WO2008084106A1 - Anti-kir antibodies, formulations, and uses thereof - Google Patents
Anti-kir antibodies, formulations, and uses thereof Download PDFInfo
- Publication number
- WO2008084106A1 WO2008084106A1 PCT/EP2008/050306 EP2008050306W WO2008084106A1 WO 2008084106 A1 WO2008084106 A1 WO 2008084106A1 EP 2008050306 W EP2008050306 W EP 2008050306W WO 2008084106 A1 WO2008084106 A1 WO 2008084106A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- kir
- antibody
- dose
- formulation
- patient
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39541—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against normal tissues, cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
Definitions
- This invention relates to novel antibodies against certain Killer Immunoglobulin-like Receptors (KIRs); formulations, dosages, and administration schedules for these and/or other therapeutic anti-KIR antibodies; and methods of producing and using the same.
- KIRs Killer Immunoglobulin-like Receptors
- KIRs are polymorphic type 1 trans-membrane molecules present on certain subsets of lymphocytes, including NK cells and some T cells. KIRs interact with determinants in the alpha 1 and 2 domains of MHC class I molecules.
- haplo-identical stem cell transplantation SCT
- SCT haplo-identical stem cell transplantation
- KIR-HLA class I mismatched NK cells resulting in reduced rates of leukemia relapse, no graft-versus-host disease, and markedly improved survival rates (Ruggeri et al., Science 2002;295:2029-31 ).
- the molecular basis for the clinical efficacy of haplo-identical SCT is that NK cell-mediated tumor killing is regulated by inhibitory KIR receptors.
- HLA-B and -C molecules are highly polymorphic in the population, and distinct HLA allotypes are recognized by either KIR2DL1 or by KIR2DL2/3, it is often possible to find donors and recipients who KIR and HLA are mismatched, i.e., where the KIR of the donor do not bind an HLA ligand in the recipient. In such situations, there is no transmission of inhibitory signals via the KIR that fail to bind HLA ligands, facilitating activation of NK cells. However, this SCT protocol is not available to all patients, e.g., to the majority of AML patients who are elderly.
- a humanized or fully human anti-KIR antibody that is capable of blocking inhibitory KIR signalling can be used.
- Anti-KIR antibodies having advantageous pharmacological properties and useful in, e.g., the treatment of cancer or infectious diseases are described in WO2006003179, WO2006072626, WO2005003172, and WO2005003168. However, for clinical applications of such antibodies, optimized formulations and effective administration regimens are needed.
- the invention described herein concerns formulations and administration regimens for anti-KIR antibodies, suitable for their use in promoting physiological effects useful in the treatment of cancer and other disorders or diseases.
- compositions of anti-KIR antibodies which, when administered, modulate NK cell activity in vivo.
- these compositions lead to efficient occupancy of KIR receptors on NK cells, and are useful in treating e.g., cancer and viral diseases.
- S241 P variant of anti-KIR antibody 1-7F9 (described in WO2006003179), novel pharmaceutical formulations that can be used with the variant and/or 1-7F9, methods of producing the same, and methods of using these compositions for promoting physiological effects, such as in the treatment of cancer and viral diseases.
- Figure 1 shows the amino acid sequence of the mutated heavy chain encoding an S241 P variant of Anti-KIR(1-7F9) (SEQ ID NO:1 ), with the mutated proline residue in bold.
- Figure 2 shows the results from a pH solubility study of Anti-KIR(1-7F9).
- Figure 3 shows the results of a precipitation analysis associated with different ex- cipients.
- Figure 4 shows a chromatogram from purification of Anti-KIR(1-7F9) S241 P mutant using Protein A and desalting into PBS buffer. Eluted material from protein A, annotated as peak start (Retention (“R.”) vol -14 ml.) and peak end (R. vol -12 ml_), was stored in a loop prior to injection at the desalting column. After desalting, fractions were collected and frac- tions annotated A2 and A3 were pooled and used for further analysis.
- R. Retention
- R. vol -12 ml_ peak end
- Figure 5 presents electropherograms and integration tables from analyses of Anti- KIR(1-7F9) expressed in hybridoma cells (A) and Anti-KIR(1-7F9) expressed in CHO K1 cells
- Figure 6 shows a schematic representation of the population pharmacokinetic model for Anti-KIR(1-7F9) in wild-type B6 mice and transgenic KIR-tgll mice including a saturable peripheral binding site.
- Figure 7 shows mean predicted PK profiles compared to mean observed values in B6 mice. Model predictions are based on the combined B6/KIR-tgll PK model.
- Figure 8 shows mean predicted PK profiles compared to mean observed values for KIR-tgll mice. Model predictions are based on the combined B6/KIR-tgll PK model.
- Figure 9 shows mean predicted PK profiles compared to mean observed values in KIR-tgl mice.
- Figure 10 shows a schematic representation of the two-compartment pharmacokinetic model applied for human PK predictions and for estimation of PK in cynomolgus monkeys.
- Figure 11 shows parallel concentration versus occupancy curves by in vitro titration of Anti-KIR(1-7F9) binding to NK cells from KIR-tgll mice and to human NK cells at 37 0 C.
- Splenocytes from KIR-tgll mice and PBMC or NK cells from human donors, as well as the YTS cell line expressing KIR2DL1 were incubated with increasing concentrations of Anti- KIR(1-7F9) and then analysed by flow cytometry.
- Figure 12 shows Anti-KIR(1-7F9) plasma concentrations in AML patients versus time after administration.
- Figure 13 shows the relationship between KIR occupancy 2 hours post- administration and serum concentration of 1-7F9 in humans.
- Plasma concentrations below Limit of Quantification (LOQ) have been plotted at /4LOQ (2.5 ng/ml).
- Figure 14 shows the relationship between KIR occupancy for time points 24 hours up to 6 weeks post-administration, and serum concentration of 1-7F9 in humans. Values below LOQ have been plotted at /4LOQ (2.5 ng/ml).
- Figure 15 shows the levels of CD107a on NK- and T-cells in patient blood after administration of Anti-KIR(1-7F9), where CD107a levels were increased on NK-cells 24h post- administration.
- compositions, formulations, dosages, and administration regimens suitable for NK cell activation and therapeutic applications of anti-KIR antibodies as well as kits comprising one or more anti-KIR antibodies with instructions for use in treating cancer or a viral disease.
- the invention provides an anti-KIR antibody administration regimen characterized by the exemplary dose-dosage regimen (or dosing frequency) combinations described in Table 1.
- the administration regimens provided are based, in part, on a combination of PK/PD modelling and data from patient studies on anti-KIR antibody 1-7F9, as described in the Examples. Without being bound to theory, the administration regimens in Table 1 lead to effi- cient NK cell modulation by achieving high KIR occupancy levels, such as at least about
- NK cells in blood after administration of an anti-KIR antibody to a human patient can also be used in an administration regimen according to the invention, as described herein.
- haplo-identical SCT between KIR and HLA mismatched donors and recipients it is possible to detect donor-derived NK cells in the circulation of patients for up to about 3 months after transplantation; nevertheless, it is possible that the NK cells persist for considerably longer, but in quantities that preclude their identification in blood.
- a therapeutically effective dosing schedule of a neutraliz- ing anti-KIR antibody is one that results in a sufficiently high (e.g., full or near-full) blocking of the KIR receptors for a period of at least about three months, preferably for at least 6 months.
- sufficiently high blockage could be achieved in human patients, or what doses of an anti-KIR antibodies were required to achieve such blockage.
- low doses of Anti-KIR(1-7F9) were sufficient to (ii) detectably activate NK-cell mediated killing of tumor cells in vivo, and (i) to achieve a near-full receptor blockade, in patients.
- the invention provides formulations suitable for 1-7F9, 1- 7F9(S241 P), or similar lgG4 antibodies, particularly similar anti-KIR lgG4 antibodies and/or cross-reactive anti-KIR antibodies.
- the formulations described herein have been determined to be associated with advantageous pharmacological properties including (a) a low level of antibody molecule precipitation (suitable solubility and low levels of particle formation), (b) an acceptable level of antibody molecule stability (in terms of maintenance of monomeric structure and secondary structural elements), and (c) a low level of aggregation formation.
- Anti-KIR antibodies useful in the present invention are NK cell-modulatory, i.e., ef- fective in modulating NK cell activity, typically by reducing KIR signalling. This can be achieved either by the antibody blocking HLA-ligand from binding to a KIR molecule, or by a non-competitive antagonist mechanism of the antibody (see WO2006072626).
- a neutralizing anti-KIR antibody For an anti- KIR antibody reducing or blocking the signalling of one or more inhibitory KIRs such as, e.g., KIR2DL1 , KIR2DL2, and KIR2DL3, herein called "a neutralizing anti-KIR antibody", a high KIR occupancy leads to potentiation of NK cell activity.
- Suitable anti-KIR antibodies may also either be mono-specific, i.e., bind to a single type of KIR-molecule, or multi-specific, i.e., bind to more than one KIR molecule.
- An anti-KIR antibody binding at least to all of KIR2DL1 , KIR2DL2, and KIR2DL3 is herein called "a cross-reactive antibody.”
- Exemplary antibodies of useful for applications according to the invention include those described in WO2006003179 and WO2006072626.
- neutralizing and cross-reactive anti-KIR antibody 1-7F9 blocks the interactions of inhibitory KIR2DL receptors KIR2DL1 , KIR2DL2, and KIR2DL3 with their HLA-C ligands, thereby enhancing NK cell cytotoxic activity.
- 1-7F9 neutralizing and cross-reactive anti-KIR antibody 1-7F9
- KIR2DL1 , KIR2DL2, and KIR2DL3 blocks the interactions of inhibitory KIR2DL receptors KIR2DL1 , KIR2DL2, and KIR2DL3 with their HLA-C ligands, thereby enhancing NK cell cytotoxic activity.
- 1-7F9 variable light and heavy chain sequences of Anti-KIR(1-7F9) are set forth in SEQ ID NO:2 and SEQ ID NO:3, respectively.
- the invention also provides a novel variant of the anti-KIR lgG4 antibody 1-7F9.
- the variant provided comprises an lgG4 heavy chain comprising the 1-7F9 variable heavy chain sequence and a serine to proline mutation in residue 241 , corresponding to position 228 according to the EU-index (Kabat et ai, "Sequences of proteins of immunological interest", 5 th ed., NIH, Bethesda, ML, 1991 ).
- 1-7F9 variants of lgG4 isotype comprising a heavy chain according to SEQ ID NO:1 provided herein.
- the nucleotide se- quence encoding SEQ ID NO:1 is set forth in SEQ ID NO:6, and its complementary sequence is set forth in SEQ ID NO:7.
- the variant can further comprise a light chain that comprises a light chain variable region according to SEQ ID NO:2.
- This variant is also referred to as 1-7F9(S241 P).
- the antibody variant is expressed recombinantly in CHO cells or another suitable cell type. As sown in the Examples, the mutation does not interfere with the ability of the variant antibody to bind to KIR antigens bound by 1-7F9. As such, the 1-
- 7F9(S241 P) antibody generally can be used in any of the ways that antibody 1-7F9 is described as being used in WO2006003179.
- the sequence of the mutated heavy chain encoding the 1-7F9(S241 P) variant is shown in Figure 1.
- the mutant was expressed in CHO cells, upon transfection of the mutated heavy chain and the wild-type light chain.
- these methods are only exemplary in that such an antibody molecule can be generated by any suitable method (examples of which are described in WO2006003179).
- the invention provides pharmaceutically acceptable antibody formula- tions.
- 1-7F9 lgG4 anti-KIR antibody or the above- described 1-7F9 variant lgG4 molecule which may be referred to as, e.g., "1-F79v”, “1-7F9 S241 P", or the "S241 P variant”, etc.
- the properties of such formulations can be applicable to formulations comprising similar lgG4 antibodies, particularly similar anti-KIR lgG4 antibodies and/or cross-reactive anti-KIR antibodies.
- any of the human anti-KIR anti- bodies described in WO2006003179, as well as a humanized lgG4 variant of a murine anti- KIR antibody such as DF200, NKVSF1 , EB6, or GL183, with or without an S241 P mutation, can be similarly used in a formulation according to the invention.
- compositions comprising variant 1-7F9 antibody.
- compositions can be characterized as having less than about 15%, such as less than about 10% (e.g., about 5% or less, about 4% or less, about 3% or less, or even about 1 % or less) of lgG4 "half-antibodies" (comprising a single heavy chain/light chain pair).
- Such lgG4 "half-antibody” by-products form due to heterogeneity of inter-heavy chain disulphide bridges in the hinge region in a proportion of secreted human lgG4 (see Angal et ai, Molecular Immunology, 30(1): 105-108, 1993 for a description of lgG4 "half-antibodies", S241 P mutation, and related principles). This effect is typically only detectable under denaturing, non-reducing conditions. In the 1-7F9 variant, the S241 P mutation is capable of reducing the formation of such half-antibody products. Significant reduction in the formation of half-antibodies was observed by standard techniques.
- the invention provides a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody; (b) about 10-50 mM sodium phosphate; (c) about 160-250 mM sucrose or about 100 mM NaCI; and (d) polysorbate 80, at a pH of about 7.
- the antibody is typically a neutralizing anti-KIR antibody, and may also be cross-reactive.
- the antibody comprises a heavy chain sequence according to SEQ ID NO:3 or SEQ ID NO:1.
- the antibody further comprises a light chain sequence according to SEQ ID NO:2.
- the concentration of lgG4 antibody molecules in such a formulation may, for example, be in the range of about 1 to about 10 mg/ml, such as, e.g., about 10 mg/ml.
- the sodium phosphate varies from about 20 to about 50 mM, the sucrose from about 220 to about 250 mM, and the polysorbate may, for example, be about 0.001 %.
- the sodium phosphate concentration is about 20 mM and the sucrose concentration about 220 mM.
- the invention provides a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 anti- body molecule comprising a heavy chain comprising a variable region according to SEQ ID NO:3 and a light chain comprising a light chain variable region according to SEQ ID NO:2; (b) about 50 mM sodium phosphate; (c) about 250 mM sucrose; and (d) about 0.001 % polysorbate 80, at a pH of about 7.
- the heavy chain comprises the sequence of SEQ ID NO:1.
- the invention provides a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody molecule comprising a heavy chain comprising a heavy chain variable region according to SEQ ID NO:3 and a light chain comprising a light chain variable region according to SEQ ID NO:2; (b) about 50 mM sodium phosphate; (c) about 250 mM sucrose or about 100 mM sodium chloride; and (d) about 0.001 % polysorbate 80, wherein the formulation has a pH of about 7.
- the antibody is 1-F79 with an S241 P mutation.
- the invention provides a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody molecule comprising a heavy chain comprising a variable region according to SEQ ID NO:3 and a light chain comprising a light chain variable region according to SEQ ID NO:2; (b) about 20 mM sodium phosphate; (c) about 220 mM sucrose; and (d) about 0.001 % polysorbate 80, at a pH of about 7.
- the heavy chain comprises the sequence of SEQ ID NO:1.
- the invention provides a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody molecule comprising a heavy chain comprising a heavy chain variable region according to SEQ ID NO:3 and a light chain comprising a light chain variable region according to SEQ ID NO:2; (b) about 20 mM sodium phosphate; (c) about 220 mM sucrose or about 100 mM sodium chloride; and (d) about 0.001 % polysorbate 80, wherein the formulation has a pH of about 7.
- the antibody is 1-F79 with an S241 P mutation.
- the invention provides a pharmaceutically acceptable and active formulation prepared from a mixture of ingredients comprising (a) an amount of an lgG4 antibody molecule comprising a heavy chain comprising a heavy chain variable region according to SEQ ID NO:3 and a light chain comprising a light chain variable region according to SEQ ID NO:2 such that the concentration of antibody in the formulation is about 10 mg/mL; (b) about 8.4 mg/mL sodium phosphate dibasic (heptahydrate); (c) about 2.6 mg/mL sodium phosphate monobasic; (d) about 85 mg/mL sucrose; and (e) about 0.01 mg/mL polysorbate 80, wherein the formulation has a pH of about 7.
- the antibody com- prises a heavy chain according to SEQ ID NO:1.
- the antibody is 1-F79.
- the invention provides a method for preparing a formulation suitable for injection to a patient from a concentrated formulation having the characteristics described above, comprising providing a concentrated formulation that is stored at a temperature of from about 5 °C, diluting the concentrated formulation with a formulation compris- ing components (b)-(d) of the formulation to produce a diluted (injection/infusion-ready) prod- uct, and optionally storing the diluted product at a temperature of from about 5 °C for up to about 24 hours before administration.
- the invention provides pharmaceutically acceptable and active formulations comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody molecule comprising a heavy chain comprising a heavy chain variable region according to SEQ ID NO:3 and a light chain comprising a light chain variable region according to SEQ ID NO:2; (b) about 5-20 mM sodium phosphate (e.g., about 5 mM sodium phosphate, about 10 mM sodium phosphate, about 15 mM sodium phosphate, or about 20 mM sodium phosphate); (c) about 180 to about 250 mM sucrose (e.g., about 180-240 mM, such as about 190- 230 mM, such as about 200-225 mM, such as about 220 mM); and (d) about 0.001 or about 0.01-0.1 % polysorbate 80 (such as about 0.02-01.%, 0.03-0.1 %, 0.05-0.09%, 0.05-0.0
- the formulation comprises less than about 35 mM (e.g., less than about 25 mM) sodium phosphate. Lower sodium phosphate concentrations can be particularly desirable where long term frozen storage of the formulation is desired. In another aspect, the formulation comprises more than about
- the antibody contained in such a formulation is 1-F79.
- the antibody in such a formulation has a heavy chain that consists or consists essentially of SEQ ID NO:1.
- the antibody is another lgG4 antibody, such as another anti-KIR lgG4 antibody, or such as another anti-KIR antibody cross-reacting with at least KIR2DL1 and KIR2DL2/3.
- the formulation can be characterized as being isotonic.
- the invention provides a method for preparing a formulation suitable for injection to a patient from a concentrated formulation having the characteristics of the formulation according to the preceding paragraph, comprising providing a concentrated formulation that is stored at a temperature of from about 5 °C, diluting the concentrated formulation with either a formulation comprising components (b)-(d) of the formulation or a sterile isotonic saline solution to produce a diluted (injection/infusion-ready) product, and optionally storing the diluted product at a temperature of from about 5 °C for up to about 24 hours before administration.
- the method may include diluting such a formulation in a diluent prepared from mixing ingredients comprising about 5 g/L sodium phosphate dibasic (dihydrate), about 3 g/L sodium phosphate monobasic (monohydrate), about 85 g of sucrose, about 0.01 g of polysorbate 80 (Tween 80), which is pH adjusted with sodium hydroxide/hydrogen chloride and set to the desired volume by addition of sterile water for injection.
- the invention provides a formulation comprising sodium chloride as a tonicity modifier, typically in place of sucrose in the above-described formulations.
- the concentration of sodium chloride will be about 20 mM to about 300 mM, and more typically about 50 mM to about 200 mM, such as about 75 mM to about 175 mM (e.g., about 90-160 mM, about 100-150 mM).
- such a formulation comprises sodium chloride in a concentration of about 100 mM.
- the invention provides a formulation in which a
- Tris (base) buffer is incorporated in the formulation, typically in place of sodium phosphate. Any suitable concentration of Tris (base) can be used. A concentration of about 10-100 mM, such as about 15-80 mM, 20-75 mM, or 10-60 mM, or more particularly such as about 25 mM, is typical. A formulation according to any of the aspects of the invention can have any suitable concentration of the antibody. Typically, the concentration is about 0.05 mg/mL to about 10 mg/mL (e.g., about 1 mg/mL to about 5 mg/mL).
- the formulation is provided as a relatively concentrated antibody formulation, which may be, e.g., a formulation that is to be diluted prior to administration (typically by intravenous administration or direct parenteral injection) having a concentration of about 10 mg/mL.
- the formulation is provided as a relatively dilute formulation, such as a formulation that is infusion/injection-ready, wherein the concentration of the antibody in the formulation is about 0.05 mg/mL or about 0.1 mg/mL.
- the formulation has an antibody concentration of about 1 mg/mL.
- a unit dose container of a formulation according to the invention can be provided in any suitable volume.
- a formulation is provided in a volume of about 1 mL to about 20 mL, such as a volume of about 3 mL to about 15 mL. Commonly, the formulation is in a volume of about 5 mL to about 10 mL (and often either in 5 mL or 10 mL).
- the container can be any suitable type of container.
- the container may have spare volume (e.g., the container may be a 6 mL vial containing 5 mL of the formulation). Not all of the volume of a unit dose container may be used in a particular therapeutic regimen.
- the volume typically selected to provide an amount that encompasses a typical range of dosages provided to patients without unnecessarily wasting drug product.
- An acceptably low level of antibody molecule precipitation in the context of this in- vention means that there is detectably (and preferably substantially, if not significantly) less precipitation in the formulation than would be obtained with an otherwise substantially identical formulation comprising other common pharmaceutical excipients, such as NaCI; a polox- amer surfactant, EDTA, HSA, HP-betaCD, polysorbate 80, and/or a combination of polysor- bate 80 and NaCI.
- Methods for assessing precipitates are known in the art and may include, e.g., visual inspection using standard techniques (exemplified herein).
- sucrose can provide a remarkably low level of precipitates in association with an anti-KIR antibody, such as 1-F79 or 1-F79v, as compared to other typical excipients, particularly at a pH of about 7 or of about 7.0 (as compared to a pH of 6.0 or less and, to a lesser extent, a pH of 7.4).
- an anti-KIR antibody such as 1-F79 or 1-F79v
- sucrose can provide advantageous tonicity to such a formulation.
- An acceptable level of antibody molecule stability in terms of maintenance of monomeric structure and secondary structural elements in the context of this invention means that the pH of the composition is maintained close enough to 7 to maintain mono- meric structure and secondary structural elements of the antibody molecule, as compared to the stability of the molecule at a pH of, e.g., 3 or 8.5.
- An acceptably low level of aggregation/precipitate formation means that the formulation contains a level of aggregation/precipitation obtained by the indicated amounts/concentrations of polysorbate 80 and sodium phosphate (in addition to sucrose). It has been determined that such formulations are associated with excellent stability and low levels of aggregation, as may be determined by, e.g., IEF, GP HPLC, and SDS PAGE analysis of the composition, for extended periods (e.g., up to about 1 month, about 2 months, about 3 months, or longer) at various temperatures (e.g., about -20 °C to about 40 °C, such as about 5 °C (e.g., 2-8 °C) to about 20 °C), while also exhibiting less precipitate than his- tidine and tris formulations.
- IEF IEF
- GP HPLC GP HPLC
- SDS PAGE analysis of the composition, for extended periods (e.g., up to about 1 month, about 2 months, about 3 months, or
- a formulation according to any of the aspects of the invention desirably comprises at least one, if not two, or all three of these characteristics.
- the pH of the formulation is an important factor. A limited amount of variation in a particular pH range may be acceptable (depending on the desired stability characteristics and planned storage time and variables for the formulation).
- a pH of at least about 6 and less than about 8 (and more generally less than about 7.7, 7.6, or 7.5) is used (e.g., in a range of 6-7.4, such as 6-7.2, such as 6-7, 6.2- 7, 6.4-7, 6.5-7, 6.7-7, etc.).
- Formulations with a pH in the range of 7-7.4, such as formulations having a pH of about 7, also have been shown to have adequate or sometimes advan- tageous properties.
- a formulation according to any of the aspects described herein can also be characterized on the basis of the lack of high molecular weight impurities (e.g., impurities that suggest aggregation (multimers) of antibody molecules in the formulation).
- a formulation according to the invention can be characterized as having a high mo- lecular weight (HMW) impurity content of less than about 10% (such as about 5% or less) for at least one day, such as at least about one week, such as at least about 2 weeks, at least about 1 month, at least about 2 months, or even at least about 3 months of storage at about 5 °C.
- HMW high mo- lecular weight
- formulations according to any of the aspects described herein can advantageously be applied in any of the dosage regimens provided herein in a method of potentiating NK cell activity in a patient in need thereof.
- a formulation according to any of the aspects of this invention can be injected or infused at any suitable volume.
- a solution of about 0.3- 30 ml. of a diluted (either with, e.g., isotonic sterile saline solution or "placebo" formulation/diluent (i.e., formulation lacking any of the antibody or other active agents)) or undiluted final formulation is injected, usually through a 1 ml. - 30 ml. syringe (e.g., using a syringe pump), over a period of about 1 hour, in an administration protocol.
- the volume will, of course, vary with the desired dosage, as exemplified by the following exemplary dosage regimen chart, where, in a specific embodiment, the anti-KIR antibody is Anti-KIR(1-7F9) with or without S241 P mutation:
- the invention provides a method of potentiating NK cell activity in a patient in need thereof comprising administering to the patient a composition comprising an anti-KIR antibody in a dosage of about 0.0003 mg (antibody)/kg (patient weight) to about 3 mg/kg (e.g., about 0.003 mg/kg to about 3 mg/kg, such as about 0.015 to about 3 mg/kg, e.g., any of about 0.075 mg to about 3 mg/kg, about 0.3 mg/kg to about 3 mg/kg, and about 1 mg/kg to about 3 mg/kg, or any of about 0.0003 mg/kg, about 0.003 mg/kg, about 0.015 mg/kg, about 0.075 mg/kg, about 0.3 mg/kg, about 1 mg/kg, and about 3 mg/kg).
- a composition comprising an anti-KIR antibody in a dosage of about 0.0003 mg (antibody)/kg (patient weight) to about 3 mg/kg (e.g., about 0.003 mg/kg to about
- the composition is an antibody formulation described in any of the preceding sec- tions.
- the method comprises repeating the administration at least once, for example with a dosing frequency in the range of 3 times per day to once per 2 months.
- the dose may also be administered, e.g., at least 3 times, at least 6 times, or at least 10 times.
- the antibody is administered intravenously.
- binding of the antibody to an inhibitory KIR on the surface of an NK cell potentiates the cytotoxic activity of the NK cell.
- the antibody is a cross-reactive anti-KIR antibody.
- the antibody may comprise the variable heavy (SEQ ID NO:3) and variable light (SEQ ID NO:2) region sequences of antibody 1-7F9. Additionally or alternatively, the antibody may comprise a heavy chain comprising the sequence of SEQ ID NO:1.
- the patient has increased CD107a levels on NK cells in blood at about 24hrs after the first dose.
- the dosage range was obtained by pharmacokinetic and pharmacodynamic (PK/PD) modelling, using cross-reactive and neutralizing anti-KIR antibody 1-7F9 as an example, as described herein.
- Human PK was predicted by assessing typical PK for human IgG molecules, the estimated PK obtained from monkey studies of 1-7F9, and allometric scaling between mouse and monkey.
- the dose also was selected to provide a detectable saturation (>20%), though not necessarily saturation (95% ⁇ ) in human patients (0.0003 mg/kg, given i.v., is, for example, predicted to result in a transient saturation of up to 50% of the maximum and to be associated with a maximum plasma concentration (C max ) of about 0.006 ⁇ g/mL.
- C max maximum plasma concentration
- the method typically includes assessing the patient for such NK cell potentiation and/or anti-tumor activity (which may be performed by use of any suitable technique, several of which being known in the art, including, e.g., KIR occupancy level, CD107a marker, etc., as described herein).
- the formulation is typically administered by i.v. administration over a suitable period of time, such as about 1 hour.
- the invention provides a method of treating a disease, condition, or disorder associated with inhibition by KIR2DL1 , -2 and -3 and/or 2DS1 and -2 in a patient (subject) comprising administering to the patient a composition comprising an anti-KIR anti- body according to any of the dose-dosage regimens described in Table 1 so as to treat the disease, condition, or disorder.
- the composition is any one of the above- described compositions or formulations.
- treatment herein refers to the delivery of an effective amount of such a formulation with the purpose of preventing any symptoms or disease state to develop or with the purpose of easing, ameliorating, or eradicating (curing) such symptoms or disease states already developed.
- the term "treatment” is thus meant to include prophylactic treatment.
- therapeutic regimens and prophylactic regimens of the invention also can be considered separate and independent aspects of this invention.
- the term is used herein it is to be understood as also providing support for such separate prophylactic and palliative/curative applications.
- the invention provides a method of treating cancer or a viral disease in a patient, comprising administering an anti-KIR antibody at a dose and a dosing frequency achieving at least about 90%, preferably at least about 95% KIR occupancy on NK cells in plasma for at least about three months.
- the dose is in the range from about 0.0003 to about 3 mg/kg; from about 0.003 to about 3 mg/kg; from about 0.015 to about 3 mg/kg; from about 0.075 to about 3 mg/kg; from about 0.075 to about 3 mg/kg; from about 0.3 to about 3 mg/kg, and from about 1 to about 3 mg/kg.
- Exemplary doses are about 0.0003, about 0.003, about 0.015, about 0.075, about 0.3, about 1 , and about 3 mg/kg.
- the dosing frequency may be in the range of once per day to once per 2 months, from about once per week to about once per 2 months; or about once per month.
- the dos- ing frequency can be selected from about three times, about twice, and about once per day; about five times, about four times, about three times, and about twice per week; and about once every two, four, and six weeks.
- a dose of from about 0.075 to about 0.3 mg/kg is administered from about 2 times per week to about once per month; a dose of from about 0.3 to about 1 mg/kg is administered from about once to about twice per month; a dose of from about 1 to about 3 mg/kg is administered from about once per month to about once per 2 months.
- the dose and dosing frequency can be selected for those in Table 1.
- the dose can be, e.g., administered at least 3 times, at least 6 times, or more.
- the method may comprise administering an anti-KIR antibody at a dose and a dosing frequency achieving at least about 95% KIR occupancy on NK cells for at least about six months.
- the antibody is typically administered intravenously, but other suitable administration modes are known, and also described in, e.g., WO2006003179.
- the antibody is preferably a neutralizing and/or a cross-reactive anti-KIR antibody, such as, e.g., Anti- KIR(1-7F9) or its S241 P variant.
- the patient to be treated by the above-described method is a patient diagnosed with cancer.
- the patient is a patient diagnosed with acute myeloid leukaemia (AML).
- the patient is a patient diagnosed with chronic myeloid leukaemia (CML).
- the patient is a patient diagnosed with multiple myeloma (MMy).
- the patient is a patient diagnosed with non-Hodgkin's lymphoma (NHL).
- the patient to be treated by the practice of the above-described method is a patient diagnosed with colorectal cancer.
- the patient to be treated by the practice of the method is a patient diagnosed with renal cancer.
- the patient is a patient diagnosed with ovarian cancer.
- the patient is a patient diagnosed with lung cancer.
- the patient is a patient diagnosed with breast cancer.
- the patient is a patient diagnosed with malignant melanoma.
- the patient to be treated by the above- described method is a patient diagnosed with an infectious disease, such as a viral infection (e.g., an infection with HIV or Hepatitis C).
- the effect of the therapy on the patient may be followed by assessing the levels of NK cell activation markers or tumor markers in a biological sample taken from the patient, such as blood, plasma, urine, or the like.
- a biological sample taken from the patient such as blood, plasma, urine, or the like.
- most patients has increased CD107a levels on NK cells in a blood sample taken 24hrs after the first dose of 1-7F9, even though very low doses were administered. Notably, this increase of CD107a could not be detected on T cells.
- Particular tumor markers selected for the clinical studies described herein and useful to monitor treatment include, e.g., Wilms' tumor gene 1 transcript in blood and/or bone marrow in AML patients, and the levels of M-protein in urine.
- NK-cells in anti-tumor activity towards various other cancers, a decrease in the level of other tumor markers, including CEA in colorectal cancer, AFP and HCG in germ cell tumors, HCG in trophoblastic tumor, CA-125 in ovarian cancer, CA 15-3, CA 27.29, and oestrogen receptors in breast cancer, PSA in prostate cancer, CD5+/CD23+ cells in chronic lymphocytic leukemia, as well as cytogenetic markers in leukemia's and lymphomas is expected in malignancies susceptible to anti-KIR treatment.
- other tumor markers including CEA in colorectal cancer, AFP and HCG in germ cell tumors, HCG in trophoblastic tumor, CA-125 in ovarian cancer, CA 15-3, CA 27.29, and oestrogen receptors in breast cancer, PSA in prostate cancer, CD5+/CD23+ cells in chronic lymphocytic leukemia, as well as cytogenetic markers in leukemia's and lymph
- the efficacy of anti-KIR therapy of malignant diseases can be assessed by standard end-points like cancer-free survival, overall survival, and/or event-free survival (see, e.g., Brune et al. (Blood. 2006; 108:88-96), for description of a Phase III trial in AML patients).
- Anti-KIR(1-7F9) or its S241 P variant is a preferred antibody for modulating NK cell activity and/or treatment of cancer, viral diseases, or other suitable diseases
- other anti- KIR antibodies may also be used in the methods and dose-dosage regimens according to the invention.
- Anti-KIR(1-7F9) should, however, have similar Kd values, similar clearance in a patient, and a similar volume of distribution, as Anti-KIR(1-7F9), where "simi- lar" means within about 50%, preferably within about 30% of the corresponding Anti-KIR(1- 7F9) parameter.
- Anti-KIR(1-7F9) has a high affinity Kd of about 4 ng/ml, and low affinity Kd of about 20 ng/ml for doses up to 0.015 mg/kg; a clearance of about 0.5 ml/h/kg, and a volume of distribution of about 115 ml/kg (see Example 1 1 ).
- An exemplary anti-KI R antibody useful in one or more methods of the invention has the following properties: (a) reduces or blocks the signalling of an inhibitory KIR on NK cells; (b) a high affinity Kd from about 2 to about 6 ng/ml; (c) a low affinity Kd from about 10 to about 30 ng/ml; (d) a clearance of from about 0.25 to about 0.75 ml/h/kg, (e) a volume of distribution of from about 50 ml/kg to about 175 ml/kg, and (f) optionally binds more than one KIR, e.g., at least all of KIR2DL1 , KIR2DL2, and KIR2DL3.
- any of the above-described methods can be further complemented by administering a secondary anti-cancer agent, such as those described in WO2006003179 (an immunomodulatory agent, a hormonal agent, a chemotherapeutic agent, an anti-angiogenic agent, an apoptotic agent, a second antibody that binds to an in- hibitory KIR, an anti-infective agent, a targeting agent, and an adjunct compound, such as, e.g., an anti-CD20 antibody).
- a secondary anti-cancer agent such as those described in WO2006003179 (an immunomodulatory agent, a hormonal agent, a chemotherapeutic agent, an anti-angiogenic agent, an apoptotic agent, a second antibody that binds to an in- hibitory KIR, an anti-infective agent, a targeting agent, and an adjunct compound, such as, e.g., an anti-CD20 antibody).
- the variant antibody of the invention also may be provided in an article of manufacture or "
- the invention further provides an isolated nucleic acid encoding the variant antibody, a method of producing the antibody by the expression of such a nucleic acid in an appropriate host cell (and recovering the antibody product therefrom by any suitable method), a host cell comprising such a nucleic acid, and a vector comprising such a nucleic acid.
- the biophysical properties and stability of human antibody 1-7F9 were studied as follows.
- the folding and secondary structure of the protein was studied by circular dichroism (CD) and the oligomerization and aggregation by dynamic light scattering (DLS).
- CD circular dichroism
- DLS dynamic light scattering
- CD measurements were performed at 25 °C with a protein concentration of 2.0 mg/ml on a Chirascan circular dichroism spectrometer (Applied Photo- physics) equipped with a peltier element for temperature control. 1-7F9 samples were in cylindrical quartz cells with 0.1 mm path length. Buffer scans were recorded and subtracted for each sample spectra. Dynamic light scattering (DLS). DLS was performed at 25 °C with a protein concentration of 2.0 mg/ml using a Dynapro 99 temperature controlled DLS instrument (Protein Solutions Inc.). Data analysis was performed using the Dynamics software supplied with the instrument.
- DLS Dynamic light scattering
- the CD measurements showed characteristics of an all beta structure and revealed that the samples formulated at pH 7.0 maintained their secondary structure throughout the accelerated study, although there was a slight drop in the signal for the sample containing only Polysorbate 80 as excipient. This might be due to a weak precipitation of the sample since the overall form of the spectra is unchanged. The sample containing sucrose showed no such decrease over time.
- the CD measurements of the samples formulated at pH 3.0 and 8.5 showed a strong change in spectral characteristics over time, probably as a result of unfolding or other conformational changes, which could lead to non-functional 1-7F9 protein. The changes were observed immediately and were most significant at pH 3.0.
- 1-7F9 maintained its physical properties and remained stable under stressed conditions (37 °C with shaking) at pH 7.0 with Polysorbate 80 and Sucrose as ex- cipients.
- a microformulation screen which tests 88 different conditions in 1 ⁇ l drops was performed on formulations containing anti-KIR human lgG4 antibody 1-F79.
- the conditions in the screen involved a pH range between 3-10 and the addition of several known excipients. All formulations where inspected visually for precipitation (assessing product clarity, color, and the presence of particles/fibers). For visual assessments, appearance was assessed independently by two operators against daylight (typically) or general laboratory lighting against black and white backgrounds.
- the results from the pH solubility study are presented in Figure 2 and the results of the precipitation analysis associated with the different excipients are shown in Figure 3.
- PAGE of reduced and non-reduced samples was performed using Novex pre-cast 4% and 20% (w/v) acrylamide gradient gels and electrophoresed at 125 V limiting conditions per gel until the dye front had migrated to within 1 cm of the bottom of the gel. Protein loadings of 4 ⁇ g for non-reducing conditions and 10 ⁇ g for reducing conditions were used. Gels were stained at room temperature using Coomassie Brillian Blue R250 strain. Novex MK12 molecular weight markers were included on each gel to cover a MW range of 6 kDa to 200 kDa. For reducing conditions, incubation was with sample buffer at pH 8.0 containing 2- mercaptoethanol.
- sample buffer at pH 7.1 without 2-mercaptoethanol.
- Reduced and non-reduced samples were prepared separately and analyzed on separate gels to prevent contamination. A single test was performed at each endpoint. The banding profile for each sample was analyzed visually for non-reduced and reduced samples and by laser densitometry for determination of the relative percentage purity for each band for reduced samples.
- the mean antibody protein concentration in the twelve formulations was 10.61 mg/mL and all samples had a protein concentration within 3% of this value.
- GP HPLC data indicated that at about 25 °C and about 40 °C, there was a marked decrease in monomer levels (indicating, e.g., aggregation/multimerization) and/or increase in fragment levels (indicating, e.g., proteolysis) for formulations containing acetate and citrate buffers at pH 5.5 compared with other formulations in the study over time.
- SDS PAGE results also indicated that at least most of the citrate and acetate formulations may be unsuitable for long term storage of an lgG4 anti-KIR antibody, particularly at higher temperatures, due to, i.a., higher levels of fragmentation compared to the other formulations.
- Lower pH formulations also were generally associated with greater levels of fragmentation (proteolysis).
- formulations to be subjected to freeze-thaw conditions also were assessed as part of this and other experiments.
- the formulations exhibited suitable freeze-thaw properties, but storage at sub-zero conditions for at least some of the formulations was considered less than optimal.
- Formulation F6 was deemed to be unsuitable for long-term storage at sub-zero temperatures due to freeze-thaw stress.
- an appropriate tonicity modifier such as sucrose and/or sodium chloride, can be important to storage at sub-zero conditions and/or for freeze-thaw of an antibody formulation.
- provision, storage, and handling of the formulation as a liquid at about 5 °C is recommended.
- S241 P variant was generated by applying site-directed mutagenesis, using a Quick-Change Mutagenesis kit (Stratagene), and the primers P1 : 5'- cccccatgcccaccatgcccagcacctgag (SEQ ID NO:4), and P2: 5'- ctcaggtgctgggcatggtgggcatggggg (SEQ ID NO:5). The mutation was confirmed by sequencing.
- HBS-EP buffer (10 mM HEPES, 15OmM NaCI, 3mM EDTA, 0.005% Polysorbat 20 (v/v)) was used as running buffer, and for all dilutions. Regeneration of the sensor chip was performed by a short pulse (15 ul, Flow 30 ul/min) of 10 mM glycin-HCI pH 1.8. The experiment was performed at flow rate 10 ul/min. at 25°C. Data was analyzed using Biaevaluation 4.1 software.
- the expressed AntiKir1-7F9 S241 P mutant was purified using Protein A and desal- teted into PBS Buffer ( Figure 4).
- eluted material from protein A is annotated as peak start (Retention ("R.") vol -14 ml.) and peak end (R. vol -12 ml.) and stored in a loop prior to injection at the desalting column. After desalting, fractions were collected and fractions annotated A2 and A3 were pooled and used for further analysis.
- FIG. 5 presents electropherograms and integration tables from analyses of Anti-KIR(1-7F9) expressed in hybridoma cells (left hand) panel and Anti-KIR(1-7F9) expressed in CHO K1 cells right hand panel.
- Table 8 reflects the amounts of half-antibody formation detected for both wild-type (WT) 1-F79 and S241 P Anti-KIR(1-F79) expressed in CHO K1 cells:
- heavy chain results in an anti-KIR lgG4 antibody product associated with significantly less "half antibody” by-products.
- Example 6 Prediction of human PK/PD of Anti-KIR(1-7F9) based on in vivo studies in KIR-transgenic mice This Example describes a pharmacokinetic (PK)/pharmacodynamic (PD) -based rationale for selection of the starting dose of Anti-KIR(1-7F9) in a human dose trial, predicting a dose which would result in detectable saturation (>20%), but not full saturation ( ⁇ 95%) of KIR-receptors in humans at the time of maximal saturation.
- PK pharmacokinetic
- PD pharmacodynamic
- a PK-model was developed to capture the PK-properties of Anti-KIR(1- 7F9) in wild-type and KIR-transgenic mice. Based on the PK-model, a PK/PD model was established for the relationship between KIR-occupancy and plasma concentration in KIR- transgenic mice. The PK-profile of Anti-KIR(1-7F9) in humans was then predicted and simulated, and a PK/PD-model for occupancy of KIR in humans devised by combining the mouse PK/PD model with the predicted human PK-profile.
- the PK/PD model in KIR-transgenic mice was based on data from a study where the relationship between saturation of KIR-receptors and plasma concentration in vivo was determined for a range of dose levels of Anti-KIR(1-7F9) administered i.v. as a single dose. A dose range of 0.0004 mg/kg to 4 mg/kg was used. Three different strains of mice were used. The wild-type B6 (C57BL/6) mouse does not express the KIR-receptor and was used as reference for assessing the magnitude of possible target-mediated clearance in two KIR-transgenic mouse strains.
- KIR-tgll A mouse strain expressing the human KIR2DL2 receptor on a subset of NK cells and T cells, similar to the pattern seen in humans, was designated KIR-transgenic Il (KIR-tgll).
- KIR-tgl A mouse strain expressing the human KIR2DL2 receptor on a subset of NK cells and T cells, similar to the pattern seen in humans, was designated KIR-transgenic Il (KIR-tgll).
- KIR-tgl KIR-transgenic I
- FACS fluorescence-activated cell sorting
- concentration of Anti-KIR(1-7F9) was determined at one time point before sacrifice as well as at the time for determining saturation using a validated ELISA method.
- Receptor occupancy was measured by FACS, using both a directly conjugated Anti-KIR(1- 7F9) to detect free KIR, and an anti-lgG4 antibody to measure bound Anti-KIR(1-7F9). In this manner, it was possible to follow the disappearance of free KIR with increasing doses of injected mAb, which was paralleled by an increasing amount of bound Anti-KIR(1-7F9).
- MFI median fluorescence intensity
- the PK and PD data were initially prepared as Excel files. Subsequently, the PK and PD data were combined and prepared for use by NON- MEM and NM-TRAN using S-PLUS.
- the final data file was used for the generation of the PK-model.
- the output from the PK-model with individual PK-estimates was used for the PD-model after excluding the irrelevant B6-mice data and adding simulation records for the purpose of simulating population means for each dose level in humans.
- PK-data BLQ-values were set to 0 and excluded from the model building, but the time point was kept in the data file for prediction of the plasma concentration using the PK-model.
- the plasma concentration in the 0.1 ⁇ g group in the KIR-tgll mice was considered an occasional outlier and was excluded during parameter estimation of the PK model.
- the group was included in the PK-PD model with predicted plasma concentrations.
- PK-models in mouse strains were developed: 1 ) For wild-type B6 only, 2) for B6 and KIR-tgll mice in combination, and 3) for KIR-tgl mice. Analysis of wild-type B6. From the analysis of PK data from wild type B6, it was found that non-linearities were needed to explain the difference between the high and the low dosing groups.
- the chosen model used a special case of Mager & Jusko's target mediated drug disposition (TMDD) model (Mager and Jusko, J Pharmacokinet Pharmacodyn 2001 ; 28(6):507-532) in which only the volume of distribution is non-linear, not the clearance (see the schematic representation in Figure 6).
- TMDD Mager & Jusko's target mediated drug disposition
- a two compartment Michaelis Men- ten model i.e. with saturable clearance, could describe the PK profiles, thus making it impossible to be conclusive regarding the underlying physiological mechanism of the observed non-linearities in the PK-data.
- the TMDD model was adopted as the final model. Joint analysis of B6 and KIR-tgll mice. For the joint analysis of wild-type B6 and KIR-tgll mice, the TMDD model was again found to be the preferable model to explain the observed non-linearities in data.
- KIR-tgl transgenic mice Analysis of KIR-tgl transgenic mice.
- the pharmacokinetics of KIR-tgl transgenic mice were found to be significantly different from the two other strains. The non-linearity was much larger, and the data were not compatible with the TMDD model, whereas a Michaelis- Menten model for saturable elimination was successful.
- Mean predicted PK profiles are compared to mean observed values for KIR-TGI transgenic mice in Figure 9.
- PK parameters for human IgG A wealth of information exists in the literature on PK of endogenous IgG's as well as monoclonal antibodies. A literature survey was conducted to identify typical values for the parameters (CL, V1 , V2 and Q) defining the 2-compartment model for an IgG in humans. The PK parameters should be consistent with the general PK-features of a human IgG in humans.
- the initial central volume is approximately the plasma volume, i.e., 3 litres
- the distri- bution volume is similar to or slightly larger than the central volume and an average terminal half-life is 20-23 days (Ghetie and Ward, Immunol Res 2002;25:97-91 13; Morell et al., J Clin Invest 1970;49:673-80; Roskos et al., Drug Dev Res 2004;61 : 108-20; Lobo et al., J Pharm Sci 2004;93:2645-68).
- V 2 (peripheral volume) 40 ml/kg
- the parameter supported with least data is the inter-compartmental clearance, Q, for which it was necessary to use data from humanized and human antibodies with and with- out target mediated clearance.
- Q was calculated as V 1 x k 12 (rate constant for transfer between compartments 1 and 2).
- An inter-compartment clearance of 1 ml/h/kg and a central volume of 40 ml/kg are consistent with a distribution phase of 1-3 days, which is often observed for mAbs.
- Anti-KIR(1-7F9) is an lgG4, but the PK parameters are expected to be similar to IgGI and -2 as assessed by comparison of endogenous IgG-subclasses (Morell et al., J Clin Invest 1970;49:673-80).
- Anti-KIR(1-7F9) is thus predicted to display PK-properties much like e.g. CP-675206, adalimumab, tefibazumab, pertuzumab and ABX-IL8 in humans.
- the NCA and population PK-model consistently show that the clearance of Anti-KIR(1-7F9) is somewhat higher (2-3 fold) compared to clearance reported for other human antibodies in monkeys.
- the terminal half-life (VA) was 8-11 days which is in accordance with expectations for a human antibody administered to monkeys (Halpern et al., Toxicol Sci 2006; 91 (2):586- 599; Gobburu et ai, J Pharmacol Exp Ther 1998; 286(2):925-930).
- the exposure was observed to be dose-proportional and no indication of saturation mechanisms important for the clearance was observed.
- monkey PK parameters may be directly transferable to humans, this should be done with caution as species differences in e.g. FcRn affinity may cause species differences in clearance (Lobo et al., J Pharm Sci 2004;93:2645- 68).
- MFI median fluorescence intensity
- MFI free control MFI associated with free receptors (PBMC)
- MFI max bound control by incubating with 1-7F9, the max MFI associated with receptors bound to 1 -7F9 (PBMC)
- MFI bound back g r The background MFI when assessing bound receptors MFI for treated animals at screening MFI free screen : MFI associated with free receptors (PBMC) (only assessed for some animals)
- MFI for treated animals at the experimental time point MFI free : MFI associated with free receptors (PBMC)
- MFI bound MFI associated with bound receptors (PBMC)
- MFI bound s pi een MFI associated with bound receptors (cells from spleen) (only assessed for some animals)
- MFI max bound s pi een MFI associated with bound receptors (cells from spleen) (only assessed for some animals)
- M 1 ⁇ F- 1 I -"-bound norm - M 1 ⁇ F "1 T A free norm which was the chosen method for the PK/PD-model.
- additional samples were taken to evaluate the MFI- max. bound. spleen and MFI. bound. spleen, making it possible to use the animals own max level to normalize.
- MFI. bound. norm. owncontrol to calculate % bound receptors. This approach was found to provide good agreement, except for the 15min samples. This difference is considered likely to be due to the difference be- tween PBMC and spleen cells, because anti-KIR(1-7F9) reaches the spleen later than it reaches the blood.
- a PK/PD-model was developed for describing the relationship between the plasma concentration of Anti-KIR(1-7F9) and the percentage receptor saturation in KIR-tgll mice. As the saturation was not in equilibrium with the plasma concentration at all time points, it was necessary to use a dynamic binding equation, linking the on- and off- rates (k on and k off ) at the receptor to the change in plasma concentration Cp with time.
- PK/PD model was implemented by basically exchanging the mouse PK parameters in the NONMEM input file with the human PK parameters described in Table 12, while keeping the PD-structure of the input (Table 13). A range of doses and time points up to 13 weeks were simulated by means of this mode. In the simulations, only population means of the structural parameters have been considered, i.e. no inter-individual or intra-individual variation of PK or PD parameters were included. In vitro binding curves of various cell types from KIR-tgll mice and humans is shown in Figure 1 1. These results support that the relationship between plasma concentration and saturation will be comparable in wVo for humans and KIR-transgenic mice. Thus, although the time course of plasma concentrations in humans will be different from that in mice, the PK/PD-model can be used to predict the saturation for a given plasma concentration in humans and at a given time point after dosage.
- a dose predicted to cause detectable plasma concentrations of Anti-KIR(1-7F9) in humans as well as measurable but not full saturation was identified as 0.0003 mg/kg and suggested as the starting dose in the FHD trial.
- a simulation model has thus been developed to predict the relationship between dose of Anti-KIR(1-7F9), the resulting plasma concentration profile and the KIR-receptor occupancy in humans.
- This model was constructed by combining a typical PK model for IgG's in humans with a model for the relationship between plasma concentration and KIR-receptor occupancy.
- the latter model was developed using data from a KIR-tgll mouse study. Cautious principles were used during model development, aiming at predicting the maximal potential occupancy. Based on this model, it was predicted that a dose of 0.0003 mg/kg is likely to produce a detectable (>20%), but not full saturation ( ⁇ 95%) in humans. This dose is expected to result in up to approximately 60% KIR occupancy at Cmax.
- Example 7 -Clinical AML study A single dose escalation trial is conducted in elderly AML patients (>60 years), who are in first complete remission following induction and consolidation chemotherapy, and not eligible for bone-marrow transplantation. A standard 3+3 design is applied, and a total of 7 dose levels are planned to be explored: Doses range from 0.0003 mg/kg to 3 mg/kg. Following dosing, the patients are monitored for safety, PK and KIR occupancy until KIR occupancy is no longer detectable.
- An extension trial is also conducted.
- AML patients who have completed the dose- escalation trial and who are still in complete remission can participate in the extension trial, in which the patients can be dosed up to 6 times on a monthly basis.
- the patients are dosed with the same dose as they received in the previous trial.
- Patients, materials and methods are also conducted.
- the dose-escalation trial is a multi-centre, open-label, single dose-escalation safety and tolerability trial. Seven dose levels are planned to be explored; 0.0003 mg/kg, 0.003 mg/kg, 0.015 mg/kg, 0.075 mg/kg, 0.3 mg/kg, 1 mg/kg and 3 mg/kg. A general (3+3) design is chosen for this trial.
- Each patient is allocated to one dose, and is monitored for safety, pharmacokinetics and pharmacodynamics until there is no detectable KIR-occupancy on the patients NK-cells.
- Safety, PK and KIR-occupancy are analysed on an on-going basis, and the data obtained during the first 4 weeks post dosing from each dose group generally forms the foundation of the dose-escalation decision.
- the extension trial is designed as a repeated dosing, multi-centre, open-label, safety and tolerability.
- the dose given to the individual patient is the same as the patient received in the single dose trial.
- the patient can receive 6 administrations at 4 week interval i.e. 6 dosing cycles with a maximal to duration of 6 months.
- Each dosing cycle consists of a dosing visit and a safety monitoring visit. Following the last dosing, the patient is monitored for safety until there is no detectable KIR-occupancy on the patients NK-cells. The duration of this safety follow-up period likely depends on the dose received, and is expected to be maximally 24 weeks post the last dosing.
- Anti-KIR(1- 7F9) was well tolerated at the doses tested so far (0.0003 mg/kg, 0.003 mg/kg, 0.015 mg/kg).
- the SAEs reported in the trials so far have all been deemed to be unrelated or unlikely re- lated to trial drug.
- Mild skin reactions (dorsal erythema, pruritus and cutaneous rash) of se- verity grade 1 occurring post dosing have been reported in 3 patients. These reactions were evaluated as non-serious and possibly related to trial drug, and the patients mostly recovered within a few days.
- Example 8 Clinical multiple myeloma study A dose escalation trial is also conducted in patients with relapsed or refractory multiple myeloma (MMy), in which patients can be dosed 4 times on a monthly basis (i.e., a dosing interval of about 4 weeks). Eligible patients are 18 years or older.
- MMy relapsed or refractory multiple myeloma
- Doses range from 0.0003 mg/kg to 3 mg/kg (0.0003 mg/kg, 0.003 mg/kg, 0.015 mg/kg, 0.075 mg/kg, 0.3 mg/kg, 1.0 mg/kg and 3.0 mg/kg). Following dosing, the patients are monitored for safety, PK and KIR occupancy until KIR occupancy is no longer detectable.
- Plasma concentrations of anti-KIR (1-7F9) are determined by ELISA as briefly de- scribed below.
- the plates are coated with KIR2DL3 coating solution (100 ⁇ l/well) and incubated overnight at about +4°C. The plates are then washed 3 times with wash buffer using an automated plate washer (400 ⁇ l/well). Blocking buffer is added (200 ⁇ l per well) and plates are incubated for approximately 2 hours on a plate shaker at room temperature. After this, the plates are once again washed 3 times with wash buffer (400 ⁇ l/well).
- TMB is added to the plates (100 ⁇ l/well), which are then incubated for approximately 30 minutes on a plate shaker at room temperature. The enzymatic reaction is terminated with addition of stop solution (50 ⁇ l/well). Absorbances are read at 450 nm (reference filter 650 nm). The lower limit of quantification for this study is 5.000 ng/mL and the upper limit of quantification for this study is 1 10.0 ng/mL. Results So far, three dose levels of 0.0003, 0.003 and 0.015 mg/kg of anti-KIR mAb have been administered intravenously to nine AML patients in the dose-escalation trial, while 0.0003 mg/kg anti-KIR has been administered to four MMy patients.
- KIR2D receptor occupancy is evaluated on human whole blood samples by four-color fluorescence analysis. Briefly, free and bound KIR2D receptor levels are assessed on T and NK lymphocytes in EDTA anti-coagulated peripheral blood. Free site assay will assess unbound KIR2D by staining with PE -conjugated 1-7F9, which binds to the KIR2D molecule. Bound site assay will assess KIR2D receptors occupied by 1-7F9 by staining with a PE-conjugated mouse anti-human lgG4 monoclonal antibody that recognizes the 1-7F9 bound to the KIR2D receptors.
- the Free and Bound Assays will allow for assessment of both percentage positive staining as well as the fluorescence intensity [MESF] for 1-7F9-PE or anti-hlgG4-PE.
- the following combinations of conjugated antibodies are used in the follow- ing two assays:
- T cells are defined as CD45+CD3+ lymphocytes and NK cells are defined as CD45+CD3-CD56+ cells.
- Occupancy values below 0 were per definition set to 0. To account for day-to-day variability in the assay, the cut-off for significant KIR-occupancy was set to 30%.
- the available PK data were used for population modelling to generate a preliminary PK-model for 1-7F9 in humans, while the PK/PD relationship was based on the exploratory analysis.
- MODEL DEVELOPMENT NONMEM's first order conditional (FOCE) estimation method with interaction was used for model development. Evaluation of and discrimination between intermediate models were based on objective function values and standard graphical evaluation methods.
- FOCE first order conditional
- Structural models Standard one and two-compartment models were investigated. In addition, models including saturable clearance and/or distribution were tested.
- results Predictive value of the preclinical PK/PD model.
- the plasma concentration of 1-7F9 immediately (10 min.) after intravenous administration was accurately predicted with the PK- model using generic human IgG parameters, cf. table 15.
- the maximal plasma concentration is primarily related to the size of the central volume, which is fairly well-defined for human beings, so it is expected that this parameter would be the one which is predicted with great- est certainty.
- the kinetic processes (clearance, distribution) are at play and thus less certain predictions can be expected, as observed, cf. below.
- Table 15 Plasma concentration of 1-7F9 in humans 10 min. after i.v. administration of the doses listed. "Predicted” is the value predicted by the preclinical PK/PD model, "Observed” are actual mean (standard deviations) values from the clinical trials, n is the number of data points.
- Figure 13 depicting the KIR occupancy 2 hours post-dose vs. the plasma concentration of 1- 7F9.
- the preclinical PK/PD model predicted that the affinity would decrease over time. Although only based on few data points so far, such a trend was indeed observed for the occu- pancy data obtained from 24 hours post-dose and up to 6 weeks ( Figure 14).
- a tentative fit with a Kd of 20 ng/ml has been superimposed on the plot.
- the preclinical model predicted the Kd at 24h to be 9 ng/ml, also shown in the plot.
- V 2 (peripheral volume) 69 ml/kg
- Example 12 Dosing regimens based on updated PK/PD model.
- the PK parameters obtained as described in the previous Example were applied to determine the optimal dosing frequency for the Anti-KIR(1-7F9) dose levels to be used in the clinical trials.
- the dosing frequency in clinical therapy using 1-7F9 depends on the steady state plasma concentration needed for saturation as well as the clearance and volume of distribution of 1-7F9.
- the concentration needed to obtain >95% occupancy here termed SatConc
- SatConc concentration needed to obtain >95% occupancy
- Eq. 10 concentration needed to obtain >95% occupancy
- V d volume of distribution at steady state (V1 + V2 in table 17)
- D is the dose
- Cl clearance
- tau diosing interval
- $ SS is predicted steady state using the updated PK-model
- tau was rounded up the nearest value of whole days or weeks, as appropriate.
- the calculations are based on assumptions of dose-linear PK parameters.
- the dose giving KIR-saturating plasma levels may instead be found using simulations from a (population) PK/PD model including any observed non-linearities.
- NK- and T-cell mediated killing of tumor cells Upon NK- and T-cell mediated killing of tumor cells, the lysosomal-associated membrane protein-1 (LAMP-1 or CD107a) lining the membrane of cytolytic granules, is exposed on the NK- and T-cell surface (Betts et al., J Immunol Methods 2003;281 :65-78). In clinical trials, assessments of CD107a expression on NK-cells have been shown to be a feasible and reliable marker of NK-cell mediated killing of tumor cells (Koch et al, Ann Surg 2006; 244:986-92).
- LAMP-1 or CD107a lysosomal-associated membrane protein-1
- CD107a was assessed by flow cytometry. Blood samples were collected, red blood cells were lysed, and peripheral blood cells were washed and subsequently stained with antibodies against CD3, CD45, CD56, and CD107a. Data were acquired on a BD FACScanto with BD FACSDiva software.
- CD107a levels were increased on NK-cells 24-hours post-dosing ( Figure 15).
- MIP-1 ⁇ macrophage inflammatory protein-1 beta
- MIP-1 ⁇ macrophage inflammatory protein-1 beta
- WT-1 Wilms' tumour gene 1
- WT-1 levels were measured in bone marrow and in blood samples. WT-1 levels were assessed by a qRT-PCR assay (PQPP-01 ) from lpsogen according to the manufacturers instructions.
- PQPP-01 qRT-PCR assay
- M-protein monoclonal immunoglobulin
- urine M-protein was assessed by a gel electrophoresis assay (3398) from Helena Laboratories according to the manufactures instructions. Reduction of urine M- protein upon Anti-KIR dosing was observed in a total of 2 out of 4 evaluable patients.
- Table 23 Appearance. Scoring: 0 being worst; 1 indicating a formulation with possibly suitable properties for a pharmaceutical product; and 2 indicating a formulation of high quality, suitable for a pharmaceutical product.
- a formulation comprising 20 mM sodium phosphate, 22OmM sucrose, 0.001 % Polysorbate 80, at pH 7.0, however, had the advantage of having both a low phosphate content and correct osmolarity, in addition to excellent stability properties.
- ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling in the range that is within the same order of magnitude and same level of significance (i.e., all similarly significant figures) as the lower end point of the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein.
- a range of 1-100 herein provides support for each integer between (and including) 1-100 (i.e., 1 , 2, 3, 4, ...
- a range of 0.1-1 provides support for each value in the same order of magnitude and level of significance as 0.1 between and including these endpoints (/.e., 0.1 , 0.2, 0.3, ... 0.9, 1.0).
- a method of modulating NK cell activity in a patient in need thereof comprising administering to the patient an antibody that binds at least one human inhibitory KIR at a dose in the range from about 0.0003 to about 3 mg/kg. 2. The method of embodiment 1 , wherein the dose is in the range from about 0.075 to about 3 mg/kg.
- the antibody comprises the variable heavy (SEQ ID NO:3) and variable light (SEQ ID NO:2) region sequences of an- tibody 1-7F9. 14. The method of any of the preceding embodiments, wherein the antibody comprises a heavy chain comprising the sequence of SEQ ID NO:1.
- the following embodiments relate to methods of treating cancer in a patient, and related articles:
- a method of treating cancer in a patient comprising administering an anti-KIR antibody at a dose and a dosing frequency achieving at least about 95% KIR occupancy on NK cells in blood for at least about three months.
- the dosing frequency is about once per month.
- the dosing frequency is selected from about three times, about twice, and about once per day; about five times, about four times, about three times, and about twice per week; and about once every two, four, and six weeks.
- 9. The method of embodiment 1 wherein a dose of from about 0.075 to about 0.3 mg/kg is administered from about 2 times per week to about once per month.
- 10. The method of embodiment 1 wherein a dose of from about 0.3 to about 1 mg/kg is administered from about once to about twice per month.
- the cancer is acute myeloid leukaemia (AML), chronic myeloid leukaemia (CML), multiple myeloma (MMy), non- Hodgkin's lymphoma (NHL), colorectal cancer, renal cancer, ovarian cancer, lung cancer, breast cancer, or malignant melanoma.
- AML acute myeloid leukaemia
- CML chronic myeloid leukaemia
- MMy multiple myeloma
- NHL non- Hodgkin's lymphoma
- colorectal cancer renal cancer, ovarian cancer, lung cancer, breast cancer, or malignant melanoma.
- variable heavy SEQ ID NO:3
- variable light SEQ ID NO:2
- CD107a levels on T cells in the blood sample.
- kits e.g., kits
- An article of manufacture comprising:
- the article of embodiment 1 wherein the dose is from about 0.075 to about 0.3 mg/kg and the dosing frequency is from about 2 times per week to about once per month. 3. The article of embodiment 1 , wherein the dose is from about 0.3 to about 1 mg/kg and the dosing frequency is from about 1 to about 2 times per month.
- the second medicament is a an immunomodulatory agent, a hormonal agent, a chemotherapeutic agent, an anti-angiogenic agent, an apop- totic agent, a second antibody that binds to an inhibitory KIR, an anti-infective agent, a targeting agent, and an anti-CD20 antibody.
- the following embodiments of the invention relate to pharmaceutical formulations of anti-KIR antibodies.
- a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody; (b) about 10-50 mM sodium phosphate; (c) about 160-250 mM sucrose or about 100 mM NaCI; and (d) polysorbate 80, at a pH of about 7. 2.
- the formulation of embodiment 1 wherein the antibody is a neutralizing anti-KIR antibody.
- a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody molecule comprising a heavy chain according to
- SEQ ID NO:1 and a light chain comprising a light chain variable region according to SEQ ID NO:2; (b) about 50 mM sodium phosphate; (c) about 250 mM sucrose; and (d) about 0.001 % polysorbate 80, at a pH of about 7.
- a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody molecule comprising a heavy chain comprising a heavy chain variable region according to SEQ ID NO:3 and a light chain comprising a light chain variable region according to SEQ ID NO:2; (b) about 50 mM sodium phosphate; (c) about 250 mM sucrose or about 100 mM sodium chloride; and (d) about 0.001 % polysorbate 80, wherein the formulation has a pH of about 7. 13.
- a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody molecule comprising a heavy chain according to SEQ ID NO:1 and a light chain comprising a light chain variable region according to SEQ ID NO:2; (b) about 20 mM sodium phosphate; (c) about 220 mM sucrose; and (d) about 0.001 % polysorbate 80, at a pH of about 7. 14.
- a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody molecule comprising a heavy chain comprising a heavy chain variable region according to SEQ ID NO:3 and a light chain comprising a light chain variable region according to SEQ ID NO:2; (b) about 20 mM sodium phos- phate; (c) about 220 mM sucrose or about 100 mM sodium chloride; and (d) about
- a pharmaceutically acceptable and active formulation prepared from a mixture of ingredients comprising (a) an amount of an lgG4 antibody molecule comprising a heavy chain comprising a heavy chain variable region according to SEQ ID NO:3 and a light chain comprising a light chain variable region according to SEQ ID NO:2 such that the concentration of antibody in the formulation is about 10 mg/mL; (b) about 8.4 mg/mL sodium phosphate dibasic (heptahydrate); (c) about 2.6 mg/mL sodium phosphate monobasic; (d) about 85 mg/mL sucrose; and (e) about 0.01 mg/mL polysorbate 80, wherein the formulation has a pH of about 7. 19.
- a pharmaceutically acceptable and active formulation comprising (a) about 0.05 mg/mL to about 10 mg/mL of an lgG4 antibody molecule comprising a heavy chain comprising a heavy chain variable region according to SEQ ID NO:3 and a light chain comprising a light chain variable region according to SEQ ID NO:2; (b) about 5-20 mM sodium phosphate; (c) about 180 to about 250 mM sucrose; and (d) about 0.001-0.1 % polysorbate 80, wherein the formulation has a pH of about 7.
- a method of preparing a pharmaceutically acceptable formulation for human administration by intravenous injection comprising storing a concentrated formulation according to any one of embodiments 1-20 at a temperature of from about 5 °C and diluting the concentrated formulation in a solution comprising components (b)-(d) of embodiment 1 (but lacking any antibody) to produce an administration-ready (diluted) product, and storing the administration-ready product at a temperature of from about 5 °C for up to about 24 hours before administration.
- a method of preparing a pharmaceutically acceptable formulation for human administration by intravenous injection comprising storing a concentrated formulation according to any one of embodiments 21-31 at a temperature of from about 5 °C and diluting the concentrated formulation in a sterile isotonic saline solution to produce an administration- ready (diluted) product, and storing the administration-ready product at a temperature of from about 5 °C for up to about 24 hours before administration.
- a pharmaceutical product comprising a storage container comprising a formulation ac- cording to any one of embodiments 1-22 in a volume of about 3 mL to about 30 mL. 37.
- a pharmaceutical product comprising a storage container comprising a formulation according to any one of embodiments 23-31 in a volume of about 3 ml. to about 30 ml_. 39.
- a method of potentiating NK cell activity in a patient in need thereof comprising administering to the patient a formulation according to any one of embodiments 1-31 in an antibody dosage of about 0.0003 mg/kg (patient weight) to about 3 mg/kg. 41. The method of embodiment 40, wherein the dosage is about 0.001 mg/kg to about 3 mg/kg.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biomedical Technology (AREA)
- Endocrinology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Oncology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Medicinal Preparation (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12/521,105 US20100189723A1 (en) | 2007-01-11 | 2008-01-11 | Anti-kir antibodies, formulations, and uses thereof |
| CA2675291A CA2675291C (en) | 2007-01-11 | 2008-01-11 | Killer ig-like receptor (kir) antibodies, formulations, and uses thereof |
| ES08707869.7T ES2579768T3 (es) | 2007-01-11 | 2008-01-11 | Anticuerpos anti-KIR, formulaciones y usos de los mismos |
| CN200880002001.2A CN101578113B (zh) | 2007-01-11 | 2008-01-11 | 抗-kir抗体、制剂及其应用 |
| JP2009545192A JP5478261B2 (ja) | 2007-01-11 | 2008-01-11 | 抗kir抗体、製剤、およびその使用 |
| AU2008204433A AU2008204433B2 (en) | 2007-01-11 | 2008-01-11 | Anti-KIR antibodies, formulations, and uses thereof |
| EP08707869.7A EP2109460B1 (en) | 2007-01-11 | 2008-01-11 | Anti-kir antibodies, formulations, and uses thereof |
| US14/606,814 US9879082B2 (en) | 2007-01-11 | 2015-01-27 | Anti-KIR antibodies, formulations, and uses thereof |
| US15/849,128 US10815299B2 (en) | 2007-01-11 | 2017-12-20 | Anti-KIR antibodies, formulations, and uses thereof |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US87996407P | 2007-01-11 | 2007-01-11 | |
| US60/879,964 | 2007-01-11 | ||
| US91152707P | 2007-04-13 | 2007-04-13 | |
| US60/911,527 | 2007-04-13 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/521,105 A-371-Of-International US20100189723A1 (en) | 2007-01-11 | 2008-01-11 | Anti-kir antibodies, formulations, and uses thereof |
| US14/606,814 Continuation US9879082B2 (en) | 2007-01-11 | 2015-01-27 | Anti-KIR antibodies, formulations, and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008084106A1 true WO2008084106A1 (en) | 2008-07-17 |
| WO2008084106A9 WO2008084106A9 (en) | 2009-09-17 |
Family
ID=39144327
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2008/050306 Ceased WO2008084106A1 (en) | 2007-01-11 | 2008-01-11 | Anti-kir antibodies, formulations, and uses thereof |
Country Status (8)
| Country | Link |
|---|---|
| US (3) | US20100189723A1 (https=) |
| EP (2) | EP2109460B1 (https=) |
| JP (3) | JP5478261B2 (https=) |
| CN (2) | CN101578113B (https=) |
| AU (1) | AU2008204433B2 (https=) |
| CA (1) | CA2675291C (https=) |
| ES (2) | ES2627923T3 (https=) |
| WO (1) | WO2008084106A1 (https=) |
Cited By (70)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010065939A1 (en) | 2008-12-05 | 2010-06-10 | Indiana University Research & Technology Corporation | Combination therapy to enhace nk cell mediated cytotoxicty |
| WO2012160448A2 (en) | 2011-05-25 | 2012-11-29 | Innate Pharma, S.A. | Anti-kir antibodies for the treatment of inflammatory disorders |
| JP2012533552A (ja) * | 2009-07-15 | 2012-12-27 | ポートラ ファーマシューティカルズ, インコーポレイテッド | 第Xa因子インヒビターの解毒剤の単位用量処方物およびその使用方法 |
| US20130251711A1 (en) * | 2010-11-22 | 2013-09-26 | Innate Pharma Sa | Nk cell modulating treatments and methods for treatment of hematological malignancies |
| WO2014055648A1 (en) | 2012-10-02 | 2014-04-10 | Bristol-Myers Squibb Company | Combination of anti-kir antibodies and anti-pd-1 antibodies to treat cancer |
| WO2014143909A1 (en) * | 2013-03-15 | 2014-09-18 | Bayer Healthcare Llc | Anti-prolactin receptor antibody formulations |
| WO2016069589A1 (en) | 2014-10-28 | 2016-05-06 | University Children's Hospital Tübingen | Treatment of pediatric bcp-all patients with an anti-kir antibody |
| US9587233B2 (en) | 2007-09-28 | 2017-03-07 | Portola Pharmaceuticals, Inc. | Antidotes for factor XA inhibitors and methods of using the same |
| WO2017079746A2 (en) | 2015-11-07 | 2017-05-11 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and immune checkpoint blockade for the treatment of cancer |
| WO2017083224A1 (en) | 2015-11-09 | 2017-05-18 | Bristol-Myers Squibb Company | Methods to manipulate quality attributes of polypeptides produced in cho cells |
| WO2017201502A1 (en) | 2016-05-20 | 2017-11-23 | Biohaven Pharmaceutical Holding Company Ltd. | Use of glutamate modulating agents with immunotherapies to treat cancer |
| US9902936B2 (en) | 2003-07-02 | 2018-02-27 | Innate Pharma S.A. | PAN-KIR2DL NK-receptor antibodies and their use in diagnostics and therapy |
| WO2018064165A2 (en) | 2016-09-27 | 2018-04-05 | Board Of Regents, The University Of Texas System | Methods for enhancing immune checkpoint blockade therapy by modulating the microbiome |
| WO2018071668A1 (en) | 2016-10-12 | 2018-04-19 | Board Of Regents, The University Of Texas System | Methods and compositions for tusc2 immunotherapy |
| WO2018111902A1 (en) | 2016-12-12 | 2018-06-21 | Multivir Inc. | Methods and compositions comprising viral gene therapy and an immune checkpoint inhibitor for treatment and prevention of cancer and infectious diseases |
| WO2018183928A1 (en) | 2017-03-31 | 2018-10-04 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2019075468A1 (en) | 2017-10-15 | 2019-04-18 | Bristol-Myers Squibb Company | TUMOR TREATMENT METHODS |
| EP3514170A1 (en) * | 2010-10-22 | 2019-07-24 | Dana-Farber Cancer Institute, Inc. | Discovery of regulatory t cells programmed to suppress an immune response |
| WO2019191676A1 (en) | 2018-03-30 | 2019-10-03 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2019185551A1 (en) | 2018-03-25 | 2019-10-03 | Snipr Biome Aps. | Treating & preventing microbial infections |
| US10463049B2 (en) | 2015-05-06 | 2019-11-05 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10494433B2 (en) | 2013-11-06 | 2019-12-03 | Bristol-Myers Squibb Company | Combination of anti-KIR and anti-CS1 antibodies to treat multiple myeloma |
| WO2019241730A2 (en) | 2018-06-15 | 2019-12-19 | Flagship Pioneering Innovations V, Inc. | Increasing immune activity through modulation of postcellular signaling factors |
| US10512689B2 (en) | 2015-04-17 | 2019-12-24 | Bristol-Myers Squibb Company | Compositions comprising a combination of nivolumab and ipilimumab |
| WO2020036635A2 (en) | 2018-03-19 | 2020-02-20 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and cd122/cd132 agonists for the treatment of cancer |
| WO2020127965A1 (en) | 2018-12-21 | 2020-06-25 | Onxeo | New conjugated nucleic acid molecules and their uses |
| US10760075B2 (en) | 2018-04-30 | 2020-09-01 | Snipr Biome Aps | Treating and preventing microbial infections |
| WO2020227159A2 (en) | 2019-05-03 | 2020-11-12 | Flagship Pioneering Innovations V, Inc. | Methods of modulating immune activity |
| WO2020243568A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Methods of identifying a subject suitable for an immuno-oncology (i-o) therapy |
| WO2020243570A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Cell localization signature and combination therapy |
| WO2020243563A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Multi-tumor gene signatures for suitability to immuno-oncology therapy |
| WO2021025177A1 (en) | 2019-08-06 | 2021-02-11 | Astellas Pharma Inc. | Combination therapy involving antibodies against claudin 18.2 and immune checkpoint inhibitors for treatment of cancer |
| WO2021113644A1 (en) | 2019-12-05 | 2021-06-10 | Multivir Inc. | Combinations comprising a cd8+ t cell enhancer, an immune checkpoint inhibitor and radiotherapy for targeted and abscopal effects for the treatment of cancer |
| WO2021127217A1 (en) | 2019-12-17 | 2021-06-24 | Flagship Pioneering Innovations V, Inc. | Combination anti-cancer therapies with inducers of iron-dependent cellular disassembly |
| WO2021255223A1 (en) | 2020-06-19 | 2021-12-23 | Onxeo | New conjugated nucleic acid molecules and their uses |
| WO2022006179A1 (en) | 2020-06-29 | 2022-01-06 | Flagship Pioneering Innovations V, Inc. | Viruses engineered to promote thanotransmission and their use in treating cancer |
| WO2022008519A1 (en) | 2020-07-07 | 2022-01-13 | BioNTech SE | Therapeutic rna for hpv-positive cancer |
| US11242393B2 (en) | 2018-03-23 | 2022-02-08 | Bristol-Myers Squibb Company | Antibodies against MICA and/or MICB and uses thereof |
| WO2022047412A1 (en) | 2020-08-31 | 2022-03-03 | Bristol-Myers Squibb Company | Cell localization signature and immunotherapy |
| US11351252B2 (en) | 2016-06-05 | 2022-06-07 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| WO2022120179A1 (en) | 2020-12-03 | 2022-06-09 | Bristol-Myers Squibb Company | Multi-tumor gene signatures and uses thereof |
| WO2022136257A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| WO2022136266A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| WO2022135666A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Treatment schedule for cytokine proteins |
| WO2022146947A1 (en) | 2020-12-28 | 2022-07-07 | Bristol-Myers Squibb Company | Antibody compositions and methods of use thereof |
| WO2022146948A1 (en) | 2020-12-28 | 2022-07-07 | Bristol-Myers Squibb Company | Subcutaneous administration of pd1/pd-l1 antibodies |
| WO2022212876A1 (en) | 2021-04-02 | 2022-10-06 | The Regents Of The University Of California | Antibodies against cleaved cdcp1 and uses thereof |
| WO2023285552A1 (en) | 2021-07-13 | 2023-01-19 | BioNTech SE | Multispecific binding agents against cd40 and cd137 in combination therapy for cancer |
| US11607453B2 (en) | 2017-05-12 | 2023-03-21 | Harpoon Therapeutics, Inc. | Mesothelin binding proteins |
| US11623958B2 (en) | 2016-05-20 | 2023-04-11 | Harpoon Therapeutics, Inc. | Single chain variable fragment CD3 binding proteins |
| WO2023061930A1 (en) | 2021-10-11 | 2023-04-20 | BioNTech SE | Therapeutic rna for lung cancer |
| WO2023111203A1 (en) | 2021-12-16 | 2023-06-22 | Onxeo | New conjugated nucleic acid molecules and their uses |
| US20230242661A1 (en) * | 2020-06-11 | 2023-08-03 | Nanjing Bioheng Biotech Co., Ltd | Engineered immune cell expressing nk inhibitory molecule and use thereof |
| WO2023178329A1 (en) | 2022-03-18 | 2023-09-21 | Bristol-Myers Squibb Company | Methods of isolating polypeptides |
| US11807692B2 (en) | 2018-09-25 | 2023-11-07 | Harpoon Therapeutics, Inc. | DLL3 binding proteins and methods of use |
| WO2023235847A1 (en) | 2022-06-02 | 2023-12-07 | Bristol-Myers Squibb Company | Antibody compositions and methods of use thereof |
| US11976125B2 (en) | 2017-10-13 | 2024-05-07 | Harpoon Therapeutics, Inc. | B cell maturation antigen binding proteins |
| WO2024126457A1 (en) | 2022-12-14 | 2024-06-20 | Astellas Pharma Europe Bv | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and immune checkpoint inhibitors |
| US12076375B2 (en) | 2022-06-29 | 2024-09-03 | Snipr Biome Aps | Treating and preventing E coli infections |
| US12084518B2 (en) | 2015-05-21 | 2024-09-10 | Harpoon Therapeutics, Inc. | Trispecific binding proteins and methods of use |
| US12195544B2 (en) | 2018-09-21 | 2025-01-14 | Harpoon Therapeutics, Inc. | EGFR binding proteins and methods of use |
| WO2025038763A1 (en) | 2023-08-15 | 2025-02-20 | Bristol-Myers Squibb Company | Ceramic hydroxyapatite chromatography flow through method |
| US12269883B2 (en) | 2021-02-03 | 2025-04-08 | Mozart Therapeutics, Inc | Binding agents and methods of using the same |
| WO2025120867A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and anti-vegfr2 antibodies |
| WO2025120866A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| WO2025121445A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| WO2025145207A1 (en) | 2023-12-29 | 2025-07-03 | Bristol-Myers Squibb Company | Combination therapy of kras inhibitor and treg-depleting agent |
| US12371504B2 (en) | 2017-10-13 | 2025-07-29 | Harpoon Therapeutics, Inc. | Trispecific proteins and methods of use |
| WO2026033885A1 (en) | 2024-08-08 | 2026-02-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| US12551515B2 (en) | 2018-11-21 | 2026-02-17 | Board Of Regents Of The University Of Texas System | Methods and compositions for treating cancer |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090191213A9 (en) * | 2003-07-02 | 2009-07-30 | Novo Nordisk A/S | Compositions and methods for regulating NK cell activity |
| EP3072522B1 (en) * | 2005-01-06 | 2019-04-24 | Novo Nordisk A/S | Anti-kir combination treatments and methods |
| KR20120093002A (ko) | 2011-02-14 | 2012-08-22 | (주)에이티젠 | Nk 세포의 활성 측정을 이용한 암 진단 방법 및 진단 키트 |
| IL274572B2 (en) | 2015-07-16 | 2024-01-01 | Biolinerx Ltd | Compositions and methods for treating cancer |
| BR112018017195A2 (pt) * | 2016-02-24 | 2019-01-02 | Children's Hospital Of Eastern Ontario Research Institute Inc. | terapia de combinação de smc para o tratamento do câncer |
| KR102735988B1 (ko) | 2019-02-18 | 2024-12-03 | 일라이 릴리 앤드 캄파니 | 치료 항체 제제 |
| US20230348854A1 (en) * | 2020-05-08 | 2023-11-02 | Seattle Children's Hospital D/B/A Seattle Children's Research Institute | Chimeric antigen receptors (cars) targeting natural killer cells |
| JP2024512669A (ja) | 2021-03-31 | 2024-03-19 | フラグシップ パイオニアリング イノベーションズ ブイ,インコーポレーテッド | タノトランスミッションポリペプチド及び癌の処置におけるそれらの使用 |
| US20240316104A1 (en) | 2021-06-29 | 2024-09-26 | Flagship Pioneering Innovations V, Inc. | Immune cells engineered to promote thanotransmission and uses thereof |
| WO2024077191A1 (en) | 2022-10-05 | 2024-04-11 | Flagship Pioneering Innovations V, Inc. | Nucleic acid molecules encoding trif and additionalpolypeptides and their use in treating cancer |
| WO2024151687A1 (en) | 2023-01-09 | 2024-07-18 | Flagship Pioneering Innovations V, Inc. | Genetic switches and their use in treating cancer |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001078779A2 (en) * | 2000-04-14 | 2001-10-25 | Millennium Pharmaceuticals, Inc. | Antibody alpha4beta7 integrin and its use to treat inflammatory bowel disease |
| US20040152632A1 (en) * | 2002-11-06 | 2004-08-05 | Wyeth | Combination therapy for the treatment of acute leukemia and myelodysplastic syndrome |
| US20050255118A1 (en) * | 2004-02-06 | 2005-11-17 | Nancy Wehner | Methods and composition for treating tumors and metastatic disease |
| WO2006003179A2 (en) * | 2004-07-01 | 2006-01-12 | Novo Nordisk A/S | Antibodies binding to receptors kir2dl1, -2, 3 but not kir2ds4 and their therapeutic use |
| WO2006072626A1 (en) * | 2005-01-06 | 2006-07-13 | Novo Nordisk A/S | Kir-binding agents and methods of use thereof |
| WO2006116369A2 (en) * | 2005-04-22 | 2006-11-02 | Genentech, Inc. | Method for treating dementia or alzheimer's disease with a cd20 antibody |
| US20060280740A1 (en) * | 2003-07-02 | 2006-12-14 | Novo Nordisk A/S | Compositions and methods for regulating NK cell activity |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU707440B2 (en) * | 1994-03-29 | 1999-07-08 | Celltech Therapeutics Limited | Antibodies against E-selectin |
| US6824780B1 (en) * | 1999-10-29 | 2004-11-30 | Genentech, Inc. | Anti-tumor antibody compositions and methods of use |
| AR035119A1 (es) * | 2001-08-16 | 2004-04-14 | Lilly Co Eli | Anticuerpos humanos antagonistas anti-htnfsf13b |
| EP1465720A4 (en) | 2001-12-19 | 2010-05-12 | Biogen Idec Inc | METHODS FOR DETECTING HALF ANTIBODIES BY IMPLEMENTING GEL ELECTROPHORESIS ON INTEGRATED CIRCUITS |
| EP1481010A2 (en) | 2002-02-28 | 2004-12-01 | Eli Lilly And Company | Anti-interleukin-1 beta analogs |
| ES2393485T3 (es) * | 2003-07-02 | 2012-12-21 | Innate Pharma | Anticuerpos del receptor de NK pan-kir2dl y su uso en diagnóstico y terapia |
| SI1639013T1 (sl) * | 2003-07-02 | 2013-01-31 | Innate Pharma | Pan-kir2dl nk-receptorska protitelesca in njihova uporaba pri diagnosticiranju in terapiji |
| DK2311873T3 (en) | 2004-01-07 | 2018-11-26 | Novartis Vaccines & Diagnostics Inc | M-CSF-SPECIFIC MONOCLONAL ANTIBODY AND APPLICATIONS THEREOF |
| EP1805931A4 (en) * | 2004-10-29 | 2010-11-10 | Hid Global Corp | MANUFACTURE OF AUTHORIZATION FOR A SAVED CONSUMPTION OF CONSUMPTION |
| US8709411B2 (en) * | 2008-12-05 | 2014-04-29 | Novo Nordisk A/S | Combination therapy to enhance NK cell mediated cytotoxicity |
| SG10201603962TA (en) * | 2011-05-25 | 2016-07-28 | Innate Pharma Sa | Anti-kir antibodies for the treatment of inflammatory disorders |
-
2008
- 2008-01-11 US US12/521,105 patent/US20100189723A1/en not_active Abandoned
- 2008-01-11 AU AU2008204433A patent/AU2008204433B2/en not_active Ceased
- 2008-01-11 CA CA2675291A patent/CA2675291C/en active Active
- 2008-01-11 WO PCT/EP2008/050306 patent/WO2008084106A1/en not_active Ceased
- 2008-01-11 JP JP2009545192A patent/JP5478261B2/ja not_active Expired - Fee Related
- 2008-01-11 CN CN200880002001.2A patent/CN101578113B/zh not_active Expired - Fee Related
- 2008-01-11 CN CN201510142726.3A patent/CN105037549B/zh not_active Expired - Fee Related
- 2008-01-11 ES ES13159380.8T patent/ES2627923T3/es active Active
- 2008-01-11 EP EP08707869.7A patent/EP2109460B1/en not_active Not-in-force
- 2008-01-11 ES ES08707869.7T patent/ES2579768T3/es active Active
- 2008-01-11 EP EP13159380.8A patent/EP2604278B1/en not_active Not-in-force
-
2013
- 2013-10-11 JP JP2013213757A patent/JP6223771B2/ja not_active Expired - Fee Related
-
2015
- 2015-01-27 US US14/606,814 patent/US9879082B2/en not_active Expired - Fee Related
- 2015-11-20 JP JP2015227492A patent/JP2016104728A/ja active Pending
-
2017
- 2017-12-20 US US15/849,128 patent/US10815299B2/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001078779A2 (en) * | 2000-04-14 | 2001-10-25 | Millennium Pharmaceuticals, Inc. | Antibody alpha4beta7 integrin and its use to treat inflammatory bowel disease |
| US20040152632A1 (en) * | 2002-11-06 | 2004-08-05 | Wyeth | Combination therapy for the treatment of acute leukemia and myelodysplastic syndrome |
| US20060280740A1 (en) * | 2003-07-02 | 2006-12-14 | Novo Nordisk A/S | Compositions and methods for regulating NK cell activity |
| US20050255118A1 (en) * | 2004-02-06 | 2005-11-17 | Nancy Wehner | Methods and composition for treating tumors and metastatic disease |
| WO2006003179A2 (en) * | 2004-07-01 | 2006-01-12 | Novo Nordisk A/S | Antibodies binding to receptors kir2dl1, -2, 3 but not kir2ds4 and their therapeutic use |
| WO2006072626A1 (en) * | 2005-01-06 | 2006-07-13 | Novo Nordisk A/S | Kir-binding agents and methods of use thereof |
| WO2006116369A2 (en) * | 2005-04-22 | 2006-11-02 | Genentech, Inc. | Method for treating dementia or alzheimer's disease with a cd20 antibody |
Non-Patent Citations (7)
| Title |
|---|
| ALTER G ET AL: "CD107a as a functional marker for the identification of natural killer cell activity", JOURNAL OF IMMUNOLOGICAL METHODS, ELSEVIER SCIENCE PUBLISHERS B.V.,AMSTERDAM, NL, vol. 294, no. 1-2, November 2004 (2004-11-01), pages 15 - 22, XP004679751, ISSN: 0022-1759 * |
| DAUGHERTY ET AL: "Formulation and delivery issues for monoclonal antibody therapeutics", ADVANCED DRUG DELIVERY REVIEWS, AMSTERDAM, NL, vol. 58, no. 5-6, 7 August 2006 (2006-08-07), pages 686 - 706, XP005611422, ISSN: 0169-409X * |
| EVELYN D LOBO ET AL: "Antibody Pharmacokinetics and Pharmacodynamics", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 93, no. 11, November 2004 (2004-11-01), pages 2645 - 2648, XP008070609, ISSN: 0022-2836 * |
| KOH CRYSTAL Y ET AL: "Augmentation of antitumor effects by NK cell inhibitory receptor blockade in vitro and in vivo", BLOOD, W.B.SAUNDERS COMPANY, ORLANDO, FL, US, vol. 97, no. 10, 15 May 2001 (2001-05-15), pages 3132 - 3137, XP002308582, ISSN: 0006-4971 * |
| MOULD DIANE R ET AL: "The pharmacokinetics and pharmacodynamics of monoclonal antibodies--mechanistic modeling applied to drug development.", CURRENT OPINION IN DRUG DISCOVERY & DEVELOPMENT JAN 2007, vol. 10, no. 1, January 2007 (2007-01-01), pages 84 - 96, XP009097022, ISSN: 1367-6733 * |
| SHEINER L B ET AL: "Pharmacokinetic/pharmacodynamic modeling in drug development.", ANNUAL REVIEW OF PHARMACOLOGY AND TOXICOLOGY 2000, vol. 40, 2000, pages 67 - 95, XP002472430, ISSN: 0362-1642 * |
| WANG W ET AL: "Antibody Structure, Instability, and Formulation", JOURNAL OF PHARMACEUTICAL SCIENCES, AMERICAN PHARMACEUTICAL ASSOCIATION. WASHINGTON, US, vol. 96, no. 1, 2007, pages 1 - 26, XP009084505, ISSN: 0022-3549 * |
Cited By (123)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9902936B2 (en) | 2003-07-02 | 2018-02-27 | Innate Pharma S.A. | PAN-KIR2DL NK-receptor antibodies and their use in diagnostics and therapy |
| US11365393B2 (en) | 2003-07-02 | 2022-06-21 | Innate Pharma | Compositions and methods for regulating NK cell activity |
| US9587233B2 (en) | 2007-09-28 | 2017-03-07 | Portola Pharmaceuticals, Inc. | Antidotes for factor XA inhibitors and methods of using the same |
| US10190111B2 (en) | 2007-09-28 | 2019-01-29 | Portola Pharmaceuticals, Inc. | Antidotes for factor Xa inhibitors and methods of using the same |
| US10954503B2 (en) | 2007-09-28 | 2021-03-23 | Alexion Pharmaceuticals, Inc. | Antidotes for factor Xa inhibitors and methods of using the same |
| EP2367553B1 (en) * | 2008-12-05 | 2017-05-03 | Novo Nordisk A/S | Combination therapy to enhance nk cell mediated cytotoxicity |
| WO2010065939A1 (en) | 2008-12-05 | 2010-06-10 | Indiana University Research & Technology Corporation | Combination therapy to enhace nk cell mediated cytotoxicty |
| US9415104B2 (en) | 2008-12-05 | 2016-08-16 | Novo Nordisk A/S | Combination therapy to enhance NK cell mediated cytotoxicity |
| JP2012533552A (ja) * | 2009-07-15 | 2012-12-27 | ポートラ ファーマシューティカルズ, インコーポレイテッド | 第Xa因子インヒビターの解毒剤の単位用量処方物およびその使用方法 |
| US10765726B2 (en) | 2009-07-15 | 2020-09-08 | Portola Pharmaceuticals, Inc. | Unit dose formulation of antidotes for factor Xa inhibitors and methods of using the same |
| EP3514170A1 (en) * | 2010-10-22 | 2019-07-24 | Dana-Farber Cancer Institute, Inc. | Discovery of regulatory t cells programmed to suppress an immune response |
| US9844593B2 (en) * | 2010-11-22 | 2017-12-19 | Innate Pharma Sa | Methods for treatment of recurrent hematological malignancies |
| US20130251711A1 (en) * | 2010-11-22 | 2013-09-26 | Innate Pharma Sa | Nk cell modulating treatments and methods for treatment of hematological malignancies |
| EP2643350A4 (en) * | 2010-11-22 | 2015-01-07 | Innate Pharma Sa | TREATMENTS WITH NK CELL MODULATION AND METHOD FOR THE TREATMENT OF HEMATOLOGICAL MALIGNOMES |
| JP2014520092A (ja) * | 2011-05-25 | 2014-08-21 | イナート・ファルマ・ソシエテ・アノニム | 炎症性障害の治療のための抗kir抗体 |
| WO2012160448A2 (en) | 2011-05-25 | 2012-11-29 | Innate Pharma, S.A. | Anti-kir antibodies for the treatment of inflammatory disorders |
| WO2014055648A1 (en) | 2012-10-02 | 2014-04-10 | Bristol-Myers Squibb Company | Combination of anti-kir antibodies and anti-pd-1 antibodies to treat cancer |
| EP3263601A1 (en) | 2012-10-02 | 2018-01-03 | Bristol-Myers Squibb Company | Combination of anti-kir antibodies and anti-pd-1 antibodies to treat cancer |
| US9023357B2 (en) | 2013-03-15 | 2015-05-05 | Bayer Healthcare Llc | Anti-prolactin receptor antibody formulations |
| WO2014143909A1 (en) * | 2013-03-15 | 2014-09-18 | Bayer Healthcare Llc | Anti-prolactin receptor antibody formulations |
| US10494433B2 (en) | 2013-11-06 | 2019-12-03 | Bristol-Myers Squibb Company | Combination of anti-KIR and anti-CS1 antibodies to treat multiple myeloma |
| WO2016069589A1 (en) | 2014-10-28 | 2016-05-06 | University Children's Hospital Tübingen | Treatment of pediatric bcp-all patients with an anti-kir antibody |
| US11639384B2 (en) | 2014-10-28 | 2023-05-02 | University Children's Hospital Tübingen | Treatment of pediatric BCP-ALL patients with an anti-KIR antibody |
| US11612654B2 (en) | 2015-04-17 | 2023-03-28 | Bristol-Myers Squibb Company | Combination therapy comprising nivolumab and ipilimumab |
| US10512689B2 (en) | 2015-04-17 | 2019-12-24 | Bristol-Myers Squibb Company | Compositions comprising a combination of nivolumab and ipilimumab |
| EP3738610A1 (en) | 2015-04-17 | 2020-11-18 | Bristol-Myers Squibb Company | Compositions comprising a combination of ipilimumab and nivolumab |
| US10582712B2 (en) | 2015-05-06 | 2020-03-10 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10624349B2 (en) | 2015-05-06 | 2020-04-21 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10463049B2 (en) | 2015-05-06 | 2019-11-05 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11844760B2 (en) | 2015-05-06 | 2023-12-19 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10506812B2 (en) | 2015-05-06 | 2019-12-17 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11147830B2 (en) | 2015-05-06 | 2021-10-19 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12226430B2 (en) | 2015-05-06 | 2025-02-18 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10524477B2 (en) | 2015-05-06 | 2020-01-07 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10561148B2 (en) | 2015-05-06 | 2020-02-18 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11400110B2 (en) | 2015-05-06 | 2022-08-02 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12502401B2 (en) | 2015-05-06 | 2025-12-23 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11642363B2 (en) | 2015-05-06 | 2023-05-09 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12514869B2 (en) | 2015-05-06 | 2026-01-06 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11612617B2 (en) | 2015-05-06 | 2023-03-28 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12514867B2 (en) | 2015-05-06 | 2026-01-06 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11547716B2 (en) | 2015-05-06 | 2023-01-10 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11517582B2 (en) | 2015-05-06 | 2022-12-06 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12084518B2 (en) | 2015-05-21 | 2024-09-10 | Harpoon Therapeutics, Inc. | Trispecific binding proteins and methods of use |
| WO2017079746A2 (en) | 2015-11-07 | 2017-05-11 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and immune checkpoint blockade for the treatment of cancer |
| WO2017083224A1 (en) | 2015-11-09 | 2017-05-18 | Bristol-Myers Squibb Company | Methods to manipulate quality attributes of polypeptides produced in cho cells |
| WO2017201502A1 (en) | 2016-05-20 | 2017-11-23 | Biohaven Pharmaceutical Holding Company Ltd. | Use of glutamate modulating agents with immunotherapies to treat cancer |
| US11623958B2 (en) | 2016-05-20 | 2023-04-11 | Harpoon Therapeutics, Inc. | Single chain variable fragment CD3 binding proteins |
| US11351252B2 (en) | 2016-06-05 | 2022-06-07 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US11471530B2 (en) | 2016-06-05 | 2022-10-18 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US12318445B2 (en) | 2016-06-05 | 2025-06-03 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| WO2018064165A2 (en) | 2016-09-27 | 2018-04-05 | Board Of Regents, The University Of Texas System | Methods for enhancing immune checkpoint blockade therapy by modulating the microbiome |
| US12318413B2 (en) | 2016-09-27 | 2025-06-03 | Board Of Regents, The University Of Texas System | Methods for enhancing immune checkpoint blockade therapy by modulating the microbiome |
| US12310996B2 (en) | 2016-09-27 | 2025-05-27 | Board Of Regents, The University Of Texas System | Methods for enhancing immune checkpoint blockade therapy by modulating the microbiome |
| US11395838B2 (en) | 2016-09-27 | 2022-07-26 | Board Of Regents, The University Of Texas System | Methods for enhancing immune checkpoint blockade therapy by modulating the microbiome |
| KR20230066654A (ko) | 2016-09-27 | 2023-05-16 | 더 보드 오브 리젠츠 오브 더 유니버시티 오브 텍사스 시스템 | 미생물유전체를 조정함으로써 면역 체크포인트 차단 요법을 증강시키는 방법 |
| US12485159B2 (en) | 2016-10-12 | 2025-12-02 | Board Of Regents, The University Of Texas System | Methods and compositions for TUSC2 immunotherapy |
| WO2018071668A1 (en) | 2016-10-12 | 2018-04-19 | Board Of Regents, The University Of Texas System | Methods and compositions for tusc2 immunotherapy |
| US11278592B2 (en) | 2016-10-12 | 2022-03-22 | Board Of Regents, The University Of Texas System | Methods and compositions for TUSC2 immunotherapy |
| WO2018111902A1 (en) | 2016-12-12 | 2018-06-21 | Multivir Inc. | Methods and compositions comprising viral gene therapy and an immune checkpoint inhibitor for treatment and prevention of cancer and infectious diseases |
| WO2018183928A1 (en) | 2017-03-31 | 2018-10-04 | Bristol-Myers Squibb Company | Methods of treating tumor |
| US11607453B2 (en) | 2017-05-12 | 2023-03-21 | Harpoon Therapeutics, Inc. | Mesothelin binding proteins |
| US12371504B2 (en) | 2017-10-13 | 2025-07-29 | Harpoon Therapeutics, Inc. | Trispecific proteins and methods of use |
| US11976125B2 (en) | 2017-10-13 | 2024-05-07 | Harpoon Therapeutics, Inc. | B cell maturation antigen binding proteins |
| US11919957B2 (en) | 2017-10-15 | 2024-03-05 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2019075468A1 (en) | 2017-10-15 | 2019-04-18 | Bristol-Myers Squibb Company | TUMOR TREATMENT METHODS |
| WO2020036635A2 (en) | 2018-03-19 | 2020-02-20 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and cd122/cd132 agonists for the treatment of cancer |
| US11242393B2 (en) | 2018-03-23 | 2022-02-08 | Bristol-Myers Squibb Company | Antibodies against MICA and/or MICB and uses thereof |
| EP4085923A1 (en) | 2018-03-25 | 2022-11-09 | SNIPR Biome ApS. | Treating and preventing microbial infections |
| EP4066851A1 (en) | 2018-03-25 | 2022-10-05 | SNIPR Biome ApS. | Treating & preventing microbial infections |
| WO2019185551A1 (en) | 2018-03-25 | 2019-10-03 | Snipr Biome Aps. | Treating & preventing microbial infections |
| WO2019191676A1 (en) | 2018-03-30 | 2019-10-03 | Bristol-Myers Squibb Company | Methods of treating tumor |
| US10760075B2 (en) | 2018-04-30 | 2020-09-01 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11421227B2 (en) | 2018-04-30 | 2022-08-23 | Snipr Biome Aps | Treating and preventing microbial infections |
| US10920222B2 (en) | 2018-04-30 | 2021-02-16 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11485973B2 (en) | 2018-04-30 | 2022-11-01 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11788085B2 (en) | 2018-04-30 | 2023-10-17 | Snipr Biome Aps | Treating and preventing microbial infections |
| US12448619B2 (en) | 2018-04-30 | 2025-10-21 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11643653B2 (en) | 2018-04-30 | 2023-05-09 | Snipr Biome Aps | Treating and preventing microbial infections |
| WO2019241730A2 (en) | 2018-06-15 | 2019-12-19 | Flagship Pioneering Innovations V, Inc. | Increasing immune activity through modulation of postcellular signaling factors |
| US12195544B2 (en) | 2018-09-21 | 2025-01-14 | Harpoon Therapeutics, Inc. | EGFR binding proteins and methods of use |
| US11807692B2 (en) | 2018-09-25 | 2023-11-07 | Harpoon Therapeutics, Inc. | DLL3 binding proteins and methods of use |
| US12551515B2 (en) | 2018-11-21 | 2026-02-17 | Board Of Regents Of The University Of Texas System | Methods and compositions for treating cancer |
| WO2020127965A1 (en) | 2018-12-21 | 2020-06-25 | Onxeo | New conjugated nucleic acid molecules and their uses |
| WO2020227159A2 (en) | 2019-05-03 | 2020-11-12 | Flagship Pioneering Innovations V, Inc. | Methods of modulating immune activity |
| WO2020243563A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Multi-tumor gene signatures for suitability to immuno-oncology therapy |
| WO2020243570A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Cell localization signature and combination therapy |
| WO2020243568A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Methods of identifying a subject suitable for an immuno-oncology (i-o) therapy |
| WO2021024020A1 (en) | 2019-08-06 | 2021-02-11 | Astellas Pharma Inc. | Combination therapy involving antibodies against claudin 18.2 and immune checkpoint inhibitors for treatment of cancer |
| WO2021025177A1 (en) | 2019-08-06 | 2021-02-11 | Astellas Pharma Inc. | Combination therapy involving antibodies against claudin 18.2 and immune checkpoint inhibitors for treatment of cancer |
| WO2021113644A1 (en) | 2019-12-05 | 2021-06-10 | Multivir Inc. | Combinations comprising a cd8+ t cell enhancer, an immune checkpoint inhibitor and radiotherapy for targeted and abscopal effects for the treatment of cancer |
| WO2021127217A1 (en) | 2019-12-17 | 2021-06-24 | Flagship Pioneering Innovations V, Inc. | Combination anti-cancer therapies with inducers of iron-dependent cellular disassembly |
| US20230242661A1 (en) * | 2020-06-11 | 2023-08-03 | Nanjing Bioheng Biotech Co., Ltd | Engineered immune cell expressing nk inhibitory molecule and use thereof |
| WO2021255223A1 (en) | 2020-06-19 | 2021-12-23 | Onxeo | New conjugated nucleic acid molecules and their uses |
| WO2022006179A1 (en) | 2020-06-29 | 2022-01-06 | Flagship Pioneering Innovations V, Inc. | Viruses engineered to promote thanotransmission and their use in treating cancer |
| WO2022008519A1 (en) | 2020-07-07 | 2022-01-13 | BioNTech SE | Therapeutic rna for hpv-positive cancer |
| WO2022047412A1 (en) | 2020-08-31 | 2022-03-03 | Bristol-Myers Squibb Company | Cell localization signature and immunotherapy |
| WO2022120179A1 (en) | 2020-12-03 | 2022-06-09 | Bristol-Myers Squibb Company | Multi-tumor gene signatures and uses thereof |
| WO2022136255A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Treatment schedule for cytokine proteins |
| WO2022135666A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Treatment schedule for cytokine proteins |
| WO2022136266A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| WO2022135667A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| WO2022136257A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| WO2022146947A1 (en) | 2020-12-28 | 2022-07-07 | Bristol-Myers Squibb Company | Antibody compositions and methods of use thereof |
| US12582713B2 (en) | 2020-12-28 | 2026-03-24 | Bristol-Myers Squibb Company | Methods of treating tumors |
| WO2022146948A1 (en) | 2020-12-28 | 2022-07-07 | Bristol-Myers Squibb Company | Subcutaneous administration of pd1/pd-l1 antibodies |
| EP4566674A2 (en) | 2020-12-28 | 2025-06-11 | Bristol-Myers Squibb Company | Antibody compositions and methods of use thereof |
| US12269883B2 (en) | 2021-02-03 | 2025-04-08 | Mozart Therapeutics, Inc | Binding agents and methods of using the same |
| WO2022212876A1 (en) | 2021-04-02 | 2022-10-06 | The Regents Of The University Of California | Antibodies against cleaved cdcp1 and uses thereof |
| WO2023285552A1 (en) | 2021-07-13 | 2023-01-19 | BioNTech SE | Multispecific binding agents against cd40 and cd137 in combination therapy for cancer |
| WO2023061930A1 (en) | 2021-10-11 | 2023-04-20 | BioNTech SE | Therapeutic rna for lung cancer |
| WO2023111203A1 (en) | 2021-12-16 | 2023-06-22 | Onxeo | New conjugated nucleic acid molecules and their uses |
| WO2023178329A1 (en) | 2022-03-18 | 2023-09-21 | Bristol-Myers Squibb Company | Methods of isolating polypeptides |
| WO2023235847A1 (en) | 2022-06-02 | 2023-12-07 | Bristol-Myers Squibb Company | Antibody compositions and methods of use thereof |
| US12076375B2 (en) | 2022-06-29 | 2024-09-03 | Snipr Biome Aps | Treating and preventing E coli infections |
| WO2024126457A1 (en) | 2022-12-14 | 2024-06-20 | Astellas Pharma Europe Bv | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and immune checkpoint inhibitors |
| WO2025038763A1 (en) | 2023-08-15 | 2025-02-20 | Bristol-Myers Squibb Company | Ceramic hydroxyapatite chromatography flow through method |
| WO2025121445A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| WO2025121444A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and anti-vegfr2 antibodies |
| WO2025120866A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| WO2025120867A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and anti-vegfr2 antibodies |
| WO2025145207A1 (en) | 2023-12-29 | 2025-07-03 | Bristol-Myers Squibb Company | Combination therapy of kras inhibitor and treg-depleting agent |
| WO2026033885A1 (en) | 2024-08-08 | 2026-02-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
Also Published As
| Publication number | Publication date |
|---|---|
| JP5478261B2 (ja) | 2014-04-23 |
| JP2016104728A (ja) | 2016-06-09 |
| JP2014050393A (ja) | 2014-03-20 |
| EP2109460A1 (en) | 2009-10-21 |
| US20150197569A1 (en) | 2015-07-16 |
| CN105037549A (zh) | 2015-11-11 |
| JP2010515709A (ja) | 2010-05-13 |
| CA2675291C (en) | 2017-05-23 |
| WO2008084106A9 (en) | 2009-09-17 |
| EP2109460B1 (en) | 2016-05-18 |
| US20180208652A1 (en) | 2018-07-26 |
| CN105037549B (zh) | 2018-09-28 |
| ES2579768T3 (es) | 2016-08-16 |
| ES2627923T3 (es) | 2017-08-01 |
| EP2604278A1 (en) | 2013-06-19 |
| US10815299B2 (en) | 2020-10-27 |
| AU2008204433B2 (en) | 2014-03-13 |
| US20100189723A1 (en) | 2010-07-29 |
| EP2604278B1 (en) | 2017-04-12 |
| CA2675291A1 (en) | 2008-07-17 |
| AU2008204433A1 (en) | 2008-07-17 |
| US9879082B2 (en) | 2018-01-30 |
| CN101578113B (zh) | 2015-04-22 |
| CN101578113A (zh) | 2009-11-11 |
| JP6223771B2 (ja) | 2017-11-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10815299B2 (en) | Anti-KIR antibodies, formulations, and uses thereof | |
| JP2026036696A (ja) | 抗tgfベータ抗体およびそれらの使用 | |
| JP7600285B2 (ja) | 抗pd-l1モノクローナル抗体 | |
| AU2016281717A1 (en) | Immune modulation and treatment of solid tumors with antibodies that specifically bind CD38 | |
| US20230382991A1 (en) | Anti-lilrb antibodies and uses thereof | |
| TW202319400A (zh) | 用於治療aml之抗體 | |
| CA3137822A1 (en) | Monoclonal antibody that binds specifically to gitr | |
| AU2013237638B2 (en) | Anti-kir antibodies, formulations, and uses thereof | |
| HK1212719A1 (zh) | 全人源抗rankl抗体 | |
| HK1254148A1 (en) | Immune modulation and treatment of solid tumors with antibodies that specifically bind cd38 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200880002001.2 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08707869 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008204433 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2008204433 Country of ref document: AU Date of ref document: 20080111 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2675291 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2009545192 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008707869 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12521105 Country of ref document: US |