WO2009073805A2 - Anticorps thérapeutiques aglycosylés et séquences nucléotidiques codant les anticorps thérapeutiques - Google Patents

Anticorps thérapeutiques aglycosylés et séquences nucléotidiques codant les anticorps thérapeutiques Download PDF

Info

Publication number
WO2009073805A2
WO2009073805A2 PCT/US2008/085568 US2008085568W WO2009073805A2 WO 2009073805 A2 WO2009073805 A2 WO 2009073805A2 US 2008085568 W US2008085568 W US 2008085568W WO 2009073805 A2 WO2009073805 A2 WO 2009073805A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
polypeptide
translational
codon
sequence
Prior art date
Application number
PCT/US2008/085568
Other languages
English (en)
Other versions
WO2009073805A3 (fr
Inventor
Joseph D. Kittle
Original Assignee
Verdezyne, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Verdezyne, Inc. filed Critical Verdezyne, Inc.
Publication of WO2009073805A2 publication Critical patent/WO2009073805A2/fr
Publication of WO2009073805A3 publication Critical patent/WO2009073805A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/241—Tumor Necrosis Factors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
    • C07K2317/41—Glycosylation, sialylation, or fucosylation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/71—Decreased effector function due to an Fc-modification
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/734—Complement-dependent cytotoxicity [CDC]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the present invention relates to therapeutic antibodies with reduced glycosylation and nucleic acid molecules for expression of therapeutic antibodies.
  • therapeutic antibodies produced in mammalian cells are glycosylated, and this glycosylation can be related to the unwanted side effects.
  • unwanted side effects can include killing of cells secreting the target cytokines as a result of the effector functions of glycosylated antibodies.
  • Toxic effects such as severe cytokine release syndromes may result. Therefore, in many instances, antibodies that are deficient in effector functions are more desirable for therapeutic uses.
  • aglycosylated therapeutic antibodies in host organisms which can have reduced effector functions, and also can have additional advantages including, but not limited to, more efficient expression, purification, and improved patient response.
  • the cytokine-binding polypeptide is a recombinantly- produced human-compatible antibody targeting a cytokine with a specificity of at least about 2-, about 5-, about 10-, about 20-, about 50-, about 100-, or about 200-fold higher relative to other naturally-occurring human antigens, wherein the antibody has a constant region, and wherein the constant region has reduced glycosylation or is aglycosylated.
  • the cytokine is selected from TNF- ⁇ , TGF, EGF, VEGF and interleukin.
  • the improvement comprises reducing effector function of the antibody therapy by reducing glycosylation of the antibody.
  • all glycosylation of the antibody is eliminated.
  • all N-linked glycosylation is eliminated.
  • binding of the antibody to ClQ protein is reduced.
  • binding of the antibody to ClQ protein is eliminated.
  • cytotoxic side effects are resultant from chronic administration of said antibody.
  • the cytotoxic side effects are resultant from a single administration of the antibody.
  • the cytoxotic side effects are resultant from antibody-mediated complement activation (AMCA).
  • the cytoxotic side effects are resultant from antibody-dependent cellular cytotoxicity (ADCC).
  • binding of the antibody to ClQ protein is reduced.
  • binding of the antibody to ClQ protein is eliminated.
  • Another embodiment provided herein is a recombinant human- compatible antibody targeting a cytokine with a specificity of at least about 10-fold higher relative to other naturally-occurring human antigens, produced in a prokaryotic expression system.
  • polynucleotide encoding a polypeptide comprising an F c antibody domain, wherein the polynucleotide is adapted for expression in a heterologous organism, wherein the F c -encoding portion of the polynucleotide does not comprise a codon pair that is likely to cause a translational pause in the host organism by more than about 5, or 3, or 2, or 1.5 standard deviations above the mean translational kinetics value for codon pairs in the heterologous organism.
  • Another embodiment provided herein is a recombinant polypeptide comprising a human-compatible F c antibody domain, having an aglycosylated F c antibody domain characteristic of expression in E. coli.
  • a polynucleotide encoding an cytokine-binding polypeptide that is adapted for expression in E. coli, wherein the F c - encoding portion of said polynucleotide does not comprise a codon pair that is likely to cause a translational pause in the host organism by more than about 5, or 3, or 2, or 1.5 standard deviations above the mean translational kinetics value for codon pairs in E. coli.
  • a method for providing anti-cytokine therapy to a patient by administering a recombinant humanized antibody having a light chain polypeptide having at least 95% sequence identity to SEQ ID NO: 2 and/or a heavy chain polypeptide having at least 95% sequence identity to SEQ ID NO: 4 the improvement comprises reducing effector function of the antibody therapy by reducing glycosylation of the antibody.
  • all glycosylation of the antibody is eliminated.
  • all N-linked glycosylation is eliminated.
  • binding of the antibody to ClQ protein is reduced.
  • binding of the antibody to ClQ protein is eliminated.
  • Also provided herein is a method for providing anti-cytokine therapy to a patient by administering a recombinant humanized antibody having a light chain polypeptide variable region having at least 95% sequence identity to SEQ ID NO: 20 and/or a heavy chain polypeptide variable region having at least 95% sequence identity to SEQ ID NO: 21, the improvement comprises reducing effector function of the antibody therapy by reducing glycosylation of the antibody. In selected embodiments, all glycosylation of the antibody is eliminated. In other selected embodiments, all N-linked glycosylation is eliminated. In selected embodiments, binding of the antibody to ClQ protein is reduced. In selected embodiments, binding of the antibody to ClQ protein is eliminated.
  • Also provided herein is a method method for reducing cytotoxic side effects in administration of anti-cytokine recombinant antibody having a light chain polypeptide having at least 95% sequence identity to SEQ ID NO: 2 and/or a heavy chain polypeptide having at least 95% sequence identity to SEQ ID NO: 4 to a patient, by reducing glycosylation of a constant region of the antibody.
  • all glycosylation of the antibody is eliminated.
  • all N-linked glycosylation is eliminated.
  • binding of the antibody to ClQ protein is reduced.
  • binding of the antibody to ClQ protein is eliminated.
  • Also provided herein is a method for reducing cytotoxic side effects in administration of anti-cytokine recombinant antibody having a light chain polypeptide variable region having at least 95% sequence identity to SEQ ID NO: 20 and/or a heavy chain polypeptide variable region having at least 95% sequence identity to SEQ ID NO: 21 to a patient, by reducing glycosylation of a constant region of the antibody.
  • all glycosylation of the antibody is eliminated.
  • all N-linked glycosylation is eliminated.
  • binding of the antibody to ClQ protein is reduced.
  • binding of the antibody to ClQ protein is eliminated.
  • the cytotoxic side effects are resultant from chronic administration of said antibody. In certain aspects, the cytotoxic side effects are resultant from a single administration of the antibody. In selected embodiments, the cytoxotic side effects are resultant from antibody-mediated complement activation (AMCA). In other selected embodiments, the cytoxotic side effects are resultant from antibody-dependent cellular cytotoxicity (ADCC). In selected embodiments, binding of the antibody to ClQ protein is reduced. In selected embodiments, binding of the antibody to ClQ protein is eliminated.
  • ACA antibody-mediated complement activation
  • ADCC antibody-dependent cellular cytotoxicity
  • polynucleotide encoding an anti-TNF ⁇ antibody, the polynucleotide comprising SEQ ID NO: 22.
  • polynucleotide encoding a polypeptide having at least 95% sequence identity to SEQ ID NO: 4, the polypeptide comprising an Fc antibody domain, wherein the polynucleotide is adapted for expression in a heterologous organism, wherein the Fc-encoding portion of the polynucleotide does not comprise a codon pair that is likely to cause a translational pause in the host organism by more than about 5, or 3, or 2, or 1.5 standard deviations above the mean translational kinetics value for codon pairs in the heterologous organism.
  • polynucleotide encoding a polypeptide having at least 95% sequence identity to SEQ ID NO: 4, the polypeptide comprising an Fc antibody domain, wherein the polynucleotide is adapted for expression in E. coli, wherein the Fc-encoding portion of the polynucleotide does not comprise a codon pair that is likely to cause a translational pause in the host organism by more than about 5, or 3, or 2, or 1.5 standard deviations above the mean translational kinetics value for codon pairs in E. coli.
  • a recombinant humanized antibody targeting TNF ⁇ comprising a light chain polypeptide having at least 95% sequence identity to SEQ ID NO: 2; said antibody having a specificity to TNF ⁇ of at least about 10-fold higher relative to other naturally-occurring human antigens produced in a prokaryotic expression system.
  • a recombinant humanized antibody targeting TNF ⁇ comprising a heavy chain polypeptide with at least 95% sequence identity to SEQ ID NO: 4; said antibody having a specificity to TNF ⁇ of at least about 10-fold higher relative to other naturally-occurring human antigens produced in a prokaryotic expression system.
  • the antibody can comprise light chains and heavy chains with at least 95% sequence identity to SEQ ID NOs: 2 and 4 respectively.
  • Also provided herein is a recombinant humanized antibody targeting TNF ⁇ with a specificity to TNF ⁇ of at least about 10-fold higher relative to other naturally-occurring human antigens, having an aglycosylated constant region characteristic of expression in E. coli.
  • polypeptide having at least 95% sequence identity to SEQ ID NO: 4, said polypeptide comprising a humanized Fc antibody domain, having an aglycosylated Fc antibody domain characteristic of expression in E. coli.
  • slowing the rate of transcription and/or translation comprises growing the bacterial cells at a temperature lower than 3O 0 C.
  • the cells are E. coli.
  • the protein is an antibody.
  • the antibody is an IgGl antibody.
  • the protein is a heavy chain-containing antibody.
  • the method comprises growth of host bacteria at a temperature suitable for logarithmic phase followed by lowering the temperature at or approximately at the time of induction of expression of a heavy chain polypeptide in an E.
  • the method comprises lowering the temperature at or approximately at the time of induction of expression of a heavy chain-containing antibody in an E. coli cell to 25 0 C.
  • Also provided herein is a method comprising identifying an antibody for which effector function is to be reduced, expressing the antibody in an expression system whereby the antibody has reduced effector function.
  • the expressed antibody has reduced glycosylation.
  • the glycoslyation of the expressed antibody is completely eliminated.
  • a method of treating a subject with anti- cytokine therapy comprising identifying a subject in whom cell effector function is to be reduced.
  • the method can further comprise administering a therapeutic amount of an anti- cytokine antibody with reduced effector function.
  • the effector function of the antibody by can by reduced reducing glycosylation of the antibody.
  • all glycosylation of the antibody is eliminated.
  • all N-linked glycosylation is eliminated.
  • binding of the antibody to ClQ protein is reduced.
  • binding of the antibody to ClQ protein is eliminated.
  • Figure 1 depicts plasmid expression constructs used in Examples 1-4.
  • Figure 2 shows the induction of anti-TNF expression from various pelB constructs visualized by Coomassie Blue staining: lane 1) MWM; 2) Uninduced; 3) pelB 3; 4) pelB 4; 5) pelB 7; 6) pelB 8, and 7 MWM.
  • Figure 3 is a Coomassie Blue stained gel showing the effect of variation in arabinose concentration on anti-TNF expression from pelB8 in whole cell and osmotic shock samples.
  • Figure 4 shows a Western blot analysis of heavy and light chain protein bands detected by AP conjugated goat anti-Human IgG.
  • Figure 5 shows an ELISA standard curve used to quantitate adalimumab generated in E. coli.
  • Figure 6 is a schematic representation of coupled translation expression constructs in comparison to bicistronic message expression constructs.
  • each schematic is a representative sequence of the region encoding the C-terminus of the heavy chain and the intervening sequence between the heavy chain and the sequence encoding the N-terminus of the light chain.
  • the nucleotide sequence of this region of the bicistronic construct is set forth as SEQ ID NO: 5, and the encoded amino acid sequence is set forth as SEQ ID NO: 6.
  • the nucleotide sequences of this region of the coupled translation expression constructs 1 and 2 are set forth as SEQ ID NOs: 7 and 9, and the corresponding encoded amino acid sequences are set forth as SEQ ID NOs: 8 and 10.
  • the bicistronic construct contains a large gap nucleotide sequence between the heavy and light chain-encoding sequences, whereas the coupled translation expression constructs contain a short intervening sequence.
  • Figure 7 is a schematic representation of the plasmid expression construct used for cloning the constructs of Example 6.
  • Figure 8 is a Coomassie Blue stained gel showing the expression of anti-TNF heavy and light chain polypeptides using coupled translation expression constructs.
  • Figure 9 shows Western Blot analysis of heavy and light chain protein bands detected by AP-conjugated goat anti-Human IgG.
  • Figure 10 shows Western Blot analysis of cell extracts and extracts spiked with Humira.
  • Figure 11 shows Western Blot analysis of samples from protein A/protein G coumns connected in series.
  • Figure 12 shows Western Blot analysis of samples from hydrophobic interaction chromatography (HIC).
  • Figure 13 shows Western Blot analysis of samples from ion exchange chromatography.
  • Figure 14 shows Western Blot analysis of samples from anion exchange chromatography at different pH values.
  • Figure 15 shows Western Blot analysis of samples from purification of ecHumira
  • Figure 16 shows Western Blot analysis of purified ecHumira.
  • Figure 17 shows graphs setting forth ELISA assays of Humira and purified ecHumira.
  • Figure 18 shows graphs setting forth ClQ assays of Humira and purified ecHumira.
  • Glycosylation plays an important role in a number of therapeutic proteins.
  • the catalytic activity of the therapeutic is mainly determined by the protein structure, whereas the pharmacokinetics, pharmacodistribution, solubility, stability, are all influenced by the carbohydrate moiety.
  • the antigen binding is determined by the structure of the protein moiety, while glycosylation has been associated with Pharmacokinetics, and enhancement of effector function and receptor binding.
  • Hyperglycosylated proteins can show increased serum half-life, are less sensitive to proteolysis and are more heat-stable compared with the non-glycosylated forms.
  • glycosylated proteins monoclonal antibodies
  • monoclonal antibodies have recently become promising therapeutic proteins, in addition to their conventional use as research tools. These proteins can be targeted to almost any extracellular or cell surface protein and, through the simple act of binding, promote the blocking or activation of specific biochemical steps. Additionally, antibodies can couple their antigen to natural effector functions or provide another activity through conjugation.
  • One characteristic of full-length IgGs is their long circulating half-life in mammals, the result of both a large molecular size preventing clearance in the kidneys, and the ability of these proteins to avoid proteolysis in the endothelium by using a salvage pathway. This pathway plays a major role in the slow clearance of IgGs and depends on binding of the immunoglobulin Fc-domain to the neonatal receptor (FcRn).
  • Monoclonal antibodies have many activities in addition to binding antigens.
  • the Fc domain of the monoclonal antibody is responsible for two effector functions: antibody-dependent cell cytotoxicity (ADCC) and antibody-mediated complement activiation (AMCA).
  • ADCC antibody-dependent cell cytotoxicity
  • AMCA antibody-mediated complement activiation
  • Full-length monoclonal antibodies have traditionally been produced in mammalian cell culture due to their parental hybridoma source, the complexity of the molecule, and the desirability of glycosylation of the monoclonal antibodies.
  • Escherichia coli is the host system of choice for the expression of antibody fragments such as Fv, scFv, Fab or F(ab') 2 . These fragments can be made relatively quickly in large quantities with the retention of antigen binding activity. However, because antibody fragments lack the Fc domain, they do not bind the FcRn receptor and are cleared quickly.
  • Full-length antibody chains can also be expressed in E. coli as insoluble aggregates and then refolded in vitro, but the complexity of this method limits its usefulness.
  • anti-TNF antibodies are produced in mammalian cells and are glycosylated.
  • the cost of producing antibodies in mammalian cells is high and the procedure is complex.
  • Glycosylation of antibodies has two effects: first, it can increase the lifetime of the antibody in the blood serum, so that it circulates for many days or even weeks. This may be because of decreased kidney clearance or because of greater resistance to proteolysis.
  • glycosylation in the constant region of the antibody is important for activating the "effector functions" of the antibody, which are triggered when an antibody binds to a target that is attached to a cell surface. These functions are linked to activation of the immune system and can lead to or natural killer (NK) mediated cell killing.
  • NK natural killer
  • TNF-binding antibodies in the case of TNF-binding antibodies, additional side effects include killing of cells secreting TNF as a result of the effector functions of glycosylated antibodies. Toxic effects, such as severe cytokine release syndromes may result. Therefore, in many instances, intact antibodies that are deficient in effector functions are more desirable for therapeutic uses.
  • a method for recombinantly expressing aglycosylated therapeutic antibodies in host organisms for more efficient expression, purification, and improved patient response.
  • anti-TNF antibodies do not express well in host cells such as E. coli. Accordingly, provided herein are anti-TNF-encoding nucleotide sequences and methods of making the same for improved expression of anti-TNF antibodies.
  • the cytokine-binding polypeptide is a recombinantly- produced human-compatible antibody targeting a cytokine with specificity for a particular cytokine relative to other naturally-occurring human antigens, wherein the antibody has a constant region, and wherein the constant region is aglycosylated.
  • Specificity is the property of antibodies which enables them to react with some antigens and not with others. Specificity is dependent on chemical composition, physical forces, and molecular structure at the binding site, and is typically determined by measuring the affinity of an antibody for a given antigen, relative to other antigens. For example, antibody specificity is typically determined by routine immuno- diagnostic techniques that are well known in the art, such as ELISA, RIA and Western Blots. As will be appreciated by one of skill in the art, the specificity of a therapeutic antibody is typically confirmed by competing with excess of antigen (peptide or protein) or immuno-neutralization with the antigens. The specificity of an antibody confers the ability to specifically bind an antigen of interest in vivo.
  • antigen-specific binding in vivo may occur in any tissue under normal physiological conditions.
  • a therapeutic antibody targeted to a cytokine can bind with specificity to the target cytokine relative to other naturally-occurring human antigens in the bloodstream, or the surface of cells in a tissue.
  • a recombinantly-produced human- compatible antibody targeting a cytokine as provided herein can have a specificity of at least about 2-, about 5-, about 10-, about 20-, about 50-, about 100-, or about 200-fold higher relative to other naturally-occurring human antigens.
  • the antibody is a recombinantly-produced human-compatible antibody targeting a cytokine with an affinity at least 10-, at least 20-, at least 100-, at least 200-, at least 500-, at least 1000-, at least 10,000-, or at least 100,000-fold greater for a specific cytokine relative to other naturally-occurring human antigens, wherein the antibody has a constant region, and wherein the constant region is aglycosylated.
  • the polypeptide provided herein can be a recombinantly-produced human-compatible antibody targeting a cytokine.
  • the cytokine is selected from TNF- ⁇ , TGF, EGF, VEGF and interleukin, although it is contemplated that any cytokine may be targeted when neutralization of the cytokine by an antibody would have a therapeutic effect. Accordingly, typically, the antibody will target a human cytokine.
  • Cytokine is a generic term for proteins released by one cell population which act on another cell as intercellular mediators. Examples of such cytokines are lymphokines, monokines, and traditional polypeptide hormones.
  • cytokines include growth hormone such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor; fibroblast growth factor; prolactin; placental lactogen; mullerian- inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; epidermal growth factor (EGF); vascular endothelial growth factor (VEGF); integrin; thrombopoietin (TPO); nerve growth factors such as NGF-P; platelet growth factor; transforming growth factors (TGFs) such as TGF- ⁇ and TGF- ⁇ ; insulin-like growth factor-I and-II; erythropoietin (EPO); osteoinductive factors; interferons such
  • the cytokine-binding polypeptide is an antibody against TNF- ⁇ with reduced glycosylation.
  • Anti-TNF- ⁇ antibodies with reduced glycosylation as presented herein have the surprising properties of efficient expression, reduced effector function and a modified half-life in serum.
  • the anti-TNF- ⁇ antibody is derived from the sequence encoding the monoclonal antibody adalimumab (Humira). The sequence of adalimumab is set forth in U.S. Patent No. 6,090,382 (hereby incorporated by reference in its entirety) and referred to therein as antibody D2E7.
  • the anti-TNF- ⁇ antibody comprises the heavy chain variable region and the light chain variable region of adalimumab and has a constant region with reduced glycosylation.
  • the constant region is aglycosylated.
  • polynucleotides and polypeptides provided herein are antibodies having a light chain polypeptide having at least 80%, least 85%, least 90%, least 91%, least 92%, least 93%, least 94%, least 95%, least 96%, least 97%, least 98%, or at least 99% sequence identity to SEQ ID NO: 2 and/or a heavy chain polypeptide having at least 80%, least 85%, least 90%, least 91%, least 92%, least 93%, least 94%, least 95%, least 96%, least 97%, least 98%, or at least 99% sequence identity to SEQ ID NO: 4.
  • the constant region of the antibodies presented herein can be constructed using any constant region known in the art or variant thereof that possesses the structural and functional properties of a constant region of an antigen-binding antibody or derivative thereof, such as, for example, a variant having at least 80%, least 85%, least 90%, least 91%, least 92%, least 93%, least 94%, least 95%, least 96%, least 97%, least 98%, or at least 99% sequence identity to a known constant region.
  • polynucleotides and polypeptides provided herein can have a light chain polypeptide having at least 80%, least 85%, least 90%, least 91%, least 92%, least 93%, least 94%, least 95%, least 96%, least 97%, least 98%, or at least 99% sequence identity to the corresponding light chain sequence and/or a heavy chain polypeptide having at least 80%, least 85%, least 90%, least 91%, least 92%, least 93%, least 94%, least 95%, least 96%, least 97%, least 98%, or at least 99% sequence identity to the corresponding heavy chain sequence.
  • a polypeptide variant of SEQ ID NO:2 will possess antigen-binding properties substantially similar to the original sequence.
  • a polypeptide variant of SEQ ID NO:2 will possess at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the antigen- binding affinity and/or specificity of the polypeptide of SEQ ID NO:2.
  • a heterotetramer comprising a polypeptide variant of a light chain in combination with its corresponding heavy chain or variant thereof will possess at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the antigen-binding affinity and/or specificity of the heterotetramer made up of the corresponding non- variant heavy and light chain polypeptides.
  • antibody-encoding polynucleotides presented herein can comprise sequence having at least 80%, least 85%, least 90%, least 91%, least 92%, least 93%, least 94%, least 95%, least 96%, least 97%, least 98%, or at least 99% sequence identity to SEQ ID NO:1 and/or SEQ ID NO: 3.
  • Variant polynucleotides can include polynucleotides encoding the identical polypeptide sequence or a variant polypeptide sequence, such as those provided in the aforementioned paragraph. Typically the encoded polypeptide will possess antigen-binding properties substantially similar to the original sequence.
  • a polypeptide variant of SEQ ID NO:2 will possess at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the antigen-binding affinity and/or specificity of the polypeptide of SEQ ID NO:2.
  • the cytokine-binding polypeptide is an anti-TNF- ⁇ antibody derived from the sequence encoding the chimeric antibody infliximab (Remicade).
  • Infliximab has human constant regions and murine variable regions.
  • the heavy chain and light chain variable regions of infliximab are set forth herein as SEQ ID NOs: 24 and 25. See, U.S. Pat. Nos. 6,277,969, 6,284,471, 6,790,444, and 6,835,823, each of which is incorporated herein by reference in its entirety.
  • the anti-TNF- ⁇ antibody comprises the heavy chain variable region and the light chain variable region of infliximab and has a constant region with reduced glycosylation.
  • the constant region is aglycosylated.
  • the cytokine-binding polypeptide is a recombinant human soluble tumor necrosis TNF ⁇ receptor fusion protein derived from the sequence encoding the fusion protein etanercept (Enbrel).
  • Etanercept is made from the combination of two naturally occurring soluble human 75-kilodalton TNF receptors (e.g. amino acids 3-163 of SEQ ID NO: 26) linked to the Fc portion of an IgGl antibody. See, U.S. Pat. No. 5,605,690, which is incorporated herein by reference in its entirety.
  • the cytokine-binding polypeptide comprises the ligand binding domain of etanercept and has a constant region with reduced glycosylation.
  • the constant region is aglycosylated.
  • the cytokine-binding polypeptide is a recombinant humanized variable region derived from the sequence encoding the recombinant protein CDP-870.
  • CDP-870 is made from the humanized variable light and heavy chain sequences of a murine mAb. Only the CDR sequences remain from the original mouse mAb. Additional site-specific mutations are made to optimize affinity for the original antigen.
  • the heavy and light chains of CDP-870 are set forth herein as SEQ ID NOs: 27 and 28.
  • the resulting humanized molecule is expressed and can be further modified by the addition of a polyethylene glycol (PEG) moiety to increase the half-life and reduce the immunogenicity of the protein. See, U.S. Pat. Pub. 2005/0048056, which is incorporated herein by reference in its entirety.
  • PEG polyethylene glycol
  • the cytokine-binding polypeptide is an anti-TNF- ⁇ antibody derived from the sequence encoding the antibody Golimumab.
  • the sequences of the heavy and light chain polypeptides of Golimumab are set forth in WO 0212502 and US 2000/223360 each of which is incorporated herein by reference in its entirety.
  • the cytokine-binding polypeptide is an anti-VEGF antibody derived from the sequence encoding the antibody Bevacizumab (Avastin).
  • Bevacizumab Avastin
  • the sequences of the heavy and light chain polypeptides of Bevacizumab are set forth in US 6,884,879 which is incorporated herein by reference in its entirety.
  • the cytokine-binding polypeptide is an anti-ILl-beta antibody derived from the sequence encoding the antibody Canakinumab.
  • the sequences of the heavy and light chain polypeptides of Canakinumab are set forth as SEQ ID NOs: 29 and 30 herein, and are set forth in US 7,446,175 which is incorporated herein by reference in its entirety.
  • the cytokine-binding polypeptide is an anti-Nerve Growth Factor (NGF) antibody derived from the sequence encoding the antibody Tanezumab.
  • NGF anti-Nerve Growth Factor
  • the sequences of the heavy and light chain polypeptides of Tanezumab are set forth as SEQ ID NOs: 31 and 32 herein, and are set forth in US 7,449,616 which is incorporated herein by reference in its entirety.
  • antibody and immunoglobulin are used interchangeably in the broadest sense and includes monoclonal antibodies (full length or intact monoclonal antibodies), polyclonal antibodies, multivalent antibodies, and multispecific antibodies (e.g., bispecific antibodies so long as they exhibit the desired biological activity).
  • a naturally occurring antibody comprises four polypeptide chains, two identical heavy (H) chains and two identical light (L) chains inter-connected by disulfide bonds.
  • Each heavy chain is comprised of a heavy chain variable region (V H ) and a heavy chain constant region.
  • the heavy chain constant region is comprised of three domains, CHl, CH2 and CH3.
  • Each light chain is comprised of a light chain variable region (V L ) and a light chain constant region.
  • the light chain constant region is comprised of one domain, C L .
  • the V H and V L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDR complementarity determining regions
  • FR framework regions
  • Each V H and V L is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FRl, CDRl, FR2, CDR2, FR3, CDR3, FR4.
  • the light chains of antibodies from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda ( ⁇ ), based on the amino acid sequences of their constant domains.
  • Papain digestion of antibodies produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual "Fc" fragment, whose name reflects its ability to crystallize readily.
  • the crystal structure of the human IgG Fc region has been determined (Deisenhofer, Biochemistry 20:2361- 2370 (1981)).
  • the Fc region is generated by papain cleavage N- terminal to Cys 226. As described above, the Fc region is central to the effector functions of antibodies.
  • full length antibody intact antibody and whole antibody are used herein interchangeably, to refer to an antibody in its substantially intact form, not antibody fragments as defined below.
  • a full length antibody can be an antibody generated from the parental sequence or an antibody variant.
  • a full length antibody can be human, humanized and/or affinity matured.
  • the cytokine-binding polypeptide presented herein is a human- compatible antibody, recombinant fusion protein, or fragment thereof.
  • a human- compatible antibody can be any antibody that has been engineered to reduce immunogenicity caused by murine components of the antibody.
  • non-limiting examples of a human-compatible antibody include, for example, a fully-human antibody, a humanized antibody, a chimeric antibody, or a substantially human antibody.
  • Other examples of human-compatible cytokine-binding polypeptides include recombinant fusion proteins and antibody fragments that are substantially human and lack the immunogenic portion of the constant region.
  • a substantially human antibody or antibody fragment is a polypeptide that has been modified to replace the murine framework sequences with human sequences to the extent that the polypeptide has reduced immunogenicity in a human patient.
  • a humanized antibody is a genetically engineered antibody in which the minimum mouse part from a murine antibody is transplanted onto a human antibody; generally humanized antibodies are 5-10% mouse and 90-95% human.
  • the term fully human antibody and human antibody has been used to label those antibodies derived from transgenic mice carrying human antibody genes or from human cells. To the human immune system, however, the difference between fully human, human, and humanized antibodies may be negligible or nonexistent and as such all three terms are used interchangeably herein.
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import” variable domain.
  • Humanization can be essentially performed following any of the various methods known in the art, including, but not limited to, the method of Winter and co-workers (Jones et al., Nature, 321 : 522-525 (1986) ; Riechmann et al, Nature, 332 : 323-327 (1988) ; Verhoeyen et aL, Science, 239 : 1534-1536 (1988), each of which is incorporated herein by reference in its entirety), by substituting hypervariable region sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Patent No.
  • humanized antibodies are human antibodies in which some hypervariable region residues and possibly some framework residues are substituted by residues from analogous sites in rodent antibodies.
  • Monoclonal antibodies have many activities in addition to neutralizing antigens. While not intended to be limited to the following, it is contemplated that the Fc domain of the monoclonal antibody is responsible for at least two types of effector function: antibody-dependent cell cytotoxicity (ADCC) and antibody-mediated complement activiation. Glycosylation of the Fc domain has been shown to have a role in effector function. For example, there is a linear increase of in vitro complement activation with increasing terminal galactosylation of the carbohydrate moiety in the Fc domain.
  • ADCC antibody-dependent cell cytotoxicity
  • complement activiation antibody-mediated complement activiation
  • the improvement comprises reducing effector function of the antibody therapy by reducing glycosylation of the antibody.
  • all glycosylation of the antibody is eliminated.
  • all N-linked glycosylation is eliminated.
  • binding of the antibody to ClQ protein is reduced.
  • binding of the antibody to ClQ protein is eliminated.
  • ADCC antibody-dependent cell cytotoxicity
  • Another known effector function of antibodies is antibody-mediated complement activation.
  • the complement system can be activated via an antibody- dependent pathway.
  • therapeutic antibodies may cause complement to be misdirected or excessively activated resulting in altered populations of immune cells or damage to host tissues. Accordingly, it is contemplated herein that the reducing or completely eliminating glycosylation of antibodies will avoid one or more of the deleterious effects of antibody-mediated complement activation during anti-cytokine therapy, such as recruitment and activation of inflammatory cells, vasodilation, and/or direct cell killing via formation of membrane attack complex.
  • N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue.
  • the tripeptide sequences asparagine-X-serine and asparagine-X- threonine, where X is any amino acid except proline, are the recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain.
  • O-linked glycosylation refers to the attachment of one of the sugars N-aceylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxyproline or 5 -hydroxy Iy sine may also be used.
  • Reduction or elimination of glycosylation sites on an antibody thus may be accomplished by altering the amino acid sequence such that it no longer contains one or more amino acids or amino acid motifs associated with N- and/or O-linked glycolylation, for example, an above-described tripeptide sequence for N-linked glycosylation sites.
  • the alteration may also be made by the deletion of, or substitution of, one or more serine or threonine residues to the sequence of the original antibody for O- linked glycosylation sites.
  • glycosylation may be eliminated or reduced by expressing the antibody in any organism where glycosylation of polypeptides does not occur or is diminished compared to mammalian systems.
  • prokaryotic organisms are used to express aglycosylated recombinant proteins.
  • yeast offer another alternative to mammalian cell culture and have the additional benefit that it is possible to rigorously control the glycosylation of the therapeutic protein. This enables clinically relevant features of the molecule to be improved.
  • antibody-mediated effector functions can be modulated by generating specific glycoforms in yeast.
  • the unique features of the antibody as presented herein make it a desired candidate for many applications in which the half life of the antibody in vivo is important yet the effector functions (i.e., complement and ADCC) are unnecessary or deleterious.
  • the Fc activities of the produced full length antibody are measured to ensure that only the desirable properties are maintained.
  • Fc receptor (FcR) binding assays can be conducted to ensure that the antibody lacks FcyRl binding (hence lacks ADCC toxicity), but retains FcRn binding ability.
  • CIq binding assays may also be carried out to confirm that the antibody is unable to bind CIq and hence lacks CDC activity.
  • In vitro and in vivo cytotoxicity assays can be conducted to confirm the depletion of CDC and or ADCC activities. Techniques for carrying out these assays are known in the art.
  • cytotoxic side effects are resultant from chronic administration of said antibody.
  • the cytotoxic side effects are resultant from a single administration of the antibody.
  • the cytoxotic side effects are resultant from antibody-mediated complement activation (AMCA).
  • the cytoxotic side effects are resultant from antibody-dependent cellular cytotoxicity (ADCC).
  • binding of the antibody to ClQ protein is reduced.
  • binding of the antibody to ClQ protein is eliminated.
  • Chronic administration of anti-cytokine therapy can include impaired immune system function due to inhibition of T-cell mediated response, and can leave patients susceptible to microbial pathogens.
  • Elderly patients in particular have severe problems when acute inflammation develops in their joints, because they are limited to older, less effective treatment modalities.
  • Current antibody therapies are optimized to achieve a very long circulation time in serum, which effectively reduces the frequency of dosing. While this may be a desirable strategy for many patients, a significant population of patients may not be able to use the long-lived molecule because it can severely impair their immune systems during extended treatment. Therefore, provided herein is a therapeutic version of an cytokine-binding polypeptide that is fast acting and has a modified half-life in serum.
  • Another embodiment provided herein is a recombinant humanized antibody targeting a cytokine with a specificity of at least about 10-fold higher relative to other naturally-occurring human antigens, produced in a prokaryotic expression system.
  • a recombinant humanized antibody targeting a cytokine with a specificity of at least about 10-fold higher relative to other naturally- occurring human antigens having an aglycosylated constant region characteristic of expression in E. coli. It is believed that aglycosylated antibodies according to the invention are absent or at relatively low abundance in nature and these aglycosylated antibodies may in general be produced synthetically in a number of ways.
  • aglycosylated proteins are most conveniently effected by transforming a suitable prokaryotic or particular eukaryotic cell system.
  • the expression system is prokaryotic. More typically, the expression system is E. coli.
  • Expression of aglycosylated antibodies in prokaryotes has been described. See for example, U.S. Patent Number 6,979,556 and Simmons et al. (2002) J. Immunol. Methods 263:133-147 (each of which is hereby incorporated by reference in its entirety), describing separate-cistron expression vectors, and where expression of the light chain and heavy chain are independently regulated by separate promoters.
  • eukaryotic cell systems may be utilized.
  • Typical eukaryotic cell systems can include yeast such as S. cerevisiae, P. pastoris or an immortalized mammalian cell line such as a myeloma cell line, rat myeloma cell, or Chinese hamster ovary (CHO) cells (although the use of plant cells is also of interest).
  • Eukaryotic systems can be manipulated to rigorously control the glycosylation of the therapeutic protein.
  • cell systems such as S. cerevisiae, P.
  • Expression typically includes transforming the cell system with expression vectors which include DNA coding for the various antibody regions, and then culturing the transformed cell system to produce the desired antibody.
  • Such general techniques of use for the manufacture of ligands as presented herein are well known in the very considerable art of genetic engineering and are described in publications such as "Molecular Cloning” by Sambrook, Fritsch and Maniatis, Cold Spring Harbour Laboratory Press, 1989 (2nd edition). The techniques are further illustrated by the Examples contained herein.
  • a process for the preparation of an aglycosylated cytokine-binding polypeptide which comprises culturing cells capable of expressing the cytokine-binding polypeptide in order to effect expression thereof. Also presented herein is a cell line which expresses an aglycosylated cytokine-binding polypeptide according to the invention.
  • polynucleotide encoding a polypeptide comprising an F c antibody domain, wherein the polynucleotide is adapted for expression in a heterologous organism, wherein the F c -encoding portion of the polynucleotide does not comprise a codon pair that is likely to cause a translational pause in the host organism by more than about 5, or 3, or 2, or 1.5 standard deviations above the mean translational kinetics value for codon pairs in the heterologous organism.
  • another embodiment provided herein is a recombinant polypeptide comprising a substantially human F c antibody domain, having an aglycosylated F c antibody domain characteristic of expression in E. coli.
  • a polynucleotide encoding an cytokine-binding polypeptide that is adapted for expression in E. coli, wherein the Fc- encoding portion of said polynucleotide does not comprise a codon pair that is likely to cause a translational pause in the host organism by more than about 5, or 3, or 2, or 1.5 standard deviations above the mean translational kinetics value for codon pairs in E. coli.
  • the antibodies and antibody variants of the present invention can be further modified to contain additional nonproteinaceous moieties that are known in the art and readily available.
  • the moieties suitable for derivatization of the antibody are water soluble polymers.
  • water soluble polymers include, but are not limited to, polyethylene glycol (PEG), copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-l,3-dioxolane, poly-l,3,6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers), and dextran or poly(n-vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, prolypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols (e.
  • PEG polyethylene glycol
  • Polyethylene glycol propionaldehyde may have advantages in manufacturing due to its stability in water.
  • the polymer may be of any molecular weight, and may be branched or unbranched.
  • the number of polymers attached to the antibody may vary, and if more than one polymers are attached, they can be the same or different molecules. In general, the number and or type of polymers used for derivatization can be determined based on considerations including, but not limited to, the particular properties or functions of the antibody to be improved, whether the antibody derivative will be used in a therapy under defined conditions.
  • the full length antibody produced by the prokaryotic expression system described herein is aglycosylated and lacks the effector activities of the Fc region. In some instances, it may be desirable to at least partially restore the stability or improved half life of the full length antibody. Accordingly, the present invention contemplates a method for modifying pharmacokinetics of the protein by attaching suitable moieties to identified residue sites in the Fc region of the aglycosylated full length antibody.
  • a preferred moiety for this purpose is PEG, although other carbohydrate polymers can also be used.
  • Pegylation may be carried out by any of the pegylation reactions known in the art. See, for example, EP 0401384; EP 0154316; WO 98/48837.
  • cysteine residues are first substituted for residues at identified positions of the antibody, such as those positions wherein the antibody or antibody variant is normally glycosylated or those positions on the surface of the antibody.
  • the cysteine is substituted for residue(s) at one or more positions 297, 298, 299, 264, 265 and 239 (numbering according to the EU index as in Kabat).
  • the cysteine substituted antibody variant can have various forms of PEG (or pre-synthesized carbohydrate) chemically linked to the free cysteine residues.
  • the antibodies and antibody-portions of the invention can be incorporated into pharmaceutical compositions suitable for administration to a subject.
  • the pharmaceutical composition comprises an antibody or antibody portion of the invention and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Pharmaceutically acceptable substances such as wetting or minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the antibody or antibody portion.
  • compositions of this invention may be in a variety of forms. These include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories.
  • liquid solutions e.g., injectable and infusible solutions
  • dispersions or suspensions tablets, pills, powders, liposomes and suppositories.
  • the preferred form depends on the intended mode of administration and therapeutic application. Typical preferred compositions are in the form of injectable or infusible solutions, such as compositions similar to those used for passive immunization of humans with other antibodies.
  • the preferred mode of administration is parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular).
  • the antibody is administered by intravenous infusion or injection.
  • the antibody is administered by intramuscular or subcutaneous injection.
  • compositions typically must be sterile and stable under the conditions of manufacture and storage.
  • the composition can be formulated as a solution, microemulsion, dispersion, liposome, or other ordered structure suitable to high drug concentration.
  • Sterile injectable solutions can be prepared by incorporating the active compound (i.e., antibody or antibody portion) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
  • the antibodies and antibody-portions of the present invention can be administered by a variety of methods known in the art, although for many therapeutic applications, the preferred route/mode of administration is intravenous injection or infusion. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results.
  • the active compound may be prepared with a carrier that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems.
  • a carrier such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
  • an antibody or antibody portion of the invention may be orally administered, for example, with an inert diluent or an assimilable edible carrier.
  • the compound (and other ingredients, if desired) may also be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the subject's diet.
  • the compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • an antibody or antibody portion of the invention is coformulated with and/or coadministered with one or more additional therapeutic agents.
  • an anti-hTNF ⁇ antibody or antibody portion of the invention may be coformulated and/or coadministered with one or more additional antibodies that bind other targets (e.g., antibodies that bind other cytokines or that bind cell surface molecules), one or more cytokines, soluble TNF ⁇ receptor (see e.g., PCT Publication No.
  • WO 94/06476 and/or one or more chemical agents that inhibit hTNF ⁇ production or activity (such as cyclohexane-ylidene derivatives as described in PCT Publication No. WO 93/19751).
  • one or more antibodies of the invention may be used in combination with two or more of the foregoing therapeutic agents.
  • Such combination therapies may advantageously utilize lower dosages of the administered therapeutic agents, thus avoiding possible toxicities or complications associated with the various monotherapies.
  • compositions of the invention may include a "therapeutically effective amount” or a “prophylactically effective amount” of an antibody or antibody portion of the invention.
  • a “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result.
  • a therapeutically effective amount of the antibody or antibody portion may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the antibody or antibody portion to elicit a desired response in the individual.
  • a therapeutically effective amount is also one in which any toxic or detrimental effects of the antibody or antibody portion are outweighed by the therapeutically beneficial effects.
  • prophylactically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.
  • Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.
  • Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic or prophylactic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
  • An exemplary, non-limiting range for a therapeutically or prophylactically effective amount of an antibody or antibody portion of the invention is 0.1-20 mg/kg, more preferably 1-10 mg/kg. It is to be noted that dosage values may vary with the type and severity of the condition to be alleviated.
  • Some translational pauses are resultant from the presence of particular codon pairs in the nucleotide sequence encoding the polypeptide to be translated. As provided herein, inappropriate or excessive translation pauses can reduce protein expression considerably. Further, the translational pausing properties of codon pairs vary from organism to organism. As a result, exogenous expression of genes foreign to the expression organism can lead to inefficient translation. Even when the gene is translated in a sufficiently efficient manner that recoverable quantities of the translation product are produced, the protein is often inactive, insoluble, aggregated, or otherwise different in properties from the parental protein expressed in the native organism. Thus, removing inappropriate or excessive translation pauses can improve protein expression.
  • a parental sequence is a term that refers to a sequence prior to modification and an offspring sequence (or modified sequence) is a term that refers to a sequence that has been modified according to the methods presented herein. Typically, the modification is to optimize the translational kinetics of the polypeptide- encoding nucleotide sequence.
  • the offspring sequence can be prepared for expression in a host cell, or it can be further modified and manipulated.
  • a translational pause can serve to slow translation of the nascent amino acid chain.
  • the pause(s) can serve to facilitate proper polypeptide folding, post-translational modification, re-organization/folding at protein domain boundaries, or other steps toward arriving at the native, active parental protein.
  • one or more pauses that are predicted to be present in native translation of antibody is/are preserved in a modified antibody-encoding polynucleotide provided in accordance with the teachings herein.
  • a codon pair in the modified antibody-encoding polynucleotide can be selected to have a predicted translational kinetics value that is at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% that of the native codon pair whose predicted pause is to be preserved; further, the codon pair in the modified antibody-encoding polynucleotide can be selected to be located within 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 codons of the native codon pair whose predicted pause is to be preserved.
  • Translation EngineeringTM ref ers to a process used to modify the translational kinetics of a polypeptide-encoding nucleic sequence.
  • Translation EngineeringTM can be applied to modify the translational kinetics of a polypeptide-encoding nucleic sequence when expressed in its native organism.
  • Translation EngineeringTM can be applied to modify the translational kinetics of a polypeptide-encoding nucleic sequence when expressed in an alternate expression organism such as E. coli In some embodiments, this process alters the polypeptide-encoding nucleic sequence to optimize codon usage and codon pair optimization in the organism in which the polypeptide-encoding nucleic sequence is expressed.
  • sequence modifications can be made to place or prevent restriction sites in the sequence, eliminate strong RNA secondary structures and avoid inadvertent Shine-Delgarno sequences.
  • Translation EngineeringTM involves modifying the translational kinetics of a polypeptide-encoding nucleic sequenceby removing, preserving, and/or inserting translational pauses into the polypeptide-encoding nucleic sequence.
  • antibody-encoding nucleotide sequences with refined translational kinetics and methods of making same are provided herein.
  • a antibody-encoding DNA sequence wherein the encoded sequence has amino acid sequence identity with parental antibody, and wherein predicted translation pauses in the expression organism have been removed or reduced by replacing input-sequence codon pairs with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the resultant antibody-encoding nucleotide is predicted to be translated rapidly along its entire length. Expression of the resultant antibody-encoding nucleotide is predicted to result in improved protein expression levels in cases where inappropriate or excessive translation pauses reduce protein expression.
  • expression of the resultant antibody- encoding nucleotide is predicted to result in improved levels of active and/or natively folded polypeptide expression in cases where inappropriate or excessive translation pauses causes expression of inactive, insoluble or aggregated antibody.
  • expression of the resultant antibody-encoding nucleotide is predicted to result in improved levels of active and/or natively folded polypeptide expression in cases where one or more predicted pauses are preserved from the native expression profile or are added to preserve expression of active and/or soluble antibody.
  • the antibody- encoding nucleotide sequences provided herein allow for one or more of the following results: higher expression levels; higher enzymatic activity; greater protein stability and resistance to degradation; and increased solubility.
  • nucleic acid sequences encoding the anti-TNF antibody are provided.
  • the nucleotide sequences provided herein include the parental sequences shown in the sequence listing (SEQ ID NOs: 1 and 3) which encode the anti- TNF light chain and heavy chain amino acid sequences (SEQ ID NOs: 2 and 4, respectively).
  • nucleic acid sequences encoding anti-TNF with refined translational kinetics for expression in E. coli e.g., SEQ ID NOs: 35 and 38.
  • polypeptides provided herein encode polypeptides that have a cytokine-binding activity.
  • an antibody-encoding DNA sequence can be transcribed and the resulting RNA translated to produce a polypeptide with cytokine-binding activity.
  • the antibody-encoding DNA sequence is adapted for expression in a heterologous host organism.
  • a DNA sequence that has been adapted for expression is a DNA sequence that has been inserted into an expression vector or otherwise modified to contain regulatory elements necessary for expression of the DNA in the host cell, positioned in such a manner as to permit expression of the DNA in the host cell.
  • regulatory elements required for expression include promoter sequences, transcription initiation sequences and, optionally, enhancer sequences.
  • a DNA sequence may be inserted into a plasmid vector adapted for expression in a bacterial cell, such as E. coli, or a eukaryotic cell, such as S. cerevisiae or other yeast, or any other host organism.
  • a heterologous host organism is an organism used to express DNA, RNA or protein that is foreign to the host organism.
  • the host organism is not human, E. coli or S. cerevisiae.
  • translational kinetics of an mRNA into polypeptide can be changed in order to achieve any of a variety of expression profiles. For example, translational kinetics of an mRNA into polypeptide can be changed in order to remove some or all translational pauses. In another example, translational kinetics of an mRNA into polypeptide can be changed in order to replace some or all translational pauses predicted to occur within an autonomous folding unit of a nascent protein. In another example, translational kinetics of an mRNA into polypeptide can be changed in order to replace some or all over-represented codon pairs.
  • a pause or translation slowing codon pair can queue ribosomes back to the beginning of the coding sequence, thereby inhibiting further ribosome attachment to the message which can result in down- regulation of protein expression levels as the rate of translation initiation readily saturates and the slowest translation step time becomes rate limiting. It is also proposed herein that the presence of a pause or translational slowing codon pair can stall or detach a ribosome. It is also proposed herein that the presence of a pause or translational slowing codon pair can expose naked mRNA, which is then subject to message degradation.
  • Organism-specific codon usage and codon pair usage, and the presence of organism-specific pause sites result in gene translation that is highly adapted to the original host organism.
  • ribosomal pausing sites that may be functional in a human cell will typically be scrambled, random, or not appropriate or not recognized in the proper context in a bacterium or other non-native host.
  • a heterologous cDNA or synthetic polynucleotide has a random but high probability of inadvertently encoding a pause site somewhere, often leading to protein expression and/or activity failure.
  • Methods for refining translational kinetics of an mRNA into polypeptide can be performed according to any method known in the art, as exemplified in U.S. Patent Application No. 11/505781, filed on August 16, 2006, which is incorporated by reference herein in its entirety.
  • a polypeptide-encoding nucleotide can be designed to be predicted to be translated rapidly along its entire length.
  • some polypeptide-encoding nucleotides provided herein are those that have been engineered to remove all predicted pauses. Expression of such a polypeptide-encoding nucleotide can result in improved protein expression levels and improved levels of active and/or natively folded polypeptide expression.
  • a test of translation pausing or slowing as a result of codon pair usage can be performed by comparing a series of genes that have random pauses with modified genes where codon pairs predicted to cause translational pauses are replaced. Unmodified genes moved from their source organism and expressed in a heterologous host can have an altered set of codon pairs predicted to cause a translational pause or ribosomal slowing (e.g., an altered set of over-represented codon pairs), resulting in altered configuration and location of presumed pause sites.
  • translational kinetics of an mRNA into anti- TNF-encoding polypeptide can be changed in order to remove some or all translational pauses or replace other codon pairs that cause translational slowing, message instability and degradation, and poor protein translation, expression, and functional properties. While not intending to be limited to the following, it is believed that, for at least some proteins, reduction or elimination of translational pauses can serve to increase the expression level and/or quality and characteristics of the protein. Accordingly, by removing some or all translational pauses or replacing other codon pairs that cause translational slowing, the expression levels and/or quality of an expressed protein can be increased.
  • the antibody-encoding nucleotide sequences provided herein allow for one or more of the following results: higher expression levels, higher enzymatic activity, greater protein stability, resistance to degradation, and increased solubility compared to the parental gene when expressed in a heterologous host.
  • antibody-encoding nucleotide sequences that have been modified to have one or more transcriptional pauses or slowing sites removed by modifying one or more codon pairs to a corresponding codon pair that is less likely to cause a transl ational pause or slowing. While in some embodiments it is preferred to replace all codon pairs predicted to cause a translational pause or slowing, in other embodiments, it is sufficient to replace a subset of codon pairs predicted to cause a translational pause or slowing. For example, expression levels can be increased by replacing at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more codon pairs predicted to cause a translational pause or slowing.
  • At least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% of codon pairs predicted to cause a translational pause or slowing are replaced by, for example, substituting different codon pairs that encode the same amino acids.
  • translational kinetics of an mRNA into polypeptide can be changed in order to remove some or all translational pauses predicted to occur within an autonomous folding unit of a protein.
  • an autonomous folding unit of a protein refers to an element of the overall protein structure that is self- stabilizing and often folds independently of the rest of the protein chain. Such autonomous folding units typically correspond to a protein domain.
  • expression of a gene in a heterologous host organism can result in translational pauses located in regions that inhibit protein expression and/or protein folding.
  • preserving or inserting a translational pause in a region predicted to separate autonomous folding units of a protein can result in improved folding and/or solubility of expressed proteins.
  • provided herein are methods of changing translational kinetics of an mRNA into polypeptide by preserving, relative to native, or inserting one or more translational pauses in one or more regions predicted to separate autonomous folding units of a protein, thereby increasing improving the folding and/or solubility of the expressed protein.
  • one step can include identifying predicted autonomous folding units of a protein.
  • Methods for identifying predicted autonomous folding units of a protein or protein domains are known in the art, and include alignment of amino acid sequences with protein sequences having known structures, and threading amino acid sequences against template protein domain databases. Such methods can employ any of a variety of software algorithms in searching any of a variety of databases known in the art for predicting the location of protein domains.
  • results of such methods will typically include an identification of the amino acids predicted to be present in a particular domain, and also can include an identification of the domain itself, and an identification of the secondary structural element, if any, in which each amino acid sequence of a domain is located.
  • the codon pair that is least likely to cause a translational pause or slowing can be selected; an amino acid insertion, deletion or mutation can be introduced to yield a codon pair that is not predicted to cause a translational pause or slowing; or no change is made.
  • One option in a computational method is to request human input in order to resolve the issue.
  • the computational method may, for example, involve the use of a computer that is programmed to request human input.
  • the computer may be programmed to make a selection, or combination of selections, such that multiple genes, or Ordered Gene Sets or small permuatation libaries are designed and synthetically produced for use in expression analysis.
  • an amino acid insertion, deletion or mutation is made in order to change translational kinetics, it is preferable to select a change that is predicted not to substantially influence the final three-dimensional structure of the protein and/or the activity of the protein.
  • Such an amino acid insertion, deletion or mutation can include, for example, a conservative amino acid substitution such as the conservative substitutions shown in Table 1.
  • the substitutions shown are based on amino acid physical-chemical properties, and as such, are independent of organism.
  • the conservative amino acid substitution is a substitution listed under the heading of exemplary substitutions.
  • codon pairs predicted to cause a translational pause or slowing are treated equally
  • one or more different threshold levels can be established for differential treatment of codon pairs, where codon pairs above a highest threshold are the codon pairs most likely to cause a translational pause or slowing, and succeedingly lower codon pair threshold-based groups correspond to succeedingly lower likelihoods of the respective codon pairs causing a translational pause or slowing.
  • codon pairs above a highest threshold are the codon pairs most likely to cause a translational pause or slowing
  • succeedingly lower codon pair threshold-based groups correspond to succeedingly lower likelihoods of the respective codon pairs causing a translational pause or slowing.
  • different numbers or percentages of codon pairs can be replaced for each of these different threshold-based groups. For example, 95% or more codon pairs above a highest threshold level can be replaced, while 90% or less of all codon pairs between that level and an intermediate threshold level are replaced.
  • codon pairs likely to cause a translational pause or slowing can be segregated into two or more different threshold- based groups, three or more different threshold-based groups, four or more different threshold-based groups, five or more different threshold-based groups, six or more different threshold-based groups, or more. Discussion of specific thresholds are provided elsewhere herein; however, typically the higher the threshold, the higher the likelihood of a translational pause or slowing caused by a codon pair with a translational kinetics value greater than the threshold. In embodiments in which codon pairs likely to cause a translational pause or slowing can be segregated into two or more different threshold- based groups, different numbers or percentages of codon pairs can be replaced for each codon pair group.
  • codon pairs above a highest threshold are replaced, while the same or a lower percentage of codon pairs are replaced from codon pair groups corresponding to one or more lower thresholds.
  • the same or a lower percentage of codon pairs are replaced.
  • all codon pairs above a highest threshold are replaced, while a codon pair above an intermediate threshold is replaced only if the codon pair is located within an autonomous folding unit.
  • all codon pairs above a highest threshold are replaced, while a codon pair above an intermediate threshold is replaced only if the codon pair can be replaced without requiring a change in the encoded polypeptide sequence.
  • all codon pairs above a highest threshold are replaced, while a codon pair above a first higher intermediate threshold is replaced only if the codon pair can be replaced without changing the encoded polypeptide sequence or with only a conservative change to the encoded polypeptide sequence, while a codon pair above a second lower intermediate threshold is replaced only if the codon pair can be replaced without requiring any change in the encoded polypeptide sequence.
  • an evaluation method can be used that determines the degree to which a codon pair should be replaced according to the translational kinetics value of the codon pair, where the degree to which the codon pair should be replaced can be counterbalanced by any of a variety of user-determined factors such as, for example, presence of the codon pair within or between autonomous folding units, and degree of change to the encoded polypeptide sequence.
  • a translational kinetics value of a codon pair is a representation of the degree to which it is expected that a codon pair is associated with a translational pause. Methods of determining the translational kinetics value of a codon pair are discussed elsewhere herein. Such translational kinetics values can be normalized to facilitate comparison of translational kinetics values between species. In some embodiments, the translational value can be the degree of over-representation of a codon pair. An over-represented codon pair is a codon pair which is present in a protein-encoding sequence in higher abundance than would be expected if all codon pairs were statistically randomly abundant.
  • a codon pair predicted to cause a translational pause or slowing is a codon pair whose likelihood of causing a translational pause or slowing is at least one standard deviation above the mean translational kinetics value, where a particular translational kinetics value above the mean translational kinetics value in this context refers to a translational kinetics value indicative of a greater likelihood of causing translational pausing or slowing, relative to a mean translational kinetics value, and is not strictly limited to a particular mathematical relationship (e.g., greater than the mean) since the depiction of propensity to cause a translational pause by a translational kinetics value can be selected to be negative or positive, based on the selected implementation by one skilled in the art.
  • over-represented codon pairs may be graphically displayed as a positive function in a SpeedPlotTM, where a positive deflection or peak above a selected threshold describes a translational pause or slowing at the exact nucleotide location as defined by the abscissa.
  • a threshold for the translational kinetics value of codon pairs that are predicted to cause a translational pause or slowing can be set in accordance with the method and level of stringency desired by one skilled in the art. For example, when it is desired to identify only a small number of the codon pairs most likely to cause a translational pause or slowing, a threshold value can be set to 5, or 3, or 2, or 1.5 standard deviations or more above the mean.
  • Typical threshold values can be at least 1 , 1.25, 1.5, 1.75, 2, 2.25, 2.5, 3, 3.5, 4, 4.5 and 5 or more standard deviations above the mean.
  • a plurality of thresholds can be applied in the herein-provided methods in segregating codon pairs into a plurality of groups. Each threshold of such a plurality can be a different value selected from 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 3, 3.5, 4, 4.5 and 5 or more standard deviations above the mean.
  • translational kinetics of an mRNA into polypeptide can be changed to add or retain one or more translational pauses predicted to occur before, after or within an autonomous folding unit of a protein, or between autonomous folding units. While not intending to be limited to the following, it is proposed that translational pauses are present in parental genes in order to slow translation of a nascent polypeptide subsequent to translation of a protein domain, thus providing time for acquisition of secondary and at least partial tertiary structure in the domain prior to further downstream translation and reorganization or reconfiguration of the growing polypeptide or domain. By modifying the translational kinetics of complex multi-domain proteins it may be possible to experimentally alter the time each domain has available to organize.
  • Folding of a heterologously-expressed gene having two or more independent domains can be altered by the presence of pause sites between the domains. Refolding studies indicate that the time it takes for a protein to settle into its final configuration may take longer than the translation of the protein. Pausing may allow each domain to partially organize and commit to a particular, independent fold. Other co- translational events, such as those associated with co-factors, protein subunits, protein complexes, membranes, chaperones, secretion, or proteolysis complexes, also can depend on the kinetics of the emerging nascent polypeptide. Pauses can be introduced by engineering one codon pair predicted to cause a translational pause or slowing, or two or more such codon pairs into the sequence to facilitate these co-translational interactions.
  • typically a translational pause is preserved, which refers to maintaining the same codon pair for a polypeptide-encoding nucleotide sequence that is expressed in the native host organism, or, when the polypeptide-encoding nucleotide sequence is heterologously expressed, changing the codon pair as appropriate to have a translational kinetics value comparable to or closest to the translational kinetics value of the native codon pair in the native host organism.
  • proximal codon pairs can be selected to be replaced in order to introduce a translational pause or slowing.
  • one of the 1, 2, 3, 4 or 5 most proximal codon pairs upstream (5' of the desired pause site) or one of the 1, 2, 3, 4 or 5 most proximal codon pairs downstream (3' of the desired pause site) can be chosen for replacement to introduce the translational pause or slowing.
  • the selected codon pair for replacement to introduce the translational pause or slowing is the codon pair closest to the originally desired codon pair location of the translational pause or slowing, provided the desired translational pause or slowing can be attained (e.g., 1 codon pair upstream or downstream is typically selected instead of 2 codon pairs upstream or downstream, provided the desired translational pause or slowing can be attained).
  • a translational pause or slowing can be introduced by selecting a replacement codon pair encoding a conservative amino acid substitution, such as the conservative substitutions shown in Table 1.
  • replacement of a proximal codon pair to introduce a translational pause or slowing is preferred over replacement of a codon pair resulting in a change in the encoded amino acid sequence.
  • graphical displays of translational kinetics values of one or more proteins can be used to provide information to assist in the selection of a translational pause or slowing to preserve or insert in a redesigned polypeptide-encoding nucleotide sequence.
  • graphical displays of translational kinetics values can permit, for example, alignment of homologous proteins from different species and an identification, based on this alignment, of predicted translational pause or slowing sites that are conserved in the aligned proteins.
  • Such predicted translational pause or slowing sites can be preserved or inserted in a redesigned polypeptide-encoding nucleotide sequence.
  • regions between autonomous folding units in one or more proteins within a particular species can be graphically examined for the presence or absence of predicted pause sites.
  • Such graphical display methods can result in an identification of a region between autonomous folding units in which a translational pause or slowing is desirably preserved in a redesigned polypeptide-encoding sequence.
  • Methods for identifying and selecting conserved translational pauses can be performed according to any method known in the art, as exemplified in U.S. Patent Application No. 60/841588, filed on August 30, 2006.
  • the codon pair translation kinetics values can be compared with a database of related gene sequences and conserved pause sites can be identified.
  • a synthetic gene can be designed wherein at least one conserved pause site is maintained to provide a synthetic gene with modified translation kinetics.
  • codon pairs are associated with translational pauses, and can thereby influence translational kinetics of an mRNA into polypeptide.
  • the methods of changing translational kinetics provided herein will typically be performed by modifying or designing one or more nucleotide sequences encoding a polypeptide to be expressed.
  • methods of modifying a gene or designing a synthetic nucleotide sequence encoding the polypeptide encoded by the gene collectively referred to herein as redesigning a polypeptide-encoding gene sequence or redesigning a polypeptide-encoding nucleotide sequence.
  • redesigning a polypeptide-encoding gene sequence or redesigning a polypeptide-encoding nucleotide sequence.
  • Also included in the various embodiments provided herein are redesigned gene sequences encoding polypeptides that are not identical to the parental gene.
  • an antibody-encoding DNA sequence wherein the encoded sequence has at least a 50%, 60%, 70%, 75%, 80%, 85%, and more typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to the parental antibody polypeptide sequence as set forth in SEQ ID NOs: 2 and 4.
  • at least 1, 2 or 3 codon pairs of a polynucleotide sequence encoding the antibody (SEQ ID NOs: 2 and 4) have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the DNA sequence is optimized for expression in S.cerevisiae.
  • At least 1, 2 or 3 codon pairs of a polynucleotide sequence encoding the antibody (SEQ ID NOs: 2 and 4) have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the DNA sequence is optimized for expression in E.coli.
  • At least 1, 2 or 3 codon pairs of a polynucleotide sequence encoding the antibody have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the DNA sequence is optimized for expression in P. pastoris.
  • a therapeutic polypeptide-encoding DNA sequence adapted for expression in a heterologous host organism, wherein at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codon pairs present in parental nucleotide sequence and which encode the V H domain of the antibody, have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the conserved amino acid sequence pattern and domain boundaries for V H domains are known in the art.
  • the replacement codon pairs are predicted to be less likely to cause a translational pause in the heterologous host organism relative to the respective parental codon pair when expressed in the heterologous host organism. That is, the embodiments in which one or more codon pairs encoding amino acids of the V H domain have been replaced include embodiments in which the nucleotide sequence encoding the V H domain is changed to increase the predicted translational kinetics of translation of the V H domain.
  • incomplete translation, improper folding, or other protein expression shortcomings can result from the presence of one or more translational pauses in a heterologously-expressed polypeptide.
  • removal of one or more of these pauses can increase the speed of translation of the V H domain, and thereby increase the quantity of protein produced and/or increase the amount of stable, properly folded, active, and/or soluble protein produced.
  • the replacement codons i.e., the codons added as replacements for the parental codons
  • the replacement codon are typically predicted to be less likely to cause a translational pause.
  • the replacement codon can have a translational kinetics value in the heterologous host organism that is 95%, 90%, 85%, 80%, 75%, 70%, or less, than the translational kinetics value of the parental codon pair when expressed in the heterologous host organism.
  • the replacement codon is selected to have a translational kinetics value similar to the translational kinetics value of the parental codon pair in the native organism.
  • the z score of at least one replacement codon pair when expressed in the heterologous host organism can be no more than 250%, 200%, 150%, 125% or 100% of the z score for the parental codon pair when expressed in the native organism.
  • a antibody-encoding DNA sequence adapted for expression in a heterologous host organism, wherein at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codon pairs present in parental nucleotide sequence and which encode the C H I domain of the antibody, have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the conserved amino acid sequence pattern and domain boundaries for C H I domains are known in the art.
  • the replacement codon pairs are predicted to be less likely to cause a translational pause in the heterologous host organism relative to the respective parental codon pair when expressed in the heterologous host organism. That is, the embodiments in which one or more codon pairs encoding amino acids of the C H I domain have been replaced include embodiments in which the nucleotide sequence encoding the C H I domain is changed to increase the predicted translational kinetics of translation of the C H I domain. As provided herein, incomplete translation, improper folding, or other protein expression shortcomings can result from the presence of one or more translational pauses in a heterologously-expressed polypeptide.
  • the replacement codons i.e., the codons added as replacements for the parental codons, are typically predicted to be less likely to cause a translational pause.
  • the replacement codon can have a translational kinetics value in the heterologous host organism that is 95%, 90%, 85%, 80%, 75%, 70%, or less, than the translational kinetics value of the parental codon pair when expressed in the heterologous host organism.
  • the replacement codon is selected to have a translational kinetics value similar to the translational kinetics value of the parental codon pair in the native organism.
  • the z score of at least one replacement codon pair when expressed in the heterologous host organism can be no more than 250%, 200%, 150%, 125% or 100% of the z score for the parental codon pair when expressed in the native organism.
  • a antibody-encoding DNA sequence adapted for expression in a heterologous host organism, wherein at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codon pairs present in parental nucleotide sequence and which encode the C H 2 domain of the antibody, have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the conserved amino acid sequence pattern and domain boundaries for C H 2 domains are known in the art.
  • the replacement codon pairs are predicted to be less likely to cause a translational pause in the heterologous host organism relative to the respective parental codon pair when expressed in the heterologous host organism. That is, the embodiments in which one or more codon pairs encoding amino acids of the C H 2 domain have been replaced include embodiments in which the nucleotide sequence encoding the C H 2 domain is changed to increase the predicted translational kinetics of translation of the C H 2 domain.
  • incomplete translation, improper folding, or other protein expression shortcomings can result from the presence of one or more translational pauses in a heterologously-expressed polypeptide.
  • removal of one or more of these pauses can increase the speed of translation of the C H 2 domain, and thereby increase the quantity of protein produced and/or increase the amount of stable, properly folded, active, and/or soluble protein produced.
  • the replacement codons i.e., the codons added as replacements for the parental codons
  • the replacement codon are typically predicted to be less likely to cause a translational pause.
  • the replacement codon can have a translational kinetics value in the heterologous host organism that is 95%, 90%, 85%, 80%, 75%, 70%, or less, than the translational kinetics value of the parental codon pair when expressed in the heterologous host organism.
  • the replacement codon is selected to have a translational kinetics value similar to the translational kinetics value of the parental codon pair in the native organism.
  • the z score of at least one replacement codon pair when expressed in the heterologous host organism can be no more than 250%, 200%, 150%, 125% or 100% of the z score for the parental codon pair when expressed in the native organism.
  • a antibody-encoding DNA sequence adapted for expression in a heterologous host organism, wherein at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codon pairs present in parental nucleotide sequence and which encode the C H 3 domain of the antibody, have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the conserved amino acid sequence pattern and domain boundaries for C H 3 domains are known in the art.
  • the replacement codon pairs are predicted to be less likely to cause a translational pause in the heterologous host organism relative to the respective parental codon pair when expressed in the heterologous host organism. That is, the embodiments in which one or more codon pairs encoding amino acids of the C H 3 domain have been replaced include embodiments in which the nucleotide sequence encoding the C H 3 domain is changed to increase the predicted translational kinetics of translation of the C H 3 domain.
  • incomplete translation, improper folding, or other protein expression shortcomings can result from the presence of one or more translational pauses in a heterologously-expressed polypeptide.
  • removal of one or more of these pauses can increase the speed of translation of the C H 3 domain, and thereby increase the quantity of protein produced and/or increase the amount of stable, properly folded, active, and/or soluble protein produced.
  • the replacement codons i.e., the codons added as replacements for the parental codons
  • the replacement codon are typically predicted to be less likely to cause a translational pause.
  • the replacement codon can have a translational kinetics value in the heterologous host organism that is 95%, 90%, 85%, 80%, 75%, 70%, or less, than the translational kinetics value of the parental codon pair when expressed in the heterologous host organism.
  • the replacement codon is selected to have a translational kinetics value similar to the translational kinetics value of the parental codon pair in the native organism.
  • the z score of at least one replacement codon pair when expressed in the heterologous host organism can be no more than 250%, 200%, 150%, 125% or 100% of the z score for the parental codon pair when expressed in the native organism.
  • a antibody-encoding DNA sequence adapted for expression in a heterologous host organism, wherein at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codon pairs present in parental nucleotide sequence and which encode the region between the N-terminus and the V H domain of the antibody, have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the conserved amino acid sequence pattern and domain boundaries for the V H domain are described hereinabove.
  • the replacement codon pairs are predicted to be more likely to cause a translational pause in the heterologous host organism relative to the respective parental codon pair when expressed in the heterologous host organism. That is, the embodiments in which one or more codon pairs encoding amino acids in the region between the N-terminus and the V H domain have been replaced include embodiments in which the nucleotide sequence encoding the region between the N-terminus and the V H domain is changed to decrease the predicted translational kinetics of translation of the region between the N-terminus and the VH domain.
  • incomplete translation, improper folding, or other protein expression shortcomings can result from the absence of one or more translational pauses in a heterologously-expressed polypeptide.
  • adding one or more of these pauses can increase the speed of translation of the VH domain, and thereby increase the quantity of protein produced and/or increase the amount of stable, properly folded, active, and/or soluble protein produced.
  • the replacement codons i.e., the codons added as replacements for the parental codons
  • the replacement codon are typically predicted to be more likely to cause a translational pause.
  • the replacement codon can have a translational kinetics value in the heterologous host organism that is 105%, 110%, 115%, 120%, 125%, 130%, or more, than the translational kinetics value of the parental codon pair when expressed in the heterologous host organism.
  • the replacement codon is selected to have a translational kinetics value similar to the translational kinetics value of the parental codon pair in the native organism.
  • the z score of at least one replacement codon pair when expressed in the heterologous host organism can be at least 75%, 80%, 85%, 90%, 95% or 100% of the z score for the parental codon pair when expressed in the native organism.
  • a antibody-encoding DNA sequence adapted for expression in a heterologous host organism, wherein at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codon pairs present in parental nucleotide sequence and which encode the region between the V H and the C H I domain of the antibody, have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the conserved amino acid sequence pattern and domain boundaries for the DOMAIN 2 domain are described hereinabove.
  • the replacement codon pairs are predicted to be more likely to cause a translational pause in the heterologous host organism relative to the respective parental codon pair when expressed in the heterologous host organism. That is, the embodiments in which one or more codon pairs encoding amino acids in the region between the V H and the C H I domain have been replaced include embodiments in which the nucleotide sequence encoding the region between the V H and the C H I domain is changed to decrease the predicted translational kinetics of translation of the region between the V H and the C H I domain.
  • incomplete translation, improper folding, or other protein expression shortcomings can result from the absence of one or more translational pauses in a heterologously- expressed polypeptide.
  • adding one or more of these pauses can increase the speed of translation of the C H I domain, and thereby increase the quantity of protein produced and/or increase the amount of stable, properly folded, active, and/or soluble protein produced.
  • the replacement codons i.e., the codons added as replacements for the parental codons
  • the replacement codon are typically predicted to be more likely to cause a translational pause.
  • the replacement codon can have a translational kinetics value in the heterologous host organism that is 105%, 1 10%, 1 15%, 120%, 125%, 130%, or more, than the translational kinetics value of the parental codon pair when expressed in the heterologous host organism.
  • the replacement codon is selected to have a translational kinetics value similar to the translational kinetics value of the parental codon pair in the native organism.
  • the z score of at least one replacement codon pair when expressed in the heterologous host organism can be at least 75%, 80%, 85%, 90%, 95% or 100% of the z score for the parental codon pair when expressed in the native organism.
  • a antibody-encoding DNA sequence adapted for expression in a heterologous host organism, wherein at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codon pairs present in parental nucleotide sequence and which encode the region between the C H I and the C H 2 domain of the antibody, have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the conserved amino acid sequence pattern and domain boundaries for the C H 2 domain are described hereinabove.
  • the replacement codon pairs are predicted to be more likely to cause a translational pause in the heterologous host organism relative to the respective parental codon pair when expressed in the heterologous host organism. That is, the embodiments in which one or more codon pairs encoding amino acids in the region between the C H I and the C H 2 domain have been replaced include embodiments in which the nucleotide sequence encoding the region between the C H I and the C H 2 domain is changed to decrease the predicted translational kinetics of translation of the region between the C H I and the C H 2 domain.
  • incomplete translation, improper folding, or other protein expression shortcomings can result from the absence of one or more translational pauses in a heterologously- expressed polypeptide.
  • adding one or more of these pauses can increase the speed of translation of the C H 2 domain, and thereby increase the quantity of protein produced and/or increase the amount of stable, properly folded, active, and/or soluble protein produced.
  • the replacement codons i.e., the codons added as replacements for the parental codons
  • the replacement codon are typically predicted to be more likely to cause a translational pause.
  • the replacement codon can have a translational kinetics value in the heterologous host organism that is 105%, 110%, 115%, 120%, 125%, 130%, or more, than the translational kinetics value of the parental codon pair when expressed in the heterologous host organism.
  • the replacement codon is selected to have a translational kinetics value similar to the translational kinetics value of the parental codon pair in the native organism.
  • the z score of at least one replacement codon pair when expressed in the heterologous host organism can be at least 75%, 80%, 85%, 90%, 95% or 100% of the z score for the parental codon pair when expressed in the native organism.
  • a antibody-encoding DNA sequence adapted for expression in a heterologous host organism wherein at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codon pairs present in parental nucleotide sequence and which encode the region between the C H 2 and the C H 3 domain of the antibody, have been replaced with different codon pairs encoding identical amino acids or conservative amino acid substitutions thereof.
  • the conserved amino acid sequence pattern and domain boundaries for the C H 3 domain are described hereinabove.
  • the replacement codon pairs are predicted to be more likely to cause a translational pause in the heterologous host organism relative to the respective parental codon pair when expressed in the heterologous host organism. That is, the embodiments in which one or more codon pairs encoding amino acids in the region between the C H 2 and the C H 3 domain have been replaced include embodiments in which the nucleotide sequence encoding the region between the C H 2 and the C H 3 domain is changed to decrease the predicted translational kinetics of translation of the region between the C H 2 and the C H 3 domain.
  • incomplete translation, improper folding, or other protein expression shortcomings can result from the absence of one or more translational pauses in a heterologously- expressed polypeptide.
  • adding one or more of these pauses can increase the speed of translation of the C H 3 domain, and thereby increase the quantity of protein produced and/or increase the amount of stable, properly folded, active, and/or soluble protein produced.
  • the replacement codons i.e., the codons added as replacements for the parental codons
  • the replacement codon are typically predicted to be more likely to cause a translational pause.
  • the replacement codon can have a translational kinetics value in the heterologous host organism that is 105%, 110%, 115%, 120%, 125%, 130%, or more, than the translational kinetics value of the parental codon pair when expressed in the heterologous host organism.
  • the replacement codon is selected to have a translational kinetics value similar to the translational kinetics value of the parental codon pair in the native organism.
  • the z score of at least one replacement codon pair when expressed in the heterologous host organism can be at least 75%, 80%, 85%, 90%, 95% or 100% of the z score for the parental codon pair when expressed in the native organism.
  • methods for redesigning the polypeptide- encoding nucleotide sequence provided herein to modify the translational kinetics of the polypeptide-encoding nucleotide sequence where the polypeptide-encoding nucleotide sequence is altered such that one or more codon pairs have a decreased likelihood of causing a translational pause or slowing relative to the unaltered polypeptide-encoding nucleotide sequence.
  • one or more nucleotides of a polypeptide-encoding nucleotide sequence can be changed such that a codon pair containing the changed nucleotides has a translational kinetics value indicative of a decreased likelihood of causing a translational pause or slowing relative to the unchanged polypeptide-encoding nucleotide sequence.
  • the redesigned polypeptide-encoding nucleotide sequence need not possess a high degree of identity to the polypeptide-encoding nucleotide sequence of the parental gene, in some embodiments, the redesigned polypeptide-encoding nucleotide sequence will have at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% nucleotide identity with the polypeptide-encoding nucleotide sequence of the parental gene.
  • a parental gene refers to a gene for which codon pair refinement is to be performed; such parental genes can be, for example, wild type genes, native genes, naturally occurring mutant genes, other mutant genes such as site-directed mutant genes or engineered or completely synthetic genes.
  • the polynucleotide sequence will be completely synthetic, and will bear much lower identity with the parental gene, e.g., no more than 90%, 80%, 70%, 60%, 50%, 40%, or lower.
  • polypeptide-encoding nucleotide sequences can be redesigned to be convenient to work with and specifically tailored to a particular host and vector system of choice.
  • the resulting sequence can be designed to: (1) reduce or eliminate translational problems caused by inappropriate ribosome pausing, such as those caused by over- represented codon pairs or other codon pairs with translational values predictive of a translational pause; (2) have codon usage refined to avoid over-reliance on rare codons; (3) reduce in number or remove particular restriction sites, splice sites, internal Shine- Dalgarno sequences, or other sites that may cause problems in cloning or in interactions with the host organism; or (4) have controlled RNA secondary structure to avoid detrimental translational termination effects, translation initiation effects, or RNA processing, which can arise from, for example, RNA self-hybridization.
  • this sequence also can be designed to avoid oligonucleotides that mis-hybridize, resulting in genes that can be assembled from refined oligonucleotides that by thermodynamic necessity only pair up in the desired manner, using methods known in the art, as exemplified in U.S. Patent Application No. 2005/0106590, which is hereby incorporated by reference in its entirety.
  • polypeptide-encoding nucleotide sequence it is not possible to modify the polypeptide- encoding nucleotide sequence to suitably modify the translational kinetics of the mRNA into polypeptide without modifying the amino acid sequence of the encoded polypeptide.
  • an amino acid insertion, deletion or mutation can be introduced to yield a codon pair that is not predicted to cause a translational pause or slowing; or no change is made.
  • the change is preferably predicted to not substantially influence the final three-dimensional structure of the protein and/or the activity of the protein.
  • Such non-identical polypeptides can vary by containing one or more insertions, deletions and/or mutations.
  • polypeptide sequence can vary according to the purpose of the change, typically such a change results in a polypeptide that is at least 50%, 60%, 70%, 75%, 80%, 85%, and more typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the parental polypeptide sequence.
  • redesign of the polypeptide-encoding gene sequence is performed in conjunction with optimization of a plurality of parameters, where one such parameter is codon pair usage.
  • Methods already known in the art for optimizing multiple parameters in synthetic nucleotide sequences can be applied to optimizing the parameters recited in the present claims. Such methods may advantageously include those exemplified in U.S. Patent App. Publication No. 2005/0106590, and R.H. Lathrop et al. "Multi-Queue Branch-and-Bound Algorithm for Anytime Optimal Search with Biological Applications" in Proc. Intl. Conf. on Genome Informatics, Tokyo, Dec 17-19, 2001 pp.
  • an exemplary method for generating a synthetic sequence can also include dividing the desired sequence into a plurality of partially overlapping segments; optimizing the melting temperatures of the overlapping regions of each segment to disfavor hybridization to the overlapping segments which are non-adjacent in the desired sequence; allowing the overlapping regions of single stranded segments which are adjacent to one another in the desired sequence to hybridize to one another under conditions which disfavor hybridization of non-adjacent segments; and filling in, ligating, or repairing the gaps between the overlapping regions, thereby forming a double-stranded DNA with the desired sequence.
  • This process can be performed manually or can be automated, e.g., in a general purpose digital computer.
  • the search of possible codon assignments is mapped into an anytime branch and bound computer
  • a synthetic nucleotide sequence encoding a desired polypeptide where the synthetic nucleotide sequence also is designed to have desirable translational kinetics properties, such as the replacement of some or all codon pairs predicted to result in a translational pause or slowing.
  • Such design methods include determining a set of partially overlapping segments with optimized melting temperatures, and determining the translational kinetics of the synthetic sequence, where if it is desired to change the translational kinetics of the synthetic gene, the sequences of the overlapping segments are modified and refined in order to approximate the desired translational kinetics while still possessing acceptable hybridization properties. In some embodiments, this process is performed iteratively.
  • graphical displays of values of observed versus expected codon pair frequencies are generated for the parental sequence, the final sequence, and/or any intermediate sequences.
  • graphical displays of refined, possible, or improved translational kinetics values of codon pairs are generated for the parental sequence, the final sequence, and/or any intermediate sequences. Such graphical displays can be used for analyzing the translational kinetics of the synthetic nucleotide sequence.
  • polypeptide-encoding nucleotide sequence redesign methods can be employed where a plurality of properties of the polypeptide- encoding nucleotide sequence can be refined in addition to codon pair usage properties, where such properties can include, but are not limited to, melting temperature gap between oligonucleotides of synthetic gene, average codon usage, average codon pair chi- squared (e.g., z score), worst codon usage, worst codon pair (e.g., z score), maximum usage in adjacent codons, Shine-Dalgarno sequence (for E.
  • coli expression occurrences of 5 consecutive G's or 5 consecutive Cs, occurrences of 6 consecutive A's or 6 consecutive T's, long exactly repeated subsequences, cloning restriction sites, user- prohibited sequences (e.g., other restriction sites), codon usage of a specific codon above user-specified limit, and out-of-frame stop codons (framecatchers).
  • additional properties that can be considered in a process of redesigning a polypeptide-encoding nucleotide sequence include, but are not limited to, occurrences of RNA splice sites, occurrences of polyA sites, and occurrence of Kozak translation initiation sequence.
  • a process of redesigning a polypeptide-encoding nucleotide sequence can include constraints including, but not limited to, minimum melting temperature gap between oligonucleotides of synthetic gene, minimum average codon usage, maximum average codon pair chi- squared (or z score), minimum absolute codon usage, maximum absolute codon pair (z score), minimum maximum usage in adjacent codons, no Shine-Dalgarno sequence (for E.
  • additional constraints can include, but are not limited to, minimum occurrences of RNA splice sites, minimum occurrences of polyA sites, and occurrence of Kozak translation initiation sequence.
  • a process of redesigning a polypeptide-encoding nucleotide sequence can include preferences including, but not limited to, prefer high average codon usage, prefer low average codon pair chi-squared, prefer larger melting temperature gap, prefer more out of frame stop codons (framecatchers), and optionally prefer evenly distributed codon usage.
  • Any of a variety of nucleotide sequence refinement/optimization methods known in the art can be used to refine the polypeptide-encoding nucleotide sequence according to the codon pair usage properties, and according to any of the additional properties specifically described above, or other properties that are refined in nucleotide sequence redesign methods known in the art.
  • a branch and bound method is employed to refine the polypeptide-encoding nucleotide sequence according to codon pair usage properties and at least one additional property, such as codon usage.
  • the methods provided herein can further include analyzing at least a portion of the candidate polynucleotide sequence in frame shift, and selecting codons for the candidate polynucleotide sequence such that stop codons are added to at least one said frame shift.
  • the generating step further includes analyzing at least a portion of the candidate polynucleotide sequence in frame shift, and selecting codons for the candidate polynucleotide sequence such that one or more stop codons in one, two or three reading frames are added downstream of polypeptide-encoding region of the nucleotide sequence.
  • methods for redesigning a polypeptide-encoding gene for expression in a host organism, by providing a data set representative of codon pair translational kinetics for the host organism which includes translational kinetics values of the codon pairs utilized by the host organism, providing a desired polypeptide sequence for expression in the host organism, and generating a polynucleotide sequence encoding the polypeptide sequence by analyzing candidate nucleotides to select, where possible, codon pairs that are predicted not to cause a translational pause in the host organism, with reference to the data set, thereby providing a candidate polynucleotide sequence encoding the desired polypeptide.
  • Also provided herein are methods for redesigning a polypeptide- encoding gene for expression in a host organism by providing a first data set representative of codon pair translational kinetics for the host organism which includes translational kinetics values of the codon pairs utilized by the host organism, providing a second data set representative of at least one additional desired property of the synthetic gene, providing a desired polypeptide sequence for expression in the host organism, and generating a polynucleotide sequence encoding the polypeptide sequence by analyzing candidate nucleotides to select, where possible, both (i) codon pairs that are predicted not to cause a translational pause in the host organism, with reference to the first data set, and (ii) nucleotides that provide a desired property, with reference to the second data set, thereby providing a candidate polynucleotide sequence encoding the desired polypeptide.
  • a branch and bound method is employed to refine the polypeptide- encoding nucleotide sequence according to codon pair usage properties of the first data set and according to the properties of the second data set.
  • the second data set contains codon preferences representative of codon usage by the host organism, including the most common codons used by the host organism for a given amino acid.
  • a antibody-encoding DNA sequence wherein the encoded sequence has at least a 50%, 60%, 70%, 75%,80%, 85%, and more typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to the parental antibody polypeptide sequence as set forth in SEQ ID NOs: 2 and 4.
  • the polynucleotide provided herein is adapted for expression in a heterologous host organism.
  • a heterologous host organism is an organism used to express DNA, RNA or protein that is foreign to the host organism.
  • the host organism is not human, E. coli or S. cerevisiae.
  • At least 1, 2 or 3 codon pairs of the parental sequence that are predicted to cause a translational pause in the host organism have been replaced with codon pairs that are predicted to be less likely to cause a translational pause therein.
  • the at least three codon pairs of the parental sequence that are predicted to cause a translational pause in the host organism are highly-overrepresented codon pairs therein and have been replaced with codon pairs that are not highly-overrepresented therein.
  • a highly- overrepresented codon pair is a codon pair that has a translational kinetics value greater than a designated threshold, wherein a threshold value can be at least 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 3, 3.5, 4, 4.5 or 5 or more standard deviations above the mean translational kinetics value.
  • a antibody-encoding DNA sequence having at least a 75% sequence identity with a parental antibody polypeptide sequence as set forth in SEQ ID NOs: 2 and 4 and is adapted for expression in a heterologous host organism, wherein at least three codon pairs of the parental sequence that are predicted to cause a translational pause in the host organism have been replaced with codon pairs that are predicted to be less likely to cause a translational pause therein, and wherein the host organisms are selected from the following: Pichia pastoris; Oryctolagus cuniculus (rabbit); Macaca fascicularis (Long-tailed monkey); M. mulatta (Monkey); E. coli Kl 2 W3110; E.
  • the methods provided herein can include analyzing the candidate polynucleotide sequence to confirm that no codon pairs are predicted to cause a translational pause in the host organism by more than a designated threshold.
  • the likelihood that a particular codon pair will cause translational pausing or slowing in an organism can be represented by a translational kinetics value.
  • the translational kinetics value can be expressed in any of a variety of manners in accordance with the guidance provided herein. In one example, a translational kinetics value can be expressed in terms of the mean translational kinetics value and the corresponding standard deviation for all codon pairs in an organism.
  • the translational kinetics value for a particular codon pair can be expressed in terms of the number of standard deviations that separate the translational kinetics value of the codon pair from the mean translational kinetics value.
  • a threshold value can be at least 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 3, 3.5, 4, 4.5 or 5 or more standard deviations above the mean translational kinetics value.
  • the methods provided herein also include generating a candidate nucleotide sequence according to codon usage.
  • codon usage As is known in the art, different organisms can have different preference for the three- nucleotide codon sequence encoding a particular amino acid. As a result, translation can often be improved by using the most common three-nucleotide codon sequence encoding a particular amino acid.
  • some methods provided herein also include generating a candidate nucleotide sequence such that codon utilization is non-randomly biased in favor of codons most commonly used by the host organism. Codon usage preferences are known in the art for a variety of organisms and methods for selecting the more commonly used codons are well known in the art.
  • the methods of redesigning a polypeptide- encoding nucleotide sequence are based on a plurality of properties, where a conflict in the preferred nucleotide sequence arising from the plurality of properties is determined in order to optimize the predicted translational kinetics. That is, when the plurality of properties being optimized would lead to more than one possible nucleotide sequence depending on which property is to be accorded more weight, typically, the conflict is resolved by selecting the nucleotide sequence predicted to be translated more rapidly, for example, due to fewer predicted translational pauses.
  • the methods of redesigning a polypeptide-encoding nucleotide sequence are based on a plurality of properties, where a conflict in the preferred nucleotide sequence arising from the plurality of properties is determined in order to optimize codon pair usage preferences. That is, when the plurality of properties being optimized would lead to more than one possible nucleotide sequence depending on which property is to be accorded more weight, typically, codon pair usage will be accorded more weight in order to resolve the conflict between the more than one possible nucleotide sequences.
  • the methods provided herein can include identifying at least one instance of a conflict between selecting common codons and avoiding codon pairs predicted to cause a translational pause; in such instances, the conflict is resolved in favor of avoiding codon pairs predicted to cause a translational pause.
  • Some embodiments provided herein include generating a candidate polynucleotide sequence encoding the polypeptide sequence, the candidate polynucleotide sequence having a non-random codon pair usage, such that the codon pairs encoding any particular pair of amino acids have the lowest translational kinetics values.
  • the candidate polynucleotide sequence encoding the polypeptide sequence is generated and/or altered such that the encoded amino acid sequence is not altered.
  • the candidate polynucleotide sequence encoding the polypeptide sequence is generated and/or altered such that the three dimensional structure of the encoded polypeptide is not substantially altered.
  • the candidate polynucleotide sequence encoding the polypeptide sequence is generated and/or altered such that no more than conservative amino acid changes are made to the encoded polypeptide.
  • the methods provided herein can further include a step of refining or altering the candidate polynucleotide sequence in accordance with a second nucleotide sequence property to be refined.
  • the methods further include generating or refining a candidate polynucleotide sequence encoding a polypeptide sequence such that the candidate polynucleotide sequence has a non-random codon usage, where the most common codons used by the host organism are over-represented in the candidate polynucleotide sequence.
  • the methods can include refining or altering the candidate polynucleotide sequence in accordance with any of a variety of additional properties provided herein, including but not limited to, melting temperature gap between oligonucleotides of synthetic gene, Shine-Dai garno sequence, occurrences of 5 consecutive G's or 5 consecutive Cs, occurrences of 6 consecutive A's or 6 consecutive T's long exactly repeated subsequences, cloning restriction sites, or any other user-prohibited sequences. Further, any of a variety of combinations of these properties can be additionally included in the nucleotide sequence refinement methods provided herein.
  • the method provided herein can further include an evaluation step in which after the candidate polynucleotide sequence is altered, the sequence is compared with at least a portion of a data set of a property against which the sequence was refined.
  • an evaluation step in which after the candidate polynucleotide sequence is altered, the sequence is compared with at least a portion of a data set of a property against which the sequence was refined.
  • the candidate nucleotide sequence can be compared to each property considered in the refinement, and, if the values for all properties are deemed to be acceptable or desired, no further sequence alteration is required. If the values for fewer than all properties are deemed to be acceptable or desired, the candidate nucleotide sequence can be subjected to further sequence alteration and evaluation.
  • sequence alteration steps of methods provided herein can be performed iteratively. That is, one or more steps of altering the nucleotide sequence can be performed, and the candidate nucleotide sequence can be evaluated to determine whether or not further sequence alteration is necessary and/or desirable. These steps can be repeated until values for all properties are deemed to be acceptable or desired, or until no further improvement can be achieved. Determination of translational kinetics values for codon pairs
  • the methods and sequences provided herein include determination and use of translational kinetics values for codon pairs. As provided herein, such a translational kinetics value can be calculated and/or empirically measured, and the final translational kinetics value used in graphical displays and methods of predicting translational kinetics can be a refined value resultant from two or more types of codon pair translational kinetics information.
  • codon pair translational kinetics information that can be used in refining or replacing a translational kinetics value for a codon pair include, for example, values of observed versus expected codon pair frequencies in a particular organism, normalized values of observed versus expected codon pair frequencies in a particular organism, the degree to which observed versus expected codon pair frequency values are conserved in related proteins across two or more species, the degree to which observed versus expected codon pair frequency values are conserved at predicted pause sites such as boundaries between autonomous folding units in related proteins across two or more species, the degree to which codon pairs are conserved at predicted pause sites across different proteins in the same species, and empirical measurement of translational kinetics for a codon pair.
  • the values of observed versus expected codon pair frequencies in a host organism can be determined by any of a variety of methods known in the art for statistically evaluating observed occurrences relative to expected occurrences. Regardless of the statistical method used, this typically involves obtaining codon sequence data for the organism, for example, on a gene-by-gene basis. In some embodiments, the analysis is focused only on the coding regions of the genome. Because the analysis is a statistical one, a large database is preferred. Initially, the total number of codons is determined and the number of times each of the 61 non-terminating codons appears is determined.
  • the expected frequency of each of the 3721 (61 2 ) possible non- terminating codon pairs is calculated, typically by multiplying together the frequencies with which each of the component codons appears.
  • This frequency analysis can be carried out on a global basis, analyzing all of the sequences in the database together; however, it is typically done on a local basis, analyzing each sequence individually. This will tend to minimize the statistical effect of an unusually high proportion of rare codons in a sequence.
  • the expected number of occurrences of each codon pair is calculated by, for example, multiplying the expected frequency by the number of pairs in the sequence. This information can then be added to a global table, and each next succeeding sequence can be analyzed in like manner.
  • the values of observed versus expected codon pair frequencies are chi-squared values, such as chi-squared 2 (chisq2) values or chi- squared 3 (chisq3) values.
  • Methods for calculating chi-squared values can be performed according to any method known in the art, as exemplified in U.S. Patent No. 5,082,767, which is incorporated by reference herein in its entirety.
  • a new value chi-squared 2 (chisq2) can be calculated as follows. For each group of codon pairs encoding the same amino acid pair (i.e., 400 groups), the sums of the expected and observed values are tallied; any non-randomness in amino acid pairs is reflected in the difference between these two values. Therefore, each of the expected values within the group is multiplied by the factor [sum observed/sum expected], so that the sums of the expected and observed values with the group are equal. The new chi- squared, chisq2, is evaluated using these new expected values.
  • a new value chi-squared 3 (chisq3) can be calculated. Correction is made only for those dinucleotides formed between adjacent codon pairs; any bias of dinucleotides within codons (codon triplet positions I-II and II-III) will directly affect codon usage and is, therefore, automatically taken into account in the underlying calculations.
  • the sums of the expected and observed values are tallied; any non- randomness in dinucleotide pairs is reflected in the difference between these two values. Therefore, each of the expected values within the group is multiplied by the factor [sum observed/sum expected], so that the sums of the expected and observed values with the group are equal.
  • the new chi-squared, chisq3, is evaluated using these new expected values.
  • Dinucleotide bias represents a smaller effect in yeast, and only a very minor one in E. coli.
  • the predominant dinucleotide bias in human is the well-known CpG deficit, other dinucleotides are also very highly biased. For example, there is a deficit of TA, as well as an excess of TG, CA and CT. Overall, the deficit of CpG contributes only 35% of the total dinucleotide bias in the human database, and 17% in yeast.
  • the values of observed versus expected codon pair frequencies in a host organism herein can be normalized. Normalization permits different sets of values of observed versus expected codon pair frequencies to be compared by placing these values on the same numerical scale. For example, normalized codon pair frequency values can be compared between different organisms, or can be compared for different codon pair frequency value calculations within a particular organism (e.g., different calculations based on input sequence information or based on different calculations such as chisql or chisq2 or chisq3). Typically, normalization results in codon pair frequency values that are described in terms of their mean and standard deviation from the mean.
  • An exemplary method for normalizing codon pair frequency values is the calculation of z scores.
  • the z score for an item indicates how far and in what direction that item deviates from its distribution's mean, expressed in units of its distribution's standard deviation.
  • the mathematics of the z score transformation are such that if every item in a distribution is converted to its z score, the transformed scores will have a mean of zero and a standard deviation of one.
  • the z scores transformation can be especially useful when seeking to compare the relative standings of items from distributions with different means and/or different standard deviations, z scores are especially informative when the distribution to which they refer is normal. In a normal distribution, the distance between the mean and a given z score cuts off a fixed proportion of the total area under the curve.
  • An exemplary method for determining z scores for codon pair chi- squared values is as follows: First, a list of all 3721 possible non-terminating codon pairs is generated. Second, for the i" 1 codon pair, the i th chi-squared value is calculated, where the i th chi-squared value is denoted c,. The chi-squared value, Cj, is given the sign of (observed - expected), so that over-represented codon pairs are assigned a positive Cj and under-represented codon pairs are assigned a negative Cj. The formula for Cj is:
  • the mean chi-squared value is calculated where the mean is denoted m.
  • the standard deviation of the chi-squared values is calculated, where the standard deviation is denoted s.
  • the formula for the standard deviation is: ) where V means square root.
  • a z score is calculated by subtracting the mean then dividing by the standard deviation, wherein the i l z score is denoted Zj.
  • the formula for the z score is:
  • provided herein are methods of refining the predictive capability of a translational kinetics value of a codon pair in a host organism by providing an initial translational kinetics value based on the value of observed codon pair frequency versus expected codon pair frequency for a codon pair in a host organism, providing additional translational kinetics data for the codon pair in the host organism, and modifying the initial translational kinetics value according to the additional codon pair translational kinetics data to generate a refined translational kinetics value for the codon pair in the host organism.
  • the translational kinetics data that can be used to refine translational kinetics values and methods of modifying translational kinetics values according to such additional translational kinetics data to generate a refined translational kinetics value for a codon pair in a host organism are provided below.
  • translational kinetics data that can be used to refine translational kinetics values are based on recurrence of a codon pair and/or recurrence of a predicted translational kinetics value associated with a codon pair.
  • Recurrence-based refinement of translational kinetics values is based on the investigation of multiple polypeptide-encoding nucleotide sequences to determine whether or not there are multiple occurrences of either codon pairs or predicted translational kinetics values in those sequences.
  • Recurrence-based refinement of translational kinetics can be performed using any of a variety of known sequence comparison methods consistent with the examples provided herein. For purposes of exemplification, and not for limitation, the following example of recurrence-based refinement of translational kinetics is provided.
  • the predicted translational kinetics value for a codon pair can be refined according to the degree to which observed versus expected codon pair frequency values are conserved in related proteins across two or more species.
  • related proteins are proteins having homologous amino acid sequences and/or similar three dimensional structures.
  • Related proteins having homologous amino acid sequences will typically have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% sequence identity.
  • Related proteins having similar three dimensional structures will typically share similar secondary structure topology and similar relative positioning of secondary structural elements; exemplary related proteins having three dimensional structures are members of the same SCOP- classified Family (see, e.g., Murzin A. G., Brenner S. E., Hubbard T., Chothia C. (1995).
  • SCOP a structural classification of proteins database for the investigation of sequences and structures. J. MoI. Biol. 247, 536-540.).
  • the observed versus expected codon pair frequency values for any given codon pair can vary from species to species. However, as provided herein, evolutionarily related proteins in different species will typically conserve some or all translational pause or slowing sites. Based on this, an observed conservation of one or more predicted translational pause or slowing sites in evolutionarily related proteins of different species can confirm or increase the likelihood that a translational pause or slowing site is a functional translational kinetics signal.
  • the codon pair located at the position on a protein that is confirmed as, or considered to have an increased likelihood of, containing an actual translational pause or slowing can itself be confirmed as being, or considered to have an increased likelihood of being, a functional translational kinetics signal.
  • a codon pair located at a position on a protein that is confirmed as not containing, or considered to have a decreased likelihood of containing, an actual translational pause or slowing, can itself be confirmed as not acting, or considered to have an decreased likelihood of acting, as a functional translational kinetics signal.
  • initially predicted translational kinetics data e.g., data based on values of observed codon pair frequency versus expected codon pair frequency
  • the predicted translational kinetics value for a codon pair can be refined according to the presence of the codon pair at a location predicted by methods other than codon pair frequency methods to contain a translational pause or slowing site.
  • a predicted location is a boundary location between autonomous folding units of a protein.
  • translational pauses are present in parental genes in order to slow translation of a nascent polypeptide subsequent to translation of a secondary structural element of a protein and/or a protein domain, thus providing time for acquisition of secondary and at least partial tertiary structure by the nascent protein prior to further downstream translation, and thereby allowing each domain to partially organize and commit to a particular, independent fold.
  • codon pairs can be associated with translational pauses between autonomous folding units of a protein, where autonomous folding units can be secondary structural elements such as an alpha helix, or can be tertiary structural elements such as a protein domain.
  • the presence of a codon pair at a boundary location between autonomous folding units of a protein can confirm or increase the likelihood that the codon pair acts to pause or slow translation.
  • predicted translational kinetics data e.g., data based on values of observed codon pair frequency versus expected codon pair frequency
  • predicted translational kinetics data can be modified according to the presence of the codon pair at a boundary location between autonomous folding units of a protein, which can increase the likelihood of the codon pair acts to pause or slow translation.
  • an over-represented codon pair that is present at a boundary location between autonomous folding units of a protein can be confirmed as acting as a translational pause or slowing codon pair.
  • a single observation of the codon pair at a boundary location between autonomous folding units of a protein can confirm or increase the likely translational pause or slowing properties of a codon pair.
  • typically a plurality of observations will be used to more accurately estimate the translational pause or slowing properties of a codon pair.
  • methods of using, for example, predicted boundary locations can be combined with methods that are based on recurrence of a codon pair and/or recurrence of a predicted translational kinetics value associated with a codon pair in methods of refining a predicted translational kinetics value for a codon pair.
  • a protein present in two or more species can have conserved boundary locations between autonomous folding units of the protein, and recurrent presence of an over-represented codon pair at the boundary locations can confirm the likelihood of an actual translational pause at that boundary location, leading to confirmation, or increased likelihood, that the corresponding codon pair for the respective species acts as a translational pause or slowing codon pair.
  • two or more proteins of the same species can have boundary locations between autonomous folding units, and recurrent presence of an over-represented codon pair at the boundary locations can confirm or indicate the likelihood of an actual translational pause at that boundary location, leading to confirmation or indication of increased likelihood that the corresponding codon pair acts as a translational pause or slowing codon pair.
  • Such recurrence-based methods also can be used to confirm or indicate increased likelihood that a non-over-represented codon pair (e.g., an under-represented codon pair or a represented-as-expected codon pair) acts as a translational pause or slowing codon pair.
  • a non-over-represented codon pair e.g., an under-represented codon pair or a represented-as-expected codon pair
  • two or more proteins of the same species can have boundary locations between autonomous folding units, and recurrent presence of a non- over-represented codon pair at the boundary locations, particularly if no over-represented codon pair is present, can confirm or indicate the likelihood of an actual translational pause at that boundary location, leading to confirmation or indication of increased likelihood that the corresponding codon pair acts as a translational pause or slowing codon pair.
  • Such recurrence-based methods also can be used to confirm or indicate the likelihood that a codon pair, such as an over-represented codon pair, does not act as a translational pause or slowing codon pair.
  • a codon pair such as an over-represented codon pair
  • two or more proteins of the same species can have boundary locations between autonomous folding units, and consistent absence of a non-over-represented codon pair at the boundary locations can confirm or indicate increased likelihood that the codon pair does not act as a translational pause or slowing codon pair.
  • the predicted translational kinetics value for a codon pair can be refined according to empirical measurement of translational kinetics for a codon pair.
  • the influence of a codon pair on translational kinetics can be experimentally measured, and these experimental measurements can be used to refine or replace the predicted translational kinetics values for a codon pair.
  • Several methods of experimentally measuring the translational kinetics of a codon pair are known in the art, and can be used herein, as exemplified in Irwin et al, J. Biol. Chem., (1995) 270:22801.
  • One such exemplary assay is based on the observation that a ribosome pausing at a site near the beginning of an mRNA coding sequence can inhibit translation initiation by physically interfering with the attachment of a new ribosome to the message, and, thus, the codon pair to be assayed can be placed at the beginning of a polypeptide-encoding nucleotide sequence and the effect of the codon pair on translational initiation can be measured as an indication of the ability of the codon pair to cause a translational pause.
  • Another such exemplary assay is based on the fact that the transit time of a ribosome through the leader polypeptide coding region of the leader RNA of the trp operon sets the basal level of transcription through the trp attenuator, and, thus, the codon pair to be assayed can be placed into a trpLep leader polypeptide codon region, and level of expression can be inversely indicative of the translational pause properties of the codon pair, due to a faster translation causing formation of a stem-loop attenuator in the leader RNA, which results in transcriptional attenuation.
  • the methods provided herein for calculation of translational kinetics values can be applied to the native organism of the polypeptide of SEQ ID NOs: 2 and 4, and also can be applied to a selected organism in which the polypeptide of SEQ ID NOs: 2 and 4, or a modification thereof, is to be heterologously expressed.
  • the nucleotide sequence information of an organism can be used to calculate chi-squared values in accordance with the methods provided herein, and the translational kinetics values can be based on these chi-squared values as well as on additional translational kinetics information provided herein, including, but not limited to, codon pairs conserved in domain boundaries and empirically measured translational kinetics for a codon pair.
  • Exemplary organisms for which translational kinetics values can be calculated and used to prepare a nucleotide sequence encoding a antibody protein provided herein incude Pichia pas tor is; Oryctolagus cuniculus (rabbit); Macaca fascicularis (Long-tailed monkey); M. mulatta (Monkey); E. coli K12 W3110; E. coli UTI89; E coli O157:H7 EDL933; E coli O157:H7 str. Sakai; Bombyx mori; Spodoptera frugiperda; Drosophila melanogaster and Schizosaccharomyces pombe.
  • the translational kinetics data described herein can be combined in such a manner as to provide a refined translational kinetics value for a codon pair in a host organism.
  • Methods of combining predictive data to arrive at a refined predictive value are known in the art and can be used herein.
  • an hypothesis H is that a given sequence feature, e.g., a given codon pair, has utility for translational kinetics engineering, e.g., creates a translational pause site.
  • H) P(Dl & D2 & D3 & D4
  • H) P(Dl & D2 & D3 & D4
  • H) P(Dl & D2 & D3 & D4
  • P(Di is correct) and P(Di is not correct) can be estimated a priori by the correlation of Di with previous experimental measurements.
  • H) are obtained by observing whether or not hypothesis H is consistent with observed data item Di. More complex and powerful Bayesian approaches are also well known to the art. The fully general approach rewrites P(D
  • the translational kinetics values for a codon pair can be refined by consideration of, for example, chi-squared value of observed versus expected codon pair frequency and the degree to which codon pairs are conserved at predicted pause sites across different proteins in the same species, for example, at protein structure domain boundaries.
  • An over-represented codon pair which is present with above-random frequency at boundary locations between autonomous folding units of proteins in the same species can have a translational kinetics value reflecting higher predicted translational pause properties of the codon pair.
  • an over- represented codon pair which is present with below-random frequency at boundary locations between autonomous folding units of proteins in the same species can have a translational kinetics value reflecting lower predicted translational pause properties of the codon pair.
  • the translational kinetics values for a codon pair can be refined by consideration of, for example, experimentally measured translation step times in one species and the degree to which codon pairs that correspond to measured pause sites in the first species are conserved across homologous proteins in other species, for example, in a multiple sequence alignment.
  • an over-represented codon pair in another species is aligned with above-random frequency to a codon pair that corresponds to a measured translation pause site in the first species, it can have a translational kinetics value reflecting higher predicted translational pause properties of that codon pair in the other species.
  • an over-represented codon pair in another species when aligned with below-random frequency to a codon pair that corresponds to a measured translation pause site in the first species, it can have a translational kinetics value reflecting lower predicted translational pause properties of that codon pair in the other species.
  • translational kinetics values for codon pairs can be determined.
  • the translational kinetic values can be organized according to the likelihood of causing a translational pause or slowing based on any method known in the art.
  • the translational kinetic values for two or more codon pairs, up to all codon pairs, in an organism are determined, and the mean translational kinetics value and associated standard deviation are calculated. Based on this, the translational kinetics value for a particular codon pair can be described in terms of the multiple of standard deviations the translational kinetics value for the particular codon pair differs from the mean translational kinetics value. Accordingly, reference herein to mean translational kinetics values and standard deviations, whether or not applied to a particular expression of translational kinetics value, can be applied to any of a variety of expressions of translational kinetics values provided herein.
  • Such a graphical display provides a visual display of the predicted translational influence, including translational pause or slowing for numerous or all codon pairs of a polypeptide-encoding nucleotide sequence.
  • This visual display can be used in methods of modifying polypeptide-encoding nucleotide sequences in order to thereby modify the predicted translational kinetics of the mRNA into polypeptide in methods such as those provided herein.
  • the graphical displays can be used to identify one or more codon pairs to be modified in a polypeptide-encoding nucleotide sequence.
  • the graphical displays can be used in analyzing a polypeptide-encoding nucleotide sequence prior to modifying the polypeptide-encoding nucleotide sequence, or can be used in analyzing a modified polypeptide-encoding nucleotide sequence to determine, for example, whether or not further modifications are desired.
  • Methods for creating and using graphical displays can be performed according to any method known in the art, as exemplified in U.S. Patent Application No. 60/746466, filed on May 4, 2006, which is incorporated by reference herein in its entirety.
  • graphical displays as described therein can be created to illustrate the translational kinetics of a parental or redesigned polypeptide-encoding nucleotide sequence in the native or a heterologous organism, or to illustrate differences and/or similarities of translation kinetic of a polypeptide-encoding nucleotide sequence in which one or more codon pairs have been modified.
  • numerous normalized graphical displays can be created to illustrate differences and/or similarities of translation kinetics of a polypeptide-encoding nucleotide sequence when expressed in two or more different organisms.
  • the graphical displays can be created using translational kinetics values based on any of the methods for determining translational kinetics values provided herein or otherwise known in the art. For example, chi-squared as a function of codon pair position, chi-squared 2 as a function of codon position, or chi-squared 3 as a function of codon pair position, translational kinetics values thereof, empirical measurement of translational pause of codon pairs in a host organism, estimated translational pause capability based on observed presence and/or recurrence of a codon pair at predicted pause site, and variations and combinations thereof as provided herein.
  • the exact format of the graphical displays can take any of a variety of forms, and the specific form is typically selected for ease of analysis and comparison between plots.
  • the abscissa typically lists the position along the nucleotide sequence or polypeptide sequence, and can be represented by nucleotide position, codon position, codon pair position, amino acid position, or amino acid pair position.
  • the ordinate typically lists the translational kinetics value of the codon pair, such as, but not limited to, a translational kinetics value of codon pair frequency, including, but not limited to the z score of chisql, the z score of chisq2, the z score of chisq3, the empirically measured value, and the refined translational kinetics value.
  • the sequence position can be plotted along the ordinate and the translational kinetics value can be plotted along the abscissa.
  • a set of graphical displays including at least a first graphical display and a second graphical display, are prepared. These sets of displays can be compared in order to determine the difference in predicted translational efficiency or translational kinetics of the two plots.
  • the plots can differ according to any of a variety of criteria. For example, each plot can represent a different polypeptide-encoding nucleotide sequence, each plot can represent a different host organism, each plot can represent differently determined translational kinetics values, or any combination thereof.
  • any number of different graphical displays can be compared in accordance with the methods provided herein, for example, 2, 3, 4, 5, 6, 7, 8 or more different graphical displays can be compared.
  • two plots will represent different polypeptide-encoding nucleotide sequences, the same sequence in different host organisms, or different sequences in different host organisms.
  • Comparison of different graphical displays can be used to analyze the predicted change in translational kinetics as a result of the difference represented by the graphical displays. For example, comparison of the same polypeptide-encoding nucleotide sequence in different host organisms can be used to analyze any predicted transcriptional pauses that can be removed. Accordingly, provided herein are methods of analyzing translational kinetics of an mRNA into polypeptide in a host organism by comparing two graphical displays to understand or predict the differences in translational kinetics of the mRNA into polypeptide, where the differences in the graphical displays can be as a result of, for example, a difference in the polypeptide-encoding nucleotide sequence or a difference in the host organism.
  • a graphical display of the translational kinetics values of codon pairs for the parental polypeptide- encoding nucleotide sequence in the heterologous host can be compared to a graphical display of the translational kinetics values of codon pairs for a modified polypeptide- encoding nucleotide sequence in the heterologous host, and it can be determined whether or not the modification to the polypeptide-encoding nucleotide sequence resulted in improved translational kinetics.
  • an expression system comprising an expression vector in a host organism, wherein the expression vector includes a DNA sequence of the embodiments provided herein operably linked to an expression control sequence.
  • an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified nucleic acid molecule.
  • the expression vector is also capable of replicating within the host cell.
  • Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids.
  • operably linked refers to functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
  • An operably linked expression vector can also include secretion signals and other modifying sequences, and may encode chaperones and proteins for a variety of organisms and systems.
  • slowing the rate of transcription and/or translation comprises growing the bacterial cells at a temperature lower than 3O 0 C.
  • the cells are E, coli.
  • the protein is an antibody.
  • the antibody is an IgGl antibody.
  • the protein is a heavy chain-containing antibody.
  • the method comprises growth of host bacteria at a temperature suitable for logarithmic phase followed by lowering the temperature at or approximately at the time of induction of expression of a heavy chain polypeptide in an E.
  • the method comprises lowering the temperature at or approximately at the time of induction of expression of a heavy chain-containing antibody in an E, coli cell to 25 0 C.
  • Transcription and/or translation levels can be reduced by any number of factors known in the art. For example, transcription and/or translation levels can be reduced by reducing the temperature of growth as discussed above from logarithmic growth conditions to temperatures that are typically considered suboptimal for logarithmic growth. Such a lowering of temperature may occur before, at or approximately at the time of induction of expression. Similarly, transcription and/or translation levels can be reduced by reducing the concentration of an inducing compound being added by about 10%, about 20%, about 30% or about 40% or more.
  • the cytokine-binding polypeptide is expressed with a secretion signal sequence.
  • the secretion signal can be an amino terminal sequence that facilitates transit across a membrane.
  • secretion signal is a leader peptide domain of a protein facilitates insertion into the membrane. The signal sequence is removed after crossing the inner membrane, and most proteins will be retained in the periplasmic space.
  • a typical secretion signal is a pelB secretion signal.
  • the predicted amino acid residue sequences of the secretion signal domain from two pelB gene product variants from Erwinia carotova are described in Lei et al., Nature, 331 :543-546 (1988).
  • the leader sequence of the pelB protein has previously been used as a secretion signal for fusion proteins (Better et al., Science, 240:1041-1043 (1988); Sastry et al., Proc. Natl. Acad. Sci., USA, 86:5728-5732 (1989); and Mullinax et al., Proc. Natl. Acad. Sci., USA, 87:8095-8099 (1990)).
  • Another typical secretion signal sequence is the gene III (gill) secretion signal.
  • Gene HI encodes pill, one of the minor capsid proteins from the filamentous phage fd (similar to Ml 3 and rl). pill is synthesized with an 18 amino acid, amino terminal signal sequence and requires the bacterial Sec system for insertion into the membrane.
  • SRP secretion signal Another typical secretion signal sequence is the SRP secretion signal.
  • SRP secretion signals have been used, for example, to improve production of fusion protein for phage display (Steiner et al. Nat. Biotechnology, 24:823-831 (2006)).
  • secretion constructs presented herein for expression of human mAb heavy and light chains use an SRP secretion signal, namely the secretion signal of the E. coli dsbA gene.
  • SRP secretion signals that can be used in the methods, polynucleotides and polypeptides provided herein include SfmC (chaperone), ToIB (translocation protein), and TorT (respiration regulator). The sequences of these signals are known in the art.
  • Secrection by the E. coli secB mechanism involves attachment of a nascent polypeptide first to trigger factor, TF, and then to secB.
  • the secB protein then directs attachment of the completed polypeptide to the Type II secretion complex which secretes the protein into the periplasm.
  • the SRP mechanism recognizes a different set of secretion signals and directs co-translation and secretion of nascent polypeptides through the Type II secretion complex into the periplasm. This mechanism can be used to avoid problems that could occur in secretion by the secB pathway.
  • Coupled translation is an alternative mechanism of translational initiation in which the ribosomes which translate the first open reading frame (ORF) move a short distance upstream after termination and reinitiate translation from a second overlapping ORF.
  • Reinitiation of translation at a nearby start codon after termination at the upstream gene is possible because ribosome dissociation from the mRNA is a slow and energy-dependent process.
  • the efficiency of reinitiation depends on the distance as well as the strength of the Shine-Dalgarno sequence, which is, in general, located 5-13 bp upstream of a start codon and which binds to the homologous 3' end of the 16S rRNA, a component of the 3OS ribosomal subunit.
  • a coupled translation expression system provides methods of expressing at least two polypeptides using a coupled translation expression system.
  • one or more codons of an upstream sequence are modified to generate a Shine-Dalgarno sequence for enhancing reinitiation of translation of the downstream, coupled sequence.
  • expression by means of a coupled translation system results in increased efficiency and optimization of expression in the host organism.
  • translational coupling sequences can be utilized that are applicable across human IgG subclasses.
  • IgG 1, 2, and 3 are identical in the coupling region (C-terminal); IgG 4 differs by one amino acid at the C-terminus, having Leu where the other IgG classes have Pro.
  • the coupling sequence set forth herein as SEQ ID NO: 23 comprises a Shine-Delgarno sequence (AGGA) located upstream of the stop codon and the start codon (ATG) of the light chain-encoding sequence.
  • AGGA Shine-Delgarno sequence
  • ATG start codon
  • the Leu codon can be selected to provide an identical Shine-Delgarno sequence.
  • This example describes characterization and optimization of expression of anti-TNF constructs in E. coli.
  • Plasmid DNA for each was transformed into E. coli Top 10 cells and individual transformant were grown in LB amp 100. Plasmid DNA for each construct was prepared cut with BamH I and Hind III. All plasmid recovered had inserts that co- migrated with the inserts in the starting plasmids
  • Osmotic shock samples were prepared from each of the induced samples and from an uninduced control following the manufacturer's instructions (Invitrogen pBAD gill product manual). Briefly, after Induction cells were spun down and washed once with 20 mM Tris pH8, 2.5mM EDTA, 20% sucrose. Cells were spun down again and osmotic shock performed with 20 mM Tris pH8, 2.5 mM EDTA. Cells were spun down again and the supernatant was collected and analyzed for anti-TNF activity.
  • Anti-TNF antibody activity was measured by ELISA assay (Described in detail below). Briefly, 96 well microtitre plates were coated with human TNF ⁇ and then blocked to prevent nonspecific binding. Samples from various expression preparations were added to these plates (primary antibody) and the plates were washed. A secondary AP conjugated goat anti-human IgG antibody (secondary antibody) was then added. Following addition of AP color reagent, plates were read in a 96 well plate reader.
  • Results of the analysis of anti-TNF activity in the osmotic shock samples from various pelB constructs are shown in Table 2. Results demonstrate that active anti-TNF antibody is being produced and secreted from the E. coli cells. Similar results were obtained from various alternative constructs.
  • the levels of active anti-TNF observed in these initial experiments were about 1 ng/mL of bacterial culture, so an experiment was performed to look at the effect of varying the level of induction.
  • the pelB 8 construct was grown and induced at a range of concentrations and osmotic shock and media samples were prepared. ELISA results are shown in Table 3 Table 3. Variation in arabinose concentration and pelB 8 expression
  • Protein products produced by various expression constructs were analyzed on Western blots to confirm that they did contain proteins of the expected sized for human IgG heavy and light chains. The results are shown in Figure 4. These results are consistent with results from Coomassie stained gels that show substantially higher levels of expression of heavy chain vs light chain. In addition, the small amount of IgG in the osmotic shock samples is consistent with the results of ELISA assays and Coomassie stained gels. These results indicate the relatively high ratio of heavy to light chain produced, and the relatively small fraction being secreted from the E. coli cells.
  • a lL E. coli culture of Top 10 + the pelB7 was grown and induced to prepare ecAnti-TNF for testing the purification procedure.
  • the culture was grown to an OD595 of 0.8 and induced with arabinose at a final concentration of 0.02%.
  • Osmotic shock and medium samples as well of the wash solution from the osmotic shock procedure were tested for anti-TNF activity by ELISA (samples were diluted 1/10 for analysis). Results indicated that the medium fraction contained the largest proportion of active antibody recovered, approximately IOng/mL of medium.
  • Antibody Characterization assays were performed as described below. Anti-TNF ELISA Assay
  • An ELISA assay was developed to detect the presence of active anti- TNF ⁇ antibody by its ability to bind to TNF ⁇ immobilized on a 96 well mmicrotiter plate.
  • the assay which, is described in detail in Appendix A, quantitates the antibody bound to the wells by incubating with a peroxidase labeled goat anti-human IgG antibody.
  • Key controls include incubation of the test solution with uncoated wells, to control for any non-specific binding of an antibody in the test solution, and incubation of coated wells with dilution buffer, to control for non-specific binding of the secondary antibody to immobilized TNF ⁇ ,
  • the ELISA assay was used with different concentrations of the adalimumab (Humira) standard to produce a standard curve (Figure 5). This standard curve was used to quantitate E. coli produced ecAnti-TNF.
  • the Kd for the expressed antibody is only 1.2 times greater than the Kd for Adalimumab (Humira).
  • Scatchard Plots are the traditional method used to determined binding constants. In order to obtain reasonably straight lines with the Scatchard Plots, it was necessary to neglect the lowest concentration TNF point for both antibodies (25 pM TNF ⁇ ). At this low concentration of antigen, the absorbances are similar to those in the absence of antigen. Calculating the Kd from the Scatchard plots gives the following results:
  • each construct was made by altering single amino acids close to the C terminus of the heavy chain of ecAnti-TNF (the unmodified heavy chain sequence is set forth as SEQ ID NO: 4).
  • SEQ ID NO: 4 the unmodified heavy chain sequence is set forth as SEQ ID NO: 4.
  • construct 1 set forth herein as SEQ ID NO: 8
  • encoded amino acid G450 is changed to R (G450R).
  • construct number 2 set forth herein as SEQ ID NO: 10
  • encoded amino acid P449 is changed to E (P449E).
  • Each amino acid substitution was made in order to incorporate a Shine-Dalgarno sequence for efficient reinitiation of translation of the coupled light chain gene.
  • Coupled translation constructs 1 and 2 were cloned into pBAD Ito (shown in Figure 7) under control of the AraBAD promoter. These constructs both included gill secretion signals at the amino termini of both the heavy and light chain genes.
  • the anti-TNF bicistronic expression construct (SEQ ID NO: 11) was used as a template for PCR amplification of gill-linked heavy chain (glll-HC) and glll- linked light chain (glll-LC).
  • PCR amplification of the heavy chain utilized the forward primer 5'GGGGATCCTACCTGACGCTTTTTATCGCAACTCTCT ACTGTTTC 3' (SEQ ID NO: 12) and the reverse primer 5' CCA
  • This example describes the development of a purification method for E. Coli produced antibody (ecHumira) and the testing of the purified antibody to determine whether this E. Coli produced antibody was capable of binding to the ClQ protein and activating the complement dependent cytotoxicity pathway.
  • ELISA An ELISA assay for Humira was developed and described in detail in Example 4 above. Briefly, microtiter plates are coated with TNFoc and then incubated with Humira standards and ecHumira samples. After washing, the Humira bound to the plate is quantitated with a horse radish peroxidase labled anti-human IgG antibody. As described in Example 4 above, it was found that the Kd of ecHumira was comparable to the Kd of pharmaceutical grade Humira.
  • the first step the Western Analysis was SDS-PAGE gel electrophoresis. Samples and standards are combined with an equal volume of 2 X Laemmli buffer (BioRad) and heated for 5 mintues at 95°C either in the presence of 5% 2-mercaptoethanol (reduced gel) or in the absence of reducing agent (non-reduced gel).
  • the membrane was incubated for at least lhour at room temperature (or overnight at 4 0 C) in 5% Blotto (BioRad; dried non-fat milk) in Tris buffered saline (TBS). After one 5 minute wash in TBS containing 0.05% Tween 20 (TTBS), the membrane in incubated for 1 hour at room temperature in detector antibody cocktail that contained a horse radish peroxidase labeled anti-human IgG (KPL; anti- H + L; 1 ⁇ g/mL ) and a horse radish peroxidase labeled anti-human light chain (Bethyl; anti- kappa; 2 ⁇ g/mL).
  • KPL horse radish peroxidase labeled anti-human IgG
  • Bethyl horse radish peroxidase labeled anti-human light chain
  • the membrane was then washed three times for 5 minutes each in TTBS and the sample bands are visualized by addition of a chemiluminescent peroxidase substrate (either LumiGLO or LumiGLO Reserve; KPL) and a molecular imaging system (VersaDoc; BioRad).
  • a chemiluminescent peroxidase substrate either LumiGLO or LumiGLO Reserve; KPL
  • KPL LumiGLO or LumiGLO Reserve
  • VersaDoc BioRad
  • ClQ Assay The ClQ assay was performed as follows.
  • CIq protein was obtained from Sigma. TNF- ⁇ was obtained from Invitrogen. Goat anti-human CIq antibody was obtained from CalBiochem. Rabbit anti- human CIq antibody was obtained from US Biological. Peroxidase labeled goat anti- rabbit (H+L) antibody, peroxidase labeled rabbit anti-goat (H+L), and human serum absorbed peroxidase labeled goat anti-rabbit (H+L) antibody were obtained from KPL. Human serum absorbed peroxidase labeled rabbit anti-goat (H+L) antibody was obtained from Zymed.
  • CIq Assay 1 (Plate Coated with Different Humira Concentrations).
  • Humira was diluted in Coating Buffer (0.05 M sodium carbonate, pH 9.6) and 0.1 mL aliquots were applied to duplicate wells of a polystyrene 96 well microtiter plate at the following concentrations: 2 ⁇ g/mL, 1 ⁇ g/mL, 0.5 ⁇ g/mL, 0.25 ⁇ g/mL, 0.125 ⁇ g/mL, 0.0625 ⁇ g/mL, and 0.0313 ⁇ g/mL, Duplicate wells were not coated as blanks. The plate was sealed with an adhesive cover and incubated overnight at 4 0 C.
  • the plate was washed 3 times and 0.1 mL aliquots of 1 ⁇ g/mL goat anti-human CIq antibody dissolved in Dilution Buffer were added to the plate.
  • the plate was incubated again for 1 hour at rt, washed 3 times, and incubated for 1 hour at rt with 0.1 mL aliquots of 1 ⁇ g/mL Human serum absorbed peroxidase labeled rabbit anti-goat (H+L) antibody dissolved in Dilution Buffer + 0.1 mg/mL Bovine IgG.
  • the plate was then washed 3 times and 0.1 mL aliquots of peroxidase substrate (TMB purchased from KPL) were added.
  • TMB peroxidase substrate
  • the plate was incubated with gently rotary shaking until the standard curve developed, at which time the reaction was quenched by the addition of 0.1 mL aliquots of 1 M hydrochloric acid. Finally the plate was read on a microtiter plate reader at 450 nm.
  • TNF- ⁇ was diluted to 1 ⁇ g/mL in Coating Buffer and applied, in 0.1 mL aliquots, to the wells of a polystyrene 96 well microtiter plate. The plate was sealed with an adhesive cover, incubated overnight at 4°C, and washed 3 times. After blocking as described above, Humira was added in PBS/0.1% BSA/0.05% Tween 20 at the following concentrations: 2 ⁇ g/mL, 1 ⁇ g/mL, 0.5 ⁇ g/mL, 0.25 ⁇ g/mL, 0.125 ⁇ g/mL, and 0 ⁇ g/mL.
  • the assay was continued as described above using the following dilution buffers: CIq addition, PBS/0.1% fish gelatin/0.05% Tween 20; primary antibody, PBS/0.1% fish gelatin/0.05% Tween 20; Secondary antibody, PBS/0.1% fish gelatin/0.05% Tween 20/0.1 mg/mL bovine IgG.
  • the plate was then incubated with 2 ⁇ g/mL ClQ protein in Dilution Buffer containing 0.05% Blotto (BioRad) followed by incubations with primary antibody (Goat anti-human ClQ; CalBiochem) in dilution buffer and secondary antibody (human serum absorbed peroxidase labeled rabbit anti-Goat H+L; Zymed) in Dilution Buffer + 0.1 mg/mL Bovine IgG (BioRad).
  • primary antibody Goat anti-human ClQ; CalBiochem
  • secondary antibody human serum absorbed peroxidase labeled rabbit anti-Goat H+L; Zymed
  • TCTGTCTCTGTCTCCAGGAAAATAGTAATGAAAAAGATT (SEQ ID NO: 23). Further, the construct includes sequence encoding dsbA secretion signals at the 5' end of each of the heavy and light chain-encoding sequences.
  • mAb expression For mAb expression, a fresh overnight culture was grown in Terrific Broth (TB) plus kanamycin in a shaker incubator at 3O 0 C, 200RPM. In the morning the overnight culture was diluted in TB plus kanamycin to and OD590 of approximately 0.1. This culture was grown in a beveled flask at 3O 0 C 200RPM to an OD590 of 2.0 to 3.0 and induced by addition of L-arabinose to a final concentration of 0.01%. At this time, the temperature of the shaker incubator was reduced to at 25 0 C and the culture was shaken at 200RPM for 20 hours.
  • TB Terrific Broth
  • 200RPM kanamycin
  • Affinity capture was performed on 1 mL prepacked columns containing either Protein A Sepharose (HiTrap Protein A HP; GE) or Protein G Sepharose (HiTrap Protein G HP; GE). Columns were loaded in extraction buffer at between 0.5 mL/minute and 1.0 mL/minute and samples were washed and eluted at 1.0 mL/minute. Unless stated otherwise, columns were washed with 10 mL PBS/0.05% Tween 20 and eluted with 0.1 M glycine, pH 2.7 containing 0.05% Tween 20.
  • Anion Exchange Chromatography Anion exchange chromatography was performed on Q Sepaharose (HiTrap Q FF; GE) and on DEAE Sepharose (HiTrap DEAE FF; GE). Columns were run at 1 mL/minute at pH values between pH 8 and pH 9 in either 0.02 M or 0.01 M Tris Buffer. Prior to application, samples were dialyzed against the column equilibration buffer. Samples were eluted from the columns in Tris Buffer containing increasing concentrations of sodium chloride.
  • Cells were frozen for 1 hour in -80 0 C freezer. Extraction was performed with gentle orbital shaking. Cells were centrifuged at 4 0 C for 5 minutes in a microfuge prior to assay.
  • the initial Protein A columns binds most of the 150 kDa tetramer, as can be seen by comparing Lanes 4 and 5 in the non-reduced gel (gel 1).
  • the protein G elution contains a strong band at -5OkDa that is not visible in the Protein A elution. This 50 kDa band can be seen in the reduced gel (gel 2, lane 4) to consist primarily of light chain.
  • the reduced gel of the Protein A product contains the heavy and light chains in amounts similar to that found for Humira as well as a band of protein degradation products.
  • the HIC product has a 100 kDa band of at least equal intensity to the 150 kDa tetramer as well as multiple additional lower molecular weight bands.
  • Cation Exchange Chromatography The Protein A purified product was dialyzed against 0.02 M sodium acetate buffer (pH 5) and applied to a 1 mL SP Sepharose column equilibrated in the same buffer. The column was eluted with successive 4 mL aliquots of the acetate buffer containing 0.1 M, 0.2 M, 0.3 M, 0.4 M, 0.5 M and 1.0 M sodium chloride. The bulk of the recovered material was found in the flow through (37%) and the 0.3 M sodium chloride elution (7%).
  • the column was eluted with portions of the same buffer containing higher concentrations of sodium chloride. As can be seen in Figure 13, most of the 150 kDa tetramer does not bind to the column ( Figure 13, Lanes 6 - 10).
  • the Flow Through contains approximately equal concentrations of tetramer and a band at 100 kDa (most likely the heavy chain dimer) as well as multiple smaller MW bands.
  • the smear that is in the starting Protein A product was removed by the column. Approximately 20% of the ecHumira ELISA activity applied to the column was recovered in the flow through.
  • the Protein A product was dialyzed at 4°C against 0.02 M Tris, pH 8, 0.05% Tween 20 and loaded at 1 mL/minute onto three 1 mL Q Sepharose columns attached together and equilibrated in the same buffer. After application, the column was washed with 15 mL of the equilibration buffer and then eluted with 12 ml portions of the equilibration buffer plus 0.01 M, 0.02 M, 0.05 M, and 1.0 M sodium chloride. The product, which eluted in the Flow Through and the Wash, contained 22 ⁇ g or 24% of the Protein A load.
  • the 100 kDa band was the predominant band in this product and the 150 kDa tetramer and the 75 kDa band were of approximately equal intensities.
  • this large scale anion exchange run did not result in effective purification of the tetramer.
  • the column did not have the capacity to bind all of the impurities so that a higher concentration of impurities eluted in the Flow Through + Wash.
  • HIC/Q Sepharose In an attempt to lower the load on the Q column and improve the separation, the product from the first Q column was adjusted to 1.0 M sodium sulfate and applied to a 1 mL Phenyl Sepharose HIC column. Approximately 12 ⁇ g was recovered in the 0.4 M sodium sulfate elution, or 55% of the load. The sample was divided into two aliquots which were both adjusted to 0.01% Tween 20 and dialyzed against 0.01 M Tris, pH 8, 0.05% Tween 20 at 4°C in either 10 kDa or 100 kDa molecular weight cut off dialysis tubing. Western analysis of these products is shown in Figure 15 (Lanes 3 and 4). The Figure shows that the tetramer is the predominant product, although the band at 100 kDa is also prominent. It was also clear that some of the smaller molecular weight impurities are removed by dialysis against the 100 kDa membrane.
  • the total amount of tetramer could be estimated by Western Analysis only after Protein A purification. After correcting for a Protein A yield of 50%, Western Analysis indicated that the original extract contained -10 ⁇ g of tetramer. Thus only ⁇ 3% of the extracted activity was due to tetramer.
  • the E. coli produced ecHumira and the CHO produced Humira have similar abilities to bind to the TNF- ⁇ antigen. However, only CHO produced Humira was found to have the ability to bind the ClQ protein. Since ecHumira does not bind to the ClQ protein, it is contemplated that ecHumira will have a reduced effect on activating the complement-dependent cytotoxicity pathway.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne des polypeptides thérapeutiques, tels que des anticorps, présentant une glycosylation réduite, et leurs méthodes de mise au point et de synthèse. Les polypeptides thérapeutiques peuvent présenter des fonctions effectrices réduites, ainsi que des avantages supplémentaires tels que, mais pas exclusivement, une expression et une purification plus efficaces, et une réaction améliorée du patient. Dans certains modes de réalisation, le polypeptide est un anticorps humanisé produit par recombinaison ciblant une cytokine, et ayant une spécificité pour une cytokine particulière L'invention se rapporte à d'autres antigènes humains naturels. L'anticorps présente une région constante qui est aglycosylée.
PCT/US2008/085568 2007-12-04 2008-12-04 Anticorps thérapeutiques aglycosylés et séquences nucléotidiques codant les anticorps thérapeutiques WO2009073805A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US99229107P 2007-12-04 2007-12-04
US60/992,291 2007-12-04

Publications (2)

Publication Number Publication Date
WO2009073805A2 true WO2009073805A2 (fr) 2009-06-11
WO2009073805A3 WO2009073805A3 (fr) 2009-07-30

Family

ID=40627568

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/085568 WO2009073805A2 (fr) 2007-12-04 2008-12-04 Anticorps thérapeutiques aglycosylés et séquences nucléotidiques codant les anticorps thérapeutiques

Country Status (1)

Country Link
WO (1) WO2009073805A2 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011086141A1 (fr) * 2010-01-14 2011-07-21 Ucb Pharma S.A. Souche hôte bactérienne exprimant dsbc recombinant
AU2011201157A1 (en) * 2002-12-24 2012-10-04 Rinat Neuroscience Corp. Anti-NGF antibodies and methods using same
EP2546267A1 (fr) * 2011-07-13 2013-01-16 UCB Pharma S.A. Souche hôte bactérienne exprimant un DsbC recombinant
WO2013011076A3 (fr) * 2011-07-19 2013-04-04 Glaxo Group Limited Protéines de liaison à un antigène ayant une liaison accrue à fcrn
CN103446583A (zh) * 2013-03-21 2013-12-18 百奥泰生物科技(广州)有限公司 一种治疗TNF-α相关疾病的人抗体制剂
CN106170298A (zh) * 2013-10-16 2016-11-30 安口生物公司 用于提高抗体稳定性的缓冲液制剂
US20180028656A1 (en) * 2012-09-07 2018-02-01 Coherus Biosciences, Inc. Stable Aqueous Formulations of Adalimumab
US20190030163A1 (en) * 2016-02-03 2019-01-31 Oncobiologics, Inc. Buffer formulations for enhanced antibody stability
US10696735B2 (en) 2015-01-21 2020-06-30 Outlook Therapeutics, Inc. Modulation of charge variants in a monoclonal antibody composition
US11071782B2 (en) 2016-04-20 2021-07-27 Coherus Biosciences, Inc. Method of filling a container with no headspace
US11229702B1 (en) 2015-10-28 2022-01-25 Coherus Biosciences, Inc. High concentration formulations of adalimumab

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5082767A (en) * 1989-02-27 1992-01-21 Hatfield G Wesley Codon pair utilization
US6090382A (en) * 1996-02-09 2000-07-18 Basf Aktiengesellschaft Human antibodies that bind human TNFα
US6979556B2 (en) * 2000-12-14 2005-12-27 Genentech, Inc. Separate-cistron contructs for secretion of aglycosylated antibodies from prokaryotes
WO2007014162A2 (fr) * 2005-07-21 2007-02-01 Abbott Laboratories Expression multigenique comprenant des constructions sorf et methodes faisant appel a des polyproteines, a des pro-proteines, et a une proteolysis

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5082767A (en) * 1989-02-27 1992-01-21 Hatfield G Wesley Codon pair utilization
US6090382A (en) * 1996-02-09 2000-07-18 Basf Aktiengesellschaft Human antibodies that bind human TNFα
US6979556B2 (en) * 2000-12-14 2005-12-27 Genentech, Inc. Separate-cistron contructs for secretion of aglycosylated antibodies from prokaryotes
WO2007014162A2 (fr) * 2005-07-21 2007-02-01 Abbott Laboratories Expression multigenique comprenant des constructions sorf et methodes faisant appel a des polyproteines, a des pro-proteines, et a une proteolysis

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ANDERSEN D C ET AL: "Production technologies for monoclonal antibodies and their fragments" CURRENT OPINION IN BIOTECHNOLOGY, LONDON, GB, vol. 15, no. 5, 1 October 2004 (2004-10-01), pages 456-462, XP004588033 ISSN: 0958-1669 *
MAZOR YARIV ET AL: "Isolation of engineered, full-length antibodies from libraries expressed in Escherichia coli" NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 25, no. 5, 1 May 2007 (2007-05-01), pages 563-565, XP002488027 ISSN: 1087-0156 [retrieved on 2007-04-15] *
SIMMONS L C ET AL: "Expression of full-length immunoglobulins in Escherichia coli: rapid and efficient production of aglycosylated antibodies" JOURNAL OF IMMUNOLOGICAL METHODS, ELSEVIER SCIENCE PUBLISHERS B.V.,AMSTERDAM, NL, vol. 263, no. 1-2, 1 May 2002 (2002-05-01), pages 133-147, XP004354391 ISSN: 0022-1759 *
STEINER DANIEL ET AL: "Signal sequences directing cotranslational translocation expand the range of proteins amenable to phage display" NATURE BIOTECHNOLOGY, vol. 24, no. 7, July 2006 (2006-07), pages 823-831, XP009117243 ISSN: 1087-0156 *

Cited By (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2011201157C1 (en) * 2002-12-24 2017-09-07 Rinat Neuroscience Corp. Anti-NGF antibodies and methods using same
AU2011201157A1 (en) * 2002-12-24 2012-10-04 Rinat Neuroscience Corp. Anti-NGF antibodies and methods using same
WO2011086141A1 (fr) * 2010-01-14 2011-07-21 Ucb Pharma S.A. Souche hôte bactérienne exprimant dsbc recombinant
EP2546267A1 (fr) * 2011-07-13 2013-01-16 UCB Pharma S.A. Souche hôte bactérienne exprimant un DsbC recombinant
WO2013011076A3 (fr) * 2011-07-19 2013-04-04 Glaxo Group Limited Protéines de liaison à un antigène ayant une liaison accrue à fcrn
US10286071B2 (en) 2012-09-07 2019-05-14 Coherus Biosciences, Inc. Syringe containing stable aqueous formulations of adalimumab
US10716853B2 (en) 2012-09-07 2020-07-21 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US20180028656A1 (en) * 2012-09-07 2018-02-01 Coherus Biosciences, Inc. Stable Aqueous Formulations of Adalimumab
US20180028657A1 (en) * 2012-09-07 2018-02-01 Coherus Biosciences, Inc. Stable Aqueous Formulations of Adalimumab
US20180028655A1 (en) * 2012-09-07 2018-02-01 Coherus Biosciences, Inc. Stable Aqueous Formulations of Adalimumab
US10155039B2 (en) 2012-09-07 2018-12-18 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10159733B2 (en) 2012-09-07 2018-12-25 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10159732B2 (en) 2012-09-07 2018-12-25 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10786566B2 (en) 2012-09-07 2020-09-29 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10195275B2 (en) 2012-09-07 2019-02-05 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10207000B2 (en) 2012-09-07 2019-02-19 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10780163B2 (en) 2012-09-07 2020-09-22 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10286072B2 (en) 2012-09-07 2019-05-14 Coherus Biosciences, Inc. Methods of manufacturing stable aqueous formulations of adalimumab
US10772959B2 (en) 2012-09-07 2020-09-15 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10688183B2 (en) 2012-09-07 2020-06-23 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10772960B2 (en) 2012-09-07 2020-09-15 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10799585B2 (en) 2012-09-07 2020-10-13 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10716854B2 (en) 2012-09-07 2020-07-21 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10716852B2 (en) 2012-09-07 2020-07-21 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
US10722579B2 (en) 2012-09-07 2020-07-28 Coherus Biosciences, Inc. Stable aqueous formulations of adalimumab
CN103446583A (zh) * 2013-03-21 2013-12-18 百奥泰生物科技(广州)有限公司 一种治疗TNF-α相关疾病的人抗体制剂
CN106170298A (zh) * 2013-10-16 2016-11-30 安口生物公司 用于提高抗体稳定性的缓冲液制剂
US10376582B2 (en) * 2013-10-16 2019-08-13 Outlook Therapeutics, Inc. Buffer formulations for enhanced antibody stability
CN106170298B (zh) * 2013-10-16 2024-01-09 前瞻疗法公司 用于提高抗体稳定性的缓冲液制剂
US10696735B2 (en) 2015-01-21 2020-06-30 Outlook Therapeutics, Inc. Modulation of charge variants in a monoclonal antibody composition
US11229702B1 (en) 2015-10-28 2022-01-25 Coherus Biosciences, Inc. High concentration formulations of adalimumab
US11285210B2 (en) 2016-02-03 2022-03-29 Outlook Therapeutics, Inc. Buffer formulations for enhanced antibody stability
US20190030163A1 (en) * 2016-02-03 2019-01-31 Oncobiologics, Inc. Buffer formulations for enhanced antibody stability
US11071782B2 (en) 2016-04-20 2021-07-27 Coherus Biosciences, Inc. Method of filling a container with no headspace
US11576971B2 (en) 2016-04-20 2023-02-14 Coherus Biosciences, Inc. Method of filling a container with no headspace

Also Published As

Publication number Publication date
WO2009073805A3 (fr) 2009-07-30

Similar Documents

Publication Publication Date Title
WO2009073805A2 (fr) Anticorps thérapeutiques aglycosylés et séquences nucléotidiques codant les anticorps thérapeutiques
US20180327446A1 (en) Purification of fkpa and uses thereof for producing recombinant polypeptides
US8314213B2 (en) Human equivalent monoclonal antibodies engineered from nonhuman variable regions
EP2906599B1 (fr) Peptides signal à chaîne lourde et à chaîne légère optimisés permettant de produire des agents thérapeutiques à base d'anticorps recombinants
AU2020200329A1 (en) Stabilization of Fc-containing polypeptides
US9540437B2 (en) Humanized antibodies
EP2310413B1 (fr) Polypeptides de liaison à l'antigène dérivée du camélidés
EP3604337A1 (fr) Anticorps b7-h3, fragment de liaison à l'antigène de celui-ci, et son utilisation médicale
JP5770710B2 (ja) 最適化されたＦｃ変異株
JP5420399B2 (ja) 改変型ヒト化抗インターロイキン−１８抗体
EP1860120B1 (fr) Procédé permettant d'améliorer un anticorps
WO2005005638A2 (fr) Proteines de fusion a haute affinite et methodes therapeutiques et diagnostiques d'utilisation
CA2824927A1 (fr) Compositions contenant des anticorps glycosyles et utilisations de celles-ci
TW202124415A (zh) 抗ｔｎｆｒ２抗體及使用方法
US20230138315A1 (en) Anti-angptl3 antibody and use thereof
KR20140062127A (ko) 견화(犬化) 항체 및 그의 제조방법
US7101978B2 (en) TNF-α binding molecules
Jagschies Selected biotherapeutics overview
US11427627B2 (en) Fc-containing molecules exhibiting predictable, consistent, and reproducible glycoform profiles
RU2772716C2 (ru) Антитело против il-5, его антигенсвязывающий фрагмент и его медицинское применение
EP1590431A2 (fr) Molecules de liaison au facteur de necrose tumorale alpha
WO2023118241A1 (fr) Anticorps anti-récepteur a de l'interleukine-31 canin (il-31ra) et leurs utilisations

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08856303

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: COMMUNICATION PURSUANT TO RULE 112(1) EPC

122 Ep: pct application non-entry in european phase

Ref document number: 08856303

Country of ref document: EP

Kind code of ref document: A2