WO2008157177A1 - Procédés de modulation d'une différenciation de cellules d'ostéoblastes et d'une génération osseuse grâce à une inhibition d'une prolylhydroxylase - Google Patents

Procédés de modulation d'une différenciation de cellules d'ostéoblastes et d'une génération osseuse grâce à une inhibition d'une prolylhydroxylase Download PDF

Info

Publication number
WO2008157177A1
WO2008157177A1 PCT/US2008/066567 US2008066567W WO2008157177A1 WO 2008157177 A1 WO2008157177 A1 WO 2008157177A1 US 2008066567 W US2008066567 W US 2008066567W WO 2008157177 A1 WO2008157177 A1 WO 2008157177A1
Authority
WO
WIPO (PCT)
Prior art keywords
bone
composition
hif
hydroxy
compound
Prior art date
Application number
PCT/US2008/066567
Other languages
English (en)
Inventor
Thomas L. Clemens
Randall S. Johnson
Ernestina Schipani
Original Assignee
The Uab Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Uab Research Foundation filed Critical The Uab Research Foundation
Publication of WO2008157177A1 publication Critical patent/WO2008157177A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4412—Non condensed pyridines; Hydrogenated derivatives thereof having oxo groups directly attached to the heterocyclic ring
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/24—Heavy metals; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids

Definitions

  • the present invention relates to the discovery of a novel pathway for the induction of osteoblast cellular differentiation and bone generation. Specifically, the
  • compositions that comprise an inhibitor of prolyl hydroxylase(s) and that are capable of promoting osteoblast cellular differentiation, improving bone mass or volume, and/or promoting osteogenesis that could be used in the treatment of various bone-loss or bone density decreasing disorders.
  • the present invention also relates to a novei screening tool for the determination of additional
  • bone is formed directly by intramembranous (osteoblast- mediated) ossification without an endochondral platform. Following surgical corticotom> there is a latency period prior to distraction that is characterized an inflammator) response like that following routine fracture. As the bone is distracted, a migrating zone of proliferating, fibrobiast-iike cells appear and align parallel to the vector of elongation. Collagen is formed in bundles, and capiilaries form between them. Osteoblasts then arrange themselves along the collagen framework and lay down woven bone which is subsequently remodeled into lamellar bone during the consolidation phase after distraction is halted.
  • Angiogenesis is a striking feature and critical component of the process of distraction histiogenesis. New blood vessels have been shown to be oriented parallel to the direction of distraction where new bone is forming along parallel collagen bundles, implying a coupling of the mechanical force applied and neovascularization. [0004] In clinical practice, delays in ossification are not uncommon and relate to inappropriate application of the method (inadequate fixation, improper rate of distraction) or unfavorable host factors such as a poor soft tissue envelope and/or compromised vascularity. In a murine model, Choi et al.
  • HlF-l ⁇ is a master regulator of the hypoxic response, and a potent inducer of vasoactive endothelial growth factor (VEGF), leading to vascularization.
  • VEGF vasoactive endothelial growth factor
  • HIF-I ⁇ has been demonstrated to be induced in the distraction gap following acute episodes of distraction in a murine model (Carvalho et al., 2004, Bone 34:849-61) and is shown to have increased expression during fracture healing in a rat model ( Komatsu et al,, 2004, Bone 34:680-8).
  • hypoxia-inducible factors have been identified as a central pathway for transmitting cellular response to hypoxia and initiating angiogenesis.
  • HIFs are transcription factors which activate genes encoding proteins that mediate adaptive responses to reduced oxygen availability (e.g., angiogenesis).
  • the HlF complex consists of a heterodimer comprised of one of three ⁇ subunits (HIF-l ⁇ , HIF-2 ⁇ , or HIF-3 ⁇ ) bound to the aryl hydrocarbon receptor nuclear transiocator (ARNT), which is also known as HIF-I ⁇ . Hypoxia induces changes in the accumulation and activity of the HIF-l ⁇ subunit.
  • the primary level of regulation is inhibition of the HIF-I ⁇ subunit degradation during hypoxia.
  • the level of HIF-l ⁇ protein is low due to the ongoing ubiquitination and proteosomal degradation.
  • the molecular mechanisms of ubiquitination and proteosomal degradation of HIF- Ia subunits involve the enzymatic prolyl hydroxylation of an oxygen degradation domain (ODD) which targets HIF- Ia for ligation-mediated proteosomal degradation.
  • ODD oxygen degradation domain
  • the ODD contains a conserved proline residue that is hydroxylated under normoxic conditions by one of a group of three proline hydroxylases (PHDs 1-3). The reaction requires the presence of iron, oxygen, and 2- oxoglutarate.
  • HIF- l ⁇ /ARNT complex can couple with the coactivator p300 and transact ⁇ vate HlF-sensitive genes by binding to hypoxia response elements (HREs) in the proximal promoter regions.
  • HREs hypoxia response elements
  • Hyciroxylation of an asparagine residue by the factor inhibiting HIF (FIH) found within the nucleus can block the HlF/p300 association.
  • FHI factor inhibiting HIF
  • cytokines are also known to regulate HIF- l ⁇ expression.
  • mechanical stretch of rat myocardium induces HIF- l ⁇ accumulation in myocytes through activation of the PI3/AKT/Frap pathway.
  • HIF-I ⁇ is upregulated in smooth muscle following experimental distension of rat aorta, and in vascular smooth muscle cells subjected to cyclical stretch.
  • Cytokines such as IL-I ⁇ and TNF and/or IFN- ⁇ have been shown to increase HIF- l ⁇ DNA-binding activity in human hepatoma cells and human renal tubular epithelial cells.
  • the pro-inflammatory mediator nitric oxide (NO)
  • NO nitric oxide
  • Both mechanical and pro-inflammatory signals are generated in bone following tissue injury and therefore may contribute to the acute induction of HIF-I ⁇ in mouse bone following distraction.
  • Angiogenesis is recognized as a critical feature of bone healing and occurs in close spatial and temporal association with osteogenesis during distraction. However, the mechanisms that regulate the coupling of angiogenesis to osteogenesis are not well understood.
  • HIF- l ⁇ As a central player in neovascularization in DO.
  • Pacicca et ai. used immunohistochemistry to identify two known angiogenic factors, bFGF (basic Fibroblast Growth Factor) and VEGF, in a rat femur distraction model (2003, Bone 33:889-98). They noted bFGF in cells adjacent to the new longitudinal vessels and VEGF in the osteoblasts and undifferentiated cells in the distractrion gap.
  • Microarray analysis revealed doubling or tripling of expression of angiogenesis-associated mRNAs including angiopoietin 1, pleiotrophin, tie-1 , and tie-2 during distraction as compared to latency. Also noted was a very high level of expression of HIF-I ⁇ ,
  • VEGF vascular endothelial growth factor
  • HIF-l ⁇ pathway to either promote or retard angiogenesis
  • therapies to increase HIF- l ⁇ activation include gene therapy, custom peptides, or small molecules.
  • a constitutively active HIF-l ⁇ gene delivered with an adenovirus vector was effective in rabbit limb ischemia (Vincent et al., 2000, Circulation 102:2255-61) and is currently in phase II clinical trials for intermittent claudication (ClinicalTrials.gov identifier NCTOOl 17650).
  • Another class of agents are 2-oxoglutarate analogs which were developed to decrease scar formation by targeting C4PHD. These agents have been shown in vitro to vary in their inhibition of C4PHD and the PHDs (Hirsila et al., 2003, J. Biol. Chem. 278:30772-80). In vivo, they have increased HIF- l ⁇ activation, been protective against ischemia, and demonstrated no toxicity. Additional agents that impinge on the HIF-I ⁇ pathway are being discovered and developed (e.g., L-mimosine, 3,4 dihydroxybenzoate (3.4 DHB), and dimethyloxalylglycine (DMOG)).
  • L-mimosine 3,4 dihydroxybenzoate
  • DMOG dimethyloxalylglycine
  • Methods for increasing bone mass or volume in a vertebrate animal comprising administering to a vertebrate animal in need thereof, an effective amount of a composition comprising a prolyl hydroxylase inhibiting compound, thereby increasing bone mass or volume in the animal.
  • the present invention provides methods for increasing bone mass or volume, comprising the step of administering to the vertebrate animal a composition comprising a therapeutically effective amount of a compound.
  • prolyl hydroxylase inhibiting compound such compound, a prodrug, or a pharmaceutically acceptable salt thereof, or a stereoisomer or diastereomeric mixture of the compound, prodrug, or salt; wherein the compound, prodrug, or pharmaceutically acceptable salt thereof, or stereoisomer or diastereomeric mixture of the compound, prodrug, or salt inhibits the activity of a prolyl hydroxylase.
  • the composition comprises an iron chelator such as desferrioxamine (N'-[5-(acetyl- hydroxy-amino)pentyl]-N-[5-[3-(5-aminopentyl-hydroxy- carbamoyi)propanoyiamino]pentyl]-N-hydroxy-butanediamide); a homolog of desferrioxamine such as: (£)-2-amino-3-(2-hydroxy-3-oxoprop-l-enylamino)propanoic acid or 2-amino-3 ⁇ (2 ⁇ hydroxy-3-oxopropylamino)propanoic acid; or cobalt.
  • desferrioxamine N'-[5-(acetyl- hydroxy-amino)pentyl]-N-[5-[3-(5-aminopentyl-hydroxy- carbamoyi)propanoyiamino]pentyl]-N-hydroxy-butanedia
  • the composition comprises a 2-oxoglutarate homolog such as L-mimosine ( ⁇ -[N-(3-Hydroxy-4-pyridone)]- ⁇ -aminopropionic Acid); 3,4 dihydroxybenzoate (3,4 DHB); dimethyloxalylglycine (DMOG); N' ⁇ -aminobulyO-N'-hydroxy- ⁇ S-fN- hydroxy-4-(4-(iV-hydroxyacetamido)butylamino)-4-oxobutanamido)pentyi)succinamide; or N 1 -(S-aminopentyO-iV 1 -hydroxy- ⁇ r '-(4-(iV-hydroxy-4-(5-( ⁇ r - hydroxyacetamido)pentylamino)-4 ⁇ oxobutanamido)butyl)succinamide,
  • the composition increases bone mass or volume and does not decrease collagen synthesis.
  • the increase in bone mass or volume can be detected, for example, by radiographic imaging.
  • the composition is administered locally to the site of bone reconstruction.
  • the composition can be administered, for example, by injection into the cartilage growth plate.
  • the composition also can be locally administered in a suitable vehicle, carrier, or diluent selected from the group consisting of bone-wax, demineralized bone powder, polymeric bone cement, and bone sealant.
  • the composition is administered by local application of the compound in a solid or semi-solid implant.
  • the so ⁇ d or semi-solid implant is selected from the group consisting of dacron-mesh, gel-foam, kiel bone, prosthesis, scaffold, delivery pin or needle, and bone screw.
  • the composition is administered systemicaily.
  • the methods for increasing bone mass or volume further comprise administering an additional agent selected from the group consisting of an organic bisphosphonate: a cathepsin K inhibitor; an estrogen or an estrogen receptor modulator; an androgen receptor modulator; an inhibitor of osteoclast proton ATPase; an inhibitor of HMG-CoA reductase: an integrin receptor antagonist; an osteoblast anabolic agent, such as PTH; calcitonin; Vitamin D or a synthetic Vitamin D analogue; selective serotonin reuptake inhibitors (SSRIs); and the pharmaceutically acceptable salts and mixtures thereof.
  • an additional agent selected from the group consisting of an organic bisphosphonate: a cathepsin K inhibitor; an estrogen or an estrogen receptor modulator; an androgen receptor modulator; an inhibitor of osteoclast proton ATPase; an inhibitor of HMG-CoA reductase: an integrin receptor antagonist; an osteoblast anabolic agent, such as PTH;
  • Also provided are methods for promoting osteogenesis or increasing osteoblast differentiation in a vertebrate animal comprising administering to a vertebrate animal in need thereof, an effective amount of a composition comprising a prolyl hydroxylase inhibiting compound, thereby promoting osteogenesis or increasing osteoblast cell differentiation in the animal
  • the present invention provides methods for promoting osteogenesis or increasing osteoblast differentiation in a vertebrate animal, comprising the step of administering to the vertebrate animal a composition comprising a therapeutically effective amount of a compound.
  • prolyl hydroxylase inhibiting compound such compound, a prodrug, or a pharmaceutically acceptable salt thereof, or a stereoisomer or d ⁇ astereomeric mixture of the compound, prodrug, or salt; wherein the compound, prodrug, or pharmaceutically acceptable salt thereof, or stereoisomer or diastereomeric mixture of the compound, prodrug, or salt inhibits the activity of a prolyl hydroxylase.
  • the composition comprises an iron chelator such as desferoxamine (N'-[5-(acetyl-hydroxy-amino)pentyl3-N-[5-[3-(5-aminopentyl-hydroxy- carbamoyl)propanoylamino]pentyl]-N-hydroxy-butanediamide); a homolog of desferrioxamine such as: (£ ⁇ -2-amino-3-(2-hydroxy-3-oxoprop-l -enytamino)pFopanoic acid or 2-amino-3-(2-hydroxy-3-oxopropyianiino)propanotc acid; or cobalt.
  • desferoxamine N'-[5-(acetyl-hydroxy-amino)pentyl3-N-[5-[3-(5-aminopentyl-hydroxy- carbamoyl)propanoylamino]pentyl]-N-hydroxy-butanediamide
  • the composition comprises a 2-oxoglutarate homolog such as L-mimosine ( ⁇ [N-(3-Hydroxy ⁇ 4 ⁇ pyridone)]- ⁇ -aminopropionic Acid); 3,4 dihydroxybenzoate (3,4 DHB); dimethyloxalylglycine (DMOG); N 1 -(4-aminobutyl)-N'-hydroxy-/V 4 -(5-(N- hydroxy-4-(4-(N-hydroxyacetamido)butylamino)-4-oxobutanamido)pentyl)succinamide; or N 1 -(5-aminopentyl)- ⁇ fl -hydroxy-j ⁇ r *-(4-(N-hydroxy-4-(5-(N- hydroxyacetamido)pentylamino)-4-oxobutanamido)butyl)succinamide,
  • the composition increases bone mass or volume and does
  • the increase in bone mass or volume can be detected, for example, by radiographic imaging.
  • the composition is administered locally to the site of bone reconstruction.
  • the composition can be administered, for example, by injection into the cartilage growth plate.
  • the composition also can be locally administered in a suitable vehicle, carrier, or diluent selected from the group consisting of bone-wax, demineralized bone powder, polymeric bone cement, and bone sealant,
  • the composition is administered by local application of the compound in a solid or semi-solid implant.
  • the solid or semi-soiid implant is seiected from the group consisting of dacron-mesh, gel-foam, kiel bone, prosthesis, scaffold, delivery pin or needle, and bone screw.
  • the composition is administered systemically.
  • the methods for increasing osteogenesis or osteoblast differentiation further comprise administering an additional agent selected from the group consisting of an organic bisphosphonate: a cathepsin K inhibitor; an estrogen or an estrogen receptor modulator; an androgen receptor modulator; an inhibitor of osteoclast proton ATPase; an inhibitor of HMG-CoA reductase; an integrin receptor antagonist: an osteoblast anabolic agent, such as PTH; calcitonin; Vitamin D or a synthetic Vitamin D analogue; selective serotonin reuptake inhibitors (SSRIs); and the pharmaceutically acceptable salts and mixtures thereof.
  • an additional agent selected from the group consisting of an organic bisphosphonate: a cathepsin K inhibitor; an estrogen or an estrogen receptor modulator; an androgen receptor modulator; an inhibitor of osteoclast proton ATPase; an inhibitor of HMG-CoA reductase; an integrin receptor antagonist: an osteoblast anabolic agent, such as PTH
  • compositions of the present invention are used to increase bone mass, increase bone volume, promote ostogenesis, and/or increase osteoblast differentiation.
  • the compositions can be used, for example, to strengthen a bone graft, to induce vertebral synostosis, to enhance long bone extension, to promote healing of a bone fracture or osteotomy, and to enhance bone healing following facial reconstruction, maxillary reconstruction, and/or mandibular reconstruction.
  • compositions also can be used for the treatment of a disease state selected from the group consisting of osteoporosis, osteopenia, or a bone-related disorder selected from the group consisting of osteoporosis, bone fractures, hypercalcemia of malignancy, osteopenia or osteolytic lesions due to bone metastases, periprosthetic osteolysis, familial expansile osteolysis, periodontal disease, tooth loss, rheumatoid arthritis, osteoarthritis, hyperparathyroidism, Paget's disease, osteodystrophy, myositis ossificans, Bechterew's disease, malignant hypercalcemia, bone loss, bone abnormalities due to steroid hormone treatment, bone abnormalities caused by cancer therapeutics, abnormally increased bone turnover, osteomalacia, Bechet's disease, hyperostosis, osteopetrosis, osteogenesis imperfecta, rachitis, immobilization-induced osteopenia, expansile skeletal hyperphosphatasia, and glucocorticoid-induced osteop
  • the present invention further provides methods of identifying a compound that increases bone healing, increases osteoblast cell differentiation, improves bone mass or volume, and/or promotes osteogenesis.
  • Such methods comprise providing an osteoblast or bone precursor cell, contacting the cell with a test compound, and determining whether an increase in dimerization, nuclear translocation, and/or transcriptional activity of a HIF- l ⁇ /HIF-l ⁇ complex occurs in the cell contacted with the compound, said increase being an indication that the compound increases bone healing, increases osteoblast cell differentiation, improves bone mass or volume, and/or promotes osteogenesis.
  • promoting osteogenesis can comprise one or more of increasing osteoblast formation, increasing osteoid volume, decreasing ostoclast formation, and decreasing osteoclast function.
  • Transcriptional activity of the HIF-i ⁇ /HIF-l ⁇ complex can be determined by expression of a HlF- lot target gene selected from the group consisting of VEGF; nitric oxide synthase 2; heme oxygenase 2; cti B -adrenergic receptor: erythropoietin; transferrin; ceruloplasmin; transferrin receptor; cyclin G2; p21 ; IGF-2; IGF-binding protein 1, 2 and 3; glucose transporter 1, and 3; hexok ⁇ nase 1, and 2; phosphofructokinase L; pyruvate kinase M; a HIF-prolyl hydroxylase; and carbonic anhydrase.
  • the transcriptional activity is determined by measuring expression of VEGF or Glut-1.
  • the present invention also provides for methods of identifying a compound that decreases osteoblast cell differentiation, decreases bone mass or volume, and/or increasing osteoclast cell differentiation.
  • Such methods comprise providing an osteoblast or bone precursor cell, contacting the cell with a test compound, and determining whether a decrease in dimerization, nuclear translocation, and/or transcriptional activity of a HJF- l ⁇ /HIF-l ⁇ complex occurs in the cell contacted with the compound, said decrease being an indication that the compound decreases osteoblast cell differentiation, decreases bone mass or volume, and/or increases osteoclast cell differentiation.
  • the invention provides a method of identifying a compound that modulates the dimerization of HIF-I ⁇ , the nuclear translocation of HIF-I ⁇ or the transcriptional activity of HIF- lot in bone is identified.
  • the compound increases dimerization, nuclear translocation, and or transcriptional activity of HIF- l ⁇ .
  • the compound decreases dimerization, nuclear translocation, and or transcriptional activity of HIF-I ⁇ .
  • the invention further provides a process for making a compound that increases osteoblast cell differentiation, improves bone mass or volume, and/or promotes osteogenesis, comprising carrying out any of the methods described above to identify a compound that increases osteoblast cell differentiation, improves bone volume, and/or promotes osteogenesis, and manufacturing the compound.
  • the invention additionally contemplates a process for making a compound that decreases osteoblast cell differentiation, decreases bone mass or volume, and/or increases osteoclast cell differentiation, comprising carrying out any of the methods described above to identify a compound that decreases osteoblast cell differentiation, decreases bone volume, and/or increases osteoclast cell differentiation, and manufacturing the compound.
  • Pharmaceutical compositions comprising said compounds, and methods of administering said pharmaceutical compositions to an individual in need thereof are also contemplated.
  • compositions and methods described herein can also serve for therapeutic intervention in bone-related disorders.
  • compounds that promote the activity of HIF-I ⁇ can be formulated into a pharmaceutical formulation for the treatment of a disease state, such as, but not limited to osteoporosis, osteopenia, or other bone-related disorders.
  • compounds that decrease the activity of HIF- l ⁇ can be formulated into a pharmaceutical formulation for the treatment of a disease state characterized by bone overgrowth, such as, but not limited to sclerotic bone.
  • Figure 1 is a schematic showing the regulation of HIFs by molecular oxygen.
  • FIG. 2 shows that conditional deletion of VHL in osteoblasts increases bone volume and vascularity.
  • Panel A is a schematic that depicts the constructs used to create a conditional deletion of VHL in osteoblasts.
  • the human osteocalcin (hOC) promoter was used to generate mice carrying a Cre transgene (top). LoxP restriction sites were inserted flanking the first exon of VHL. Osteocalcin Cre mediated recombination results in loss of VHL function is osteoblasts (bottom).
  • Panel B is a photograph of the bones of the hmdlimb from a control (left) and a ⁇ VHL mouse (right).
  • Panel C shows the results of MicroCT imaging of femurs from ⁇ VHL mice (right) compared to control littermates (left). These images show significantly increased bone volume in ⁇ VHL mice compared to control littermates at 6 weeks of age as noted on longitudinal and cross sectional images.
  • Panel D shows the results of MicroCT angiography of hindlimbs of ⁇ VHL mice (right) and control littermates (left). The MicroCT imaging was performed following Microfil perfusion. Reconstruction of vasculature within the bone from concordant areas of the distal femur shows increased vascularity in the ⁇ VHL mouse.
  • FIG. 3 shows that vessel volume and bone volume are increased in ⁇ VHL mice.
  • Panel A is an autoraciiograph of bones from ⁇ VHL mice and control mice (Con).
  • Panel B shows the results of rnicoCT angiography; and
  • Panel C shows microCT volumetric and sagittal plane reconstruction images.
  • Panel D shows graphs of vessel volume per total volume (VV/TV) and bone volume per total volume (BV/TV). Both show significant increases associated with the targeted deletion of VHL.
  • Figure 4 shows that the Cre mediated deletion of VHL in osteoblasts in vitro activates HIF- l ⁇ .
  • Panel A shows a photograph of Western blots stained with antibodies directed to either HIF- l ⁇ or ⁇ -tubulin.
  • Panel B is a graph showing an increase in HIF-I ⁇ -activated genes. To evaluate gene expression. mRNA was collected 48 hours after transfection, and real-time PCR was performed, confirming the VHL deletion, and demonstrating upregulation of VEGF and Glut-1. Expression of HIF-I ⁇ and HIF2 ⁇ changed modestly. Panel C is a photograph of cells stained for alkaline phosphatase activity or mineralization.
  • Figure 5 shows that activation of HIF- l ⁇ increases angiogenesis and improves bone healing in distraction osteogenesis.
  • Panel A shows X-rays and MicroCT images depicting healing of a distraction gap in control (bottom) and ⁇ VHL mice (top). Distraction osteogenesis was performed at a rate of 0,15 mm/day. X-rays demonstrate healing of the distraction gap by plain radiographs at the end of consolidation (left). MicroCT images of bone healing in the distraction gap are not markedly different at the conclusion of consolidation (middle). However, microCT angiography performed using a silicone perfusion technique shows increased vascularity in the distraction zone at the end of distraction in the ⁇ VHL mice (right). Panel B shows a quantitation of the MicroCT data.
  • FIG. 1 Bone volume per total volume in the distraction gap at the end of consolidation was not different in the ⁇ VHL mice compared to controls (top), but vessel volume per total volume in the distraction zone at the end of distraction was dramatically increased (bottom).
  • Panel C shows X-rays and MicroCT images at the conclusion of the consolidation period. The distraction rate was increased to 0.3 mm/day. Radiographs (left) and microCT images (right) at the conclusion of the consolidation period show increased bone formation in the distraction zone in the ⁇ VHL mice following distraction.
  • Figure 6 shows that blocking the VEGF receptor results in the inhibition of increased angiogenesis and bone formation seen following DO in the setting of genetic activation of HIF-l ⁇ .
  • Panel A shows X-rays at the conclusion of distraction.
  • Panel B shows MicroCT images reflecting the decreased vascularity in mice treated with the VEGF receptor antibody when compared with the control mice.
  • Pane! C shows graphs of vessel volume per total volume (VV/TV), vessel number, and vessel surface. All show significant decreases associated with the treatment with the VEGF receptor antibody. Also shown is a graph showing vessel separation, demonstrating an increased separation associated with treatment with VEGF receptor antibody.
  • Figure 7 shows that prolyl hydroxylases are present in osteoblasts in vitro.
  • Panel A is a photograph of Western blots stained for PHDl, PHD2, or ⁇ -tubuiin. Western blotting for PHDs 1 and 3 was performed using protein from cultured osteoblasts with and without VHL deletion.
  • Panel B is a schematic showing the active site for hydroxylation by the PHDs, represented by the grey area, with note of the cofactors iron, oxygen, and 2- oxyglutarate.
  • Panel C is a schematic showing the structures of 2-oxyglutarate and analogs 3,4-DHB and L-mimosine (from Warnecke et aL 2003, FASEB J. 17: 1 186-8). [0030] Figure 8 shows that cobalt activates HlF-I ⁇ in osteoblasts in vitro.
  • Panel A shows a Western blot of nuclear extracts stained for HlF- l ⁇ , showing increased nuclear accumulation after cobalt treatment at all doses.
  • Panel B is a graph of real time PCR data. Real time PCR was performed for VEGF following cobalt treatment. Marked upregulation of VEGF was seen after 12 and 24 hours of treatment,
  • FIG. 9 shows that DFO and L-mimosine (L-mim or L-M) activate HREs and that DFO increased tube formation in HUVECs and metatarsal explants.
  • Panel A is a graph showing a strong increase in luciferase activity from a HRE luciferase promoter in osteosarcoma cells treated with DFO or L-mim, as compared to control cells or cells treated with cobalt chloride or DHB, Photographs of Western blots stained with either HlF- l ⁇ antibody or ⁇ -actin antibody (control) are shown below the graph in Panel A.
  • Panel B is a graph of results of real time PCR experiments, showing an increase in VEGF expression in cells treated with different doses of DFO or when under hypoxic conditions.
  • Panel C is a graph showing the number of tube-like structures in HUVEC cells cultured on matrigei chambers with the addition of VEGF, VEGF antibody, DFO, or L-mim. Numbers of tube like structures were counted after 12 hours of incubation.
  • Pane! D shows photographs of metatarsal explants, showing increased endothelial sprouting of control explants or explants treated with VEGF. DFO, or L-mim.
  • FIG 10 shows that local application of DFO in a DO model results in increased vascularity and improved bone healing.
  • Distraction osteogenesis was performed in the left tibiae of eight week old wild type C57/B6 mice at a rate of 0.15 mm/day for 10 days. The mice were injected with DFO or saline every other day during the active distraction phase.
  • Panel A shows a methylene blue stained tibia in the DO model (left), as well as X-rays depicting healing of a distraction gap in DFO treated mice (right) as compared to saline treated control mice (middle).
  • Panel B shows microCT images of bone healing in the distraction gap
  • Panel C shows images generated by microCT angiography performed using a silicone perfusion technique, demonstrating increased vascularity in the distraction zone in mice treated with DFO (right) as compared to control mice treated with saline (left).
  • Panels D and E show graphs of connectivity, vessel number, bone volume per total volume (BV/TV), and bone volume in the DO model in DFO treated and saline treated control mice. All measurements show significant increases associated with the treatment with DFO.
  • Figure 1 1 shows that local application of L-mimosine in a DO model results in little change in vascularity and bone healing.
  • Distraction osteogenesis was performed in the left tibiae of eight week old wild type C57/B6 mice at a rate of 0.15 mm/day for 30 days.
  • the mice were injected with L-mim or saline every other day during the active distraction phase.
  • Panel A shows X-rays of the healing of a distraction gap in L-mim treated mice (right) as compared to saline treated control mice (left).
  • Panel B shows microCT images of bone healing in the distraction gap.
  • Panel C shows graphs of vessel number and connectivity in the DO model in L-mim treated and saline treated control mice. L-mim did not have a significant impact in terms of increasing vascularity and improving bone healing in the DO model.
  • the present invention relates to methods for increasing bone healing, increasing osteoblast differentiation, increasing bone mass, increasing bone volume, and/or increasing osteogenesis by administering a composition that inhibits a prolyl hydroxylase.
  • the present invention also relates to a method for screening for a compound that increases bone healing, increases osteoblast differentiation, improves bone mass or volume, and/or promotes osteogenesis.
  • the present invention provides methods for increasing bone mass or volume, promoting osteogenesis or increasing osteoblast cell differentiation in a vertebrate animal, comprising administering to a vertebrate animal in need thereof, an effective amount of a composition comprising a prolyl hydroxylase inhibiting compound, thereby increasing bone mass or volume, promoting osteogenesis or increasing osteoblast ceil differentiation in the animal.
  • the present invention provides methods for increasing bone mass or volume, promoting osteogenesis or increasing osteoblast cell differentiation in a vertebrate animal comprising the step of administering to the vertebrate a composition comprising a therapeutically effective amount of a compound.
  • prolyl hydroxylase inhibiting compound such compound, a prodrug, or a pharmaceutically acceptable salt thereof, or a stereoisomer or diastereomeric mixture of the compound, prodrug, or salt; wherein the compound, prodrug, or pharmaceutically acceptable salt thereof, or stereoisomer or diastereomeric mixture of the compound, prodrug, or salt inhibits the activity of a prolyl hydroxylase.
  • the composition comprises an iron chelator such as desferoxamine (N'-[5-(acetyl-hydroxy-amino)pentyl]-N-[5-[3-(5-aminopentyl- hydroxy-carbamoyl)propanoylaminoJpentyl]-N-hydroxy-butanediamide); a homolog of desferoxamine such as: (£)-2-amino-3-(2-hydroxy-3-oxoprop-l-enylamino)propanoic acid or 2-amino-3-(2-hydroxy-3-oxopropylamino)propanoic acid; or cobalt.
  • desferoxamine N'-[5-(acetyl-hydroxy-amino)pentyl]-N-[5-[3-(5-aminopentyl- hydroxy-carbamoyl)propanoylaminoJpentyl]-N-hydroxy-butanediamide
  • the composition comprises a 2-oxoglutarate homolog such as L-mimosine ( ⁇ -[N-(3-Hydroxy-4-pyridone)]- ⁇ -aminopropionic Acid); 3,4 dihydroxybenzoate (3,4 DHB); dimethyloxalylglycine (DMOG); /V ⁇ -aminobutyO-iV 1 - hydroxy- ⁇ -(5-(N-hydroxy-4-(4-(N-hydroxyacetamido)butylamino)-4- oxobutanamido)pentyl)succinamide; or ⁇ r '- ⁇ 5-aminopentyl)-/V' !
  • L-mimosine ⁇ -[N-(3-Hydroxy-4-pyridone)]- ⁇ -aminopropionic Acid
  • 3,4 DHB dimethyloxalylglycine
  • DMOG dimethyloxalylglycine
  • DMOG
  • the composition substantially increases bone mass or volume and does not substantially decrease collagen synthesis.
  • HIF- P4Hs cytoplasmic and nuclear HIF prolyl 4-hydroxylases
  • C-P4Hs coilagen prolyl 4-hydroxylases
  • the increase in bone mass or volume can be detected, for example, by radiographic imaging,
  • the prolyl hydroxylase inhibiting compound is contained in a therapeutic composition.
  • the composition can be administered locally to the site of bone reconstruction.
  • the composition can be administered, for example, by injection into the cartilage growth plate.
  • the composition also can be locally administered in a suitable vehicle, carrier, or diluent selected from the group consisting of bone-wax, demineralized bone powder, polymeric bone cement, and bone sealant.
  • the composition is administered by local application of the compound in a solid or semi-solid implant.
  • the solid or semi-soiid implant is selected from the group consisting of dacron-mesh, gel-foam, kiel bone, prosthesis, scaffold, delivery pin or needle, and bone screw, In other embodiments, the composition is administered systemically.
  • compositions of the present invention are used to increase bone mass, increase bone volume, promote ostogenesis, and/or increase osteoblast differentiation.
  • the compositions can be used, for example, to strengthen a bone graft, to induce vertebral synostosis, to enhance long bone extension, to promote healing of a bone fracture or osteotomy, and to enhance bone healing following facial reconstruction, maxillary reconstruction, and/or mandibular reconstruction.
  • compositions also can be used for the treatment of a disease state selected from the group consisting of osteoporosis, osteopenia, or a bone-related disorder selected from the group consisting of osteoporosis, bone fractures, hypercalcemia of malignancy, osteopenia or osteolytic lessons due to bone metastases, periprosthetic osteolysis, familial expansile osteolysis, periodontal disease, tooth loss, rheumatoid arthritis, osteoarthritis, hyperparathyroidism, Paget ' s disease, osteodystrophy, myositis ossificans, Bechterew's disease, malignant hypercalcemia, bone loss, bone abnormalities due to steroid hormone treatment, bone abnormalities caused by cancer therapeutics, abnormally increased bone turnover, osteomalacia, Bechet's disease, hyperostosis, osteopetrosis, osteogenesis imperfecta, rachitis, immobilization-induced osteopenia, expansile skeletal hyperphosphatasia. and glucocorticoid-induced osteo
  • the present invention provides methods for identifying a compound that improves bone mass or volume, wherein the method comprises the steps of: providing an osteoblast or bone precursor ceil; contacting the cell with a test compound; and determining whether an increase in dimerization, nuclear translocation, and/or transcriptional activity of a HIF-l ⁇ /HIF-l ⁇ complex occurs in the cell contacted with the compound, said increase being an indication that the compound improves bone mass or volume.
  • the transcriptional activity of a H ⁇ F-l ⁇ /HIF-l ⁇ complex is determined by measuring the transcription activation of a HlF- l ⁇ target gene selected from the group consisting of VEGF; nitric oxide synthase 2; heme oxygenase 2; alB- adrenergic receptor; erythropoietin; transferrin; ceruloplasmin; transferrin receptor; cyclin G2; p21 ; IGF-2: IGF-binding protein 1.
  • the transcription activation may be determined by techniques well known in the art, for example, by real-time PCR, Northern blotting, or reporter gene assays.
  • the expression level of HIF-I ⁇ protein is measured. In certain embodiments, the expression level is measured by Western blotting.
  • the present invention also provides methods that comprise an additional step of determining whether an increase or decrease in collagen synthesis occurs in the cell contacted with the compound.
  • the increase or decrease in collagen synthesis is detected by measuring the level of secreted collagen in the media, for example, by Western blotting.
  • the present invention also provides processes for making a compound that increases bone healing, increases osteoblast cell differentiation, improves bone mass or volume, and/or promotes osteogenesis, comprising the steps of: providing an osteoblast or bone precursor cell; contacting the cell with a test compound; determining whether an increase in dimerization, nuclear translocation, and/or transcriptional activity of a HIF- Icc/HIF-l ⁇ complex occurs in the cell contacted with the compound, said increase being an indication that the compound increases bone healing, increases osteoblast cell differentiation, improves bone mass or volume, and/or promotes osteogenesis; and manufacturing the compound.
  • the present invention provides methods of identifying a compound that promotes osteogenesis, wherein the method comprises the comprises the steps of: providing an osteoblast or bone precursor cell; contacting the cell with a test compound; and determining whether an increase in dimerization, nuclear translocation, and/or transcriptional activity of a HIF-l ⁇ /HJF-l ⁇ complex occurs in the cell contacted with the compound, said increase being an indication that the compound promotes osteogenesis.
  • the compounds of the present invention promote osteogenesis by one or more of increasing osteoblast formation, increasing osteoid volume, decreasing osteoclast formation, and decreasing osteoclast function.
  • the present invention also provides methods of identifying a compound that increases osteoblast cell differentiation, wherein the method comprises the steps of: providing an osteoblasts or bone precursor cell; contacting the cell with a test compound; and determining whether an increase in dimerization. nuclear translocation, and/or transcriptional activity of an HIF-l ⁇ /HIF-l ⁇ complex occurs in the cell contacted with the compound, said increase being an indication that the compound increases osteoblast cell differentiation.
  • the present invention also provides for methods of identifying a compound capable of decreasing osteoblast cell differentiation, decreasing bone mass or volume, and/or increasing osteoclast cell differentiation, wherein the methods comprise the steps of providing an osteoblast or bone precursor cell; contacting the cell with a test compound; and determining whether a decrease in dimerization, nuclear translocation, and/or transcriptional activity of a HIF-l ⁇ /HIF-I ⁇ complex occurs in the cell contacted with the compound, said decrease being an indication that the compound decreases osteoblast cell differentiation, decreases bone mass or volume, and/or increases osteoclast cell differentiation.
  • the present invention provides processes for making a compound that decreases osteoblast cell differentiation, decreases bone mass or volume, and/or increases osteoclast cell differentiation, comprising the steps of: providing an osteoblast or bone precursor cell; contacting the cell with a test compound; and determining whether a decrease in dimerization, nuclear translocation, and/or transcriptional activity of a HIF- lot/HIF-l ⁇ complex occurs in the cell contacted with the compound, said decrease being an indication that the compound decreases osteoblast cell differentiation, decreases bone mass or volume, and/or increases osteoclast cell differentiation; and manufacturing the compound.
  • the terms used herein are to be understood according to conventional usage by those of ordinary skill in the relevant art.
  • Standard techniques for cloning, DNA isolation, amplification and purification, for enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases and the like, and various separation techniques are those known and commonly employed by those skilled in the art.
  • a number of standard techniques are described in Sambrook et al., 1989 Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory, Plainview, New York; Maniatis et al,, 1982 Molecular Cloning, Cold Spring Harbor Laboratory, Plainview, New York; Wu (Ed.) 1993 Meth. Enzymol. 218, Part I; Wu (Ed.) 1979 Meth. Enzymol. 68; Wu et al,, (Eds.) 1983 Meth. Enzymol.
  • the terms "'compound” or ''pharmacologic agent” refer to any compound or molecule that may affect bone mass or volume, osteogenesis, osteoblast differentiation, bone graft strengthening, vertebral synostosis, long bone extension, the treatment and promotion of healing of bone fractures and osteotomies, or bone healing following facial reconstruction, maxillary reconstruction, and/or mandibular reconstruction.
  • prolyl hydroxylase inhibiting compound' includes a compound, prodrug, or a pharmaceutically acceptable salt thereof, or a stereoisomer or diastereomeric mixture of the compound, prodrug, or salt; wherein the compound, prodrug or pharmaceutically acceptable salt thereof, or stereoisomer or diastereomeric mixture of the compound, prodrug or salt inhibits the activity of the a prolyl hydroxylase.
  • the compositions and methods described herein have several useful features. For example, the compositions and methods described herein are useful for the therapeutic intervention in disease states, such as osteoporosis, osteopenia, or other bone- loss or bone density decreasing disorders.
  • Bone-related disorders include, but are not limited to, osteoporosis, bone fractures, hypercalcemia of malignancy, osteopenia or osteolytic lesions due to bone metastases, periprosthetic osteolysis, familial expansile osteolysis, periodontal disease, tooth loss, rheumatoid arthritis, osteoarthritis, hyperparathyroidism, Paget's disease, osteodystrophy, myositis ossificans, Bechterew's disease, malignant hypercalcemia, bone loss, bone abnormalities due to steroid hormone treatment, bone abnormalities caused by cancer therapeutics, abnormally increased bone turnover, osteomalacia, Bechet's disease, hyperostosis, osteopetrosis, osteogenesis imperfecta, rachitis, immobilization-induced osteopenia, expansile skeletal hyperphosphatasia, and glucocorticoid-
  • carrier suitable pharmaceutically acceptable diluents, excipients, adjuvants, or carriers (collectively referred to herein as "carrier” materials) suitably selected with respect to the intended form of administration, that is, oral tablets, capsules, pilis, powders, granules, elixirs, tinctures, suspensions, syrups and the like, and consistent with conventional pharmaceutical practices.
  • the compounds may also be administered in intravenous (bolus or infusion), intraperitoneal, intranasal, rectal, topical, subcutaneous, intramuscular or transdermal form, all using forms well known to those of ordinary skill in the pharmaceutical arts.
  • the compounds are administered locally to the site of bone reconstruction, In another preferred embodiment, the compounds are administered systemically.
  • Suitable carrier materials are well known in the art and may include, for example, bulking agents, stabilizers, thickeners, wetting agents, emulsifiers, pH buffers, lubricants, colorants, taste masking agents, and the like, as known in the art.
  • the compounds can be applied to the sites of bone fractures or osteotomies, for example, either by injection of the compound in a suitable solvent (e.g., an oily solvent such as arachis oil) to the cartilage growth plate or, in cases of open surgery, by local application thereto of the compound in a suitable vehicle, carrier, or diluent such as bone- wax, demineralized bone powder, polymeric bone cements, bone sealants, etc.
  • a suitable carrier or diluent such as bone- wax, demineralized bone powder, polymeric bone cements, bone sealants, etc.
  • local application can be achieved by applying a solution or dispersion of the compound in a suitable carrier or diluent onto the surface of, or incorporating it into solid or semi-solid implants conventionally used in orthopedic surgery, such as dacron-mesh, gel-foam and kie! bone, or prostheses.
  • the active drug component can be combined with an oral, non-toxic, pharmaceutically acceptable, inert carrier such as lactose, starch, sucrose, glucose, methyl cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, mannitol, sorbitol and the like; for oral administration in liquid form, the oral drug components can be combined with any oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, and the like. Moreover, when desired or necessary, suitable binders, lubricants, disintegrating agents, and coloring agents can also be incorporated into the mixture.
  • suitable binders, lubricants, disintegrating agents, and coloring agents can also be incorporated into the mixture.
  • Suitable binders include starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth or sodium alginate, carboxymethylceUulose, polyethylene glycol, waxes, and the like.
  • Lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like.
  • Disintegrators include, without limitation, starch, methyl cellulose, agar, bentonite, xanthan gum, and the like. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents.
  • certain sweetening and/or flavoring agents may be added.
  • sterile solutions of the active ingredient are usually prepared, and the pH of the solutions should be suitably adjusted and buffered.
  • the total concentration of solutes should be controlled in order to render the preparation isotonic.
  • solutions in sesame or peanut oil or in aqueous propylene glycol can be employed, as well as sterile aqueous solutions of the corresponding water-soluble salts.
  • Such aqueous solutions may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal injection purposes.
  • sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.
  • dilute sterile, aqueous or partially aqueous solutions are prepared.
  • the phrase "pharmaceutically acceptable” refers to an agent that does not interfere with the effectiveness of the biological activity of an active ingredient, and which may be approved by a regulatory agency of the Federal government or a state government, or is listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly for use in humans. Accordingly, suitable pharmaceutically acceptable carriers include agents that do not interfere with the effectiveness of a pharmaceutical composition.
  • the compounds of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles.
  • Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine, or phosphatidylcholines.
  • Compounds of the present invention also may be delivered by the use of monoclonal antibodies as individual carriers to which the compound molecules are coupled.
  • the compounds of the present invention may also be coupled with soluble polymers as targetable drug carriers.
  • Such polymers can include polyvinylpyrrolidone. pyran copolymer, polyhydroxypropylmethacrylamide-phenol, polyhydroxy- ethylaspartamide-phenol, or poiyethyleneoxide-polylysine substituted with palmitoyl residues.
  • the compounds of the present invention may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid. poSyglycoiic acid, copolymers of poiylactic and polyglycolic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates, and crosslinked or amphipathic block copolymers of hydrogels.
  • polylactic acid poSyglycoiic acid, copolymers of poiylactic and polyglycolic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates, and crosslinked or amphipathic block copolymers of hydrogels.
  • the instant compounds are also useful in combination with known agents useful for treating bone-related disorders. Combinations of the presently disclosed compounds with other agents useful in treating osteoporosis or other bone disorders are within the scope of the invention. A person of ordinary skill in the art would be able to discern which combinations of agents would be useful based on the particular characteristics of the drugs and the disease involved.
  • Such agents include but are not limited to the following: an organic bisphosphonate; a cathepsin K inhibitor; an estrogen or an estrogen receptor modulator; an androgen receptor modulator; an inhibitor of osteoclast proton ATPase; an inhibitor of HMG-CoA reductase; an integrin receptor antagonist; an osteoblast anabolic agent, such as PTH; calcitonin; Vitamin D or a synthetic Vitamin D analogue; selective serotonin reuptake inhibitors (SSRIs); and the pharmaceutically acceptable salts and mixtures thereof.
  • administration and variants thereof (e.g.. “administering” a compound) in reference to a compound of the invention means introducing the compound or a prodrug of the compound into the system of the individual in need of treatment.
  • a compound of the invention or prodrug thereof is provided in combination with one or more other active agents (e.g., a bisphosphonate, etc.)
  • “administration' 1 and its variants are each understood to include concurrent and sequential introduction of the compound or prodrug thereof and other agents .
  • the present invention includes within its scope prodrugs of the compounds of this invention.
  • prodrugs will be functional derivatives of the compounds of this invention which are readily convertible in vivo into the required compound.
  • the term ''administering shall encompass the treatment of the various conditions described with the compound specifically disclosed or with a compound which may not be specifically disclosed, but which converts to the specified compound in vivo after administration to the patient.
  • Conventional procedures for the selection and preparation of suitable prodrug derivatives are described, for example, in "Design of Prodrugs,” ed. H. Bundgaard, Elsevier, 1985, which is incorporated by reference herein in its entirety.
  • Metabolites of these compounds include active species produced upon introduction of compounds of this invention into the biological milieu.
  • the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, sex, weight, and response of the individual patient, as well as the severity of the patient's symptoms, the route of administration; and the particular compound or salt thereof employed.
  • An ordinarily skilled physician, veterinarian or clinician can readily determine and prescribe the effective amount of the drug required to prevent, counter, or arrest the progress of the condition.
  • a suitable amount of compound is administered to a mammal undergoing treatment.
  • Oral dosages of the present invention when used for the indicated effects, will range between about 0.01 mg per kg of body weight per day (mg/kg/day) to about 100 mg/kg/day, preferably 0.01 to 10 mg/kg/day, and most preferably 0.1 to 5.0 mg/kg/day.
  • the compositions are preferably provided in the form of tablets containing 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, and 500 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated.
  • a medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably, from about 1 mg to about 100 mg of active ingredient.
  • the most preferred doses will range from about 0.1 to about 10 mg/kg/minute during a constant rate infusion.
  • compounds of the present invention may be administered in a single daily dose, or the total daily dosage may be administered in divided doses of two, three, or four times daily.
  • preferred compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art.
  • the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
  • compositions and methods of the present invention are administered and carried out until the desired therapeutic effect is achieved.
  • the phrase "until the desired therapeutic effect is achieved," as used herein, means that the therapeutic agent or agents are continuously administered, according to the dosing schedule chosen, up to the time that the clinical or medical effect sought for the disease or condition being treated is observed by the clinician or researcher.
  • the pharmaceutical composition is continuously administered until the desired improvement in bone mass or structure is observed. In such instances, achieving an improvement in bone mass or a replacement of abnormal bone structure with normal bone structure are the desired objectives.
  • the pharmaceutical composition is continuously administered for as long as necessary to prevent the undesired condition. In such instances, maintenance of bone mass density is often the objective.
  • Non-limiting examples of administration periods can range from about 2 weeks to the remaining lifespan of the mammal.
  • administration periods can range from about 2 weeks to the remaining lifespan of the human, preferably from about 2 weeks to about 20 years, more preferably from about 1 month to about 20 years, more preferably from about 6 months to about 10 years, and most preferably from about 1 year to about 10 years.
  • composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts.
  • therapeutically effective amount means that amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician.
  • treating or ⁇ 'treatment of a disease as used herein includes: preventing the disease, i.e., causing the clinical symptoms of the disease not to develop in a mammal that may be exposed to or predisposed to the disease but does not yet experience or display symptoms of the disease; inhibiting the disease, i.e., arresting or reducing the development of the disease or its clinical symptoms: or relieving the disease, i.e., causing regression of the disease or its clinical symptoms.
  • the term “improving' * with respect to bone mass or volume includes increasing or maintaining the current bone mass or volume of an individual, and includes slowing the rate of bone loss. As such, the term includes reducing or inhibiting the resorption of bone in bone-related disorders.
  • determining whether an increase in dimerization, nuclear translocation, and/or transcriptional activity of a HIF-l ⁇ /HlF-l ⁇ complex occurs in the cell contacted in vitro with the compound is predictive that the compound is useful for treating a bone-related disorder, or improving bone mass or volume.
  • the term "bone resorption,” as used herein, refers to the process by which osteoclasts degrade bone.
  • bone mass refers to bone mass per unit area, which is sometimes referred to as bone mineral density.
  • T-tests are used to compare the primary outcome of interest, i.e., bone healing response (operational ized as the proportion of Bone Volume/Tota! Volume in the distraction gap), between the treatment and control groups. Additional outcomes include angiogenesis (VV/TV), histologic healing (percent bone per area of distraction gap), and biomechanical properties (stiffness, hardness, energy to failure).
  • VV/TV angiogenesis
  • histologic healing percent bone per area of distraction gap
  • biomechanical properties stress, hardness, energy to failure.
  • independent analyses are conducted for each of the treatment groups relative to each control group. There are no specific hypotheses requiring a comparison of the treatment groups with each other, nor a comparison of the control groups. Therefore, the use of independent t-tests is considered more desirable than an analysis of variance (ANOVA). However, post-hoc analyses are conducted using this type of statistical model.
  • Osteoblasts originate from mesenchymal progenitors or osteoprogenitor cells that, with the appropriate stimulation, undergo proliferation and differentiate into preosteoblasts, and then into mature, functional osteoblasts.
  • osteoblasts form bone-like mineralized nodules by undergoing three stages of development; proliferation, extracellular matrix maturation, and mineralization.
  • specific subsets of genes are sequentially expressed or repressed.
  • collagen I is known to be a marker for proliferation, alkaline phosphatase for extracellular matrix maturation, and osteocalcin for mineralization. The regulation of gene expression in osteoblasts during development and differentiation occurs predominantly at the transcriptional level.
  • osteoblast refers to a terminally or non-terminally differentiated cell derived from a bone precursor cell, wherein the osteoblast cell is at least more differentiated towards an osteoblast phenotype than the cell from which it is derived.
  • osteoblasts or “osteoblast cells” are characterized by the expression of one or more specific marker transcripts, such as, but not limited to, AP-I family members, Runx2, Fra-2, alkaline phosphatase, osteocalcin, ⁇ - catenin, CCAAT/enhancer binding protein (C/EBP), and ATF4, and may also show matrix deposition, matrix mineralization, and/or cubo ⁇ dal morphology of the cells.
  • AP-I family members such as, but not limited to, AP-I family members, Runx2, Fra-2, alkaline phosphatase, osteocalcin, ⁇ - catenin, CCAAT/enhancer binding protein (C/EBP), and ATF4
  • C/EBP CCAAT/enhancer binding protein
  • ATF4 a specific marker transcripts
  • terminalally differentiated osteoblast refers to an osteoblast cell that is actively producing and mineralizing bone material
  • producing an osteoblast cell encompasses the production of a cell culture that is enriched for osteoblast cells.
  • the term "enriched" refers to a cell culture that contains more than approximately 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the desired cell lineage.
  • bone precursor cell refers to a cell that differentiates towards the osteoblast lineage upon treatment with known osteoblast- promoting agents, such as, but not limited to type I collagen, fibrinogen, fibrin, fibrinogen, osteocalcin, osteonectin, TGF- ⁇ , 1,25-OH Vitamin D3, basic fibroblast growth factor, or bone morphogenic protein 2, It is preferred that the bone precursor cell express one or more of osteocalcin, osteonectin, or alkaline phosphatase, In a preferred embodiment, bone precursor cells include osteoprogenitor cells or preosteoblasts.
  • the term ''differentiate refers to the production of a cell type that is more differentiated than the cell type from which it is derived. The term therefore encompasses cell types that are partially and terminally differentiated.
  • the term “express” refers to the transcription of a polynucleotide or translation of a polypeptide in a cell, such that levels of the molecule are measurably higher in a cell that expresses the molecule than they are in a cell that does not express the molecule.
  • Methods to measure the expression of a molecule are well known to those of ordinary skill in the art, and include without limitation, Northern blotting, RT- PCR, in situ hybridization, real time PCR, Western blotting, and immunostaining.
  • the term “contacting” ⁇ i.e., contacting a cell e.g.
  • a target cell, with a compound is intended to include incubating the compound and the celi together in vitro ⁇ e.g., adding the compound to cells in culture).
  • the term "contacting" is not intended to include the in vivo exposure of cells to an effector of the HlF-l ⁇ signaling pathway that may occur naturally in a subject ⁇ i.e., exposure that may occur as a result of a natural physiological process).
  • the step of contacting the cell with a test compound can be conducted in any suitable manner.
  • the ceils may be treated in adherent culture or in suspension culture.
  • a ceil differentiating medium or environment may be utilized to partially, terminally, or reversibly differentiate the bone progenitor cells of the present invention.
  • the medium of the cell differentiation environment may contain a variety of components including, for example. DMEM, Ham's F12 medium, FBS (fetal bovine serum), FGF2 (fibroblast growth factor). ⁇ -MEM, vitamin C, beta glycerophosphate.
  • the cell differentiation environment can also contain supplements such as L-Giutamine, NEAA (non-essential amino acids), and P/S (penicillin/streptomycin).
  • Jt is contemplated that additional factors may be added to the cell differentiation environment, including, but not limited to, fibronectin, iaminin, heparin, heparin sulfate, retinoic acid, members of the epidermal growth factor family (EGFs), members of the fibroblast growth factor family (FGFs) including FGF2 and/or FGF8, members of the platelet derived growth factor family (PDGFs), transforming growth factor (TGF)/ bone morphogenetic protein (BMP)/ growth and differentiation factor (GDF) factor family antagonists including but not limited to noggin, follistatin. chordin, gremlin, cerberus/DAN family proteins, ventropin, high dose activin, and amnionless.
  • EGFs epidermal growth factor family
  • FGFs fibroblast growth factor family
  • PDGFs platelet derived growth factor family
  • TGF transforming growth factor
  • BMP bone morphogenetic protein
  • GDF growth and differentiation factor
  • TGF/BMP/GDF antagonists could also be added in the form of TGF/BMP/GDF receptor- Fc chimeras.
  • Other factors that may be added include molecules that can activate or inactivate signaling through Notch receptor family, including but not limited to proteins of the Delta-like and Jagged families as well as inhibitors of Notch processing or cleavage.
  • Other growth factors may include members of the insulin like growth factor family (IGF), insulin, the wingless related (VVNT) factor family, and the hedgehog factor family.
  • the cell differentiation environment comprises plating the cells in an adherent culture.
  • the terms "plated" and “plating' ' refer to any process that allows a cell to be grown in adherent culture.
  • the term "adherent culture” refers to a cell culture system whereby cells are cultured on a solid surface, which may in turn be coated with a solid substrate that may in turn be coated with another surface coat of a substrate, such as those listed below, or any other chemical or biological material that allows the cells to proliferate or be stabilized in culture.
  • the cells may or may not tightly adhere to the solid surface or to the substrate.
  • the cells are plated on matrigel coated plates.
  • the substrate for the adherent culture may comprise any O ⁇ Q or combination of polyornithine, Iaminin, poly-tysine, purified collagen, gelatin, extracellular matrix, fibronectin, tenascin, vitronectin, entactin, heparin sulfate proteoglycans, poly glycolytic acid (PGA), poly lactic acid (PLA), poly lactic-giycolic acid (PLGA) and feeder layers such as, but not limited to, primary fibroblasts or fibroblast cells lines.
  • the substrate for the adherent culture may comprise the extracellular matrix laid down by a feeder layer, or laid down by the target cell or cell culture.
  • target cells may be cultured with a feeder cell or feeder layer.
  • a "feeder cell” is a cell that is co-cultured with a target cell and stabilizes the target eel! in its current state of differentiation.
  • a feeder layer comprises more than one feeder cell in culture.
  • conditioned medium is obtained from a feeder cell that stabilizes the target cell in its current state of differentiation. Any and all factors produced by a feeder cell that allow a target cell to be stabilized in its current state of differentiation can be isolated and characterized using methods routine to those of skill in the art. These factors may be used in lieu of a feeder layer, or may be used to supplement a feeder layer.
  • the above-mentioned growth factors are provided to the cells so that the growth factors are present in the cultures at concentrations sufficient to promote differentiation of at least a portion of the target cells to the desired cell lineage.
  • the above-mentioned growth factors are present in the cell culture at a concentration of at least about 10 ng/ml, at least about 25 ng/mi, at least about 50 ng/ml, at least about 75 ng/ml, at least about 100 ng/ml, at least about 200 ng/mi, at least about 300 ng/ml, at least about 400 ng/ml, at least about 500 ng/ml, or at least about 1000 ng/ml, In certain embodiments of the present invention, the above- mentioned growth factors are removed from the cell culture subsequent to their addition.
  • the growth factors can be removed within about one day, about two days, about three days, about four days, about five days, about six days, about seven days, about eight days, about nine days or about ten days after their addition.
  • various publications are referenced. The disclosures of al! of these publications and those references cited within those publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.
  • [0081] It should also be understood that the foregoing relates to preferred embodiments of the present invention and that numerous changes may be made therein without departing from the scope of the invention. The invention is further illustrated by the following examples, which are not to be construed in any way as imposing limitations upon the scope thereof.
  • a mouse was developed in which HIF- l ⁇ was increased in bone through genetic manipulation.
  • a strategy to impair degradation of HIF-I ⁇ . rather than increase its expression was required because degradation is the main mode of regulation of HIF-I ⁇ .
  • This impaired degradation was achieved using a targeted Cre/loxP approach to selectively delete VHL (which is responsible for HIF-I degradation) in osteoblasts (Fig. 2A),
  • microCT A marked increase in bone volume per total volume in the femur at 6 weeks of age was noted by microCT in ⁇ VHL mice compared to control littermates (Fig. 2C).
  • the increased vascularity was confirmed by microCT angiography using a technique adapted in collaboration with Dr. Robert Guldberg (Georgia Tech)(Duvall et a!., 2004, Am. J. Physiol. Heart Circ, Physiol. 287:H302-10).
  • the animals were euthanized and perfused with a silicon contrast agent, (M ⁇ crofil® MV-122).
  • the limb was dissected and decalcified, and microCT scanning with 3-D reconstruction of the vasculature was performed.
  • HIF-Ia Increased HIF-Ia In DO Increases Angiogenesis and Bone Formation
  • HIF- l ⁇ and its downstream targets are strongly induced by distraction in the mouse model.
  • cells within the distraction gap consistent with osteoblasts are hypoxic by staining with pimonidazole (data not shown).
  • Pimonidazole which forms adducts with proteins at pO2 less than 10 mm Hg, was administered to mice immediately before an episode of distraction. The animals were sacrificed 3 hours later, and the bones harvested and sectioned. The pimonidazole-protein adducts were then detected by immunohistochemistry. Intense staining was seen in the distraction gap, and specifically, cells lining areas of new bone formation were noted to be hypoxic,
  • vascularity induced in the distraction gap was observed to be almost doubled in the OC-Cre-VHLFl/Fl mice at the end of the distraction period as measured by vessel volume/total volume of regenerate in the distraction zone (reconstructed vasculature Fig. 5A, quantitation, Fig. 5B). This indicates that despite the dramatic upregulation of angiogenic factors during routine DO, a further increase in vascularity can be achieved by increased HIF-I ⁇ .
  • biomechanical testing of the healed bones was performed to determine whether the bone formed was structurally sound. Mice were sacrificed after 21 days consolidation period, and tibiae were collected and fresh frozen.
  • mice Up to 21 days were then allowed for consolidation. The mice were then treated with non-immune IgG or with monoclonal antibodies against mouse VEGF receptors (VEGFR-I (clone rnF-1) and VEGFR-2 (clone DClOl) (ImClone Systems)). Injections were performed intraperitoneally every three days after surgery, for a total of five doses.
  • VEGFR-I mouse VEGF receptors
  • VEGFR-2 clone DClOl
  • Radiographs were performed using a Faxitron x-ray machine postoperatively, following distraction and following consolidation. Any animal in which the device was shown to change position from the original placement or that lost proper alignment during the experimental period was not used for any analysis.
  • Computed tomography was used to quantify bone healing using the MicroCT-40 computed tomography system (Scanco Medical, Bassersdorf, Switzerland) and related analysis software.
  • a volume of interest (VOI) was selected which contained the distraction osteogenesis area.
  • a bone segmentation threshold setting of 204 was employed.
  • BV bone volume
  • TV total volume
  • BV/TV bone surface
  • Tb.Th mean trabecular thickness
  • Tb.Sp trabecular separation
  • Tb.N trabecular number
  • the class of PHDs acting on HIF- l ⁇ require oxygen, iron, and 2- oxyglutarate as co-factors.
  • Small molecules that block these enzymes are iron chelators, such as cobalt and desferoxamine, or 2-oxyglutarate analogs such as L-mimosine and 3,4 DHB, and DMOG.
  • a schematic of the PHD enzyme and the structures of the 2- oxyglutarate analogs is reproduced in Figure 7.
  • a number of previous studies have shown an increase of VEGF and other HIF- l ⁇ target genes in cells treated with the small molecule PHD inhibitors selected here.
  • agents are examined for their ability to activate HIF-l ⁇ by interfering with prolyl hydroxylase(s), thereby blocking VHL mediated HIF- l ⁇ degradation.
  • Small molecules are used initially, due to the ease of preparation and application, relative low cost, and lack of requirement for vectors or carriers as compared to other approaches such as gene therapy or custom peptides. Additional more complex strategies also may be analyzed. Published in vitro experiments using these agents to mimic hypoxia have been have been performed in cell lines or with tumor cells, but there is no published data on their use in primary osteoblasts.
  • HIF-l ⁇ degradation in osteoblasts demonstrated an increase in HIF-l ⁇ and VEGF expression, but little in vitro effect was seen on subsequent differentiation and mineralization (Fig. 2C). Therefore, HIF-l ⁇ accumulation and VEGF expression is used as the first level of screening of agents. Because of the potential for interference with collagen metabolism by blocking C4PHD. evaluation of collagen synthesis is the second level of screening. The desired candidate agents strongly block HIF- l ⁇ destruction, resulting in a marked increase sn HIF-I ⁇ accumulation, but lacks major negative effects on collagen synthesis.
  • Cells are harvested after 0, 3, 6, 12, and 24 hours of continuous exposure to a range of concentrations of the agents. Using standard methods, mRNA is extracted. Real time PCR is performed to quantify the upregulation of VEGF expression with ⁇ -actin as a control. These data serve as the first level of screening as it is quantitative, and a large number of samples can be evaluated simultaneously.
  • Western blotting is used to confirm HIF-I ⁇ activation by selected agents that have strongly upregulated VEGF expression using the same time course and the most effective doses. Nuclear protein is extracted using a commercially available kit (NE-PER, Pierce). Following gradient gel electrophoresis and membrane transfer, Western blotting is performed using a polyclonal antibody to HIF-l ⁇ (Novus) as primary antibody.
  • BSots are developed using ECL detection. Membranes are then washed and reprobed for ⁇ -actin as a loading control. Films are scanned, for example, by using NIH Image, and the image density of HIF-I ⁇ blots is normalized to blots for ⁇ -actin of the corresponding samples.
  • Agents demonstrating strong induction of HIF-l ⁇ are then evaluated for possible effects on collagen synthesis. Cells are grown to near confluence. Media is changed, and PHD inhibiting agents or PBS (control) are added. After 24 hours, secreted collagen in the media is measured.
  • the calvarial osteoblast culture technique is similar to techniques for culturing mesenchymal stem cells from marrow of long bones, and may contain many of the same cell lineages. A distinct advantage is the greater reliability of the calvarial osteoblast cultures. Finally, the ability of manipulation of the osteoblasts to impact bone formation in DO is demonstrated herein by the data showing that VHL deletion in osteoblasts resulted in increased vascularity in response to DO and improved bone volume in healing DO at supraoptimal distraction rates.
  • a 6 mm track distractor (KLS Martin, Jacksonville, FL) is attached to bone with ligature wire. The fibula and tibia are then osteotomized and reapproximated, if necessary.
  • a mini-osmotic pump (Alzet, Cupertino, CA) is filled with the agent of interest and implanted subcutaneously on the back. The tubing is routed to the osteotomy site. The pump is designed to give a constant infusion at a rate which can vary from 0.25-10 ⁇ L/hr based on the model chosen. The desired dosing can be achieved by varying the concentration.
  • the wounds are closed with absorbable monofilament suture.
  • distraction commences. Distraction is achieved by turning a screw on the device (one turn equals 0.3 mm distraction). In the standard protocol, active distraction is for a period of 10 days with 1/2 turn (0.15 mm) per day, for a total lengthening of 1.5 mm, or approximately 8% of the original tibial length. The consolidation phase is then a further 14 days. For the accelerated lengthening protocol, active distraction is lengthened 0.3 mm/day for 10 days (3 mm), or approximately 15% of total length.
  • Histologic, radiographic, and biomechanica! evaluation of healing is performed. Histologic examination of the distracted bone is performed at the end of latency, during distraction, at the end of distraction, and during consolidation. Specimens are stripped of soft tissue, fixed in 4% paraformaldehyde, and decalcified in EDTA. Specimens are embedded in paraffin, sectioned, and mounted onto slides. Examination qualitatively evaluates described features of DO including fibrous tissue, osteoblasts, vessel ingrowth, and bone and cartilage formation. Quantitative analysis of bone formation is performed by color match analysis of Safranin-0 stained sections to yield a percent of the distraction gap occupied by bone, cartilage, or other tissue.
  • Radiographic evaluation includes, for example, Digital x-rays, microCT, and microCT angiography. Digitally captured x-ray images are performed using a Faxitron MX-20 benchtop machine following surgery to confirm alignment.
  • x- rays are used to assess bone formation on day 7 (end of consolidation), day 14 (during distraction), and after 7 and 14 days of consolidation.
  • Micro computed tomography is performed to further evaluate bone healing at consolidation days 7 and 14. Mice are sacrificed and the limbs dissected and the fixators removed.
  • a high resolution (8-36 ⁇ m voxel size) mic ⁇ >CT imaging system is utilized ( ⁇ CT 40, Scanco Medical, Bassersdorff, Switzerland). Approximately 300 contiguous axial slices are obtained at 70 kV and 1 12 ⁇ A with a voxel size of 16 ⁇ m.
  • the region of interest is defined as inclusive of the slices between the most proximal and distal slices containing 50% of the original bone cortex, A bone segmentation threshold setting of 235 (segmentation 1.2/2/235) is employed. Direct calculation of morphometric parameters are obtained with the accompanying software. Bone volume/total volume is the primary microCT endpoint.
  • a perfusion micro-CT technique is used at the completion of distraction and after 7 and 14 days of consolidation.
  • the technique has been adapted to evaluate vasculature within bone.
  • the animals are euthanized, the vasculature flushed with heparinized saline, then fixed with formalin via a needle inserted in the left ventricle.
  • a silicone rubber compound containing lead chromate (Microfil® MV- 122, Flow Tech, Carver, MA) is then injected until the vasculature is observed to be perfused (turns yellow). After polymerization, the limbs are dissected and the bones are decalcified. MicroCt analysis is then performed. The volume of interest is defined as above.
  • a threshold of 306 (segmentation 1.2/2/306) is used, based on visual interpretation of thresholded 2-D tomograms in specimens from preliminary evidence. Three dimensional histomorphometric values vessel volume, connectivity, number, thickness, thickness distribution, separation, and degree of anisotropy are calculated with the accompanying software. Vessel volume as a percent of total volume of the region of interest (distraction gap) is the primary endpoint assessed.
  • Destructive testing is done on a custom made three-point bending fixture with a support span of 12 mm using an 858 MiniBionix Materials Testing System (MTS Systems, Eden Prairie, MN, USA). The specimens are flexed about their medio-lateral axis and loaded at the rate of 0.03 mm/s. Stiffness, peak load, and energy to failure are obtained from the load-displacement graphs while elastic modulus (E) and ultimate strength ( ⁇ f) are obtained incorporating the cross- sectional geometry measures from microCT. Nanoindentation is performed to evaluate microstructural properties. Sections are dehydrated, embedded, and sectioned, then ground, polished, and cleansed ultrasonically.
  • Depth-control nanoindentation tests are conducted using a Nanoindenter XP (MTS Systems, Oak Ridge, TN) with a Berkovich diamond indenter.
  • the loading/unloading process consists of loading to a maximum indentation depth of 500 nm at a strain rate of 0.05 1/s with a 100 s hold period at maximum load to minimize viscoelasticity effects and 200 s hold period at 10% of the maximum load during unloading to correct the displacement due to thermal drift.
  • the modulus and hardness are calculated from the load-displacement curves using Oliver and Pharr method.
  • HIF- l ⁇ activation in osteoblasts during development and during skeletal repair in DO leads to dramatically increased bone formation and vascularity in vivo.
  • Pharmacologic agents can increase HIF-I ⁇ and downstream target VEGF levels in osteoblasts in vitro. Therefore, it is expected that increased HIF-l ⁇ activation by local application of pharmacologic agents will improve healing of DO by increasing angiogenesis and bone formation in the distraction gap.
  • Primary endpoints are BV/TV by microCT for bone healing and VV/TV by microCT for angiogenesis. A significant increase in VV/TV in the treated group in both the standard and accelerated protocols is anticipated. As discussed previously, standard distraction ultimately leads to routine bone healing without intervention.
  • BV/TV may differ at the midpoint of consolidation, indicating faster healing, or following rapid distraction, indicating ability to heal larger gaps in the same time. Either result could translate to decreased total time of external fixation required per length obtained (analogous to bone healing index clinically). Histology will provide additional data on bone formation, vascularity, and HIF-I ⁇ activation.
  • the doses and route proposed represent a starting point based on published series to maximize effect while attempting to avoid toxicity. Additionally, use of a vehicle for local administration may be required, though a single local injection (fibroblast growth factor) has been effective in improving healing in a rabbit distraction model. If necessary, fibrin gel has been successfully used in other models and could be easily adapted to this protocol.
  • the described delivery system allows sustained application of the desired agents which should in theory serve to maximize effect and minimize potential toxicity. It has been used successfully to deliver IGF-I to improve intramembranous healing of calvarial defects in a rat model. Control animals with vehicle administration alone are included.
  • HIF- l ⁇ pathway Activation of the HIF- l ⁇ pathway is likely to increase angiogenesis and osteogenesis, at least in part, by increasing VEGF. Bone healing was improved by local application of VEGF in a rabbit fracture non-union model (Eckardt et al,, 2005, J Bone Joint Surg. Br. 87: 1434-38). However, a similar investigation of local application of VEGF or VEGF inhibitor to distraction sites did not show improved or impaired bone formation during DO in rabbits. Those authors speculated one possible explanation for the lack of improvement in bone formation in distraction could be near maximal stimulation by distraction alone, or lack of additional vascular promoters such as angiopoetin.
  • HIF- l ⁇ impinges on a number of angiogenic factors in addition to VEGF, so it is reasonable to expect that activating the HlF- l ⁇ pathway may yield different results.
  • factors in addition to vascular formation are required. Since HIF-l ⁇ is known to not only be important in angiogenesis, but also involved in cell recruitment and inflammation, and impinges on mesynchymat stem cell differentiation, it is uniquely qualified to muster the necessary resources for skeletal repair.
  • OC-Cre-VHL mice exhibit greatly increased bone formation, but the bone is immature, woven bone. Therefore, it may be advantageous to produce a large quantity of bone in the distraction and early consolidation period, and then remove the stimulus to allow HIF- l ⁇ activity to normalize to allow normal remodeling and maturation of the bone in the distraction gap. Accordingly, the design of the osmotic pumps lends itself most easily to delivery for a two week time course, coinciding with the latency and distraction phases. Alternately, therapy could be initiated by waiting to fill the pumps at the beginning of the distraction phase. Replacing the pumps may be necessary if a longer duration of treatment is required. The ability to vary the timing and the duration of intervention is a potential advantage over gene therapy approaches.
  • HREs HIF- responsive elements
  • U2OS human osteosarcoma cell line stably expressing a luciferase reporter construct under the control of a hypoxia response element (U2OS-HRE-luc) The cells were treated for 24 hours DFO or L-mim, and luciferase activity was detected using the Bright-Glo luciferase reagent (Promega) and a luminometer. Cells cultured in hypoxia ( ⁇ 1% O 2 ) served as the positive controls. Desferoxamine (DFO) and L-mimosine (L- mim) strongly activated HREs in this reporter assay (Fig. 9A).
  • the agents were further tested in vitro using primary mouse bone marrow mesenchymal stem cells (MSCs) isolated from marrow flushes of the femora and tibiae of normal FVBn mice. Ficoll column purification was performed, and the adherent cells were subcultured. Cells were exposed to L-Mim or DFO for 24 hours, and then total RNA was extracted by the TRIZOL protocol (Invitrogen). Real time PCR was performed at 57°C for 30 cycles in the Opticon Continuous Fluorescent Detector using IQTM SYBR Green supermix (Bio-Rad. Hercules, CA, USA). Triplicate tests were performed, and results were normalized to ⁇ -actin. The following primers were used: VEGFA: F5'- CCACGTCAGAGAGCAACATCA -3' (SEQ ID NO:1) and R5 r -
  • DFO and L-mim were tested to determine whether they could influence vascularity in vitro.
  • Matrigel tube formation assays were performed with human umbilical vein endothelial cells (HUVEC) treated with the agents.
  • VEGF was used for a positive control, and VEGF receptor antibodies were applied as a negative control. Numbers of tube like structures were counted after 12 hours incubation. Exposure to DFO, but not L-mim, increased formation of tube-like structures compared to controls (data not shown).
  • DFO was, therefore, selected for local application in the DO model by repeated injection. Wild type C57/B6 mice were injected with DFO or saiine every other day during the active distraction phase with 20 ⁇ L of saline (control) or DFO 200 ⁇ M, for a total of five doses. DFO strongly increased vascularity in the distraction gap, as demonstrated by significantly increased vessel number and vessel connectivity (Fig. I OB, 10D). X-ray and microCT examination after 14 days consolidation showed that bone regeneration was increased following DFO treatment. BV and BV/TV, and were significantly increased compared with the controls (Fig. 1 OA, 1OC, 10E).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Inorganic Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des compositions comprenant des inhibiteurs de prolylhydroxylase (S), et des procédés d'utilisation des compositions pour favoriser une guérison osseuse, augmenter une masse ou un volume osseux, promouvoir une différenciation de cellules d'ostéoblastes, et/ou favoriser une ostéogenèse. Les compositions de la présente invention peuvent également être utilisées dans le traitement de divers troubles caractérisés par une perte osseuse ou une diminution de la densité osseuse. La présente invention fournit en outre un outil de dépistage pour la détermination de composés additionnels capables de favoriser une guérison osseuse, favoriser une différenciation de cellules d'ostéoblastes, augmenter une masse osseuse ou un volume osseux, et/ou promouvoir l'ostéogenèse.
PCT/US2008/066567 2007-06-13 2008-06-11 Procédés de modulation d'une différenciation de cellules d'ostéoblastes et d'une génération osseuse grâce à une inhibition d'une prolylhydroxylase WO2008157177A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US94372307P 2007-06-13 2007-06-13
US60/943,723 2007-06-13

Publications (1)

Publication Number Publication Date
WO2008157177A1 true WO2008157177A1 (fr) 2008-12-24

Family

ID=40156598

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/066567 WO2008157177A1 (fr) 2007-06-13 2008-06-11 Procédés de modulation d'une différenciation de cellules d'ostéoblastes et d'une génération osseuse grâce à une inhibition d'une prolylhydroxylase

Country Status (1)

Country Link
WO (1) WO2008157177A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102892385A (zh) * 2010-04-29 2013-01-23 细胞安全有限公司 包含二羟基苯甲酸衍生物的骨移植用或骨填充用组合物

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5367113A (en) * 1991-10-30 1994-11-22 University Of Florida Research Foundation, Inc. Method for synthesis of desferrioxamine B, analogs and homologs thereof
US20020019351A1 (en) * 1998-02-23 2002-02-14 Ke Huazhu Treatment of skeletal disorders
WO2006114213A1 (fr) * 2005-04-28 2006-11-02 Bayer Healthcare Ag Derives de 4-(pyridin-3-yl)-2-(pyridin-2-yl)-1,2-dihydro-3h-pyrazol-3-one utilises en tant qu'inhibiteurs specifiques des hif-prolyl-4-hydroxylases pour traiter des maladies cardiovasculaires et hematologiques
US20070004627A1 (en) * 2005-06-15 2007-01-04 Fibrogen, Inc. Compounds and methods for treatment of cancer
WO2007047194A2 (fr) * 2005-10-11 2007-04-26 Dana-Farber Cancer Institute, Inc. Méthodes pour traiter des troubles en rapport avec le mitf

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5367113A (en) * 1991-10-30 1994-11-22 University Of Florida Research Foundation, Inc. Method for synthesis of desferrioxamine B, analogs and homologs thereof
US20020019351A1 (en) * 1998-02-23 2002-02-14 Ke Huazhu Treatment of skeletal disorders
WO2006114213A1 (fr) * 2005-04-28 2006-11-02 Bayer Healthcare Ag Derives de 4-(pyridin-3-yl)-2-(pyridin-2-yl)-1,2-dihydro-3h-pyrazol-3-one utilises en tant qu'inhibiteurs specifiques des hif-prolyl-4-hydroxylases pour traiter des maladies cardiovasculaires et hematologiques
US20070004627A1 (en) * 2005-06-15 2007-01-04 Fibrogen, Inc. Compounds and methods for treatment of cancer
WO2007047194A2 (fr) * 2005-10-11 2007-04-26 Dana-Farber Cancer Institute, Inc. Méthodes pour traiter des troubles en rapport avec le mitf

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102892385A (zh) * 2010-04-29 2013-01-23 细胞安全有限公司 包含二羟基苯甲酸衍生物的骨移植用或骨填充用组合物
EP2567675A2 (fr) * 2010-04-29 2013-03-13 Cellsafe Co. Ltd. Composition de greffe osseuse ou d'obturation osseuse comprenant un dérivé d'acide dihydroxybenzoïque
JP2013524990A (ja) * 2010-04-29 2013-06-20 セルセイフ カンパニー リミテッド ジヒドロキシ安息香酸誘導体を含む骨移植用または骨充填用の組成物
EP2567675A4 (fr) * 2010-04-29 2014-01-15 Cellsafe Co Ltd Composition de greffe osseuse ou d'obturation osseuse comprenant un dérivé d'acide dihydroxybenzoïque
US8871749B2 (en) 2010-04-29 2014-10-28 Cellsafe Co., Ltd. Bone-transplant or bone-filling composition comprising a dihydroxybenzoic acid derivative

Similar Documents

Publication Publication Date Title
Delgado-Calle et al. Role and mechanism of action of sclerostin in bone
Suen et al. Sclerostin, an emerging therapeutic target for treating osteoporosis and osteoporotic fracture: A general review
Yoon et al. The opposing effects of CCN2 and CCN5 on the development of cardiac hypertrophy and fibrosis
Tabit et al. Tumor necrosis factor-α levels and non-surgical bleeding in continuous-flow left ventricular assist devices
Jilka et al. Intermittent PTH stimulates periosteal bone formation by actions on post-mitotic preosteoblasts
US20150352131A1 (en) Compositions and Methods for the Prevention and Treatment of Osteolysis and Osteoporosis
KR102434879B1 (ko) 폐혈관 질환 치료용 조성물 및 방법
Guo et al. Salidroside improves angiogenesis-osteogenesis coupling by regulating the HIF-1α/VEGF signalling pathway in the bone environment
Cantini et al. Profibrotic role of myostatin in Peyronie's disease
Schindeler et al. Modeling bone morphogenetic protein and bisphosphonate combination therapy in wild‐type and Nf1 haploinsufficient mice
US20200297775A1 (en) Enhanced direct cardiac reprogramming
US20100015164A1 (en) Compositions and Methods for Modulating Osteoblast Cell Differentiation and Bone Generation Through HIF-1a
Xiong et al. FOXO1 differentially regulates bone formation in young and aged mice
US9833467B2 (en) Use of cyclophilin D inhibitors to treat or prevent bone disorders
Tang et al. p53 peptide prevents LITAF-induced TNF-alpha-mediated mouse lung lesions and endotoxic shock
WO2008157177A1 (fr) Procédés de modulation d'une différenciation de cellules d'ostéoblastes et d'une génération osseuse grâce à une inhibition d'une prolylhydroxylase
CN115786270A (zh) 工程化的巨噬细胞及其在治疗纤维化疾病中的应用
Kawao et al. Tmem119 is involved in bone anabolic effects of PTH through enhanced osteoblastic bone formation in mice
US20220280607A1 (en) Treatment of Heart Defects and Conditions in Pediatric Patients
CN116744949A (zh) 一种用于预防或治疗纤维化的、包含线粒体的药物组合物
WO2017149306A1 (fr) Polythérapie
US20040105860A1 (en) Cell modulation using a cytoskeletal protein
WO2017126655A1 (fr) Composition pharmaceutique permettant de prévenir ou de traiter la douleur, et procédé de criblage pour la recherche d'une substance de prévention de la douleur utilisant le robo4
JP5927782B2 (ja) 石灰化組織における可溶化Ｋｌｏｔｈｏ、ＦＧＦ２３およびＦＧＦＲ複合体形成機構を利用した用途
KR20160062517A (ko) Ｄｐｐ­４ 저해제를 유효성분으로 함유하는 혈관 석회화 억제용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08770716

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08770716

Country of ref document: EP

Kind code of ref document: A1