WO2009055732A1 - Cdna synthesis using non-random primers - Google Patents
Cdna synthesis using non-random primers Download PDFInfo
- Publication number
- WO2009055732A1 WO2009055732A1 PCT/US2008/081206 US2008081206W WO2009055732A1 WO 2009055732 A1 WO2009055732 A1 WO 2009055732A1 US 2008081206 W US2008081206 W US 2008081206W WO 2009055732 A1 WO2009055732 A1 WO 2009055732A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- population
- oligonucleotides
- nucleic acid
- seq
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
Definitions
- the present invention relates to methods of selectively amplifying target nucleic acid molecules and oligonucleotides useful for priming the amplification of target nucleic acid molecules.
- Gene expression analysis often involves amplification of starting nucleic acid molecules.
- Amplification of nucleic acid molecules may be accomplished by reverse transcription (RT), in vitro transcription (IVT) or the polymerase chain reaction (PCR), either individually or in combination.
- the starting nucleic acid molecules may be mRNA molecules, which are amplified by first synthesizing complementary cDNA molecules, then synthesizing second cDNA molecules that are complementary to the first cDNA molecules, thereby producing double stranded cDNA molecules.
- the synthesis of first strand cDNA is typically accomplished using a reverse transcriptase and the synthesis of second strand cDNA is typically accomplished using a DNA polymerase.
- the double stranded cDNA molecules may be used to make complementary RNA molecules using an RNA polymerase, resulting in amplification of the original starting mRNA molecules.
- the RNA polymerase requires a promoter sequence to direct initiation of RNA synthesis.
- Complementary RNA molecules may, for example, be used as a template to make additional complementary DNA molecules.
- the double stranded cDNA molecules may be amplified, for example, by PCR and the amplified PCR products may be used as sequencing templates or in microarray analysis.
- oligonucleotide primers that specifically hybridize to one or more target nucleic acid molecules in the starting material.
- Each oligonucleotide primer may include a promoter sequence that is located 5' to the hybridizing portion of the oligonucleotide that hybridizes to the target nucleic acid molecule(s). If the hybridizing portion of an oligonucleotide is too short, then the oligonucleotide does not stably hybridize to a target nucleic acid molecule and priming and subsequent amplification does not occur.
- the hybridizing portion of an oligonucleotide is too short, then the oligonucleotide does not specifically hybridize to one or a small number of target nucleic acid molecules, but nonspecifically hybridizes to numerous target nucleic acid molecules.
- RNA molecules typically require the use of a population of numerous oligonucleotides having different nucleic acid sequences.
- the cost of the oligonucleotides increases with the length of the oligonucleotides.
- oligonucleotide primers that are no longer than the minimum length required to ensure specific hybridization of an oligonucleotide to a target sequence. It is often undesirable to amplify highly expressed RNAs (e.g., ribosomal RNAs).
- oligonucleotide primers that selectively amplify desired nucleic acid molecules within a population of nucleic acid molecules (e.g., oligonucleotide primers that selectively amplify all mRNAs that are expressed in a cell except for the most highly expressed RNAs).
- the hybridizing portion of each oligonucleotide should be no longer than necessary to ensure specific hybridization to a desired target sequence under defined conditions.
- the present invention provides methods for selectively amplifying a target population of nucleic acid molecules within a larger non-target population of nucleic acid molecules (e.g., all RNA molecules expressed in a cell type except for the most highly expressed RNA species).
- a target population of nucleic acid molecules within a larger non-target population of nucleic acid molecules e.g., all RNA molecules expressed in a cell type except for the most highly expressed RNA species.
- the methods of this aspect of the invention each include the steps of (a) providing a population of single- stranded primer extension products synthesized from a population of RNA template molecules in a sample isolated from a mammalian subject using reverse transcriptase enzyme and a first population of oligonucleotide primers, wherein each oligonucleotide in the first population of oligonucleotide primers comprises a hybridizing portion and a defined sequence portion located 5' to the hybridizing portion, wherein the population of RNA template molecules comprises a target population of nucleic acid molecules and a non-target population of nucleic acid molecules; (b) synthesizing double- stranded cDNA from the population of single- stranded primer extension products according to step (a) using a DNA polymerase and a second population of oligonucleotide primers, wherein each oligonucleotide in the second population of oligonucleotides comprises a hybridizing portion, wherein the hybrid
- the present invention provides methods of selectively amplifying a target population of nucleic acid molecules within a larger non-target population of nucleic acid molecules.
- the methods of this aspect of the invention comprise the steps of (a) synthesizing single- stranded cDNA from a sample comprising total RNA isolated from a mammalian subject using reverse transcriptase enzyme and a first population of oligonucleotide primers, wherein each oligonucleotide within the first population of oligonucleotide primers comprises a hybridizing portion and a defined sequence portion located 5' to the hybridizing portion, wherein the hybridizing portion is a member of the population of oligonucleotides comprising SEQ ID NOS: 1-749; and (b) synthesizing double- stranded cDNA from the single- stranded cDNA synthesized according to step (a) using a DNA polymerase and a second population of oligonucleotide primers, wherein each
- the present invention provides methods for transcriptome profiling.
- the methods of this aspect of the invention comprise (a) synthesizing a population of single stranded primer extension products from a target population of nucleic acid molecules within a population of RNA template molecules in a sample isolated from a subject using reverse transcriptase enzyme and a first population of oligonucleotide primers comprising a hybridizing portion and a first PCR primer binding site located 5' to the hybridizing portion; (b) synthesizing double- stranded cDNA from the population of single- stranded primer extension products generated according to step (a) using a DNA polymerase and a second population of oligonucleotide primers comprising a hybridizing portion and a second PCR primer binding site located 5' to the hybridizing portion; and (c) PCR amplifying the double- stranded cDNA generated according to step (b) using a first PCR primer that binds to the first PCR primer binding site and a second PCR
- the present invention provides populations of oligonucleotides comprising SEQ ID NOS: 1-749. These oligonucleotides can be used, for example, to prime the synthesis of first-strand cDNA molecules complementary to RNA molecules isolated from a mammalian subject without priming the synthesis of first strand cDNA molecules complementary to ribosomal RNA (18S, 28S) or mitochondrial ribosomal RNA (12S, 16S) molecules.
- each oligonucleotide in the population of oligonucleotides further comprises a defined sequence portion located 5' to the hybridizing portion.
- the defined sequence portion comprises a transcriptional promoter, which may be used as a primer binding site in PCR amplification, or for in vitro transcription.
- the defined sequence portion comprises a primer binding site that is not a transcriptional promoter.
- the present invention provides populations of oligonucleotides wherein a transcriptional promoter, such as the T7 promoter (SEQ ID NO: 1508), is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- the present invention provides populations of oligonucleotides wherein each oligonucleotide consists of the T7 promoter (SEQ ID NO: 1508) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- the present invention provides populations of oligonucleotides wherein the defined sequence portion comprises at least one primer binding site that is useful for priming a PCR synthesis reaction and that does not include an RNA polymerase promoter sequence.
- a representative example of a defined sequence portion for use in such embodiments is provided as 5TCCGATCTCT3' (SEQ ID NO: 1499), which is preferably located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- the present invention provides populations of oligonucleotides comprising SEQ ID NOS:750-1498.
- These oligonucleotides can be used, for example, to prime the synthesis of second strand cDNA molecules complementary to first strand cDNA molecules synthesized from RNA isolated from a mammalian subject without priming the synthesis of second strand cDNA molecules complementary to first strand cDNA reverse transcribed from ribosomal RNA (18S, 28S) or mitochondrial ribosomal RNA (12S, 16S) molecules.
- each oligonucleotide in the population of oligonucleotides further comprises a defined sequence portion located 5' to the hybridizing portion.
- the defined sequence portion comprises a transcriptional promoter, which may be used as a primer binding site in PCR amplification or for in vitro transcription.
- the defined sequence portion comprises a primer binding site that is not a transcriptional promoter.
- the present invention provides populations of oligonucleotides wherein a transcriptional promoter, such as the T7 promoter (SEQ ID NO: 1508), is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:750-1498.
- the present invention provides populations of oligonucleotides wherein each oligonucleotide consists of the T7 promoter (SEQ ID NO: 1508) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:750-1498.
- the present invention provides populations of oligonucleotides wherein the defined sequence portion comprises at least one primer binding site that is useful for priming a PCR synthesis reaction and that does not include an RNA polymerase promoter sequence.
- a representative example of a defined sequence portion for use in such embodiments is provided as 5 'TCCG ATCTG A3' (SEQ ID NO: 1500), which is preferably located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:750-1498.
- the present invention provides a reagent for selectively amplifying a target population of nucleic acid molecules in a larger population of non-target nucleic acid molecules.
- the reagent comprises at least 10% of the oligonucleotides comprising SEQ ID NOS: 1-749. In another embodiment, the reagent comprises at least 10% of the oligonucleotides comprising SEQ ID NOS:750-1498.
- the present invention provides a kit for selectively amplifying a target population of nucleic acid molecules.
- the kit of this aspect of the invention comprises a reagent comprising a first population of oligonucleotides for first strand cDNA synthesis, wherein each oligonucleotide in the first population of oligonucleotides comprises a hybridizing portion and a defined sequence portion located 5' to the hybridizing portion, wherein the hybridizing portion is a member of the population of oligonucleotides comprising SEQ ID NOS: 1-749.
- the kit further comprises a second population of oligonucleotides for second strand cDNA synthesis, wherein each oligonucleotide in the second population of oligonucleotides comprises a hybridizing portion and a defined sequence portion located 5' to the hybridizing portion, wherein the hybridizing portion is a member of the population of oligonucleotides comprising SEQ ID NOS:750-1498.
- the present invention provides a population of selectively amplified nucleic acid molecules comprising a representation of a transcriptome of a mammalian subject comprising a 5' defined sequence, a population of amplified sequences corresponding to a nucleic acid expressed in the mammalian subject, a 3' defined sequence wherein the population of amplified sequences is characterized by having the following properties with reference to the particular mammalian species: (a) having greater than 75% polyadenylated and non-polyadenylated transcripts and having less than 10% ribosomal RNA.
- FIGURE IA shows the number of exact matches for random 6-mers (N6) oligonucleotides on nucleotide sequences in the human RefSeq transcript database as described in Example 1
- FIGURE IB shows the number of exact matches for Not-So-Random (NSR) 6-mer oligonucleotides on nucleotide sequences in the human RefSeq transcript database as described in Example 1
- N6 random 6-mers
- NSR Not-So-Random
- FIGURE 1C shows a representative embodiment of the methods of the invention for synthesizing a preparation of selectively amplified cDNA molecules using a mixture of random primers for first strand cDNA synthesis and a mixture of anti-NSR 6-mer oligonucleotides for second strand cDNA synthesis, as described in Example 2;
- FIGURE ID shows a representative embodiment of the methods of the invention for synthesizing a preparation of selectively amplified aDNA molecules using a mixture of NSR 6-mer oligonucleotides for first strand cDNA synthesis and a mixture of anti-NSR6-mer oligonucleotides for second strand cDNA synthesis, followed by PCR amplification, as described in Example 2 and Example 4;
- FIGURE 2 is flow diagram illustrating a method of whole transcriptome analysis of a subject comprising selectively amplifying nucleic acid molecules from RNA isolated from the subject followed by sequence analysis or microarray analysis of the amplified nucleic acid molecules as described in Example 4 and Example 5;
- FIGURE 4A is a histogram plot showing the gene-specific polyA content of representative gene transcripts in cDNA synthesized using various NSR primers during first strand synthesis as
- FIGURE 4B is a histogram plot showing the relative abundance level of representative non-polyadenylated RNA transcripts in cDNA amplified from Jurkat-1 and Jurkat-2 total RNA using various NSR primers during first strand cDNA synthesis as described in Example 3;
- FIGURE 5 graphically illustrates the log ratio of Jurkat/K562 mRNA expression data measured in cDNA generated using NSR-6mers (x-axis) versus the log ratio of Jurkat/K562 mRNA expression data measured in cDNA generated using random primers (N8), as described in Example 3;
- FIGURE 6A graphically illustrates the proportion of rRNA to mRNA in total RNA typically obtained after polyA purification, demonstrating that even after 95% removal of rRNA from total RNA, the remaining RNA consists of a mixture of about 50% rRNA and 50% mRNA as described in Example 3;
- FIGURE 6B graphically illustrates the proportion of rRNA to mRNA in a cDNA sample prepared using NSR primers during first strand cDNA synthesis and anti-NSR primers during second strand cDNA synthesis.
- NSR primers and anti-NSR primers to generate cDNA from total RNA is effective to remove 99.9% rRNA, resulting in a cDNA population enriched for greater than 95% mRNA as described in Example 3;
- FIGURE 7A graphically illustrates the detection and positional distribution of polyA+ RefSeq mRNA in NSR-primed (dotted line) or expressed sequence tag (EST) (solid line) cDNAs across long transcripts (>4kb), illustrating the combined read frequencies for 5,790 transcripts shown at each base position starting from the 5' termini, as described in Example 7;
- FIGURE 7B graphically illustrates the detection and positional distribution of polyA+ RefSeq mRNA in NSR-primed (dotted line) or expressed sequence tag (EST) (solid line) cDNAs across long transcripts (>4kb), illustrating the combined read frequencies for 5,790 transcripts shown at each base position starting from the 3' termini, as described in Example 7; and
- FIGURE 8 graphically illustrates the enrichment of small nucleolar RNAs (snoRNAs) encoded by the Chromosome 15 Prader-Willi neurological disease locus in
- NSR-6mers described in co-pending U.S. Patent Application Serial No. 11/589,322 comprise populations of oligonucleotides that hybridize to all mRNA molecules expressed in blood cells but that do not hybridize to globin mRNA (HBAl, HB A2, HBB, HBD, HBGl and HBG2) or to nuclear ribosomal RNA (18S and 28S rRNA).
- NSR primers SEQ ID NOS: 1-749
- SEQ ID NOS: 1-749 includes oligonucleotides that hybridize to all mRNA molecules expressed in mammalian cells, including globin mRNA, but that do not hybridize to nuclear ribosomal RNA (18S and 28S rRNA) and mitochondrial ribosomal RNAs (12S and 16S mt-rRNA).
- the present application further provides a second population of anti-NSR oligonucleotides (SEQ ID NOS:750-1498) for use during second strand cDNA synthesis.
- the anti-NSR oligonucleotides are selected to hybridize to all first strand cDNA molecules reverse transcribed from RNA templates expressed in mammalian cells, including globin mRNA, but that do not hybridize to first strand cDNA molecules transcribed from nuclear ribosomal RNA (18S and 28S rRNA) and mitochondrial ribosomal RNAs (12S and 16S mt-rRNA).
- the use of a first round of selective amplification using NSR primers (SEQ ID NOS: 1-749) during first strand synthesis followed by a second round of selective amplification using anti-NSR primers (SEQ ID NOS:750-1498) during second strand synthesis results in a population of double stranded cDNA that represents substantially all of the polyA RNA and non-polyA RNA expressed in the cell, with a very low level (less than 10%) of nucleic acid molecules representing unwanted nuclear ribosomal RNA and mitochondrial ribosomal RNA.
- the invention also provides methods which analyze the products of the amplification methods of the invention, such as sequencing and gene expression profiling (e.g., microarray analysis).
- the present invention provides methods for selectively amplifying a target population of nucleic acid molecules within a larger non-target population of nucleic acid molecules (e.g., all RNA molecules expressed in a cell type except for the most highly expressed RNA species).
- a target population of nucleic acid molecules within a larger non-target population of nucleic acid molecules e.g., all RNA molecules expressed in a cell type except for the most highly expressed RNA species.
- the methods of this aspect of the invention each include the steps of (a) synthesizing single- stranded cDNA from RNA in a sample isolated from a mammalian subject using reverse transcriptase enzyme and a first population of oligonucleotide primers, wherein each oligonucleotide in the first population of oligonucleotide primers comprises a hybridizing portion and a defined sequence portion located 5' to the hybridizing portion, wherein the RNA comprises a target population of nucleic acid molecules within a larger non-target population of nucleic acid molecules; and (b) synthesizing double- stranded cDNA from the single- stranded cDNA synthesized according to step (a) using a DNA polymerase and a second population of oligonucleotide primers, wherein each oligonucleotide in the second population of oligonucleotides comprises a hybridizing portion, wherein the hybridizing portion consists of one of 6, 7, or 8
- the second population of oligonucleotides may also include a defined sequence portion located 5' to the hybridizing portion.
- the defined sequence portion comprises a transcriptional promoter that can also be used as a primer binding site. Therefore, in certain embodiments of this aspect of the invention, each oligonucleotide of the second population of oligonucleotides comprises a hybridizing portion that consists of 6 nucleotides or 7 nucleotides or 8 nucleotides and a transcriptional promoter portion located 5' to the hybridizing portion.
- the defined sequence portion of the second population of oligonucleotides includes a second primer binding site for use in a PCR amplification reaction and that may optionally include a transcriptional promoter.
- the populations of anti-NSR oligonucleotides provided by the present invention are useful in the practice of the methods of this aspect of the invention.
- a population of oligonucleotides (SEQ ID NOS:750-1498), that each has a length of 6 nucleotides, was identified that can be used as primers to prime the second strand synthesis of all, or substantially all, first strand cDNA molecules synthesized from a target population of RNA molecules from mammalian cells but that do not prime the second strand synthesis of first strand cDNA reverse transcribed from non-target ribosomal RNA (rRNA) or mitochondrial rRNA (mt-rRNA) from mammalian cells.
- rRNA non-target ribosomal RNA
- mt-rRNA mitochondrial rRNA
- the identified second population of oligonucleotides (SEQ ID NOS:750-1498) is referred to as anti-Not-So-Random (anti-NSR) primers.
- this population of oligonucleotides (SEQ ID NOS:750-1498) can be used to prime the second strand synthesis of a population of first strand nucleic acid molecules (e.g., cDNAs) that are representative of a starting population of mRNA molecules isolated from mammalian cells but do not prime second strand synthesis of cDNA molecules that correspond to rRNA or mt-rRNAs.
- each oligonucleotide in the first population of oligonucleotides comprises a hybridizing portion, wherein the hybridizing portion consists of one of 6, 7, or 8 nucleotides and a defined sequence located 5' to the hybridizing portion wherein the hybridizing portion is selected from all possible oligonucleotides having a length of 6, 7, or 8 nucleotides that do not hybridize under the defined conditions to the non-target population of nucleic acid molecules in a sample comprising RNA from a mammalian subject.
- the first population of oligonucleotides may also include a defined sequence portion located 5' to the hybridizing portion.
- the defined sequence portion comprises a transcriptional promoter that can also be used as a first primer binding site. Therefore, in certain embodiments of this aspect of the invention, each oligonucleotide of the first population of oligonucleotides comprises a hybridizing portion that consists of 6 nucleotides or 7 nucleotides or 8 nucleotides and a transcriptional promoter portion located 5' to the hybridizing portion.
- the defined sequence portion of the first population of oligonucleotides includes a first primer binding site for use in a PCR amplification reaction and that may optionally include a transcriptional promoter.
- the populations of NSR oligonucleotides provided by the present invention are useful in the practice of the methods of this aspect of the invention.
- a first population of oligonucleotides (SEQ ID NOS: 1-749) wherein each has a length of 6 nucleotides, was identified that can be used as primers to prime the first strand synthesis of all, or substantially all, mRNA molecules from mammalian cells, but that do not prime the amplification of non-target ribosomal RNA (rRNA) or mitochondrial rRNA (mt-rRNA) from mammalian cells.
- the identified first population of oligonucleotides (SEQ ID NOS: 1-749) is referred to as Not-So-Random (NSR) primers.
- this population of oligonucleotides can be used to prime the first strand synthesis of a population of nucleic acid molecules (e.g., cDNAs) that are representative of a starting population of mRNA molecules isolated from mammalian cells but do not prime first strand synthesis of cDNA molecules that correspond to rRNA or mt-rRNAs.
- a population of nucleic acid molecules e.g., cDNAs
- the present invention also provides a first population of oligonucleotides for priming first strand cDNA synthesis, wherein a defined sequence, such as the T7 promoter (SEQ ID NO: 1508) or a first primer binding site (SEQ ID NO: 1499) is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- each oligonucleotide may include a hybridizing portion (selected from SEQ ID NOS: 1-749) that hybridizes to target nucleic acid molecules (e.g., mRNAs) and a defined sequence, such as a promoter sequence or first primer binding site, is located 5' to the hybridizing portion.
- the defined sequence portion may be incorporated into DNA molecules amplified using the oligonucleotides (that include the T7 promoter) as primers and can thereafter promote transcription from the DNA molecules.
- the defined sequence portion such as the transcriptional promoter or first primer binding site, may be covalently attached to the cDNA molecule, for example, by DNA ligase enzyme.
- Useful transcription promoter sequences include the T7 promoter (5 1 AATTAAT ACGACTCACT ATAGGGAGA3 1 (SEQ ID NO: 1508)), the SP6 promoter (5 1 ATTTAGGTGACACTATAGAAGNG3 1 (SEQ ID NO: 1509)), and the T3 promoter (5 1 AATTAACCCTCACTAAAGGGAGA3 1 (SEQ ID NO: 1510)).
- the target nucleic acid population can include, for example, all mRNAs expressed in a cell or tissue except for a selected group of non-target mRNAs such as, for example, the most abundantly expressed mRNAs.
- a non-target abundantly expressed mRNA typically constitutes at least 0.1% of all the mRNA expressed in the cell or tissue (and may constitute, for example, more than 50% or more than 60% or more than 70% of all the mRNA expressed in the cell or tissue).
- An example of an abundantly expressed non-target mRNA is ribosomal rRNA or mitochondrial rRNA in mammalian cells.
- Other examples of abundantly expressed non-target RNA that one could selectively eliminate using the methods of the invention include, for example, globin mRNA (from blood cells) or chloroplast rRNA (from plant cells).
- the methods of the invention are useful for transcriptome profiling of total RNA in a biological cell sample in which it is desirable to reduce the presence of a group of RNAs (that do not hybridize to the NSR and/or anti-NSR primers) from an amplified sample, such as, for example, highly expressed RNAs (e.g., ribosomal RNAs).
- a group of RNAs that do not hybridize to the NSR and/or anti-NSR primers
- highly expressed RNAs e.g., ribosomal RNAs
- the methods of the invention may be used to reduce the amount of a group of nucleic acid molecules that do not hybridize to the NSR primers and/or anti-NSR primers in amplified nucleic acid derived from an RNA sample by at least 2 fold up to 1000 fold, such as at least 10 fold, 50 fold, 100 fold, 500 fold or greater, in comparison to the amount of amplified nucleic acid molecules that do hybridize to the NSR and/or anti-NSR primers.
- Populations of oligonucleotides used to practice the method of this aspect of the invention are selected from within a larger population of oligonucleotides, wherein the first population of oligonucleotides is selected based on its ability to hybridize under defined conditions to a target RNA population but not hybridize under the defined conditions to a non-target RNA population and the first population of oligonucleotides comprises all possible oligonucleotides having a length of 6 nucleotides, 7 nucleotides, or 8 nucleotides.
- the second population of oligonucleotides is selected based on its ability to hybridize under defined conditions to a target first strand cDNA population, but not hybridize under the defined conditions to a non-target first strand cDNA population and the second population of oligonucleotides comprises all possible oligonucleotides having a length of 6 nucleotides, 7 nucleotides, or 8 nucleotides.
- the second population of oligonucleotides may be generated by synthesizing the reverse complement of the sequence of the first population of oligonucleotides. Composition of First Population of Oligonucleotides.
- the first population of oligonucleotides includes all possible oligonucleotides having a length of 6 nucleotides or 7 nucleotides or 8 nucleotides.
- the first population of oligonucleotides may include only all possible oligonucleotides having a length of 6 nucleotides or all possible oligonucleotides having a length of 7 nucleotides or all possible oligonucleotides having a length of 8 nucleotides.
- the first population of oligonucleotides may include other oligonucleotides in addition to all possible oligonucleotides having a length of 6 nucleotides or all possible oligonucleotides having a length of 7 nucleotides or all possible oligonucleotides having a length of 8 nucleotides.
- each member of the first population of oligonucleotides is no more than 30 nucleotides long.
- Sequences of First Population of Oligonucleotides There are 4,096 possible oligonucleotides having a length of 6 nucleotides, 16,384 possible oligonucleotides having a length of 7 nucleotides, and 65,536 possible oligonucleotides having a length of 8 nucleotides.
- the sequences of the oligonucleotides that constitute the population of oligonucleotides can readily be generated by a computer program such as Microsoft Word®.
- the subpopulation of first oligonucleotides is selected from the population of oligonucleotides based on the ability of the members of the subpopulation of first oligonucleotides to hybridize under defined conditions to a population of target nucleic acids but not hybridize under the same defined conditions to a non-target population.
- a sample of amplified includes target nucleic acid molecules (e.g., RNA or DNA molecules) that are to be amplified (e.g., using reverse transcription) and also includes non-target nucleic acid molecules that are not to be amplified.
- the subpopulation of first oligonucleotides is made up of oligonucleotides that each hybridize under defined conditions to target sequences distributed throughout the population of the nucleic acid molecules that are to be amplified but that do not hybridize under the same defined conditions to most (or any) of the non-target nucleic acid molecules that are not to be amplified.
- the subpopulation of first oligonucleotides hybridizes under defined conditions to target nucleic acid sequences other than those that have been intentionally avoided (non-target sequences).
- the cell sample may include a population of all mRNA molecules expressed in mammalian cells including many ribosomal RNA molecules (e.g., 5S, 18S, and 28S ribosomal RNAs) and mitochondrial rRNA molecules (e.g., 12S and 16S ribosomal RNAs). It is typically undesirable to amplify the ribosomal RNAs. For example, in gene expression experiments that analyze expression of genes in cells, amplification of numerous copies of abundant ribosomal RNAs may obscure subtle changes in the levels of less abundant mRNAs.
- ribosomal RNA molecules e.g., 5S, 18S, and 28S ribosomal RNAs
- mitochondrial rRNA molecules e.g., 12S and 16S ribosomal RNAs
- a subpopulation of first oligonucleotides is selected that does not hybridize under defined conditions to most (or any) non-target ribosomal RNAs but that does hybridize under the same defined conditions to most (preferably all) of the other target mRNA molecules expressed in the cells.
- nucleic acid sequences of the 5S, 18S, and 28S ribosomal RNAs (or a representative member of each of the foregoing classes of ribosomal RNA) and the nucleic acid sequences of the 12S and 16S ribosomal mitochondrial RNAs.
- sequences for the ribosomal RNAs for the mammalian species from which the cell sample is obtained can be found in a publically accessible database.
- NCBI Genbank identifiers are provided in TABLE l for human 12S, 16S, 18S, and 28S ribosomal RNA, as accessed on September 5, 2007.
- a suitable software program is then used to compare the sequences of all of the oligonucleotides in the population of first oligonucleotides (e.g., the population of all possible 6 nucleic acid oligonucleotides) to the sequences of the ribosomal RNAs to determine which of the oligonucleotides will hybridize to any portion of the ribosomal RNAs under defined hybridization conditions. Only the oligonucleotides that do not hybridize to any portion of the ribosomal RNAs under defined hybridization conditions are selected. Perl script may easily be written that permits comparison of nucleic acid sequences and identification of sequences that hybridize to each other under defined hybridization conditions.
- the subpopulation of all possible 6 nucleic acid oligonucleotides that were not exactly complementary to any portion of any ribosomal RNA sequence was identified.
- the subpopulation of oligonucleotides (that hybridizes under defined conditions to a target nucleic acid population but does not hybridize under the defined conditions to a non- target nucleic acid population) must contain enough different oligonucleotide sequences to hybridize to all or substantially all nucleic acid molecules in the RNA sample.
- Example 1 herein shows that the population of oligonucleotides having the nucleic acid sequences set forth in SEQ ID NOS: 1-749 hybridizes to all or substantially all nucleic acid sequences within a population of gene transcripts stored in the publicly accessible database called RefSeq. Additional Defined Nucleic Acid Sequence Portions.
- the selected subpopulation of first oligonucleotides e.g., SEQ ID NOS: 1-749 can be used to prime the reverse transcription of a target population of RNA molecules to generate first strand cDNA.
- a population of first oligonucleotides can be used as primers wherein each oligonucleotide includes the sequence of one member of the selected subpopulation of oligonucleotides and also includes an additional defined nucleic acid sequence.
- the additional defined nucleic acid sequence is typically located 5' to the sequence of the member of the selected subpopulation of oligonucleotides.
- the population of oligonucleotides includes the sequences of all members of the selected subpopulation of oligonucleotides (e.g., the population of oligonucleotides can include all of the sequences set forth in SEQ ID NOS: 1-749).
- each first oligonucleotide can include a transcriptional promoter sequence or first primer binding site (PBS#1) located 5' to the sequence of the member of the selected subpopulation of oligonucleotides.
- the promoter sequence may be incorporated into the amplified nucleic acid molecules which can, therefore, be used as templates for the synthesis of RNA.
- Any RNA polymerase promoter sequence can be included in the defined sequence portion of the population of oligonucleotides. Representative examples include the T7 promoter (SEQ ID NO: 1508), the SP6 promoter (SEQ ID NO: 1509), and the T3 promoter (SEQ ID NO: 1510).
- each oligonucleotide in the first population of oligonucleotides comprises a random hybridizing portion and a defined sequence located 5' to the hybridizing portion.
- each first oligonucleotide can include a defined sequence comprising a primer binding site located 5' to the random hybridizing portion.
- the primer binding site is incorporated into the amplified nucleic acids, which can then be used as a PCR primer binding site for the generation of double- stranded amplified DNA products from the cDNA.
- the primer binding site may be a portion of a transcriptional promoter sequence.
- Sequences of Second Population of Oligonucleotides The selection process for the second population of oligonucleotides is similar to the process described above for the selection of the first population of oligonucleotides with the difference being that the hybridizing portion consisting of 6 nucleotides, 7 nucleotides, or 8 nucleotides is selected to hybridize to the first strand cDNA reverse transcribed from the target RNA under defined conditions and not hybridize to the first strand cDNA reverse transcribed from the non-target RNA under defined conditions.
- the second population of oligonucleotides can be selected using the methods described above, for example, using the publicly available sequences for ribosomal RNA.
- the second population of oligonucleotides can also be generated as the reverse-complement of the first population of oligonucleotides (anti-NSR).
- Example 1 shows that the population of oligonucleotides having the nucleic acid sequences set forth in SEQ ID NOS: 1-749 hybridizes to all or substantially all nucleic acid sequences within a population of gene transcripts stored in the publicly accessible database called RefSeq.
- a second population SEQ ID NOS:750-1498 (anti-NSR) was then generated that was the reverse complement of the first population of oligonucleotides (SEQ ID NOS: 1-749, NSR).
- the selected subpopulation of second oligonucleotides can be used to prime the second strand cDNA synthesis of a target population of first strand cDNA molecules.
- a population of second oligonucleotides can be used as primers wherein each oligonucleotide includes the sequence of one member of the selected subpopulation of oligonucleotides and also includes an additional defined nucleic acid sequence.
- the additional defined nucleic acid sequence is typically located 5' to the sequence of the member of the selected subpopulation of oligonucleotides.
- the population of oligonucleotides includes the sequences of all members of the selected subpopulation of oligonucleotides (e.g., the population of oligonucleotides can include all of the sequences set forth in SEQ ID NOS:750-1498).
- each first oligonucleotide can include a transcriptional promoter sequence or second primer binding site (PBS#2) located 5' to the sequence of the member of the selected subpopulation of oligonucleotides.
- the promoter sequence may be incorporated into the amplified nucleic acid molecules that can, therefore, be used as templates for the synthesis of RNA.
- Any RNA polymerase promoter sequence can be included in the defined sequence portion of the population of oligonucleotides. Representative examples include the T7 promoter (SEQ ID NO: 1508), the SP6 promoter (SEQ ID NO: 1509), and the T3 promoter (SEQ ID NO: 1510).
- the present invention provides a population of first oligonucleotides wherein each oligonucleotide of the population includes (a) a sequence of a 6 nucleic acid oligonucleotide that is a member of a subpopulation of oligonucleotides (SEQ ID NOS: 1-749), wherein the subpopulation of oligonucleotides hybridizes to all or substantially all RNAs expressed in mammalian cells but does not hybridize to ribosomal RNAs; and (b) a primer binding site (PBS#1) sequence (SEQ ID NO: 1499) located 5' to the sequence of the 6 nucleic acid oligonucleotide.
- SEQ ID NOS: 1-749 a subpopulation of oligonucleotides
- the population of first oligonucleotides includes all of the 6 nucleotide sequences set forth in SEQ ID NOS: 1-749. In another embodiment, the population of first oligonucleotides includes at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the 6 nucleotide sequences set forth in SEQ ID NOS: 1-749.
- a spacer portion is located between the defined sequence portion and the hybridizing portion in the first population of oligonucleotides.
- the spacer portion can, for example, be composed of a random selection of nucleotides. All or part of the spacer portion may or may not hybridize to the same target nucleic acid sequence as the hybridizing portion.
- the effect is to enhance the efficiency of cDNA synthesis primed by the oligonucleotide that includes the hybridizing portion and the hybridizing spacer portion.
- the population of first oligonucleotides further comprises a spacer region consisting of from 1 to 10 random nucleotides (A, C, T, or G) located between the primer binding site and the hybridizing portion.
- the population of first oligonucleotides includes all of the six nucleotide sequences set forth in SEQ ID NOS: 1-749 wherein each nucleotide sequence further comprises at least one spacer nucleotide at the 5' end.
- the present invention provides a population of second oligonucleotides wherein each oligonucleotide of the population includes (a) a sequence of a 6 nucleic acid oligonucleotide that is a member of a subpopulation of oligonucleotides (SEQ ID NOS:750- 1498), wherein the subpopulation of oligonucleotides hybridizes to all or substantially all first strand cDNAs reverse transcribed from RNAs expressed in mammalian cells but does not hybridize to first strand cDNAs reverse transcribed from ribosomal RNAs; and (b) a primer binding site (PBS#2) sequence (SEQ ID NO: 1500) located 5' to the sequence of the 6 nucleic acid oligonucleotide.
- SEQ ID NOS:750- 1498 a subpopulation of oligonucleotides
- the population of first oligonucleotides includes all of the 6 nucleotide sequences set forth in SEQ ID NOS:750-1498. In another embodiment, the population of first oligonucleotides includes at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the 6 nucleotide sequences set forth in SEQ ID NOS:750-1498.
- a spacer portion is located between the defined sequence portion and the hybridizing portion in the second population of oligonucleotides.
- the spacer portion can, for example, be composed of a random selection of nucleotides. All or part of the spacer portion may or may not hybridize to the same target nucleic acid sequence as the hybridizing portion.
- the effect is to enhance the efficiency of cDNA synthesis primed by the oligonucleotide that includes the hybridizing portion and the hybridizing spacer portion.
- the population of first oligonucleotides further comprises a spacer region consisting of from 1 to 10 random nucleotides (A, C, T, or G) located between the primer binding site and the hybridizing portion.
- the population of first oligonucleotides includes all of the six nucleotide sequences set forth in SEQ ID NOS:750-1498, wherein each nucleotide sequence further comprises at least one spacer nucleotide at the 5' end.
- the defined sequence portion of the first population of oligonucleotides and the defined sequence portion of the second population of oligonucleotides each consists of a length ranging from at least 10 nucleotides up to 30 nucleotides, such as from 10 to 12 nucleotides, from 10 to 14 nucleotides, from 10 to 16 nucleotides, from 10 to 18 nucleotides, and from 10 to 20 nucleotides.
- the defined sequence portion of each of the first and second population of oligonucleotides consists of 10 nucleotides, wherein the defined sequence portion comprises a PCR primer binding site, and wherein at least 8 consecutive nucleotides in the PCR binding site in each member of the first population of oligonucleotides have an identical sequence with at least 8 nucleotides in the PCR binding site in each member of the second population of oligonucleotides.
- the defined sequence portion of each of the first and second population of oligonucleotides consists of 10 nucleotides, wherein the defined sequence portion comprises a PCR primer binding site, and wherein at least 8 consecutive nucleotides in the PCR binding site in each member of the first population of oligonucleotides have an identical sequence with at least 8 nucleotides in the PCR binding site in each member of the second population of oligonucleotides, and wherein the remaining two nucleotides at the 3' end of the defined sequence portion in the first population of oligonucleotides are different (e.g., C, T) from the two nucleotides at the 3' end of the defined sequence portion in the second population of oligonucleotides (e.g., G, A), thereby allowing for the identification of the transcript strand (sense or antisense) after sequence analysis prior to alignment of the sequence reads.
- the defined sequence portion comprises a PCR primer binding site
- hybrid RNA/DNA oligonucleotides wherein the defined sequence portion of the first population of oligonucleotides comprises an RNA portion and a DNA portion, wherein the RNA portion is 5' with respect to the DNA portion.
- the 5' RNA portion of the hybrid primer consists of at least 11 RNA nucleotide defined sequence portions and the 3' DNA portion of the hybrid primer consists of at least three DNA nucleotides.
- the hybrid RNA/DNA oligonucleotides comprise SEQ ID NO: 1558 covalently attached to the 5' end of the NSR primers (SEQ ID NOS: 1-749).
- the cDNA generated using the hybrid RNA/DNA oligonucleotides may be used as a template for generating single- stranded amplified DNA using the methods described in U.S. Patent No. 6,946,251, hereby incorporated by reference, as further described in Example 6.
- a first population of oligonucleotides for first strand cDNA synthesis comprising a hybrid RNA/DNA defined sequence portion (SEQ ID NO: 1558) and a hybridizing portion (SEQ ID NOS: 1-749) forms the basis for replication of the target nucleic acid molecules in template RNA.
- the first population of oligonucleotides comprising the hybrid RNA/DNA primer portion hybridize to the target RNA in the RNA templates and the hybrid RNA/DNA primer is extended by an RNA-dependent DNA polymerase to form a first primer extension product (first strand cDNA). After cleavage of the template RNA, a second strand cDNA is formed in a complex with the first primer extension product.
- the double- stranded complex of first and second primer extension products is composed of an RNA/DNA hybrid at one end due to the presence of the hybrid primer in the first primer extension product.
- the double- stranded complex is then used to generate single- stranded DNA amplification products with an agent such as an enzyme which cleaves RNA from the RNA/DNA hybrid (such as RNAseH) which cleaves the RNA sequence from the hybrid, leaving a sequence on the second primer extension product available for binding by another hybrid primer, which may or may not be the same as the first hybrid primer.
- Another first primer extension product is produced by a highly processive DNA polymerase, such as phi29, which displaces the previously bound cleaved first primer extension product, resulting in displaced cleaved first primer extension product.
- a double- stranded complex for single- stranded DNA amplification is generated by modifying a double- stranded cDNA product (all DNA), generated using either random primers or NSR and anti-NSR primers, or a combination thereof.
- the double- stranded cDNA product is denatured and an RNA/DNA hybrid primer is annealed to a pre-determined primer sequence at the 3' end portion of the second strand cDNA.
- the DNA portion of the hybrid primer is then extended using reverse transcriptase to form a double- stranded complex with an RNA hybrid portion.
- the double- stranded complex is then used as a template for single- stranded DNA amplification by first treating with RNAseH to remove the RNA portion of the complex, adding the RNA/DNA hybrid primer, and adding a highly processive DNA polymerase, such as phi29 to generate single- stranded DNA amplification products.
- a population of first oligonucleotides is selected from a population of oligonucleotides based on the ability of the members of the population of oligonucleotides to hybridize under defined conditions to a target nucleic acid population but not hybridize under the same defined conditions to a non-target nucleic acid population.
- the defined hybridization conditions permit the first oligonucleotides to specifically hybridize to all nucleic acid molecules that are present in the sample except for ribosomal RNAs.
- hybridization conditions are no more than 25°C to 30 0 C (for example, 10 0 C) below the melting temperature (Tm) of the native duplex.
- exemplary hybridization conditions are 5°C to 10 0 C below Tm.
- the Tm of a short oligonucleotide duplex is reduced by approximately (500/oligonucleotide length)°C.
- the hybridization temperature is in the range of from 40 0 C to 50 0 C. The appropriate hybridization conditions may also be identified empirically without undue experimentation.
- the first population of oligonucleotides hybridizes to a target population of nucleic acid molecules at a temperature of about 4O 0 C.
- the second population of oligonucleotides hybridizes to a target population of nucleic acid molecules in a population of single- stranded primer extension products at a temperature of about 37 0 C.
- Amplification Conditions In the practice of the present invention, the amplification of the first subpopulation of a target nucleic acid population occurs under defined amplification conditions. Hybridization conditions can be chosen as described, supra. Typically, the defined amplification conditions include first strand cDNA synthesis using a reverse transcriptase enzyme. The reverse transcription reaction is performed in the presence of defined concentrations of deoxynucleotide triphosphates (dNTPs).
- dNTPs deoxynucleotide triphosphates
- the dNTP concentration is in a range from about 1000 to about 2000 microMolar in order to enrich the amplified product for target genes, as described in co-pending U.S. Patent Application Serial No. 11/589,322, filed October 27, 2006, incorporated herein by reference.
- An oligonucleotide primer useful in the practice of the present invention can be DNA, RNA, PNA, chimeric mixtures, or derivatives or modified versions thereof, as long as it is still capable of priming the desired reaction.
- the oligonucleotide primer can be modified at the base moiety, sugar moiety, or phosphate backbone and may include other appending groups or labels, so long as it is still capable of priming the desired amplification reaction.
- an oligonucleotide primer may comprise at least one modified base moiety that is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methy lino sine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannos
- an oligonucleotide primer can include at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
- an oligonucleotide primer can include at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
- An oligonucleotide primer for use in the methods of the present invention may be derived by cleavage of a larger nucleic acid fragment using non-specific nucleic acid cleaving chemicals or enzymes, or site-specific restriction endonucleases, or by synthesis by standard methods known in the art, for example, by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.) and standard phosphoramidite chemistry.
- phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (Nucl. Acids Res.
- methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., Proc. Natl. Acad. ScL U.S.A. 85:7448-7451, 1988).
- the desired oligonucleotide is synthesized, it is cleaved from the solid support on which it was synthesized and treated by methods known in the art to remove any protecting groups present.
- the oligonucleotide may then be purified by any method known in the art, including extraction and gel purification.
- concentration and purity of the oligonucleotide may be determined by examining an oligonucleotide that has been separated on an acrylamide gel or by measuring the optical density at 260 nm in a spectrophotometer.
- the methods of this aspect of the invention can be used, for example, to selectively amplify coding regions of mRNAs, introns, alternatively spliced forms of a gene, and non-coding RNAs that regulate gene expression.
- the present invention provides populations of oligonucleotides comprising at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the nucleic acid sequences set forth in SEQ ID NOS: 1-749.
- oligonucleotides can be used, for example, to prime the first strand synthesis of cDNA molecules complementary to RNA molecules isolated from a mammalian subject without priming the first strand synthesis of cDNA molecules complementary to ribosomal RNA molecules.
- these oligonucleotides can be used, for example, to prime the synthesis of cDNA using any population of RNA molecules as templates, without amplifying a significant amount of ribosomal RNAs or mitochondrial ribosomal RNAs.
- the present invention provides populations of oligonucleotides wherein a defined sequence portion, such as a transcriptional promoter such as the T7 promoter (SEQ ID NO: 1508), or a primer binding site (PBS#1) (SEQ ID NO: 1499) is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- a defined sequence portion such as a transcriptional promoter such as the T7 promoter (SEQ ID NO: 1508), or a primer binding site (PBS#1) (SEQ ID NO: 1499) is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- PBS#1 primer binding site
- the present invention provides populations of oligonucleotides wherein each oligonucleotide consists of the primer binding site SEQ ID NO: 1499 and a random spacer nucleotide (A, C, T, or G) is located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- the population of oligonucleotides includes at least 10% (such as 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%) of the six nucleotide sequences set forth in SEQ ID NOS: 1-749.
- the present invention provides populations of oligonucleotides comprising at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the nucleic acid sequences set forth in SEQ ID NOS:750-1498.
- These oligonucleotides can be used, for example, to prime the second strand synthesis of single- stranded primer extension products complementary to RNA molecules isolated from a mammalian subject without priming the second strand synthesis of cDNA molecules complementary to ribosomal RNA molecules.
- these oligonucleotides can be used, for example, to prime the synthesis second strand cDNA using any population of single stranded primer extension molecules as templates, without amplifying a significant amount of single- stranded primer extension molecules that are complementary to ribosomal RNAs or mitochondrial ribosomal RNAs.
- the present invention provides populations of oligonucleotides wherein a defined sequence portion, such as a transcriptional promoter such as the T7 promoter (SEQ ID NO: 1508), or a primer binding site (PBS#2) (SEQ ID NO: 1500) is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:750-1498.
- a defined sequence portion such as a transcriptional promoter such as the T7 promoter (SEQ ID NO: 1508), or a primer binding site (PBS#2) (SEQ ID NO: 1500) is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:750-1498.
- the present invention provides populations of oligonucleotides wherein each oligonucleotide consists of the primer binding site (PBS#2) SEQ ID NO: 1500 and a random spacer nucleotide (A, C, T, or G) is located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:750-1498.
- the population of oligonucleotides includes at least 10% (such as 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%) of the six nucleotide sequences set forth in SEQ ID NOS:750-1498.
- the present invention provides a reagent for selectively synthesizing single- stranded primer extension products (first strand cDNA) from a population of RNA template molecules.
- the reagent can be used, for example, to prime the synthesis of first strand cDNA molecules complementary to target RNA template molecules in a sample isolated from a mammalian subject without priming the synthesis of first strand cDNA molecules complementary to ribosomal RNA molecules.
- the reagent of the present invention comprises a population of oligonucleotides comprising at least 10% of the nucleic acid sequences set forth in SEQ ID NOS: 1-749.
- the present invention provides a reagent comprising a population of oligonucleotides that includes at least 10% (such as 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the six nucleotide sequences set forth in SEQ ID NOS: 1-749.
- the population of oligonucleotides is selected to hybridize to substantially all nucleic acid molecules that are present in a sample except for ribosomal RNAs and mitochondrial rRNAs.
- the population of oligonucleotides is selected to hybridize to a subset of nucleic acid molecules that are present in a sample, wherein the subset of nucleic acid molecules does not include ribosomal RNAs.
- the present invention provides a reagent for selectively synthesizing double- stranded cDNA from a population of single- stranded primer extension products (first strand cDNA).
- the reagent can be used, for example, to prime the synthesis of second strand cDNA molecules that are complementary to target RNA template molecules in a sample isolated from a mammalian subject without priming the synthesis of second-strand cDNA molecules complementary to ribosomal RNA molecules.
- the reagent in accordance with this aspect of the invention may be used to prime the synthesis of first strand cDNA generated using random primers, or may be used to prime the synthesis of first strand cDNA generated using NSR primers, such as SEQ ID NO: 1-749, in order to provide an additional step of selectivity of target molecules.
- the reagent according to this aspect of the present invention comprises a population of oligonucleotides comprising at least 10% of the nucleic acid sequences set forth in SEQ ID NOS:750-1498.
- the present invention provides a reagent comprising a population of oligonucleotides that includes at least 10% (such as 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the six nucleotide sequences set forth in SEQ ID NOS:750-1498.
- the population of oligonucleotides is selected to hybridize to substantially all first strand cDNA molecules that are present in a sample except for first strand cDNA synthesized from ribosomal RNAs and mitochondrial rRNAs.
- the population of oligonucleotides is selected to hybridize to a subset of first strand cDNA molecules that are present in a sample, wherein the subset of first strand cDNA molecules does not include cDNA molecules synthesized from ribosomal RNAs.
- the present invention provides a reagent that comprises a population of oligonucleotides wherein a defined sequence portion comprising a transcriptional promoter such as the T7 promoter is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- the present invention provides a reagent comprising populations of oligonucleotides wherein each oligonucleotide consists of the T7 promoter (SEQ ID NO: 1508) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- the present invention provides a reagent that comprises a population of oligonucleotides wherein a defined sequence portion comprising a primer binding site (e.g., PBS#1) is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- a reagent comprising populations of oligonucleotides wherein each oligonucleotide consists of the primer binding site (PBS#1) (SEQ ID NO: 1499) located 5' to a different member of the population of oligonucleotides having the sequences set forth as SEQ ID NOS: 1-749.
- the present invention provides a reagent the further comprises a spacer region of at least one random nucleotide located between the primer binding site and a different member of the population of oligonucleotides having the sequences set forth as SEQ ID NOS: 1-749.
- the present invention provides a reagent that comprises a population of oligonucleotides wherein a defined sequence portion comprising a transcriptional promoter such as the T7 promoter is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:750-1498.
- the present invention provides a reagent comprising populations of oligonucleotides wherein each oligonucleotide consists of the T7 promoter (SEQ ID NO: 1508) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:750-1498.
- the present invention provides a reagent that comprises a population of oligonucleotides wherein a defined sequence portion comprising a primer binding site (e.g., PBS#2) is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:750-1498.
- a reagent comprising populations of oligonucleotides wherein each oligonucleotide consists of the primer binding site (PBS#2) (SEQ ID NO: 1500) located 5' to a different member of the population of oligonucleotides having the sequences set forth as SEQ ID NOS:750-1498.
- the present invention provides a reagent the further comprises a spacer region of at least one random nucleotide located between the primer binding site and a different member of the population of oligonucleotides having the sequences set forth as SEQ ID NOS:750-1498.
- the reagents of the present invention can be provided as an aqueous solution or an aqueous solution with the water removed or a lyophilized solid.
- the reagent of the present invention may include one or more of the following components for the production of double- stranded cDNA: a reverse transcriptase, a DNA polymerase, a DNA ligase, an RNase H enzyme, a Tris buffer, a potassium salt, a magnesium salt, an ammonium salt, a reducing agent, deoxynucleoside triphosphates (dNTPs), [beta] -nicotinamide adenine dinucleotide ( ⁇ -NAD+), and a ribonuclease inhibitor.
- dNTPs deoxynucleoside triphosphates
- ⁇ -NAD+ [beta] -nicotinamide adenine dinucleotide
- ribonuclease inhibitor a reverse transcriptase, a DNA polymerase, a DNA ligase, an RNase H enzyme, a Tris buffer, a potassium salt, a magnesium salt, an ammoni
- the reagent may include components optimized for first strand cDNA synthesis, such as a reverse transcriptase with reduced RNase H activity and increased thermal stability (e.g., SuperscriptTM III Reverse Transcriptase, Invitrogen), and a final concentration of dNTPs in the range of from 50 to 5000 microMolar or, more preferably, in the range of from 1000 to 2000 microMolar.
- a reverse transcriptase with reduced RNase H activity and increased thermal stability e.g., SuperscriptTM III Reverse Transcriptase, Invitrogen
- a final concentration of dNTPs in the range of from 50 to 5000 microMolar or, more preferably, in the range of from 1000 to 2000 microMolar.
- kits for selectively amplifying a target population of nucleic acid molecules within a population of RNA template molecules in a sample obtained from a mammalian subject comprise (a) a first reagent that comprises a first population of oligonucleotide primers wherein a defined sequence portion such as a primer binding site (PBS#1) is located 5' to a hybridizing portion consisting of 6 nucleotides selected from all possible oligonucleotides having a length of 6 nucleotides that do not hybridize under defined conditions to the non-target population of nucleic acid molecules in the population of RNA template molecules, wherein the non-target population of nucleic acid molecules consists essentially of the most abundant nucleic acid molecules in the population of RNA template molecules, (b) a second reagent that comprises a second population of oligonucleotide primers wherein a defined sequence portion such as a primer binding site (PBS#2), is located
- the first reagent comprises a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- the present invention provides kits containing a first reagent comprising a first population of oligonucleotides wherein each oligonucleotide consists of a first primer binding site (PBS#1) (SEQ ID NO: 1499) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-749.
- PBS#1 primer binding site
- kits containing a second reagent comprising a second population of oligonucleotides wherein each oligonucleotide consists of a second primer binding site (PBS#2) (SEQ ID NO: 1500) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:750-1498.
- PBS#2 second primer binding site
- the invention provides kits containing a first PCR primer comprising at least 10 consecutive nucleotides that hybridize to the defined sequence portion in the first oligonucleotide population, and optionally comprises an additional sequence tail that does not hybridize to the first oligonucleotide population and a second PCR primer comprising at least 10 consecutive nucleotides that hybridize to the defined sequence portion in the second oligonucleotide population, and optionally comprises an additional sequence tail that does not hybridize to the second oligonucleotide population.
- the first PCR primer consists of SEQ ID NO: 1501
- the second PCR primer consists of SEQ ID NO: 1502.
- kits according to this embodiment are useful for producing amplified PCR products from cDNA generated using the Not-So-Random primers (SEQ ID NOS: 1-749) and the anti-NSR (SEQ ID NOS:750- 1498) primers of the invention.
- kits of the invention may be designed to detect any target nucleic acid population, for example, all RNAs expressed in a cell or tissue except for the most abundantly expressed RNAs, in accordance with the methods described herein.
- exemplary oligonucleotide primers include SEQ ID NOS: 1-749.
- primer binding regions are set forth as SEQ ID NOS: 1499 and 1500.
- the spacer portion may include any combination of nucleotides including nucleotides that hybridize to the target RNA.
- the kit comprises a reagent comprising oligonucleotide primers with hybridizing portions of 6, 7, or 8 nucleotides. In certain embodiments, the kit comprises a reagent comprising a population of oligonucleotide primers that may be used to detect a plurality of mammalian mRNA targets.
- the kit comprises oligonucleotides that hybridize in the temperature range of from 40 0 C to 50 0 C.
- the kit comprises a subpopulation of oligonucleotides that do not detect rRNA or mitochondrial rRNA.
- Exemplary oligonucleotides for use in accordance with this embodiment of the kit are provided in SEQ ID NOS: 1-749 and SEQ ID NOS:750-1498.
- the kits comprises a reagent comprising a population of oligonucleotides comprising at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the six nucleotide sequences set forth in SEQ ID NOS: 1-749.
- kits comprise a reagent comprising a population of oligonucleotides comprising at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the six nucleotide sequences set forth in SEQ ID NOS:750-1498.
- the kit includes oligonucleotides wherein the transcription promoter comprises the T7 promoter (SEQ ID NO: 1508), the SP6 promoter (SEQ ID NO: 1509), or the T3 promoter (SEQ ID NO: 1510).
- the kit may comprise oligonucleotides with a spacer portion of from 1 to 12 nucleotides that comprises any combination of nucleotides.
- the kit may further comprise one or more of the following components for the production of cDNA: a reverse transcriptase enzyme a DNA polymerase enzyme, a DNA ligase enzyme, an RNase H enzyme, a
- Tris buffer a potassium salt (e.g., potassium chloride), a magnesium salt (e.g., magnesium chloride), an ammonium salt (e.g., ammonium sulfate), a reducing agent
- the kit may include components optimized for first strand cDNA synthesis, such as a reverse transcriptase with reduced RNase H activity and increased thermal stability (e.g.,
- dNTP stock solution to provide a final concentration of dNTPs in the range of from 50 to 5000 microMolar or, more preferably, in the range of from 1000 to 2000 microMolar.
- the kit may include a detection reagent such as SYBR green dye or BEBO dye that preferentially or exclusively binds to double- stranded DNA during a PCR amplification step.
- the kit may include a forward and/or reverse primer that includes a fluorophore and quencher to measure the amount of the PCR amplification products.
- kits of the invention can also provide reagents for in vitro transcription of the amplified cDNAs.
- the kit may further include one or more of the following components: a RNA polymerase enzyme, an IPPase (Inositol polyphosphate 1 -phosphatase) enzyme, a transcription buffer, a Tris buffer, a sodium salt
- the kit may include reagents for labeling the in vitro transcription products with Cy3 or Cy5 dye for use in hybridizing the labeled cDNA samples to microarrays.
- the kit may include reagents for labeling the double- stranded PCR products.
- the kit may include reagents for incorporating a modified base, such as amino-allyl dUTP, during PCR which can later be chemically coupled to amine-reactive Cy dyes.
- the kit may include reagents for direct chemical linkage of Cy dyes to guanine residues for labeling PCR products.
- the kit may include one or more of the following reagents for sequencing the double- stranded PCR products: Taq DNA Polymerase, T4
- the kit optionally includes instructions for using the kit in the selective amplification of mRNA targets.
- the kit can also be optionally provided with instructions for in vitro transcription of the amplified cDNA molecules and with instructions for labeling and hybridizing the in vitro transcription products to microarrays.
- the kit can also be provided with instructions for labeling and/or sequencing.
- the kit can also be provided with instructions for cloning the PCR products into an expression vector to generate an expression library representative of the transcriptome of the sample at the time the sample was taken.
- the present invention provides methods of selectively amplifying a target population of nucleic acid molecules to generate selectively amplified cDNA molecules.
- the method according to this aspect of the invention comprises (a) providing a first population of oligonucleotides, wherein each oligonucleotide comprises a hybridizing portion and first PCR primer binding site located 5' to the hybridizing portion, (b) annealing the first population of oligonucleotides to a sample comprising RNA templates isolated from a mammalian subject; (c) synthesizing cDNA from the RNA using a reverse transcriptase enzyme; (d) synthesizing double- stranded cDNA using a DNA polymerase and a second population of oligonucleotides, wherein each oligonucleotide comprises a hybridizing portion and a second PCR binding site located 5' to the hybridizing portion, wherein the hybridizing portion is a member of the population of oligonucleotides compris
- the method further comprises PCR amplifying the double- stranded cDNA molecules.
- FIGURE 1C shows a representative embodiment of the methods according to this aspect of the invention.
- the first primer mixture comprises a first PCR primer binding site (PBS#1) located 5' to a hybridizing portion, wherein the hybridizing portion comprises a population of random 9mers.
- the present invention provides methods of selectively amplifying a target population of nucleic acid molecules to generate selectively amplified aDNA molecules.
- FIGURE ID shows a representative embodiment of the methods according to this aspect of the invention.
- the first primer mixture comprises a first PCR primer binding site (PBS#1) located 5' to the hybridizing portion, wherein the hybridizing portion is a member of the population of oligonucleotides comprising SEQ ID NOS: 1-749.
- the method further comprises PCR amplifying the double- stranded cDNA using thermostable DNA polymerase, a first PCR primer that binds to the first PCR primer binding site and a second PCR primer that binds to the second PCR primer binding site to generate amplified double- stranded DNA (aDNA).
- aDNA amplified double- stranded DNA
- the method further comprises the step of sequencing at least a portion of the aDNA.
- any DNA-dependent DNA polymerase may be utilized to synthesize second-strand DNA molecules from the first strand cDNA.
- the Klenow fragment of DNA Polymerase I can be utilized to synthesize the second strand DNA molecules.
- the synthesis of second strand DNA molecules is primed using a second population of oligonucleotides comprising a hybridizing portion consisting of from 6 to 9 nucleotides and further comprising a defined sequence portion 5' to the hybridizing portion.
- the defined sequence portion may include any suitable sequence, provided that the sequence differs from the defined sequence contained in the first population of oligonucleotides. Depending on the choice of primer sequence, these defined sequence portions can be used, for example, to selectively direct DNA-dependent RNA synthesis from the second DNA molecule and/or to amplify the double- stranded cDNA template via DNA-dependent DNA synthesis.
- Double-Stranded DNA Molecules Synthesis of the second DNA molecules yields a population of double- stranded DNA molecules wherein the first DNA molecules are hybridized to the second DNA molecules, as shown in FIGURE ID.
- the double- stranded DNA molecules are purified to remove substantially all nucleic acid molecules shorter than 50 base pairs, including all or substantially all (i.e., typically more than 99%) of the second primers.
- the purification method selectively purifies DNA molecules that are substantially double- stranded and removes substantially all unpaired, single- stranded nucleic acid molecules such as single- stranded primers.
- Purification can be achieved by any art-recognized means, such as by elution through a size-fractionation column.
- the purified second DNA molecules can then, for example, be precipitated and redis solved in a suitable buffer for the next step of the methods of this aspect of the invention.
- the double-stranded DNA molecules are utilized as templates that are enzymatically amplified using the polymerase chain reaction.
- Any suitable primers can be used to prime the polymerase chain reaction.
- two primers are used — one primer hybridizes to the defined portion of the first primer sequence (or to the complement thereof), and the other primer hybridizes to the defined portion of the second primer sequence (or to the complement thereof).
- a desirable number of amplification cycles is between 5 and 40 amplification cycles, such as from 5 to 35, such as from 10 to 30 amplification cycles.
- typically a cycle comprises a melting temperature such as 95 0 C, an annealing temperature that varies from about 4O 0 C to 7O 0 C, and an elongation temperature that is typically about 72 0 C.
- the annealing temperature is from about 55 0 C to 65 0 C, more preferably about 6O 0 C.
- amplification conditions for use in this aspect of the invention comprise 10 cycles of (95 0 C, 30 sec; 6O 0 C, 30 sec; 72 0 C, 60 sec) then 20 cycles of (95 0 C, 30 sec; 6O 0 C, 30 sec, 72 0 C, 60 sec (+ 10 sec added to the elongation step with each cycle)).
- dNTPs are typically present in the reaction in a range from 50 ⁇ M to 2000 ⁇ M dNTPs and, more preferably, from 800 to 1000 ⁇ M.
- MgCl 2 is typically present in the reaction in a range from 0.25 mM to 10 mM, and more preferably about 4 mM.
- the forward and reverse PCR primers are typically present in the reaction from about 50 nM to 2000 nM, and more preferably present at a concentration of about 1000 nM. DNA Labeling.
- the amplified DNA molecules can be labeled with a dye molecule to facilitate use as a probe in a hybridization experiment, such as a probe used to screen a DNA chip.
- a dye molecule to facilitate use as a probe in a hybridization experiment, such as a probe used to screen a DNA chip.
- Any suitable dye molecules can be utilized, such as fluorophores and chemiluminescers.
- An exemplary method for attaching the dye molecules to the amplified DNA molecules is provided in Example 5.
- the methods according this aspect of the invention may be used, for example, for transcriptome profiling in a biological sample containing total RNA.
- the amplified aDNA generated from cDNA using NSR priming in the first strand cDNA and anti-NSR priming in the second- strand synthesis produced in accordance with the methods of this aspect of the invention is labeled for use in gene expression experiments, thereby providing a hybridization based reagent that typically produces a lower level of background than amplified RNA generated from NSR-primed cDNA.
- the defined sequence portion of the first and/or second primer binding regions further includes one or more restriction enzyme sites, thereby generating a population of amplified double- stranded DNA products having one or more restriction enzyme sites flanking the amplified portions.
- These amplified products may be used directly for sequence analysis or may be released by digestion with restriction enzymes and subcloned into any desired vector, such as an expression vector for further analysis.
- Sequence analysis of the PCR products may be carried out using any DNA sequencing method, such as, for example, the dideoxy chain termination method of Sanger, dye-terminator sequencing methods, or a high throughput sequencing method as described in U.S. Patent No. 7,232,656 (Solexa), hereby incorporated by reference.
- the invention provides a population of selectively amplified nucleic acid molecules comprising a representation of a target population of nucleic acid molecules within a population of RNA template molecules is a sample isolated from a mammalian subject, each amplified nucleic acid molecule comprising: a 5' defined sequence portion flanking a member of the population of amplified nucleic acid sequences, and a 3' defined sequence, wherein the population of selectively amplified sequences comprises amplified nucleic acid sequence corresponding to a target RNA molecule expressed in the mammalian subject, and is characterized by having the following properties with reference to the particular mammalian species: (a) having greater than 75% poly-adenylated and non-polyadenylated transcripts and having less than 10% ribosomal RNA (e.g., rRNA (18S or 28S) and mt-RNA).
- ribosomal RNA e.g., rRNA (18S or 28S
- mt-RNA
- the populations of selectively amplified nucleic acid molecules in accordance with this aspect of the invention can be generated using the methods of the invention described herein.
- the population of selectively amplified nucleic acid molecules may be cloned into an expression vector to generate a library.
- the population of selectively amplified nucleic acid molecules may be immobilized on a substrate to make a microarray of the amplification products.
- the microarray may comprise at least one amplification product immobilized on a solid or semi- solid substrate fabricated from a material selected from the group consisting of paper, glass, ceramic, plastic, polystyrene, polypropylene, nylon, polyacrylamide, nitrocellulose, silicon, metal, and optical fiber.
- An amplification product may be immobilized on the solid or semi-solid substrate in a two-dimensional configuration or a three-dimensional configuration comprising pins, rods, fibers, tapes, threads, beads, particles, microtiter wells, capillaries and cylinders.
- This Example describes the selection of a first population (Not-So-Random, "NSR”) of 749 6-mer oligonucleotides (SEQ ID NOS: 1-749) that hybridizes to all or substantially all RNA molecules expressed in mammalian cells but that does not hybridize to nuclear ribosomal RNA (18S and 28S rRNA) or mitochondrial ribosomal RNA (12S and 16S mt-rRNA).
- SEQ ID NOS:750-1498 was also generated that is the reverse complement of the NSR oligos.
- the NSR oligo population may be used to prime first strand cDNA synthesis and the anti-NSR oligo population may be used to prime second strand cDNA synthesis.
- Random 6-mers can anneal at every nucleotide position on a transcript sequence from the RefSeq database (represented as "nucleotide sequence"), as shown in FIGURE IA.
- NSR oligonucleotides show a perfect match to every 4 to 5 nucleotides on nucleic acid sequences within the RefSeq database (represented as "nucleotide sequence"), as shown in FIGURE IB.
- each nucleotide was A, T (or U), C, or G.
- the reverse complement of each 6-mer oligonucleotide was compared to the nucleotide sequences of 18S and 28S rRNAs, and to the nucleotide sequences of 12S and 16S mitochondrial rRNAs, as shown below in TABLE 1.
- the reverse complements of 749 6-mers did not perfectly match any portion of the rRNA transcripts.
- the 749 6-mer oligonucleotides (SEQ ID NOS: 1-749) that do not have a perfect match to any portion of the rRNA genes and mt-rRNA genes are referred to as "Not-So-Random" ("NSR") primers.
- NSR Not-So-Random
- the population of 749 6-mers (SEQ ID NOS: 1-749) is capable of amplifying all transcripts except 18S, 28S, and mitochondrial rRNA (12S and 16S).
- the population of NSR oligos may be used to prime first strand cDNA synthesis, as described in EXAMPLE 2, which may then be followed by second strand synthesis using either random primers, or anti-NSR primers.
- a population of anti-NSR oligos SEQ ID NO: 1
- NOS:750-1498 may be used to prime second strand cDNA synthesis.
- first strand cDNA synthesis may be carried out using random primers, followed by second strand cDNA synthesis using anti-NSR primers.
- first strand cDNA synthesis may be carried out using NSR primers, followed by second strand cDNA synthesis using anti-NSR primers.
- RNA Samples For gene profiling of mammalian cells other than human (e.g., rat, mouse), a similar approach may be carried out by subtracting out ribosomal nuclear rRNA of the genes corresponding to 18S and 28S, as well as subtracting out ribosomal mitochondrial rRNA of the genes corresponding to 12S and 16S from the respective mammalian species.
- Gene profiling of plant cells may also be carried out by generating a population of Not-So-Random (NSR) primers that exclude chloroplast ribosomal RNA.
- NSR Not-So-Random
- primers were synthesized individually as follows:
- a first population of NSR-6mer primers (SEQ ID NOS: 1-749) and a second population of anti-NSR-6mer primers (SEQ ID NOS:750-1498) were generated as described in Example 1.
- the first primer set of NSR primers for use in first strand cDNA synthesis (SEQ ID NOS: 1-749) further comprises the following 5' primer binding sequence:
- PBS#1 5' TCCGATCTCT 3' (SEQ ID NO: 1499) covalently attached at the 5' end (otherwise referred to as "tailed")
- each NSR-6mer optionally included at least one spacer nucleotide (N) (where each
- N A, G, C, or T) where (N) was located between the 5'PBS#1 and the NSR-6mer.
- the population of anti-NSR-6mer primers for use in second strand cDNA synthesis (SEQ ID NOS:750-1498) further comprises the following 5' primer binding sequence:
- PBS#2 5TCCGATCTGA 3'(SEQ ID NO: 1500) covalently attached at the 5' end of the anti-NSR-6mer primers (otherwise referred to as "tailed"),
- Forward and Reverse Primers (for PCR Amplification).
- the following forward and reverse primers were synthesized to amplify double- stranded cDNA generated using NSR-6mers tailed with PBS#1 (SEQ ID NO: 1499) and anti-NSR-6mers tailed with PBS#2 (SEQ ID NO: 1500).
- the 5' most region of the forward primer (SEQ ID NO: 1501) and reverse primer (SEQ ID NO: 1502) each include a lOmer sequence of (N) nucleotides.
- the 5' -most region of the forward primer (SEQ ID NO: 1501) and reverse primer (SEQ ID NO: 1502) each include more than 10 (N) nucleotides, such as at least 20 (N) nucleotides, at least 30 (N) nucleotides, or at least 40 (N) nucleotides to facilitate DNA sequencing of the amplified PCR products.
- NSR primers that include the core set of 6-mer NSR oligos with no perfect match to globin (alpha or beta), no perfect match to rRNA (18S, 28S).
- T7 5' AATTAATACGACTCACTATAGGGAGA 3' (SEQ ID NO: 1508)
- SP6 5' ATTTAGGTGACACTATAGAAGNG 3' (SEQ ID NO: 1509)
- T3 5'AATTAACCCTCACTAAAGGGAGA 3' (SEQ ID NO: 1510)
- Primer Pool Configurations Used to Amplify RNA. Primers were synthesized individually as described above and pooled in the following configuration, then the primer pools were used to generate libraries of amplified nucleic acids from total RNA as described below.
- R rRNA (18S or 28S)
- M mt-rRNA (12S or 16S)
- G globin (HBAl, HBA2, HBB, HBD, HBGl, HBG2)
- first strand cDNA was generated from RNA using reverse transcription that was primed with NSR primers comprising a first primer binding site (PBS#1) to generate NSR primed first strand cDNA
- second strand cDNA synthesis was primed with anti-NSR primers comprising a second primer binding site (PBS#2)
- the synthesized cDNA was PCR amplified using forward and reverse primers that bind to the first and second primer binding sites to generate amplified DNA (aDNA).
- the sample was mixed, incubated at 23 0 C for 10 minutes, transferred to a 4O 0 C pre-warmed thermal cycler (to provide a "hot start"), and the sample was then incubated at 4O 0 C for 30 minutes, 7O 0 C for 15 minutes, and chilled to 4 0 C.
- a second strand synthesis cocktail was prepared as follows:
- the resulting double- stranded cDNA was purified using Spin Cartridges obtained from Ambion (Message AmpTM II aRNA Amplification Kit, Ambion Cat #AM1751) and buffers supplied in the kit according to the manufacturer's directions. A total volume of 30 ⁇ l was eluted from the column, of which 20 ⁇ l was used for follow-on PCR.
- PCR program #2 94 0 C for 2 minutes 94 0 C for 10 seconds 2 cycles of: • 4O 0 C for 10 sec
- results were analyzed in terms of (1) measuring amplified DNA "aDNA” yield; (2) evaluation of an aliquot of the aDNA on an agarose gel to confirm that the population of species in the cDNA was equally represented; and (3) measuring the level of amplification of selected reporter genes by qPCR (as described in Example 3).
- the PCR products were analyzed on 2% agarose gels. A DNA smear between
- RNAse H treatment reduced the amount of contamination from amplified rRNA if the NSR primer pool was used only for first strand cDNA synthesis followed by random primed second strand synthesis.
- NSR primers were used to prime the first strand synthesis, followed by the use of anti-NSR primers to prime the second strand synthesis, then RNAse treatment was not found to affect specificity of the resulting cDNA product.
- RNAse may be added to second strand cDNA synthesis using anti-NSR primers to improve efficiency of the reaction by making the cDNA more available as a template during the Klenow reaction.
- anti-NSR primers during second strand synthesis provided several unexpected advantages for selective amplification of target nucleic acid molecules. For example, it was unexpectedly found that the magnitude of rRNA depletion during second strand synthesis using anti-NSR primers was nearly identical to the magnitude of rRNA depletion observed using NSR primers during reverse transcription. In addition, it was an unexpected result that priming specificity during second strand synthesis was achieved under standard reaction conditions using Klenow enzyme. These results indicate that short oligonucleotides can be used to specifically prime DNA synthesis using a variety of polymerases and nucleic acid templates, however, the reaction conditions that dictate priming specificity may be enzyme- specific.
- This Example shows that the 749 NSR 6-mers (SEQ ID NOS: 1-749) (that each have PBS#1 (SEQ ID NO: 1499 plus N spacer) covalently attached at the 5' end) for first strand cDNA synthesis followed by the 749 anti-NSR 6-mers (SEQ ID NOS:750-1498) (that each have PBS#2 (SEQ ID NO: 1500 plus N spacer) covalently attached at the 5' end) prime the amplification of a substantial fraction of the transcriptome present in a sample containing total RNA.
- each PCR reaction was purified using the Qiagen MinElute spin column. The column was washed with 80% ethanol and eluted with 20 ⁇ L of elution buffer. The yield was quantitated with UV/VIS spectrometer using the NanoDrop instrument. Samples were then diluted and characterized by quantitative PCR (qPCR) using the following assays:
- the cDNA generated using the primer pool with NSR#1 + NSR#3 (NSR-6mers that do not hybridize to mt-rRNA or rRNA) for first strand cDNA synthesis and the primer pool anti-NSR#5 and anti-NSR#7 for second strand synthesis showed a substantial reduction in abundance of rRNA (0.086% 18S; 0.673% 28S) and a reduced abundance of mt-rRNA (1.807% 12S; and 8.512% 16S) as compared to cDNA generated with random 8-mers.
- FIGURE 4A graphically illustrates the gene-specific polyA content of cDNA amplified using various NSR primers during first strand synthesis and anti-NSR primers or random primers during second strand synthesis as determined using a set of representative gene-specific assays for PPIA, SRP14, STMNl, TRIM63, ACTB, DBNl, EIF3S3, GAPDH, and NUCB2.
- Relative abundance of the polyA content shown in FIGURE 4A was calculated by first combining the input adjusted raw abundance values of individual rRNA assays by transcript.
- the collapsed rRNA transcript abundance values were normalized to NUCB2 gene levels measured within each sample preparation such that gene content was equal to 1.0.
- the rRNA/gene ratios calculated for amplified samples were then normalized to that obtained for the unamplified control (N8) such that N8 was equal to 100 for each rRNA transcript. Therefore, the N8 was used as the standard value for the abundance level of each gene.
- saNSR.1 refers to cDNA amplified using NSR#1 primer pool in the first strand synthesis and anti-NSR#5 primer pool in the second strand synthesis (i.e., depleted for rRNA, mt-rRNA and globin in first and second strand synthesis).
- saNSR.1+2 refers to cDNA amplified using NSR#l+#2 primer pools in the first strand synthesis and anti-NSR#5+#6 primer pools in the second strand synthesis (i.e., depleted for rRNA and globin, but not depleted for mt-rRNA in both first and second strand synthesis).
- saNSR.1+3 refers to cDNA amplified using NSR#l+#3 primer pools in the first strand synthesis and anti-NSR #5 +#7 primer pools in the second strand synthesis (i.e., depleted for rRNA and mt-rRNA, but not depleted for globin in both first and second strand synthesis).
- saNSR.1+4 refers to cDNA amplified using NSR#l+#4 primer pools in the first strand synthesis and anti-NSR#5+#8 primer pools in the second strand synthesis (i.e., depleted for rRNA, but not depleted for mt-rRNA and globin in both first and second strand synthesis).
- Y4R-NSR refers to cDNA amplified using NSR primers including the core set of 6-mer NSR oligos with no perfect match to globin (alpha or beta), no perfect match to rRNA (18S, 28S).
- Y4-N7 refers to cDNA amplified using random 7-mer primers during first and second strand synthesis.
- N8 refers to first strand synthesis using random 8mers (no second strand synthesis).
- the NSR priming for first strand synthesis amplified gene-specific transcripts at least as efficiently as random primers, with the exception of the gene TRIM63.
- FIGURE 4B graphically illustrates the relative abundance level of non-polyadenylated RNA transcripts in cDNA amplified from Jurkat-1 and Jurkat-2 total RNA using various NSR primers during first strand cDNA synthesis.
- gene specific content in the cDNA amplified using NSR and anti-NSR primers is enriched as the rRNA and mt-rRNA content is decreased.
- NSR-dependent rRNA depletion is not a general effect, but rather is specific to the transcripts targeted for removal.
- FIGURE 5 graphically illustrates the log ratio of Jurkat/K562 mRNA expression data measured in cDNA generated using the primer pool NSR#l+#3 (x-axis) versus the log ratio of Jurkat/K562 mRNA expression data measured in cDNA generated using the random primer pool N8 (no amplification). This result shows that the relative abundance of messenger RNA in different samples is preserved through NSR priming and PCR amplification.
- FIGURE 6A graphically illustrates the proportion of rRNA to mRNA in total
- RNA that is typically obtained after polyA purification using conventional methods includes approximately 98% rRNA and approximately 2% mRNA and other (non-polyA RNA). As shown, even after 95% removal of rRNA from total RNA using polyA purification, the remaining RNA consists of a mixture of about 50% rRNA and 50% mRNA.
- FIGURE 6B graphically illustrates the proportion of rRNA to mRNA in a cDNA sample prepared using NSR primers during first strand cDNA synthesis and anti-NSR primers during second strand cDNA synthesis.
- NSR primers and anti-NSR primers to generate cDNA from total RNA is effective to remove 99.9% rRNA (including nuclear and mitochondrial rRNA), resulting in a cDNA population enriched for greater than 95% mRNA. This is a very significant result for several reasons.
- the use of polyA purification or strategies that rely on primer binding to the polyA tail of mRNA exclude non-polyA containing RNA molecules such as, for example, miRNA and other molecules of interest, and therefore exclude nucleic acid molecules that contribute to the richness of the transcriptome.
- the methods of the present invention that include the use of NSR primers and anti-NSR primers during cDNA synthesis do not require polyA selection and therefore preserve the richness of the transcriptome.
- the use of NSR and anti-NSR primers during cDNA synthesis is effective to generate cDNA with removal of 99.9% rRNA, resulting in cDNA with less than 10% rRNA contamination, as shown in FIGURE 6B.
- This Example shows that the use of the 749 NSR-6mers (SEQ ID NOS: 1-749) (each has a spacer N and the PBS#1 (SEQ ID NO: 1499) covalently attached at the 5' end) for first strand cDNA synthesis and the use of the 749 anti-NSR-6mers (SEQ ID NOS:750-1498) (that each have a spacer N and the PBS#2 (SEQ ID NO: 1500) covalently attached at the 5' end) prime the amplification of a substantial fraction of the transcriptome (both polyA+ and polyA-) and do not prime unwanted non-target sequences present in total RNA, as determined by sequence analysis of the amplified cDNA.
- cDNA was generated using 749 NSR-6mers (SEQ ID NOS: 1-749) (each has a spacer N and the PBS#1 (SEQ ID NO: 1499) covalently attached at the 5' end) for first strand cDNA synthesis and the use of the 749 anti-NSR-6mers (SEQ ID NOS:750-1498) (each has a spacer N and the PBS#2 (SEQ ID NO: 1500) covalently attached at the 5' end), with the various primer pools shown in TABLE 8, using the methods described in Example 2.
- the cDNA products were PCR amplified and column purified as described in Example 2.
- the column-purified PCR products were then cloned into TOPO vectors using the pCR-XL TOPO kit (Invitrogen).
- the TOPO ligation reaction was carried out with 1 ⁇ l PCR product, 4 ⁇ l water and 1 ⁇ l of vector.
- Chemically competent TOPlO One Shot cells (Invitrogen) were transformed and plated onto LB+Kan (50 ⁇ g/mL) and grown overnight at 37 0 C. Colonies were screened for inserts using PCR amplification. It was determined by 2% agarose gel analysis that all clones had inserts of at least 100 bp (data not shown).
- the clones were then used as templates for DNA sequence analysis. Resulting sequences were run against a public database for determining homology to rRNA species and the genome.
- TABLE 9 provides the results of sequence analysis of the PCR products generated from cDNA synthesized using the various primer pools shown in TABLE 8.
- This Example describes methods that are useful to label the aDNA (PCR products) for subsequent use in gene expression monitoring applications.
- aDNA PCR product obtained as described in Example 2
- labeling reagent as described by the manufacturer.
- the labeling reagents covalently attach Cy3 or Cy5 to the nucleic acid sample, which can then be used in almost any molecular biology application, such as gene expression monitoring.
- the labeled aDNA was then purified and its fluorescence was measured relative to the starting label.
- aDNA PCR product generated using the NSR and anti-NSR primer pool as described in Example 2
- a PCR reaction mix as follows: « 100 to 1000 ⁇ M aadUTP+dCTP+cATP+dGTP+dUTP (the optimal balance of aadUTP to dUTP may be empirically determined using routine experimentation)
- PCR Reaction 5 to 20 cycles of PCR (94 0 C 30 seconds, 6O 0 C 30 seconds, 72 0 C
- PCR Reaction 5 to 20 cycles of PCR (94 0 C 30 seconds, 6O 0 C 30 seconds, 72 0 C
- EXAMPLE 6 This Example describes the use of a hybrid RNA/DNA primer covalently linked to NSR-6mers to generate amplified nucleic acid templates useful for generating single- stranded DNA molecules for gene expression analysis.
- the defined sequence portion (e.g., PBS#1) of a first oligonucleotide population for first strand cDNA synthesis, and/or the defined sequence portion (e.g., PBS#2) of a second oligonucleotide population for second strand cDNA synthesis comprises an RNA portion to generate an amplified nucleic acid template suitable for generating multiple copies of DNA products using strand displacement, as described in U.S. Patent No. 6,946,251, hereby incorporated by reference.
- a hybrid NSR primer (PBS#1(RNA/DNA)/NSR) may be used to synthesize first strand cDNA, thereby generating products suitable for use as templates for synthesis of single- stranded DNA having a sequence complementary to template RNA.
- an RNA/DNA hybrid primer tail may be added after second strand synthesis, as described in more detail below.
- One advantage provided by this method is the ability to generate a plurality of single- stranded amplification products of the original cDNA sequence, and not the amplification of the product of the amplification itself.
- the population of NSR primers for use in first strand cDNA synthesis may further comprise a 5' primer binding sequence (RNA), such as hybrid PBS#1:
- Hybrid PBS#1 (RNA) 5' GACGG AUGCGGUCU 3' (SEQ ID NO: 1557) covalently attached at the 5' end of the NSR primers.
- RNA:DNA hybrid oligonucleotides having an RNA defined sequence portion located 5' to the DNA hybridizing portion with the following configuration:
- the process of preparing the first strand cDNA is carried out essentially as described in Example 2, with the substitution of the hybrid PBS#1 (SEQ ID NO: 1557) (RNA) for the PBS#1 (SEQ ID NO: 1499) (DNA), with the use of an RNAseH- reverse transcriptase and without the addition of RNAseH prior to second strand cDNA synthesis, to generate a double- stranded substrate for amplification of single- stranded DNA products
- the substrate for single stranded amplification preferably consists of a double stranded template with the first strand consisting of an RNA/DNA hybrid molecule and the second strand consisting of all DNA.
- second strand synthesis is carried out using an RNAseH- reverse transcriptase.
- the second strand synthesis may be carried out using Klenow followed by a polished step with RNAseH- reverse transcriptase, since Klenow will not use RNA as a template.
- Second strand cDNA synthesis may be carried out using either random primers, or using anti-NSR primers.
- the use of the RNA hybrid/NSR primer population during first strand cDNA synthesis results in the incorporation of a unique sequence of the RNA portion of the hybrid primer into the synthesized single- stranded cDNA product.
- Single-stranded DNA amplification products that are identical to the target RNA sequence may then be generated from the double- stranded template described above by denaturing and RNAseH treating the denatured substrate to remove the RNA portion of the substrate, and adding a hybrid RNA/DNA single- stranded amplification primer, e.g., 5' GACGGAUGCGGTGT 3' (SEQ ID NO: 1558), where the 5' portion of the primer consists of at least eleven RNA nucleotides (underlined) that hybridize to a predetermined sequence on the first strand cDNA and the 3' portion consists of at least three DNA nucleotides to the substrate in the presence of a highly processive strand displacing DNA polymerase, such as, for example, phi29.
- a hybrid RNA/DNA single- stranded amplification primer e.g., 5' GACGGAUGCGGTGT 3' (SEQ ID NO: 1558)
- the 5' portion of the primer
- the substrate for single- stranded DNA amplification may be prepared by preparing first strand cDNA synthesis using DNA primers (e.g., NSR or random primers), followed by second strand synthesis with Klenow also using DNA primers (e.g., anti-NSR or random primers).
- DNA primers e.g., NSR or random primers
- Klenow also using DNA primers (e.g., anti-NSR or random primers).
- the double- stranded DNA template is then modified to produce a substrate for single- stranded DNA amplification by denaturing and annealing an RNA/DNA hybrid oligonucleotide that hybridizes to the second strand cDNA and extending the hybrid RNA/DNA oligonucleotide with Reverse Transcriptase, to generate a double stranded template with one strand consisting of an RNA/DNA hybrid molecule and the other strand consisting of all DNA.
- Single stranded DNA amplification products that are complementary to the target RNA sequence may then be generated from the double- stranded substrate by denaturing and RNAseH treating the denatured substrate to remove the RNA portion of the substrate.
- a hybrid RNA/DNA single- stranded amplification primer is then annealed to the second strand, wherein the 5' portion of the hybrid primer consists of at least eleven RNA nucleotides that hybridize to a pre-determined sequence on the second strand cDNA and the 3' portion of the hybrid primer consists of at least three DNA nucleotides.
- a highly processive strand displacing DNA polymerase such as, for example, phi29. is then used to generate single- stranded DNA products.
- This Example describes the robust detection of poly A+ and poly A- transcripts in cDNA amplified from total RNA using NSR primers .
- the whole transcriptome that is, the entire collection of RNA molecules present within cells and tissues at a given instant in time, carries a rich signature of the biological status of the sample at the moment the RNA was collected.
- the biochemical reality of total RNA is that an overwhelming majority of it codes for structural subunits of cytoplasmic and mitochondrial ribosomes, which provide relatively little information on cellular activity. Consequently, molecular techniques that enrich for more informative low copy transcripts have been developed for large-scale transcriptional studies, such as the exploitation of 3' polyadenylation sequences as an affinity tag for non-ribosomal RNA.
- RNA transcripts have provided a rich foundation of cDNA fragments that form the basis of current gene models (see e.g., Hsu F. et al., Bioinformatics 22:1036-1046 (2006)). Priming of cDNA synthesis from polyA sequences has also been used for the most commonly practiced, genome-wide RNA profiling methods.
- NSR not-so-random
- rRNA ribosomal RNA
- a second set of tailed NSR hexamers complementary to the first set of NSR primers (“anti-NSR” primers) was generated to prime 2nd strand synthesis.
- the unique tail sequences used for first and second strand NSR primers enabled the preservation of strand orientation during amplification and sequencing.
- all sequencing reads were oriented in a 3' to 5' direction with respect to the template RNA, although opposite strand reads can be easily generated by modifying the universal PCR amplification primers.
- UHR Universal Human Reference
- a collection of random hexamers were also synthesized with the tail sequences SEQ ID NO: 1499 and SEQ ID NO: 1500 for generation of control libraries.
- NSR-priming selectively captures the non-ribosomal RNA fraction including poly A+ and poly A- transcripts.
- Two rounds of NSR priming selectivity were applied during library construction.
- NSR oligonucleotides (antisense) initiate reverse transcription at not-so-random template sites.
- anti-NSR oligonucleotides (sense) anneal to single- stranded cDNA at not- so-random template sites and direct Klenow-mediated second strand synthesis.
- PCR amplification with asymmetric forward and reverse primers preserves strand orientation and adds terminal sites for downstream end sequencing.
- Antisense tag sequencing is then carried out from the 3' end of cDNA fragments using a portion of the forward amplification primer. Pairwise alignments are then used to map the reverse complements of tag sequences to the human genome.
- RNA from whole brain was obtained from the FirstChoice® Human Total RNA Survey Panel (Ambion, Inc.). Universal Human Reference (UHR) cell line RNA was purchased from Stratagene Corp. Total RNA was converted into cDNA using SuperscriptTM III reverse transcription kit (Invitrogen Corp). Second strand synthesis was carried out with 3'-5' exo-Klenow Fragment (New England Biolabs Inc.). DNA was amplified using Expand High Fidelity PLU ⁇ PCR System (Roche Diagnostics Corp.).
- NSR primed cDNA synthesis 2 ⁇ l of 100 ⁇ M NSR primer mix (SEQ ID NO: 1499 plus SEQ ID NOS: 1-749) was combined with 1 ⁇ l template RNA and 7 ⁇ l of water in a PCR-strip-cap tube (Genesee Scientific Corp.). The primer-template mix was heated at 65 0 C for 5 minutes and snap-chilled on ice before adding 10 ⁇ l of high dNTP reverse transcriptase master mix (3 ⁇ l of water, 4 ⁇ l of 5X buffer, 1 ⁇ L of 100 mM DTT, 1 ⁇ l of 40 mM dNTPs and 1.0 ⁇ l of SuperscriptTM III enzyme).
- RNA template was removed by adding 1 ⁇ l of RNAseH (Invitrogen Corp.) and incubated at 37 0 C for 20 minutes, 75 0 C for 15 minutes and cooled to 4 0 C.
- DNA was subsequently purified using the QIAquick® PCR purification kit and eluted from spin columns with 30 ⁇ l elution buffer (Qiagen, Inc. USA).
- PCR master mix (19 ⁇ l of water, 20 ⁇ l of 5X Buffer 2, 10 ⁇ l of 25 mM MgCl 2 , 5 ul of 10 mM dNTPs, 10 ⁇ l of 10 ⁇ M forward primer, 10 ⁇ L of 10 ⁇ M reverse primer, 1 ⁇ L of ExpandPLUS enzyme, Roche Diagnostics Corp.).
- a control library was generated using the same methods with the use of random primers, expect for the concentration of dNTPs was 0.5 mM (rather than 2.0 mM) in the final reverse transcription reaction.
- the random primed control library was amplified using the PCR primers SEQ ID NO: 1559 and SEQ ID NO: 1560.
- tag sequences were generated as 36 nucleotide antisense reads from NSR-primed (2.6 million) and random-primed (3.8 million) cDNA libraries using the Illumina IG Genome Analyzer (Illumina, Inc.).
- CT dinucleotide barcode
- ELAND mapping program allows up to 2 mismatches per 32 nt alignment (Illumina, Inc.).
- each tag sequence was permitted to align to multiple transcripts. Read counts were then converted to expression values by calculating frequency per 1000 nucleotides from transcript length. A sample normalization factor (nf) was applied to adjust for the total number of reads generated from each library. This was derived from the total number of non-ribosomal RNA reads mapping to the genome for each library (brain 1:17.7 million reads, 1.0 nf; brain 2:19.3 million reads, 1.087 nf; UHR: 17.6 million reads, 0.995 nf).
- sequencing reads were first aligned to the non-coding RNA and repeat databases with alignments to multiple reference sequences permitted. The remaining tag sequences were then mapped to the March 2006 hgl8 assembly of the human genome sequence (http:genome.ucsd.edu/). Reads mapping to single genomic sites were classified into mRNA, intron and intergenic categories using coordinates defined by UCSC Known Genes (http://genome.ucsc.edu). Sequences that mapped to multiple genomic sequences that did not include repeats or non-coding RNAs made up the "other" category. Ribosomal RNA sequences were obtained from RepeatMasker (http://www.repeatmasker.org/) and Genbank (NC_001807).
- Non-coding RNA sequences were collected from Sanger RFAM (http://www.sanger.ac.uk/Software/Rfam/), Sanger miRBASE (http://microrna.sanger.ac.uk), snoRNABase (http://www- snorna.biotoul.fr) and RepeatMasker. Repetitive elements were obtained from RepeatMasker.
- FIGURE 7A shows the combined read frequencies for 5,790 transcripts shown at each base position starting from the 5' termini, with NSR (dotted line) or EST (solid line) cDNAs across long transcripts (>4kb).
- FIGURE 7B shows the combined read frequencies for 5,790 transcripts shown at each base position starting from the 3' termini, with NSR (dotted line) or EST (solid line) cDNAs across long transcripts (>4kb). Data shown in FIGURES 7 A and 7B were normalized to the maximal value within each dataset.
- NSR-primed cDNA fragments show full-length coverage of large transcripts with higher representation of internal sites than conventional ESTs. This is an important feature of whole transcriptome profiling because the technology preferably captures alternative splicing information.
- the sequencing coverage exhibited a modest deficit at the extreme 5' ends of known transcripts owing to the fact that all of the sequencing reads were generated from the 3' ends of cDNA fragments. This effect may be alleviated if sequencing is directed at both ends of NSR cDNA products.
- these results demonstrate the robustness of NSR-based selective priming as a technology for whole transcriptome expression profiling. Another requirement of whole transcriptome profiling is that it must effectively capture poly A- transcripts.
- poly A- non-coding RNAs in NSR- primed cDNA was determined as follows. Sequence tags from NSR-primed libraries were aligned to a comprehensive database of known poly A- non-coding RNA (ncRNA) sequences. Transcripts representing diverse functional classes were widely detected with a substantial fraction of small nucleolar RNAs ("snoRNAs”) (286/665) and small nuclear RNAs (“snRNAs”) (7/19) present at 5 or more copies in at least one sample. Interestingly, only a small portion of miRNA hairpins and tRNA species were observable at detectable levels. As shown below in TABLE 12, individual transcripts were observed over a broad range of expression levels with members of the snRNA and snoRNA families among the most highly abundant.
- snoRNAs small nucleolar RNAs
- snRNAs small nuclear RNAs
- ncRNA non-coding transcripts represented by at least two NSR tag sequences in whole brain
- the NSR-primed libraries containing poly A- transcripts included members of the snRNA and snoRNA families, as well as RNAs corresponding to other well-known transcripts such as 7SK, 7SL and members of the small cajal body-specific RNA family.
- FIGURE 8 graphically illustrates the enrichment of snoRNAs encoded by the Chromosome 15 Prader-Willi neurological disease locus in whole brain NSR primed library relative to the UHR NSR primed library.
- ncRNA transcripts detected in this study were less than 100 nucleotides in length and were predicted to have extensive secondary structure, thereby also demonstrating that NSR-priming is capable of capturing templates considered problematic to capture using conventional methods.
- the collection of whole transcriptome cDNA sequences generated using NSR priming may be assembled into a global expression map for whole brain and UHR.
- all non-ribosomal RNA tag sequences were assigned to one of six non-overlapping categories based on current genome annotations as shown in TABLE 14 below.
- mRNA, intron and intergenic categories shown above in TABLE 14 were defined by the genomic coordinates of UCSC Known Genes and include only cDNAs that map to unique locations. Sequencing tag reads overlapping any part of a coding exon or UTR were considered mRNA. Sequencing tag reads mapping to multiple genomic sites were binned into the ncRNA, repeats or other categories.
- overlapping NSR tag sequences were assembled into contiguous transcription units. Multiple sequencing reads mapping to single genomic sites were collapsed into single transcripts when at least one nucleotide overlapped on either strand. Overall, over 2.5 million transcriptionally active regions were identified that were not covered by current transcript models. Of these, only 21% were supported by sequences in public EST databases (Benson, D.A. et al., Nucleic Acids Res 32-.D23-26 (2004)). Unannotated transcription sites averaged 36.9 nucleotides in length and ranged from 32 to 1003 bp, with nearly 5% exceeding 100 bp. Many of the transcriptional elements identified here may represent novel non-coding RNAs. They may also be previously unidentified segments of known genes including alternatively spliced exons and extensions of untranslated regions.
- NSR priming was examined by aligning sequence tags to functional elements of known protein-coding genes. Over 99% of cDNA sequences mapping to protein-coding exons were oriented in the sense orientation, demonstrating the discrimination power of this method for monitoring strand- specific expression. This discrimination power allowed us to determine the orientation of novel transcripts and to assess the prevalence of antisense transcription among the functional elements of known genes. As shown below in TABLE 15, antisense transcription was detected at particularly high levels in 5'UTRs and introns, constituting about 20% of transcription events in those regions. TABLE 15: The relative frequency ratio of NSR tag sequences oriented in the sense or antisense direction for sequencing reads obtained from NSR primed whole brain and
- Transcript discovery by sequencing provides information with a level of specificity that cannot be achieved with genomic tiling arrays, which are prone to adverse cross-hybridization effects that necessitate significant data processing and subsequent experimental validation (see. e.g., Royce T. E. et al., Trends Genet 27:466-475 (2005)).
- the depth of sampling needed to obtain sufficient coverage of rare transcripts in highly complex whole transcriptome libraries limits the capacity of sequencing to rapidly survey large numbers of tissues.
- expression profiling microarrays facilitate the quantitative analysis of transcript levels in many samples, provided there is quality sequence information to direct probe selection.
- NSR selective priming provides several advantages over conventional methods. For example, NSR selective priming provides a direct link between informative sequencing and high throughput array experiments. The sequence information obtained using NSR selective primed cDNA libraries allows for the identification of unannotated transcriptional features. The functional characterization of the unannotated transcriptional features identified using the NSR-primed libraries will shed light on a wide range of biological processes and disease states.
- the information obtained from high-throughput sequencing may be used to inform the design of whole transcriptome arrays for hybridization with NSR-primed cDNA.
- custom designed whole transcriptome profiling arrays may be used to assess the expression patterns of novel features in relation to one another and in the context of known transcripts.
- Large scale profiling studies may also be used to implicate individual transcripts in human pathological states and expand the repertoire of bio markers available for clinical studies (see, e.g., van't Veer, LJ. et al., Nature 415:530-536 (2002)).
- the integration of whole transcriptome expression profiling data with genetic linkage analysis may be used to reveal biological activities that are modulated by novel transcriptional elements.
- paired-end sequencing is utilized for whole transcriptome analysis.
- Paired-end sequencing provides a direct physical link between the 5' and 3' termini of individual cDNA fragments (Ng P. et al., Nucleic Acids Res 34 e84 (2006); and Campbell, PJ. et al., Nat Genet 40:122-129 (2008)). Therefore, pair-end sequencing allows spliced exons from distal sites to be unambiguously assigned to a single transcript without any additional information.
- large- scale computational analysis can be applied to determine whether these genes represent protein-coding or non-coding RNA entities (Frith M.C. et al., RNA Biol. 3:40-48 (2006)).
- NSR priming is an elementary form of cDNA subtraction with the advantage that it can be simply and reproducibly applied to a wide variety of samples.
- NSR primer pools may be designed to avoid any population of confounding, hyper- abundant transcripts.
- an NSR primer pool may be designed to avoid the mRNAs encoding the alpha and beta subunits of globin proteins, which constitute up to 70% of whole blood total RNA mass, and can adversely affect both the sensitivity and accuracy of blood profiling experiments (see Li L. et al., Physiol. Genomics 32:190-197 (2008)).
- NSR primer pools may also be designed to reduce rRNA content in other organisms, allowing cross-species comparisons of whole transcriptome expression patterns.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP08842031A EP2209912A1 (en) | 2007-10-26 | 2008-10-24 | Cdna synthesis using non-random primers |
| JP2010531293A JP2011500092A (ja) | 2007-10-26 | 2008-10-24 | 非ランダムプライマーを用いたcDNA合成の方法 |
| CN2008801228338A CN102124126A (zh) | 2007-10-26 | 2008-10-24 | 使用非随机引物的cdna合成 |
| US12/509,312 US20100029511A1 (en) | 2007-10-26 | 2009-07-24 | Cdna synthesis using non-random primers |
| US12/767,542 US20110039732A1 (en) | 2007-10-26 | 2010-04-26 | cDNA Synthesis Using Non-Random Primers |
| US13/710,285 US20130252823A1 (en) | 2007-10-26 | 2012-12-10 | cDNA SYNTHESIS USING NON-RANDOM PRIMERS |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US98308507P | 2007-10-26 | 2007-10-26 | |
| US60/983,085 | 2007-10-26 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/509,312 Continuation-In-Part US20100029511A1 (en) | 2007-10-26 | 2009-07-24 | Cdna synthesis using non-random primers |
| US12/767,542 Continuation US20110039732A1 (en) | 2007-10-26 | 2010-04-26 | cDNA Synthesis Using Non-Random Primers |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2009055732A1 true WO2009055732A1 (en) | 2009-04-30 |
Family
ID=40253256
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2008/081206 Ceased WO2009055732A1 (en) | 2007-10-26 | 2008-10-24 | Cdna synthesis using non-random primers |
Country Status (5)
| Country | Link |
|---|---|
| US (3) | US20100029511A1 (https=) |
| EP (1) | EP2209912A1 (https=) |
| JP (1) | JP2011500092A (https=) |
| CN (1) | CN102124126A (https=) |
| WO (1) | WO2009055732A1 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110189679A1 (en) * | 2009-09-11 | 2011-08-04 | Nugen Technologies, Inc. | Compositions and methods for whole transcriptome analysis |
| US8268987B2 (en) | 2005-12-06 | 2012-09-18 | Applied Biosystems, Llc | Reverse transcription primers and methods of design |
| WO2014118377A3 (en) * | 2013-02-01 | 2014-12-04 | Ozan Selvi | Primer technology |
| WO2017140659A1 (en) * | 2016-02-15 | 2017-08-24 | F. Hoffmann-La Roche Ag | System and method for targeted depletion of nucleic acids |
| US10472666B2 (en) | 2016-02-15 | 2019-11-12 | Roche Sequencing Solutions, Inc. | System and method for targeted depletion of nucleic acids |
| US11999992B2 (en) | 2016-03-31 | 2024-06-04 | Bruker Cellular Analysis, Inc. | Nucleic acid stabilization reagent, kits, and methods of use thereof |
Families Citing this family (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009055732A1 (en) * | 2007-10-26 | 2009-04-30 | Rosetta Inpharmatics Llc | Cdna synthesis using non-random primers |
| AU2009205523A1 (en) * | 2008-01-14 | 2009-07-23 | Applied Biosystems, Llc | Compositions, methods, and kits for detecting ribonucleic acid |
| WO2012064739A2 (en) * | 2010-11-08 | 2012-05-18 | The Trustees Of Columbia University In The City Of New York | Microbial enrichment primers |
| WO2012174214A1 (en) * | 2011-06-15 | 2012-12-20 | The Regents Of The University Of California | High resolution analysis of mammalian transcriptome using gene pool specific primers |
| WO2013059746A1 (en) | 2011-10-19 | 2013-04-25 | Nugen Technologies, Inc. | Compositions and methods for directional nucleic acid amplification and sequencing |
| EP2807292B1 (en) | 2012-01-26 | 2019-05-22 | Tecan Genomics, Inc. | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation |
| US9777334B2 (en) | 2012-04-30 | 2017-10-03 | The Research Foundation for State University of New York | Cancer blood test using BC200 RNA isolated from peripheral blood for diagnosis and treatment of invasive breast cancer |
| CA2877094A1 (en) * | 2012-06-18 | 2013-12-27 | Nugen Technologies, Inc. | Compositions and methods for negative selection of non-desired nucleic acid sequences |
| US20150011396A1 (en) | 2012-07-09 | 2015-01-08 | Benjamin G. Schroeder | Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing |
| US10323279B2 (en) | 2012-08-14 | 2019-06-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| AU2013302756C1 (en) | 2012-08-14 | 2018-05-17 | 10X Genomics, Inc. | Microcapsule compositions and methods |
| US9822408B2 (en) | 2013-03-15 | 2017-11-21 | Nugen Technologies, Inc. | Sequential sequencing |
| WO2015073711A1 (en) | 2013-11-13 | 2015-05-21 | Nugen Technologies, Inc. | Compositions and methods for identification of a duplicate sequencing read |
| EP3105325B2 (en) * | 2014-02-13 | 2024-10-23 | Takara Bio USA, Inc. | Methods of depleting a target molecule from an initial collection of nucleic acids, and compositions and kits for practicing the same |
| US9745614B2 (en) | 2014-02-28 | 2017-08-29 | Nugen Technologies, Inc. | Reduced representation bisulfite sequencing with diversity adaptors |
| WO2015200893A2 (en) * | 2014-06-26 | 2015-12-30 | 10X Genomics, Inc. | Methods of analyzing nucleic acids from individual cells or cell populations |
| US12312640B2 (en) | 2014-06-26 | 2025-05-27 | 10X Genomics, Inc. | Analysis of nucleic acid sequences |
| US10711296B2 (en) * | 2015-03-24 | 2020-07-14 | Sigma-Aldrich Co. Llc | Directional amplification of RNA |
| CN105985949A (zh) * | 2015-11-02 | 2016-10-05 | 中国动物卫生与流行病学中心 | 一种rna高通量测序文库构建方法 |
| CN111621548A (zh) * | 2016-04-26 | 2020-09-04 | 序康医疗科技(苏州)有限公司 | 扩增dna的方法 |
| GB201621477D0 (en) * | 2016-12-16 | 2017-02-01 | Multiplicom Nv | Modified multiplex and multistep amplification reactions and reagents therefor |
| WO2018165593A1 (en) * | 2017-03-09 | 2018-09-13 | iRepertoire, Inc. | Dimer avoided multiplex polymerase chain reaction for amplification of multiple targets |
| US12492430B2 (en) | 2017-04-11 | 2025-12-09 | Tecan Genomics, Inc. | Library quantitation and qualification |
| US11099202B2 (en) | 2017-10-20 | 2021-08-24 | Tecan Genomics, Inc. | Reagent delivery system |
| CN112105745A (zh) * | 2018-05-07 | 2020-12-18 | 罗氏创新中心哥本哈根有限公司 | 用于寡核苷酸治疗剂的大规模平行发现方法 |
| WO2020124391A1 (zh) * | 2018-12-18 | 2020-06-25 | 深圳先进技术研究院 | 骨密度性状遗传力分析方法及装置 |
| US20220154180A1 (en) | 2019-03-13 | 2022-05-19 | Toyobo Co., Ltd. | Production and amplification of nucleic acids |
| CN111534512A (zh) * | 2019-09-11 | 2020-08-14 | 广东美格基因科技有限公司 | 一种去除核糖体rna的反转录引物池、试剂盒及去除核糖体rna的方法 |
| EP3851542A1 (en) | 2020-01-20 | 2021-07-21 | Tecan Genomics, Inc. | Depletion of abundant uninformative sequences |
| US12059674B2 (en) | 2020-02-03 | 2024-08-13 | Tecan Genomics, Inc. | Reagent storage system |
| US11280028B1 (en) | 2021-02-24 | 2022-03-22 | Agency For Science, Technology And Research (A*Star) | Unbiased and simultaneous amplification method for preparing a double-stranded DNA library from a sample of more than one type of nucleic acid |
| CN120584195A (zh) | 2023-01-26 | 2025-09-02 | 东洋纺株式会社 | 源自核糖体rna的逆转录的抑制 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0787209B1 (fr) * | 1995-07-24 | 2002-03-20 | Bio Merieux | Procede d'amplification de sequences d'acide nucleique par deplacement, a l'aide d'amorces chimeres |
| WO2007050990A2 (en) * | 2005-10-27 | 2007-05-03 | Rosetta Inpharmatics Llc | Nucleic acid amplification using non-random primers |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1007730A4 (en) * | 1996-08-30 | 2004-04-28 | Invitrogen Corp | METHODS OF IDENTIFYING AND ISOLATING SPECIFIC NUCLEOTIDE SEQUENCES IN cDNA AND GENOMIC DNA |
| EP1007739A2 (en) * | 1997-09-05 | 2000-06-14 | Sidney Kimmel Cancer Center | Selection of pcr primer pairs to amplify a group of nucleotide sequences |
| US6787308B2 (en) * | 1998-07-30 | 2004-09-07 | Solexa Ltd. | Arrayed biomolecules and their use in sequencing |
| MXPA02012739A (es) * | 2001-03-09 | 2004-04-20 | Nugen Technologies Inc | Metodos y composiciones para amplificacion de secuencias de arn. |
| WO2003020979A1 (en) * | 2001-08-31 | 2003-03-13 | Rosetta Inpharmactis Llc. | Methods for preparing nucleic acid samples |
| WO2009055732A1 (en) * | 2007-10-26 | 2009-04-30 | Rosetta Inpharmatics Llc | Cdna synthesis using non-random primers |
-
2008
- 2008-10-24 WO PCT/US2008/081206 patent/WO2009055732A1/en not_active Ceased
- 2008-10-24 JP JP2010531293A patent/JP2011500092A/ja active Pending
- 2008-10-24 EP EP08842031A patent/EP2209912A1/en not_active Withdrawn
- 2008-10-24 CN CN2008801228338A patent/CN102124126A/zh active Pending
-
2009
- 2009-07-24 US US12/509,312 patent/US20100029511A1/en not_active Abandoned
-
2010
- 2010-04-26 US US12/767,542 patent/US20110039732A1/en not_active Abandoned
-
2012
- 2012-12-10 US US13/710,285 patent/US20130252823A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0787209B1 (fr) * | 1995-07-24 | 2002-03-20 | Bio Merieux | Procede d'amplification de sequences d'acide nucleique par deplacement, a l'aide d'amorces chimeres |
| WO2007050990A2 (en) * | 2005-10-27 | 2007-05-03 | Rosetta Inpharmatics Llc | Nucleic acid amplification using non-random primers |
Non-Patent Citations (2)
| Title |
|---|
| WONG K-K ET AL: "Use of tagged random hexamer amplification (TRHA) to clone and sequence minute quantities of DNA application to a 180 kb plasmid isolated from Sphingomonas F199", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 24, no. 19, 1 October 1996 (1996-10-01), pages 3778 - 3783, XP008094799, ISSN: 0305-1048 * |
| ZHANG J ET AL: "Differential priming of RNA templates during cDNA synthesis markedly affects both accuracy and reproducibility of quantitative competitive reverse-transcriptase PCR", BIOCHEMICAL JOURNAL, THE BIOCHEMICAL SOCIETY, LONDON, vol. 337, no. PART 2, 15 January 1999 (1999-01-15), pages 231 - 241, XP002304124, ISSN: 0264-6021 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8268987B2 (en) | 2005-12-06 | 2012-09-18 | Applied Biosystems, Llc | Reverse transcription primers and methods of design |
| US8809513B2 (en) | 2005-12-06 | 2014-08-19 | Applied Biosystems, Llc | Reverse transcription primers and methods of design |
| US20110189679A1 (en) * | 2009-09-11 | 2011-08-04 | Nugen Technologies, Inc. | Compositions and methods for whole transcriptome analysis |
| WO2014118377A3 (en) * | 2013-02-01 | 2014-12-04 | Ozan Selvi | Primer technology |
| EP3633046A1 (en) * | 2013-02-01 | 2020-04-08 | Ozan Selvi | Primer technology |
| WO2017140659A1 (en) * | 2016-02-15 | 2017-08-24 | F. Hoffmann-La Roche Ag | System and method for targeted depletion of nucleic acids |
| US10472666B2 (en) | 2016-02-15 | 2019-11-12 | Roche Sequencing Solutions, Inc. | System and method for targeted depletion of nucleic acids |
| US11155853B2 (en) | 2016-02-15 | 2021-10-26 | Roche Sequencing Solutions, Inc. | System and method for targeted depletion of nucleic acids |
| US11999992B2 (en) | 2016-03-31 | 2024-06-04 | Bruker Cellular Analysis, Inc. | Nucleic acid stabilization reagent, kits, and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20110039732A1 (en) | 2011-02-17 |
| US20100029511A1 (en) | 2010-02-04 |
| EP2209912A1 (en) | 2010-07-28 |
| JP2011500092A (ja) | 2011-01-06 |
| US20130252823A1 (en) | 2013-09-26 |
| CN102124126A (zh) | 2011-07-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20110039732A1 (en) | cDNA Synthesis Using Non-Random Primers | |
| US9879312B2 (en) | Selective enrichment of nucleic acids | |
| US8383344B2 (en) | Methods for quantification of microRNAs and small interfering RNAs | |
| US8986958B2 (en) | Methods for generating target specific probes for solution based capture | |
| EP1735459B1 (en) | Methods for quantification of micrornas and small interfering rnas | |
| US7846666B2 (en) | Methods of RNA amplification in the presence of DNA | |
| EP3578697B1 (en) | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation | |
| US8465950B2 (en) | Global amplification using a randomly primed composite primer | |
| EP4524259B1 (en) | Controlled strand-displacement for paired-end sequencing | |
| US20110294701A1 (en) | Nucleic acid amplification using non-random primers | |
| CN108611398A (zh) | 通过新一代测序进行基因分型 | |
| WO2020136438A1 (en) | Method and kit for preparing complementary dna | |
| US12545950B2 (en) | Methods for preparing CDNA samples for RNA sequencing, and CDNA samples and uses thereof | |
| CN114341353A (zh) | 扩增mRNA和制备全长mRNA文库的方法 | |
| JP7150731B2 (ja) | シングルプライマーからデュアルプライマーのアンプリコンへのスイッチング | |
| US20260009021A1 (en) | Variant allele enrichment by unidirectional dual probe primer extension | |
| US20240368586A1 (en) | Guide rna sequencing confirmation | |
| WO2026035644A1 (en) | Excess rna depletion probes for high-value cdna preparation with reverse transcription | |
| WO2008127901A1 (en) | Region-specific hyperbranched amplification | |
| EP3798319A1 (en) | An improved diagnostic and/or sequencing method and kit | |
| HK40049321A (en) | An improved diagnostic and/or sequencing method and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200880122833.8 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08842031 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010531293 Country of ref document: JP Ref document number: 2441/CHENP/2010 Country of ref document: IN |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008842031 Country of ref document: EP |