WO2008072777A2 - Ttk as tumor marker and therapeutic target for lung cancer - Google Patents
Ttk as tumor marker and therapeutic target for lung cancer Download PDFInfo
- Publication number
- WO2008072777A2 WO2008072777A2 PCT/JP2007/074359 JP2007074359W WO2008072777A2 WO 2008072777 A2 WO2008072777 A2 WO 2008072777A2 JP 2007074359 W JP2007074359 W JP 2007074359W WO 2008072777 A2 WO2008072777 A2 WO 2008072777A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- ttk
- egfr
- polypeptide
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to lung cancer, more particularly the diagnosis and treatment thereof.
- Lung cancer is one of the most common causes of cancer death worldwide, and non- small cell lung cancer (NSCLC) accounts for nearly 80% of those cases (Greenlee, R. T., et al., (2001) CA Cancer J Clin, 51: 15-36.).
- Small cell lung cancer (SCLC) comprises 15-20% of all lung cancers (Chute JP et al., (1999) J Clin Oncol.; 17: 1794-801 , Simon GR et al., (2003) Chest; 123(1 Suppl):259S-271S).
- SCLC small cell lung cancer
- Epidermal growth factor receptor plays a critical role in the growth and survival of human cancers in various tissues by stimulation of ligands such as EGF that, in turn, leads to autophosphorylation of EGFR and thus activates the EGFR signaling pathway.
- ligands such as EGF
- TTK has been identified as over-expressed in the great majority of lung cancers and has further been shown to be associated with poor prognosis.
- suppression of endogenous TTK expression by treatment with siRNA has been shown to cause significant growth inhibition of non-small cell lung cancer cells.
- TTK kinase Screening of potential substrates for TTK kinase using a panel of antibodies against phospho-proteins related to cancer-cell signaling resulted in the identification of an EGFR as an intracellular target of TTK. It was further discovered that phosphorylation at Tyr-992 and Ser-967 of EGFR by TTK occurred independently of EGF stimulation, and led to the activation of PLCgamma and phosphorylation of MAPK. In addition, point mutations were identified in the tyrosine kinase domain of the TTK gene in two patients with metastatic brain tumors derived from primary lung adenocarcinoma and in a lung-cancer cell line RERF-LC-AI. In vitro, the TTK mutant increased the invasive ability of mammalian cells.
- TTK functions as oncogene and its activation is likely to play an important role in the intracellular stimulation of EGFR-MAPK signaling in cancer cells, and that a novel intracellular signaling pathway between TTK kinase and EGFR, independent from the presence of EGF, plays a significant role in pulmonary carcinogenesis.
- the present invention suggests that targeting the TTK enzymatic activity will be a promising therapeutic strategy for treatment of lung-cancer patients.
- EGFR Epidermal growth factor receptor
- agents that selectively block EGFR signaling have been under development; to that end, anti-EGFR monoclonal antibody, cetuximab (Erbitux), and small-molecule inhibitors of EGFR tyrosine kinase such as gefitinib (Iressa) and erlotinib (Tarceva), have been used in clinical practice (Dowell J, et al., Nat Rev Drug Discov. 2005 Jan;4(l):13-4.; Herbst RS, et al., Nat Rev Cancer. 2004 Dec;4(12):956- 65.).
- cetuximab Erbitux
- small-molecule inhibitors of EGFR tyrosine kinase such as gefitinib (Iressa) and erlotinib (Tarceva)
- Stimulation of its ligands, such as EGF, causes EGFR to undergo a conformational change and autophosphorylation that activates the EGFR signaling pathways includes the MAPK (mitogen activated protein kinase) cascade and the c-Src (cellular Src) cascade (Yarden Y. Eur J Cancer. 2001 Sep;37 Suppl 4:S3-8.; Pal SK & Pegram M. Anticancer Drugs. 2005
- TTK plays a significant role in pulmonary carcinogenesis through EGF-independent phosphorylation of EGFR Tyr-992 and Ser- 967, and subsequent activation of downstream MAPK signals that are considered to be indispensable for tumor growth/survival.
- variant TTK proteins composed of various amino acid - A - substitutions, for example, an exchange from leucine to proline at codon 72 (L72P), serine to threonine at codon 76 (S76T), tyrosine to cysteine at codon 574 (Y574C), proline to Glutamine at codon 789 (P789Q) and lysine to Isoleusine at codon 856 (K856I) (Table 4).
- L72P leucine to proline at codon 72
- S76T serine to threonine at codon 76
- Y574C tyrosine to cysteine at codon 574
- P789Q proline to Glutamine at codon 789
- K856I lysine to Isoleusine at codon 856
- DBSNP http://www.ncbi.nhn.nih.gov/projects/SNP/).
- two missense mutations were identified in the TTK kinase domain in clinical samples of two metastatic brain tumors derived from primary lung adenocarcinoma.
- the mutations resulted in two amino acid substitution, namely the substitution of Valine to Phenylalanine at codon 610 (V610F) and Glutamine to Histidine at codon 753 (Q753H).
- Matched normal brain tissue was available for these two patients and showed only the wild-type DNA sequence, indicating that the mutations had arisen somatically during tumor formation or progression.
- mutant-TTK (Y574C) transfected cells showed a high-autophosphorylation level as compared to non-transfected cells, indicating that the mutation could promote the TTK kinase activity. Furthermore, it was confirmed that the invasive ability of mutant-TTK (Y574C) transfected cells was significantly enhanced by matrigel invasion assay using the mutant-TTK construct. These results doubtlessly indicate that the TTK mutation originated from RERF-LC- AI cell could be an activating mutation involved in lung carcinogenesis.
- Table 4 List of TTK mutation in lung-cancer cell lines.
- ADC A427 Hetero. Hetero. Hetero. Homo.
- ASC Hetero. Hetero. Hetero. Hetero H226 NCI-
- the present invention is based, in part, on the discovery of the EGF-independent phosphorylation of EGFR Tyr-992 and Ser-967 by TTK, and subsequent activation of downstream MAPK signals that are considered to be indispensable for tumor growth and/or survival.
- the present invention provides a method of diagnosing lung cancer or a predisposition for developing lung cancer in a subject, including the step of determining TTK expression level and a level of kinase activity of TTK for EGFR in a biological sample derived from the subject, wherein an increase in said level as compared to a normal control level indicates that the subject suffers from or is at risk of developing lung cancer.
- the kinase activity of TTK for EGFR is EGF-independent and one of the phosphorylation sites of EGFR is Tyr-992 or Ser-967.
- the present invention also provides methods of assessing or determining a lung cancer prognosis. In some embodiments, the method includes the steps of: a.
- detecting a TTK expression level and/or phospho-EGFR level in a specimen collected from a subject whose lung cancer prognosis is to be assessed or determined and b. indicating a poor prognosis when an elevated level of TTK expression and/or phospho- EGFR level is detected.
- the kinase activity of TTK for EGFR is EGF-independent and the phosphorylation site of EGFR is Tyr-992 or Ser-967.
- the present invention features a method of measuring TTK kinase activity, the method involving the incubation of polypeptides under conditions suitable for a phosphorylation of EGFR by TTK.
- Suitable polypeptides include a TTK polypeptide or functional equivalent thereof and an EGFR polypeptide or functional equivalent thereof.
- the TTK polypeptide may possess the amino acid sequence of SEQ ID NO:
- the TTK polypeptide may possess an amino acid sequence of SEQ ID NO: 2, where one or more amino acids are modified by substitution, deletion or insertion, so long as the resulting polypeptide retains the biological activity of the polypeptide of SEQ ID NO: 2.
- Biological activities of the polypeptide of SEQ ID NO: 2 include, for example, the promotion of cell proliferation and the kinase activity of TTK for EGFR. Additionally, the polypeptide may take the form of an 857-amino acid protein encoded by the open reading frame of SEQ. ID. NO.
- polynucleotide that hybridizes under stringent conditions, e.g., low or high, to the nucleotide sequence of SEQ ID NO: 1, so long as the resulting polynucleotide encodes a protein that retains the biological activity of the polypeptide of SEQ ID NO: 2, e.g. the region including
- the EGFR polypeptide may possess the amino acid sequence of SEQ ID NO; 4 (GenBank Accession No. NP 005219). In the cells, EGFR is cleavage at the N-terminal domain and forms an 1186 residue protein (SEQ ID NO: 42).
- the EGFR polypeptide may possess an amino acid sequence of SEQ ID NO: 4, wherein one or more amino acids are modified by substitution, deletion or insertion, so long as the resulting polypeptide retains the target region of TTK kinase on SEQ ID NO: 4, e.g. the region including Tyr-992 and Ser-967 at cleavage type of EGFR.
- the EGFR polypeptide may take the form of a 1210-amino acid protein encoded by the open reading frame of SEQ. ID. NO. 3 (GenBank Accession No. NM 005228), or a polynucleotide that hybridizes under stringent conditions, e.g. low or high, to the nucleotide sequence of SEQ ID NO: 3, so long as the resulting polynucleotide encodes a protein that retains the target site of TTK kinase on SEQ ID NO: 4.
- the kinase activity of TTK for EGFR can be defined by the detection of the phospho-EGFR, especially phosphorylated at Tyr-992 ( Figure 4e).
- the kinase activity of TTK for EGFR may be detected by conventional methods, such as western-blot analysis using an antibody for phospho-EGFR.
- the phosphorylation may occur either in vitro or in vivo.
- purified recombinant TTK polypeptide can be incubated with whole extracts prepared from cell lines or recombinant EGFR polypeptide with ATP as a phosphate donor.
- cells that endogenously or exogenously co-expressing TTK and EGFR may be used. Suitable conditions for synthesis include, for example, basic buffer conditions know in the art such as Tris-HCl.
- the present invention further provides methods of identifying an agent that modulates (e.g., increases or decreases) kinase activity of TTK for EGFR is detected by incubating a TTK polypeptide, or functional equivalent thereof and EGFR polypeptide, or functional equivalent thereof in the presence of ATP as a phosphate donor and determining the phospho-EGFR level.
- a decrease in the phospho-EGFR level as compared to a normal control level indicates that the test agent is an inhibitor of TTK kinase.
- Compounds that inhibit (e.g., decreases) kinase activity of TTK for EGFR are useful for treating, preventing or alleviating a symptom of lung cancer. For example, such compounds may inhibit the proliferation of lung cancer cells.
- an increase in the level or activity as compared to a normal control level indicates that the test agent is an enhancer of kinase activity of TTK for EGFR.
- the phrase normal control level refers to a level of kinase activity of TTK for EGFR detected in the absence of the test compound.
- phosphorylation of EGFR by TTK is EGF-independent and examples of the phosphorylated sites of EGFR are Tyr-992 and Ser-967, and so on.
- the present invention also encompasses compositions and methods for treating or preventing of lung cancer by contacting a lung cancer cell with a compound identified as described above.
- the present invention provides for the use of a compound identified as described above, for manufacturing a pharmaceutical composition suitable for treating or preventing lung cancer.
- a method of treating lung cancer may involve the step of administering to a mammal, e.g. a human patient having been diagnosed with such a disease state, with a composition containing a pharmaceutically effective amount of a compound identified as described above and a pharmaceutical carrier.
- the present invention also provides a kit for the detecting the kinase activity of TTK for EGFR.
- the reagents are preferably packaged together in the form of a kit.
- the reagents may be packaged in separate containers and may include, for example, a TTK polypeptide, an EGFR polypeptide, reagent for detecting a phospho-EGFR, e.g. phospho-EGFR (Tyr992) or phospho- EGFR (Ser967), a control reagent (positive and/or negative), and/or a detectable label.
- Instructions e.g., written, tape, VCR, CD-ROM, etc.
- the assay format of the kit may include any kinase assay known in the art.
- the present invention is based in part on the discovery of the various amino acid substitutions of TTK at kinase domain, especially the mutations resulted in the amino acid substitution; Valine to Phenylalanine at codon 610 (V610F) and Glutamine to Histidine at codon 753 (Q753H), which are available for these two patients respectively, and a missense mutation Tyrosine to Cysteine at codon 574 (Y574C) on the TTK kinase domain found in a RERF-LC-AI cell line, which was not present in the SNP databases.
- the mutation of TTK could promote the TTK kinase activity and the invasive ability
- the mutation of TTK originated from RERF-LC-AI cell could be an activating mutation involved in lung carcinogenesis. Accordingly, the present invention provides the method of predicting a metastasis of lung cancer, especially a brain metastasis of lung cancer, by using the mutations of kinase domain of TTK, e.g. Y574C or Q753H as index.
- the present invention also provides A method for treating or preventing lung cancer comprising administering to subject a composition comprising a double- stranded molecule which reduces TTK (SEQ ID NO: 1) or EGFR (SEQ ID NO: 3) gene expression, wherein the double-stranded molecule comprises a sense nucleic acid and an anti- sense nucleic acid, wherein the sense nucleic acid comprises a ribonucleotide sequence corresponding to a sequence of SEQ ID NO: 62 or 63 as the target sequence.
- the present invention also provides a composition for treating or preventing lung cancer comprising a pharmaceutically effective amount of a double-stranded molecule which reduces TTK (SEQ ID NO: 1) or EGFR (SEQ ID NO: 3) gene expression, and a pharmaceutically acceptable carrier.
- the present invention provides inhibitory polypeptides that are selected from group of ISSILEKGERLPQPPICTI (SEQ ID NO: 44), DVYMIMVKCWMIDADSRPK (SEQ ID NO. 45) and FRELIIEFSKMARDPQRYL (SEQ ID NO. 46).
- the present invention further provides pharmaceuticals or methods using these inhibitory polypeptides for prevention and/or treatment of lung cancer.
- the present invention also relates to methods for treatment and/or prevention of lung cancer comprising the step of administering an inhibitory polypeptide that is selected from group of ISSILEKGERLPQPPICTI (SEQ ID NO: 44), DVYMIMVKCWMIDADSRPK (SEQ ID NO.
- Figure 1 depicts the validation of TTK expression in primary lung cancers and cell lines.
- Part a depicts the expression of TTK in clinical samples of NSCLC (T) and corresponding normal lung tissues (N), examined by semiquantitative RT-PCR.
- Part b depicts the expression of TTK in lung-cancer cell lines by semiquantitative RT-PCR.
- Part c depicts the expression of TTK protein in 7 lung-cancer cell lines, normal airway epithelial cells (SAEC), and two normal lung fibroblast cells (CCD 19Lu and MRC-5) detected by western- blot analysis.
- SAEC normal airway epithelial cells
- CCD 19Lu and MRC-5 normal lung fibroblast cells
- Part d provides representative images of immunohistochemical analysis of TTK protein in lung adenocarcinomas (ADC) 5 squamous-cell carcinomas (SCC), and small cell lung cancer (SCLC) tissues. Magnification, x200.
- ADC lung adenocarcinomas
- SCC squamous-cell carcinomas
- SCLC small cell lung cancer
- Part e depicts the expression of TTK in A549 (left panels) and LC319 cells (right panels) by immunocytochemical analyses. Cells were fixed and stained using anti-TTK antibody and Alexa Fluor 488-conjugated goat anti-mouse IgG as secondary antibody. TTK was visualized in green and the cell nuclei in blue (DAPI). Part f depicts the results of western blot analyses with anti-TTK antibody, confirming that TTK localizes in the cytosolic and nuclear fraction of A549 (left panels) and LC319 cells (right panels).
- FIG. 2 depicts the TTK expression in primary lung cancers and its prognostic value.
- Part a depicts the results of immunohistochemical evaluation of TTK protein expression on tissue microarrays. Examples are shown for strong, weak, or absent TTK expression in lung
- Part b depicts the results of Kaplan-Meier analysis of tumor-specific survival in patients with non-small cell lung cancer (NSCLC) according to TTK expression (P ⁇ 0.0001 by the Log-rank test).
- Figure 3 depicts the growth-promoting effect of TTK and activation of cellular invasive activity by TTK.
- Part a depicts the expression of TTK in response to si-TTKs (si-TTK-1, -2) or control siRNAs
- LC319 cells analyzed by semiquantitative RT-PCR (left upper panels). Viability of LC319 cells evaluated by MTT assay in response to si-TTKs, -
- Part b depicts the expression of TTK protein in TTK-stable transfectants of HEK293 cells on western-blot analysis.
- Part c depicts the transfectants expressing low levels (clone 1) or high levels (clone 2) of TTK, or controls cells transfected with mock vector were each cultured in triplicate; at each time point, the cell viability was evaluated by MTT assay.
- Part d depicts the growth curves of TTK-stable transfectants of HEK293 cells or mock-HEK293 cells transplanted to subcutaneous of nude mice (5 x 10 6 TTK-transfected HEK293 cells/mouse).
- Part e depicts the results of Matrigel invasion assay demonstrating the increased invasive ability of NIH-3T3 cells transfected with TTK-, the catalytically inactive TTK-KD (kinase dead)-, or mock- vector. The number of invading cells through Matrigel-coated filters was shown.
- Figure 4 relates to the direct phosphorylation of EGFR on Tyr-992 by TTK protein kinase.
- Part a depicts results of Tyr-992 phosphorylation of EGFR in COS-7 cells that transiently over- expressed TTK.
- COS-7 cells that scarcely expressed endogenous TTK were transfected with the TTK-expression vector, the catalytically inactive TTK-KD (D647A)-expression vector, or mock vector.
- Whole cell extracts from these cells were used for western-blot analysis using a total of 31 antibodies against various phospho-proteins involved in cancer-cell signaling (see Table 2). Blots were stripped and re-probed for total EGFR or ACTB to verify equal loading; all bands of EGFR are about 175 kDa.
- Part b depicts the results of interaction of endogenous TTK with EGFR in lung cancer cells. Imrnunoprecipitations were performed using anti-TTK antibodies and extracts from A549 cells in the absence or presence of EGF (100 nM). Immunoprecipitates were subjected to western blot analysis to detect endogenous EGFR. IP, immunoprecipitation; IB, immunoblot.
- Part c depicts the results of phase contrast images of A549 cells treated with AG1478, or transfected with siRNA (oligo) against TTK, or siRNA (oligo) against EGFR.
- Non-treated A549 cells were served as controls.
- Part d depicts the results of in vitro kinase assay by incubating purified recombinant TTK protein with whole cell lysates isolated from COS-7 cells. After in vitro kination reaction, the samples were subjected to western-blot analysis with anti-phospho-EGFR antibodies (Tyr-845, Tyr-992, Tyr-1045, Tyr-1068, Tyr-1148, and Tyr-1173). Blots were stripped and re-probed for total EGFR or ACTB to verify equal loading (left panels).
- COS-7 cells maintained in serum- free medium for 24 hours were exposed to EGF (100 nM) for 5 or 15 min at 37 0 C.
- COS-7 cells without exposure to the EGF treatment were served as a control.
- Whole cell extracts from these cells were used for western-blot analysis with these anti-phospho-EGFR antibodies (right panels); all bands shown are around 175 kDa.
- Part e is a schemaic representation of the EGFR-deletion mutants (DELs). GST fusion proteins with three partial EGFR sequences at cytoplasmic region were constructed (deletion mutants). Individual mutants are shown as a bar with amino acid residue number at both ends.
- TM transmembrane region
- Tyr-845 Src phosphorylation site
- Tr-992 tyrosine autophosphorylation sites
- Part f depicts the results of three recombinant EGFR-DELs loaded on SDS-PAGE were visualized by Coomassie Brilliant Blue staining (upper panel), hi vitro kinase assay by incubating purified recombinant TTK with three deletion mutants of EGFR as substrates (lower panels). After the kinase reaction, samples were subjected to western-blot analysis with anti- phospho-EGFR antibodies. Blots were stripped and re-probed for GST to verify equal loading.
- Part g depicts the results of in vitro kinase assays by incubating the recombinant TTK (as kinase) and catalytically active recombinant GST-tagged EGFR (active-rhEGFR as substrates; Upstate). After the kinase reaction, samples were subjected to western-blot analysis with anti- phospho-tyrosine antibodies. The kinase activity of active-rhEGFR was detected in the presence of ATP (lane 2, # indicates the autophosphorylation of active-rhEGFR).
- Part h depicts the results of immunohistochemical staining of representative surgically-resected samples including NSCLC (lung-ADC and -SCC) and SCLC as well as normal lung, using anti- phospho-EGFR (Tyr-992) antibody on tissue microarrays (x200).
- Part i depicts the results of Kaplan-Meier analysis of tumor-specific survival in patients with NSCLC according to phospho-EGFR (Tyr-992) expression (P ⁇ 0.0001 by the Log-rank test).
- Part j depicts the results of association of co-activation of TTK and phospho-EGFR (Tyr-992) with poor prognosis of NSCLC patients.
- the 366 NSCLC cases were divided into three groups; group- 1 for cases with strong-positive staining for both TTK and phospho-EGFR (Tyr-992) (63 patients), group-2 for cases with negative staining for both markers (74 patients), group-3 for any other cases (229 patients, shown as others).
- Part k and 1 depict the results of immunofluorescence analysis of phospho-EGFR (Tyr-992) in COS-7 cells that were transiently over-expressed TTK.
- COS-7 cells that scarcely expressed endogenous TTK were transfected with TTK-expressing vector or with empty- vector (mock), and were maintained in serum-free medium for 12 hours, and subsequently washed and fixed;
- the TTK-Alexa488, phospho-EGFR (Tyr-992)-Alexa594, or cell nuclei (DAPI) were visualized in green, red, or blue, respectively.
- Internalization of phospho-EGFR (Tyr-992) was observed in cells transfected with TTK-expressing plasmids (k). Arrows indicate localization of phospho- EGFR (Tyr-992) (1).
- Part m depicts the levels of phospho-EGFR (Tyr-992) detected by immunofluorescence analysis in A549 cells transfected with the RNAi (oligo) against TTK (si-TTK). RNAi mediated suppression of TTK reduced the phosphorylation of EGFR at Tyr-992.
- Figure 5 depicts the results of induction of phospho-EGFR (Tyr-992) and activation of downstream signals in a TTK-dependent oncogenic pathway.
- Part a depicts the expression levels of TTK and the phosphorylation levels of EGFR (Tyr-992) in A549 cells that had been arrested at mitosis with colcemid treatment (0, 100, 200 nM) (WAKO) for 24 hours, was detected by western-blot analysis using anti-TTK or pEGFR (Tyr- 992) antibody (top and third panels).
- the cell lysate was treated or untreated with Lambda Protein Phosphatase ( ⁇ - PPase; New England Biolabs) in phosphatase buffer or buffer alone for 1 hour at 37 0 C.
- Part b depicts the expression levels of TTK, phospho-EGFR (Tyr-992), total EGFR, phospho- PLC ⁇ l (Tyr-771), total PLC ⁇ l, phospho-p44/42 MAPK (Thr202/Tyr204), and total p44/42 MAPK, detected by western-blot analysis in A549 cells transfected with the RNAi (oligo) against TTK.
- RNAi mediated suppression of TTK reduced the phosphorylation of both EGFR (Tyr-992), PLC ⁇ l (Tyr-771) and p44/42 MAPK (Thr202/Tyr204).
- Part c depicts results of immunofluorescence analysis of phospho-p44/42 MAPK in COS-7 cells transiently over-expressing TTK.
- Transfected cells were maintained in serum-free medium for 12 hours, and subsequently washed and fixed;
- the Flag-TTK-Alexa488, phospho-p44/42 MAPK (Thr202/Tyr204)-Alexa594, or cell nuclei (DAPI) were visualized in green (upper panel), red (middle panel), or blue, respectively.
- Phosphorylation of p44/42 MAPK was observed only in TTK-transfected cells, but it was not detected in TTK-non-transfected cells (lower panel).
- Part d depicts the results of co-immunoprecipitaion of PLC ⁇ l with EGFR in COS-7 cells that were transfected with the TTK-, TTK-KD- or empty- vector (mock).
- the EGFR was immunoprecipitated from whole cell extracts of these cells by using anti-EGFR antibody. Immunoprecipitates were analyzed by western-blotting.
- Figure 6 depicts the results of direct phosphorylation of EGFR on Ser-967 by TTK protein kinase.
- Part a depicts the results of in vitro kinase assay performed by incubating recombinant EGFR- DEL-2 (wild type) or EGFR-DEL-2 mutant whose Tyr-992 residue was replaced with an alanine (Y992A), with recombinant TTK in the presence of [ ⁇ - 32 P] ATP. The products were separated on SDS-PAGE and phosphorylation was visualized by autoradiography. Part b depicts the levels of TTK, phospho-EGFR (Ser-967), and total EGFR proteins in lung- cancer cell lines, detected by western-blot analysis.
- Part c depicts the results of phospho-EGFR (Ser-967) in COS-7 cells that transiently over- expressed TTK, detected by immunofluorescence analysis.
- COS-7 cells that scarcely expressed endogenous TTK were transfected with the TTK-expression vector.
- the TTK-Alexa594, phospho-EGFR (Ser-967)- Alexa488, or cell nuclei (DAPI) were visualized in red (right panels), green (middle panels), or blue (left panels), respectively.
- TTK over-expression induced the phosphorylation of EGFR (Ser-967).
- Part d depicts the phosphorylation level of EGFR (Ser-967) detected by immunofluorescence analysis of A549 cells transfected with the RNAi (oligo) against TTK. RNAi mediated suppression of TTK reduced the phosphorylation of EGFR (Ser-967).
- Part e depicts the results of immunohistochemical evaluation of phospho-EGFR (Ser-967) expression on tissue microarrays. Examples are shown for strong, weak, or absent phospho- EGFR (Ser-967) expression. Magnification, xlOO.
- Part f depicts the results of Kaplan-Meier analysis of tumor-specific survival in patients with NSCLC according to phospho-EGFR (Ser-967) expression (P ⁇ 0.0001 by the Log-rank test).
- Figure 7 depicts the results of inhibition of cell growth/invasion by targeting TTK-EGFR pathway.
- Part a depicts the results of MTT assay demonstrating the increased growth promoting effect of TTK-stable transfectants of HEK293.
- TTK- or mock-stable transfectants of HEK293 cells were each cultured in triplicate; at each time point, the cell viability was evaluated by MTT assay. These stable transfectants were transfected with the RNAi (oligo) against EGFR (si-EGFR).
- Part b depicts the results of Matrigel invasion assay demonstrating the increased invasive ability of TTK- or mock-stable transfectants of HEK293. These stable transfectants were transfected with si-EGFR.
- Part c depicts the results of inhibition of growth of lung cancer cells by cell-permeable EGFR peptides (1 IR-EGFR) detected by MTT assay.
- Growth-suppressive effect of 11R-EGFR899-917, 11R-EGFR918-936, or 11R-EGFR937-955 that was derived from TTK-binding region in EGFR left panel.
- the treatment with scramble peptides derived from the most effective 11R-EGFR937-955 peptides resulted in no growth-suppressive effect in cell viability as measured by MTT assay (right panel). Columns, relative absorbance of triplicate assays; bars, SD.
- Figure 8 relates to the activating mutation of TTK in human lung cancer.
- Part a depicts the results of Sequence analyses of TTK mutations in lung cancer.
- a point mutation Y574C; arrow
- a point mutation resulting in amino acid substitution within the tyrosine kinase domain of TTK found in a lung cancer cell line
- RERF-LC-AL Representative wild type sequence is shown as a reference.
- Middle and right panels Point mutations (arrows) resulting in amino acid substitution within the tyrosine kinase domain of TTK in two metastatic braur tumors derived from primary lung adenocarcinoma (V610F in Case 2 and Q753H in Case 8).
- V610F in Case 2
- Q753H in Case 8
- Part b depicts the results of western-blot analysis using anti-Flag antibody detecting exogenously expressed mutant TTKs (Y574C) and (Q753H) in NIH-3T3 cells. Phospho-TTK was indicated by arrowhead.
- Part c and d depict the results of Matrigel invasion assay demonstrating the increased invasive ability of NIH-3T3 cells transfected wt-TTK-, TTK-KD-, mutant TTK (Y574C)-, or mutant TTK (Q753H)-, or mock-vector. Invading cells through Matrigel-coated filters evaluated by Giemsa staining (x200) (c) and the cell numbers counted (d).
- FIG. 9 depicts the expression of TTK in clinical samples.
- the TTK polypeptide may be a polypeptide having the amino acid sequence of SEQ ID NO: 2 or a polypeptide having the amino acid sequence of SEQ ID NO: 2 in which one or more amino acids are modified by substitution, deletion or insertion, provided the resulting polypeptide is functionally equivalent to the polypeptide of SEQ ID NO: 2.
- the TTK polypeptide may take the form of an 857-amino acid protein encoded by the open reading frame of SEQ. ID. NO. 1 , or a polynucleotide that hybridizes under stringent conditions, e.g., low or high, to the nucleotide sequence of SEQ ID NO: 1, provided the resulting polynucleotide encodes a protein that is functionally equivalent to the polypeptide of
- the term "functionally equivalent” means that the subject protein retains a biological activity of the original protein.
- Biological activities of the polypeptide of SEQ ID NO: 2 include, for example, the promotion of cell proliferation and the kinase activity of TTK for EGFR.
- a protein that is functionally equivalent to TTK preferably has kinase activity for EGFR. Whether or not a subject protein has the target activity can be determined in accordance with the present invention.
- kinase activity for EGFR can be determined by incubating a polypeptide under conditions suitable for phosphorylation of EGFR and detecting the phosphor-EGFR level.
- phosphorylation site of EGFR by TTK is Tyr992 or Ser967.
- the homology of a protein can be determined by following the algorithm in "Wilbur, W. J. and
- stringency in the context of hybridization refers to the relative rigor of hybridization standards utilized.
- suitable low stringency conditions include, for example, 42 0 C, 2x SSC, 0.1% SDS, or preferably 5O 0 C, 2x SSC, 0.1% SDS.
- a high stringency condition is used.
- control level refers to an mRNA or protein expression level detected in a control sample and may include any of (a) a normal control level or (b) a lung cancer specific control level.
- a control level can be a single expression pattern from a single reference population or composed from a plurality of expression patterns.
- the control level can be a database of expression patterns from previously tested cells.
- the phrase "normal control level” refers to a level of gene expression detected in a normal, healthy individual or in a population of individuals known not to be suffering from cancer, such as lung cancer. A normal individual is one with no clinical symptoms of cancer, particularly lung cancer.
- a "lung cancer control level” refers to a level of gene expression found in a population suffering from lung cancer.
- an expression level of a particular gene is deemed “increased" when the expression of the gene or the activity of its gene product is increased by at least 0.1, at least 0.2, at least 1, at least 2, at least 5, or at least 10 or more fold as compared to a control level.
- TTK gene expression can be determined by detecting mRNA of TTK from a tissue sample from a patient, e.g., by RT-PCR or Northern blot analysis, or detecting a protein encoded by TTK, e.g., by immunohistochemical analysis of a tissue sample from a patient.
- the specimen obtained from a subject may be any biological sample for example, a solid tissue or bodily fluid sample, obtained from' a test subject, e.g. , a patient known to or suspected of having cancer, more particularly lung cancer.
- the tissue can contain epithelial cells. More particularly, the tissue can be epithelial cells from lung cancer cells, e.g. non-small cell lung cancer or small cell lung cancer.
- the specimen may be a bodily fluid, such a blood, serum, or plasma.
- the present invention relates to cancer therapy and prevention.
- therapy against cancer or prevention of the onset of cancer includes any of the following steps, including inhibition of the growth of cancerous cells, involution of cancer, and suppression of the occurrence of cancer.
- a decrease in mortality and morbidity of individuals having cancer, decrease in the levels of tumor markers in the blood, alleviation of detectable symptoms accompanying cancer, and such are also included in the therapy or prevention of cancer.
- Such therapeutic and preventive effects are preferably statistically significant. For example, in observation, at a significance level of 5% or less, wherein the therapeutic or preventive effect of a pharmaceutical composition against cell proliferative diseases is compared to a control without administration.
- Student's t-test, the Mann- Whitney U-test, or ANOVA can be used for statistical analysis.
- prevention encompasses any activity which reduces the burden of mortality or morbidity from disease. Prevention can occur at primary, secondary and tertiary prevention levels. While primary prevention avoids the development of a disease, secondary and tertiary levels of prevention encompass activities aimed at preventing the progression of a disease and the emergence of symptoms as well as reducing the negative impact of an already established disease by restoring function and reducing disease- related complications.
- an "efficacious" treatment is one that leads to a reduction in the level of TTK or the phosphorylation levels of EGFR or a decrease in size, prevalence, or metastatic potential of lung cancer in a subject.
- efficacious means that the treatment retards or prevents occurrence of lung cancer or alleviates a clinical symptom of lung cancer.
- the assessment of lung cancer can be made using standard clinical protocols.
- the efficaciousness of a treatment can be determined in association with any known method for diagnosing or treating lung cancer. For example, lung cancer is routinely diagnosed histopathologically or by identifying symptomatic anomalies.
- EGFR Epidermal growth factor receptor
- agents that selectively block EGFR signaling have been under development; examples currently in clinical use include anti-EGFR monoclonal antibody, cetuximab (Erbitux), and small-molecule inhibitors of EGFR tyrosine kinase such as gefitinib (Iressa) and erlotinib (Tarceva) (Dowell J, et al., Nat Rev Drug Discov. 2005 Jan;4(l):13-4.; Herbst RS, et al., Nat Rev Cancer. 2004 Dec;4(12):956-65.).
- cetuximab Erbitux
- small-molecule inhibitors of EGFR tyrosine kinase such as gefitinib (Iressa) and erlotinib (Tarceva)
- Stimulation of its ligands, such as EGF, causes EGFR to undergo a conformational change and autophosphorylation that activates the EGFR signaling pathways includes the MAPK (mitogen activated protein kinase) cascade and c-Src (cellular Src) cascade (Yarden Y. Eur J Cancer. 2001 Sep;37 Suppl 4:S3-8.; Pal SK & Pegram M. Anticancer Drugs. 2005 Jun;16(5):483-94.; Tice DA, et al., Proc Natl Acad Sci U S A. 1999 Feb 16;96(4): 1415-20.).
- MAPK mitogen activated protein kinase
- c-Src cellular Src cascade
- TTK plays a significant role in pulmonary carcinogenesis through EGF-independent phosphorylation of EGFR Tyr-992 or Ser-967 and subsequent activation of downstream MAPK signals that are considered to be indispensable for tumor growth/survival.
- a novel signaling between TTK and EGFR, independent of the presence of EGF, represents a potential target for development of novel therapeutic drugs for lung cancer.
- the present invention is based, in part, on the discovery of a novel intracellular target molecule of a TTK kinase, EGFR.
- the present invention is also based on the finding that a high expression level of TTK and/or a high level of phospho-EGFR is associated with a poor prognosis in lung cancer patients.
- the lung cancer is non-small cell lung cancer (NSCLC).
- the present invention thus provides methods for assessing or determining a prognosis for lung cancer patients.
- the pohsphorylation site of EGFR is Tyr-992 or Ser-967.
- An example of such a method includes the steps of: a. detecting a TTK expression level or a phosphorylation level of EGFR in a specimen collected from a subject whose lung cancer prognosis is to be assessed or determined, and b. indicating a poor prognosis when an elevated level of TTK expression or phosphor- EGFR is detected.
- the specimen is collected from a subject.
- An example of a preferred specimen for use in the context of the present invention is a lung tissue obtained by biopsy or surgical-resection from lung cancer patients.
- the test specimen is deemed to have an elevated level of TTK expression or a phosphorylation level of EGFR.
- An example of a useful control level in the context of the present invention may include a standard value of TTK expression or a phosphorylation level of EGFR level taken from a group associated with good prognosis.
- the standard value may be obtained by any method known in the art. For example, a range of mean ⁇ 2 S.D. or mean ⁇ 3 S.D. may be used as the standard value.
- poor prognosis can be determined, when strong staining is observed by immunohistochemical analysis of sample tissue.
- an expression level of TTK may be detected by any one of the method selected from the group consisting of:
- the mRNA, the protein, or biological activity of the protein may be detected by any method. Methods for detecting a given protein, mRNA or biological activity thereof are well known to those skilled in the art. For example, mRNA may be detected using known PCR or hybridization based technologies. Alternatively, any immunoassay format may be applied for detection of a protein. Furthermore, the biological activity of TTK, e.g. a kinase activity of TTK for EGFR, may also detected using any suitable assay method, such as those described herein.
- the kinase activity of TTK for EGFR may be detected at tyrosine of 992 amino acid residue or serine of 967 amino acid residue in SEQ ID NO: 42.
- a phosphorylation level of EGFR may be detected by measuring the amount of phosphorylated EGFR, e.g.Ty ⁇ -992 or Ser-967 phosphorylated EGFR.
- the method of detecting the phosphorylated EGFR is well known to those skilled in the art. For example, immunoassay by using a specific antibody may be useful.
- determination of a poor prognosis may be used to determine further treatment, e.g., to stop further treatments that reduce quality of life, to treat the cancer in a different manner than previously used, or to treat the cancer more aggressively.
- assessment of a prognosis by TTK or phosphorylation of EGFR enables clinicians to choose, in advance, the most appropriate treatment for an individual lung cancer patient without even the information of conventional clinical staging of the disease, using only routine procedures for tissue-sampling.
- the methods of the present invention may be used to assess the efficacy of a course of treatment.
- the efficacy of an anti-cancer treatment can be assessed by monitoring the TTK expression level or the phosphorylation level of EGFR over time.
- a decrease in TTK expression level or the phosphorylation level of EGFR in a biological sample taken from a mammal following a course of treatment, as compared to a level observed in a sample taken from the mammal before treatment onset, or earlier in, the treatment may be indicative of efficacious treatment.
- an intermediate result may also be provided in addition to other test results for assessing or determining the prognosis of a subject.
- Such intermediate result may assist a doctor, nurse, or other practitioner to assess, determine, or estimate the prognosis of a subject. Additional information that may be considered, in combination with the intermediate result obtained by the present invention, to assess prognosis includes clinical symptoms and physical conditions of a subject.
- kits for assessing or determining lung cancer prognosis including any one component selected from the group consisting of: (a) a reagent for detecting the presence of an mRNA encoding the amino acid sequence of
- SEQ ED NO: 2 or tyrosine of 992 amino acid residue or serine of 967 amino acid residue in SEQ ED NO: 42, and (c) a reagent for detecting a biological activity of the protein having the amino acid sequence of SEQ ID NO: 2.
- TTK has a kinase activity for EGFR, and its expression level and phospho-EGFR level (Tyr-992 or Ser-967) revealed a shorter tumor-specific survival period. Furthermore, the phosphorylation of EGFR at Tyr-992 or Ser-967 by TTK is independent from the EGF stimulation. Thus, TTK-mediated phosphorylation of EGFR is useful as a diagnostic parameter of lung cancer, e.g. non-small cell lung cancer.
- kits for assessing or determining lung cancer or a predisposition for developing lung cancer in a subject wherein the kit includes a reagent for detecting the kinase activity of TTK for EGFR.
- the kit is also useful as a diagnostic of lung cancer, e.g. non-small cell lung cancer.
- the kinase activity of TTK for EGFR e.g. an EGF-independent phosphorylation of EGFR by TTK, may also detected using any suitable reagent.
- kinase activity of TTK for EGFR The selective phosphorylation of EGFR by TTK is revealed herein. Consequently, in another aspect, the present invention provides a method of measuring a kinase activity of TTK for EGFR. Such a method may include the steps of: a. incubating EGFR or functional equivalent thereof and TTK under conditions suitable for the EGFR phosphorylation by TTK, wherein the TTK is selected from the group consisting of: i. a polypeptide having the amino acid sequence of SEQ ID NO: 2 (TTK); ii.
- the conditions suitable for the EGFR phosphorylation may be provided with an incubation of EGFR and TTK in the presence of phosphate donor.
- preferable phosphate donor is ATP.
- the conditions suitable for the EGFR phosphorylation by TTK also include culturing cells expressing the polypeptides.
- the cell may be a transformant cell harboring an expression vector that contains a polynucleotide encoding the polypeptide.
- the phosphorylation reaction against EGFR is performed by incubation of EGFR and TTK in kinase assay buffer (for example, 50 mM Tris, pH7.4, 10 mM MgCl 2 , 2 mM dithiothreitol, 1 mM NaF, 0.2 mM ATP) for 60 min at 3O 0 C.
- kinase assay buffer for example, 50 mM Tris, pH7.4, 10 mM MgCl 2 , 2 mM dithiothreitol, 1 mM NaF, 0.2 mM ATP
- functional equivalent of EFGR is fragment of EGFR which may be comprised TTK-mediated phosphorylation site of EGFR, Tyr992 or Ser967.
- the fragment of EGFR may be comprised amono acid sequence of SEQ ID NO: 43.
- a phospho-EGFR level can be detected with an antibody recognizing phosphorylated EGFR.
- EGFR may be separated from other elements, or cell lysate of EGFR expressing cells. For instance, gel electrophoresis may be used for separation of EGFR.
- EGFR may be captured by contacting EGFR with a carrier having an anti-EGFR antibody.
- phospho-EGFR level can be detected via tracing the label. For example, radio- labeled ATP (e.g. P-ATP) was used as phosphate donor, radio activity of the separated EGFR correlates with phospho-EGFR level.
- radio- labeled ATP e.g. P-ATP
- kinase activity of TTK in biological samples may be estimated.
- the biological sample of the present invention may include cancer tissues obtained from a patient or cancer cell lines.
- the kinase activity of TTK in such biological samples is useful as credible marker for indicating lung cancer, or assessing or determining prognosis.
- the present invention further provides a reagent for measuring a kinase activity of TTK for EGFR. Examples of such reagents include EGFR and phosphate donor.
- the kit for measuring a kinase activity of TTK for EGFR is also provided.
- Such a kit may include the reagent of the present invention and detecting agent for detecting phospho-EGFR level.
- Preferable detecting agent is an antibody specifically recognizing phosphorylated EGFR from unphosphorylated EGFR.
- preferable antibody recognizes phosphorylated EGFR at Tyr992 or Ser967.
- the present invention also provides a method of diagnosing lung cancer or a predisposition for developing lung cancer in a subject, such a method including the step of determining a level of the TTK expression or the phosphorylation of EGFR in a biological sample derived from the subject, wherein an increase in said level, as compared to a normal control level, indicates that said subject suffers from or is at risk of developing lung cancer.
- any sample derived from a subject to be diagnosed may be used.
- An example of a preferred sample for use in the context of the present invention is a lung tissue obtained by biopsy or surgical-resection.
- the phosphorylation site of EGFR by TTK is Tyr992 or Ser967.
- an intermediate result for examining the condition of a subject may be provided.
- Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to determine that a subject suffers from lung cancer.
- the present invention relates to a method for screening a person who is required to be further diagnosed for lung cancer. After the screening, persons indicating positive result are recommended to be submitted further screening test, or medical treatment to confirm whether they truly suffer from lung cancer.
- the present invention may be used to detect cancerous cells in a subject- derived tissue, and provide a doctor with useful information to determine that the subject suffers from lung cancer. Accordingly, the present invention involves determining (e.g., measuring) a level of a kinase activity of TTK for EGFR in subject derived samples.
- a method for diagnosing lung cancer also includes a method for testing or detecting lung cancer.
- diagnosing lung cancer also refers to showing a suspicion, risk, or possibility of lung cancer in a subject.
- the diagnostic method of the present invention involves the step of determining (e.g., measuring) the expression of TTK.
- sequence of TTK gene can be detected and measured using conventional techniques well known to one of ordinary skill in the art. For example, northern blot hybridization analyses can be used for determining the expression of TTK gene.
- Hybridization probes typically include at least 10, at least 20, at least 50, at least 100, or at least 200 consecutive nucleotides of TTK sequence.
- the sequences can be used to construct primers for specifically amplifying the TTK nucleic acid in, e.g., amplification- based detection methods, for example, reverse-transcription based polymerase chain reaction (RT-PCR).
- an antibody against TTK e.g. , an anti-TTK polyclonal antibody or anti-TTK monoclonal antibody, can be used for immunoassay, for example, immunohistochemical analysis, western blot analysis or ELISA, etc.
- the expression of TTK can be detected by the biological activity.
- the biological activity is cell proliferative activity or invasion activity or kinase activity against EGFR Tyr997 or Ser967. The method of detecting the kinase activity described in above.
- the diagnostic method of the invention involves the step of determining the pohsphorylation level of EGFR.
- the pohsphorylation site of EGFR is Tyr992 or Ser967.
- the antibody that specifically recognizes the pohsphorylation without non- phosphorylation type can be used for immunoassay, for example, immunohistochemical analysis, western blot analysis or ELISA, etc.
- the level of the TTK expression or the pohsphorylation level of EGFR detected in a test cell population can then be compared to that in a reference cell population.
- the reference cell population may include one or more cells for which the compared parameter is known, i.e., lung cancer cells or normal lung epithelial cells (non-lung cancer cells).
- the level of the TTK expression or the pohsphorylation level of EGFR in a test cell population as compared to a reference cell population indicates the presence of lung cancer or a predisposition thereto depends upon the composition of the reference cell population. For example, if the reference cell population is composed of non-lung cancer cell, a similarity in the level between the test cell population and the reference cell population indicates the test cell population is non-lung cancer. Conversely, if the reference cell population is made up of lung cancer cells, a similarity in gene expression between the test cell population and the reference cell population indicates that the test cell population includes lung cancer cells.
- the level of the TTK expression or the pohsphorylation level of EGFR in a test cell population is considered “altered” or deemed to “differ” if it varies from the level in a reference cell population by more than 1.1, more than 1.5, more than 2.0, more than 5.0, more than 10.0 or more fold.
- Differential gene expression between a test cell population and a reference cell population can be normalized to a control gene, e.g. a housekeeping gene.
- a control gene is one which is known not to differ depending on the cancerous or non-cancerous state of the cell.
- the expression level of a control gene can thus be used to normalize signal levels in the test and reference cell populations.
- Exemplary control genes include, but are not limited to, e.g., beta-actin, glyceraldehyde 3- phosphate dehydrogenase and ribosomal protein Pl.
- the test cell population can be compared to multiple reference cell populations. Each of the multiple reference cell populations can differ in the known parameter. Thus, a test cell population can be compared to a first reference cell population known to contain, e.g. , lung cancer cells, as well as a second reference cell population known to contain, e.g., non-lung cancer cells (normal cells).
- the test cell population can be included in a tissue or cell sample from a subject known to contain, or suspected of containing, lung cancer cells.
- the test cell population can be obtained from a bodily tissue or a bodily fluid, e.g., biological fluid (for example, blood, sputum, saliva).
- the test cell population can be purified from lung tissue.
- the test cell population comprises an epithelial cell.
- the epithelial cell is preferably from a tissue known to be or suspected to be lung carcinoma.
- Cells in the reference cell population are preferably from a tissue type similar to that of the test cell population.
- the reference cell population is a cell line, e.g. a lung cancer cell line (i.e., a positive control) or a normal non-lung cancer cell line (i.e., a negative control).
- the control cell population can be from a database of molecular information obtained from cells for which the assayed parameter or condition is known.
- the subject is preferably a mammal.
- exemplary mammals include, but are not limited to, e.g., a human, non-human primate, mouse, rat, dog, cat, horse, or cow.
- the present invention also provides a kit for detection of kinase activity of TTK for
- kits examples include, EGFR, an antibody that binds to phospho-EGFR, e.g. anti-phospho-EGFR (Tyr992) antibody or anti-phospho-EGFR (Ser967) antibody, and a detectable label for detecting the antibody.
- An antibody recognizing phosphorylated Tyr992 or Ser967 of EGFR is commercially available. Alternatively, " it is well known that such antibody can be obtained by immunization with phosphorylated EGFR at Tyr992 or Ser967, or fragment thereof that includes the Tyr992 or Ser967 residue.
- the TTK cDNA consists of 2,984 nucleotides that contain an open reading frame of 2,571 nucleotides as set forth in SEQ. ID. NO.: 1 (GenBank Accession No. NM 003318).
- the open reading frame encodes an 857-amino acid protein having amino acid sequence as set forth in SEQ. ID. NO.: 2 (GenBank Accession No. NP_003309).
- Mpsl (TTK is its human homologue) was first discovered in budding yeast as a factor to be required in centrosome duplication and was subsequently shown to have a critical function in the spindle checkpoint.
- the present invention also relates to the finding that TTK has the kinase activity for EGFR.
- the phosphorylation site of EGFR by TTK is Tyr992 or Ser967 and the phosphorylation is EGF-independent.
- one aspect of the invention involves identifying test compounds that regulate TTK-mediated phosphorylation of EGFR.
- the present invention provides novel methods for identifying compounds that modulates a kinase activity of TTK for EGFR.
- the present invention provides a method of identifying an agent that modulates a kinase activity of TTK for EGFR, such a method including the steps of: a.
- TTK is a polypeptide selected from the group consisting of: i. a polypeptide having the amino acid sequence of SEQ ID NO: 2 (TTK); ii. a polypeptide having the amino acid sequence of SEQ ID NO: 2 wherein one or more amino acids are modified by substitution, deletion or insertion, provided the resulting polypeptide has a biological activity equivalent to the polypeptide having the amino acid sequence of SEQ ID NO: 2; iii.
- a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide having the nucleotide sequence of SEQ ID NO: 1 provided the resulting polypeptide has a biological activity equivalent to the polypeptide having the amino acid sequence of SEQ ID NO: 2; b. detecting a phospho-EGFR level; and c. comparing the phospho-EGFR level to a control level, wherein an increase or decrease in the phospho-EGFR level as compared to the control level indicates that the test compound modulates the kinase activity of TTK for EGFR.
- Agents identified by the present method constitute candidate compounds that may slow or arrest the progression of, e.g., lung cancer, by inhibiting TTK-mediated phosphorylation of EGFR. Accordingly, the invention thus provides a method of screening for a compound that modulates TTK kinase activity for EGFR, e.g. EGF independent phosphorylation of EGFR by TTK.
- a compound that modulates TTK kinase activity for EGFR e.g. EGF independent phosphorylation of EGFR by TTK.
- the phosphorylation site of EGFR is Tyr992 or Ser967.
- the method is practiced by contacting a TTK, or a functional equivalent thereof having kinase activity for EGFR, and EGFR or functional equivalent thereof capable of phosphorylation by TTK, with one or more candidate compounds, and assaying phospho-EGFR level.
- the functional equivalent of EGFR that is capable of phosphorylation by TTK may be comprised TTK-mediated phosphorylation site of EGFR, Tyr992 or Ser967. More preferably, the fragment of EGFR may be comprised the region from 889aa to 1045aa of SEQ ID NO: 42.
- a compound that modulates phosphorylation of EGFR by TTK or functional equivalent is thereby identified. Consequently, the present invention also provides a method of screening for a compound for treating and/or preventing lung cancer, such a method including the steps of: a. identifying a test compound that modulates kinase activity of TTK for EGFR by the method as mentioned above, and b. selecting a compound that decreases the phospho-EGFR level as compared to a control level.
- kits for detecting the ability of a test compound to modulate kinase activity of TTK for EGFR may include the components of:
- kits for detecting for the ability of a test compound to modulate kinase activity of TTK for EGFR may include the components of: A) a cell expressing EGFR or functional equivalent thereof a polypeptide selected from the group consisting of: i. a polypeptide having the amino acid sequence of SEQ ID NO: 2 (TTK); ii. a polypeptide having the amino acid sequence of SEQ ID NO: 2 wherein one or more amino acids are modified by substitution, deletion or insertion, provided the resulting polypeptide has a biological activity equivalent to the polypeptide having the amino acid sequence of SEQ ID NO: 2; iii.
- the functional equivalent of EGFR is the fragment consisting of amino acid sequence of SEQ ID NO: 43.
- the kit may further include phosphate donor. Preferable phosphate donor is ATP.
- the reagent for detection in the kit of the present invention may also include an antibody recognizes phosphorylated Tyr992 or Ser967 of EGFR as the reagent for detecting a phospho-EGFR.
- the present invention further provides a composition for treating or preventing lung cancer, such a composition composed of a pharmaceutically effective amount of a compound that decreases a kinase activity of TTK for EGFR and a pharmaceutically acceptable carrier.
- the term "functionally equivalent" means that the subject protein retains the biological activity of the original protein, in this case the kinase activity for EGFR. Whether or not a subject protein has the target activity can be determined in accordance with the present invention.
- kinase activity for EGFR can be determined by incubating a polypeptide under conditions suitable for phosphorylation of EGFR and detecting the phosphor-EGFR level.
- the phosphorylation site of EGFR by TTK is Tyr992 or Ser967.
- Methods for preparing proteins functionally equivalent to a given protein are well known to those skilled in the art and include conventional methods of introducing mutations into the protein.
- one skilled in the art can prepare proteins functionally equivalent to the human TTK protein by introducing an appropriate mutation in the amino acid sequence of the human TTK protein via site-directed mutagenesis (Hashimoto-Gotoh, T. et al.
- the proteins suitable for use in the context present invention include those proteins having the amino acid sequences of the human TTK protein in which one or more amino acids are mutated, provided the resulting mutated proteins are functionally equivalent to the human TTK protein.
- the number of amino acids to be mutated in such a mutant is generally 25 amino acids or less, preferably 10 to 15 amino acids or less, more preferably 5 to 6 amino acids or less, and even more preferably 2 to 3 amino acids or less.
- Mutated or modified proteins proteins having amino acid sequences modified by substitution, deletion or insertion of one or more amino acid residues of a certain amino acid sequence, are known to retain the original biological activity (Mark, D. F. et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-6, Zoller, M. J. & Smith, M., Nucleic Acids Research (1982) 10, 6487-500, Wang, A. et al., Science (1984) 224, 1431-3, Dalbadie-McFarland, G et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-13).
- the amino acid residue to be mutated is preferably mutated into a different amino acid in which the properties of the amino acid side-chain are conserved (a process known in the art as "conservative amino acid substitution").
- properties of amino acid side chains are hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), and side chains having the following functional groups or characteristics in common: an aliphatic side-chain (G, A, V, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side- chain (D, N, E, Q); a base containing side-chain (R, K, H); and an aromatic containing side-chain (H, F, Y, W).
- the parenthetic letters indicate the one-letter codes of amino acids
- a protein to which one or more amino acids residues are inserted or added to the amino acid sequence of human TTK protein is a fusion protein containing the human TTK protein.
- Fusion proteins suitable for use in the context of the present invention include, for example, fusions of the human TTK protein and other peptides or proteins. Fusion proteins can be made using techniques well known to those skilled in the art, for example by linking the DNA encoding the human TTK protein of the invention with DNA encoding other peptides or proteins, so that the frames match, inserting the fusion DNA into an expression vector and expressing it in a host. There is no restriction as to the peptides or proteins to be fused to the protein of the present invention.
- peptides that can be used as peptides that are fused to the TTK protein include, for example, FLAG (Hopp, T. P. et al., (1988) Biotechnology 6, 1204-10), 6xHis containing six His (histidine) residues, lOxHis, Influenza agglutinin (HA), human c-myc fragment, VSP-GP fragment, pi 8HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen fragment, lck tag, alpha- tubulin fragment, B-tag, Protein C fragment, and the like.
- FLAG Hopp, T. P. et al., (1988) Biotechnology 6, 1204-10
- 6xHis containing six His (histidine) residues include, for example, 6xHis containing six His (histidine) residues, lOxHis, Influenza agglutinin (HA), human c-myc fragment, VSP-GP fragment, pi 8HIV
- Fusion proteins can be prepared by fusing commercially available DNA, encoding the fusion peptides or proteins discussed above, with the DNA encoding a protein of the present invention and expressing the fused DNA prepared.
- An alternative method known hi the art to isolate functional equivalent proteins is, for example, the method using a hybridization technique (Sambrook, J. et ah, (1989) Molecular Cloning 2nd ed. 9.47-9.58, Cold Spring Harbor Lab. Press).
- One skilled in the art can readily isolate a DNA having high homology with a whole or part of the TTK DNA sequence (e.g., SEQ ID NO: 1) encoding the human TTK protein, and isolate functional equivalent proteins to the human TTK protein from the isolated DNA.
- the proteins used for the present invention include those that are encoded by DNA that hybridize with a whole or part of the DNA sequence encoding the human TTK protein and are functional equivalent to the human TTK protein.
- proteins include mammal homologues corresponding to the protein derived from human or rat (for example, a protein encoded by a monkey, mouse, rabbit and bovine gene).
- mammal homologues corresponding to the protein derived from human or rat (for example, a protein encoded by a monkey, mouse, rabbit and bovine gene).
- isolating a cDNA highly homologous to the DNA encoding the human TTK protein from animals it is particularly preferable to use tissues from testis or lung cancer.
- hybridization may be performed by conducting pre-hybridization at 68 0 C for 30 min or longer using "Rapid-hyb buffer" (Amersham LIFE SCIENCE), adding a labeled probe, and warming at 68 0 C for 1 hour or longer.
- the following washing step can be conducted, for example, for a low stringency condition.
- Exemplary low stringency conditions include, for example, 42°C, 2x SSC, 0.1% SDS 3 or preferably 5O 0 C, 2x SSC, 0.1% SDS. More preferably, high stringency conditions are selected.
- Exemplary high stringency conditions include, for example, washing 3 times in 2x SSC, 0.01% SDS at room temperature for 20 min, then washing 3 times in Ix SSC, 0.1% SDS at 37 0 C for 20 min, and washing twice in Ix SSC, 0.1% SDS at 5O 0 C for 20 min.
- factors such as temperature and salt concentration, can influence the stringency of hybridization. Selection of the factors necessary to achieve a requisite level of stringency constitutes routine optimization that is well within the purview of one skilled in the art.
- a gene amplification method for example, the polymerase chain reaction (PCR) method, can be utilized to isolate a DNA encoding a protein functionally equivalent to the human TTK protein, using a primer synthesized based on the sequence information of the DNA (SEQ ID NO: 1) encoding the human TTK protein (SEQ ID NO: 2).
- PCR polymerase chain reaction
- proteins that are functionally equivalent to the human TTK protein, encoded by the DNA isolated through the above hybridization techniques or gene amplification techniques normally have a high homology to the amino acid sequence of the human TTK protein.
- the term "high homology” refers to a homology of 40% or higher, preferably 60% or higher, more preferably 80% or higher, even more preferably 95% or higher.
- the homology of a protein can be determined by following the algorithm in "Wilbur, W. J. and Lipman, D. J. (1983) Proc. Natl. Acad. Sci. USA 80, 726-30".
- a protein useful in the context of the present invention may have variations in amino acid sequence, molecular weight, isoelectric point, the presence or absence of sugar chains, or form, depending on the cell or host used to produce it or the purification method utilized. Nevertheless, so long as it is functionally equivalent to a human TTK protein (SEQ ID NO: 2), it is useful in the context of the present invention.
- the proteins useful in the context of the present invention can be prepared as recombinant proteins or natural proteins, by methods well known to those skilled in the art.
- a recombinant protein can be prepared, for example, by inserting a DNA encoding a protein of the present invention (for example, the DNA having the nucleotide sequence of SEQ ID NO: 1) into an appropriate expression vector, introducing the vector into an appropriate host cell, obtaining the extract, and purifying the protein by subjecting the extract to chromatography, for example, ion exchange chromatography, reverse phase chromatography, gel filtration, or affinity chromatography utilizing a column to which antibodies against the protein of the present invention are fixed, or by combining more than one of aforementioned columns.
- chromatography for example, ion exchange chromatography, reverse phase chromatography, gel filtration, or affinity chromatography utilizing a column to which antibodies against the protein of the present invention are fixed, or by combining more than one of aforementioned columns.
- a protein useful in the context of the present invention when expressed within host cells (for example, animal cells and E. coif) as a fusion protein with glutathione-S- transferase protein or as a recombinant protein supplemented with multiple histidines, the expressed recombinant protein can be purified using a glutathione column or nickel column.
- a natural protein can be isolated by methods known to those skilled in the art, for example, by contacting an affinity column, in which antibodies binding to the TTK protein described below are bound, with the extract of tissues or cells expressing a protein of the present invention.
- the antibodies can be polyclonal antibodies or monoclonal antibodies.
- a kinase activity of TTK or its functional equivalent can be determined by methods known in the art. For example, TTK and EGFR can be incubated with an ATP, under suitable assay conditions for a phosphorylation of EGFR by TTK.
- exemplary conditions for the phosphorylation of EGFR include the steps of contacting TTK with EGFR or cell extracts, and incubating them, hi the present invention, conditions for the phosphorylation of EGFR may be provided by the incubation of TTK with EGFR in the presence of phosphate donor.
- An ATP is an example of suitable phosphate donor.
- a radio labeled ATP can be the phosphate donor.
- the increased radio-labeled-EGFR may be detected by any suitable method. For example, in a hot assay, the radio-labeled-EGFR is detected by scintillation counter.
- the phospho-EGFR is detected using an antibody binding to phospho-EGFR, e.g. western blot assay or ELISA.
- an antibody binding to phospho-EGFR e.g. western blot assay or ELISA.
- suitable conditions for phosphorylation of EGFR by TTK are set forth below: Reaction mixture:
- the reaction mixture is mixed with a sample containing TTK to be determined, and incubated for 60 min. at 3O 0 C.
- the reactions were stopped by addition of Laemmli sample buffer and heating at 95°C for 5 min. Proteins were resolved by SDS-PAGE and then western- blot using an antibody binding to phospho-EGFR.
- a kinase activity of TTK for EGFR can be estimated based on a radio- labeled-EGFR by scintillation counter.
- a phospho-EGFR can be detected by an antibody based f
- a phospho-EGFR can be detected with mass spectrometry, e.g. MALDI-TOF-MS.
- the phosphorylation site of EGFR by TTK is Tyr992 or Ser967.
- the kinase activity of TTK for EGFR at Tyr992 or Ser967 may be detected by using an antibody specific for phospho-EGFR (Tyr992 or Ser967).
- Various low-throughput and high-throughput enzyme assay formats are known in the art and can be readily adapted for detection or measuring of the phosphorylation level of EGFR by TTK.
- the EGFR is preferably immobilized on a solid support, such as a multi-well plate, slide or chip.
- the phospho-EGFR can be detected on the solid support.
- an antibody binding to phospho-EGFR can be used.
- the phosphorylation site of EGFR by TTK is Tyr992 or Ser967.
- the phosphorylation of EGFR at Tyr992 or Ser967 by TTK may be detected by using an antibody specific for phosphor-EGFR (Tyr992 or Ser967).
- P 32 labeled ATP may be used as a phosphate donor.
- the phospho-EGFR can be traced with radioactive P 32 .
- the solid support may be coated with streptavidin and the EGFR labeled with biotin. The skilled person can determine suitable assay formats depending on the desired throughput capacity of the screen.
- test compound including, but not limited to, cell extracts, cell culture supernatant, products of fermenting microorganisms, extracts from marine organisms, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds and natural compounds, can be used in the screening methods of the present invention.
- the test compound of the present invention can be also obtained using any of the numerous approaches in combinatorial library methods known in the art, including (1) biological libraries, (2) spatially addressable parallel solid phase or solution phase libraries, (3) synthetic library methods requiring deconvolution, (4) the "one-bead, one-compound” library method and (5) synthetic library methods using affinity chromatography selection.
- a compound isolated by the screening method of the present invention is a candidate for the development of drugs that inhibit a kinase activity of TTK for EGFR and can be applied to the treatment or prevention of lung cancer.
- the kinase activity of TTK for EGFR is EGF-independent.
- the phosphorylation site of EGFR is Tyr-992 or Ser-967.
- a compound in which a part of the structure of the compound inhibiting the kinase activity of TTK for EGFR is converted by addition, deletion and/or replacement are also included in the compounds obtainable by the screening method of the present invention.
- Treating and preventing lung cancer provides compositions for treating or preventing lung cancer containing any of the compounds selected by the screening methods of the present invention.
- a compound isolated by a method of the present invention as a pharmaceutical for humans and other mammals, such as mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, and chimpanzees
- the isolated compound can be directly administered or, alternatively, can be formulated into a dosage form using conventional pharmaceutical preparation methods.
- the drugs can be taken orally, as sugar-coated tablets, capsules, elixirs and microcapsules, or non-orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid.
- the compound can be mixed with pharmaceutically acceptable carriers or media, specifically, sterilized water, physiological saline, plant-oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders, and such, in a unit dose form required for generally accepted drug implementation.
- the amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable.
- additives that can be mixed to form tablets and capsules include, for example, binders, such as gelatin, corn starch, tragacanth gum and arabic gum; excipients, such as crystalline cellulose; swelling agents, such as corn starch, gelatin and alginic acid; lubricants, such as magnesium stearate; sweeteners, such as sucrose, lactose or saccharin; and flavoring agents, such as peppermint, Gaultheria adenothrix oil and cherry.
- a liquid carrier such as an oil
- Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections.
- Physiological saline, glucose, and other isotonic liquids can be used as aqueous solutions for injections.
- adjuvants such as D- sorbitol, D-mannose, D-mannitol, and sodium chloride
- sorbitol can be used as aqueous solutions for injections.
- suitable solubilizers such as alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, non-ionic surfactants, such as Polysorbate 80 (TM) and HCO-50.
- TM Polysorbate 80
- Sesame oil and soy-bean oil are examples of suitable oleaginous liquids and may be used in conjunction with benzyl benzoate or benzyl alcohol as solubilizers.
- a buffer such as phosphate buffer or sodium acetate buffer
- a pain-killer such as procaine hydrochloride
- a stabilizer such as benzyl alcohol or phenol
- an anti-oxidant such as benzyl alcohol or phenol
- the prepared injection may be filled into a suitable ampule.
- Methods well known to those skilled in the art may be used to administer a pharmaceutical composition of the present invention to patients, for example, as intra-arterial, intravenous, or percutaneous injections and also as intranasal, transbronchial, intramuscular or oral administrations.
- the dosage and method of administration may vary according to the body- weight and age of the patient and the selected administration method; however, one skilled in the art can routinely select a suitable method of administration and dosage.
- the DNA can be inserted into a vector for gene therapy and the vector can be administered to a patient to perform the therapy.
- the dosage and method of administration may again vary according to the body- weight, age, and symptoms of the patient; however, one skilled in the art can suitably select them.
- a suitable dose is generally about 0.1 mg to about 100 mg per day, preferably about 1.0 mg to about 50 mg per day and more preferably about 1.0 mg to about 20 mg per day, when administered orally to a normal adult (weight 60 kg).
- the present invention includes pharmaceutical, or therapeutic, compositions containing one or more therapeutic compounds described herein.
- Pharmaceutical formulations may include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, subcutaneous and intravenous) administration, or for administration by inhalation or insufflation.
- the formulations may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods conventional in the art of pharmacy. All such Pharmaceutical methods herein include the steps of bringing into association the active compound with liquid carriers or finely divided solid carriers or both as needed and then, if necessary, shaping the product into the desired formulation.
- compositions suitable for oral administration may conveniently be presented as discrete units, such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; or as a solution, a suspension or as an emulsion.
- the active ingredient may also be presented as a bolus electuary or paste, and be in a pure form, i.e., without a carrier.
- Tablets and capsules for oral administration may contain conventional excipients, such as binding agents, fillers, lubricants, disintegrant or wetting agents.
- a tablet may be made by compression or molding, optionally with one or more fo ⁇ nulational ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form, such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art. Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use.
- Such liquid preparations may contain conventional additives, such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives.
- the tablets may optionally be formulated so as to provide slow or controlled release of the active ingredient therein.
- Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non- aqueous sterile suspensions which may include suspending agents and thickening agents.
- the formulations may be presented in unit dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline, water-for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion.
- Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
- Formulations for rectal administration may be presented as a suppository with the usual carriers, such as cocoa butter or polyethylene glycol.
- Formulations for topical administration in the mouth include lozenges, containing the active ingredient in a flavored base, such as sucrose and acacia or tragacanth, and pastilles containing the active ingredient in a base, such as gelatin and glycerin or sucrose and acacia.
- the compounds of the present invention may be used as a liquid spray or dispersible powder or in the form of drops. Drops may be formulated with an aqueous or non- aqueous base also including one or more dispersing agents, solubilizing agents or suspending agents. Liquid sprays are conveniently delivered from pressurized packs.
- the compounds of the present invention are conveniently delivered from an insufflator, nebulizer, pressurized pack or other convenient aerosol spray delivery means.
- Pressurized packs may include a suitable propellant, such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- the compounds of the present invention may take the form of a dry powder composition, for example a powder mix of the compound and a suitable powder base, such as lactose or starch.
- a suitable powder base such as lactose or starch.
- the powder composition may be presented in a unit dosage form, in for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators.
- compositions of the present invention may also contain other active ingredients, such as antimicrobial agents, immunosuppressants or preservatives.
- formulations of the present invention may include other agents conventional in the art, having regard to the type of formulation in question; for example, those suitable for oral administration may include flavoring agents.
- Preferred unit dosage formulations are those containing an effective dose, as recited below, or an appropriate fraction thereof, of the active ingredient.
- the compositions may be administered orally or via injection at a dose ranging from about 0.1 to about 250 mg/kg per day.
- the dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day.
- Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple of the same, for instance, units containing about 5 mg to about 500 mg, usually from about 100 mg to about 500 mg.
- the pharmaceutical composition preferably is administered orally or by injection (intravenous or subcutaneous), and the precise amount administered to a subject will be the responsibility of the attendant physician.
- the dose employed will depend upon a number of factors, including the age and sex of the subject, the precise disorder being treated, and its severity.
- the route of administration may vary depending upon the condition and its severity.
- the present invention is based in part on the discovery of the various amino acid substitutions of TTK at kinase domain, especially the mutations resulted in promoting the TTK kinase activity and the invasive ability.
- the present invention thus provides methods for predicting metastasis of lung cancer.
- An example of such a method includes the steps of: detecting one or more mutations of TTK at kinase domain, and then indicating a high risk of metastasis of lung cancer when a mutation is detected.
- one or more amino acid substitutions of TTK at kinase domain are Valine to Phenylalanine at codon 610 (V610F), Glutamine to Histidine at codon 753 (Q753H) and Tyrosine to Cysteine at codon 574 (Y574C) of SEQ ID NO: 2.
- V610F Valine to Phenylalanine at codon 610
- Q753H Glutamine to Histidine at codon 753
- Tyrosine to Cysteine at codon 574 Y574C of SEQ ID NO: 2.
- the detection can be accomplished by sequencing, mini-sequencing, hybridization, restriction fragment analysis, oligonucleotide ligation assay or allele specific PCR.
- the present invention also provides a method and reagent for detecting such TTK mutant.
- the present invention provides a method for detecting one or more mutation of TTK, wherein the mutation is at least one mutation selected from the group consisted of Valine to Phenylalanine at codon 610 (V610F), Glutamine to Histidine at codon 753 (Q753H) and Tyrosine to Cysteine at codon 574 (Y574C) of SEQ ID NO: 2.
- the method of the present invention includes steps of: a) contacting a subject polypeptide or cDNA encoding thereto with a binding agent recognizing any one of the mutation of the polypeptide or cDNA encoding thereto, b) detecting the binding agent with the polypeptide or cDNA encoding thereto, and c) showing the mutation of TTK when the binding of the agent of step b) is detected.
- a binding agent recognizing any one of the mutation of the polypeptide is preferably an antibody that binds to polypeptide having at least one mutation selected from the group consisted of Valine to Phenylalanine at codon 610 (V610F), Glutamine to Histidine at codon 753 (Q753H) and Tyrosine to Cysteine at codon 574 (Y574C) of SEQ ID NO: 2, and substantially not binds to the polypeptide of SEQ ID NO: 2.
- the antibody may be monoclonal antibody or polyclonal antibody, or fragment thereof that contains the antigen-binding region.
- such antibodies may be obtained by conventional methods of immunization of TTK polypeptide or immunological-active fragment containing the mutation.
- a screening of antibody variable region recognizing the TTK mutant from antibody library may be performed using TTK mutant as antigen.
- a preferred antibody will specifically recognize the TTK mutant.
- Such antibody is referred as TTK mutant specific antibody.
- a preferred TTK mutant specific antibody will substantially not bind to the polypeptide of SEQ ID NO: 2.
- antibody which substantially does not bind with wild type of TTK having the amino acid sequence of SEQ ID NO: 2 shows generally 30% or less, preferably 20% or less, more preferably 10% or less of reactivity with wild type of TTK, comparing with that of TTK mutant.
- the TTK mutant includes at least one mutation selected from the group consisted of Valine to Phenylalanine at codon 610 (V610F), Glutamine to Histidine at codon 753 (Q753H) and Tyrosine to Cysteine at codon 574 (Y574C) of SEQ ID NO: 2.
- Such mutant may be prepared by conventional method of introducing site specific mutations into the protein.
- one skilled in the art can prepare proteins having the mutation by introducing site specific mutation in the amino acid sequence of the human TTK protein via site- directed mutagenesis (Hashimoto-Gotoh, T. et al. (1995), Gene 152, 271-5; Zoller, MJ, and Smith, M. (1983), Methods Enzymol.
- TTK mutant can also be detected by determining of the nucleotide sequence of cDNA encoding TTK mutant.
- primers or probes annealing with the cDNA (or mRNA) at region may include any one codon of Valine to Phenylalanine at codon 610 (V610F), Glutamine to Histidine at codon 753 (Q753H) and Tyrosine to Cysteine at codon 574 (Y574C) of SEQ ID NO: 2.
- the present invention also provides a reagent for detecting one or more mutation of TTK, wherein the mutation is at least one mutation selected from the group consisted of Valine to Phenylalanine at codon 610 (V610F), Glutamine to Histidine at codon 753 (Q753H) and Tyrosine to Cysteine at codon 574 (Y574C) of SEQ ID NO: 2, wherein the reagent includes a binding agent recognizing any one of the mutation of the polypeptide or cDNA encoding thereto.
- polynucleotides that encode a TTK mutant or fragment thereof that includes the mutated position are useful as control samples for detecting the mutation.
- the present invention provides an isolated polynucleotide having the nucleotide sequence of SEQ ID NO: 1, in which one or more mutations selected from group consisting of A1870G (for Y574C), G1977T (for V610F), and G2408C (for Q753H) are included, or fragment thereof containing the one or more mutations.
- polynucleotide of TTK mutant can be used as positive control.
- any fragment of the polynucleotide of TTK mutant may be used as such control, unless at least one mutation is included.
- Preferable length of the fragments of the polynucleotide of TTK mutant is generally 25 or more, 50 or more, 100 or more, and more preferably 200 or more nucleotides.
- a polypeptide encoding a TTK mutant or fragment thereof containing the mutated position is also useful as control sample for detecting the mutation.
- the present invention provides an isolated polypeptide having the amino acid sequence of SEQ ID NO: 2, in which one or more mutations selected from group consisting of V610F, Q753H and for Y574C are included, or fragment thereof containing the one or more mutations.
- polypeptide of TTK mutant can be used as positive control.
- any fragment of the polypeptide of TTK mutant may be used as such control, unless at least one mutation is included.
- the mutation of TTK polypeptide can also be detected by molecular mass analysis of whole peptide or fragment thereof.
- Length of the fragments of the polypeptide of TTK mutant is generally 10 or more, preferably 20 or more, or 50 or more, and more preferably 100 or more amino acid residues.
- the present invention relates to inhibitory polypeptides that contain
- the inhibitory polypeptide comprises ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46); a polypeptide functionally equivalent to the polypeptide; or polynucleotide encoding those polypeptides, wherein the polypeptide lacks the kinase activity of TTK for EGFR.
- polypeptides comprising the selected amino acid sequence of the present invention can be of any length, so long as the polypeptide contain the amino acid sequence of ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) and inhibits cancer cell proliferation.
- the length of the amino acid sequence may range from 19 to 76 residues preferably from 19 to 57, more more preferably from 19 to 38.
- the polypeptides of the present invention may contain two or more "selected amino acid sequences".
- the two or more "selected amino acid sequences” may be the same or different amino acid sequences.
- the "selected amino acid sequences” can be linked directly. Alternatively, they may be disposed with any intervening sequences among them.
- the present invention relates to polypeptides homologous ⁇ i.e., share sequence identity) to the ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) polypeptide specifically disclosed here.
- polypeptides homologous to the ISSILEKGERLPQPPICTI SEQ ID NO: 44
- DVYMIMVKCWMIDADSRPK SEQ ID NO: 45
- FRELIIEFSKMARDPQRYL SEQ ID NO: 46
- polypeptides functionally equivalent to the ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) peptide in the present invention preferably have amino acid mutations in sites other than the ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) sequence.
- Amino acid sequences of polypeptides functionally equivalent to the ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) peptide in the present invention conserve the ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) sequence, and have 60% or higher, usually 70% or higher, preferably 80% or higher, more preferably 90% or higher, or 95% or higher, and further more preferably 98% or higher homology to a "selected amino acid sequence". Amino acid sequence homology can be determined using algorithms well known in the art, for example, BLAST or ALIGN set to their default settings.
- polypeptides of the present invention can be chemically synthesized from any position based on selected amino acid sequences.
- Methods used in the ordinary peptide chemistry can be used for the method of synthesizing polypeptides. Specifically, the methods include those described in the following documents and Japanese Patent publications: Peptide Synthesis, Interscience, New York, 1966; The Proteins, Vol. 2, Academic Press
- polypeptides of the present invention can be also synthesized by known genetic engineering techniques.
- An example of genetic engineering techniques is as follows. Specifically, DNA encoding a desired peptide is introduced into an appropriate host cell to prepare a transformed cell.
- the polypeptides of the present invention can be obtained by recovering polypeptides produced by this transformed cell.
- a desired polypeptide can be synthesized with an in vitro translation system, in which necessary elements for protein synthesis are reconstituted in vitro.
- the polypeptide of the present invention can be expressed as a fused protein with a peptide having a different amino acid sequence.
- a vector expressing a desired fusion protein can be obtained by linking a polynucleotide encoding the polypeptide of the present invention to a polynucleotide encoding a different peptide so that they are in the same reading frame, and then introducing the resulting nucleotide into an expression vector.
- the fusion protein is expressed by transforming an appropriate host with the resulting vector.
- Different peptides to be used in forming fusion proteins include the following peptides:
- 6xHis consisting of six His (histidine) residues, lOxHis,
- VSV-GP fragment pl ⁇ HIV fragment
- Immunoglobulin constant region ⁇ -galactosidase
- MBP maltose-binding protein
- the polypeptide of the present invention can be obtained by treating the fusion protein thus produced with an appropriate protease, and then recovering the desired polypeptide.
- the fusion protein is captured in advance with affinity chromatography that binds with the fusion protein, and then the captured fusion protein can be treated with a protease.
- the desired polypeptide is separated from affinity chromatography, and the desired polypeptide with high purity is recovered.
- the polypeptides of the present invention include modified polypeptides.
- the term "modified" refers, for example, to binding with other substances. Accordingly, in the present invention, the polypeptides of the present invention may further comprise other substances such as cell-membrane permeable substance.
- the other substances include organic compounds such as peptides, lipids, saccharides, and various naturally-occurring or synthetic polymers.
- the polypeptides of the present invention may have any modifications so long as the polypeptides retain the desired activity of inhibiting the kinase activity of TTK for EGFR.
- the inhibitory polypeptides can directly compete with EGFR binding to TTK. Modifications can also confer additive functions on the polypeptides of the invention. Examples of the additive functions include targetability, deliverability, and stabilization.
- modifications in the present invention include, for example, the introduction of a cell-membrane permeable substance.
- the intracellular structure is cut off from the outside by the cell membrane. Therefore, it is difficult to efficiently introduce an extracellular substance into cells.
- Cell membrane permeability can be conferred on the polypeptides of the present invention by modifying the polypeptides with a cell-membrane permeable substance. As a result, by contacting the polypeptide of the present invention with a cell, the polypeptide can be delivered into the cell to act thereon.
- the "cell-membrane permeable substance” refers to a substance capable of penetrating the mammalian cell membrane to enter the cytoplasm. For example, a certain liposome fuses with the cell membrane to release the content into the cell. Meanwhile, a certain type of polypeptide penetrates the cytoplasmic membrane of mammalian cell to enter the inside of the cell. For polypeptides having such a cell-entering activity, cytoplasmic membranes and such in the present invention are preferable as the substance. Specifically, the present invention includes polypeptides having the following general formula.
- [R]-[D] wherein, [R] represents a cell-membrane permeable substance; [D] represents a fragment sequence containing ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46).
- [R] and [D] can be linked directly or indirectly through a linker.
- Peptides, compounds having multiple functional groups, or such can be used as a linker.
- amino acid sequences containing -GGG- can be used as a linker.
- a cell-membrane permeable substance and a polypeptide containing a selected sequence can be bound to the surface of a minute particle.
- [R] can be linked to any positions of [D]. Specifically, [R] can be linked to the N terminal or C terminal of [D], or to a side chain of amino acids constituting [D]. Furthermore, more than one [R] molecule can be linked to one molecule of [D]. The [R] molecules can be introduced to different positions on the [D] molecule. Alternatively, [D] can be modified with a number of [R] s linked together.
- any substance selected from the following group can be used as the above-described cell- permeable substance: poly-arginine; Matsushita et al., (2003) J. Neurosci.; 21, 6000-7.
- the poly-arginine which is listed above as an example of cell-membrane permeable substances, is constituted by any number of arginine residues. Specifically, for example, it is constituted by consecutive 5-20 arginine residues. The preferable number of arginine residues is 11 (SEQ ID NO: 60).
- compositions comprising ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46)
- polypeptides of the present invention inhibit proliferation of lung cancer cells. Therefore, the present invention provides therapeutic and/or preventive agents for cancer which comprise as an active ingredient a polypeptide which comprises ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or
- the present invention relates to methods for treating and/or preventing lung cancer comprising the step of administering a polypeptide of the present invention. Furthermore, the present invention relates to the use of the polypeptides of the present invention in manufacturing pharmaceutical compositions for treating and/or preventing lung cancer.
- the present invention also relates to a polypeptide selected from peptides comprising ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) for treating and/or preventing lung cancer.
- the inhibitory polypeptides of the present invention can be used to induce apoptosis of cancer cells. Therefore, the present invention provides apoptosis inducing agents for cells, which comprise as an active ingredient a polypeptide which comprises ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46); or a polynucleotide encoding the same.
- the apoptosis inducing agents of the present invention may be used for treating cell proliferative diseases such as cancer.
- the present invention relates to methods for inducing apoptosis of cells which comprise the step of administering the polypeptides of the present invention. Furthermore, the present invention relates to the use of polypeptides of the present invention in manufacturing pharmaceutical compositions for inducing apoptosis in cells.
- the inhibitory polypeptides of the present invention induce apoptosis in TTK- expressing cells such as lung cancer.
- TTK expression has not been observed in most of normal organs.
- the expression level of TTK is relatively low as compared with lung cancer tissues. Accordingly, the polypeptides of the present invention may induce apoptosis specifically in lung cancer cells.
- polypeptides of the present invention are administered, as a prepared pharmaceutical, to human and other mammals such as mouse, rat, guinea pig, rabbit, cat, dog, sheep, pig, cattle, monkey, baboon and chimpanzee for treating lung cancer or inducing apoptosis in cells
- isolated compounds can be administered directly, or formulated into an appropriate dosage form using known methods for preparing pharmaceuticals.
- the pharmaceuticals can be orally administered as a sugar-coated tablet, capsule, elixir, and microcapsule, or alternatively parenterally administered in the injection form that is a sterilized solution or suspension with water or any other pharmaceutically acceptable liquid.
- the compounds can be mixed with pharmacologically acceptable carriers or media, specifically sterilized water, physiological saline, plant oil, emulsifier, suspending agent, surfactant, stabilizer, corrigent, excipient, vehicle, preservative, and binder, in a unit dosage form necessary for producing a generally accepted pharmaceutical.
- pharmacologically acceptable carriers or media specifically sterilized water, physiological saline, plant oil, emulsifier, suspending agent, surfactant, stabilizer, corrigent, excipient, vehicle, preservative, and binder.
- a suitable dose within the specified range can be determined.
- binders such as gelatin, corn starch, tragacanth gum, and gum arabic
- media such as crystalline cellulose
- swelling agents such as corn starch, gelatin, and alginic acid
- lubricants such as magnesium stearate
- sweetening agents such as sucrose, lactose or saccharine
- corrigents such as peppermint, wintergreen oil and cherry.
- Sterilized mixture for injection can be formulated using media such as distilled water for injection according to the realization of usual pharmaceuticals.
- Physiological saline, glucose, and other isotonic solutions containing adjuvants such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride can be used as an aqueous solution for injection. They can be used in combination with a suitable solubilizer, for example, alcohol, specifically ethanol and polyalcohols such as propylene glycol and polyethylene glycol, non- ionic surfactants such as Polysorbate 80TM and HCO-50.
- a suitable solubilizer for example, alcohol, specifically ethanol and polyalcohols such as propylene glycol and polyethylene glycol, non- ionic surfactants such as Polysorbate 80TM and HCO-50.
- Sesame oil or soybean oil can be used as an oleaginous liquid, and also used in combination with benzyl benzoate or benzyl alcohol as a solubilizer. Furthermore, they can be further formulated with buffers such as phosphate buffer and sodium acetate buffer; analgesics such as procaine hydrochloride; stabilizers such as benzyl alcohol and phenol; and antioxidants. Injections thus prepared can be loaded into appropriate ampoules.
- buffers such as phosphate buffer and sodium acetate buffer
- analgesics such as procaine hydrochloride
- stabilizers such as benzyl alcohol and phenol
- antioxidants antioxidants
- Methods well-known to those skilled in the art can be used for administering pharmaceutical compounds of the present invention to patients, for example, by intraarterial, intravenous, or subcutaneous injection, and similarly, by intranasal, transtracheal, intramuscular, or oral administration.
- Doses and administration methods are varied depending on the body weight and age of patients as well as administration methods. However, those skilled in the art can routinely select them.
- DNA encoding a polypeptide of the present invention can be inserted into a vector for the gene therapy, and the vector can be administered for treatment.
- doses and administration methods are varied depending on the body weight, age, and symptoms of patients, those skilled in the art can appropriately select them.
- a dose of the compound which bind to the polypeptides of the present invention so as to regulate their activity is, when orally administered to a normal adult (body weight 60 kg), about 0.1 mg to about 100 mg/day, preferably about 1.0 mg to about 50 mg/day, more preferably about 1.0 mg to about 20 mg/day, although it is slightly varied depending on symptoms.
- the compound is parenterally administered to a normal adult (body weight 60 kg) in the injection form, it is convenient to intravenously inject a dose of about 0.01 mg to about 30 mg/day, preferably about 0.1 mg to about 20 mg/day, more preferably about 0.1 mg to about 10 mg/day, although it is slightly varied depending on patients, target organs, symptoms, and administration methods.
- the compound can be administered to other animals in an amount converted from the dose for the body weight of 60 kg.
- siRNA of TTK or EGFR siRNA of TTK or EGFR gene can be used to reduce the expression level of the TTK or
- siRNA of TTK or EGFR gene is useful for the treatment of lung cancer.
- siRNA of the present invention can act by binding to mRNAs corresponding thereto, thereby promoting the degradation of the mRNA, and/or inhibiting the expression of protein encoded by the TTK or EGFR gene, thereby, inhibiting the function of the protein.
- polynucleotide and “oligonucleotide” are used interchangeably herein unless otherwise specifically indicated and are referred to by their commonly accepted single- letter codes. The terms apply to nucleic acid (nucleotide) polymers in which one ot more nucleic acids are linked by ester bonding.
- the polynucleotide or oligonucleotide may be composed of DNA, RNA or a combination thereof.
- double-stranded molecule refers to a nucleic acid molecule that inhibits expression of a target gene including, for example, short interfering RNA (siRNA; e.g., double-stranded ribonucleic acid (dsRNA) or small hairpin RNA (shRNA)) and short interfering DNA/RNA (siD/R-NA; e.g. double-stranded chimera of DNA and RNA (dsD/R-NA) or small hairpin chimera of DNA and RNA (shD/R-NA)).
- siRNA short interfering RNA
- dsRNA double-stranded ribonucleic acid
- shRNA small hairpin RNA
- siD/R-NA short interfering DNA/RNA
- siRNA against the TTK or EGFR gene can be used to reduce the expression level of the TTK or EGFR gene.
- siRNA refers to a double stranded RNA molecule which prevents translation of a target mRNA. Standard techniques for introducing siRNA into the cell can be used, including those in which DNA is a template from which RNA is transcribed.
- the siRNA is composed of a sense nucleic acid sequence and an anti-sense nucleic acid sequence against SEQ ID NO: 62 or 63.
- the siRNA is constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a hairpin.
- the siRNA may either be a dsRNA or shRNA.
- dsRNA refers to a construct of two RNA molecules having sequences complementary to one another annealed together via the complementary sequences to form a double-stranded RNA molecule.
- the nucleotide sequence of two strands may include not only the "sense” or "antisense” RNAs selected from a protein coding sequence of target gene sequence, but also RNA molecule having a nucleotide sequence selected from non-coding region of the target gene.
- shRNA refers to an siRNA having a stem-loop structure, composed of first and second regions complementary to one another, i.e., sense and antisense strands.
- the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region.
- the loop region of an shRNA is a single-stranded region intervening between the sense and antisense strands and may also be referred to as "intervening single- strand".
- siD/R-NA refers to a double-stranded polynucleotide molecule which is composed of both RNA and DNA, and includes hybrids and chimeras of RNA and DNA and prevents translation of a target mRNA.
- a hybrid indicates a molecule wherein a polynucleotide composed of DNA and a polynucleotide composed of RNA hybridize to each other to form the double-stranded molecule; whereas a chimera indicates that one or both of the strands composing the double stranded molecule may contain RNA and DNA. Standard techniques of introducing siD/R-NA into the cell are used.
- the siD/R-NA includes a TTK or EGFR sense nucleic acid sequence (also referred to as "sense strand"), a TTK or EGFR antisense nucleic acid sequence (also referred to as "antisense strand") or both.
- the siD/R-NA may be constructed such that a single transcript has both the sense and complementary antisense nucleic acid sequences from the target gene, e.g., a hairpin.
- the siD/R-NA may either be a dsD/R-NA or shD/R-NA.
- dsD/R-NA refers to a construct of two molecules having sequences complementary to one another annealed together via the complementary sequences to form a double-stranded polynucleotide molecule.
- the nucleotide sequence of two strands may include not only the "sense” or "antisense” polynucleotides sequence selected from a protein coding sequence of target gene sequence, but also polynucleotide having a nucleotide sequence selected from non-coding region of the target gene.
- One or both of the two molecules constructing the dsD/R-NA are composed of both RNA and DNA (chimeric molecule), or alternatively, one of the molecules is composed of RNA and the other is composed of DNA (hybrid double-strand).
- shD/R-NA refers to an siD/R-NA having a stem-loop structure, including first and second regions complementary to one another, i.e., sense and antisense strands. The degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region.
- the loop region of an shD/R-NA is a single-stranded region intervening between the sense and antisense strands and may also be referred to as "intervening single-strand"
- the double-stranded molecules of the invention may contain one or more modified nucleotides and/or non-phosphodiester linkages.
- Chemical modifications well known in the art are capable of increasing stability, availability, and/or cell uptake of the double-stranded molecule.
- the skilled person will be aware of other types of chemical modification which may be incorporated into the present molecules (WO03/070744; WO2005/045037).
- modifications can be used to provide improved resistance to degradation or improved uptake.
- modifications include phosphorothioate linkages, 2'-O- methyl-4' linked ribonucleotides, 2'-O-methyl ribonucleotides (especially on the sense strand of a double-stranded molecule), 2'-deoxy-fluoro ribonucleotides, 2'-deoxy ribonucleotides, "universal base” nucleotides, 5'-C- methyl nucleotides, and inverted deoxyabasic residue incorporation (US20060122137).
- modifications can be used to enhance the stability or to increase targeting efficiency of the double-stranded molecule.
- Modifications include chemical cross linking between the two complementary strands of a double-stranded molecule, chemical modification of a 3 ' or 5 ' terminus of a strand of a double-stranded molecule, sugar modifications, nucleobase modifications and/or backbone modifications, 2-fluoro modified ribonucleotides and 2'-deoxy ribonucleotides (WO2004/029212).
- modifications can be used to increased or decreased affinity for the complementary nucleotides in the target mRNA and/or in the complementary double-stranded molecule strand (WO2005/044976).
- an unmodified pyrimidine nucleotide can be substituted for a 2-thio, 5-alkynyl, 5-methyl, or 5-propynyl pyrimidine.
- an unmodified purine can be substituted with a 7-deza, 7-alkyi, or 7-alkenyi purine.
- the 3'- terminal nucleotide overhanging nucleotides may be replaced by deoxyribonucleotides (Elbashir SM et al., Genes Dev 2001 Jan 15, 15(2): 188-200).
- published documents such as US20060234970 are available. The present invention is not limited to these examples and any known chemical modifications may be employed for the double-stranded molecules of the present invention so long as the resulting molecule retains the ability to inhibit the expression of the target gene.
- the double-stranded molecules of the invention may include both DNA and RNA, e.g., dsD/R-NA or shD/R-NA.
- RNA e.g., dsD/R-NA or shD/R-NA.
- a hybrid polynucleotide of a DNA strand and an RNA strand or a DNA-RNA chimera polynucleotide shows increased stability.
- RNA i.e., a hybrid type double-stranded molecule consisting of a DNA strand (polynucleotide) and an RNA strand (polynucleotide), a chimera type double-stranded molecule including both DNA and RNA on any or both of the single strands (polynucleotides), or the like may be formed for enhancing stability of the double-stranded molecule.
- the hybrid of a DNA strand and an RNA strand may be the hybrid in which either the sense strand is DNA and the antisense strand is RNA, or the opposite so long as it has an activity to inhibit expression of the target gene when introduced into a cell expressing the gene.
- the sense strand polynucleotide is DNA and the antisense strand polynucleotide is RNA.
- the chimera type double-stranded molecule may be either where both of the sense and antisense strands are composed of DNA and RNA, or where any one of the sense and antisense strands is composed of DNA and RNA so long as it has an activity to inhibit expression of the target gene when introduced into a cell expressing the gene.
- the molecule preferably contains as much DNA as possible, whereas to induce inhibition of the target gene expression, the molecule is required to be RNA within a range to induce sufficient inhibition of the expression.
- an upstream partial region i.e., a region flanking to the target sequence or complementary sequence thereof within the sense or antisense strands
- the upstream partial region indicates the 5' side (5 '-end) of the sense strand and the 3' side (3 '-end) of the antisense strand.
- the upstream partial region preferably is a domain consisting of 9 to 13 nucleotides counted from the terminus of the target sequence or complementary sequence thereto within the sense or antisense strands of the double-stranded molecules.
- preferred examples of such chimera type double-stranded molecules include those having a strand length of 19 to 21 nucleotides in which at least the upstream half region (5' side region for the sense strand and 3' side region for the antisense strand) of the polynucleotide is RNA and the other half is DNA. In such a chimera type double-stranded molecule, the effect to inhibit expression of the target gene is much higher when the entire antisense strand is RNA (US20050004064).
- the double-stranded molecule may form a hairpin, such as a short hairpin RNA (shRNA) and short hairpin consisting of DNA and RNA (shD/R-NA).
- shRNA or shD/R-NA is a sequence of RNA or mixture of RNA and DNA making a tight hairpin turn that can be used to silence gene expression via RNA interference.
- the shRNA or shD/R- NA preferably includes the sense target sequence and the antisense target sequence on a single strand wherein the sequences are separated by a loop sequence.
- the hairpin structure is cleaved by the cellular machinery into dsRNA or dsD/R-NA, which is then bound to the RNA- induced silencing complex (RISC).
- RISC RNA- induced silencing complex
- RNAs partially replaced with DNAs, or methylated RNAs can be used to confer RNAase resistance to the siRNA.
- nucleic acid derivatives that confer RNAase resistance are also included in the double-stranded RNA.
- the double stranded molecule may include a double stranded RNA constructed from ribonucleotides, modified ribonucleotides, or ribonucleotide derivatives.
- siRNA of the TTK or EGFR gene hybridizes to target mRNA and thereby decreases or inhibits production of the polypeptides encoded by the TTK or EGFR gene by associating with the normally single-stranded mRNA transcript, thereby interfering with translation and thus, expression of the protein.
- an siRNA is preferably less than 500, 200, 100, 50, or 25 nucleotides in length. More preferably an siRNA is 19-25 nucleotides in length.
- Exemplary nucleic acid sequence for the production of TTK or EGFR siRNA includes the sequences of nucleotides of SEQ ID NOs: 63 or 64 as the target sequence.
- one or more uridine (“u”) nucleotides can be added to 3 'end of the antisense strand of the target sequence.
- the number of "u's” to be added is at least 2, generally 2 to 10, preferably 2 to 5.
- the added "u's” form a single strand at the 3 'end of the antisense strand of the siRNA.
- An siRNA of the TTK or EGFR gene can be directly introduced into the cells in a form that is capable of binding to the mRNA transcripts.
- a DNA encoding the siRNA can be carried in a vector.
- Vectors can be produced, for example, by cloning an TTK or EGFR gene target sequence into an expression vector having operatively-linked regulatory sequences flanking the sequence in a manner that allows for expression (by transcription of the DNA molecule) of both strands (Lee, N.S., et al., (2002) Nature Biotechnology 20: 500-5).
- RNA molecule that is antisense to mRNA of the TTK or EGFR gene is transcribed by a first promoter (e.g., a promoter sequence 3' of the cloned DNA) and an RNA molecule that is the sense strand for the mRNA of the TTK or EGFR gene is transcribed by a second promoter (e.g., a promoter sequence 5' of the cloned DNA).
- the sense and antisense strands hybridize in vivo to generate siRNA constructs for silencing of the TTK or EGFR gene.
- the two constructs can be utilized to create the sense and anti-sense strands of a siRNA construct.
- Cloned TTK or EGFR gene can encode a construct having secondary structure, e.g., hairpins, wherein a single transcript has both the sense and complementary antisense sequences from the target gene.
- a loop sequence consisting of an arbitrary nucleotide sequence can be located between the sense and antisense sequence in order to form the hairpin loop structure.
- the present invention also provides siRNA having the general formula 5'-[A]-[B]-[A']-3', wherein [A] is a ribonucleotide sequence corresponding to a sequence of the TTK or EGFR gene,
- [B] is a ribonucleotide sequence composed of 3 to 23 nucleotides
- [A'] is a ribonucleotide sequence having the complementary sequence of [A].
- the region [A] hybridizes to [A'], and then a loop composed of region [B] is formed.
- the loop sequence can be 3 to 23 nucleotides in length.
- the loop sequence for example, can be selected from the following sequences (found on the worldwide web at ambion.com/techlib/tb/tb_506.html).
- a loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J. M., et al., (2002) Nature 418 : 435-8.).
- UUCG Lee, N.S., et al., (2002) Nature Biotechnology 20: 500-5.; Fruscoloni, P., et al., (2003) Proc. Natl. Acad. Sci. USA 100(4): 1639-44.
- UUCAAGAGA Dykxhoom, D. M., et al., (2003) Nature Reviews Molecular Cell Biology 4: 457-67.
- the loop sequence can be selected from group consisting of, CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA.
- a preferable loop sequence is UUCAAGAGA ("ttcaagaga" in DNA).
- Exemplary hairpin siRNA suitable for use in the context of the present invention include: for TTK-siRNA;
- nucleotide sequence of suitable siRNAs can be designed using an siRNA design computer program available from the Ambion website on the worldwide web at ambion.com/tecMib/misc/siRNA finder.html.
- the computer program selects nucleotide " sequences for siRNA synthesis based on the following protocol.
- the regulatory sequences flanking the TTK or EGFR gene sequences can be identical or different, such that their expression can be modulated independently, or in a temporal or spatial manner.
- siRNAs are transcribed intracellularly by cloning the TTK or EGFR gene templates, respectively, into a vector containing, e.g., a RNA polymerase III transcription unit from the small nuclear RNA (snRNA) U6 or the human Hl RNA promoter.
- transfection-enhancing agent can be used for introducing the vector into the cell. FuGENE (Roche diagnostics), Lipofectamine 2000 (Invitrogen), Oligofectamine (Invitrogen), and Nucleofector (Wako pure _Chemical) are useful as the transfection-enhancing agent.
- the siRNA of the present invention inhibits the expression of a polypeptide of the present invention and is thereby useful for suppressing the biological activity of a polypeptide of the invention.
- expression-inhibitors, including the siRNA of the invention are useful in the point that they can inhibit the biological activity of the polypeptide of the invention. Therefore, a composition composed of one or more siRNAs of the present invention is useful for treating a lung cancer.
- the present invention provides use of inhibitory nucleic acids including the siRNAs, or vector expressing the nucleic acids for manufacturing a pha ⁇ naceutical composition for treating or preventing lung cancer. Further, the present invention also provides such inhibitory nucleic acids including the siRNAs, or vector expressing the nucleic acids for treating or preventing lung cancer.
- siRNA therapy is used to inhibit expression of TTK or EGFR in patients suffering from or at risk of developing lung cancer.
- Such patients are identified by standard methods of the particular tumor type.
- Lung cancer cell is diagnosed for example, by CT, MRI, ERCP, MRCP, computer tomography, or ultrasound. Treatment is efficacious if the treatment leads to clinical benefit such as, a reduction in expression of TTK or EGFR, or a decrease in size, prevalence, or metastatic potential of the tumor in the subject.
- siRNA therapy is carried out by administering to a patient an siRNA by standard vectors encoding the siRNAs of the invention and/or gene delivery systems such as by delivering the synthetic siRNA molecules.
- synthetic siRNA molecules are chemically stabilized to prevent nuclease degradation in vivo. Methods for preparing chemically stabilized RNA molecules are well known in the art. Typically, such molecules comprise modified backbones and nucleotides to prevent the action of ribonucleases. Other modifications are also possible, for example, cholesterol-conjugated siRNAs have shown improved pharmacological properties. (Song et al. Nature Med. 9:347-351 (2003)).
- Suitable gene delivery systems may include liposomes, receptor-mediated delivery systems, or viral vectors such as herpes viruses, retroviruses, adenoviruses and adeno-associated viruses, among others.
- a therapeutic nucleic acid composition is formulated in a pharmaceutically acceptable carrier.
- the therapeutic composition may also include a gene delivery system as described above.
- Pharmaceutically acceptable carriers are biologically compatible vehicles which are suitable for administration to an animal, e.g., physiological saline.
- a therapeutically effective amount of a compound is an amount which is capable of producing a medically desirable result such as reduced production of a TTK or EGFR gene product, reduction of cell growth, e.g., proliferation, or a reduction in tumor growth in a treated animal.
- Parenteral administration such as intravenous, subcutaneous, intramuscular, and intraperitoneal delivery routes, may be used to deliver siRNA compositions of TTK or EGFR.
- parenteral administration such as intravenous, subcutaneous, intramuscular, and intraperitoneal delivery routes, may be used to deliver siRNA compositions of TTK or EGFR.
- direct infusion into the tissue or near the site of cancer is useful.
- Dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular nucleic acid to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently.
- Dosage for intravenous administration of nucleic acids is from approximately 106 to 1022 copies of the nucleic acid molecule.
- the polynucleotides are administered by standard methods, such as by injection into the interstitial space of tissues such as muscles or skin, introduction into the circulation or into body cavities or by inhalation or insufflation. Polynucleotides are injected or otherwise delivered to the animal with a pharmaceutically acceptable liquid carrier, e.g., a liquid carrier, which is aqueous or partly aqueous.
- a pharmaceutically acceptable liquid carrier e.g., a liquid carrier, which is aqueous or partly aqueous.
- the polynucleotides are associated with a liposome (e.g., a cationic or anionic liposome).
- the polynucleotide includes genetic information necessary for expression by a target cell, such as a promoter.
- compositions comprising siRN ⁇
- the present invention includes medicaments and methods useful in either or both preventing and treating lung cancer.
- These medicaments and methods comprise a siRNA that inhibits expression of TKK (SEQ ID NO: 62) or EGFR (SEQ ID NO: 63) in an amount effective to achieve attenuation or arrest of disease cell proliferation.
- a therapeutically effective amount means an amount effective to prevent development of, or to alleviate existing symptoms of, the subject being treated.
- Individuals to be treated with methods of the present invention include any individual afflicted with lung cancer.
- Such an individual can be, for example, a vertebrate such as a mammal, including a human, dog, cat, horse, cow, or goat; or any other animal, particularly a commercially important animal or a domesticated animal.
- suitable pharmaceutical formulations include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, sub-cutaneous and intravenous) administration, or for administration by inhalation or insufflation. Preferably, administration is intravenous.
- the formulations are optionally packaged in discrete dosage units.
- Pharmaceutical formulations suitable for oral administration include capsules, cachets or tablets, each containing a predetermined amount of active ingredient. Suitable formulations also include powders, granules, solutions, suspensions and emulsions.
- the active ingredient is optionally administered as a bolus electuary or paste.
- Tablets and capsules for oral administration may contain conventional excipients, for example, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol, cellulose preparations such as maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP), binding agents, lubricants, and/or wetting agents.
- disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
- a tablet may be made by compression or molding, optionally with one or more formulational ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form, such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active and/or dispersing agent.
- Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art.
- Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use.
- Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), pH maintaining agents, and/or preservatives.
- the tablets may optionally be formulated so as to provide slow or controlled release of the active ingredient therein.
- a package of tablets may contain one tablet to be taken on each of the month.
- Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions, optionally contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; as well as aqueous and non-aqueous sterile suspensions including suspending agents and/or thickening agents.
- the formulations may be presented in unit dose or multi-dose containers, for example as sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline, water-for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion.
- Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
- Formulations suitable for rectal administration include suppositories with standard carriers such as cocoa butter or polyethylene glycol.
- Formulations suitable for topical administration in the mouth include lozenges, containing the active ingredient in a flavored base such as sucrose and acacia or tragacanth, and pastilles comprising the active ingredient in a base such as gelatin and glycerin or sucrose and acacia.
- the compounds of the invention may be used as a liquid spray, a dispersible powder or in the form of drops. Drops may be formulated with an aqueous or non- aqueous base also comprising one or more dispersing agents, solubilizing agents and/or suspending agents.
- the compounds can be conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray.
- Pressurized packs may comprise a suitable propellant such as dichlorodifiuoromethane, trichlorofiuoromethane, dichiorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- the compounds may take the form of a dry powder composition, for example a powder mix of the compound and a suitable powder base such as lactose or starch.
- the powder composition may be presented in unit dosage form, for example, as capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators.
- compositions include implantable devices and adhesive patches; which release a therapeutic agent.
- the above described formulations adapted to give sustained release of the active ingredient, may be employed.
- the pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants and/or preservatives.
- formulations of this invention may include other agents conventional in the art with regard to the type of formulation in question.
- formulations suitable for oral administration may include flavoring agents. It will be apparent to those persons skilled in the art that certain excipients may be more preferable depending upon, for instance, the route of administration, the concentration of test compound being administered, or whether the treatment uses a medicament that includes a protein, a nucleic acid encoding the test compound, or a cell capable of secreting a test compound as the active ingredient.
- compositions of the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. Proper formulation is dependent upon the route of administration chosen.
- Lung cancer cell lines were grown in monolayers in appropriate medium supplemented with 10% fetal calf serum (FCS) and were maintained at 37 0 C in an atmosphere of humidified air with 5% CO 2 .
- FCS fetal calf serum
- Primary lung cancer and metastatic brain tumors derived from lung adenocarcinoma samples had been obtained earlier with informed consent (Kikuchi et al., Oncogene. 2003 Apr 10;22(14):2192-205., Int J Oncol. 2006 Apr;28(4):799-805., Taniwaki et al., Int J Oncol. 2006 Sep;29(3):567-75.).
- ADC adenocarcinomas
- SCC 104 squamous-cell carcinomas
- LCC large-cell carcinomas
- Human multiple-tissue blots (BD Biosciences Clontech) were hybridized with a 32 P-labeled PCR product of TTK.
- the full-length cDNA of TTK was prepared by RT-PCR using primers. Prehybridization, hybridization, and washing were performed according to the supplier's recommendations.
- the blots were autoradiographed with intensifying screens at room temperature for 72 hours.
- Anti-phospho-EGFR (Ser-967) antibodies were raised against Ser-967- phosphorylated synthetic peptides and purified with the phosphopeptide column. Antigen- antibody complexes were detected using secondary antibodies conjugated to horseradish peroxidase (GE Healthcare Bio-sciences). Protein bands were visualized by ECL Western Blotting Detection Reagents (GE Healthcare Bio-sciences).
- mice monoclonal anti-Mpsl (TTK) antibody (Upstate) and a rabbit polyclonal anti-phospho-EGFR (Tyr-992) (Cell " Signaling Technology, Inc.), or a rabbit polyclonal anti-phospho-p44/42 MAPK (Thr202/Tyr204) antibody (Cell Signaling Technology, Inc.), or a mouse monoclonal anti-Flag antibody (SIGMA).
- TTK mouse monoclonal anti-Mpsl
- Tyr-992 rabbit polyclonal anti-phospho-EGFR
- Thr202/Tyr204 Thr202/Tyr204 antibody
- SIGMA mouse monoclonal anti-Flag antibody
- Antibodies were stained with an anti-mouse secondary antibody conjugated to Alexa Fluor 488 (Molecular Probes) and an anti-rabbit secondary antibody conjugated to Alexa Fluor 594 (Molecular Probes).
- anti-human TTK antibody NOVUS Biologicals, Inc.
- anti-phospho-EGFR Tyr-992
- anti-phospho-EGFR Ser-967 antibody
- the tumor tissue microarrays were constructed as published previously (Chin et al., MoI Pathol. 2003 Oct;56(5):275-9.; Callagy et al., Diagn MoI Pathol. 2003 Mar;12(l):27-34., J Pathol. 2005 Feb;205(3):388-96.).
- the tissue area for sampling was selected based on a visual alignment with the corresponding HE-stained section on a slide.
- Three, four, or five tissue cores (diameter 0.6 mm; height 3 - 4 mm) taken from the donor tumor blocks were placed into a recipient paraffin block using a tissue microarrayer (Beecher Instruments). A core of normal tissue was punched from each case.
- TTK tumor size
- pN lymph-node metastasis
- Tumor-specific survival curves were calculated from the date of surgery to the time of death related to NSCLC, or to the last follow-up observation.
- Kaplan-Meier curves were calculated for each relevant variable and for TTK and/or phospho- EGFR (Tyr-992) and/or phospho-EGFR (Ser-967) expression; differences in survival times among patient subgroups were analyzed using the log-rank test. Univariate analyses were performed with the Cox proportional-hazard regression model to determine associations between clinicopathological variables and cancer-related mortality.
- RNA interference assay (i) vector based assay A vector-based RNA interference (RNAi) system, psiHlBX3.0, had previously established to direct the synthesis of siRNAs in mammalian cells (Suzuki et al., 2003, 2005; Kato et al, 2005; Furukawa et al, 2005). 10 micro-g of siRNA-expression vector were transfected into NSCLC cell lines LC319 and A549 both of which over-expressed TTK endogenously, using 30 micro-1 of Lipofectamine 2000 (Invitrogen).
- the transfected cells were cultured for five days in the presence of appropriate concentrations of geneticin (G418), after which cell numbers and viability were measured by Giemsa staining and triplicate MTT assays.
- the target sequences of the synthetic oligonucleotides for RNAi were as follows: control 1 (Luciferase: Photinus pyralis luciferase gene), 5 '-CGT ACGCGGAAT ACTTCGA-3' (SEQ ID NO: 9); control 2 (Scramble: chloroplast Euglena gracilis gene coding for 5S and 16S rRNAs), 5'- GCGCGCTTTGTAGGATTCG-3' (SEQ ID NO: 10); siRNA-TTK (si-TTK-1), 5'-ACAGTGTTCCGCTAAGTGA-S' (SEQ ID NO: 11); siRNA-TTK (si-TTK-2), 5'-ATCACGGACCAGTACATCT-S' (SEQ ID NO: 12
- RNAiRNAs (Luciferase and Scramble) were initially confirmed using semiquantitative RT-PCR to decrease expression of the corresponding target genes that had been transiently transfected into COS-7 cells. Down-regulation of TTK expression by si-TTK, but not by controls, was confirmed with semiquantitative RT-PCR in the cell lines used for this assay, (ii) oligo based assay The oligo-siRNAs (Dharmacon, Inc., Lafayette, CO) (600 pM) were transfected into appropriate lung-cancer cell lines using 30 micro-1 of Lipofectamine 2000 (Invitrogen, Carlsbad, CA) following the manufacturer's protocol.
- RNAi-TTK (oligo):CAAGATGTGTTAAAGTGTTTT (SEQ ID NO: 62); and RNAi-EGFR (oligo): GT AAC AAGCTC ACGC AGTTTT (SEQ ID NO: 63).
- RNAi-TTK (oligo):CAAGATGTGTTAAAGTGTTTT (SEQ ID NO: 62); and RNAi-EGFR (oligo): GT AAC AAGCTC ACGC AGTTTT (SEQ ID NO: 63).
- the full-length cDNA of TTK was subcloned into pFastBac HT vector.
- the recombinant shuttle vector was transformed into the baculovirus genome (bacmid DNA) in DHlOBac competent cells (Invitrogen) by using Tn7 site-specific transposition according to the minufacture's instructions for the Bac-to-Bac expression system (Invitrogen).
- the recombinant bacmid DNA was isolated, purified, transfected into Sf9 cells (Invitrogen) (recombinant baculovirus), and used for next infection.
- TTK-expressing stable transfectants were established according to a standard protocol. Using FuGENE 6 Transfection Reagent (Roche Diagnostics), we transfected HEK293 and NIH3T3 cells with plasmids expressing TTK (pCAGGS-n3 FH-TTK) or mock plasmids (pCAGGS-n3FH). Transfected cells were cultured in DMEM containing 10% FCS and G418, then individual colonies were trypsinized and screened for stable transfectants by a limiting-dilution assay. Expression of TTK was determined in each clone by RT-PCR, western blotting, and immunostaining.
- HEK293 or NIH3T3 transfectants that stably expressed TTK were seeded onto 6- well plates (5 X 10 4 cells/well), and maintained in medium containing 10% FCS and 0.4 mg/ml G418 for 7 days. At each time point, cell proliferation was evaluated by the MTT assay using Cell Counting Kits (WAKO). All experiments were done in triplicate. (o) TTK mutation analysis
- NIH-3T3 or COS-7 cells were transfected with plasmids expressing TTK (pCAGGS-n3FH-TTK), TTK-KD (D647A), mutant TTK (originated in RERF-LC-AI cells) or mock plasmids (pCAGGS-n3FH). Transfected cells were harvested and suspended in
- 11R-EGFR937-955 RRRRRRRRRRR-GGG-FRELIIEFSKMARDPQRYL(SEQ ID NO: 46); 11R-EGFR958-976: RRRRRRRRRRR-GGG-QGDERMHLPSPTDSNFYRA; 11R-EGFR983-1001: RRRRRRRRRRR-GGG-MDDWDADEYLIPQQGFFS; and 11R-EGFR965-994: RRRRRRRRRRR-GGG-LPSPTDSNFYRALMDEEDMDD WD ADEYLI. Scramble peptides derived from the most effective 11R-EGFR937-955 peptides were synthesized as a control: Scramble, RRRRRRRRRRR-GGG-EFMAELLRYFRPQSKRDII.
- Peptides were purified by preparative reverse-phase high-pressure liquid chromatography. A549 cells were incubated with the 1 IR peptides at the concentration of 2.5, 5, and 7.5 micro-mol/L for 5 days. The medium was exchanged at every 48 hours at the appropriate concentrations of each peptide and the viability of cells was evaluated by MTT assay at 5 days after the treatment.
- TTK in lung tumors was confirmed by examining expression of endogenous TTK protein on western blot analyses using anti-TTK antibody in all of 7 lung- cancer cell lines ( Figure Ic).
- Northern blotting with TTK cDNA as a probe identified a 3.0-kb transcript specifically in testis among 24 normal human tissues examined (data not shown).
- the subcellular localization of TTK in NSCLC cell lines, A549 and LC319, were examined by immunocytochemical and western-blot analyses with anti-TTK antibody, and it was found to be mainly localized in the cytoplasm and nucleus ( Figures Ie and If).
- TTK protein expression was examined in clinical NSCLCs by means of tissue microarrays containing NSCLC tissues from 366 patients as well as SCLC tissues from 12 patients. Positive staining for TTK was observed in 68.6% of surgically-resected NSCLCs (251/366) and in 66.7% of SCLCs (8/12), while no staining was observed in any of normal lung tissues examined (Figure 2a). The correlation of its positive staining with various clinicopathological parameters was then examined hi 366 NSCLC patients.
- TTK expression level on the tissue array was classified as ranging from absent (scored as 0) to weak/strong positive (scored as 1+ ⁇ 2+) ( Figure 2a; see Example 1).
- TTK was strongly stained in 135 (36.9%; score 2+), weakly stained in 116 (31.7%; score 1+), and not stained in 115 cases (31.4%; score 0).
- ADC adenocarcinoma
- SCC squamous-cell carcinoma
- LCC large-cell carcinoma
- Example 4 Growth-suppression of lung cancer cells by siRNA against TTK
- siRNAs were constructed to express siRNA against TTK (si-TTK-1 and -T) as well as two control plasmids (siRNAs for Luciferase (LUC), or Scramble (SCR)), and transfected each of them into LC319 and A549 cells (Representative data of LC319 was shown in Figure 3a).
- the amount of TTK transcript in the two NSCLC cell lines transfected with si-TTK-1 was significantly decreased in comparison with the two control siRNAs. (Figure 3a, left upper panels).
- si-TTK-1 Cell viability and colony numbers of the cells transfected with si-TTK-1, measured by MTT and colony-formation assays were reduced significantly in comparison with those with the two control siRNAs ( Figure 3a, left lower and right panels).
- si-TTK-2 revealed weaker reduction of the TTK expression and modest growth-suppressive effect. The results suggested the growth-promoting effect of TTK on NSCLC cells.
- HEK293 -derived transfectants that stably expressed TTK were established. Growth of HEK293 cells expressing exogenous TTK was promoted at a significant degree in accordance with the expression level of TTK compared their growth with control cells transfected with mock vector ( Figure 3b and 3c). The TTK-transfected HEK293 cells transplanted to subcutaneous of mice also exhibited higher growth rate compared to the control cells ( Figure 3d). The results suggested the growth- promoting effect of TTK on NSCLC cells.
- Example 7 Identification of EGFR as a novel substrate-protein for TTK To elucidate the function of TTK kinase in carcinogenesis, the present inventers attempted to identify substrate proteins that would be phosphorylated by TTK and activate cell-proliferation signaling. Immunoblot-screening of kinase substrates for TTK was performed by using cell lysates of COS-7 cells transfected with TTK-expression vector and a series of antibodies specific for phospho-proteins related to cancer-cell signaling (see Example 1). A total of 31 phosphoproteins (Table 2) were screened. It was found that Tyr-992 of EGFR was significantly phosphorylated in the cells transfected with the TTK-expression vector, compared with those with mock vector ( Figure 4a).
- Table 2 List of phospho-specific antibodies used for immunoblot-screening of substrate- protein(s) for TTK kinase.
- TTK and EGFR in lung cancer cells were also investigated by immunoprecipitaion experiment using extracts from A549 cells, and the interaction between these two proteins regardless the EGF-stimulation was detected (Figure 4b).
- TTK or EGFR function in A549 cells were suppressed and cell morphology was microscopically observed.
- ADC adenocarcinoma
- SCC squamous-cell carcinoma LCC, large-cell carcinoma * P ⁇ 0.05 (Chi-square test) NS, no significance
- TTK was exogenously over-expressed in serum-starved COS-7 cells and microscopically observed that phospho-EGFR (Tyr-992) was detected as small spots around the nucleus in only TTK- expressing cells ( Figure 4k and 41). Endogenous phospho-EGFR (Tyr-992) was localized in the nucleus of serum-starved A549 cells that over-express TTK endogenously ( Figure 4m, left panel), whereas reduction of TTK protein by RNAi-TTK (oligo) significantly decreased the phospho-EGFR (Tyr-992) ( Figure 4m, right panel). The data suggested the TTK-induced phosphorylation at Tyr-992 of EGFR and its internalization that occurred independently from EGF stimulation.
- Example 8 Activation of MAPK signals by phospho-EGFR (Tyr-992) in a TTK-dependent oncogenic pathway
- the phosphorylation level of EGFR Tyr-992 was then examined in the mitotic phase of A549 cells, when the expression level of TTK was remarkably enhanced (Figure 5a). Phosphorylation levels of EGFR on Tyr-992 were in concordant with the expression levels of phospho-TTK. To assess whether the abundant expression of TTK is critical for phosphorylation of EGFR Tyr-992 in cancer cells, the expression of the TTK mRNA was selectively knocked down in A549 cells by using siRNA against TTK (RNAi-TTK (oligo)).
- RNAi-TTK Reduction of TTK protein by RNAi-TTK (oligo) decreased the phosphorylation level of EGFR Tyr-992 ( Figure 5b), indicating that endogenous TTK in lung cancer cells induces the phosphorylation of EGFR.
- Tyr-992 of EGFR is known to be a binding site for two adaptor proteins, phospholipase C ⁇ (PLC ⁇ ) and She, and its phosphorylation is required for activation (phosphorylation) of these adaptor proteins 15- 17.
- PLC ⁇ phospholipase C ⁇
- She phospholipase C ⁇
- Example 9 Identification of a novel phosphorylation site (Ser-967) in EGFR by TTK
- ADC adenocarcinoma
- SCC squamous-cell carcinoma Others
- NS no significance
- Example 10 Inhibition of cell growth/invasion by targeting TTK-EGFR pathway
- RNAi-EGFR oligo
- HEK293 -derived transfectants that stably expressed TTK.
- Example 11 Activating mutation of TTK in lung cancer
- Oncogenic protein kinase activation by somatic mutation in kinase domain is one of the common mechanisms of tumorigenesis (Herbst, R.S., et al., Nat Rev Cancer. 4, 956-965. (2004); Pal, S.K. and Pegram, M., Anticancer Drugs. 16, 483-494. (2005)).
- TTK tumorigenesis
- the TTK kinase domain was directly sequenced by using mRNAs prepared from 36 lung-cancer cell lines and 60 clinical lung cancer tissue samples (30 primary NSCLCs and 30 metastatic brain tumors derived from primary NSCLCs).
- a missense mutation was found at codon 574 (Y574C) in a RERF-LC-AI cell line, which had not been reported in the SNP databases (JSNP: http://snp.ims.u-tokyo.ac.jp/indexja.html; DBSNP: http://www.ncbi.nlm.nih.gov/projects/SNP/) ( Figure 8a, left panels).
- two missense mutations were identified in clinical samples of two metastatic brain tumors derived from primary lung adenocarcinoma.
- V610F valine to Phenylalanine at codon 610
- Q753H Glutamine to Histidine at codon 753
- TTK is its human homologue
- budding yeast was first discovered in budding yeast as a factor to be required in centrosome duplication (Winey M, et al., J Cell Biol. 1991 Aug;l 14(4):745-54.) and was subsequently shown to have a critical function in the spindle checkpoint (Weiss E & Winey M. J Cell Biol. 1996 Jan;132(l-2):111-23.).
- over-expression of TTK was found in several cancers, but their functional significance in carcinogenesis has been remained unclear (Stucke VM, et al., EMBO J. 2002 Apr 2;21(7):1723-32.).
- NSCLC patients showing high levels of TTK and phospho-EGFR revealed a shorter tumor-specific survival period.
- EGFR autophosphorylation has been shown to play a critical role in the activation of the MAPK cascade following EGF stimulation.
- Tyr-992 was proven to be a high binding-affinity site to PLCgamma, and is required for PLCgamma activation by EGF stimulation (Rotin D, et al., EMBO J. 1992 Feb; 11 (2):559-67.).
- PLCgamma activates the Ras/MAPK cascade through inositol 1,4,5 -triphosphate production and oscillations in cytosolic Ca 2+ (Schmidt-Ullrich RK, Oncogene. 2003 Sep l;22(37):5855-65.).
- the activation of the MAP kinase pathway is associated with cell division and its aberrant activity is supposed to be involved in the uncontrolled cell proliferation that occurs in tumors (Pal SK & Pegram M. Anticancer Drugs. 2005 Jun;16(5):483-94.).
- the data herein indicate that phosphorylation of EGFR at Tyr-992 and Ser-967 by TTK is independent from the EGF stimulation.
- Phosphorylation of EGFR Ser-967 has been reported to be constitutive phosphorylation (Elisabetta et al., 2005), but any role of its function has not been implicated. Phosphorylation of EGFR at Ser-967 was mainly detected in nuclear EGFR. Nuclear EGFR was recently reported as a transcription factor or transcriptional coactivator (Lin et al., Nat Cell Biol. 3:802-8 (2001)). Our data indicated that phosphorylation of EGFR at Ser-967 may be important for nuclear localization of EGFR during lung carcinogenesis.
- TTK protein kinase domain DNA sequences of the TTK kinase domain in 36 lung-cancer cell lines and 60 primary and metastatic NSCLCs were also examined, from which one lung squamous-cell carcinoma cell line that has an activating mutation promoting cellular invasive activity was identified. Point mutations were also found in 2 cases of brain metastatic lesion of adenocarcinoma. Interestingly, abundant expression of TTK protein kinase was observed in the great majority of lung-cancer samples of various histological types and much higher expression in advanced stage tumor and especially in brain metastasis (Figure 9).
- TTK through activation of the EGFR- PLCgamma signaling pathway plays an important role as a key molecule associated with brain metastasis, and that the specific subset of patients with lung cancer carrying the TTK mutations is more likely to suffer the metastatic disease to the brain.
- the present invention strongly demonstrates for the first time that EGFR signaling is intracellularly regulated by the activated TTK kinase and that targeting of the enzymatic activity of TTK holds promise for development of a new strategy for treatment of lung-cancer patients.
- TTK has kinase activity for EGFR, and the suppression of this activity leads to the inhibition of cell proliferation of lung cancer cells.
- agents that inhibit the kinase activity of TTK for EGFR find therapeutic utility as anti-cancer agents for the treatment of lung cancer.
- the phosphorylation site of EGFR by TTK is Try922 or Ser967, which is an EGF-independent phosphorylation.
- the present invention provides a screening method for anti-cancer agents that inhibit the kinase activity of TTK for EGFR.
- EGFR has been recognized as an important mediator of growth signaling pathways. Accordingly, it is expected that candidate compounds that inhibit the critical step for cell proliferation can be isolated by the present invention.
- the present invention demonstrates that treatment of lung cancer cells with siRNA against TTK suppresses its expression as well as the kinase activity of TTK for EGFR at Tyr-992 or Ser-967, and, thus, suppresses growth of cancer cells.
- This data implies that up- regulation of TTK function and enhancement of kinase activity of TTK for EGFR are common features of pulmonary carcinogenesis. Accordingly, the selective suppression of TTK kinase activity may be a promising therapeutic strategy for treatment of lung-cancer patients.
- lung cancer can be detected using the kinase activity of TTK for EGFR as a diagnostic marker.
- a prognosis of lung cancer can be assessed or determined by measuring a TTK expression level and/or phosphor-EGFR (Tyr992 or Ser967).
- TKK mutations are associated with a high risk of metastasis of lung cancer. Accordingly, risk assessment for metastasis of lung cancer can be achieved by detecting such mutations. Furthermore, method for detecting a TKK mutant is also provided by the present invention.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- General Engineering & Computer Science (AREA)
- Hospice & Palliative Care (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Public Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP07859848A EP2102360A2 (en) | 2006-12-13 | 2007-12-12 | Ttk as tumor marker and therapeutic target for lung cancer |
| US12/518,876 US20100009920A1 (en) | 2006-12-13 | 2007-12-12 | Ttk as tumor marker and therapeutic target for lung cancer |
| JP2009524832A JP2010512730A (ja) | 2006-12-13 | 2007-12-12 | 肺癌の腫瘍マーカーおよび治療標的としてのttk |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US87479106P | 2006-12-13 | 2006-12-13 | |
| US60/874,791 | 2006-12-13 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008072777A2 true WO2008072777A2 (en) | 2008-06-19 |
| WO2008072777A3 WO2008072777A3 (en) | 2008-07-31 |
Family
ID=39332098
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2007/074359 Ceased WO2008072777A2 (en) | 2006-12-13 | 2007-12-12 | Ttk as tumor marker and therapeutic target for lung cancer |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US20100009920A1 (enExample) |
| EP (3) | EP2468887A1 (enExample) |
| JP (1) | JP2010512730A (enExample) |
| TW (1) | TW200831673A (enExample) |
| WO (1) | WO2008072777A2 (enExample) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010023340A3 (es) * | 2008-08-28 | 2010-05-20 | Proyecto De Biomedicina Cima, S.L. | Nuevo biomarcador como diana terapéutica en cáncer de pulmón |
| US8383590B2 (en) | 2007-02-21 | 2013-02-26 | Oncotherapy Science, Inc. | Peptide vaccines for cancers expressing tumor-associated antigens |
| US8530430B2 (en) | 2009-05-11 | 2013-09-10 | Oncotherapy Science, Inc. | TTK peptides and vaccines including the same |
| US10155796B2 (en) | 2013-02-22 | 2018-12-18 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for inhibiting tumor cells by inhibiting the transcription factor ATF5 |
| US10316077B2 (en) | 2017-02-20 | 2019-06-11 | Sapience Therapeutics, Inc. | Cell-penetrating ATF5 polypeptides and uses thereof |
| US10525100B2 (en) | 2018-01-03 | 2020-01-07 | Sapience Therapeutics, Inc. | ATF5 peptide variants and uses thereof |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7847060B2 (en) * | 2005-02-25 | 2010-12-07 | Oncotherapy Science, Inc. | Peptide vaccines for lung cancers expressing TTK, URLC10 or KOC1 polypeptides |
| EP2343294A1 (en) | 2009-11-30 | 2011-07-13 | Bayer Schering Pharma AG | Substituted triazolopyridines |
| WO2011130644A2 (en) * | 2010-04-16 | 2011-10-20 | Arqule, Inc. | Phosphorylated nf45 biomarkers, antibodies and methods of using same |
| ES2541054T3 (es) * | 2010-10-20 | 2015-07-15 | Université De Bordeaux | Firmas del resultado clínico en tumores estromales gastrointestinales y método de tratamiento de tumores estromales gastrointestinales |
| KR101232084B1 (ko) * | 2011-10-31 | 2013-02-08 | 연세대학교 산학협력단 | 암 세포 바이오 마커를 동정하는 방법 및 상기 방법으로 동정한 nmd-무관 암 세포 바이오 마커 |
| CN109423517B (zh) * | 2017-08-28 | 2022-08-05 | 中国医学科学院肿瘤医院 | 外泌体在肿瘤诊断、治疗和预后评估中的用途 |
Family Cites Families (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| ES2294844T3 (es) | 1998-06-25 | 2008-04-01 | Green Peptide Co., Ltd. | Peptidos antigenicos tumorales derivados de ciclofilina b. |
| US20020103360A1 (en) | 1998-09-01 | 2002-08-01 | Yang Pan | Novel protein related to melanoma-inhibiting protein and uses thereof |
| US20030045491A1 (en) * | 2001-02-23 | 2003-03-06 | Christoph Reinhard | TTK in diagnosis and as a therapeutic target in cancer |
| CN101732717A (zh) * | 2001-02-21 | 2010-06-16 | 诺华疫苗和诊断公司 | 用于诊断和作为癌症治疗靶标的ttk |
| CA2467936C (en) | 2001-11-21 | 2013-11-05 | Mitsubishi Chemical Corporation | Method of inhibiting gene expression |
| AU2003207708A1 (en) | 2002-02-20 | 2003-09-09 | Sirna Therapeutics, Inc. | Rna interference mediated inhibition of map kinase genes |
| ATE513843T1 (de) | 2002-09-25 | 2011-07-15 | Univ Massachusetts | Abstellen von genen in vivo durch chemischmodifizierte und stabile sirna |
| TW200413725A (en) | 2002-09-30 | 2004-08-01 | Oncotherapy Science Inc | Method for diagnosing non-small cell lung cancers |
| US20060024692A1 (en) * | 2002-09-30 | 2006-02-02 | Oncotherapy Science, Inc. | Method for diagnosing non-small cell lung cancers |
| DE602004015064D1 (de) * | 2003-01-06 | 2008-08-28 | Wyeth Corp | Zusammensetzungen und verfahren zur diagnose und behandlung von kolonkrebs |
| WO2004070062A2 (en) * | 2003-02-04 | 2004-08-19 | Wyeth | Compositions and methods for diagnosing and treating cancers |
| WO2005044976A2 (en) | 2003-06-20 | 2005-05-19 | Isis Pharmaceuticals, Inc. | Oligomeric compounds for use in gene modulation |
| US20050136437A1 (en) | 2003-08-25 | 2005-06-23 | Nastech Pharmaceutical Company Inc. | Nanoparticles for delivery of nucleic acids and stable double-stranded RNA |
| WO2005045037A2 (en) | 2003-10-23 | 2005-05-19 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED INHIBITION OF 5-ALPHA REDUCTASE AND ANDROGEN RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| WO2006021817A2 (en) | 2004-08-23 | 2006-03-02 | Sylentis S.A.U. | Treatment of eye disorders characterized by an elevated introacular pressure by sirnas |
| EP2395109A1 (en) * | 2004-12-08 | 2011-12-14 | Aventis Pharmaceuticals Inc. | Method for measuring resistance or sensitivity to docetaxel |
| EP2295601A1 (en) * | 2005-02-10 | 2011-03-16 | Oncotherapy Science, Inc. | Method of diagnosing bladder cancer |
| US7847060B2 (en) * | 2005-02-25 | 2010-12-07 | Oncotherapy Science, Inc. | Peptide vaccines for lung cancers expressing TTK, URLC10 or KOC1 polypeptides |
| US8053183B2 (en) * | 2005-07-27 | 2011-11-08 | Oncotherapy Science, Inc. | Method of diagnosing esophageal cancer |
| TW201008574A (en) * | 2008-08-19 | 2010-03-01 | Oncotherapy Science Inc | INHBB epitope peptides and vaccines containing the same |
-
2007
- 2007-12-12 EP EP11185104A patent/EP2468887A1/en not_active Withdrawn
- 2007-12-12 EP EP07859848A patent/EP2102360A2/en not_active Withdrawn
- 2007-12-12 EP EP11185101A patent/EP2468886A1/en not_active Withdrawn
- 2007-12-12 WO PCT/JP2007/074359 patent/WO2008072777A2/en not_active Ceased
- 2007-12-12 JP JP2009524832A patent/JP2010512730A/ja not_active Withdrawn
- 2007-12-12 TW TW096147377A patent/TW200831673A/zh unknown
- 2007-12-12 US US12/518,876 patent/US20100009920A1/en not_active Abandoned
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9284349B2 (en) | 2007-02-21 | 2016-03-15 | Oncotherapy Science, Inc. | Peptide vaccines for cancers expressing tumor-associated antigens |
| US8383590B2 (en) | 2007-02-21 | 2013-02-26 | Oncotherapy Science, Inc. | Peptide vaccines for cancers expressing tumor-associated antigens |
| US8623829B2 (en) | 2007-02-21 | 2014-01-07 | Oncotherapy Science, Inc. | Peptide vaccines for cancers expressing tumor-associated antigens |
| US8759481B2 (en) | 2007-02-21 | 2014-06-24 | Oncotherapy Science, Inc. | Peptide vaccines for cancers expressing tumor-associated antigens |
| US9067973B2 (en) | 2007-02-21 | 2015-06-30 | Oncotherapy Science, Inc. | Peptide vaccines for cancers expressing tumor-associated antigens |
| WO2010023340A3 (es) * | 2008-08-28 | 2010-05-20 | Proyecto De Biomedicina Cima, S.L. | Nuevo biomarcador como diana terapéutica en cáncer de pulmón |
| US8530430B2 (en) | 2009-05-11 | 2013-09-10 | Oncotherapy Science, Inc. | TTK peptides and vaccines including the same |
| US10155796B2 (en) | 2013-02-22 | 2018-12-18 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for inhibiting tumor cells by inhibiting the transcription factor ATF5 |
| US10273274B2 (en) | 2013-02-22 | 2019-04-30 | The Regents Of The University Of California | Compositions and methods for inhibiting tumor cells by inhibiting the transcription factor ATF5 |
| US11555057B2 (en) | 2013-02-22 | 2023-01-17 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for inhibiting tumor cells by inhibiting the transcription factor ATF5 |
| US10316077B2 (en) | 2017-02-20 | 2019-06-11 | Sapience Therapeutics, Inc. | Cell-penetrating ATF5 polypeptides and uses thereof |
| US10525100B2 (en) | 2018-01-03 | 2020-01-07 | Sapience Therapeutics, Inc. | ATF5 peptide variants and uses thereof |
| US11878047B2 (en) | 2018-01-03 | 2024-01-23 | Sapience Therapeutics, Inc. | ATF5 peptide variants and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20100009920A1 (en) | 2010-01-14 |
| JP2010512730A (ja) | 2010-04-30 |
| EP2102360A2 (en) | 2009-09-23 |
| EP2468886A1 (en) | 2012-06-27 |
| EP2468887A1 (en) | 2012-06-27 |
| TW200831673A (en) | 2008-08-01 |
| WO2008072777A3 (en) | 2008-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20100009920A1 (en) | Ttk as tumor marker and therapeutic target for lung cancer | |
| WO2011096211A1 (en) | Whsc1 and whsc1l1 for target genes of cancer therapy and diagnosis | |
| WO2012144220A1 (en) | Ezh2 as target gene for cancer therapy and diagnosis | |
| EP2329044B1 (en) | Prmt1 for target genes of cancer therapy and diagnosis | |
| CA2697517A1 (en) | Cancer-related genes, cdca5, epha7, stk31 and wdhd1 | |
| WO2007013575A2 (en) | Method for diagnosing and treating renal cell carcinoma | |
| WO2010095364A1 (en) | Jarid1b for target gene of cancer therapy and diagnosis | |
| US20100184047A1 (en) | Screening and therapeutic method for nsclc targeting the cdca8-aurkb complex | |
| US20110014615A1 (en) | METHOD FOR DIAGNOSING NON-SMALL CELL LUNG CANCERS BY tRNA-DIHYDROURIDINE SYNTHASE ACTIVITY OF URLC8 | |
| CN101189346A (zh) | 乳腺癌相关基因znfn3a1 | |
| US20110070245A1 (en) | Imp-1 oncogene as a therapeutic target and prognostic indicator for lung cancer | |
| WO2012023290A1 (en) | Rasef as tumor marker and therapeutic target for cancer | |
| US8182997B2 (en) | Prostate cancer related gene STYK1 | |
| WO2010023854A1 (en) | Cancer related gene, lgn/gpsm2 | |
| CN101273145A (zh) | 癌症相关基因rasgef1a | |
| WO2012023288A1 (en) | Fam161a as a target gene for cancer therapy and diagnosis | |
| WO2011018898A1 (en) | Cdc45l as tumor marker and therapeutic target for cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07859848 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2009524832 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007859848 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12518876 Country of ref document: US |