WO2008116878A1 - Hafnia phytase - Google Patents

Hafnia phytase Download PDF

Info

Publication number
WO2008116878A1
WO2008116878A1 PCT/EP2008/053561 EP2008053561W WO2008116878A1 WO 2008116878 A1 WO2008116878 A1 WO 2008116878A1 EP 2008053561 W EP2008053561 W EP 2008053561W WO 2008116878 A1 WO2008116878 A1 WO 2008116878A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
phytase
seq
identity
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2008/053561
Other languages
English (en)
French (fr)
Inventor
Soeren Flensted Lassen
Carsten Sjoeholm
Lars Kobberoee Skov
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novozymes AS
Original Assignee
Novozymes AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes AS filed Critical Novozymes AS
Priority to EP08718230.9A priority Critical patent/EP2129781B1/en
Priority to ES08718230.9T priority patent/ES2456960T3/es
Priority to AU2008231749A priority patent/AU2008231749B2/en
Priority to CA2681392A priority patent/CA2681392C/en
Priority to PL08718230T priority patent/PL2129781T3/pl
Priority to DK08718230.9T priority patent/DK2129781T3/da
Priority to BRPI0808999-0A priority patent/BRPI0808999B1/pt
Priority to CN200880017652.9A priority patent/CN101679986B/zh
Priority to MX2009010043A priority patent/MX289945B/es
Priority to JP2010500256A priority patent/JP5643083B2/ja
Publication of WO2008116878A1 publication Critical patent/WO2008116878A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K20/00Accessory food factors for animal feeding-stuffs
    • A23K20/10Organic substances
    • A23K20/142Amino acids; Derivatives thereof
    • A23K20/147Polymeric derivatives, e.g. peptides or proteins
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K20/00Accessory food factors for animal feeding-stuffs
    • A23K20/10Organic substances
    • A23K20/174Vitamins
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K20/00Accessory food factors for animal feeding-stuffs
    • A23K20/10Organic substances
    • A23K20/189Enzymes
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K50/00Feeding-stuffs specially adapted for particular animals
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K50/00Feeding-stuffs specially adapted for particular animals
    • A23K50/30Feeding-stuffs specially adapted for particular animals for swines
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K50/00Feeding-stuffs specially adapted for particular animals
    • A23K50/70Feeding-stuffs specially adapted for particular animals for birds
    • A23K50/75Feeding-stuffs specially adapted for particular animals for birds for poultry
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K50/00Feeding-stuffs specially adapted for particular animals
    • A23K50/80Feeding-stuffs specially adapted for particular animals for aquatic animals, e.g. fish, crustaceans or molluscs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L29/00Foods or foodstuffs containing additives; Preparation or treatment thereof
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17Amino acids, peptides or proteins
    • A23L33/18Peptides; Protein hydrolysates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/01Carboxylic ester hydrolases (3.1.1)
    • C12Y301/01004Phospholipase A2 (3.1.1.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/01Carboxylic ester hydrolases (3.1.1)
    • C12Y301/01005Lysophospholipase (3.1.1.5)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/03Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/030083-Phytase (3.1.3.8)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/03Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/030264-Phytase (3.1.3.26), i.e. 6-phytase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/04Phosphoric diester hydrolases (3.1.4)
    • C12Y301/04003Phospholipase C (3.1.4.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/04Phosphoric diester hydrolases (3.1.4)
    • C12Y301/04004Phospholipase D (3.1.4.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01001Alpha-amylase (3.2.1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01004Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01006Endo-1,3(4)-beta-glucanase (3.2.1.6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01008Endo-1,4-beta-xylanase (3.2.1.8)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01022Alpha-galactosidase (3.2.1.22)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01032Xylan endo-1,3-beta-xylosidase (3.2.1.32), i.e. endo-1-3-beta-xylanase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01089Arabinogalactan endo-beta-1,4-galactanase (3.2.1.89)
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel

Definitions

  • a phytase producing bacterial strain was isolated from Danish soil. The strain was demonstrated to produce a phytase with acidic pH optimum and high thermostability. The strain was identified as Hafnia alvei and it was deposited on March 21 , 2007, under the terms of the Budapest Treaty with Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) and given the following accession number:
  • the present invention relates to isolated polypeptides having phytase activity and isolated polynucleotides encoding the polypeptides.
  • the polypeptides are related to a phytase derived from Hafnia alvei, the amino acid sequence of which is shown in the appended sequence listing as SEQ ID NO: 10.
  • the invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides, in particular within animal feed.
  • Phytases are well-known enzymes, as are the advantages of adding them to foodstuffs for animals, including humans. Phytases have been isolated from very many sources, including a number of fungal and bacterial strains. It is an object of the present invention to provide alternative polypeptides having phytase activity and polynucleotides encoding the polypeptides.
  • polypeptides of the invention are preferably of amended, more preferably improved, properties, for example of a different substrate specificity, of a higher specific activity, of an increased stability (such as acid-stability, heat-stability, and/or protease stability, in particular pepsin stability), of an altered pH optimum (such as a lower, or higher pH optimum) and/or of an improved performance in animal feed (such as an improved release and/or degradation of phytate).
  • the present invention relates to polypeptides having phytase activity, selected from the group consisting of: (a) a polypeptide having an amino acid sequence which has at least 75% identity with (i) amino acids 1 to 413 of SEQ ID NO: 10, and/or (ii) the mature polypeptide part of SEQ ID NO: 10; (b) a variant comprising a deletion, insertion, and/or conservative substitution of one or more amino acids of (i) amino acids 1 to 413 of SEQ ID NO: 10, and/or (ii) the mature polypeptide part of SEQ ID NO: 10; and/or (c) a fragment of (i) amino acids 1 to 413 of SEQ ID NO: 10, and/or (ii) the mature polypeptide part of SEQ ID NO: 10.
  • the invention also relates to isolated polynucleotides encoding a polypeptide having phytase activity, selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with amino acids 1 to 413 of SEQ ID NO: 10; and (b) a polynucleotide having at least 75% identity with nucleotides 100 to 1338 of SEQ ID NO: 9.
  • the invention also relates to nucleic acid constructs, recombinant expression vectors, and recombinant host cells comprising the polynucleotides.
  • the invention also relates to methods for producing such polypeptides having phytase activity comprising (a) cultivating a recombinant host cell comprising a nucleic acid construct comprising a polynucleotide encoding the polypeptide under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • the invention further relates to a nucleic acid construct comprising a gene encoding a protein operably linked to a nucleotide sequence encoding a signal peptide consisting of (i) nucleotides 1 to 99 of SEQ ID NO: 1 1.
  • the invention also relates to methods of using the phytases of the invention in animal feed, as well as animal feed and animal feed additive compositions containing the polypeptides.
  • the invention also relates to methods of using the phytases of the invention in producing a fermentation product, such as, e.g., ethanol, beer, wine, wherein the fermentation is carried out in the presence of a phytase of the present invention.
  • a fermentation product such as, e.g., ethanol, beer, wine
  • the present invention relates to methods for treating proteins, including vegetable proteins, with the phytases of the present invention.
  • Fig. 1 shows the residual inositol-phosphate bound phosphorous after in vitro incubation in a comparison between the Hafnia alvei phytase and a Citrobacter braakii phytase dosed from 125 to 500 FYT/kg Feed.
  • Fig. 2 shows a comparison of the residual inositol-phosphate bound phosphorous after in vitro incubation between the Hafnia alvei phytase and a Peniophora lycii phytase phytase dosed at 250 FYT/kg Feed and 500 FYT/kg Feed.
  • Fig. 3 shows the Appendix of the structural coordinates for the solved crystal three dimensional structure of the Hafnia alvei phytase.
  • a polypeptide having phytase activity is an enzyme which catalyzes the hydrolysis of phytate (myo-inositol hexakis- phosphate) to (1 ) myo-inositol and/or (2) mono-, di-, tri-, tetra- and/or penta-phosphates thereof and (3) inorganic phosphate.
  • the ENZYME site at the internet is a repository of information relative to the nomenclature of enzymes. It is primarily based on the recommendations of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (IUB-MB) and it describes each type of characterized enzyme for which an EC (Enzyme Commission) number has been provided (Bairoch A.
  • a 3- phytase (myo-inositol hexaphosphate 3-phosphohydrolase, EC 3.1.3.8), a 6-phytase (myoinositol hexaphosphate 6-phosphohydrolase, EC 3.1.3.26), and a 5-phytase (EC 3.1.3.72).
  • all types are included in the definition of phytase.
  • the phytases of the invention belong to the family of acid histidine phosphatases, which includes the Escherichia coli pH 2.5 acid phosphatase (gene appA) as well as fungal phytases such as Aspergillus awamorii phytases A and B (EC: 3.1.3.8) (gene phyA and phyB).
  • the histidine acid phosphatases share two regions of sequence similarity, each centered around a conserved histidine residue. These two histidines seem to be involved in the enzymes' catalytic mechanism. The first histidine is located in the N-terminal section and forms a phosphor-histidine intermediate while the second is located in the C-terminal section and possibly acts as proton donor.
  • the phytases of the invention have a conserved active site motif, viz. R-H-G-X-R-X-P, wherein X designates any amino acid (see amino acids 18 to 24 of the mature phytase shown in SEQ ID NO: 10).
  • the phytase activity is determined in the unit of FYT, one FYT being the amount of enzyme that liberates 1 micro-mol inorganic ortho- phosphate per min. under the following conditions: pH 5.5; temperature 37°C; substrate: sodium phytate (C 6 H 6 O 24 PeNa I2 ) in a concentration of 0.0050 mol/l.
  • Suitable phytase assays are the FYT and FTU assays described in Example 1 of WO 00/20569.
  • FTU is for determining phytase activity in feed and premix.
  • Phytase activity may also be determined using the phytase assays of the examples herein.
  • pH optimum The pH-optimum of a polypeptide of the invention is determined by incubating the phytase at various pH-values, using a substrate in a pre-determined concentration and a fixed incubation temperature. The pH-optimum is then determined from a graphical representation of phytase activity versus pH.
  • the FYT assay is used, viz. the substrate is 5mM sodium phytate, the reaction temperature 37°C, and the activity is determined in FYT units at various pH-values, as done in the examples below.
  • the phytase assay of any one of the examples is used.
  • a relatively low pH-optimum means a pH-optimum below pH 5.0, for example below pH 4.5, 4.0, 3.5, 3.0, 2.5, or even below 2.0.
  • a relatively high pH-optimum means a pH-optimum above pH 5.0, for example above pH 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or even above 9.0.
  • Isolated polypeptide refers to a polypeptide which is at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, most preferably at least 90% pure, and even most preferably at least 95% pure, as determined by SDS-PAGE.
  • substantially pure polypeptide denotes herein a polypeptide preparation which contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material with which it is natively associated.
  • the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99%, most preferably at least 99.5% pure, and even most preferably 100% pure by weight of the total polypeptide material present in the preparation.
  • polypeptides of the present invention are preferably in a substantially pure form.
  • the polypeptides are in "essentially pure form", i.e., that the polypeptide preparation is essentially free of other polypeptide material with which it is natively associated. This can be accomplished, for example, by preparing the polypeptide by means of well-known recombinant methods or by classical purification methods.
  • substantially pure polypeptide is synonymous with the terms “isolated polypeptide” and “polypeptide in isolated form.”
  • Identity The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "identity”.
  • the degree of identity between two amino acid sequences is determined by the program "align” which is a Needleman-Wunsch alignment (i.e. global alignment), useful for both protein and DNA alignments.
  • the default scoring matrix BLOSU M50 and the default identity matrix are used for protein and DNA alignments respectively.
  • the penalty for the first residue in a gap is -12 for proteins and -16 for DNA. While the penalties for additional residues in a gap are -2 for proteins and -4 for DNA.
  • Align is part of the FASTA package version v20u6 (see W. R. Pearson and D. J.
  • the Needleman-Wunsch algorithm is described in Needleman, S. B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48: 443-453, and the align program by Myers and W. Miller in "Optimal Alignments in Linear Space” CABIOS (computer applications in the biosciences) (1988) 4:1 1-17.
  • the degree of identity between the target (or sample, or test) sequence and a specified sequence e.g.
  • amino acids 1 to 413 of the mature phytase shown in SEQ ID NO: 10 may also be determined as follows: The sequences are aligned using the program "align.” The number of perfect matches (“N-perfect-match”) in the alignment is determined (a perfect match means same amino acid residue in same position of the alignment, usually designated with a "
  • " in the alignment). The length of the specified sequence (the number of amino acid residues) is determined ("N-specified", in the example mentioned above 413). The degree of identity is calculated as the ratio between "N-perfect-match" and "N-specified” (for conversion to percentage identity, multiply by 100).
  • the degree of identity between a target (or sample, or test) sequence and the specified sequence is determined as follows: The two sequences are aligned using the program "align.” The number of perfect matches ("N-perfect-match") in the alignment is determined (a perfect match means same amino acid residue in same position of the alignment, usually designated with a "
  • the degree of identity between a target (or sample, or test) sequence and a specified sequence is determined as follows: The sequences are aligned using the program "align.” The number of perfect matches ("N-perfect-match") in the alignment is determined (a perfect match means same amino acid residue in same position of the alignment, usually designated with a "I” in the alignment). The length of the target sequence (the number of amino acid residues) is determined ("N-target”). The degree of identity is calculated as the ratio between "N-perfect-match" and "N-target” (for conversion to percentage identity, multiply by 100).
  • the overlap is at least 20% of the specified sequence ("N-overlap" as defined above, divided by the number of the amino acids in the specified sequence ("N- specified"), and multiplied by 100), more preferably at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or at least 95%.
  • N-overlap as defined above, divided by the number of the amino acids in the specified sequence
  • N- specified the specified sequence
  • the overlap is at least 20% of the specified sequence (N-overlap" as defined above, divided by the number of the amino acids in the specified sequence ("N- specified"), and multiplied by 100), more preferably at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or at least 95%.
  • at least 20% (preferably 25-95%) of the amino acids of the specified sequence end up being included in the overlap, when the sample sequence is aligned to the specified sequence.
  • the overlap is at least 20% of the target (or sample, or test) sequence ("N-overlap” as defined above, divided by "N-target” as defined above, and multiplied by 100), more preferably at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or at least 95%.
  • N-overlap as defined above, divided by "N-target” as defined above, and multiplied by 100
  • the overlap is at least 20% of the target (or sample, or test) sequence ("N-overlap” as defined above, divided by "N-target” as defined above, and multiplied by 100), more preferably at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or at least 95%.
  • at least 20% (preferably 25-95%) of the amino acids of the target sequence end up being included in the overlap, when aligned against the specified sequence).
  • Polypeptide Fragment is defined herein as a polypeptide having one or more amino acids deleted from the amino and/or carboxyl terminus of the mature peptide part of the specified sequence, e.g. SEQ ID NO: 10, or a homologous sequence thereof, wherein the fragment has phytase activity.
  • the fragment contains at least 350, 360, 370, 380, 390, 400, 405, or at least 410 amino acid residues.
  • Subsequence is defined herein as a nucleotide sequence having one or more nucleotides deleted from the 5' and/or 3' end of the mature peptide encoding part of the specified sequence, e.g. SEQ ID NO: 9, or a homologous sequence thereof, wherein the subsequence encodes a polypeptide fragment having phytase activity.
  • the subsequence contains at least 1050, 1080, 11 10, 1 140, 1 170, 1200, 1215, 1230, 1245, 1260, 1275, 1290, 1305, 1320, or at least 1335 nucleotides.
  • allelic variant denotes herein any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences.
  • An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
  • substantially pure polynucleotide refers to a polynucleotide preparation free of other extraneous or unwanted nucleotides and in a form suitable for use within genetically engineered protein production systems.
  • a substantially pure polynucleotide contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1 %, and even most preferably at most 0.5% by weight of other polynucleotide material with which it is natively associated.
  • a substantially pure polynucleotide may, however, include naturally occurring 5' and 3' untranslated regions, such as promoters and terminators. It is preferred that the substantially pure polynucleotide is at least 90% pure, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, even more preferably at least 98% pure, most preferably at least 99%, and even most preferably at least 99.5% pure by weight.
  • the polynucleotides of the present invention are preferably in a substantially pure form.
  • the polynucleotides disclosed herein are in "essentially pure form", i.e., that the polynucleotide preparation is essentially free of other polynucleotide material with which it is natively associated.
  • substantially pure polynucleotide is synonymous with the terms “isolated polynucleotide” and “polynucleotide in isolated form.”
  • the polynucleotides may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.
  • nucleic acid construct refers to a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or which is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature.
  • nucleic acid construct is synonymous with the term “expression cassette” when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention.
  • Control sequence The term “control sequences” is defined herein to include all components, which are necessary or advantageous for the expression of a polynucleotide encoding a polypeptide of the present invention. Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide.
  • control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
  • the control sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide.
  • operably linked denotes herein a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence such that the control sequence directs the expression of the coding sequence of a polypeptide.
  • Coding sequence When used herein the term "coding sequence” means a nucleotide sequence, which directly specifies the amino acid sequence of its protein product.
  • the boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or alternative start codons such as GTG and
  • the coding sequence may a DNA, cDNA, or recombinant nucleotide sequence.
  • Mature polypeptide part When used herein the terms "mature polypeptide part" or
  • mature peptide part refers to that part of the polypeptide which is secreted by a cell which contains, as part of its genetic equipment, a polynucleotide encoding the polypeptide.
  • the mature polypeptide part refers to that part of the polypeptide which remains after the signal peptide part is cleaved off once it has fulfilled its function of directing the encoded polypeptide into the cell's secretory pathway.
  • amino acids -33 to -1 thereof which means that the predicted mature polypeptide part of SEQ ID NO: 10 corresponds to amino acids 1 to 413 thereof.
  • a slight variation may occur from host cell to host cell, and therefore the expression mature polypeptide part is preferred.
  • Mature polypeptide encoding part When used herein the term “mature polypeptide encoding part” or “mature polypeptide coding sequence” refers to that part of the polynucleotide encoding the polypeptide which encodes the mature polypeptide part. For example, for SEQ ID NO: 9, the predicted mature polypeptide encoding part corresponds to nucleotides 100 to 1338 (encoding amino acids 1 to 413 of SEQ ID NO: 10).
  • Expression includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
  • Expression vector is defined herein as a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide of the invention, and which is operably linked to additional nucleotides that provide for its expression.
  • host cell includes any cell type which is susceptible to transformation, transfection, transduction, and the like with a nucleic acid construct comprising a polynucleotide of the present invention.
  • Modification means herein any chemical modification of the specified polypeptide, e.g. the polypeptide consisting of the amino acids 1 to 413 of SEQ ID NO: 10, as well as genetic manipulation of the DNA encoding that polypeptide.
  • the modification(s) can be substitution(s), deletion(s) and/or insertions(s) of the amino acid(s) as well as replacement(s) of amino acid side chain(s).
  • Artificial variant When used herein, the term “artificial variant” means a polypeptide having phytase activity produced by an organism expressing a modified nucleotide sequence of mature phytase encoding part of SEQ ID NO: 9. The modified nucleotide sequence is obtained through human intervention by modification of the mature phytase encoding part of the nucleotide sequence disclosed in SEQ ID NO: 9.
  • the present invention relates to isolated polypeptides having phytase activity and having an amino acid sequence which has a degree of identity to amino acids 1 to 413 of SEQ ID NO: 10 (i.e., the mature polypeptide) of at least 75%.
  • the degree of identity is at least 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%, which have phytase activity (hereinafter "homologous polypeptides").
  • the homologous polypeptides have an amino acid sequence which differs by 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid from amino acids 1 to 413 of SEQ ID NO: 10.
  • the polypeptide of the present invention comprises the mature part of the amino acid sequence of SEQ ID NO: 10, or is an allelic variant thereof; or a fragment thereof that has phytase activity.
  • the polypeptide comprises amino acids 1 to 413 of SEQ ID NO: 10, or an allelic variant thereof; or a fragment thereof that has phytase activity.
  • the present invention relates to isolated polypeptides having phytase activity which are encoded by polynucleotides which hybridize under at least medium, preferably medium, stringency conditions with (i) nucleotides 100 to 1338 of SEQ ID NO: 9, (ii) the mature polypeptide encoding part of SEQ ID NO: 9, and/or (iii) a complementary strand of any one of (i), and (ii), and/or (iv) a subsequence of (i), (ii), or (iii) (J. Sambrook, E. F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).
  • a subsequence of SEQ ID NO: 9 contains at least 100 contiguous nucleotides or preferably at least 200 contiguous nucleotides. Moreover, the subsequence may encode a polypeptide fragment which has phytase activity.
  • the hybridization takes place under at least medium-high, at least high, or at least very high stringency conditions; preferably under medium-high, high, or very high stringency conditions.
  • the hybridization is conducted under very low, or low stringency conditions.
  • nucleotide sequence of SEQ ID NO: 9, or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO: 10, or a fragment thereof may be used to design a nucleic acid probe to identify and clone DNA encoding polypeptides having phytase activity from strains of different genera or species according to methods well known in the art.
  • probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein.
  • Such probes can be considerably shorter than the entire sequence, but should be at least 14, preferably at least 25, more preferably at least 35, and most preferably at least 70 nucleotides in length.
  • the nucleic acid probe is at least 100 nucleotides in length.
  • the nucleic acid probe may be at least 200 nucleotides, preferably at least 300 nucleotides, more preferably at least 400 nucleotides, or most preferably at least 500 nucleotides in length.
  • Even longer probes may be used, e.g., nucleic acid probes which are at least 600 nucleotides, at least preferably at least 700 nucleotides, more preferably at least 800 nucleotides, or most preferably at least 900 nucleotides in length.
  • Both DNA and RNA probes can be used.
  • the probes are typically labeled for detecting the corresponding gene (for example, with 32 P, 3 H, 35 S, biotin, or avidin). Such probes are encompassed by the present invention.
  • a genomic DNA library prepared from such other organisms may, therefore, be screened for DNA which hybridizes with the probes described above and which encodes a polypeptide having phytase activity.
  • Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or
  • the carrier material is used in a Southern blot.
  • hybridization indicates that the nucleotide sequence hybridizes to a labeled nucleic acid probe corresponding to the nucleotide sequence shown in SEQ ID NO: 9, the complementary strand thereof, or a subsequence thereof, under very low to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using X-ray film.
  • the nucleic acid probe is any one of SEQ ID NOs: 1-8.
  • the nucleic acid probe is the complementary strand of nucleotides 100 to 450, nucleotides 450 to 900, or nucleotides 900 to 1338 of SEQ ID NO: 9.
  • the nucleic acid probe is a polynucleotide sequence which encodes the mature part of the polypeptide of SEQ ID NO: 10, or a subsequence thereof.
  • the nucleic acid probe is SEQ ID NO: 9, in particular any one of the mature polypeptide coding regions thereof.
  • very low to very high stringency conditions are defined as prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 microgram/ml sheared and denatured salmon sperm DNA, and either 25% formamide for very low and low stringencies, 35% formamide for medium and medium-high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures for 12 to 24 hours optimally.
  • the carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS preferably at least at 45°C (very low stringency), more preferably at least at 50 0 C (low stringency), more preferably at least at 55°C (medium stringency), more preferably at least at 60 0 C (medium-high stringency), even more preferably at least at 65°C (high stringency), and most preferably at least at 70 0 C (very high stringency).
  • 2X SSC 0.2% SDS preferably at least at 45°C (very low stringency), more preferably at least at 50 0 C (low stringency), more preferably at least at 55°C (medium stringency), more preferably at least at 60 0 C (medium-high stringency), even more preferably at least at 65°C (high stringency), and most preferably at least at 70 0 C (very high stringency).
  • stringency conditions are defined as prehybridization, hybridization, and washing post- hybridization at about 5°C to about 10 0 C below the calculated T m using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) in 0.9 M NaCI, 0.09 M Tris-HCI pH 7.6, 6 mM EDTA, 0.5% NP-40, 1X Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures.
  • the carrier material is washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5°C to 10°C below the calculated T m .
  • the effective T m is what controls the degree of identity required between the probe and the filter bound DNA for successful hybridization.
  • the effective T m may be determined using the formula below to determine the degree of identity required for two DNAs to hybridize under various stringency conditions.
  • Effective T m 81.5 + 16.6(log M[Na + ]) + 0.41 (%G+C) - 0.72(% formamide) (See www.ndsu.nodak.edu/instruct/mcclean/plsc731/dna/dna6.htm) "G+C" designates the content of nucleotides G and T in the probe.
  • the formamide is 35% and the Na + concentration for 5X SSPE is 0.75 M.
  • the present invention relates to isolated polypeptides having phytase activity, and the following physicochemical properties (as analyzed on the substantially pure polypeptides):
  • a high specific activity such as a specific activity on phytate of at least 50% of the specific activity of E. coli appA (SPTREMBLQ8GN88), the specific activity being preferably measured in the units of FYT per mg phytase enzyme protein;
  • acid-stability such as
  • heat-stability such as a residual phytase activity after 0.5, 1 , 1.5, or 2 hours, preferably 0.5 hours, of incubation at a pH of 5.5 and a temperature of 55, 60, 65, 70, 75, 80, 85 or 95°C, preferably 70 0 C, of at least 50%, compared to the residual activity of E. coli appA (SPTREMBLQ8GN88);
  • DSC Differential Scanning Calorimetry
  • the Td is indicative of the heat-stability of the protein: The higher the Td, the higher the heat-stability.
  • DSC measurements may be performed at various pH values, e.g. using the VP-DSC from Micro CaI. Scans are performed at a constant scan rate of 1.5°C/min from 20-90 0 C. Preferred pH values are 4.0 and 5.5, preferably 4.0.
  • the phytases are desalted, e.g. using NAP-5 columns (Pharmacia) equilibrated in appropriate buffers (e.g.
  • Td also called the melting temperature, Tm
  • protease-stability such as a residual phytase activity after 0.5, 1 , 1.5, or 2 hours, preferably 1 hour, incubation at a temperature of 20, 25, 30, 35, or 37°C, preferably 37°C, and a pH of 5.5, in the presence of 0.1 mg/ml pepsin, of at least 50%, compared to the residual activity of E. coli appA (SPTREMBLQ8GN88); and/or
  • the specific activity is at least 60, 70, 80, 90, 100, 1 10, 120, 130, 140, or at least 150% of the specific activity of E. coli appA.
  • the residual activity is at least 60, 70, 80, 90, 100, 1 10, 120, 130, 140, or at least 150% of the residual activity of E. coli appA.
  • the activity of the enzyme of the invention, at pH 5.0 and 37 0 C, measured on the substrate pNP-phosphate is less than 11 % of the activity of the enzyme measured on the substrate phytate.
  • the ratio is less than 10%, 9%, 8%, 7%, 6%, or less than 5%.
  • the ratio of pNP to phytate hydrolysis is indicative of the true phytase nature of the enzyme.
  • a high ratio of activity on pNP relative to activity on phytate may indicate that the enzyme in question is a phosphatase with relatively low substrate specificity, whereas a low ratio indicates that this is an enzyme more specifically accepting phytate as a substrate.
  • the phytase of the invention has a higher release of phosphorous (P) in an in vitro model, as compared to the phytase from Peniophora lycii, preferably at least 1 10 % thereof, more preferably at least 120%, 130%, or at least 140% thereof.
  • the phytase of the invention dosed 0.25 FYT/g feed, releases at least 150% phosphorous (P), relative to the phosphorous released by the phytase from Peniophora lycii, also dosed 0.25 FYT/g feed, in the in vitro model.
  • the release is at least 155%, 160%, 165%, 170%, 175%, or at least 180%.
  • the phytase of the invention dosed 0.75 FYT/g feed, releases at least 150% phosphorous (P), relative to the phosphorous released by the phytase from Peniophora lycii, also dosed 0.75 FYT/g feed, in the in vitro model.
  • the release is at least 155%, 160%, 165%, 170%, 175%, 180%, 185%, or at least 190%.
  • the residual activity is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or at least 80%.
  • the residual activity is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or at least 80%.
  • the present invention relates to artificial variants comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of SEQ ID NO: 10, or the mature polypeptide thereof.
  • An insertion can be inside the molecule, and/or at the N- and/or C-terminal end of the molecule in which case it is also designated extension.
  • amino acid changes are of a minor nature, that is conservative amino acid substitutions; small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain - in other words: Changes that do not significantly affect the folding and/or activity of the protein. Examples of conservative substitutions are within the group of basic amino acids
  • amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine).
  • conservative substitutions are substitutions of the 20 standard amino acids with non-standard amino acids (such as 4-hydroxyproline, 6-N-methyl lysine, 2- aminoisobutyric acid, isovaline, and alpha-methyl serine).
  • Conservative substitutions may also include a substitution into amino acids that are not encoded by the genetic code, and unnatural amino acids.
  • "Unnatural amino acids” have been modified after protein synthesis, and/or have a chemical structure in their side chain(s) different from that of the standard amino acids.
  • Unnatural amino acids can be chemically synthesized, and preferably, are commercially available, and include pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, and 3,3-dimethylproline.
  • amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered.
  • amino acid changes may improve the thermal stability of the polypeptide, alter the substrate specificity, change the pH optimum, and the like.
  • Essential amino acids in the parent polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity (i.e., phytase activity) to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271 : 4699-4708.
  • the active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. MoI. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309:59-64.
  • the identities of essential amino acids can also be inferred from analysis of identities with polypeptides which are related to a polypeptide according to the invention.
  • Single or multiple amino acid substitutions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241 : 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625.
  • Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochem. 30:10832-10837; U.S. Patent No. 5,223,409; WO 92/06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46:145; Ner et al., 1988, DNA 7:127).
  • Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells.
  • Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure.
  • the total number of amino acid substitutions (preferably conservative substitutions), deletions and/or insertions in the sequence of amino acids 1 to 413 of SEQ ID NO: 10 is at most 10, preferably at most 9, more preferably at most 8, more preferably at most 7, more preferably at most 6, more preferably at most 5, more preferably at most 4, even more preferably at most 3, most preferably at most 2, and even most preferably 1.
  • the total number of amino acid substitutions, deletions and/or insertions of amino acids 1 to 413 of SEQ ID NO: 10 is 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 6, more preferably at most 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.
  • the total number of amino acid substitutions (preferably conservative substitutions), deletions and/or insertions in the sequence of amino acids 1 to 413 of SEQ ID NO: 10 is at most 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, or at most 11.
  • the polypeptide of the invention is a low-allergenic variant, designed to invoke a reduced immunological response when exposed to animals, including man.
  • the term immunological response is to be understood as any reaction by the immune system of an animal exposed to the polypeptide.
  • One type of immunological response is an allergic response leading to increased levels of IgE in the exposed animal.
  • Low-allergenic variants may be prepared using techniques known in the art.
  • the polypeptide may be conjugated with polymer moieties shielding portions or epitopes of the polypeptide involved in an immunological response. Conjugation with polymers may involve in vitro chemical coupling of polymer to the polypeptide, e.g.
  • Conjugation may in addition or alternatively thereto involve in vivo coupling of polymers to the polypeptide.
  • Such conjugation may be achieved by genetic engineering of the nucleotide sequence encoding the polypeptide, inserting consensus sequences encoding additional glycosylation sites in the polypeptide and expressing the polypeptide in a host capable of glycosylating the polypeptide, see e.g. WO00/26354.
  • Another way of providing low-allergenic variants is genetic engineering of the nucleotide sequence encoding the polypeptide so as to cause the polypeptide to self-oligomerize, effecting that polypeptide monomers may shield the epitopes of other polypeptide monomers and thereby lowering the antigenicity of the oligomers.
  • Such products and their preparation is described e.g. in WO96/16177.
  • Epitopes involved in an immunological response may be identified by various methods such as the phage display method described in WO 00/26230 and WO 01/83559, or the random approach described in EP 561907.
  • an epitope Once an epitope has been identified, its amino acid sequence may be altered to produce altered immunological properties of the polypeptide by known gene manipulation techniques such as site directed mutagenesis (see e.g. WO 00/26230, WO 00/26354 and/or WO00/22103) and/or conjugation of a polymer may be done in sufficient proximity to the epitope for the polymer to shield the epitope.
  • site directed mutagenesis see e.g. WO 00/26230, WO 00/26354 and/or WO00/22103
  • conjugation of a polymer may be done in sufficient proximity to the epitope for the polymer to shield the epitope.
  • the three-dimensional structure of a Hafnia alvei phytase (amino acids 1 to 413 of SEQ ID NO: 10) is provided in the Appendix.
  • the structure was solved in accordance with the principles for x-ray crystallographic methods, for example, as given in X-Ray Structure Determinations, Stout, G. K. and Jensen, L. H., John Wiley and Sons, Inc. NY 1989.
  • the structural coordinates for the solved crystal structure of Hafnia alvei phytase are given in standard PDB format (Protein Database Bank, Brookhaven National Laboratory, Brookhaven, Conn.) as set forth in the Appendix. It is to be understood that the Appendix forms part of the present application.
  • the Appendix provides the coordinates of the heavy atoms, excluding the hydrogen atoms.
  • the first three residues of the enzyme were not visible in the crystal structure as well as the amino acid residues between amino acids 180 and 189.
  • the structure between 180 and 189 was built using modelling combining the homology modelling (see, for example, Marti-Renom et al., 2000) program NEST from the JACKAL package (wiki.c2b2. Columbia. edu/honiglab_public/index.php/Software:Jackal) and the simulation software called CHARMm (//accelrys.com/products/scitegic/component- collections/charmm.html).
  • a polypeptide of the present invention may be obtained from microorganisms of any genus.
  • the term "obtained from” as used herein in connection with a given source shall mean that the polypeptide encoded by a nucleotide sequence is produced by the source or by a strain in which the nucleotide sequence from the source has been inserted.
  • the polypeptide obtained from a given source is secreted extracellularly.
  • a polypeptide of the present invention may be a bacterial polypeptide.
  • the polypeptide may be a gram positive bacterial polypeptide such as a Bacillus polypeptide, or a Streptomyces polypeptide; or a gram negative bacterial polypeptide, e.g., an Escherichia coli, Yersinia, Klebsiella, Citrobacter, or a Pseudomonas polypeptide.
  • the polypeptide is derived from Proteobacteria, such as Gammaproteobacteria, for example Enterobacteriales, such as Enterobacteriaceae.
  • the polypeptide derived from Enterobacteriaceae is a Hafnia polypeptide, such as a Hafnia alvei species polypeptide.
  • a polypeptide of the present invention may also be a fungal polypeptide, such as a yeast polypeptide or a filamentous fungal polypeptide.
  • polypeptides may be identified and obtained from other sources including microorganisms isolated from nature (e.g., soil, composts, water, etc.) using the above-mentioned probes. Techniques for isolating microorganisms from natural habitats are well known in the art.
  • the polynucleotide may then be obtained by similarly screening a genomic or cDNA library of another microorganism. Once a polynucleotide sequence encoding a polypeptide has been detected with the probe(s), the polynucleotide can be isolated or cloned by utilizing techniques which are well known to those of ordinary skill in the art (see, e.g., Sambrook et al., 1989, supra).
  • Polypeptides of the present invention also include fused polypeptides or cleavable fusion polypeptides in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof.
  • a fused polypeptide is produced by fusing a nucleotide sequence (or a portion thereof) encoding another polypeptide to a nucleotide sequence (or a portion thereof) of the present invention.
  • Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fused polypeptide is under control of the same promoter(s) and terminator.
  • the present invention also relates to isolated polynucleotides having a nucleotide sequence which encodes a polypeptide of the present invention.
  • the nucleotide sequence is set forth in SEQ ID NO: 9.
  • the nucleotide sequence is the mature polypeptide coding region of SEQ ID NO: 9.
  • the present invention also encompasses nucleotide sequences which encode a polypeptide having the amino acid sequence of SEQ ID NO: 10, or the mature polypeptides thereof, which differ from SEQ ID NO: 9, by virtue of the degeneracy of the genetic code.
  • the present invention also relates to subsequences of SEQ ID NO: 9, which encode fragments of SEQ ID NO: 10, that have phytase activity.
  • the present invention also relates to mutant polunucleotides comprising at least one mutation in the mature polypeptide coding sequence of any one of SEQ ID NO: 9, in which the mutant nucleotide sequence encodes a polypeptide which consists of amino acids 1 to 413 of SEQ ID NO: 10.
  • the techniques used to isolate or clone a polynucleotide encoding a polypeptide include isolation from genomic DNA, preparation from cDNA, or a combination thereof.
  • the cloning of the polynucleotides of the present invention from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., lnnis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York.
  • nucleic acid amplification procedures such as ligase chain reaction (LCR), ligated activated transcription (LAT) and nucleotide sequence- based amplification (NASBA) may be used.
  • LCR ligase chain reaction
  • LAT ligated activated transcription
  • NASBA nucleotide sequence- based amplification
  • the polynucleotides may be cloned from a strain of Hafnia, or another or related organism and thus, for example, may be an allelic or species variant of the polypeptide encoding region of the nucleotide sequence.
  • the present invention also relates to polynucleotides having nucleotide sequences which have a degree of identity to the mature polypeptide coding sequence of SEQ ID NO: 9 (i.e., nucleotides 100 to 1338) of at least 75%, and which encode a polypeptide having phytase activity.
  • the degree of identity is at least In particular embodiments, the degree of identity is at least in particular embodiments, the degree of identity is at least 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%. In alternative embodiments, the degree of identity is at least 75%, 80%, 85%, 90%, 94, 97, 98, 98.0, 98.1 , 98.2, or at least 98.3%.
  • Modification of a nucleotide sequence encoding a polypeptide of the present invention may be necessary for the synthesis of polypeptides substantially similar to the polypeptide.
  • the term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide.
  • These polypeptides may differ in some engineered way from the polypeptide isolated from its native source, e.g., artificial variants that differ in specific activity, thermostability, pH-optimum, or the like.
  • the variant sequence may be constructed on the basis of the nucleotide sequence presented as the polypeptide encoding region of SEQ ID NO: 9, e.g., a subsequence thereof, and/or by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which correspond to the codon usage of the host organism intended for production of the polypeptide, or by introduction of nucleotide substitutions which may give rise to a different amino acid sequence.
  • nucleotide substitution see, e.g., Ford et al., 1991 , Protein Expression and Purification 2: 95-107.
  • amino acid residues essential to the activity of the polypeptide encoded by an isolated polynucleotide of the invention may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, mutations are introduced at every positively charged residue in the molecule, and the resultant mutant molecules are tested for phytase activity to identify amino acid residues that are critical to the activity of the molecule.
  • Sites of substrate-polypeptide interaction can also be determined by analysis of the three-dimensional structure as determined by such techniques as nuclear magnetic resonance analysis, crystallography or photoaffinity labelling (see, e.g., de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).
  • the present invention also relates to isolated polynucleotides encoding a polypeptide of the present invention, which hybridize under medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with (i) nucleotides 100 to 1338 of SEQ ID NO: 9, (ii) the mature polypeptide encoding part of SEQ ID NO: 9, and/or (iii) a complementary strand of any one of (i), and/or (ii); or allelic variants and subsequences thereof (Sambrook et al., 1989, supra), as defined herein.
  • the hybridization is conducted under very low, or low, stringency conditions.
  • the present invention also relates to isolated polynucleotides obtained, or obtainable, by (a) hybridizing a population of DNA under very low, low, medium, medium- high, high, or very high stringency conditions with (i) nucleotides 100 to 1338 of SEQ ID NO: 9, (ii) the mature polypeptide encoding part of SEQ ID NO: 9, and/or (iii) a complementary strand of any one of (i), and/or (ii); and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having phytase activity.
  • the present invention also relates to nucleic acid constructs comprising an isolated polynucleotide of the present invention operably linked to one or more control sequences which direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
  • An isolated polynucleotide encoding a polypeptide of the present invention may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the polynucleotide's sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotide sequences utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be an appropriate promoter sequence, a nucleotide sequence which is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention.
  • the promoter sequence contains transcriptional control sequences which mediate the expression of the polypeptide.
  • the promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • suitable promoters for directing the transcription of the nucleic acid constructs of the present invention are the promoters obtained from the E. coli lac operon, Streptomyces coelicolor agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha- amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, and prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75: 3727-3731 ), as well as the tac promoter (DeBoer et al., 1983), as well as the tac promoter (DeB
  • promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha- amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venen
  • useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1 ), Saccharomyces cerevisiae galactokinase (GAL1 ), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1 ,ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionine (CUP1 ), Saccharomyces cerevisiae 3- phosphoglycerate kinase, and Pichia pastoris alcohol oxidase (AOX1 ).
  • ENO-1 Saccharomyces cerevisiae enolase
  • GAL1 Saccharomyces cerevisiae galactokinase
  • ADH1 ,ADH2/GAP Saccharomyces cerevisiae triose
  • the control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription.
  • the terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin- like protease.
  • Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1 ), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase.
  • Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
  • the control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell.
  • the leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.
  • the control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell.
  • the leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.
  • Preferred leaders for filamentous fungal host cells are obtained from the genes for
  • Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
  • Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1 ), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
  • ENO-1 Saccharomyces cerevisiae enolase
  • Saccharomyces cerevisiae 3-phosphoglycerate kinase Saccharomyces cerevisiae alpha-factor
  • Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase ADH2/GAP
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleotide sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
  • Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin-like protease, and Aspergillus niger alpha-glucosidase.
  • Useful polyadenylation sequences for yeast host cells are described by Guo and
  • the control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway.
  • the 5' end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide.
  • the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence.
  • the foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region.
  • the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide.
  • any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice may be used in the present invention.
  • Effective signal peptide coding regions for bacterial host cells are the signal peptide coding regions obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus stearothermophilus alpha-amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase, Bacillus stearothermophilus neutral proteases (nprT, nprS, nprM), and Bacillus subtilis prsA. Further signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.
  • Effective signal peptide coding regions for filamentous fungal host cells are the signal peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase.
  • Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding regions are described by Romanos et al., 1992, supra, and by Xiong et al in Journal of Applied Microbiology 2005, 98, 418-428.
  • the signal peptide coding region is nucleotides 1 to 99 of SEQ ID NO: 9, which encode amino acids 1 to 33 of SEQ ID NO: 10. In another preferred aspect, the signal peptide coding region is nucleotide 1 to 81 of SEQ ID NO: 1 1 , which encode amino acids 1 to 27 of SEQ ID NO: 12.
  • the control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide.
  • the resultant polypeptide is known as a propolypeptide or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila laccase (WO 95/33836).
  • the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.
  • regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell.
  • regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
  • Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems.
  • yeast the ADH2 system or GAL1 system may be used.
  • filamentous fungi the TAKA alpha-amylase promoter, Aspergillus niger glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences.
  • Other examples of regulatory sequences are those which allow for gene amplification.
  • the present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals.
  • the various nucleic acids and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites.
  • a nucleotide sequence of the present invention may be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression.
  • the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
  • the recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about expression of the nucleotide sequence.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vectors may be linear or closed circular plasmids.
  • the vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
  • the vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed cells.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
  • a conditionally essential gene may function as a non-antibiotic selectable marker.
  • Non-limiting examples of bacterial conditionally essential non-antibiotic selectable markers are the dal genes from Bacillus subtilis, Bacillus licheniformis, or other Bacilli, that are only essential when the bacterium is cultivated in the absence of D-alanine. Also the genes encoding enzymes involved in the turnover of UDP-galactose can function as conditionally essential markers in a cell when the cell is grown in the presence of galactose or grown in a medium which gives rise to the presence of galactose. Non-limiting examples of such genes are those from B. subtilis or B.
  • licheniformis encoding UTP-dependent phosphorylase (EC 2.7.7.10), UDP-glucose-dependent uridylyltransferase (EC 2.7.7.12), or UDP-galactose epimerase (EC 5.1.3.2).
  • a xylose isomerase gene such as xylA, of Bacilli can be used as selectable markers in cells grown in minimal medium with xylose as sole carbon source.
  • the genes necessary for utilizing gluconate, gntK, and gntP can also be used as selectable markers in cells grown in minimal medium with gluconate as sole carbon source.
  • Other examples of conditionally essential genes are known in the art.
  • Antibiotic selectable markers confer antibiotic resistance to such antibiotics as ampicillin, kanamycin, chloramphenicol, erythromycin, tetracycline, neomycin, hygromycin or methotrexate.
  • Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1 , and URA3.
  • Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof.
  • Preferred for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Strepto
  • the vectors of the present invention preferably contain an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
  • the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or nonhomologous recombination.
  • the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s).
  • the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and most preferably 800 to 10,000 base pairs, which have a high degree of identity with the corresponding target sequence to enhance the probability of homologous recombination.
  • the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell.
  • the integrational elements may be non-encoding or encoding nucleotide sequences.
  • the vector may be integrated into the genome of the host cell by non-homologous recombination.
  • the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
  • the origin of replication may be any plasmid replicator mediating autonomous replication which functions in a cell.
  • the term "origin of replication" or “plasmid replicator” is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo.
  • Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, and pUBHO, pE194, pTA1060, and pAM ⁇ i permitting replication in Bacillus.
  • Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1 , ARS4, the combination of ARS1 and CEN3, and the combination of
  • origins of replication useful in a filamentous fungal cell are AMA1 and AMA2
  • More than one copy of a polynucleotide of the present invention may be inserted into the host cell to increase production of the gene product.
  • An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
  • the procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).
  • the present invention also relates to recombinant host cells, comprising a polynucleotide of the present invention, which are advantageously used in the recombinant production of the polypeptides.
  • a vector comprising a polynucleotide of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier.
  • the term "host cell” encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
  • the host cell may be a unicellular microorganism, e.g., a prokaryote, or a non- unicellular microorganism, e.g., a eukaryote.
  • Useful unicellular microorganisms are bacterial cells such as gram positive bacteria including, but not limited to, a Bacillus cell, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis; or a Streptomyces cell, e.g., Streptomyces lividans and Streptomyces murinus, or gram negative bacteria such as E.
  • the bacterial host cell is a Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus, or Bacillus subtilis cell.
  • the Bacillus cell is an alkalophilic Bacillus.
  • the introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 11 1-1 15), using competent cells (see, e.g., Young and Spizizin, 1961 , Journal of Bacteriology 81 : 823-829, or Dubnau and Davidoff-Abelson, 1971 , Journal of Molecular Biology 56: 209-221 ), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751 ), or conjugation (see, e.g., Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).
  • protoplast transformation see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 11 1-1 15
  • competent cells see, e.g., Young and Spizizin, 1961 , Journal of Bacteriology 81 : 823
  • the host cell may also be a eukaryote, such as a mammalian, insect, plant, or fungal cell.
  • the host cell is a fungal cell.
  • "Fungi” as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et al., 1995, supra, page 171 ) and all mitosporic fungi (Hawksworth et al., 1995, supra).
  • the fungal host cell is a yeast cell.
  • yeast as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi lmperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F.A., Passmore, S. M., and Davenport, R. R., eds, Soc. App. Bacterid. Symposium Series No. 9, 1980).
  • the yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell.
  • the yeast host cell is a Pichia pastoris, Pichia methanolica, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell.
  • the yeast host cell is a Kluyveromyces lactis cell.
  • the yeast host cell is a Yarrowia lipolytica cell.
  • the fungal host cell is a filamentous fungal cell.
  • filamentous fungi include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra).
  • the filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides.
  • Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.
  • vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
  • the filamentous fungal host cell is an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
  • the filamentous fungal host cell is an Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae cell.
  • the filamentous fungal host cell is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell.
  • the filamentous fungal host cell is a Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, or Ceriporiopsis subvermispora, Coprinus cinereus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koning
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81 : 1470-1474. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.
  • the present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) cultivating a cell, which in its wild-type form is capable of producing the polypeptide, under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • the cell is of the genus Hafnia, and more preferably Hafnia alvei.
  • the present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) cultivating a host cell under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • the present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) cultivating a host cell under conditions conducive for production of the polypeptide, wherein the host cell comprises a mutant nucleotide sequence having at least one mutation in the mature polypeptide coding region of any one of SEQ ID NO: 9, wherein the mutant nucleotide sequence encodes a polypeptide which consists of amino acids 1 to 413 of SEQ ID NO: 10, and (b) recovering the polypeptide.
  • the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods well known in the art.
  • the cell may be cultivated by shake flask cultivation, and small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated.
  • the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
  • polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of a polypeptide product, or disappearance of an polypeptide substrate. For example, an polypeptide assay may be used to determine the activity of the polypeptide as described herein.
  • the resulting polypeptide may be recovered using methods known in the art.
  • the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
  • polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J. -C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g., preparative isoelectric focusing
  • differential solubility e.g., ammonium sulfate precipitation
  • SDS-PAGE or extraction
  • the present invention also relates to a transgenic plant, plant part, or plant cell which has been transformed with a nucleotide sequence encoding a polypeptide having phytase activity of the present invention so as to express and produce the polypeptide in recoverable quantities.
  • the polypeptide may be recovered from the plant or plant part.
  • the plant or plant part containing the recombinant polypeptide may be used as such for improving the quality of a food or feed, e.g., improving nutritional value, palatability, and rheological properties, or to destroy an antinutritive factor.
  • the polypeptide is targeted to the endosperm storage vacuoles in seeds.
  • This can be obtained by synthesizing it as a precursor with a suitable signal peptide, see Horvath et al in PNAS, Feb. 15, 2000, vol. 97, no. 4, p. 1914-1919.
  • the transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot) or engineered variants thereof.
  • monocot plants are grasses, such as meadow grass (blue grass, Poa), forage grass such as Festuca, Lolium, temperate grass, such as Agrostis, and cereals, e.g., wheat, oats, rye, barley, rice, sorghum, triticale (stabilized hybrid of wheat (Triticum) and rye (Secale), and maize (corn).
  • dicot plants are tobacco, legumes, such as sunflower (Helianthus), cotton (Gossypium), lupins, potato, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape seed, and the closely related model organism Arabidopsis thaliana.
  • Low- phytate plants as described e.g. in US patent no. 5,689,054 and US patent no. 6,11 1 ,168 are examples of engineered plants.
  • plant parts are stem, callus, leaves, root, fruits, seeds, and tubers, as well as the individual tissues comprising these parts, e.g. epidermis, mesophyll, parenchyma, vascular tissues, meristems. Also specific plant cell compartments, such as chloroplast, apoplast, mitochondria, vacuole, peroxisomes, and cytoplasm are considered to be a plant part. Furthermore, any plant cell, whatever the tissue origin, is considered to be a plant part. Likewise, plant parts such as specific tissues and cells isolated to facilitate the utilisation of the invention are also considered plant parts, e.g. embryos, endosperms, aleurone and seed coats.
  • the transgenic plant or plant cell expressing a polypeptide of the present invention may be constructed in accordance with methods known in the art. Briefly, the plant or plant cell is constructed by incorporating one or more expression constructs encoding a polypeptide of the present invention into the plant host genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.
  • the expression construct is a nucleic acid construct which comprises a nucleic acid sequence encoding a polypeptide of the present invention operably linked with appropriate regulatory sequences required for expression of the nucleic acid sequence in the plant or plant part of choice.
  • the expression construct may comprise a selectable marker useful for identifying host cells into which the expression construct has been integrated and DNA sequences necessary for introduction of the construct into the plant in question (the latter depends on the DNA introduction method to be used).
  • regulatory sequences such as promoter and terminator sequences and optionally signal or transit sequences are determined, for example, on the basis of when, where, and how the polypeptide is desired to be expressed.
  • the expression of the gene encoding a polypeptide of the present invention may be constitutive or inducible, or may be developmental, stage or tissue specific, and the gene product may be targeted to a specific cell compartment, tissue or plant part such as seeds or leaves.
  • Regulatory sequences are, for example, described by Tague et al., 1988, Plant Physiology 86: 506.
  • the following promoters may be used: The 35S-CaMV promoter (Franck et al., 1980, Cell 21 : 285-294), the maize ubiquitin 1 (Christensen AH, Sharrock RA and Quail 1992. Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation), or the rice actin 1 promoter (Plant Mo. Biol. 18, 675-689.; Zhang W, McElroy D. and Wu R 1991 , Analysis of rice Act1 5' region activity in transgenic rice plants. Plant Cell 3, 1 155-1165).
  • Organ-specific promoters may be, for example, a promoter from storage sink tissues such as seeds, potato tubers, and fruits (Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from metabolic sink tissues such as meristems (Ito et al., 1994, Plant MoI. Biol.
  • a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu et al., 1998, Plant and Cell Physiology 39: 885-889), a Vicia faba promoter from the legumin B4 and the unknown seed protein gene from Vicia faba (Conrad et al., 1998, Journal of Plant Physiology 152: 708-711 ), a promoter from a seed oil body protein (Chen et al., 1998, Plant and Cell Physiology 39: 935-941 ), the storage protein napA promoter from Brassica napus, or any other seed specific promoter known in the art, e.g., as described in WO 91/14772.
  • a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu et al., 1998, Plant and Cell Physiology 39: 885-889)
  • the promoter may be a leaf specific promoter such as the rbcs promoter from rice or tomato (Kyozuka et al., 1993, Plant Physiology 102: 991-1000, the chlorella virus adenine methyltransferase gene promoter (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the aldP gene promoter from rice (Kagaya et al., 1995, Molecular and General Genetics 248: 668-674), or a wound inducible promoter such as the potato pin2 promoter (Xu et al., 1993, Plant Molecular Biology 22: 573-588).
  • the promoter may be inducible by abiotic treatments such as temperature, drought or alterations in salinity or inducible by exogenously applied substances that activate the promoter, e.g. ethanol, oestrogens, plant hormones like ethylene, abscisic acid, gibberellic acid, and/or heavy metals.
  • abiotic treatments such as temperature, drought or alterations in salinity or inducible by exogenously applied substances that activate the promoter, e.g. ethanol, oestrogens, plant hormones like ethylene, abscisic acid, gibberellic acid, and/or heavy metals.
  • a promoter enhancer element may also be used to achieve higher expression of the polypeptide in the plant.
  • the promoter enhancer element may be an intron which is placed between the promoter and the nucleotide sequence encoding a polypeptide of the present invention.
  • Xu et al., 1993, supra disclose the use of the first intron of the rice actin 1 gene to enhance expression.
  • codon usage may be optimized for the plant species in question to improve expression (see Horvath et al referred to above).
  • the selectable marker gene and any other parts of the expression construct may be chosen from those available in the art.
  • the nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biolistic transformation, and electroporation (Gasser et al., 1990, Science 244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).
  • Agrobacterium tumefaciens-mediated gene transfer is the method of choice for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38), and it can also be used for transforming monocots, although other transformation methods are more often used for these plants.
  • the method of choice for generating transgenic monocots, supplementing the Agrobacterium approach is particle bombardment (microscopic gold or tungsten particles coated with the transforming DNA) of embryonic calli or developing embryos (Christou, 1992, Plant Journal 2: 275-281 ; Shimamoto, 1994, Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992, Bio/Technology 10: 667-674).
  • An alternative method for transformation of monocots is based on protoplast transformation as described by Omirulleh et al., 1993, Plant Molecular Biology 21 : 415-428.
  • the transformants having incorporated therein the expression construct are selected and regenerated into whole plants according to methods well-known in the art.
  • the transformation procedure is designed for the selective elimination of selection genes either during regeneration or in the following generations by using e.g. co-transformation with two separate T-DNA constructs or site specific excision of the selection gene by a specific recombinase.
  • the present invention also relates to methods for producing a polypeptide of the present invention comprising (a) cultivating a transgenic plant or a plant cell comprising a nucleic acid sequence encoding a polypeptide having phytase activity of the present invention under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • the present invention also relates to a transgenic, non-human animal and products or elements thereof, examples of which are body fluids such as milk and blood, organs, flesh, and animal cells.
  • body fluids such as milk and blood, organs, flesh, and animal cells.
  • Techniques for expressing proteins, e.g. in mammalian cells are known in the art, see e.g. the handbook Protein Expression: A Practical Approach, Higgins and Hames (eds), Oxford University Press (1999), and the three other handbooks in this series relating to Gene Transcription, RNA processing, and Post-translational Processing.
  • to prepare a transgenic animal selected cells of a selected animal are transformed with a nucleic acid sequence encoding a polypeptide having phytase activity of the present invention so as to express and produce the polypeptide.
  • the polypeptide may be recovered from the animal, e.g. from the milk of female animals, or the polypeptide may be expressed to the benefit of the animal itself, e.g. to assist the animal's digestion. Examples of animals are mentioned below in the section headed Animal Feed.
  • a gene encoding the polypeptide may be inserted into the fertilized eggs of an animal in question, e.g. by use of a transgene expression vector which comprises a suitable milk protein promoter, and the gene encoding the polypeptide.
  • the transgene expression vector is is microinjected into fertilized eggs, and preferably permanently integrated into the chromosome.
  • the potential embryo is implanted into a surrogate mother, and animals carrying the transgene are identified.
  • the resulting animal can then be multiplied by conventional breeding.
  • the polypeptide may be purified from the animal's milk, see e.g. Meade, H. M. et al (1999): Expression of recombinant proteins in the milk of transgenic animals, Gene expression systems: Using nature for the art of expression. J. M. Fernandez and J. P. Hoeffler (eds.), Academic Press.
  • the transgene in order to produce a transgenic non-human animal that carries in the genome of its somatic and/or germ cells a nucleic acid sequence including a heterologous transgene construct including a transgene encoding the polypeptide, the transgene may be operably linked to a first regulatory sequence for salivary gland specific expression of the polypeptide, as disclosed in WO 00/064247.
  • the present invention relates to compositions comprising a polypeptide of the present invention, as well as methods of using these.
  • polypeptide compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition.
  • the polypeptide composition may be in the form of granulates or microgranulates.
  • the polypeptide to be included in the composition may be stabilized in accordance with methods known in the art.
  • the phytase of the invention can be used for degradation, in any industrial context, of, for example, phytate, phytic acid, and/or the mono-, di-, tri-, tetra- and/or penta- phosphates of myo-inositol. It is well known that the phosphate moieties of these compounds chelates divalent and trivalent cations such as metal ions, i.a. the nutritionally essential ions of calcium, iron, zinc and magnesium as well as the trace minerals manganese, copper and molybdenum. Besides, the phytic acid also to a certain extent binds proteins by electrostatic interaction.
  • polypeptides of the invention are in animal feed preparations (including human food) or in additives for such preparations.
  • the polypeptide of the invention can be used for improving the nutritional value of an animal feed.
  • improving the nutritional value of animal feed including human food
  • the nutritional value of the feed is therefore increased, and the growth rate and/or weight gain and/or feed conversion (i.e. the weight of ingested feed relative to weight gain) of the animal may be improved.
  • polypeptide of the invention can be used for reducing phytate level of manure.
  • animal includes all animals, including human beings. Examples of animals are non-ruminants, and ruminants. Ruminant animals include, for example, animals such as sheep, goats, horses, and cattle, e.g. beef cattle, cows, and young calves. In a particular embodiment, the animal is a non-ruminant animal. Non-ruminant animals include mono- gastric animals, e.g.
  • pigs or swine including, but not limited to, piglets, growing pigs, and sows
  • poultry such as turkeys, ducks and chicken (including but not limited to broiler chicks, layers); young calves; and fish (including but not limited to salmon, trout, tilapia, catfish and carps; and crustaceans (including but not limited to shrimps and prawns).
  • feed or feed composition means any compound, preparation, mixture, or composition suitable for, or intended for intake by an animal.
  • the polypeptide can be fed to the animal before, after, or simultaneously with the diet. The latter is preferred.
  • the polypeptide, in the form in which it is added to the feed, or when being included in a feed additive is substantially pure.
  • it is well-defined.
  • the term "well-defined” means that the phytase preparation is at least 50% pure as determined by Size-exclusion chromatography (see Example 12 of WO 01/58275).
  • the phytase preparation is at least 60, 70, 80, 85, 88, 90, 92, 94, or at least 95% pure as determined by this method.
  • a substantially pure, and/or well-defined polypeptide preparation is advantageous.
  • dose correctly refers in particular to the objective of obtaining consistent and constant results, and the capability of optimising dosage based upon the desired effect.
  • the phytase polypeptide of the invention need not be that pure; it may e.g. include other polypeptides, in which case it could be termed a phytase preparation.
  • the phytase preparation can be (a) added directly to the feed (or used directly in a treatment process of proteins), or (b) it can be used in the production of one or more intermediate compositions such as feed additives or premixes that is subsequently added to the feed (or used in a treatment process).
  • the degree of purity described above refers to the purity of the original polypeptide preparation, whether used according to (a) or (b) above.
  • Polypeptide preparations with purities of this order of magnitude are in particular obtainable using recombinant methods of production, whereas they are not so easily obtained and also subject to a much higher batch-to-batch variation when the polypeptide is produced by traditional fermentation methods.
  • Such polypeptide preparation may of course be mixed with other polypeptides.
  • the polypeptide can be added to the feed in any form, be it as a relatively pure polypeptide, or in admixture with other components intended for addition to animal feed, i.e. in the form of animal feed additives, such as the so-called pre-mixes for animal feed.
  • compositions for use in animal feed such as animal feed, and animal feed additives, e.g. premixes.
  • the animal feed additives of the invention contain at least one fat-soluble vitamin, and/or at least one water soluble vitamin, and/or at least one trace mineral.
  • the feed additive may also contain at least one macro mineral.
  • feed-additive ingredients are colouring agents, e.g. carotenoids such as beta-carotene, astaxanthin, and lutein; aroma compounds; stabilisers; antimicrobial peptides; polyunsaturated fatty acids; reactive oxygen generating species; and/or at least one other polypeptide selected from amongst phytase (EC 3.1.3.8 or 3.1.3.26); xylanase (EC
  • phospholipase C 3.1.4.3
  • phospholipase D EC 3.1.4.4
  • amylase such as, for example, alpha-amylase (EC 3.2.1.1 ); and/or beta-glucanase (EC 3.2.1.4 or EC 3.2.1.6).
  • alpha-amylase EC 3.2.1.1
  • beta-glucanase EC 3.2.1.4 or EC 3.2.1.6
  • these other polypeptides are well-defined (as defined above for phytase preparations).
  • the phytase of the invention having a relatively low pH-optimum is combined with at least one phytase having a higher pH-optimum.
  • phytases of higher pH-optimum are Bacillus phytases, such as the phytases from Bacillus licheniformis and Bacillus subtilis, as well as derivatives, variants, or fragments thereof having phytase activity.
  • the phytase of the invention may also be combined with other phytases, for example ascomycete phytases such as Aspergillus phytases, for example derived from Aspergillus ficuum, Aspergillus niger, or Aspergillus awamori; or basidiomycete phytases, for example derived from Peniophora lycii, Agrocybe pediades, Trametes pubescens, or Paxillus involutus; or derivatives, fragments or variants thereof which have phytase activity.
  • ascomycete phytases such as Aspergillus phytases, for example derived from Aspergillus ficuum, Aspergillus niger, or Aspergillus awamori
  • basidiomycete phytases for example derived from Peniophora lycii, Agrocybe pediades, Trametes pubesc
  • the phytase of the invention is combined with such phytases.
  • RONOZYME P phytase derived from Peniophora lycii as well as derivatives, variants, and fragments thereof, may also be combined with Bacillus phytases, in particular the B. licheniformis phytase as well as with a derivative, fragment or variant thereof, in particular for animal feed purposes.
  • Bacillus phytases in particular the B. licheniformis phytase as well as with a derivative, fragment or variant thereof, in particular for animal feed purposes.
  • antimicrobial peptides are CAP18, Leucocin A, Tritrpticin,
  • Protegrin-1 Thanatin, Defensin, Lactoferrin, Lactoferricin, and Ovispirin such as Novispirin (Robert Lehrer, 2000), Plectasins, and Statins, including the compounds and polypeptides disclosed in WO 03/044049 and WO 03/048148, as well as variants or fragments of the above that retain antimicrobial activity.
  • AFP's antifungal polypeptides
  • Aspergillus giganteus and Aspergillus niger peptides, as well as variants and fragments thereof which retain antifungal activity, as disclosed in WO 94/01459 and WO 02/090384.
  • polyunsaturated fatty acids are C18, C20 and C22 polyunsaturated fatty acids, such as arachidonic acid, docosohexaenoic acid, eicosapentaenoic acid and gamma- linoleic acid.
  • reactive oxygen generating species are chemicals such as perborate, persulphate, or percarbonate; and polypeptides such as an oxidase, an oxygenase or a syntethase.
  • the animal feed additive of the invention is intended for being included (or prescribed as having to be included) in animal diets or feed at levels of 0.01 to 10.0%; more particularly 0.05 to 5.0%; or 0.2 to 1.0% (% meaning g additive per 100 g feed). This is so in particular for premixes.
  • fat-soluble vitamins are vitamin A, vitamin D3, vitamin E, and vitamin K, e.g. vitamin K3.
  • water-soluble vitamins are vitamin B12, biotin and choline, vitamin B1 , vitamin B2, vitamin B6, niacin, folic acid and panthothenate, e.g. Ca-D-panthothenate.
  • trace minerals are manganese, zinc, iron, copper, iodine, selenium, and cobalt.
  • Examples of macro minerals are calcium, phosphorus and sodium.
  • the nutritional requirements of these components are listed in Table A of WO 01/58275. Nutritional requirement means that these components should be provided in the diet in the concentrations indicated.
  • the animal feed additive of the invention comprises at least one of the individual components specified in Table A of WO 01/58275. At least one means either of, one or more of, one, or two, or three, or four and so forth up to all thirteen, or up to all fifteen individual components. More specifically, this at least one individual component is included in the additive of the invention in such an amount as to provide an in-feed-concentration within the range indicated in column four, or column five, or column six of Table A.
  • the present invention also relates to animal feed compositions.
  • Animal feed compositions or diets have a relatively high content of protein.
  • Poultry and pig diets can be characterised as indicated in Table B of WO 01/58275, columns 2-3.
  • Fish diets can be characterised as indicated in column 4 of this Table B.
  • Furthermore such fish diets usually have a crude fat content of 200-310 g/kg.
  • WO 01/58275 corresponds to US 09/779334 which is hereby incorporated by reference.
  • An animal feed composition according to the invention has a crude protein content of 50-800 g/kg, and furthermore comprises at least one polypeptide as claimed herein.
  • the animal feed composition of the invention has a content of metabolisable energy of 10-30
  • MJ/kg and/or a content of calcium of 0.1-200 g/kg; and/or a content of available phosphorus of 0.1-200 g/kg; and/or a content of methionine of 0.1-100 g/kg; and/or a content of methionine plus cysteine of 0.1-150 g/kg; and/or a content of lysine of 0.5-50 g/kg.
  • the content of metabolisable energy, crude protein, calcium, phosphorus, methionine, methionine plus cysteine, and/or lysine is within any one of ranges 2, 3, 4 or 5 in Table B of WO 01/58275 (R. 2-5).
  • the nitrogen content is determined by the Kjeldahl method (A.O.A.C, 1984, Official Methods of Analysis 14th ed., Association of Official Analytical Chemists, Washington DC).
  • Metabolisable energy can be calculated on the basis of the NRC publication Nutrient requirements in swine, ninth revised edition 1988, subcommittee on swine nutrition, committee on animal nutrition, board of agriculture, national research council. National Academy Press, Washington, D. C, pp. 2-6, and the European Table of Energy Values for Poultry Feed-stuffs, Spelderholt centre for poultry research and extension, 7361 DA Beekbergen, The Netherlands. Grafisch bedrijf Ponsen & looijen bv, Wageningen. ISBN 90- 71463-12-5.
  • the dietary content of calcium, available phosphorus and amino acids in complete animal diets is calculated on the basis of feed tables such as Veevoedertabel 1997, gegevens over chemische samenstelling, verteerbaarheid en voederwaarde van voedermiddelen, Central Veevoederbureau, Runderweg 6, 8219 pk Lelystad. ISBN 90-72839-13-7.
  • the animal feed composition of the invention contains at least one protein.
  • the protein may be an animal protein, such as meat and bone meal, and/or fish meal; or it may be a vegetable protein.
  • the term vegetable proteins as used herein refers to any compound, composition, preparation or mixture that includes at least one protein derived from or originating from a vegetable, including modified proteins and protein- derivatives.
  • the protein content of the vegetable proteins is at least 10, 20, 30, 40, 50, or 60% (w/w).
  • Vegetable proteins may be derived from vegetable protein sources, such as legumes and cereals, for example materials from plants of the families Fabaceae (Leguminosae), Cruciferaceae, Chenopodiaceae, and Poaceae, such as soy bean meal, lupin meal and rapeseed meal.
  • Fabaceae Leguminosae
  • Cruciferaceae Chenopodiaceae
  • Poaceae such as soy bean meal, lupin meal and rapeseed meal.
  • the vegetable protein source is material from one or more plants of the family Fabaceae, e.g. soybean, lupine, pea, or bean.
  • the vegetable protein source is material from one or more plants of the family Chenopodiaceae, e.g. beet, sugar beet, spinach or quinoa.
  • Other examples of vegetable protein sources are rapeseed, sunflower seed, cotton seed, and cabbage.
  • Soybean is a preferred vegetable protein source.
  • the animal feed composition of the invention contains 0-80% maize; and/or 0-80% sorghum; and/or 0-70% wheat; and/or 0-70% Barley; and/or 0-30% oats; and/or 0-40% soybean meal; and/or 0-25% fish meal; and/or 0-25% meat and bone meal; and/or 0-20% whey.
  • Animal diets can e.g. be manufactured as mash feed (non pelleted) or pelleted feed.
  • the milled feed-stuffs are mixed and sufficient amounts of essential vitamins and minerals are added according to the specifications for the species in question.
  • Polypeptides can be added as solid or liquid polypeptide formulations.
  • a solid polypeptide formulation is typically added before or during the mixing step; and a liquid polypeptide preparation is typically added after the pelleting step.
  • the polypeptide may also be incorporated in a feed additive or premix.
  • the final polypeptide concentration in the diet is within the range of 0.01-200 mg polypeptide protein per kg diet, for example in the range of 0.1-10 mg/kg animal diet (typical dosage is in the range of 250 to 2000 FYT/kg animal diet).
  • the phytase of the invention should of course be applied in an effective amount, i.e. in an amount adequate for improving solubilisation and/or improving nutritional value of feed.
  • the polypeptide is administered in one or more of the following amounts (dosage ranges): 0.01-200; 0.01-100; 0.5-100; 1-50; 5-100; 10-100; 0.05-
  • the phytase is purified from the feed composition, and the specific activity of the purified phytase is determined using a relevant assay.
  • the phytase activity of the feed composition as such is also determined using the same assay, and on the basis of these two determinations, the dosage in mg phytase protein per kg feed is calculated.
  • Yet another aspect of the present invention relates to the methods for producing a fermentation product, such as, e.g., ethanol, beer, wine, distillers dried grains (DDG), wherein the fermentation is carried out in the presence of a phytase of the present invention.
  • a fermentation product such as, e.g., ethanol, beer, wine, distillers dried grains (DDG)
  • DDG distillers dried grains
  • fermentation processes include, for example, the processes described in WO
  • Fermentation is carried out using a fermenting microorganism, such as, yeast.
  • the present invention provides methods for producing fermentation product, comprising (a) fermenting (using a fermenting microorganism, such as yeast) a carbohydrate containing material (e.g., starch) in the presence of a phytase of the present invention and (b) producing the fermentation product from the fermented carbohydrate containing material.
  • a fermenting microorganism such as yeast
  • a carbohydrate containing material e.g., starch
  • the present invention provides methods for producing ethanol, comprising fermenting (using a fermenting microorganism, such as yeast) a carbohydrate containing material (e.g., starch) in the presence of a phytase of the present invention and producing or recovering ethanol from the fermented carbohydrate containing material.
  • a fermenting microorganism such as yeast
  • a carbohydrate containing material e.g., starch
  • the present invention provides methods for producing ethanol comprising a) hydrolyzing starch, e.g., by a liquefaction and/or saccharification process, a raw starch hydrolysis process, b) fermenting the resulting starch in the presence of a phytase of the present invention, and c) producing ethanol.
  • the phytase may be added to the fermentation process at any suitable stage and in any suitable composition, including alone or in combination with other enzymes, such as, one or more alpha-amylases, glucoamylases, proteases, and/or cellulases.
  • the present invention provides methods for producing ethanol comprising hydrolyzing biomass, and fermenting (using a fermenting microorganism, such as yeast) the resulting biomass in the presence of a phytase of the present invention.
  • the present invention also relates to nucleic acid constructs comprising a gene encoding a protein operably linked to a first nucleotide sequence consisting of nucleotides 1 to 99 of SEQ ID NO: 9, encoding a signal peptide consisting of amino acids 1 to 33 of SEQ ID NO: 10, wherein the gene is foreign to the first nucleotide sequences.
  • the present invention also relates to recombinant expression vectors and recombinant host cells comprising such nucleic acid constructs.
  • the present invention also relates to methods for producing a protein comprising (a) cultivating such a recombinant host cell under conditions suitable for production of the protein; and (b) recovering the protein.
  • the first nucleotide sequences may be operably linked to foreign genes individually with other control sequences or in combination with other control sequences. Such other control sequences are described supra.
  • the protein may be native or heterologous to a host cell.
  • the term “protein” is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins.
  • the term “protein” also encompasses two or more polypeptides combined to form the encoded product.
  • the proteins also include hybrid polypeptides which comprise a combination of partial or complete polypeptide sequences obtained from at least two different proteins wherein one or more may be heterologous or native to the host cell. Proteins further include naturally occurring allelic and engineered variations of the above mentioned proteins and hybrid proteins.
  • the protein is a hormone or variant thereof, polypeptide, e.g., enzyme, receptor or portion thereof, antibody or portion thereof, or reporter.
  • the protein is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase.
  • the protein is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha- glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic polypeptide, peroxidase, phytase, polyphenoloxidase, proteolytic polypeptide, ribonuclease, transglutaminase or xylanase.
  • the gene may be obtained from any prokaryotic, eukaryotic, or other source.
  • nucleic acid sequences nucleic acid constructs, recombinant expression vectors, recombinant host cells, methods for production of the polypeptides, transgenic plants and animals, and the various uses, methods of use and feed compositions/additives, all as claimed.
  • An isolated polypeptide having phytase activity wherein the activity of the polypeptide, at pH 5.0 and 37 0 C, measured on the substrate pNP-phosphate is less than 1 1% of the activity of the polypeptide measured on the substrate phytate; preferably with an identity to i) amino acids 1 to 413 of SEQ ID NO: 10, of at least 75%, preferably at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%.
  • polypeptide having phytase activity wherein the polypeptide has a higher release of phosphorous (P), as compared to the phytase from Peniophora lycii; preferably as measured in the in vitro model; and/or, wherein the polypeptide preferably has an identity to i) amino acids 1 to 413 of SEQ ID NO: 10, of at least 75%, preferably at least 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%
  • FYT/g feed releases at least 150% phosphorous (P), relative to the phosphorous released by the phytase from Peniophora lycii, also dosed 0.25 FYT/g feed; and/or, wherein the polypeptide preferably has an identity to i) amino acids 1 to 413 of SEQ ID NO: 10, of at least 75%, preferably at least 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9%.
  • polypeptide having phytase activity wherein the polypeptide, dosed 0.75 FYT/g feed, releases at least 150% phosphorous (P), relative to the phosphorous released by the phytase from Peniophora lycii, also dosed 0.75 FYT/g feed; and/or, wherein the polypeptide preferably has an identity to i) amino acids 1 to 413 of SEQ ID NO: 10, of at least 75%, preferably at least 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%,
  • An isolated polypeptide having phytase activity selected from the group consisting of: (a) a polypeptide having an amino acid sequence which has at least 75% identity with (i) amino acids 1 to 413 of SEQ ID NO: 10, and/or (ii) the mature polypeptide part of SEQ ID NO: 10, (b) a polypeptide which is encoded by a polynucleotide which hybridizes under at least medium stringency conditions with (i) nucleotides 100 to 1338 of SEQ ID NO: 9, (ii) the mature polypeptide encoding part of SEQ ID NO: 9, and/or (iii) a complementary strand of any one of (i), or (ii); (c) a variant of any one of the polypeptides of (a)(i)-(a)(ii), comprising a conservative substitution, deletion, and/or insertion of one or more amino acids; and (d) a fragment of any one of the polypeptides of (a)(i)-(
  • An isolated polynucleotide comprising a nucleotide sequence which encodes the polypeptide of section I.
  • III. An isolated polynucleotide encoding a polypeptide having phytase activity, selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity, preferably at least 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with amino acids
  • IV The isolated polynucleotide of any one of sections Il and III, having at least one mutation in the mature polypeptide coding sequence of SEQ ID NO: 9, in which the mutant nucleotide sequence encodes a polypeptide comprising amino acids 1 to 413 of SEQ ID NO: 10.
  • V A nucleic acid construct comprising the polynucleotide of any one of sections N-IV operably linked to one or more control sequences that direct the production of the polypeptide in an expression host.
  • a recombinant expression vector comprising the nucleic acid construct of section V.
  • a recombinant host cell comprising the nucleic acid construct of section V.
  • a method for producing the polypeptide of section I comprising (a) cultivating a cell, which in its wild-type form is capable of producing the polypeptide, under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • IX. A method for producing the polypeptide of section I comprising (a) cultivating a recombinant host cell comprising a nucleic acid construct comprising a nucleotide sequence encoding the polypeptide under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • transgenic plant, plant part or plant cell which has been transformed with a polynucleotide encoding the polypeptide of section I.
  • XI A transgenic, non-human animal, or products, or elements thereof, being capable of expressing the polypeptide of section I.
  • XIV A method for improving the nutritional value of an animal feed, wherein at least one polypeptide of section I is added to the feed.
  • An animal feed additive comprising (a) at least one polypeptide of section I; and (b) at least one fat soluble vitamin, (c) at least one water soluble vitamin, and/or (d) at least one trace mineral.
  • XVI The animal feed additive of section XV, which further comprises at least one amylase, at least one additional phytase, at least one xylanase, at least one galactanase, at least one alpha-galactosidase, at least one protease, at least one phospholipase, and/or at least one beta-glucanase.
  • XVII The animal feed additive of section XVI, wherein the additional phytase has a pH-optimum which is higher than the pH-optimum of the polypeptide having the amino acid sequence of amino acids 1 to 413 of SEQ ID NO: 10.
  • An animal feed composition having a crude protein content of 50 to 800 g/kg and comprising at least one polypeptide of section I.
  • a polypeptide having phytase activity which comprises, preferably has or consists of, an amino acid sequence which has at least 75% identity, preferably at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 98.9%, 99%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with amino acids 1 to 413 of SEQ ID NO: 10.
  • a polypeptide having phytase activity which comprises, preferably has, the sequence of
  • HAP histidine acid phosphatases
  • the primers were used for PCR screening of a number of bacterial species at annealing temperatures between 40 and 50 0 C but typical as touch down program starting with 50 0 C and then reduced the annealing temperature with 1°C for each cycle over the next 10 cycles before conducting standard PCR.
  • a partial phytase gene in the form of an approximately 950 bp PCR fragment was identified in Hafnia alvei (DSM 19197).
  • the PCR fragment was isolated from agarose gel and the fragment was sequenced using the same PCR primers the fragment was generated with. By translation of the nucleotide sequence, it was confirmed that the DNA fragment was part of a HAP phytase gene. For obtaining the full length nucleotide sequence of the gene, the DNA WALKING
  • SPEEDUPTM Kit (DWSK-V102 from Seegene, Inc., 2nd Fl., Myungji Bldg., 142-21 , Samsung- dong, Kangnam-gu, Seoul, 135-090, Korea) was used, which is designed to capture unknown target sites.
  • 6 specific oligonucleotides were designed and used with the kit. 2328 TSPI dw: 5 ' - ACTTGCATCGACGTTGGCTG (SEQ ID NO: 3)
  • TSP2up 5 ' - ACGTCTGCCCAAACATACACG (SEQ ID NO: 7)
  • 2333 TSP3up: 5 ' - ACCGCCCATCAGGCTAATC (SEQ ID NO: 8)
  • SEQ ID NO: 9 19197 is shown in the sequence listing as SEQ ID NO: 9, and the corresponding encoded amino acid sequence is shown in SEQ ID NO: 10.
  • the first 33 amino acids of SEQ ID NO:10 i.e. amino acids -33 to -1
  • a 27 amino-acid signal peptide encoding polynucleotide of a native protease, SavinaseTM, from Bacillus licheniformis was fused by PCR in frame to the gene encoding the mature phytase from from Hafnia alvei.
  • the signal peptide coding sequence is shown in SEQ ID NO: 1 1 , encoding the signal peptide of SEQ ID NO: 12.
  • the DNA coding for the fusion polypeptide was integrated by homologous recombination on a Bacillus subtilis host cell genome.
  • the gene construct was expressed under the control of a triple promoter system (as described in WO 99/43835), consisting of the promoters from Bacillus licheniformis alpha-amylase gene (amyL), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), and the Bacillus thuringiensis crylllA promoter including the mRNA stabilizing sequence.
  • Chloramphenicol acetyl-transferase was used as marker, as described in, e.g., Diderichsen et al., A useful cloning vector for Bacillus subtilis. Plasmid, 30, p. 312, 1993.
  • Chloramphenicol resistant transformants was cultured in PS-1 medium (10% sucrose, 4% soybean flour, 1% Na 3 PO 4 -12H 2 O, 0.5% CaCO 3 , and 0.01 % pluronic acid) shaken at 250 RPM at 30 0 C. After 2-5 days of incubation the supernatant was removed and the phytase activity was identified by applying 20 microliter of the supernatant into 4 mm diameter holes punched out in 1 % LSB-agarose plates containing 0.1 M Sodium acetate pH 4.5 and 0.1% Inositol hexaphosphoric acid.
  • the plates were left over night at 37°C and a buffer consisting of 0.25M CaCI 2 and 50OmM MES (adjusted to pH 6.5 with 4N NaOH) was poured over the plates.
  • the plates were left at room temperature for 1 h and the inositolphosphate phosphatase, or phytase, activity was then identified as a clear zone.
  • the selected clone of Bacillus subtilis which was harboring the Hafnia alvei phytase construct and was capable of expressing the phytase (mature part) was cultivated at 30 0 C and with 250rpm for 6 days in SK-1 M medium (Sodium Caseinate (Miprodan 30 from ArIa) 4Og, Maltodextrin 01 (Glucidex 6, catalogue no. 332203 from Roquette), 20Og, Soybean Meal 5Og, Dowfax 63N10 (a non-ionic surfactant from Dow) 0.1 ml, tap water up to 1000 ml, CaCO 3 tablet 0.5g/100 ml).
  • SK-1 M medium sodium Caseinate (Miprodan 30 from ArIa) 4Og, Maltodextrin 01 (Glucidex 6, catalogue no. 332203 from Roquette)
  • 20Og Soybean Meal 5Og
  • Dowfax 63N10 a non-ionic surfactant from Dow
  • Example 4 Purification of Hafnia alvei phytase The fermentation supernatant with the phytase was first centrifuged at 7200rpm and
  • the phytase was purified by chromatography on S Sepharose, approximately 50 ml in a XK26 column, using as buffer A 50 mM sodium acetate pH 4.5, and as buffer B 50 mM sodium acetate + 1 M NaCI pH 4.5.
  • the fractions from the column were analyzed for activity using the phosphatase assay (see below) and fractions with activity were pooled.
  • the solution was added solid ammonium sulfate giving a final concentration of 1.5 M and the pH was adjusted to 6.0 using 6 M HCI.
  • the phytase-containing solution was applied to a butyl-sepharose column, approximately 30 ml in a XK26 column, using as buffer A 25 mM bis-tris (Bis-(2-hydroxyethyl)imino-tris(hydroxymethyl)methan)) + 1.5 M ammonium sulfate pH 6.0, and as buffer B 25 mM bis-tris pH 6.0.
  • the fractions from the column were analyzed for activity using the phosphatase assay (see below) and fractions with activity were pooled.
  • the solution containing the purified phytase was buffer-changed into 50 mM sodium acetate + 0.1 M NaCI, pH 4.5 and concentrated using an Amicon ultra-15 filtering device with a 30 kDa cut-off membrane.
  • 75 microliter phytase-containing enzyme solution is dispensed in a microtiter plate well, e. g. NUNC 269620 and 75 microliter substrate is added (for preparing the substrate, two 5 mg p-nitrophenyl phophate tablets (Sigma, Cat. No. N-9389) are dissolved in 10 ml 0.1 M Na-acetate buffer, pH 5.5). The plate is sealed and incubated 15 min., shaken with 750 rpm at 37°C. After the incubation time 75 microliter stop reagent is added (the stop reagent is 0.1 M di-sodiumtetraborate in water) and the absorbance at 405 nm is measured in a microtiter plate spectrophotometer.
  • the stop reagent is 0.1 M di-sodiumtetraborate in water
  • 75 microliter phytase-containing enzyme solution appropriately diluted in 0.25M sodium acetate, 0.005% (w/v) Tween-20. pH5.5, is dispensed in a microtiter plate well, e. g. NUNC 269620, and 75 microliter substrate is added (prepared by dissolving 100mg sodium phytate from rice (Aldrich Cat.No. 274321 ) in 10ml 0.25M sodium acetate buffer, pH5.5). The plate is sealed and incubated 15min. shaken with 750rpm at 37°C.
  • stop reagent is added (the stop reagent being prepared by mixing 10 ml molybdate solution (10% (w/v) ammonium hepta-molybdate in 0.25% (w/v) ammonia solution), 10ml ammonium vanadate (0.24% commercial product from Bie&Berntsen, Cat.No. LAB17650), and 20ml 21.7% (w/v) nitric acid), and the absorbance at 405nm is measured in a microtiter plate spectrophotometer.
  • the phytase activity is expressed in the unit of FYT, one FYT being the amount of enzyme that liberates 1 micromole inorganic ortho-phosphate per minute under the conditions above.
  • An absolute value for the measured phytase activity may be obtained by reference to a standard curve prepared from appropriate dilutions of inorganic phosphate, or by reference to a standard curve made from dilutions of a phytase enzyme preparation with known activity (such standard enzyme preparation with a known activity is available on request from Novozymes A/S, Krogshoejvej 36, DK-2880 Bagsvaerd).
  • the specific activity of the phytase was determined in sodium acetate buffer, pH 5.5.
  • the phytase was highly purified as described above, i.e. only one component was identified on an SDS poly acryl amide gel.
  • the protein concentration was determined by amino acid analysis as follows: An aliquot of the sample was hydrolyzed in 6M HCI, 0.1% phenol for 16h at 110 0 C in an evacuated glass tube. The resulting amino acids were quantified using an Applied Biosystems 420A amino acid analysis system operated according to the manufacturer's instructions. From the amounts of the amino acids the total mass - and thus also the concentration - of protein in the hydrolyzed aliquot was calculated.
  • the phytase activity was determined in the units of FYT as described above and the specific activity was calculated as the phytase activity measured in FYT units per mg phytase enzyme protein.
  • the resulting specific activity was 980 FYT/mg protein.
  • the specific activity was determined on sodium phytate at pH5.5 and 37°C.
  • the pH profile was determined at 37°C in the pH range of 2.0 to 7.5 (in 0.5 pH-unit steps) as described above in the section "Determination of phytase activity", except that a buffer cocktail (5OmM glycine, 5OmM acetic acid and 5OmM Bis-Tris was used instead of the 0.25M sodium acetate pH5.5 buffer.
  • a buffer cocktail 5OmM glycine, 5OmM acetic acid and 5OmM Bis-Tris was used instead of the 0.25M sodium acetate pH5.5 buffer.
  • the isoelectric point, pi, for the phytase was determined using isoelectric focusing gels (Novex pH 310 IEF gel from Invitrogen, catalog number EC6655A2) run as described by the manufacturer.
  • the pi for the Hafnia alvei phytase is about 7.4.
  • the temperature profile (phytase activity as a function of temperature) was determined for the Hafnia alvei phytase in the temperature range of 20-90 0 C essentially as described above ("Determination of phytase activity").
  • the enzymatic reactions 100 microliter phytase-containing enzyme solution + 100 microliter substrate
  • the tubes were cooled to 20 0 C for 20 seconds and 150 microliter of each reaction mixture was transferred to a microtiter plate.
  • 75 microliter stop reagent was added and the absorbance at 405 nm was measured in a microtiter plate spectrophotometer.
  • Table 2 The results are summarized in Table 2 below. The numbers given for each temperature are relative activity (in %) normalized to the value at optimum.
  • Hafnia alvei phytase expressed in both Aspergillus oryzae and Bacillus subtilis were subjected to thermostability measurements by Differential Scanning Calorimetry (DSC) and compared to the E. coli phytase (commercially available as PHYZYME XP from Danisco NS).
  • Example 4 was dialysed against 2 x 500 ml 20 mM Na-acetate, pH 4.0 at 4°C in a 2-3h step followed by an overnight step.
  • the sample was 0.45 ⁇ m filtered and diluted with buffer to approx. 2 A280 units. The exact absorbance values measured are given in the results table shown below.
  • the dialysis buffer was used as reference in Differential Scanning Calorimetry (DSC).
  • the samples were degassed using vacuum suction and stirring for approx. 10 minutes.
  • An aliquot of the E. coli phytase from the commercial product PHYZYME XP was purified in a similar fashion as described in Example 4.
  • a DSC scan was performed at a constant scan rate of 1.5 °C/min from 20-80 0 C. Filtering period: 16 s.
  • the phytases were dialyzed against the appropriate buffers (e.g. 0.1 M glycine-HCI, pH 2.5 or 3.0; 2OmM sodium acetate pH 4.0; 0.1 M sodium acetate, pH 5.5; 0.1 M Tris-HCI, pH 7.0).
  • Data-handling was performed using the MicroCal Origin software (version 4.10), and the denaturation temperature, Td (also called the melting temperature, Tm) is defined as the temperature at the apex of the peak in the thermogram.
  • a second scan was performed immediately after a short cooling phase.
  • a large peak (between 75-100 % of the peak area of the first scan) is interpreted as a reversible unfolding/folding process.
  • the Hafnia alvei phytase had greater thermostability than the E. coli phytase. It is also clear that the thermostability of the Hafnia alvei phytase was not affected by the expression host.
  • E. coli phytase and H. alvei phytase had very similar gastro proteolytic resistance properties.
  • Example 11 Performance in animal feed in an in vitro model for the Hafnia alvei phytase and Citrobacter braakii phytase
  • the performance in animal feed of the Hafnia alvei phytase was compared, in an in vitro model, to the performance of a Citrobacter braakii phytase.
  • the in vitro model simulates gastro-intestinal conditions in a monogastric animal and correlates well with results obtained in animal trials in vivo.
  • Phytase activity in the sample is determined as described in Example 5 under "Determination of phytase activity". The comparison was performed as follows:
  • CaCI2 to a concentration of 5 g calcium per kg feed are then prepared and pre-incubated at 40 0 C and pH 3.0 for 30 minutes followed by addition of pepsin (3000 U/g feed) and suitable dosages of the phytases (identical dosages are used for all phytases to be tested to allow comparison), for example between 0.1 to 1.0 phytase units FYT/g feed. A blank with no phytase activity was also included as reference. The samples was then incubated at 40 0 C and pH 3.0 for 60 minutes followed by pH 4.0 for 30 minutes.
  • the reactions were stopped and phytic acid and inositol-phosphates extracted by addition of HCI to a final concentration of 0.5 M and incubation at 40 0 C for 2 hours, followed by one freeze-thaw cycle and 1 hour incubation at 40°C.
  • Figure 1 shows a dose-response of the Hafnia alvei phytase compared to a Citrobacter braakii phytase at dosing of 125 FYT/kg feed, 250 FYT/kg feed and 500 FYT/kg feed.
  • the effects of phytases in vitro are shown as the residual inositol-phosphate bound phosphorous (IP-P) remaining in a sample after in vitro incubation and compared to the residual IP-P remaining in a control sample without phytase. All numbers given are average and standard deviation of 4 or 5 replica (in vitro incubations).
  • Dosing 250 FYT/kg of the Hafnia phytase reduced the amount of residual IP-P in the in vitro sample to about the same degree as 125 FYT/kg of the Citrobacter phytase.
  • the Hafnia phytase was able to obtain a very good reduction in the amount of residual inositol-phosphate bound phosphorous.
  • Example 12 Performance in animal feed in an in vitro model for the Hafnia alvei phytase and Peniophora lycii phytase phytase
  • the performance in animal feed of the Hafnia alvei phytase in an in vitro model was also compared to the performance of a Peniophora lycii phytase at dosing of 250 FYT/kg and 500 FYT/kg feed.
  • the results were obtained following the experimental protocol as described in Example 1 1.
  • the Hafnia alvei phytase reduced the amount of residual IP-P in the in vitro sample better than the Peniophora lycii phytase.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Polymers & Plastics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Food Science & Technology (AREA)
  • Animal Husbandry (AREA)
  • Birds (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Insects & Arthropods (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Cell Biology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Fodder In General (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
PCT/EP2008/053561 2007-03-26 2008-03-26 Hafnia phytase Ceased WO2008116878A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
EP08718230.9A EP2129781B1 (en) 2007-03-26 2008-03-26 Hafnia phytase
ES08718230.9T ES2456960T3 (es) 2007-03-26 2008-03-26 Fitasa de Hafnia
AU2008231749A AU2008231749B2 (en) 2007-03-26 2008-03-26 Hafnia phytase
CA2681392A CA2681392C (en) 2007-03-26 2008-03-26 Hafnia phytase
PL08718230T PL2129781T3 (pl) 2007-03-26 2008-03-26 Fitaza z Hafnia
DK08718230.9T DK2129781T3 (da) 2007-03-26 2008-03-26 Hafnia-phytase
BRPI0808999-0A BRPI0808999B1 (pt) 2007-03-26 2008-03-26 Aditivo de ração animal, construção de ácido nucleico, vetor de expressão recombinante, microrganismo recombinante, métodos para a produção de um polipeptídeo e para melhorar o valor nutricional de uma ração animal, uso de pelo menos um polipeptídeo, e, composição de ração animal
CN200880017652.9A CN101679986B (zh) 2007-03-26 2008-03-26 哈夫尼菌属肌醇六磷酸酶
MX2009010043A MX289945B (es) 2007-03-26 2008-03-26 Fitasa de hafnia.
JP2010500256A JP5643083B2 (ja) 2007-03-26 2008-03-26 ハフニア・フィターゼ

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP07104870.6 2007-03-26
EP07104870 2007-03-26

Publications (1)

Publication Number Publication Date
WO2008116878A1 true WO2008116878A1 (en) 2008-10-02

Family

ID=38657067

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2008/053561 Ceased WO2008116878A1 (en) 2007-03-26 2008-03-26 Hafnia phytase

Country Status (11)

Country Link
US (2) US7923232B2 (cg-RX-API-DMAC7.html)
EP (1) EP2129781B1 (cg-RX-API-DMAC7.html)
JP (1) JP5643083B2 (cg-RX-API-DMAC7.html)
KR (1) KR20100014593A (cg-RX-API-DMAC7.html)
CN (1) CN101679986B (cg-RX-API-DMAC7.html)
CA (1) CA2681392C (cg-RX-API-DMAC7.html)
DK (1) DK2129781T3 (cg-RX-API-DMAC7.html)
ES (1) ES2456960T3 (cg-RX-API-DMAC7.html)
MX (1) MX289945B (cg-RX-API-DMAC7.html)
PL (1) PL2129781T3 (cg-RX-API-DMAC7.html)
WO (1) WO2008116878A1 (cg-RX-API-DMAC7.html)

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010034835A3 (en) * 2008-09-26 2010-06-24 Novozymes A/S Hafnia phytase variants
US7923232B2 (en) 2007-03-26 2011-04-12 Novozymes A/S Hafnia phytase
WO2011048046A2 (de) 2009-10-22 2011-04-28 Basf Se Synthetische phytasevarianten
WO2012143861A1 (en) 2011-04-21 2012-10-26 Basf Se Synthetic phytase variants
US8557555B2 (en) 2011-04-21 2013-10-15 Basf Se Synthetic phytase variants
WO2015035914A1 (en) 2013-09-11 2015-03-19 Novozymes A/S Processes for producing fermentation products
WO2015197871A1 (en) 2014-06-27 2015-12-30 Dsm Ip Assets B.V. A method for improving the nutritional value of animal feed
EP3061515A1 (en) 2015-02-27 2016-08-31 FCC Aqualia, S.A. Device and method for simultaneous removal of hydrogen sulphide and carbon dioxide from biogas
WO2017112540A1 (en) 2015-12-22 2017-06-29 Novozymes A/S Processes for producing fermentation products
WO2019055455A1 (en) 2017-09-15 2019-03-21 Novozymes A/S MIXTURES OF ENZYMES AND METHODS FOR IMPROVING THE NUTRITIONAL QUALITY OF ANIMAL FEED
WO2019083831A1 (en) 2017-10-23 2019-05-02 Novozymes A/S METHODS FOR LACTIC ACID REDUCTION IN A BIOCARBURIZER FERMENTATION SYSTEM
WO2019231944A2 (en) 2018-05-31 2019-12-05 Novozymes A/S Processes for enhancing yeast growth and productivity
WO2020106796A1 (en) * 2018-11-20 2020-05-28 Dupont Nutrition Biosciences Aps ENGINEERED ROBUST HIGH Tm-PHYTASE CLADE POLYPEPTIDES AND FRAGMENTS THEREOF
WO2020160126A1 (en) 2019-01-31 2020-08-06 Novozymes A/S Polypeptides having xylanase activity and use thereof for improving the nutritional quality of animal feed
WO2021026201A1 (en) 2019-08-05 2021-02-11 Novozymes A/S Enzyme blends and processes for producing a high protein feed ingredient from a whole stillage byproduct
WO2021126966A1 (en) 2019-12-16 2021-06-24 Novozymes A/S Processes for producing fermentation products
WO2021229093A1 (en) 2020-05-15 2021-11-18 Dsm Ip Assets B.V. A method for improving the nutritional value of animal feed
WO2023237543A1 (en) 2022-06-08 2023-12-14 Dsm Ip Assets B.V. Means and methods for reducing phosphorus secretion by fish
WO2024137248A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Compositions comprising arabinofuranosidases and a xylanase, and use thereof for increasing hemicellulosic fiber solubilization
WO2024137246A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Carbohydrate esterase family 1 (ce1) polypeptides having ferulic acid esterase and/or acetyl xylan esterase activity and polynucleotides encoding same
WO2024137252A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Process for reducing syrup viscosity in the backend of a process for producing a fermentation product
WO2024137704A2 (en) 2022-12-19 2024-06-27 Novozymes A/S Processes for producing fermentation products using fiber-degrading enzymes with engineered yeast
WO2024137250A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Carbohydrate esterase family 3 (ce3) polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
WO2024258820A2 (en) 2023-06-13 2024-12-19 Novozymes A/S Processes for producing fermentation products using engineered yeast expressing a beta-xylosidase
WO2025128568A1 (en) 2023-12-11 2025-06-19 Novozymes A/S Composition and use thereof for increasing hemicellulosic fiber solubilization
WO2026008449A2 (en) 2024-07-04 2026-01-08 Novozymes A/S A process for producing a fermentation product and a concentrated protein co-product

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2109356A2 (en) 2007-01-30 2009-10-21 Novozymes A/S Polypeptides having phytase activty and polynucleotides encoding same
BRPI0910457B1 (pt) * 2008-04-18 2020-12-29 Danisco Us Inc. variante de fitase, usos da mesma, composição enzimática, alimento e métodos de produção do mesmo, bem como para redução dos níveis de fósforo em estrume animal
FR2947563B1 (fr) * 2009-07-01 2015-08-21 Biomethodes Variants ameliores d'une phytase
ES2723050T3 (es) 2010-03-26 2019-08-21 Novozymes As Variantes de fitasa termoestables
GB201102857D0 (en) 2011-02-18 2011-04-06 Danisco Feed additive composition
GB201102865D0 (en) 2011-02-18 2011-04-06 Danisco Feed additive composition
US20120276593A1 (en) * 2011-04-29 2012-11-01 Danisco Us Inc. Use of cellulase and glucoamylase to improve ethanol yields from fermentation
CA2840971A1 (en) 2011-07-07 2013-01-10 Dupont Nutrition Biosciences Aps Assay
GB201213801D0 (en) 2012-08-03 2012-09-12 Dupont Nutrition Biosci Aps Feed additive composition
CN105154439B (zh) * 2015-08-04 2019-04-05 南开大学 对蜂房哈夫尼亚菌g5902,g5903,g5904,g5906特异的核苷酸序列
US20200359656A1 (en) 2018-02-08 2020-11-19 Danisco Us Inc. Thermally-resistant wax matrix particles for enzyme encapsulation
CA3098454A1 (en) 2018-04-26 2019-10-31 Danisco Us Inc Method for increasing stability of phytase in a solid composition and a granule composition comprising phosphate and phytase
BR112022000351A2 (pt) 2019-07-09 2022-05-10 Dupont Nutrition Biosci Aps Composições de enzima particuladas revestidas de gordura
WO2021034660A1 (en) 2019-08-16 2021-02-25 Dupont Nutrition Biosciences Aps Compositions for gut health comprising combinations of lactobacillus strains
WO2021046073A1 (en) 2019-09-05 2021-03-11 Dupont Nutrition Biosciences Aps Feed composition
CN114828642B (zh) 2019-10-21 2024-12-13 国际N&H丹麦有限公司 用于消化道健康的组合物
WO2021158927A1 (en) 2020-02-07 2021-08-12 Dupont Nutrition Biosciences Aps Feed compositions for animal health
WO2022081947A1 (en) 2020-10-16 2022-04-21 Dupont Nutrition Biosciences Feed compositions for animal health
EP4001407A1 (en) * 2020-11-17 2022-05-25 EW Nutrition GmbH Stable synthetic phytase variants
WO2022169933A2 (en) 2021-02-03 2022-08-11 Dupont Nutrition Biosciences Aps Compositions for gut health
JP2024536931A (ja) 2021-09-27 2024-10-08 インターナショナル エヌ アンド エイチ デンマーク エーピーエス 飼料添加組成物及びそれを使用する方法
WO2024227153A1 (en) 2023-04-28 2024-10-31 International N&H Denmark Aps Ruminant feed additive compositions
WO2025059013A1 (en) 2023-09-11 2025-03-20 International N&H Denmark Aps Bacillus-based components for inhibiting or delaying the growth of enterococcus spp. in animals

Citations (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (en) 1986-03-17 1987-09-23 Novo Nordisk A/S Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus
WO1991014772A1 (en) 1990-03-23 1991-10-03 Gist-Brocades N.V. Production of enzymes in seeds and their use
WO1992006204A1 (en) 1990-09-28 1992-04-16 Ixsys, Inc. Surface expression libraries of heteromeric receptors
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
EP0561907A1 (en) 1990-12-05 1993-09-29 Novo Nordisk A/S Proteins with changed epitopes and methods for the production thereof
WO1994001459A1 (en) 1992-07-10 1994-01-20 Novo Nordisk A/S A fungicidally active compound
WO1995017413A1 (de) 1993-12-21 1995-06-29 Evotec Biosystems Gmbh Verfahren zum evolutiven design und synthese funktionaler polymere auf der basis von formenelementen und formencodes
WO1995022625A1 (en) 1994-02-17 1995-08-24 Affymax Technologies N.V. Dna mutagenesis by random fragmentation and reassembly
WO1995033836A1 (en) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides useful in the treatment of cardiovascular diseases
WO1996000787A1 (en) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
WO1996016177A1 (en) 1994-11-24 1996-05-30 Novo Nordisk A/S A process for producing polypeptides with reduced allergenicity
WO1996017929A1 (en) 1994-12-07 1996-06-13 Novo Nordisk A/S Polypeptide with reduced allergenicity
US5689054A (en) 1994-03-17 1997-11-18 The United States Of America As Represented By The Secretary Of Agriculture Low phytic acid mutants and selection thereof
WO1998030682A1 (en) 1997-01-10 1998-07-16 Novo Nordisk A/S Enzyme coupled with polymeric molecules for skin care
WO1998035026A1 (en) 1997-02-06 1998-08-13 Novo Nordisk A/S Polypeptide-polymer conjugates having added and/or removed attachment groups
WO1999000489A1 (en) 1997-06-25 1999-01-07 Novo Nordisk A/S A modified polypeptide
WO1999043835A2 (en) 1998-02-26 1999-09-02 Novo Nordisk Biotech, Inc. Methods for producing a polypeptide in a bacillus cell
WO2000020569A1 (en) 1998-10-02 2000-04-13 Novozymes A/S Solid phytase compositions
WO2000022103A1 (en) 1998-10-13 2000-04-20 Novozymes A/S A modified polypeptide with reduced immune response
WO2000024883A1 (en) 1998-10-26 2000-05-04 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
WO2000026354A1 (en) 1998-10-30 2000-05-11 Novozymes A/S Glycosylated proteins having reduced allergenicity
WO2000026230A1 (en) 1998-10-30 2000-05-11 Novozymes A/S Low allergenic protein variants
WO2000056900A2 (en) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoter sequences derived from fusarium venenatum and uses thereof
WO2001058275A2 (en) 2000-02-08 2001-08-16 F Hoffmann-La Roche Ag Use of acid-stable subtilisin proteases in animal feed
WO2001062947A1 (en) 2000-02-23 2001-08-30 Novozymes A/S Fermentation with a phytase
WO2001083559A2 (en) 2000-04-28 2001-11-08 Novozymes A/S Production and use of protein variants having modified immunogenecity
WO2002090384A2 (en) 2001-05-04 2002-11-14 Novozymes A/S Antimicrobial polypeptide from aspergillus niger
WO2003044049A1 (en) 2001-11-20 2003-05-30 Novozymes A/S Antimicrobial polypeptides from pseudoplectania nigrella
WO2003048148A2 (en) 2001-12-03 2003-06-12 Novozymes A/S Statin-like compounds
WO2006043178A2 (en) 2004-10-18 2006-04-27 Danisco A/S Enzymes

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NZ330940A (en) * 1997-07-24 2000-02-28 F Production of consensus phytases from fungal origin using computer programmes
US7078035B2 (en) * 1997-08-13 2006-07-18 Diversa Corporation Phytases, nucleic acids encoding them and methods for making and using them
US6855365B2 (en) * 1997-08-13 2005-02-15 Diversa Corporation Recombinant bacterial phytases and uses thereof
AU4056700A (en) * 1999-03-31 2000-10-16 Cornell Research Foundation Inc. Phosphatases with improved phytase activity
US6841370B1 (en) * 1999-11-18 2005-01-11 Cornell Research Foundation, Inc. Site-directed mutagenesis of Escherichia coli phytase
AU2002347019A1 (en) * 2001-12-07 2003-06-17 Novozymes A/S Polypeptides having protease activity and nucleic acids encoding same
JP4426307B2 (ja) 2002-02-08 2010-03-03 ノボザイムス アクティーゼルスカブ フィターゼ変異体
GB0422052D0 (en) * 2004-10-04 2004-11-03 Dansico As Enzymes
ES2531135T3 (es) * 2006-09-21 2015-03-11 Basf Enzymes Llc Fitasas, ácidos nucleicos que las codifican y métodos para su producción y uso
EP2109356A2 (en) * 2007-01-30 2009-10-21 Novozymes A/S Polypeptides having phytase activty and polynucleotides encoding same
ES2513217T3 (es) 2007-02-07 2014-10-24 Danisco Us, Inc., Genencor Division Fitasas de Buttiauxella sp. variantes que tienen propiedades alteradas
US8143046B2 (en) * 2007-02-07 2012-03-27 Danisco Us Inc., Genencor Division Variant Buttiauxella sp. phytases having altered properties
PL2129781T3 (pl) * 2007-03-26 2014-07-31 Novozymes As Fitaza z Hafnia
ES2636369T3 (es) * 2008-09-26 2017-10-05 Novozymes A/S Variantes de fitasa de Hafnia
CA2794244C (en) * 2010-03-26 2019-03-12 Novozymes A/S Thermostable phytase variants

Patent Citations (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (en) 1986-03-17 1987-09-23 Novo Nordisk A/S Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1991014772A1 (en) 1990-03-23 1991-10-03 Gist-Brocades N.V. Production of enzymes in seeds and their use
WO1992006204A1 (en) 1990-09-28 1992-04-16 Ixsys, Inc. Surface expression libraries of heteromeric receptors
EP0561907A1 (en) 1990-12-05 1993-09-29 Novo Nordisk A/S Proteins with changed epitopes and methods for the production thereof
WO1994001459A1 (en) 1992-07-10 1994-01-20 Novo Nordisk A/S A fungicidally active compound
WO1995017413A1 (de) 1993-12-21 1995-06-29 Evotec Biosystems Gmbh Verfahren zum evolutiven design und synthese funktionaler polymere auf der basis von formenelementen und formencodes
WO1995022625A1 (en) 1994-02-17 1995-08-24 Affymax Technologies N.V. Dna mutagenesis by random fragmentation and reassembly
US5689054A (en) 1994-03-17 1997-11-18 The United States Of America As Represented By The Secretary Of Agriculture Low phytic acid mutants and selection thereof
US6111168A (en) 1994-03-17 2000-08-29 The United States Of America As Represented By The Secretary Of Agriculture Low phytic acid mutants and selection thereof
WO1995033836A1 (en) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides useful in the treatment of cardiovascular diseases
WO1996000787A1 (en) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
WO1996016177A1 (en) 1994-11-24 1996-05-30 Novo Nordisk A/S A process for producing polypeptides with reduced allergenicity
WO1996017929A1 (en) 1994-12-07 1996-06-13 Novo Nordisk A/S Polypeptide with reduced allergenicity
WO1998030682A1 (en) 1997-01-10 1998-07-16 Novo Nordisk A/S Enzyme coupled with polymeric molecules for skin care
WO1998035026A1 (en) 1997-02-06 1998-08-13 Novo Nordisk A/S Polypeptide-polymer conjugates having added and/or removed attachment groups
WO1999000489A1 (en) 1997-06-25 1999-01-07 Novo Nordisk A/S A modified polypeptide
WO1999043835A2 (en) 1998-02-26 1999-09-02 Novo Nordisk Biotech, Inc. Methods for producing a polypeptide in a bacillus cell
WO2000020569A1 (en) 1998-10-02 2000-04-13 Novozymes A/S Solid phytase compositions
WO2000022103A1 (en) 1998-10-13 2000-04-20 Novozymes A/S A modified polypeptide with reduced immune response
WO2000024883A1 (en) 1998-10-26 2000-05-04 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
WO2000026230A1 (en) 1998-10-30 2000-05-11 Novozymes A/S Low allergenic protein variants
WO2000026354A1 (en) 1998-10-30 2000-05-11 Novozymes A/S Glycosylated proteins having reduced allergenicity
WO2000056900A2 (en) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoter sequences derived from fusarium venenatum and uses thereof
WO2001058275A2 (en) 2000-02-08 2001-08-16 F Hoffmann-La Roche Ag Use of acid-stable subtilisin proteases in animal feed
WO2001062947A1 (en) 2000-02-23 2001-08-30 Novozymes A/S Fermentation with a phytase
WO2001083559A2 (en) 2000-04-28 2001-11-08 Novozymes A/S Production and use of protein variants having modified immunogenecity
WO2002090384A2 (en) 2001-05-04 2002-11-14 Novozymes A/S Antimicrobial polypeptide from aspergillus niger
WO2003044049A1 (en) 2001-11-20 2003-05-30 Novozymes A/S Antimicrobial polypeptides from pseudoplectania nigrella
WO2003048148A2 (en) 2001-12-03 2003-06-12 Novozymes A/S Statin-like compounds
WO2006043178A2 (en) 2004-10-18 2006-04-27 Danisco A/S Enzymes

Non-Patent Citations (81)

* Cited by examiner, † Cited by third party
Title
"Biology and Activities of Yeast", 1980
"Enzyme Nomenclature from NC-IUBMB", 1992
"Nutrient requirements in swine", 1988, NATIONAL ACADEMY PRESS, pages: 2 - 6
"Official Methods of Analysis", 1984, ASSOCIATION OF OFFICIAL ANALYTICAL CHEMISTS
"Protein Purification", 1989, VCH PUBLISHERS
"Useful proteins from recombinant bacteria", SCIENTIFIC AMERICAN, vol. 242, 1980, pages 74 - 94
BAIROCH A.: "The ENZYME database", NUCLEIC ACIDS RES, vol. 28, 2000, pages 304 - 305
BECKER; GUARENTE: "Methods in Enzymology", vol. 194, ACADEMIC PRESS, INC., article "Guide to Yeast Genetics and Molecular Biology", pages: 182 - 187
BOLTON; MCCARTHY, PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 48, 1962, pages 1390
BOWIE; SAUER, PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 2152 - 2156
CHANG; COHEN, MOLECULAR GENERAL GENETICS, vol. 168, 1979, pages 111 - 115
CHEN ET AL., JOURNAL OF CHROMATOGRAPHY A, vol. 1018, 2003, pages 41 - 52
CHEN ET AL., PLANT AND CELL PHYSIOLOGY, vol. 39, 1998, pages 935 - 941
CHRISTOU, PLANT JOURNAL, vol. 2, 1992, pages 275 - 281
CONRAD ET AL., JOURNAL OF PLANT PHYSIOLOGY, vol. 152, 1998, pages 708 - 711
CULLEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 15, 1987, pages 9163 - 9175
CUNNINGHAM; WELLS, SCIENCE, vol. 244, 1989, pages 1081 - 1085
DE VOS ET AL., SCIENCE, vol. 255, 1992, pages 306 - 312
DEBOER ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 80, 1983, pages 21 - 25
DERBYSHIRE ET AL., GENE, vol. 46, 1986, pages 145
DIDERICHSEN ET AL.: "A useful cloning vector for Bacillus subtilis", PLASMID, vol. 30, 1993, pages 312
DUBNAU; DAVIDOFF-ABELSON, JOURNAL OF MOLECULAR BIOLOGY, vol. 56, 1971, pages 209 - 221
EDWARDS; CORUZZI, ANN. REV. GENET., vol. 24, 1990, pages 275 - 303
EUROPEAN TABLE OF ENERGY VALUES FOR POULTRY FEED-STUFFS
FORD ET AL., PROTEIN EXPRESSION AND PURIFICATION, vol. 2, 1991, pages 95 - 107
FRANCK ET AL., CELL, vol. 21, 1980, pages 285 - 294
GASSER ET AL., SCIENCE, vol. 244, 1990, pages 1293
GEMS ET AL., GENE, vol. 98, 1991, pages 61 - 67
GREAVES M P ET AL: "A RAPID METHOD FOR DETERMINING PHYTASE ACTIVITY OF SOIL MICRO-ORGANISMS.", NATURE 21 DEC 1963, vol. 200, 21 December 1963 (1963-12-21), pages 1231 - 1232, XP009093349, ISSN: 0028-0836 *
GU WEI-NA ET AL: "[Gene cloning, expression and characterization of a novel phytase from Hafnia alvei]", SHENG WU GONG CHENG XUE BAO = CHINESE JOURNAL OF BIOTECHNOLOGY NOV 2007, vol. 23, no. 6, November 2007 (2007-11-01), pages 1017 - 1021, XP009102936, ISSN: 1000-3061 *
GUO; SHERMAN, MOLECULAR CELLULAR BIOLOGY, vol. 15, 1995, pages 5983 - 5990
HAWKSWORTH ET AL.: "Ainsworth and Bisby's Dictionary of The Fungi", 1995, UNIVERSITY PRESS
HILTON ET AL., J. BIOL. CHEM., vol. 271, 1996, pages 4699 - 4708
HINNEN ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 75, 1978, pages 1920
HOOYKAS; SCHILPEROORT, PLANT MOLECULAR BIOLOGY, vol. 19, 1992, pages 15 - 38
HORVATH ET AL., PNAS, vol. 97, no. 4, 15 February 2000 (2000-02-15), pages 1914 - 1919
HUANG ET AL: "A novel phytase with preferable characteristics from Yersinia intermedia", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 350, no. 4, 1 December 2006 (2006-12-01), pages 884 - 889, XP005712102, ISSN: 0006-291X *
INNIS ET AL.: "PCR: A Guide to Methods and Application", 1990, ACADEMIC PRESS
ITO ET AL., JOURNAL OF BACTERIOLOGY, vol. 153, 1983, pages 163
ITO ET AL., PLANT MOL. BIOL., vol. 24, 1994, pages 863 - 878
KAGAYA ET AL., MOLECULAR AND GENERAL GENETICS, vol. 248, 1995, pages 668 - 674
KOEHLER; THORNE, JOURNAL OF BACTERIOLOGY, vol. 169, 1987, pages 5771 - 5278
KYOZUKA ET AL., PLANT PHYSIOLOGY, vol. 102, 1993, pages 991 - 1000
LOWMAN ET AL., BIOCHEM., vol. 30, 1991, pages 10832 - 10837
MALARDIER ET AL., GENE, vol. 78, 1989, pages 147 - 156
MITRA; HIGGINS, PLANT MOLECULAR BIOLOGY, vol. 26, 1994, pages 85 - 93
MYERS; W. MILLER: "Optimal Alignments in Linear Space", CABIOS, vol. 4, 1988, pages 11 - 17
NEEDLEMAN, S.B.; WUNSCH, C.D., JOURNAL OF MOLECULAR BIOLOGY, vol. 48, 1970, pages 443 - 453
NER ET AL., DNA, vol. 7, 1988, pages 127
OMIRULLEH ET AL., PLANT MOLECULAR BIOLOGY, vol. 21, 1993, pages 415 - 428
PLANT MO. BIOL., vol. 18, pages 675 - 689
POTRYKUS, BIO/TECHNOLOGY, vol. 8, 1990, pages 535
REIDHAAR-OLSON; SAUER, SCIENCE, vol. 241, 1988, pages 53 - 57
ROMANOS ET AL., YEAST, vol. 8, 1992, pages 423 - 488
RYAN ET AL: "ProteinParser-A community based tool for the generation of a detailed protein consensus and FASTA output", COMPUTER METHODS AND PROGRAMS IN BIOMEDICINE, ELSEVIER, AMSTERDAM, NL, vol. 85, no. 1, 2 December 2006 (2006-12-02), pages 69 - 76, XP005788524, ISSN: 0169-2607 *
SHIGEKAWA; DOWER, BIOTECHNIQUES, vol. 6, 1988, pages 742 - 751
SHIMAMOTO ET AL., NATURE, vol. 338, 1989, pages 274
SHIMAMOTO, CURRENT OPINION BIOTECHNOLOGY, vol. 5, 1994, pages 158 - 162
SIMONEN; PALVA, MICROBIOLOGICAL REVIEWS, vol. 57, 1993, pages 109 - 137
SKOG-LUND ET AL., J. AGRIC. FOOD CHEM., vol. 45, 1997, pages 431 - 436
SMITH ET AL., J. MOL. BIOL., vol. 224, 1992, pages 899 - 904
SMITH ET AL., JOURNAL OF MOLECULAR BIOLOGY, vol. 224, 1992, pages 899 - 904
STOUT, G. K.; JENSEN, L. H.: "X-Ray Structure Determinations", 1989, JOHN WILEY AND SONS, INC.
T. F. SMITH; M. S. WATERMAN: "Smith-Waterman algorithm", J. MOL. BIOL., vol. 147, 1981, pages 195 - 197
TAGUE ET AL., PLANT PHYSIOLOGY, vol. 86, 1988, pages 506
VASIL ET AL., BIO/TECHNOLOGY, vol. 10, 1992, pages 667 - 674
VEEVOEDERTABEL: "gegevens over chemische samenstelling, verteerbaarheid en voederwaarde van voedermiddelen", 1997, CENTRAL VEEVOEDERBUREAU
VILLA-KAMAROFF ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 75, 1978, pages 3727 - 3731
W. R. PEARSON: "Rapid and Sensitive Sequence Comparison with FASTP and FASTA", METHODS IN ENZYMOLOGY, vol. 183, 1990, pages 63 - 98
W. R. PEARSON; D. J. LIPMAN: "Improved Tools for Biological Sequence Analysis", PNAS, vol. 85, 1988, pages 2444 - 2448
WLODAVER ET AL., FEBS LETT., vol. 309, 1992, pages 59 - 64
WLODAVER ET AL., FEBS LETTERS, vol. 309, 1992, pages 59 - 64
WU ET AL., PLANT AND CELL PHYSIOLOGY, vol. 39, 1998, pages 885 - 889
XIONG ET AL., JOURNAL OF APPLIED MICROBIOLOGY, vol. 98, 2005, pages 418 - 428
XU ET AL., PLANT MOLECULAR BIOLOGY, vol. 22, 1993, pages 573 - 588
YELTON ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 81, 1984, pages 1470 - 1474
YOON SEONG JUN ET AL: "Isolation and identification of phytase-producing bacterium, enterobacter sp. 4, and enzymatic properties of phytase enzyme", ENZYME MICROB TECHNOL; ENZYME AND MICROBIAL TECHNOLOGY MAY 1 1996 ELSEVIER SCIENCE INC, NEW YORK, NY, USA, vol. 18, no. 6, 1 May 1996 (1996-05-01), pages 449 - 454, XP002461412 *
YOUNG; SPIZIZIN, JOURNAL OF BACTERIOLOGY, vol. 81, 1961, pages 823 - 829
ZHANG W; MCELROY D.; WU R: "Analysis of rice Act1 5' region activity in transgenic rice plants", PLANT CELL, vol. 3, 1991, pages 1155 - 1165
ZININ N V ET AL: "Phytase activity of several bacteria groups", BIOSIS, 2003, XP002392194 *
ZININ N V ET AL: "PHYTASE ACTIVITY OF SEVERAL BACTERIA GROUPS", BIOTEKHNOLOGIYA, GLAVNOE UPRAVLENIE MIKROBIOLOGICESKOJ PROMY LENNOSTI PRI, SU, no. 2, 2003, pages 3 - 10, XP008045468, ISSN: 0234-2758 *

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7923232B2 (en) 2007-03-26 2011-04-12 Novozymes A/S Hafnia phytase
US8663963B2 (en) 2007-03-26 2014-03-04 Novozymes A/S Hafnia phytase
WO2010034835A3 (en) * 2008-09-26 2010-06-24 Novozymes A/S Hafnia phytase variants
US8507240B2 (en) 2008-09-26 2013-08-13 Novozymes A/S Hafnia phytase variants
EP2650364A1 (en) * 2008-09-26 2013-10-16 Novozymes A/S Hafnia phytase variants
EP2933329A1 (en) * 2008-09-26 2015-10-21 Novozymes A/S Hafnia phytase variants
JP2015177800A (ja) * 2009-10-22 2015-10-08 ビーエーエスエフ ソシエタス・ヨーロピアBasf Se 合成フィターゼ変異体
WO2011048046A2 (de) 2009-10-22 2011-04-28 Basf Se Synthetische phytasevarianten
WO2011048046A3 (de) * 2009-10-22 2011-08-11 Basf Se Synthetische phytasevarianten
CN102575237A (zh) * 2009-10-22 2012-07-11 巴斯夫欧洲公司 合成的植酸酶变体
JP2013507939A (ja) * 2009-10-22 2013-03-07 ビーエーエスエフ ソシエタス・ヨーロピア 合成フィターゼ変異体
RU2567000C2 (ru) * 2009-10-22 2015-10-27 Басф Се Фитаза, ее применение, корм и кормовая добавка для животных, содержащие ее
WO2012143861A1 (en) 2011-04-21 2012-10-26 Basf Se Synthetic phytase variants
US8557555B2 (en) 2011-04-21 2013-10-15 Basf Se Synthetic phytase variants
WO2015035914A1 (en) 2013-09-11 2015-03-19 Novozymes A/S Processes for producing fermentation products
EP3712274A1 (en) 2013-09-11 2020-09-23 Novozymes A/S Processes for producing fermentation products
WO2015197871A1 (en) 2014-06-27 2015-12-30 Dsm Ip Assets B.V. A method for improving the nutritional value of animal feed
US10980249B2 (en) 2014-06-27 2021-04-20 Dsm Ip Assets B.V. Method for improving the nutritional value of animal feed
EP3061515A1 (en) 2015-02-27 2016-08-31 FCC Aqualia, S.A. Device and method for simultaneous removal of hydrogen sulphide and carbon dioxide from biogas
US9901864B2 (en) 2015-02-27 2018-02-27 Fcc Aqualia, S.A. Device and method for simultaneous hydrogen sulphide removal and biogas upgrading
WO2017112540A1 (en) 2015-12-22 2017-06-29 Novozymes A/S Processes for producing fermentation products
WO2019055455A1 (en) 2017-09-15 2019-03-21 Novozymes A/S MIXTURES OF ENZYMES AND METHODS FOR IMPROVING THE NUTRITIONAL QUALITY OF ANIMAL FEED
WO2019083831A1 (en) 2017-10-23 2019-05-02 Novozymes A/S METHODS FOR LACTIC ACID REDUCTION IN A BIOCARBURIZER FERMENTATION SYSTEM
WO2019231944A2 (en) 2018-05-31 2019-12-05 Novozymes A/S Processes for enhancing yeast growth and productivity
IL283241B1 (en) * 2018-11-20 2024-08-01 Dupont Nutrition Biosci Aps Transgenic high-potency Tm-phytase polypeptides and their fragments
WO2020106796A1 (en) * 2018-11-20 2020-05-28 Dupont Nutrition Biosciences Aps ENGINEERED ROBUST HIGH Tm-PHYTASE CLADE POLYPEPTIDES AND FRAGMENTS THEREOF
US12365886B2 (en) 2018-11-20 2025-07-22 International N&H Denmark Aps Engineered robust high Tm-phytase clade polypeptides and fragments thereof
WO2020160126A1 (en) 2019-01-31 2020-08-06 Novozymes A/S Polypeptides having xylanase activity and use thereof for improving the nutritional quality of animal feed
WO2021026201A1 (en) 2019-08-05 2021-02-11 Novozymes A/S Enzyme blends and processes for producing a high protein feed ingredient from a whole stillage byproduct
WO2021126966A1 (en) 2019-12-16 2021-06-24 Novozymes A/S Processes for producing fermentation products
WO2021229093A1 (en) 2020-05-15 2021-11-18 Dsm Ip Assets B.V. A method for improving the nutritional value of animal feed
WO2023237543A1 (en) 2022-06-08 2023-12-14 Dsm Ip Assets B.V. Means and methods for reducing phosphorus secretion by fish
WO2024137248A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Compositions comprising arabinofuranosidases and a xylanase, and use thereof for increasing hemicellulosic fiber solubilization
WO2024137246A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Carbohydrate esterase family 1 (ce1) polypeptides having ferulic acid esterase and/or acetyl xylan esterase activity and polynucleotides encoding same
WO2024137252A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Process for reducing syrup viscosity in the backend of a process for producing a fermentation product
WO2024137704A2 (en) 2022-12-19 2024-06-27 Novozymes A/S Processes for producing fermentation products using fiber-degrading enzymes with engineered yeast
WO2024137250A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Carbohydrate esterase family 3 (ce3) polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
WO2024258820A2 (en) 2023-06-13 2024-12-19 Novozymes A/S Processes for producing fermentation products using engineered yeast expressing a beta-xylosidase
WO2025128568A1 (en) 2023-12-11 2025-06-19 Novozymes A/S Composition and use thereof for increasing hemicellulosic fiber solubilization
WO2026008449A2 (en) 2024-07-04 2026-01-08 Novozymes A/S A process for producing a fermentation product and a concentrated protein co-product

Also Published As

Publication number Publication date
BRPI0808999A2 (pt) 2014-11-11
CN101679986A (zh) 2010-03-24
US20080263688A1 (en) 2008-10-23
CN101679986B (zh) 2016-08-10
EP2129781B1 (en) 2014-01-22
CA2681392C (en) 2017-08-01
ES2456960T3 (es) 2014-04-24
MX289945B (es) 2011-09-05
KR20100014593A (ko) 2010-02-10
JP2010522548A (ja) 2010-07-08
AU2008231749A1 (en) 2008-10-02
PL2129781T3 (pl) 2014-07-31
JP5643083B2 (ja) 2014-12-17
CA2681392A1 (en) 2008-10-02
MX2009010043A (es) 2009-10-12
US7923232B2 (en) 2011-04-12
DK2129781T3 (da) 2014-03-31
US8663963B2 (en) 2014-03-04
EP2129781A1 (en) 2009-12-09
BRPI0808999A8 (pt) 2017-04-04
US20110154519A1 (en) 2011-06-23

Similar Documents

Publication Publication Date Title
CA2681392C (en) Hafnia phytase
US7867743B2 (en) Polypeptides having phytase activity and polynucleotides encoding same
US7833768B2 (en) Polypeptides having phytase activity
WO2006063588A1 (en) Polypeptides having acid phosphatase activity and polynucleotides encoding same
AU2008231749B2 (en) Hafnia phytase
BRPI0808999B1 (pt) Aditivo de ração animal, construção de ácido nucleico, vetor de expressão recombinante, microrganismo recombinante, métodos para a produção de um polipeptídeo e para melhorar o valor nutricional de uma ração animal, uso de pelo menos um polipeptídeo, e, composição de ração animal

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880017652.9

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08718230

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2008718230

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2008231749

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: MX/A/2009/010043

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2681392

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 5615/CHENP/2009

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2010500256

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020097020077

Country of ref document: KR

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2008231749

Country of ref document: AU

Date of ref document: 20080326

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: PI0808999

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20090917