WO2009060129A1 - Human monoclonal antibodies directed to sialyl lewis c, sialyl tn and n-glycolylneuraminic acid epitopes and a method of analysis of stem cells comprising said epitopes - Google Patents

Human monoclonal antibodies directed to sialyl lewis c, sialyl tn and n-glycolylneuraminic acid epitopes and a method of analysis of stem cells comprising said epitopes Download PDF

Info

Publication number
WO2009060129A1
WO2009060129A1 PCT/FI2008/050643 FI2008050643W WO2009060129A1 WO 2009060129 A1 WO2009060129 A1 WO 2009060129A1 FI 2008050643 W FI2008050643 W FI 2008050643W WO 2009060129 A1 WO2009060129 A1 WO 2009060129A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
sequences
antibodies
human
monoclonal antibody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/FI2008/050643
Other languages
English (en)
French (fr)
Inventor
Marja-Leena Laukkanen
Kristiina Takkinen
Jari Natunen
Tero Satomaa
Jaakko Parkkinen
Leena Valmu
Sari Tiitinen
Suvi Natunen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suomen Punainen Risti Veripalvelu
Glykos Finland Ltd
Original Assignee
Suomen Punainen Risti Veripalvelu
Glykos Finland Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suomen Punainen Risti Veripalvelu, Glykos Finland Ltd filed Critical Suomen Punainen Risti Veripalvelu
Priority to EP08847066A priority Critical patent/EP2209809A4/en
Priority to AU2008324073A priority patent/AU2008324073A1/en
Priority to CA2743032A priority patent/CA2743032A1/en
Priority to JP2010532633A priority patent/JP2011504099A/ja
Priority to US12/741,987 priority patent/US20100292095A1/en
Publication of WO2009060129A1 publication Critical patent/WO2009060129A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3076Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells against structure-related tumour-associated moieties
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966Animal cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2400/00Assays, e.g. immunoassays or enzyme assays, involving carbohydrates
    • G01N2400/10Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters

Definitions

  • This invention relates to antibody engineering technology. More particularly, the present invention relates to human glycan-binding antibodies and derivatives thereof, which bind specific oligosaccharide sequences including antigenic non-human glycans
  • the present invention also relates to processes for making and engineering such glycan-binding monoclonal antibodies and to methods for using these antibodies and derivatives thereof in the field of immunodiagnostics, enabling qualitative and quantitative determination of specific oligosaccharide sequences including antigenic non-human glycans in biological and raw material samples, as well as in immunotherapy, enabling blocking of antigenic glycans in patients, e.g., in context of a transplantation.
  • human natural antibodies are not well-known. It is realized that natural antibodies may be involved in protection against malignant condition such as cancer or even autoimmune conditions or pathogenic materials such as xenoantigenic glycans. It is realized that the specificities of the natural antibodies are useful of characterization of pathogenic condition caused their production. Furthermore novel antibodies and specificities are useful for the production and optimization of novel reagents.
  • Table 2 lists certain antibody type protein sequences, which may be related with parts of peptide sequences of heavy chain of 1.4.30, which may be involved in carbohydrate recognition, the most preferred target oligosaccharide sequences according to the invention have not been indicated. It is realized that the publications would not indicate the whole heavy chain 1.4.30 sequence nor the novel light chain sequences. It is further realized that the carbohydrate sequences have not been indicated to the other novel antibodies such as 1.4.24 or 1.4.11 or antibodies homologous to these.
  • Various cell based therapies are under development. Contamination of therapeutic cells with antigenic glycan and/or xenoantigenic materials has been recognized as major problem in the development of novel cell therapies.
  • the NeuGc has been known as a xenoantigen and an obstacle preventing xenotransplantation of organs for example from pig to human (WO02088351, Zhu, Alex), xenotransplantation is also under development by multiple biotech companies.
  • Antibodies against NeuGc have been published. The most published antibodies have been produced in chicken, which also lacks NeuGc-glycans like human. A method has been published for production of NeuGc-recognizing antibodies by affinity purification of chicken antibodies in column containing oxidized NeuGc lacking characteristic glycerol- radical side chain of sialic acids (Varki A et al. WO 2005010485). This method appears to be useful for purification of certain chicken antibodies.
  • the present invention is directed to production of human natural monoclonal antibodies including the binding activity towards the glycerol part of NeuGc. It is realized that monoclonal antibodies have benefit as reagents which can be characterized and produced reproducibly by regular biotechnical method.
  • the antibodies according to the present invention were revealed to recognize specific acid saccharide epitopes and NeuGc comprising a monosaccharide and oligosaccharide structuress and such structures also on human cells an proteins
  • NeuGc antibodies specific for the oligosaccharide glyco lipid structure NeuGc ⁇ 3Lac ⁇ Cer (GM3) has been reported. These studies appear not to represent pure human antibodies useful for analytic or therapeutic uses.
  • Neu5Gc recognizing P3 antibody binding specifically to NeuGc comprising GM3 ganglioside NeuGc ⁇ 3Gal ⁇ 4Glc ⁇ Cer or sialyl-type 2 N-acetyllactosamine glyco lipid NeuGc ⁇ 3Gal ⁇ 4GlcNAc ⁇ Gal ⁇ 4Glc ⁇ Cer has been known as natural mouse IgM antibody and as humanized antibody (WO9920656 Vasquez et al.). The antibody has been indicated as glyco lipid specific.
  • the present specificity excludes the type NeuGc ⁇ 3Gal ⁇ 4Glc(NAc) -wherein there is ⁇ 4-linkage in N-acetyllactosamine together with cc3-linkage for the sialic acid comprising sequences, further more P3 antibody has been reported exclusively NeuGc specific while present antibodies have sequence specific preferences for sialic acids.
  • the present invention reveals novel human antibodies with different peptide sequences on heavy chain and light chain with different specificities recognizing cc3-sialylated type 1 N- acetyllactosamine SA ⁇ 3Gal ⁇ 3 GIcNAc and cc6-sialylated type 2 N-acetyllactosamine SA ⁇ 6Gal ⁇ 4GlcNAc, with both Neu5Gc and Neu5Ac.
  • the unusual binding specificity further includes terminal sequence Neu5Accc6GalNAc, in a preferred embodiment in alfa- linked form as sialyl-Tn structure.
  • the present antibodies recognize preferred glycan structures on proteins and/or on proteins and glyco lipids and that the specificity does not require lipid structures in the target molecules.
  • the cc3-sialylated type 2 N-acetyllactosamines and lactoses SA ⁇ 3Gal ⁇ 4Glc(NAc) n have very low binding affinity to the present antibodies or are not recognized at all, indicating difference to the P3 type or GM3 specific antibodies.
  • the novel oligosaccharide sequence binding specificity is very different from the mostly ganglioside specificities in the background, including e.g. ones associated to sequences related to 1.4.30, especially heavy chain CDRl and CDR2 regions, more specifically FTFSSYAMS type sequences.
  • the heavy CDRl region has certain homology to P3 and 14F7 antibodies with totally different oligosaccharide binding specificities.
  • the light chain and heavy chain sequences provided by the present invention allow design and optimization of human antibodies having oligosaccharide binding activity/ies according to the invention.
  • the human antibodies are useful for immunodiagnostics and analysis or therapies in vivo and in vitro because they are not antigenic.
  • the present invention is directed to unusual binder reagent recognizing several different sequences from the surface of intact cells.
  • the recognition may involve large cell populations, an example showing almost 80 % labelling of stem cells, see fig 9.
  • the invention revealed the method especially useful for characterization of mesenchymal stem cells, especially preferred human blood related stem cells and in context of certain types of exogenous reagents and cell culture conditions or lack thereof.
  • human natural antibodies are more preferred for human applications than several known antibodies from animals with potential for harmful anti-antibody immune reactions and are more likely to recognize relevant structures from human glycans.
  • NeuGc binding antibodies distinctively recognise xenoantigenic epitopes, which would be useful in clinics or immunodiagnostics for detecting and determining immune reactions against such materials.
  • Production of monoclonal antibodies capable of specific binding of NeuGc- epitopes by conventional methodology such as hybridoma technology has been hampered by the presence of the structure as normal glycosylation in mice and most other animals.
  • Phage display technology has been applied in production of antibodies against certain human complex oligosaccharide structures, wherein the effective antigenic determinant covers several monosaccharide residues.
  • phage display or other human antibodies capable of effectively recognizing a single terminal monosaccharide with only minor variation of one proton substituted by a hydroxyl group such as in antibodies binding to NeuGc-glycans but not to NeuAc-glycans.
  • the present antibodies recognize effectively polyvalent high density conjugate of NeuGc - monosaccharide and other saccharides.
  • the antibodies were also shown to be useful for recognition of proteins and cells including human cells. This methodology is giving new tools to produce acid oligosaccharide and/or NeuGc-specif ⁇ c recombinant antibodies that can be produced in consistent quality for clinical and diagnostic applications.
  • human immunoglobulin preferably IgM
  • antibody fragments that bind specifically certain novel acidic oligosaccharides including cc3-sialylated type 1 lactosamines, SA ⁇ Gal/GalNAc- strutures, SA ⁇ 6Gal ⁇ 4GlcNAc and sialyl-Tn SA ⁇ GalNAc and certain monosaccharide epitopess including xenoantigenic NeuGc-saccharides or corresponding NeuGc-glycans, when the antibodies have affinity and specificity high enough to be utilised as reagents in immunoassays designed for the qualitative and quantitative measurement of the saccharides and NeuGc saccharides in biological samples and, in immunotherapy e.g.
  • the present invention describes selection of human antibodies specific to the saccharides and/or NeuGc by an antibody library method such as the phage display technique, and the characterisation of the binding properties of the engineered antibody fragments produced in E.coli.
  • This invention thus provides new reagents to be utilised in different kinds of immunoassay protocols, as well as human immunotherapy.
  • the invention also permits guaranteed continuous supply of these specific reagents of uniform quality, eliminating inherent batch- to-batch variation of polyclonal antisera. These advantageous effects permit the manufacture of new, specific and economical immunodiagnostic assays and therapeutic molecules of uniform quality.
  • one specific object of the present invention is to provide human monoclonal antibodies binding saccharides according to the invention, fragments thereof, chemical or non-covalent conjugates thereof, or other derivatives of such antibodies, which bind the acidic saccharides and/or in a preferred embodimentNeuGc-glycans with affinity and specificity which allow qualitative and/or quantitative measurement of the saccharides and/or NeuGc in biological samples, as well as their use in immunotherapy.
  • the monovalent and especially oligovalent antibodies of the present invention demonstrate a specific binding to the saccharides including xenoantigenic NeuGc -saccharides.
  • Another object of the present invention is to provide cDNA clones encoding specific oligosaccharide and/or NeuGc -saccharide specific antibody chains, as well as constructs and methods for expression of such clones to produce specific oligosaccharide and/or NeuGc -saccharide binding antibodies, fragments thereof or other derivatives of such antibodies.
  • the invention is further directed to the use of the nucleic acid sequences and the complementary nucleic acid sequences and homologues thereof with the similar capacity to bind and hybridize with the nucleic acid sequences a) for analysis of expression of the nucleic acid sequences b) for effecting the expression of the nucleic acid sequences.
  • a further object of this invention is to provide methods of using such specific saccharide and in preferred embodiment especially NeuGc -comprising saccharide binding antibodies, fragments thereof or other derivatives of such antibodies, or combinations of them for qualitative and quantitative measurement of specific saccharide and/or NeuGc saccharide in biological samples. Additionally, this invention provides specific saccharide and/or NeuGc-binding antibodies, fragments thereof or other derivatives of such antibodies, or combinations of them for immunotherapy in patients.
  • Figure 1 shows a schematic presentation of an intact human immunoglobulin antibody, Fab fragment and single-chain antibody (scFv).
  • the domain structure and valency of the antibody depends on the selected antibody class, for example IgM comprises a pentamer of divalent antibody structures.
  • the antigen-binding site is indicated by a triangle.
  • Figure 2 shows schematically the panning procedure.
  • Figure 3 The alignment of the deduced amino acid sequences of the VL region.
  • the Complementarity Determining Regions (CDRs) are boxed. Numbering is according to Kabat (Kabat et al. , 1991 ) .
  • Figure 4 The Alignment of the deduced amino acid sequences of the VH region.
  • CDRs Complementarity Determining Regions
  • FIG. 1 The cDNA of different VL regions.
  • the cDNA of the VL regions were isolated by phage display technology.
  • FIG. 6 The cDNA of different VH regions.
  • the cDNA of the VH regions were isolated by phage display technology.
  • FIG. 7 Homology of VH and VL regions at protein level. The amino acid sequence alignments in Fig. 3 and 4 were used for drawing the protein sequence tree.
  • the letter ⁇ at the reducing end of the saccharides, and a in the linkage structures, eg, Ca2,6) means (alfa2,6) alfa-Iinkage, and letter B at the reducing end of the .saccharides, and b in the linkage .structures mean beta anorneric structures.
  • Polyvalent polyacrylamide saccharide conjtsgates were from Lectinity Holdings Russia or were synthesized by ⁇ ialySu'an ⁇ fera ⁇ e reaction; * (en/yraes from Calbiochem) from these using OlP-Nei ⁇ c or CMP-Neu5Gc as donors and structures of glycans were verified by KMR spectroscopy.
  • FIG 11a The cDNA and protein sequences of scFv 1.4.19-3 (F3).
  • Applicants have other co-pending inventions about glycan marker structures of stem cells e.g. WO/2007/006864, WO 2008/107522, WO/2008/087259, WO/2008/087258, WO/2008/087257, WO/2007/006870, included fully as reference.
  • Binder molecules/reagents bind glycans and preferably include property allowing observation of the binding such as a label linked to the binder.
  • the novel glyears .specificity against the rigid glycan structures define structurally the conformation of reagents binding to the glycans, structures are available e.g. from internet pages of sweetdb, Vx eckib nukx.pbp.
  • the preferred binders include a) Proteins such as antibodies, lectins and en/yi ⁇ s b) Peptides such as binding domains and sites of proteins, and synthetic library derived analogs such as phage display peptides c) Other polymers or organic scaffold molecules mimicking tbe peptide materials including ap tamers and the like.
  • the peptides and proteins arc preferably recombinant proteins or corresponding carbohydrate recognition domains derived thereof, when the proteins arc selected from the group monoclonal antibody, glycosidase, glycosyl transferring en/yme, plant lectin, animal lectin or a peptide mimetic thereof, and wherein the binder includes a detectable label structure. It is realized that based on sequence data and molecular modelling it is possible to design binder molecules like the present antibodies. Antibodies and fragments there of are most preferred binder reagents. The following definitions are provided for some terms used in this specification. The terms, “immunoglobulin”, “heavy chain”, “light chain” and “Fab” are used in the same way as in the European Patent Application No. 0125023.
  • Antibody in its various grammatical forms is used herein as a collective noun that refers to a population of immunoglobulin molecules and/or immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site or a paratope.
  • Examples of molecules which are described by the term “antibody” herein include, but are not limited to: single chain Fvs (scFvs), Fab fragments, Fab' fragments, F(ab') fragments, disulfide linked Fvs (sdFvs), Fvs, and fragments comprising or alternatively consisting of, either a VL or a VH domain.
  • the immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), or subclass of immunoglobulin molecule.
  • an antibody of the invention comprises, or alternatively consists of, a VH domain, VH CDR, VL domain, or VL CDR.
  • an “antigen-binding site”, a “paratope”, is the structural portion of an antibody molecule that specifically binds an antigen.
  • Exemplary antibodies are those portions of an immunoglobulin molecule that contain the paratope, including those portions known as Fab and Fv.
  • Fab fragment with specific antigen binding
  • Fab fragments can also be produced by recombinant methods, which are well known to those skilled in the art. See, for example, U.S. Patent 4,949,778.
  • Domain is used to describe an independently folding part of a protein. General structural definitions for domain borders in natural proteins are given in Argos, 1988.
  • variable domain or “Fv” is used to describe those regions of the immunoglobulin molecule, which are responsible for antigen or hapten binding. Usually these consist of approximately the first 100 amino acids of the N-termini of the light and the heavy chain of the immunoglobulin molecule.
  • Single-chain antibody (scFv) is used to define a molecule in which the variable domains of the heavy and light chain of an antibody are joined together via a linker peptide to form a continuous amino acid chain synthesised from a single mRNA molecule (transcript).
  • Linker or "linker peptide” is used to describe an amino acid sequence that extends between adjacent domains in a natural or engineered protein.
  • a “NeuGc-binding antibody” is an antibody, which specifically recognises NeuGc and binds to it, due to interaction mediated by its variable domains. Specific recognition means higher binding activity towards specific saccharide in comparison to the corresponding control saccharide.
  • saccharide means monosaccharide or oligosaccharide epitope.
  • the saccharide epitopes are preferably non-reducing end terminal saccharides, which may be elongated preferably only from its reducing end. The elongation may be to a larger carbohydrate structure and/or elongation by linkage to a carrier such as a protein: a polymer including polyacrylamides, polypeptides, dendrimers or polysaccharides; or a lipid comprising a hydrophobic aglycon.
  • the preferred polymer structures further include natural and/or non- natural carbohydrate structures e.g in synthetic neoglycoproteins or neoglyco lipids or saccharide polymer conjugates comprising a linkage to monovalent aglycon structure or spacer to a carrier structure such as a polymer.
  • natural and/or non- natural carbohydrate structures e.g in synthetic neoglycoproteins or neoglyco lipids or saccharide polymer conjugates comprising a linkage to monovalent aglycon structure or spacer to a carrier structure such as a polymer.
  • preferred oligosaccharide epitopes include non- reducing end terminal oligosaccharide sequences, more preferably elongated oligosaccharide sequences, and natural the carrier structures are preferably natural glycoconjugates such as protein(s), including O-glycan and/or N-glycan structures linked to proteins and/or lipid structures such as glycosphingo lipids comprising a ceramide at the reducing end.
  • the epitopes may be in preferred embodiment part of polysaccharide such as branched bacterial polysaccharide, known and modifiable in prior art e.g. as described part of the inventors.
  • the saccharides are elongated solely form the reducing end furthermore the oligosaccharide sequences are preferably not modified or derived by any additional groups to any hydroxylgroup structure, which is not the reducing end.
  • the elongating structure may be a natural sequence of the natural glycan recognized such as O- glycan, N-glycan or glyco lipid (preferably glycospingo lipid) structure.
  • the single monosaccharide residues are linked by alfa- or beta-glycosidic linkage to a non- monosaccharide material such as spacer structures, preferably glycosidically linked alkyl spacer, linking glycans to polymers, in a preferred embodiment to polypeptides, dendrimers or polyacrylamides, more preferably polyacrylamides.
  • the invention revealed binding to both alfa- and beta linked sialic acids, preferably Neu5Gc and glucuronic acid, preferably GIcA with alfa or beta linkage.
  • the invention is further directed to the analysis of binding to GIcA in natural glycans comprising GIcA, especially glycosaminoglycans and/or glyco lipids.
  • the invention is further directed to the analysis of antibody binding to uronic acid containing monosaccharide residues in oligosaccharide sequences in the middle polysaccharide sequences such as in glycosaminoglycans.
  • Glyco lipid and carbohydrate nomenclature is essentially according to recommendations by the IUPAC-IUB Commission on Biochemical Nomenclature (e.g. Carbohydrate Res. 1998, 312, 167; Carbohydrate Res. 1997, 297, 1; Eur. J. Biochem. 1998, 257, 29).
  • Gal galactose
  • GIc glucose
  • GIcNAc N-acetylglucosamine
  • GaINAc N-acetylgalactosamine
  • Neu5Ac Neu5Ac
  • the amine group is as defined for natural galactos-and glucosamines on the 2-position of GaINAc or GIcNAc.
  • linkages of the sialic acid SA/Neu5X-residues cc3 and cc6 mean the same as cc2-3 and cc2-6, respectively, and with other monosaccharide residues ⁇ l-3, ⁇ l-3, ⁇ l-4, and ⁇ l-6 can be shortened as cc3, ⁇ 3, ⁇ 4, and ⁇ 6, respectively.
  • Lactosamine refers to type II N- acetyllactosamine, Gal ⁇ 4GlcNAc, and/or type I N-acetyllactosamine, Gal ⁇ 3 GIcNAc and sialic acid (SA) is N-acetylneuraminic acid (Neu5Ac) or N-glycolylneuraminic acid (Neu5Gc) or any other natural sialic acid including derivatives of Neu5X.
  • the sialic acid are referred together as NeuNX or Neu5X, wherein preferably X is Ac or Gc.
  • Ocassionally Neu5Ac/Gc/X may be referred as NeuNAc/NeuAc/NeuNGc/NeuGc/NeuNX.
  • Term glycan means here broadly oligosaccharide or polysaccharide chains present in human or animal glycoconjugates, especially on glyco lipids or glycoproteins.
  • Glycan epitope or epitopes mean oligosaccharide sequence and elongated epitope means reducing end elongated preferred oligosaccharide sequence variants.
  • Olet al. sequence means specific sequence of glycosidically linked monosaccharide residues, preferably including terminal and "core”sequences,
  • the core oligosaccharide sequences can be modified by non-reducing end monosaccharide residue(s).
  • terminal oligosaccharide sequence indicates that the oligosaccharide is not substituted to the non-reducing end terminal residue by another monosaccharide residue or residues.
  • the non-reducing end of the oligosaccharide sequence consists of the oligosaccharide sequence and it is only modified from the reducing end of the oligosaccharide sequence, preferably it is glycosidically conjugated from the reducing end.
  • the present invention thus provides derivatives of NeuGc and/or saccharide -binding antibodies, e.g. Fab fragments or scFv fragments. It will be appreciated that mutant versions of the CDR sequences or complete V L and V H sequences having one or more conservative substitutions which do not substantially affect binding capability, may alternatively be employed.
  • the novel antibody sequences were reproducibly produced from large pool on IgM genes from about 50 persons.
  • the invention revealed that the antibody sequences share substantial homology as shown for 4 antibodies in examples and in figures. It is realized that each antibody sequence is valuable as such natural type human antibody sequence recognizing the important antigen.
  • the present invention is directed to antibodies having substantial homology or similarity with sequences of light chain (VL) and/or of heavy chain (VH). It is realized that the sequence homologies are substantial on both protein and nucleic acid, such as cDNA-level.
  • the peptide (protein) sequences of the antibody domains are compared.
  • the present invention is directed to antibodies having substantial homology with sequences of light chain (VL) sequences in Fig.3 (or corresponding DNA in Fig.5, realizing that the exact homology % vary from the one defined for proteins), as shown in Fig. 7, all antibodies share protein level homology of about 50 %, more specifically at least about 49 %, three protein sequences 1.4.11, 1.4.24, and 1.4.30, referred as 1.4-group share even higher homology of at least about 90 %, more precisely at least 93 % for the specific sequences.
  • the analysis further reveals a preferred subgroup of 1.4.11 and 1.4.30 type antibodies even sharing about 95 %, more precisely about 97 % homology with each other, the homology being close to identity of the sequences.
  • the present invention is directed to antibodies having substantial sequence homology with sequences of heavy chain (VH) sequences in Fig.4 (or corresponding DNA in Fig.6, realizing that the exact homology % vary from the one defined for proteins), as shown in Fig. 7, all antibodies share protein level homology of about 50 %, three protein sequences 1.4.11, 1.4.24, and 1.4.30, referred as 1.4-group share even higher homology of at least about 80 %, more precisely at least 81 % for the specific sequences.
  • the analysis further reveals a preferred subgroup of 1.4.11 and 1.4.24 type antibodies even sharing about 85 % homology with each other.
  • the present invention is directed to methods of defining consensus sequences for specific saccharide recognizing and/or NeuGc antibodies by comparing the antibody sequences according to the invention and optionally other antibodies.
  • the present invention is further directed to methods of defining unusual characteristic sequences for specific saccharide and/or NeuGc antibodies or antibody groups by comparing the antibody sequences according to the invention and optionally other antibodies.
  • the present invention is especially directed to comparison of CDR-sequences, as shown for example in boxes in Figs. 3 and 4 for both light and heavy chains, as CDRs known to be essential for the binding properties of antibodies.
  • the invention is in a preferred embodiment directed to the following consensus sequences for light chains of 1.4 group antibodies:
  • CDRl TLRSGINVGX I X 2 RIY, wherein Xi is preferably A or T and X 2 is Y or S CDR2: KS XiSDKQQGS , wherein Xi is preferably N or D.
  • CDR3 MIWHX I X 2 AX 3 WV, wherein Xi is preferably S or N and X 2 is G or R and X 3 is W or V. It is noticed that the homology is high within the CDR-sequences.
  • An antibody of 1.4 group comprise all the characteristic light chain which preferably has CDRs similar or essentially similar to the CDRl -3 sequences.
  • the invention is in a preferred embodiment directed to following consensus sequences for light chains of 1.2.20 type antibodies: CDRl : GGDNLGGKSVH, CDR2: DDRDRPS, CDR3: QVWDSGSESVV, An antibody of 1.2.20 type comprise the characteristic light chain, which preferably has CDRs similar or essentially similar to the CDRl -3 sequences.
  • CDR2 residues 57-62: DZiXiX 2 X 3 S, wherein Xi is preferably D or Q; and X 2 is R, or Q; and X 3 is P, or G; and Zi is basic chain comprising polar amino acid residue, preferably Zi is R, or K.
  • CDR3, 98-102 ZiWXiX 2 X 3 , wherein Xi is preferably D or H; and X 2 is S, or N; and X 3 is G, or R; and Zi is an aliphatic chain comprising hydrophopic amino acid residues, preferably Zi is V or I.
  • Preferred CDR3 sequences further include ZiWXiSG, wherein Xi is preferably D or H; and Zi is V or I. This sequence is preferred common sequence for 1.2.20, 1.4.11 and 1.4.30.
  • Heavy chain consensus sequences The invention is in a preferred embodiment directed to the following consensus sequences for heavy chains of 1.4 group antibodies:
  • CDRl XiTFX 2 X 3 YX 4 MX 5 , wherein Xi is preferably I or F; and X 2 is R or S; and X 3 is K, or S, or R; and X 4 is A or S; and X 5 is N or S.
  • CDR3 XiX 2 X 3 X 4 XsXeXvDX 8 , wherein Xi is preferably R or M: and X 2 is P, K or N and X 3 is K or nothing; and X 4 is G or nothing; and X 5 is G, A, or nothing; and X 6 is G, or A; and X 7 is M, or F, and X 8 is V, or P or I.
  • An antibody of 1.4 group comprise all the characteristic heavy chain which preferably has CDRs similar or essentially similar to the preferably CDRl and CDR2 and most preferably all CDRl -3 sequences.
  • the invention is in a preferred embodiment directed to following consensus sequences for heavy chains of 1.2.20 type antibodies: CDRl : GTVNSYYWS, CDR2: RVYSSGTTNLNPS, CDR3: DYGTDY
  • An antibody of 1.2.20 type comprise the characteristic heavy chain, which preferably has CDRs similar or essentially similar to preferably CDRl and CDR2 and most preferably all the CDRl -3 sequences.
  • CDR2 X I Z I Z 2 X 2 SX 3 X 4 X 5 X 6 Z 3 Z 4 Z 5 Z 6 SZ 7 KZ 8 , wherein Xi is preferably R, A or S; and X 2 is N, G, or S; and X 3 is G, or S; and X 4 is T, S or G; and X 5 is nothing, D, S or Y; and X 6 is T or I; and, Zi is V, or I; and Z 2 is Y or S; and Z 3 is N or Y; and Z 4 is L or Y; and Z 5 is N or A; and Z 6 is P or A; and Z 7 is L or V; and Z 8 is S or G.
  • CDR3 XiX 2 X 3 X 4 X 5 X 6 X 7 DX 8 , wherein Xi is preferably D, R or M: and X 2 is Y, P, K or N and X 3 is K or nothing; and X 4 is G or nothing; and X 5 is G, A, or nothing; and X 6 is G, or A; and X 7 is T, M, or F; X 8 is Y, V, or P or I.
  • Preferred heavy chain CDR3 sequences include the conserved D residue at second last position.
  • the conserved CDR protein or nucleic acids such as DNA sequences are useful for the recognition of the antibodies or corresponding nucleic acid expression in assays such as assays by specific saccharide entigens or antibodies recognizing the protein sequences and/or by RNA/DNA analysis such as PCR analysis for recognition of the corresponding nucleic acid expression.
  • the data reveals that especially the three protein sequences the 1.4-group, share large sequence homology forming a homogeneous group of antibodies with some specific characteristics for each antibody.
  • the similarities allow analysis of conserved structures of the 1.4-group of antibodies.
  • the invention is directed to the 1.4- group antibodies as a preferred type of saccharide and NeuGc-recognizing antibodies, and use of the antibody protein or nucleic acid sequence(s) for comparative analysis of other potentially saccharide and NeuGc-recognizing antibodies.
  • the sequence 1.2.20 has distinct sequence, but shares some specific sequence characteristics similar with the 1.4-group.
  • the invention is directed to 1.2.20 type antibodies as a preferred type of saccharide and NeuGc-recognizing antibodies, and use of the antibody protein or nucleic acid sequence for comparative analysis of other potentially saccharide and NeuGc-recognizing antibodies.
  • the similarities between the four sequences allow analysis of conserved structures of the 1.4-group of antibodies and the 1.2.20 like antibodies.
  • the present invention is further directed to methods of comparing the antibodies according to the invention either structurally and/or functionally with known antibodies, preferably antibodies, which are likely to have similar structure and/or function.
  • the invention is especially directed to comparison the antibodies with known NeuGc recognizing antibodies such as known polyclonal antibodies produced in chicken or known NeuGc- recognizing monoclonal antibodies such as antibodies cloned from human described by Furukawa et al.
  • the functional binding of the antibodies is preferably compared for the binding with the polyvalent conjugate used in the present invention and/or protein and/or lipid bound saccharide or NeuGc-comprising structures present on cell materials.
  • the protein binding of present antibodies and possible comparison antibodies can be performed by any suitable protein interaction method, and is preferably performed by a solid phase assay method such as Western-blot method.
  • the invention is further directed to the comparison of the sequences, preferably the protein sequences, of the present antibodies with other antibody sequences, preferably from antibodies, which are likely to have similar structure and/or function.
  • the preferred antibodies with similar function include acid carbohydrate recognizing antibodies, preferably carboxylic acid comparising carbohydrate such as GIcA or Sialic acid, and more preferably sialylated carbohydrate, and in a preferred embodiment NeuGc -carbohydrate recognizing antibodies.
  • the invention is directed to method of comparing antibody sequences associated with these diseases, preferably human antibody sequences from cancer and/or autoimmune diseases and preferably selecting antibody sequences with homology % with regard to heavy and/or light chains, in range of preferred antibodies/antibody groups according to the invention and preferably testing such antibody/antibodies with regard to binding to NeuGc comprising carbohydrate. It is realized that such experiments are very useful for revealing causes of and designing potential treatments for the diseases.
  • the antibody sequence for comparison is cloned from a person who has had a blood contact with NeuGc material, such as transplantation/injection with biological reagent or material comprising NeuGc, preferred transplantation is organ/tissue transplantation with material comprising NeuGc, preferred organ transplantation further includes stem cell transplantation with possibility of contamination with NeuGc.
  • NeuGc material such as transplantation/injection with biological reagent or material comprising NeuGc
  • preferred transplantation is organ/tissue transplantation with material comprising NeuGc
  • preferred organ transplantation further includes stem cell transplantation with possibility of contamination with NeuGc.
  • the present invention revealed a library of monoclonal antibodies with novel and useful monosaccharide and oligosaccharide binding specificities.
  • the antibodies have binding specificity profile, which is useful for the analysis of multiple cell types especially human cells.
  • the binding specificity includes several useful glycan types, part of which are specific for the subtypes of cells.
  • the invention is in a preferred embodiment directed to selecting an antibody from the present antibodies for the binding of specific subtype of human cells. It is further realized that the antibodies are useful for the sorting of the cells.
  • the invention further reveals that there is substantial homology in part of the heavy chains of the present antibody (/antibodies) with antibodies recognizing important antigenic structures in context of cancer and/or autoimmune diseases.
  • the specificities of antibodies cannot be produced directly from the sequences, especially when the three dimensional structures are not known.
  • the present invention reveals that there are novel carbohydrate binding specificities among the antibodies which comprise heavy chain CDRs according to the invention, especially CDRl and CDR2, according to the invention, especially in the antibodies homologous to 1.4.24.
  • the present invention provides methods for revealing the carbohydrate specificities of antibodies recognizing especially acidic monosaccharide residue comprising structures such as sialic acids (Neu5Gc and Neu5Ac) and glucuronic acid comprising structures.
  • the invention is directed to the method of analysis of disease associated or a cell binding antibody, preferably human antibody, wherein the method includes step of measuring the specificity of the antibody towards the saccharides including the monosaccharide and oligosaccharide sequences according to the invention.
  • the binding of the antibody is measured with regard to at least oligosaccharide sequences, and more preferably at least to two key oligosaccharide sequence, more and most preferably to three key oligosaccharide sequences according to the invention.
  • the antibody binding to the control saccharides, according to the invention including preferably at least one, more preferably at least two and most preferably at least three control oligosaccharide sequences is measured.
  • the preferred analysis method includes step of contacting an antibody with the preferred saccharide sequence or sequences according to the invention.
  • Further preferred step includes measuring the complex formed between the saccharide and the antibody.
  • the preferred methods for observing the complex includes methods for measuring distance of molecules such as fluorescence method including FRET, and methods of removing non-bound reagent from the assay, such as washing the non-bound reagent such as the antibody and measuring the bound reagent such as the antibody by standard methods including detection methods such as enzyme, fluorescence or radiolabel based methods, the preferred enzyme linked assays includes ELISA assays. It is realized that the assay may be a solid phase assay.
  • Monosaccharide binding specificities The analysis revealed that novel antibodies have affinity towards monosaccharide residues, when analysed as polyacrylamide conjugates comprising flexible spacer structures: Neu5Gc ⁇ , GlcA ⁇ , GlcA ⁇ , GalNAc ⁇ , GalNAc ⁇ . It is realized that recognition of these monosaccharide residues as terminal parts of oligosaccharide chains may require similar flexible representation of the structures, especially for Neu5Gc.
  • Several neutral non- reducing terminal monosaccharide residues especially alfa- and beta linked GIc, Man, GlcNAc ⁇ -, Gal ⁇ - and Fuc ⁇ - were practically negative in the binding experiments, Fig 8. The best binding was to the acid monosaccharide residues glucuronic acid and Neu5Gc sialic acid.
  • the oligosaccharide binding specificities revealed binding to several Neu5Ac comprising oligosaccharide sequences.
  • the invention is in a preferred embodiment directed to the development of antibodies for the recognition of sialic acid comprising glycans and more preferably antibodies specific for Neu5Ac or Neu5Gc comprising glycans.
  • Neu5Gc comprising glycans
  • the invention is directed to novel antibodies binding more strongly (recognizing more specifically) Neu5Gc than Neu5Ac oligosaccharide sequence.
  • the Neu5Gc oligosaccharide sequence bound/recognized is type 1 N-acetyllactosamine sequence Neu5Gccc3Gal ⁇ 3GlcNAc.
  • Neu5Gc ⁇ 3Gal ⁇ 3 GIcNAc is recognized by more efficiently than Neu5Ac ⁇ 3Gal ⁇ 3GlcNAc, preferably in an ELISA-type assay.
  • Neu5Ac comprising glycans
  • the invention is directed to novel antibodies binding more strongly (recognizing more specifically) Neu5Ac than Neu5Gc oligosaccharide sequence, more preferably the antibody binds to Neu5 Ac but much weakly or practically not at all to Neu5Gc.
  • the Neu5Ac oligosaccharide sequence bound/recognized is sialylated non-reduging end terminal Neu5Accc6GalNAc-structure, more preferably sialyl-Tn sequences Neu5Accc6GalNAc ⁇ . It is realized that selective recognition of Neu5Ac structure is also a useful property for an antibody, and it is in a preferred embodiment used for differentiation between human and animal glycan structures.
  • the invention revealed highly specific recognition of a few important key oligosaccharide sequences a) cc3 -sialylated type 1 N-acetyllactosamine sequence SA ⁇ 3Gal ⁇ 3 GIcNAc, wherein
  • SA is Neu5Gc or Neu5Ac, more preferably Neu5Gc ⁇ 3Gal ⁇ 3 GIcNAc, or even more preferably Neu5Gc ⁇ 3Gal ⁇ 3 GIcNAc is recognized or bound with higher affinity than Neu5Ac ⁇ 3Gal ⁇ 3GlcNAc.
  • ⁇ 6-sialylated type 2 N-acetyllactosamine sequence SA ⁇ 6Gal ⁇ 4GlcNAc wherein SA is Neu5Gc or Neu5Ac, including Neu5Ac ⁇ 6Gal ⁇ 4GlcNAc, and Neu5Gc ⁇ 6Gal ⁇ 4GlcNAc.
  • a preferred target recognized with higher affinity is Neu5Ac ⁇ 6Gal ⁇ 4GlcNAc.
  • the invention further revealed useful control oligosaccharide sequences, with much lower or no binding to the antibodies including: cc3-sialylated type II N-acetyllacotsamines and lactoses SA ⁇ 3Gal ⁇ 4Glc(NAc) n , wherein SA is Neu5Gc or Neu5Ac and n is 0 or 1.
  • SA is Neu5Gc or Neu5Ac and n is 0 or 1.
  • binding specificities and combinations thereof are novel for human monoclonal antibodies, especially for natural monoclonal human antibodies. It is realized that presence of multiple but highly selective glycan recognitions by human monoclonal antibody is somewhat unusual. Furthermore it is realized that due to species specificity of glycosylation, antigenicity of a structure cannot be known from results from experiments from other species such as mice, rats or rabbits commonly used in immunizations. In case of polyclonal antisera, the actual binding specificity can not been derived from results with polyclonal antibodies and antisera.
  • the antibody binding mono- or oligosaccharide structures or epitopes thereof according to the invention may be part of larger oligosaccharide sequences, which would be recognized with higher or lower affinity than the present oligosaccharide epitopes.
  • the present invention is directed to screening of other glycans, especially with larger oligosaccharide sequences present on natural glycolipids or glycoproteins, in a binding assay including step of comparing the binding of the antibody to the other saccharide with the mono-or oligosaccharide structure according to the present invention, preferably including at least one novel binding sequence according to the present invention.
  • the invention is directed to the methods of changing of the antibody specificities for development of new antibodies by changing the peptide sequences of the antibodies in the variable regions by mutagenesis methods and/or by replacing the one or more variable CDR-sequences or parts thereof from one antibody by corresponding sequence from another antibody.
  • the mutagenesis method is combined with the carbohydrate binding assay according to the invention and the binding of the modified antibodies to specific acid glycan structures according to the invention is measured to reveal the altered specificity.
  • Novel protein expressed or protein/and lipid expressed target glycans In a preferred embodiment the present invention is directed to development and analysis of antibodies recognizing protein type glycan target sequences. The invention revealed that there is binding to sialyl-Tn sequence NeuNAc ⁇ GalNAc ⁇ , which is present on mucin type glycoproteins. The invention is directed to human monoclonal antibodies recognizing the structure, especially antibodies comprising consensus sequences or substantial homology with present antibodies.
  • cc3-sialylated type 1 N-acetyllactosamine sequence SA ⁇ 3Gal ⁇ 3 GIcNAc and ⁇ 6-sialylated type 2 N-acetyllactosamine sequence SA ⁇ 6Gal ⁇ 4GlcNAc can be presented both by proteins and glyco lipids.
  • the invention is directed to the use of the antibodies for analysis of the structures from protein and lipids.
  • the invention is further directed to human monoclonal antibodies recognizing the structure, especially antibodies comprising consensus sequences or substantial homology with present antibodies.
  • the present invention is especially directed to novel antibodies, preferably human antibodies, and further development and assays thereof directed to these, when the antibodies recognizes Neu5Ac or Neu5Gc on protein linked glycans.
  • the present invention is directed to human natural antibodies binding to protein linked Neu5Gc saccharide sequences.
  • the invention is directed to the analysis of binding of natural human antibody to saccharide sequences according to the invention, preferably Neu5Gc comprising oligosaccharide sequences, when the saccharide sequences are linked to proteins.
  • the invention is directed to the analysis of binding of natural human antibody to saccharide sequences according to the invention, preferably Neu5Gc comprising oligosaccharide sequences, when the saccharide sequences are linked to lipids.
  • the invention is especially directed to analysis of binding to lacto- and neolactoseries gly co lipids comprising the terminal epitopes according to the invention.
  • Neu5Gc linked oligosaccharide can be present on glycoproteins which may get to contact with human in therapeutic or nutrition contexts and cause immune reactions.
  • the invention is directed to analysis of human antibodies against the oligosaccharide sequences according to the invention, when the oligosaccharide sequences are linked to a therapeutic protein, preferably a therepautic recombinant protein.
  • the antibody to be measured in assay according to the invention has homology to the antibodies according to the invention. It is realized that homology to present amino acid sequences can be used a method step of selecting antibodies for saccharide binding analysis according to the invention.
  • the antibody has at least one variable region according to the concensus sequence according to the invention, or has sequecne at least 70%, more preferably at least 80 % and most preferably at least 90 % homologous or comprise only two or more preferably only one different amino acid residue, in a preferred embodiment the different amino acid residue is an amino acid, with similar charge or hydrophobicity with the amino acid in the sequence according to the invention. Analysis of linkage specificities
  • the invention is further directed to the testing of present antibodies and optional comparison antibodies with regard to binding to sialic acids, preferably NeuGc, comprising carbohydrates, which have different sialic acid linkage structures such as cc3-, and/or cc6-, and/or ⁇ 8-linkage, and preferably controlling the experiment with corresponding NeuAc- comprising glycoconjugates.
  • sialic acids preferably NeuGc
  • carbohydrates which have different sialic acid linkage structures such as cc3-, and/or cc6-, and/or ⁇ 8-linkage
  • Preferred carbohydates to be tested include any saccharides potentially comprising any of the terminal oligosaccharide sequences according to the invention and/or terminal oligosaccharide sequences not recognized by the antibodies.
  • the invention is especially directed to the antibodies especially for the studies and analysis of all types of natural acid glycans, more preferably sialylated glycans and/or glucuronic acid comprising glycans and materials, even more preferably natural materials comprising these.
  • the carbohydrates to be analyzed are glycans on natural glycoconjugates such as on glycoproteins such as O-glycans and/or N-glycans or on glyco lipids such as glycosphingo lipids comprising glycans linked to ceramide.
  • the terminal disaccharide or oligosaccharide epitopes recognized by the antibodies according to the invention are preferred as terminal oligosaccharide epitopes as part of glycans or when corresponding sequence is present as a whole (natural) glycan such as Tn antigen, the antibody recognizes preferably essentially whole glycan (at least partially all monosaccharide residues in the sequence) and optionally further part of the carrier structure.
  • the oligosaccharide specificity allows analysis of the natural mammalian glycoconjugates, in a preferred embodient the glyconjugates preferably glycoproteins and/or glyco lipid, are present on a cell and/or tissue material, more preferably on cell materials such as isolated cells and/cultivated cells.
  • similar human monoclonal antibodies can be produced by similar methods from human antibody phage display libraries. It is realized, that similar antibodies can be produced by changing single amino acid residues, which are not essential for the antibody binding, or can be changed to allow similar binding.
  • the changing of amino acid residues is preferably performed by regular recombinant DNA technologies producing single mutations or producing libraries of mutated protein sequences and screening the sequences for the binding to NeuGc comprising carbohydrate structures.
  • the invention is directed to the use of known similarity of certain amino acid residues such as residues with similar side chain properties such as hydrophilic/hydrophobic structure, size, charge, or aromatic structure, for design and/or production of the mutations and variants of the present antibodies.
  • the invention is directed to methods of defining the three dimensional structures of the antibodies by molecular modelling and/or X-ray crystallography and/or NMR-methods, preferably the structure is produced in complex with a specific saccharide or NeuGc- residue comprising carbohydrate structure.
  • the invention is further directed to defining the complex and use the information for further designing experiments for mutagenesis of the antibody sequences and developing the specificity and/or affinity of the antibodies to specific saccharides and/or NeuGc comprising structures by mutagenesis of the amino acid residues of the antibody.
  • the natural sequences according to the invention and their possible close homologues from human antibody display libraries are preferred for various human uses e.g. in human in vivo or for in vitro diagnostics avoiding cross-reaction from human serum antibodies with alternative non-human antibodies. It also realized that the present antibodies or their ligand binding sequences in chimeric forms with animal antibody frame are preferred for use in animal trials in order to study the biological activities of the antibodies, having advance due to fact that the antibody sequences are recognizable from the natural antibodies of the test animal species.
  • antibodies and antibody derivatives of the invention may be labelled.
  • any type of label conventionally employed for analytic or diagnostic antibody labelling is acceptable.
  • antibodies and antibody derivatives of the invention may be labelled with a therapeutic molecule.
  • any pharmaceutically acceptable label conventionally employed for therapeutic antibody labelling is appropriate.
  • the antibody/antibody conjugate is preferably not cytotoxic.
  • Non-immunogenic antibody fragments such as Fab- fragments or scFv-type fragments, may be used for blocking binding of autoimmunity reaction suffering or transplanted tissue by natural NeuGc antibodies to antigenic NeuGc- structures.
  • antibodies and antibody derivatives of the invention may be labelled.
  • any pharmaceutically acceptable imaging label conventionally employed for antibody labelling is appropriate.
  • antibody is conjugate at a site away from the antigen binding site.
  • the conjugation is in a preferred embodiment performed from a glycan, preferably N-linked glycan of an antibody, such as a Fc-domain N-glycan or from a glycan produced to novel glycosylation site produced by mutagenesis.
  • N-or C- terminal of the polypeptide remote from the variable regions preferably terminus comprise a structure which can be chemically modified, without harming the protein structure, such as N-terminal serine residue, which can be oxidized (similarly as glycans) and the conjugated specifically by aldehyde reactive reagents such as hydrazine or aminooxy- reagents, which are linked to therapeutic or diagnostic molecular structure.
  • the therapeutic or diagnostic molecular structure is preferably a cytotoxic, or a radioactive, or a prodrug/prodrug releasing molecule for therapy; or for analytic uses e.g. an ELISA reagent, a photoactivable molecule for optical analysis, biotin for avidin/strepavidin labellings, or a radioactive or NMR/MRI-active molecule for in vivo imagining.
  • the present invention also provides DNA molecules encoding an antibody or antibody derivative of the invention, and fragments of such DNAs, which encode the CDRs of the V L and/or V H region.
  • a DNA may be cloned in a vector, more particularly, for example, an expression vector which is capable of directing expression of antibody derivatives of the invention, or at least one antibody chain or a part of one antibody chain.
  • host cells are provided, selected from bacterial cells, yeast cells, fungal cells, insect cells, plant cells and mammalian cells, containing a DNA molecule of the invention, including host cells capable of expressing an antibody or antibody derivative of the invention.
  • antibody derivatives of the invention may be prepared by culturing host cells of the invention expressing the required antibody chain(s), and either directly recovering the desired protein or, if necessary, initially recovering and combining individual chains.
  • the above-indicated scFv fragments were obtained by biopanning of a human IgM scFv- phage library using xenoantigenic recombinant NeuGc.
  • the human IgM scFv-phage library was constructed from mRNAs isolated from lymphocytes of 50 healthy blood donors.
  • the variable region of the light and heavy chain cDNAs were synthesised using human IgM-specif ⁇ c primers for Fd cDNAs and human kappa (K) and lambda ( ⁇ ) light chains using human K and ⁇ chain specific primers.
  • variable regions of the light and heavy chains were amplified by PCR using human K and ⁇ chain specific primers for VK and V ⁇ cDNAs and human IgM specific primers for V H CDNAS, respectively.
  • the human IgM scFv library was constructed by cloning the variable region cDNAs into a scFv phage display vector using restriction sites introduced into the PCR primers.
  • the human IgM scFv library was selected by phage display using a panning procedure.
  • the human IgM scFv phage library was screened by a biotinylated xenoantigenic recombinant NeuGc in solution and the binders were captured on streptavidin. The elution of phages was done with 100 mM HCl (pH 2.2) followed by immediate neutralisation with 2 M Tris solution. The phage eluate was amplified in E. coli cells. After 4 rounds of biopanning, soluble scFv fragments were produced from isolated phages. The binding specificity of the selected scFv fragments was analysed by ELISA. Several saccharide and/or NeuGc-specific scFv fragment clones were obtained.
  • the phage display technique is an efficient and feasible approach to develop human IgM recombinant anti-saccharide and/or anti-NeuGc antibodies for diagnostic and therapeutic applications.
  • the invention is directed for the selecting of an antibody fragment from a phage display antibody library, when the display library of antibody fragments is selected as non-binding towards non-reducing end single terminal NeuAc ⁇ -conjugate and as the binding to non- reducing end single terminal NeuGc ⁇ -conjugate.
  • the conjugates for the selection are immobilized.
  • said NeuAc ⁇ - non-binding conjugates are first selected out of the phage library and then NeuGc ⁇ -binding clones are selected from the library. It is realized that antibody libraries can be constructed in various ways, in a preferred embodiment the library is a scFv-library.
  • the present invention revealed novel useful method of selecting an antibody fragment from a library of human antibodies, preferably form a library derived from multiple persons, more preferably the library is derived from at least about 50 persons.
  • the library shown in the examples is derived from blood cells of about 50 healthy blood donors. Due to large number of donors the library is likely to contain practically all possible human antibodies against the single terminal NeuGc ⁇ -residues.
  • the antibody libraries give same clones from multiple selections indicating that the method is reproducible.
  • the selection in the examples was performed from a library of IgM antibodies.
  • the present invention is preferably directed to selection of IgM-antibodies for production/discovery of anti-NeuGc-antibodies. There are typically differences between IgM and other antibody types because of "maturation" antibodies.
  • the IgM-antibodies are also naturally decavalent and the present selection method was designed to mimic the natural oligovalent recognition of NeuGc by using phages displaying the antibody fragments in oligovalent form.
  • the invention indicates that the antibodies according to the present invention are useful for recognition of the polyvalent clustered saccharide or NeuGc-structures with polyvalent binders astufted IgM but also for recognition of monovalent epitopes by FAb type reagents.
  • the other antibody types are typically divalent and likely less useful for oligovalent recognition of antigens.
  • the antibody fragments are selected against polyvalent conjugates of NeuAc ⁇ and NeuGc ⁇ .
  • both structures are preferably conjugated to the same carrier structure.
  • the invention is specifically directed to antibodies which can recognize clustered oligovalent epitopes of NeuGc. It is notable that previous works about NeuGc-recognizing antibodies are describe binding to unimolecular glyco lipid structures, which contain single NeuGc-residue or two NeuGc-residues in structure very close to each other like in structure NeuGc ⁇ 8NeuGccc3Gal ⁇ 4Glc ⁇ Cer. It is further realized that present antibodies are useful for recognition of the glycan structures also from other glyco conjugates than glyco lipids as the screening was performed against the non-reducing end terminal structure.
  • the preferred polyvalent conjugates have a distance between sialic acid residues of less than about 20 atomic bonds but more than about six atomic bonds.
  • the polyvalent polyvalent conjugate comprises preferably flexible polyamide structure, more preferably a polyacrylamide structure. Flexible indicates that the structure comprises spacers with methylene structures. Preferably NeuAc ⁇ /NeuGc ⁇ is linked to three carbon spacer, being preferably a methylene-radical, further conjugated to the polyacrylamide back bone.
  • Polyvalent acrylamide conjugates can be synthesized chemically as described by Bovin N. 1998, polyvalent polyacrylamide conjugates are commercially available from reagent supplier such as Sigma Co. St Louis, USA or Syntesome, Russia. The invention further directed to antibodies discovered by selection from human antibody libraries according to the invention.
  • the antibodies according to the invention revealed binding specificity to xenoantigenic non-reducing end single terminal NeuGc ⁇ , but not binding non-reducing end single terminal NeuAc ⁇ , when analyzed with polyvalent monosaccharide conjugates. It is notable that certain antibodies recognize sialic acids in non-terminal positions such as in oligo- or polysialic acids NeuGcoc8NeuGcoc3 Gal ⁇ 4Glc ⁇ Cer, and not as terminal non-reducing end residues, for example the antigens used for purification of chicken polyclonal antibodies of Varki and colleagues were truncated with regard to the glycerol structure and thus would allow recognition of terminally modified and/or elongated NeuGc-structures.
  • the present invention revealed good binding active antibodies selected for non-reducing terminal NeuGc ⁇ .
  • the effective recognition does not require additional modifications but it is affected by the carrier structures or elongation by other NeuGc-residue, and thus the epitope is referred as single terminal NeuGc ⁇ , including the terminal monosaccharide residue conjugated to a carrier.
  • the antibodies have binding specificity, which allows recognition of human cells containing certain acidic saccharides and/or non-reducing terminal NeuGc epitopes. This is in contrast to previously published human antibodies one of which did recognize terminal non-reducing end NeuGc on glyco lipids but not on human cells and one which did not recognize terminal non-reducing end NeuGc on glyco lipids but apparently not on proteins but bound human cells grown in fetal bovine serum.
  • the invention describes for the first time phage display or other human antibodies capable of effectively recognizing a single terminal monosaccharide with only minor variation of one proton substituted by a hydroxyl group such as in antibodies binding to NeuGc-terminal monosaccharide residue but not to NeuAc- terminal monosaccharide residue.
  • the high monosaccharide level selectivity has not been described for human or any other NeuGc antibody selected for binding complete NeuGc-residue.
  • the unique monosaccharide selectivity was further studied with two other human terminal monosaccharide residues conjugated as the sialic acids and with difference of single epimeric position, which did not yield similar selective antibodies.
  • the phage display system produces natural type human antibodies. These should be more easily acceptable for human use than animal antibodies or humanized animal antibodies, which contain structures unnatural in human.
  • the antibodies of the present invention recognize effectively polyvalent high density/ clustered conjugate of NeuGc (described above) and it is in a preferred embodiment used in a clustered oligovalent form such as in tri- to decavalent forms mimicking the recognition of human IgM or produced as human IgM-antibody by methods known in the art, e.g. Volmers et al., OncoMAb(TM), Germany.
  • the antibodies are also effective as monovalent Fab type or single chain antibodies, though in general the affinities of the FAbs IgM antibodies recognizing glycans are very low. It is notable that most of the antibodies in background are of different type involving different specificity and usually only divalent structures.
  • the invention is further directed to nucleic acid sequences corresponding to the antibody sequences including all variants of genetic code. These are well-known to any person skilled in the art.
  • the present invention is especially directed to the human natural nucleic acid sequences coding the antibodies.
  • the invention is further directed to the complementary nucleic acid sequences for the human natural nucleic acid sequences.
  • the invention is further directed to the use of the nucleic acid sequences and the complementary nucleic acid sequences and homologues thereof with the similar capacity to bind and hybridize with the nucleic acid sequences a) for analysis of expression of the nucleic acid sequences b) for effecting the expression of the nucleic acid sequences.
  • a preferred group of preferred nucleic acid homologues includes peptide nucleic acids.
  • the preferred nucleic acid sequence analysis includes cloning and sequencing of the nucleic acid sequences, and analysis by hybridization methods and by PCR-methods such as RT- PCR methods.
  • the invention is especially directed to the analysis of the nucleic acid in context of analysing a human immune reaction against specific saccharides and/or NeuGc, preferably in the context of immune reaction against transplant, more preferably in context of cell transplant or xenotransplant, when there is reason to believe that the transplanted material comprise specific saccharides and/or NeuGc.
  • the invention is further directed to the analysis of the nucleic acids according to the invention from a person in the context of a nutritional change in the amount of NeuGc in food.
  • the development and characterisation of the specific saccharide and/or human NeuGc- binding recombinant antibodies and their usefulness in immunoassays is now described in more detail in the following examples.
  • the invention is specifically directed to the use of the antibodies for analysis of cells and tissues.
  • Preferred cells and tissues to be analyzed include cell materials of animal origin or materials, which have been in contact with animal material containing NeuGc.
  • the invention revealed that the present antibodies are useful and preferred for analysis of acidic glycans and/or NeuGc-structures of the invention from animal cell or animal cell/tissue derived materials such as pig cells or proteins.
  • the invention is especially directed to human monoclonal antibody that binds to terminal non-reducing end oligosaccharide sequences:
  • sialylated non-reducing end terminal Neu5Accc6GalNAc-structures preferably sialyl-Tn sequences Neu5Accc6GalNAc ⁇ . and/or terminal non-reducing end monosaccharide residues:
  • oligosaccharide sequences according to SA ⁇ 3Gal ⁇ 4Glc(NAc) n , wherein SA is Neu5Gc or Neu5 Ac and n is 0 or 1.
  • the invention is especially directed to the unique antibodies with specificities combining the preferred oligosaccharide binding specificities.
  • the specificites includes at least terminal non-reducing end oligosaccharide sequences:
  • SA is Neu5Gc or Neu5Ac, said sequence being preferably Neu5Gc ⁇ 3Gal ⁇ 3 GIcNAc and 2) SAcc6Gal(NAc)n, wherein SA is sialic acid, preferably being Neu5Gc or Neu5Ac and n is 0 or 1.
  • the second group represent similar a6-linked sialic acid structures, which is unusual specificity together with the cc3-sialic aicd binding.
  • the preferred binding to oligosaccharide sequences SAcc6Gal(NAc)n includes cc6- sialylated type 2 N-acetyllactosamine sequence SA ⁇ 6Gal ⁇ 4GlcNAc, wherein SA is Neu5Gc or Neu5Ac, and sialylated non-reducing end terminal Neu5Accc6GalNAc-structures, preferably sialyl-Tn sequence Neu5Accc6GalNAc ⁇ .
  • the specificity is further characterized by specificity with regard to polymer conjugated sialic acid residues and non- binding or very low binding activity oligosaccharide sequences as shown in examples, especially including a3-sialylated lactose and type II N- acetyllactosamine.
  • Terminal non-reducing end monosaccharide residues further include:
  • the preferred antibody binds to both cc3-sialylated type 1 N-acetyllactosamine sequences
  • Neu5Gc ⁇ 3 ⁇ 3Gal ⁇ 3GlcNAc and Neu5Ac ⁇ 3 ⁇ 3Gal ⁇ 3 GIcNAc, and wherein the antibody binds to terminal non-reducing end epitopes sialyl-Tn sequences
  • Neu5Ac ⁇ 6Gal ⁇ 4GlcNAc with higher affinity than Neu5Gc ⁇ 6Gal ⁇ 4GlcNAc, and/or more effectively to Neu5Gc ⁇ 3Gal ⁇ 3 GIcNAc than Neu5Ac ⁇ 3cc3Gal ⁇ 3 GIcNAc and/or not to
  • the invention is further directed to a monoclonal antibody, wherein the antibody binds to cc3-sialylated type 1 N-acetyllactosamine sequence SA ⁇ 3Gal ⁇ 3 GIcNAc, wherein SA is Neu5Gc or Neu5Ac, preferably more effectively Neu5Gc ⁇ 3Gal ⁇ 3 GIcNAc; and/or wherein the antibody binds to both Neu5Gc ⁇ 3Gal ⁇ 3 GIcNAc and Neu5Ac ⁇ 3Gal ⁇ 3 GIcNAc
  • the invention is further directed to a monoclonal antibody, wherein the antibody binds to ⁇ 6-sialylated terminal non-reducing end epitopes according to the formula SAcc6Gal(NAc)n, wherein SA is sialic acid, preferably being Neu5Gc or Neu5Ac
  • the invention is further directed to a monoclonal antibody, wherein the antibody binds to terminal non-reducing end epitopes Neu5Accc6GalNAc, preferably sialyl-Tn sequences Neu5Ac ⁇ 6GalNAc ⁇ .
  • the invention is further directed to a monoclonal antibody, wherein the antibody binds to both ⁇ 6-sialylated type 2 N-acetyllactosamine including Neu5Ac ⁇ 6Gal ⁇ 4GlcNAc, and Neu5Gc ⁇ 6Gal ⁇ 4GlcNAc.
  • the invention is further directed to a monoclonal antibody, wherein the antibody binds to terminal non-reducing end epitopes Neu5 Ac ⁇ 6Gal ⁇ 4GlcNAc with higher affinity than Neu5Gccc6Gal ⁇ 4GlcNAc.
  • the affinities are in a preferred embodiment measured by ELISA assay as described in the invention.
  • the invention is further directed to a monoclonal antibody, wherein the antibody binds to terminal xenoantigenic non-reducing end single terminal NeuGc ⁇ -monosaccharide residue, but does not bind to non-reducing end single terminal NeuAc ⁇ - monosaccharide residue
  • the invention is further directed to a monoclonal antibody, wherein the antibody does not bind to oligosaccharide sequences according to SA ⁇ 3Gal ⁇ 4Glc(NAc) n , wherein SA is Neu5Gc or Neu5 Ac and n is 0 or 1.
  • the invention is directed to the antibody, which has preferred polypeptide sequences according to the invention.
  • the antibodies further preferably have the binding specificity characteristic s) according to the invention.
  • the invention revealed novel useful antibodies for recognition of oligosaccharide sequences.
  • the antibodies have special usefulness for therapeutics and diagnostics because they are human antibodies and are not effectively recognized by human immune system.
  • Antibody CDR sequences are preferred polypeptide sequences according to the invention.
  • the CDR sequences are a characteristic for the antibody family and simila antibodies can be recognized base on fragments of full CDR sequences of the antibodies.
  • the invention is is further directed to at least 40 %, more preferably at least 50 %, even more preferably at least 60 %, more preferably at least 70 %, more preferably at least 80 %, and even more preferably at least 90 %, similar or more preferably identical antibody sequences.
  • the similar sequences are especially preferred for methods of searching new antibodies with same or similar specificites as the antibodies according to the invention or for optimization of an antibody according to the invention, e.g by mutagenesis methods and screening the resulting antibodies against the preferred oligosaccharide sequences according to the invention.
  • the invention is further directed to short characteristic epitopes include tri- to decapeptide fragments of the preferred consensus sequences.
  • the preferred heavy chain sequences of the antibody polypeptides comprise heavy chain sequences of 1.4. group antibodies with with CDRl sequences consensus sequence CDRl : GFTFR, GFTFS, GITFR, or GITFS; FTFR, FTFS, ITFR, or ITFS; or
  • CDRI I XITFX 2 X 3 Y wherein Xi is preferably I or F; and X 2 is R or S; and X 3 is K, or S, or R; and/or with CDR2 sequences having preferred short consensus sequence is YADSVK or YYAD,
  • sequences with two tyrosines are especially preferred as characteristic peptides.
  • CDRl fragments include TFRK, TFRKY, TFRKYA, TFRKYAM, TFRKYAMN, TFSS, TFSSY, TFSSYA, TFSSYAM, TFSSYAMS, TFSR, TFSRY, TFSRYS, TFSRYSM, TFSRYSMN; FRKY, FRKYA, FRKYAM, FRKYAMN, FSSY, FSSYA, FSSYAM, FSSYAMS, FSRY, FSRYS, FSRYSM, FSRYSMN; RKYA, RKYAM, RKYAMN, SSYA, SSYAM, SSYAMS, SRYS, SRYSM, and SRYSMN.
  • tripeptides are most preferred the terra-, penta, and hexapeptides and larger ones in order of decreasing preference.
  • Preferred tripeptides includes TFS, and TFR; FRK, FSS and FSR; RKY, SSY, and SRY.
  • the invention is further directed to an antibody, which has the binding specificity characteristics according to the invention and which comprises heavy chain CDRl and
  • CDRl XiTFX 2 X 3 YX 4 MX 5 , wherein Xi is preferably I or F; and X 2 is R or S; and X 3 is K, or S, or R; and X 4 is A or S; and X 5 is N or S.
  • CDR3 XiX 2 X 3 X 4 X 5 X 6 X 7 DX 8 , wherein Xi is preferably R or M: and X 2 is P, K or N and X 3 is K or nothing; and X 4 is G or nothing; and X 5 is G, A, or nothing; and X 6 is G, or A; and X 7 is M, or F, and X 8 is V, or P or I, or heavy chain CDRs of 1.2.20 type antibodies:
  • CDRl GTVNSYYWS
  • CDR2 RVYSSGTTNLNPS
  • the invention is further directed to antibodies, wherein the antibody comprises light chain
  • CDR2 KSXi SDKQQGS , wherein Xi is preferably N or D, and optionally
  • CDR3 MIWHX I X 2 AX 3 WV, wherein Xi is preferably S or N and X 2 is G or R and X 3 is W or V or
  • CDRl GGDNL, GGDN, GDNL, or GGDNLGGKSVH,
  • CDR2 DDRDRPS
  • CDR3 QVWDSGSESVV.
  • the preferred short characteristic epitopes include tri to- decapeptide fragments of the preferred consensus sequences, preferably for light chain CDRl including: TLRS, TLRSG, TLRSGI, TLRSGIN 5 TLRSGINV 5 TLRSGINVG 5 LRS 5 LRSG 5 LRSGI, LRSGIN 5
  • a preferred antibody comprises at least one of the 1.4 type light chain CDR sequences, preferably at least two being preferably CDRl and CDR2 and most preferably all sequences CDRl -3..
  • novel antibodies can be produced by combining the light chain and heavy cahin sequences, or homologous sequences of the antibodies according ot the invention, in a preferred embodiment the antibody comprises the light chain CDR1-CDR3 sequences selected from the group 1.4.11, 1.4.24 sequences 1.4.30, or 1.2.20: and heavy chain CDRl -CDR3 sequences selected from the group 1.4.11 , 1.4.24 sequences 1.4.30, or 1.2.20. More preferably sequences of 1.4. -group antibodies are combined, e.g as in 1.4.19-3 (F3) antibody. It is realized that any of CDRl, CDR2 or CDR3 can be derived from different original sequences.
  • a preferred antibody comprises the light and heavy chain CDR1-CDR3 sequences of 1.4.24 antibody and in a preferred embodiment 1.4. -group light chain sequences, in a preferred embodiment the 1.4.24 light chain sequences.
  • the 1.4.24 and 1.4.19 (-3), more preferably 1.4.24 antibodies are preferred for their higher affinities to oligosaccharide sequences. This was shown in examples by ELISA assay, the invention is especially directed to the antibody specificties, wherein the specificities are compared by elisa assay using polyvalent oligosaccharide conjugates, preferably polyacrylamide conjugates.
  • the invention is directed to a method of analysis of disease associated or a cell binding antibody, preferably human antibody, wherein the method includes step of measuring the specificity of the antibody towards the sialylated oligosaccharide and monosaccharide sequences according to the invention, preferably using oligosaccharide sequences shown in examples,, preferably measuring specificity with regard 3 oligosaccharide sequences of included in the preferred binding specificity, preferably the preferred a3- and a6-linked sialyl- oligosaccharide sequences.
  • the specificity is measured when antibody has sequence or sequence fragment according to the invention or homologous sequence or at least one similar or homologous CDRl -3 sequence.
  • the invention is further directed to methods for searching or characterizing or optimization of antibodies including a method for detecting carbohydrate epitope binding antibodies, the method comprising the steps of: a) searching from available sequence data antibody sequences having essentially similar or same CDRl or CDR2 sequences or sequence fragment or homolog as described in the invention; b) contacting an antibody found in step a) with sialyl saccharide library comprising saccharide sequences as described in the preferred saccharide binding specificity according to the invention; c) detecting if said antibody binds to any of said saccharide sequences or in preferred embodiment have the same binding specificity as the antibody according to the invention.
  • the invention is especially directed to the selection of antibodies having essentially same or qualitatively similar specificity including binding to the same oligosaccharide sequences, preferably in the ELISA assay according to the invention.
  • sequence data may be available from sequence databases or from sequencing of antibodies as known in the art.
  • the invention is especially directed to a method to analyze status of human cells, to analyze status of a human stem cell population involving a step of contacting the cells with a binder reagent, preferably a monoclonal antibody, according to the invention, for the analysis of a effect of exogenous materials and/cell culture conditions to the cells.
  • a binder reagent preferably a monoclonal antibody
  • the analysis method is especially directed to the cell surface expression of glycan structures on an intact cell population. It is realized that it is useful to analyze cell surface structures, which are most relevant with regard to immunological responses in vivo and or cell biology of the cells, preferably stem cells.
  • the labelling of the human cells, preferably human stem cells, by the antibody is associated with cell culture conditions in the presence of non-human exogenous material and/or lack of the labelling is associated cell culture conditions in the presence of human equivalent material.
  • non-human materials also referred as exogenous or xenoantigenic materials, can be used in cell cultures and changes or contaminations by these to the cells would affect the suitability of the cells for human in vivo uses, for example, by alterations immunological suitability and/or cell biological targeting properties of the cells.
  • the non-human exogenous materials preferably comprise non-human or animal type glycan structures in said non-human exogenous materials
  • preferred non-human exogenous materials are non- human animal proteins/peptides used in cell culture such as animal serummbreins or animal cellular proteins, preferably animal serum proteins such as animal serums or fractons thereof such as FCS (fetal calf serum) or animal cell preparations (e.g. pig cell preparations) or recombinantly produced proteins derived from cell culture producing non- human glycan structures.
  • human equivalent materials which are associated with the lack of labelling mean in a preferred embodiment the presence of human type glycan structures in said human equivalent materials (and preferably non-presence of animal type glycans), such as human serum or cell/blood cell derived proteins such as human serum proteins and/or recombinant human proteins produced to comprise human glycosylation.
  • the invention is directed to the analysis methods, wherein major subpopulation of the intact cells is labelled, more preferably at least 15 %, even more preferably at least 20 %, even more preferably at least 25 %, %, even more preferably at least 35 %, even more preferably at least 45 %, even more preferably at least 55 %, even more preferably at least 65 %, and most preferably at least 75 % or 80 m% of the cells are labelled.
  • the invention revealed that unexpectedly large portion of the human cells, preferably human stem cells, most preferably human mesenchymal stem cells according to the invention are labelled by the novel reagents.
  • the preferred stem cells are human blood derived mesenchymal stem cells, more preferably cord blood or bone marrow derived mesenchymal stem cells.
  • the invention is especially directed to the analysis method according to the invention, wherein novel antibodies according to the invention are used.
  • Most preferred cells to be analyzed include i) cultivated cells, and/or ii) cells, which have been in contact with exogenous carbohydrate materials such as serum and/or exogenous glycoproteins and/or glyco lipids and/or iii) cells which have grown in conditions inducing the expression of one or more of the specific oligosaccharide recognized by the antibodies according to the invention.
  • cell culture condition can induce expression of novel glycans e.g. by providing precursor materials (e.g. sialic acids such as Neu5Gc or glyco lipids) for biosynthesis of special oligosaccharide sequences on cell surfaces and/or by affecting the control of glycan biosynthesis in cells.
  • precursor materials e.g. sialic acids such as Neu5Gc or glyco lipids
  • the present invention revealed that the antibodies can recognize saccharide sequences on intact cells observable by flow cytometry such as FACS analysis and/or immunohistochemistry.
  • the present invention is especially directed to analysis of one or more the saccharide sequences, more preferably oligosaccharide sequences on intact cells, more specifically as antibody accessible material.
  • Figure 9 shows labelling of human cord blood mesenchymal stem cells, human CB-MSC cells, by 1.4.24 antibody in FACS (fluorescence activated cell sorting).
  • the cells were cultivated in presence of exogenous non-human materials, and the lebelling was not observed when the non-human material were replaced by "xeno-free materials" or more specifically human derived materials.
  • the data shows a major population of intact cells labelled by the antibody, and the labelling does depend on cell culture conditions. Neuraminidase (sialidase) treatment was used to confirm the sialic acid dependent binding to the cells.
  • the example further shows effective labelling of human stem cells when being in contact with exogenous (non-human) materials and effective labelling of animal cells.
  • the invention is directed analysis of cultivated cells with regard to contamination by exogenous materials, more preferably material comprising or inducing presence of one or more of the oligosaccharide sequences recognized by the present antibodies.
  • the antibodies are used to analysis of cells cultivated in presence of non- human animal materials such pig or cow derived material, preferably when the material comprises one or more of the oligosaccharide sequences according to the invention.
  • Most preferred cells to be analyzed include cultivated cells, preferred cell types include cells known to incorporate NeuGc(Neu5Gc), especially when these have been in any contact with NeuGc-containing biological materials. It is further known that not all cells are effectively contaminated by NeuGc.
  • the inventors have in copending applications revealed that specific sialylated glycan structures can be incorporated to hematopoietic, mesenchymal or embryonic stem cells.
  • the invention is in a preferred embodiment especially directed to evalution of cells comprising NeuGc in context of specific oligosaccharide sequences recognized by the present antibodies.
  • Preferred cell types to be analyzed include human cells, more preferably human stem cells, even more preferably human hematopoietic cells, bone marrow derived cells, cord blood cells, mesenchymal stem cells and embryonal stem cells or other stem cells and like and possible feeder cells for these cell types, especially when these have been in any contact with NeuGc-containing and preferred sialyl-oligosaccharide sequence containining or materials inducing presence of specific oligosaccharide sequences. It is realized that the present antibodies can be used for recognizing various contamination or contamination induced oligosaccharide sequences on the preferred cell types.
  • the inventors have specifically found novel possibilities for effective NeuGc contaminations and/or Neu5Gc/sialic acid comprising oligosaccharide contamination, from multipotent cells, preferably these are multipotent cells, which are not of embryonal origin, more preferably the cell types include hematopoietic cells, bone marrow derived cells, cord blood cells, and mesenchymal stem cells, which are all of good therapeutic potential and with less teratocarcinogenesis type risks as have the embryonal stem cells. It is further known that not all cells are effectively contaminated by NeuGc or sialic aicd oligosaccharide comprising glycoconjugates..
  • Heiskanen A., Tero Satomaa, T., Tiitinen, S., Laitinen, A., Mannelin, S., Mikkola, M., Olsson, C, Miller-Podraza, H., Blomqvist, M., Olonen, A., Lehenkari, P., Tuuri, T., Otonkoski, T., Natunen, J., Saarinen, J. & Laine, J. (2006) submitted.
  • human IgM scFv library was constructed and selected by xenoantigenic NeuGc in order to isolate scFv fragments with affinity and specificity to NeuGc monosaccharide.
  • Construction of human IgM scFv phage library was prepared indirectly by constructing IgM Fab- ⁇ and Fab- ⁇ libraries first, and then the particular library DNAs were used for PCR amplification of variable domains of heavy and light chains.
  • the final PCR products of the antibody fragments were pooled and digested with appropriate restriction enzymes. Digested DNA fragments, encoding VH region and VK and V ⁇ regions, were ligated into a phagemid vector and transformed into E. coli XL-I Blue cells to yield scFv- ⁇ and scFv- ⁇ libraries of about 10 8 independent clones.
  • the biotinylated panning (Ag+) and depletion (Ag-) antigens were coupled onto the streptavidin-conjugated magnetic beads (Dynal) according the manufacturer's protocol.
  • the Ag+ was polyvalent Neu5Gc ⁇ -polyacrylamide -biotin and Ag- was polyvalent Neu5 Ac ⁇ -polyacrylamide -biotin both from Syntesome/Lectinity, Russia.
  • the conjugate has 3 -carbon alkyl spacer which is linked to branched polyacrylamide conjugate containing biotin branches.
  • the human scFv- ⁇ and scFv- ⁇ libraries were selected by the phage display technique (McCafferty et al, 1990, Barbas et al, 1991).
  • the human na ⁇ ve IgM scFv- ⁇ and scFv- ⁇ libraries were displayed on the surface of the bacteriophage in a multivalent format, the libraries were pooled and panned using an affinity panning procedure.
  • Biotinylated polyacrylamide- conjugated sialic acid derivatives were coupled to streptavidin-conjugated magnetic beads (Dynal) according the manufacturer's protocol.
  • a NeuAc conjugate (Ag-) was used for depletion and a NeuGc conjugate (Ag+) for panning of the library.
  • the phage pools were allowed to react with the magnetic beads coupled with the depletion Ag (Ag-) that was used also as a background control in screening steps for 16 h at +4 0 C. Thereafter, the phage pools were withdrawn and transferred onto the beads containing either panning antigen (Ag+) or depletion antigen (Ag-, background). After a 2- h incubation at room temperature (RT), the beads were washed 2 times with PBS (10 mM sodium phosphate, pH 7.2, 140 mM NaCl) containing 0.05% Tween 20 and the bound phages were eluted with acidic buffer (100 mM Glycine-HCl, pH 2.2), and immediately neutralised with 2 M Tris solution.
  • PBS mM sodium phosphate, pH 7.2, 140 mM NaCl
  • the eluted phage pools were amplified by infecting E. coli XL-I Blue cells.
  • the hyperphage Progen
  • Soluble monovalent scFv-pIII fusions from the second, third and fourth panning round were expressed in E. coli XL-I Blue cells.
  • 148 individual clones were grown in a 1-ml scale for preliminary characterisation. The supernatants were analysed on ELISA using Ag+ -coated wells to catch the glycan-specif ⁇ c binders and Ag- -coated wells to see the non-specific binding. Twelve most promising clones were sequenced and as a result six different DNA sequences were found. Five of them were selected for further characterisation in cell binding assays.
  • the cells were rinsed 5 times with PBS and fixed with 4% paraformaldehyde in PBS for 10-15 min at RT, followed by washings 3 times for 5 min with PBS.
  • the nonspecific binding sites were blocked with 3% HSA (human serum albumin, FRC Blood Service, Finland) in PBS for 30 minutes at RT.
  • Phage antibodies were diluted to 10 6 pfu/ml in 1% HSA-PBS and incubated for 60 minutes at RT, followed by washings 3 times 10 min with PBS.
  • Secondary murine anti-phage antibody ccM13 , 1 :500, Amersham
  • tertiary FITC-labelled goat-anti-mouse 1 :300, Sigma
  • the antibody Fab fragments were tested in immunostaining of sialylated cells and NeuGc comprising cells. Positive staining depending on sialic acids, releasable by sialidase enzyme, were observed when the antibodies were characterized with animal cellular materials, see Table 1.
  • the cells were observed with Zeiss Axioskop 2 plus fluorescence microscope (Carl Zeiss Vision GmbH, Germany) with fluorescein and DAPI filters. Images were taken with Zeiss AxioCam MRc camera and with AxioVision Software 3.1/4.0 (Carl Zeiss) with 400X magnification. Intensity of the stainings was graded as - (negative) or +/++/+++ (positive).
  • the antibodies were also tested in Western blot assays.
  • the assays indicated binding to glycoproteins.
  • the antibody sequences according to the invention are compared with other available antibody sequences by standard methods. For example homologous sequences are searched by BLAST-program, which is available for example from entrez-netpages. Table 5 shows random examples of sequences which can be found by searching short nearly homologous sequences by BLAST with the specified sequences.
  • the CDR3 sequences have other rare characteristics.
  • the heavy chain CDR3s are relatively short: 1.2.20 and 1.4.24 have 6 and 1.4.30 7 amino acid residues, and even 1.4.11. with 9 residues is relatively short.
  • the heavy chain CDR3s appear also to have rare sequences, e.g 1.2.20 heavy chain CDR3 was not found in any immunoglobulin.
  • the invention is directed to the unique characteristic features and combination thereof with the more conserved corresponding CDRl and 2-sequences and consensus sequences.
  • Specificity of the antibodies 1.4.24 and 1.4.30 determined by immunoassay.
  • Polyacrylamide(PAA)-biotin-conjugated polyvalent monosaccharides or glycans (Lectinity, Russia, see Table 6) were immobilized onto streptavidin microtiter plates (Perkin Elmer, Finland) 100 ng/well in TBS buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl) at +4°C o/n.
  • Wells were washed 4 times with TBS and non-specific binding sites were blocked with 1% ultra pure BSA-TBS (Sigma, A7638) for 60 minutes at room temperature (RT).
  • Antibodies 1.4.24 and 1.4.30 were diluted 3 ⁇ g/ml in 0,1% ultra pure BSA-TBS and incubated for 2 hours at RT. Furthermore, wells were washed 4 times with TBS and secondary antibody, Europium-labelled goat anti-human lambda (Southern Biotechnology) was diluted 1 ⁇ g/ml in 0,1% ultra pure BSA-TBS and incubated for 60 minutes at RT in the dark. Wells were washed as previously and 200 ⁇ l of DELFIA Enhancement solution (Perkin Elmer, Finland) was added per well, after which the plate was shaked for 5 minutes at RT. Europium signals were detected with Victor plate reader (Perkin Elmer, Finland).
  • both antibodies 1.4.24 and 1.4.30 are highly specific for NeuGc-monosaccharide (GF309) over naturally occurring NeuAc-monosaccharide (GF308, Fig 8). However, both antibodies cross react with some acidic monosaccharides, such as glucuronic acid ⁇ / ⁇ (GF341 and GF271, respectively). Furthermore, anti-NeuGc antibodies show variable recognition of di- and tri-monosaccharides carrying either NeuGc or NeuAc monosaccharide.
  • SA sialic acid
  • GaINAc N- acetyl galactosamine
  • Gal galactose
  • NeuAc is recognized at least 4 times better than NeuGc (GF345-GF348).
  • SA is Cc2-3 linked to type 1 LacNAc
  • both NeuGc/Ac are recognized by antibodies, NeuGc slightly better than NeuAc (GF462 and GF461, respectively). All other structures, where SAs are linked with cc2-3 linkage (GF459, GF460, GF463-GF468) are not recognized at all by anti-NeuGc antibodies.
  • the antibody Fab fragments were tested in immunostaining of sialyl glycan contaminenated/modif ⁇ ed human bone marrow-derived mesenchymal stem cells (MSC) generated as described (Leskela et al, 2003).
  • MSC human bone marrow-derived mesenchymal stem cells
  • FCS animal material
  • MSCs were cultured on coated glass 8-chamber slides and fixed with paraformaldehyde as described above for LLC-PKl cells.
  • Antibody Fab fragments were diluted in 1% HSA-PBS and incubated for 60 min at RT followed by washings 3 times 10 min with PBS.
  • FITC-labelled goat anti- human lambda antibody (1 :1000, Southern Biotechnology) was incubated for 60 min at RT, and washed 3 times for 5-10 min with PBS before mounting.
  • the cells were observed with Zeiss Axioskop 2 plus fluorescence microscope (Carl Zeiss Vision GmbH, Germany) with fluorescein and DAPI filters. Images were taken with Zeiss AxioCam MRc camera and with Axio Vision Software 3.1/4.0 (Carl Zeiss) with 400X magnification. Intensity of the stainings was graded as - (negative) or +/++/+++ (positive). Results are shown in Table 7. The antibodies 1.4.24 and 1.4.30, where found especially useful for recognizing the stem cells.
  • Both BM and CB MSCs were analyzed by flow cytometry to be negative for CD 14, CD34, CD45 and HLA-DR; and positive for CD 13, CD29, CD44, CD90, CD 105 and HLA-ABC.
  • the cells were shown to be able to differentiate along osteogenic, adipogenic and chondrogenic lineages.
  • the cells were cultivated in presence of fetal cal serum.
  • the cells cultivated in presence of FCS accumulated sialyl-oligosaccahride epitopes observable by 1.4.24 Fab fragment. A part of these could be removed by a neuraminidase treatment(not optimized) showing that the binding was sialic acid dependent.
  • the antibody When cells are grown in presence of non- animal/unusual sialic acid glycan containing material (espcially human serum), the antibody does not label the cells effectively.
  • the invention is directed to the labelling of the stem cells and presence of the special sialic acid epitope, when correlated with culture in the presence of animal sialyl-material and not correlating with cultivation with xeno-free human material such as human serum.
  • Example of an antibody variant The screening of phage display library revealed a further antibody sequence referred as 1.4.19. (-3) also referred as F3.
  • the sequence of the antibody includes heavy chain of 1.4.24 and light chain of 1.4.19, figures 11a and l ib.
  • the specificity and activity of the antibody is similar to 1.24.4 indicating that the heavy chain is a key factor determining the antibody specificity figure 10.
  • the data further indicates that the light chains are at elats in part interchangeable.
  • the invention is directed to antibodies comprising the heavy sequences of antibody 1.4.24, with any of the four other antibodies, more preferably 1.4.
  • WO 2006084050 heparan sulfate, phosphorylated polypeptides
  • AEJ60702 protein negatively charged carbohydrate or polypeptide
  • VH2a 5'- GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCCAGGTCAACTTAAGGGAGTCTGG -3'
  • VH3a 5'- GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGTCTGG -3'
  • VH4a 5'- GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGCAGGAGTCGGG -3'
  • VH5a 5'- GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGTTGCAGTCTGC -3'
  • VH6a 5'- GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCCAGGTACAGCTGCAGCAGTCAGG -3'
  • FTFSRYSMN CAA78004 FTFSRYSMN ISDTFTTIYYADSVKG STAVRGITFDY Mortari, F AAL59365 FTFSGYSMN ISSSSSTIYYADSVKG EALAGNFDY Lieby P et al
  • Table 7 Binding of the selected Sialyl-oligosaccharide-specific antibody Fab fragments to human mesenchymal stem cells (MSC). The binding was assessed by immunostaining.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/FI2008/050643 2007-11-09 2008-11-10 Human monoclonal antibodies directed to sialyl lewis c, sialyl tn and n-glycolylneuraminic acid epitopes and a method of analysis of stem cells comprising said epitopes Ceased WO2009060129A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP08847066A EP2209809A4 (en) 2007-11-09 2008-11-10 HIAL MONOCLONAL ANTIBODIES TREATED ON SIALYL LEWIS C, SIALYL TN AND N-GLYCOLYL NEURAMIC ACID EPITOPES AND METHOD FOR STUDYING STEM CELLS WITH THESE EPITOPES
AU2008324073A AU2008324073A1 (en) 2007-11-09 2008-11-10 Human monoclonal antibodies directed to sialyl Lewis c, sialyl Tn and N-glycolylneuraminic acid epitopes and a method of analysis of stem cells comprising said epitopes
CA2743032A CA2743032A1 (en) 2007-11-09 2008-11-10 Human monoclonal antibodies directed to sialyl lewis c, sialyl tn and n-glycolylneuraminic acid epitopes and a method of analysis of stem cells comprising said epitopes
JP2010532633A JP2011504099A (ja) 2007-11-09 2008-11-10 シアリルルイスc、シアリルTn、及びN−グリコリルノイラミン酸のエピトープに関連づけられるヒトモノクローナル抗体、ならびに前記エピトープを含む幹細胞の分析方法
US12/741,987 US20100292095A1 (en) 2007-11-09 2008-11-10 Human monoclonal antibodies directed to sialyl lewis c, sialyl tn and n glycolylneuraminic acid epitopes and a method of analysis of stem cells comprising said epitopes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FI20070853A FI20070853A0 (fi) 2007-11-09 2007-11-09 Glykaania sitovat monoklonaaliset vasta-aineet
FI20070853 2007-11-09

Publications (1)

Publication Number Publication Date
WO2009060129A1 true WO2009060129A1 (en) 2009-05-14

Family

ID=38786638

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FI2008/050643 Ceased WO2009060129A1 (en) 2007-11-09 2008-11-10 Human monoclonal antibodies directed to sialyl lewis c, sialyl tn and n-glycolylneuraminic acid epitopes and a method of analysis of stem cells comprising said epitopes

Country Status (7)

Country Link
US (1) US20100292095A1 (https=)
EP (1) EP2209809A4 (https=)
JP (1) JP2011504099A (https=)
AU (1) AU2008324073A1 (https=)
CA (1) CA2743032A1 (https=)
FI (1) FI20070853A0 (https=)
WO (1) WO2009060129A1 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110143373A1 (en) * 2008-07-18 2011-06-16 Suomen Punainen Risti, Veripalvelu Method of evaluating the integrity of the plasma membrane of cells by detecting glycans found only intracellularly
WO2018158247A3 (en) * 2017-02-28 2018-10-25 National University Of Ireland, Galway In vitro screening and selection of specific dna aptamers against the non-human sialic acid, n-glycolyl neuraminic acid (neu5gc)
US11028181B2 (en) 2015-11-12 2021-06-08 Seagen Inc. Glycan-interacting compounds and methods of use
US11253609B2 (en) 2017-03-03 2022-02-22 Seagen Inc. Glycan-interacting compounds and methods of use
US11401330B2 (en) 2016-11-17 2022-08-02 Seagen Inc. Glycan-interacting compounds and methods of use
USRE49435E1 (en) 2014-11-12 2023-02-28 Seagen Inc. Glycan-interacting compounds and methods of use

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010044131A1 (ja) * 2008-10-13 2010-04-22 三菱電機株式会社 リソース割り当て装置及びリソース割り当てプログラム及び記録媒体及びリソース割り当て方法
WO2013151649A1 (en) * 2012-04-04 2013-10-10 Sialix Inc Glycan-interacting compounds
US9867841B2 (en) 2012-12-07 2018-01-16 Glycomimetics, Inc. Compounds, compositions and methods using E-selectin antagonists for mobilization of hematopoietic cells
US9879087B2 (en) 2014-11-12 2018-01-30 Siamab Therapeutics, Inc. Glycan-interacting compounds and methods of use
JP6689854B2 (ja) 2014-12-03 2020-04-28 グリコミメティクス, インコーポレイテッド E−セレクチンおよびcxcr4ケモカイン受容体のヘテロ二官能性阻害剤
JP2019503985A (ja) * 2015-11-03 2019-02-14 グリコミメティクス, インコーポレイテッド モノクローナル抗体、造血幹細胞の産生のための方法および組成物、ならびにそれらを使用する方法
WO2017151708A1 (en) 2016-03-02 2017-09-08 Glycomimetics, Inc. Methods for the treatment and/or prevention of cardiovescular disease by inhibition of e-selectin
US11433086B2 (en) 2016-08-08 2022-09-06 Glycomimetics, Inc. Combination of T-cell checkpoint inhibitors with inhibitors of e-selectin or CXCR4, or with heterobifunctional inhibitors of both E-selectin and CXCR4
AU2017341065B2 (en) 2016-10-07 2023-04-06 Crescent Biopharma, Inc. Highly potent multimeric E-selectin antagonists
EP3596096A1 (en) 2017-03-15 2020-01-22 GlycoMimetics, Inc. Galactopyranosyl-cyclohexyl derivatives as e-selectin antagonists
JP7275131B2 (ja) 2017-11-30 2023-05-17 グリコミメティクス, インコーポレイテッド 骨髄浸潤リンパ球を動員する方法、およびその使用
KR20200104889A (ko) 2017-12-29 2020-09-04 글리코미메틱스, 인크. E-셀렉틴 및 갈렉틴-3의 이종이기능성 억제제
PT110526B (pt) * 2018-01-26 2021-02-04 Univ Nova De Lisboa Anticorpo, fragmento funcional ou sonda do mesmo contra antigénios tumorais
KR20200128025A (ko) 2018-03-05 2020-11-11 글리코미메틱스, 인크. 급성 골수성 백혈병 및 관련 병태의 치료 방법
MX2021002761A (es) * 2018-09-10 2021-05-31 Cold Spring Harbor Laboratory Metodos para tratar la pancreatitis.
US11845771B2 (en) 2018-12-27 2023-12-19 Glycomimetics, Inc. Heterobifunctional inhibitors of E-selectin and galectin-3
WO2025149667A1 (en) 2024-01-12 2025-07-17 Pheon Therapeutics Ltd Antibody drug conjugates and uses thereof

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4965198A (en) * 1985-12-24 1990-10-23 Konica Corporation Monoclonal antibody and method of manufacturing hybridoma producing the same
WO2005010485A2 (en) * 2003-07-15 2005-02-03 The Regents Of The University Of California Methods for detecting and analyzing n-glycolylneuraminic acid (neu5gc) in biological materials
WO2007054620A1 (en) * 2005-11-08 2007-05-18 Suomen Punainen Risti, Veripalvelu Novel carbohydrate profile compositions from human cells and methods for analysis and modification thereof
WO2008000918A1 (en) * 2006-06-29 2008-01-03 Suomen Punainen Risti, Veripalvelu Novel cellular glycan compositions
WO2008087260A1 (en) * 2007-01-18 2008-07-24 Suomen Punainen Risti, Veripalvelu Novel specific cell binders
WO2008087258A1 (en) * 2007-01-18 2008-07-24 Suomen Punainen Risti, Veripalvelu Novel carbohydrate from human cells and methods for analysis and modification thereof
WO2008087259A1 (en) * 2007-01-18 2008-07-24 Suomen Punainen Risti, Veripalvelu Novel carbohydrate profile compositions from human cells and methods for analysis and modification thereof

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4342566A (en) * 1980-02-22 1982-08-03 Scripps Clinic & Research Foundation Solid phase anti-C3 assay for detection of immune complexes
US4949778A (en) * 1987-12-16 1990-08-21 Kawasaki Steel Corporation Immersion nozzle for continuous casting
DE4208795A1 (de) * 1992-03-19 1993-09-23 Behringwerke Ag Monoklonaler anti-gangliosid-antikoerper, seine herstellung und verwendung als tumortherapeutikum
FI20055398A0 (fi) * 2005-07-08 2005-07-08 Suomen Punainen Risti Veripalv Menetelmä solupopulaatioiden evaluoimiseksi

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4965198A (en) * 1985-12-24 1990-10-23 Konica Corporation Monoclonal antibody and method of manufacturing hybridoma producing the same
WO2005010485A2 (en) * 2003-07-15 2005-02-03 The Regents Of The University Of California Methods for detecting and analyzing n-glycolylneuraminic acid (neu5gc) in biological materials
WO2007054620A1 (en) * 2005-11-08 2007-05-18 Suomen Punainen Risti, Veripalvelu Novel carbohydrate profile compositions from human cells and methods for analysis and modification thereof
WO2008000918A1 (en) * 2006-06-29 2008-01-03 Suomen Punainen Risti, Veripalvelu Novel cellular glycan compositions
WO2008087260A1 (en) * 2007-01-18 2008-07-24 Suomen Punainen Risti, Veripalvelu Novel specific cell binders
WO2008087258A1 (en) * 2007-01-18 2008-07-24 Suomen Punainen Risti, Veripalvelu Novel carbohydrate from human cells and methods for analysis and modification thereof
WO2008087259A1 (en) * 2007-01-18 2008-07-24 Suomen Punainen Risti, Veripalvelu Novel carbohydrate profile compositions from human cells and methods for analysis and modification thereof

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DEVINE, P.L. ET AL.: "The breast tumor-associated epitope defined by monoclonal antibody 3E1.2 is an 0-linked mucin carbohydrate containing N-glycolylneuraminic acid", CANCER RESEARCH, vol. 51, no. 21, 1991, pages 5826 - 5836, XP001121854 *
HEISKANEN, A. ET AL.: "N-glycolylneuraminic acid xenoantigen contamination of human embryonic and mesenchymal stem cells is substantially reversible.", STEM CELLS, vol. 25, no. 1, 2007, pages 197 - 202, XP003024947 *
MACK, D.R. ET AL.: "Altered expression of sialylated carbohydrate antigens in HT29 colonic carcinoma cells", GLYCOCONJUGATE JOURNAL, vol. 15, no. 12, 1998, pages 1155 - 1163, XP003024945 *
MORENO, E. ET AL.: "Delineation of the epitope recognized by an antibody specific for N-glycolylneuraminic acid-containing gangliosides", GLYCOBIOLOGY, vol. 8, no. 7, 1998, pages 695 - 705, XP000700252 *
See also references of EP2209809A4 *
VAUGHAN, T.J. ET AL.: "Human antibodies by design", NATURE BIOTECHNOLOGY, vol. 16, no. 6, 1998, pages 535 - 539, XP002141139 *
WINTER, G. ET AL.: "Humanized antibodies", IMMUNOLOGY TODAY, vol. 14, no. 6, 1993, pages 243 - 246, XP002357357 *
ZENITA, K. ET AL.: "Northern hybridization analysis of V(H) gene expression in murine monoclonal antibodies directed to cancer-associated ganglioside antigens having various sialic acid linkages.", JOURNAL OF IMMUNOLOGY, vol. 144, no. 11, 1990, pages 4442 - 4451, XP003024946 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110143373A1 (en) * 2008-07-18 2011-06-16 Suomen Punainen Risti, Veripalvelu Method of evaluating the integrity of the plasma membrane of cells by detecting glycans found only intracellularly
EP2316028A4 (en) * 2008-07-18 2011-11-23 Suomen Punainen Risti Veripalvelu METHOD FOR ASSESSING THE INTEGRITY OF THE PLASMA MEMBRANE OF CELLS USING ONLY INTREZELLULARLY PROOFED GLYCANES
USRE49435E1 (en) 2014-11-12 2023-02-28 Seagen Inc. Glycan-interacting compounds and methods of use
US11028181B2 (en) 2015-11-12 2021-06-08 Seagen Inc. Glycan-interacting compounds and methods of use
US11401330B2 (en) 2016-11-17 2022-08-02 Seagen Inc. Glycan-interacting compounds and methods of use
WO2018158247A3 (en) * 2017-02-28 2018-10-25 National University Of Ireland, Galway In vitro screening and selection of specific dna aptamers against the non-human sialic acid, n-glycolyl neuraminic acid (neu5gc)
US11253609B2 (en) 2017-03-03 2022-02-22 Seagen Inc. Glycan-interacting compounds and methods of use

Also Published As

Publication number Publication date
JP2011504099A (ja) 2011-02-03
AU2008324073A1 (en) 2009-05-14
CA2743032A1 (en) 2009-05-14
US20100292095A1 (en) 2010-11-18
FI20070853A0 (fi) 2007-11-09
EP2209809A4 (en) 2011-03-30
EP2209809A1 (en) 2010-07-28

Similar Documents

Publication Publication Date Title
US20100292095A1 (en) Human monoclonal antibodies directed to sialyl lewis c, sialyl tn and n glycolylneuraminic acid epitopes and a method of analysis of stem cells comprising said epitopes
JP5773352B2 (ja) 抗muc1抗体
JP5916017B2 (ja) 新規なmuc1抗体
CN101652388B (zh) 单克隆人肿瘤特异性抗体
AU2015254257B2 (en) Anti-MUC1 antibody or antigen-binding fragment of same, and use thereof
JP2015030666A (ja) 抗ヒトcd26モノクローナル抗体又はその抗原結合性断片
US10604586B2 (en) Humanized monoclonal antibody and uses thereof
US20210017564A1 (en) Antigen treatment method
Sakai et al. Isolation and characterization of antibodies against three consecutive Tn-antigen clusters from a phage library displaying human single-chain variable fragments
WO2019077951A1 (ja) Muc1に対する抗体またはその抗原結合断片、それらのコード遺伝子、およびその用途
WO2013093122A2 (en) Antibodies for the treatment and diagnosis of affective and anxiety disorders
WO2020083979A1 (en) Antibodies specific for glycosylated apoj and uses thereof
CN119899269B (zh) 一种单克隆抗体及其检测应用
US20240309110A1 (en) Combotope Antibody Libraries
EP4623995A1 (en) Monoclonal antibody, reagent for measuring crtac1b, reagent kit, and method for measuring crtac1b
EP2719709A1 (en) The detection of free and protein-bound non-human Gal-alpha(1-3)-Gal epitope
CA3272584A1 (en) Antibody against coatomer protein complex subunit beta 2
CN118140144A (zh) 用于诊断癌症的糖蛋白生物标志物
JP2026509914A (ja) コンボトープ抗体ライブラリー
CN121449746A (zh) 一种单克隆抗体及其实验检测应用
WO2026063524A1 (ja) 抗Vanin-1抗体又はその抗原結合断片、及びその用途
JP2020162572A (ja) 抗原の処理方法。
JP2006055141A (ja) 糖鎖構造に特異的な抗体の同定方法
KR20210116113A (ko) c-Myc 펩타이드 특이적인 항체 및 이의 용도
Matsubara et al. Identification of oligosaccharide-recognition molecules by phage-display technology

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08847066

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2010532633

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2008324073

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2008847066

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2008324073

Country of ref document: AU

Date of ref document: 20081110

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12741987

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2743032

Country of ref document: CA