WO2008065636A2 - Treatment of disease by modulating cf5 protein - Google Patents

Treatment of disease by modulating cf5 protein Download PDF

Info

Publication number
WO2008065636A2
WO2008065636A2 PCT/IE2007/000117 IE2007000117W WO2008065636A2 WO 2008065636 A2 WO2008065636 A2 WO 2008065636A2 IE 2007000117 W IE2007000117 W IE 2007000117W WO 2008065636 A2 WO2008065636 A2 WO 2008065636A2
Authority
WO
WIPO (PCT)
Prior art keywords
activity
cell
protein
expression
agent
Prior art date
Application number
PCT/IE2007/000117
Other languages
French (fr)
Other versions
WO2008065636A3 (en
Inventor
Rosemary O'connor
Katie O'callaghan
Original Assignee
University College York - National University Of Ireland, Cork
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University College York - National University Of Ireland, Cork filed Critical University College York - National University Of Ireland, Cork
Publication of WO2008065636A2 publication Critical patent/WO2008065636A2/en
Publication of WO2008065636A3 publication Critical patent/WO2008065636A3/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4716—Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/575—Hormones
    • G01N2333/65—Insulin-like growth factors (Somatomedins), e.g. IGF-1, IGF-2
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/32—Cardiovascular disorders

Definitions

  • the invention relates to a method of preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual in need thereof.
  • the IGF-IR and its ligands activate a conserved signalling pathway through PI3-Kinase and Akt that regulates the Forkhead and mTOR pathways necessary for survival, growth, and development.
  • This complex signalling pathway overlaps the insulin pathway and is modulated by nutrients, growth factors, cytokines, and environmental signals to directly control metabolism, protein synthesis, cell growth, and cell-cycle progression. Ultimately it determines the survival or death of a cell or organism and may also control lifespan.
  • dysregulation of this pathway is associated with many human diseases including cancer, diabetes, cardiovascular disease, and neurodegenerative disorders. Some of the most frequently altered tumour-suppressor genes or oncogenes in cancers encode proteins that directly affect the IGF-IR signalling pathway.
  • Akt Akt
  • TCSl-TCS-2 complex activated by the nutrient-sensing LKBl kinase-AMPK pathway to regulate mTOR
  • DNA damage-activated tumour suppressor p53 The PI-3 kinase pathway also has complex amplification and feedback regulatory mechanisms that complicate the targeting of individual components of the pathway in the treatment of disease.
  • IGF-IR Intracellular signalling
  • tumour cells may be sufficiently more dependent on its signals to allow safe therapeutic use of IGF-IR inhibitors, but this remains to be seen.
  • Serum levels of IGFs and IGF binding protein 3 have been linked with increased risks of breast, prostate, colorectal, and lung cancer, but the correlation of increased IGF-IR expression levels in cancer tissue vs. normal tissue or in different stages of cancer progression is less clear.
  • the expression levels of IGF-IR in tumour cells may not be enough to predict their sensitivity to inhibitors or to select patient cohorts that may respond to IGF-IR inhibitors.
  • IGF-IR inhibitors may be toxic to normal tissues adds new urgency to identifying the mediators and modulators of IGF-IR signalling that distinguish its activity in tumour cells from its activity in normal cells. These proteins may identify which tumours are responsive to IGF-IR inhibition and may also become more suitable targets for inhibiting this signalling pathway than the IGF-IR itself.
  • New mediators of IGF-IR function were identified in a screen for genes that were differentially expressed in IGF-IR- transformed (R+) cells when compared with IGF-IR null (R-) cells (derived from the IGF-IR knockout mouse (Sell, C, et al., 1994. Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts. MoI Cell Biol 14:3604-12.).
  • R- IGF-IR null cells
  • Mystique is a new insulin-like growth factor-I-regulated PDZ-LIM domain protein that promotes cell attachment and migration and suppresses Anchorage- independent growth.
  • a method of preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual in need thereof comprising a step of modulating Cf5 protein activity in the individual.
  • the method involves treating the individual with a therapeutically effective amount of an agent capable of modulating, and especially attenuating, Cf5 activity.
  • the method involves treating the individual with Cf5 protein, or a biologically active fragment of variant thereof.
  • the pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways is one that involves aberrant cell or tissue acidification, or aberrant cell migration, proliferation, invasion, or motility.
  • Diseases or conditions associated with this pathology will be well known to those skilled in the art.
  • the disease or condition is selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis.
  • the pathology is cancer
  • the agent capable of modulating Cf5 activity is an agent capable of attenuating Cf5 activity in a cancer cell.
  • the cancer is selected from the group comprising: fibrosarcoma; myxosarcoma; liposarcoma; chondrosarcom; osteogenic sarcoma; chordoma; angiosarcoma; endotheliosarcoma; lymphangiosarcoma; lymphangioendotheliosarcoma; synovioma; mesothelioma; Ewing's tumor; leiomyosarcoma; rhabdomyosarcoma; colon carcinoma; pancreatic cancer; breast cancer; ovarian cancer; prostate cancer; squamous cell carcinoma; basal cell carcinoma; adenocarcinoma; sweat gland carcinoma; sebaceous gland carcinoma; papillary carcinoma; papillary adenocarcinomas; cystadenocarcinoma; medull
  • the invention provides a method of attenuating the drug/radiation resistance of a cancer cell comprising the steps of treating the cell with an agent capable of attenuating the Cf5 activity of the cell.
  • the agent sensitises the cancer cell to drug-based or radiation- based cancer therapies.
  • the cell is treated with a combination of a cytotoxic agent and an agent that attenuates the Cf5 activity of the cell.
  • the invention provides a method of prevention or treatment of metastases in an individual, typically an individual afflicted with an existing tumour such as a primary tumour, the method comprising the steps of treating the individual with an agent capable of attenuating the Cf5 activity of the cell.
  • the metastases is selected from the group comprising: bone metastases; lung metastases; liver metastases; bone marrow metastases; breast metastases; and brain metastases.
  • the invention also relates to a method of inhibiting VATP function is a cell comprising the step of treating the cell with an agent capable of attenuating the Cf5 activity of the cell. This method may be usefully employed in the prevention or treatment of any disease, condition or pathology that involves aberrant cell or tissue acidification, or aberrant cell survival, proliferation, migration or invasion.
  • RNA interference is an evolutionally highly conserved process of post-transcriptional gene silencing (PTGS) by which double stranded RNA (known as siRNA molecules), when introduced into a cell, causes sequence- specific degradation of mRNA sequences.
  • RNAi machinery once it finds a double-stranded RNA molecule, cuts it up, separates the two strands, and then proceeds to destroy RNA molecules that are complementary to one of those segments, or prevent their translation into proteins.
  • suppression of Cf5 expression may be achieved by treating an individual with siRNA molecules designed to target Cf5 mRNA, preferably a sequence in the Cf5 mRNA from nucleotides 158 to 183. More preferably, the siRNA molecules are designed to target a sequence in the human Cf5 mRNA selected from the group comprising: nucleotides 158 to 176; and nucleotides 165 to 183.
  • the siRNA molecule A 5'-UGGUGACGCACGUGAUGUAUU-S' (SEQUENCE ID NO: 5) specifically targets nucleotides 5'-TGGTGACGCACGTGATGTA- 3 at nucleotide positions 158-176 after the start codon of cF5.
  • the siRNA molecule B 5'-GCACGUGAUGUACAUGCAAUU-S' (SEQNUENCE ID NO: 6) specifically targets nucleotides 5'- GCACGTGATGTACATGCAA-3' at nucleotide positions 165-183 after the start codon of Cf5.
  • siRNA oligonucleotides designed to target mouse and rat Cf5 genes are provided in SEQUENCE ID NO's: 15 and 16.
  • the invention relates to an oligonucleotide selected from the group comprising: SEQUENCE ID NO: 5; SEQUENCE ID NO: 6; SEQUENCE ID NO: 15; and SEQUENCE ID NO: 16 .
  • the invention also relates to a siRNA molecule designed to target human Cf5 mRNA, suitably a sequence in human Cf5 mRNA from nucleotides 158 to 176, or from nucleotides 165 to 183 after the start codon of Cf5.
  • the invention relates to a medicament comprising an oligonucleotide or siRNA molecule of the invention, optionally in combination with a suitable pharmaceutical excipient.
  • the medicament is useful in the prevention or treatment of a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling in an individual such as, for example, one that involves aberrant cell or tissue acidification, or aberrant cell migration, proliferation, invasion, or motility.
  • Diseases or conditions associated with this pathology will be well know to those skilled in the art.
  • the disease or condition is selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis
  • miRNAs are small ( ⁇ 22nt) non-coding RNAs (ncRNAs) that regulate gene expression at the level of translation.
  • ncRNAs non-coding RNAs
  • miRNAs have been found to be critical for development, cell proliferation and cell development, apoptosis and fat metabolism, and cell differentiation.
  • small hairpin RNA (shRNA) molecules are short RNA molecules having a small hairpin loop in their tertiary structure tha may be employed to silence genes.
  • miRNA or shRNA molecules capable of silencing Cf5 will be apparent to those skilled in the field of miRNA or shRNA molecule design.
  • the level of Cf5 expression can be modulated using antisense or ribozyme approaches to inhibit or prevent translation of Cf5 mRNA transcripts or triple helix approaches to inhibit transcription of the Cf5 gene.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to Cf5mRNA. The antisense oligonucleotides will bind to the complementary mRNA transcripts and prevent translation.
  • Ribozyme molecules designed to catalytically cleave Cf5 mRNA transcripts can also be used to prevent translation and expression of Cf5.
  • Attenuation of Cf5 activity is achieved using an agent that directly inhibits Cf5 activity, wherein the agent is selected from the group comprising: a Cf5 ligand (such as a Cf5-specific antibody) ; amantadine or an amantadine-like molecule.
  • a Cf5 ligand such as a Cf5-specific antibody
  • amantadine or an amantadine-like molecule typically, when the pathology is a neurodegenerative disease, the agent is not memantine.
  • the susceptibility to inhibition by amantadine-like agents is based on the amino acid sequence and predicted structure of the CF5 protein.
  • CF5 has a buried arginine (Arg 34) in the first transmembrane domain next to a glutamine (glu 35), and it also has a buried tryptophan (Trp 51) four residues away from a histidine (His 56) in the second transmembrane domain. This suggests that CF5 may constitute a proton channel rather than a proton pump. Protonation of histidine side chains has been shown to be an essential mechanism in H+ channel conductance in the homotetrameric acid-activated M2 H+ channel from influenza A.
  • M2 is a well-characterized proton channel that acidifies the viral core after it is endocytosed into cells and is an influenza drug target inhibited by amantadine (AMT) (see http://en.wikipedia.org/wiki/Amantadine).
  • AMT amantadine
  • His 37 two juxtaposed histidines
  • protonation of a third histidine in the complex is associated with channel activation (Hu et al., 2006. Histidines, heart of the hydrogen ion channel from influenza A virus: toward an understanding of conductance and proton selectivity. Proc Natl Acad Sci U S A 103:6865-70).
  • the channel acts a sensor of pH and is activated in response to increase in H+ concentration.
  • Proton channels like M2 are virtually uncharacterized in mammalian cells with the exception of a family of acid sensitive channels that bear no structural resemblance to CF5.
  • CF5 may also be inhibitable by macrolide antibiotics concanamycin-like molecules and baflicomycin-like molecules, which have been shown to bind to and inhibit the c subunit of the V-ATpase.
  • a method of preventing or treating cardiovascular disease in an individual in need thereof comprising a step of modulating Cf5 protein activity in the individual.
  • the cardiovascular disease is selected from the group comprising: cardiac hypertrophy; myocardial infarction; stroke; arteriosclerosis; and heart failure.
  • the method involves treating the individual with an agent that modulates Cf5 activity, suitably by modulating the expression of Cf5 or by modulating the activity of the Cf5 protein.
  • Cf5 activity may be modulated by treatment with IGF-IR or IGF-IR agonists or antagonists.
  • a method of preventing or treating renal disease in an individual in need thereof comprising a step of modulating Cf5 protein activity in the individual.
  • the renal disease is selected from the group comprising: Duplicated ureter; Horseshoe kidney; Polycystic kidney disease; Renal dysplasia; Unilateral small kidney; Diabetic nephropathy; Glomerulonephritis; Hydronephrosis; Interstitial nephritis; Lupus nephritis; nephrotic syndrome; and acute renal failure; chronic renal failure.
  • the method involves treating the individual with an agent that modulates Cf5 activity, suitably by modulating the expression or activity of Cf5 or by acting as an agonist to the Cf5 protein.
  • Cf5 activity may be modulated by treatment with IGF-IR.
  • the invention also relates to a method of identifying or monitoring VATP activity in a biological system comprising the step of assaying the biological system for Cf5 activity. Suitably this assay involves determining Cf5 expression levels in the biological system.
  • Cf5 acts as a surrogate marker of VATP activity. Expression levels may be determined by any means known in the art, i.e. at a protein or mRNA level.
  • the invention also relates to a method of identifying or monitoring IGF-IR signalling pathway activity in a biological system comprising the step of assaying the biological system for Cf5 activity.
  • this assay involves determining Cf5 expression levels in the biological system.
  • Cf5 acts as a surrogate marker of IGF-IR signalling pathway activity.
  • Expression levels may be determined by any means known in the art, i.e. at a protein or mRNA level.
  • the invention also relates to a method of assessing the ability of an agent to modulate the VATP or IGF-IR signalling pathway activity of a biological system comprising the steps of treating the biological system with the agent and then assaying the system for expression of Cf5.
  • biological system should be taken to include a cell, a cell line, a tissue sample, an organ, a unicellular or multicellular organism, or a lower or higher life form.
  • the invention also relates to a method of assessing the metastatic status of a cell or tissue comprising the step of assaying the cell for expression of Cf5, wherein an increased level of Cf5 expression compared to a reference level is indicative of the cell having metastatic potential.
  • the Cf5 expression level is a surrogate prognostic marker or a component of a signature of metastatic potential, or indeed a diagnostic marker of cell metastases.
  • Cf5 may act on it' s own as a diagnostic or prognostic variable of certain pathologies, or the activity of certain cellular signalling pathways or components of signalling pathways, it is likely that it's use as a prognostic or diagnostic variable will be in combination with other markers in the form of a panel of markers which together are capable of providing a profile or signature of cellular activity or pathologies.
  • the invention also provides methods of screening for compounds capable of modulating Cf5 activity, which compounds will find use in treating pathologies characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling in an individual such as, for example, one that involves aberrant cell or tissue acidification, or aberrant cell migration, proliferation, invasion, or motility.
  • Diseases or conditions associated with this pathology will be well know to those skilled in the art.
  • the disease or condition is selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e.
  • wound healing tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.
  • inflammation and inflammatory disease autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis.
  • these methods all involve monitoring Cf5 activity at a protein expression level or a protein activity level.
  • the invention also relates to a method of identifying compounds useful in the treatment or prevention of pathologies characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways, comprising determining a reference level of activity of a CF5 protein, contacting the Cf5 protein with a candidate compound, and determining the level of activity of the contacted Cf5 protein, wherein a decrease or increase in the level of activity of the contacted Cf5 protein relative to the reference level of Cf5 activity is an indication that the candidate compound is useful in the treatment or prevention of pathologies characterised by dysregulated IGF-Ir signalling pathways.
  • the invention relates to a method of identifying compounds useful in the treatment or prevention of cancer comprising determining a reference level of activity of a CF5 protein, contacting the Cf5 protein with a candidate compound, and determining the level of activity of the contacted Cf5 protein, wherein a decrease in the level of activity of the contacted Cf5 protein relative to the reference level of Cf5 activity is an indication that the candidate compound is useful in the treatment or prevention of cancer.
  • the invention relates to a method of identifying compounds useful in the treatment or prevention of cardiovascular disease comprising determining a reference level of activity of a CF5 protein, contacting the Cf5 protein with a candidate compound, and determining the level of activity of the contacted Cf5 protein, wherein modulation in the level of activity of the contacted Cf5 protein relative to the reference level of Cf5 activity is an indication that the candidate compound is useful in the treatment or prevention of cancer
  • the Cf5 protein is preferably provided in the form of Cf5 expressing cells, and in which the level of activity is preferably determined by assaying for a level of expression of Cf5 protein in the cells.
  • the invention provides a method of identifying an agent that modulates expression of Cf5 protein comprising the steps of providing a source of Cf5 expressing cells, treating the cells with a candidate agent, and assaying the cells for expression of Cf5 protein, wherein a decrease or increase in the level of expression of Cf5 protein in the treated cells relative to untreated cells is an indication that the candidate agent is useful in modulating expression of Cf5 protein.
  • the amino acid sequence of human Cf5 protein is provided in SEQUENCE ID NO: 1, and that of a mouse homolog is provided in SEQUENCE ID NO: 2. Accordingly, the invention relates to an isolated polypeptide comprising an amino acid sequence of SEQUENCE ID NO' s : 1 or 2, or a biologically active fragment or variant thereof.
  • the invention also relates to an isolated polypeptide consisting essentially of the amino acid sequence of SEQUENCE ID NO: 1 or SEQUENCE ID NO: 2, or a biologically active fragment or variant thereof.
  • biologically active should be taken to mean that the fragment retains all or part of the biological functionality of the parent protein.
  • the fragment will retain the ability to promote the acidification, growth factor responsiveness, endocytosis, survival, proliferation, and/or motility/invasion of a cell relative to an untreated cell.
  • a “fragment” of the Cf5 protein means a contiguous stretch of amino acid residues of at least 5 amino acids, preferably at least 6 amino acids.
  • the "fragment” will comprise at least 10, preferably at least 20, more preferably at least 30, and ideally at least 40 contiguous amino acids.
  • a "variant" of the Cf5 protein shall be taken to mean proteins having amino acid sequences which are substantially identical to wild-type Cf5 protein, especially human wild-type Cf5.
  • the term should be taken to include proteins or polypeptides that are altered in respect of one or more amino acid residues.
  • such alterations involve the insertion, addition, deletion and/or substitution of 5 or fewer amino acids, more preferably of 4 or fewer, even more preferably of 3 or fewer, most preferably of 1 or 2 amino acids only. Insertion, addition and substitution with natural and modified amino acids is envisaged.
  • the variant may have conservative amino acid changes, wherein the amino acid being introduced is similar structurally, chemically, or functionally to that being substituted.
  • Cf5 proteins which have been altered by substitution or deletion of catalytically- important residues will be excluded from the term "variant".
  • substitution, deletion, insertion, addition or modification will in one embodiment be carried out on the non- transmembrane parts of the protein.
  • Such parts of the protein will be evident from Figure 1.
  • the variant will have at least 70% amino acid sequence homology, preferably at least 80% sequence homology, more preferably at least 90% sequence homology, and ideally at least 95%, 96%, 97%, 98% or 99% sequence homology with wild-type human Cf5.
  • sequence homology comprises both sequence identity and similarity, i.e. a polypeptide sequence that shares 70% amino acid homology with wild-type human Cf5 is one in which any 70% of aligned residues are either identical to, or conservative substitutions of, the corresponding residues in wild-type human Cf5.
  • variant is also intended to include chemical derivatives of Cf5 protein, i.e. where one or more residues of Cf5 is chemically derivatized by reaction of a functional side group. Also included within the term variant are Cf5 molecules in which naturally occurring amino acid residues are replaced with amino acid analogues.
  • Proteins and polypeptides (including variants and fragments thereof) of and for use in the invention may be generated wholly or partly by chemical synthesis or by expression from nucleic acid.
  • the proteins and peptides of and for use in the present invention can be readily prepared according to well- established, standard liquid or, preferably, solid-phase peptide synthesis methods known in the art (see, for example, J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, 2nd edition, Pierce Chemical Company, Rockford, Illinois (1984), in M. Bodanzsky and A. Bodanzsky, The Practice of Peptide Synthesis, Springer Verlag, New York (1984).
  • the DNA sequence of the open reading frame (ORF) of the human and mouse Cf5 genes are provided in SEQUENCE ID NO: 3 and SEQUENCE ID NO: 4, respectively.
  • the Accession Numbers for the human and mouse Cf5 genes are NM_017842 and BC022913.
  • the human gene has been found to have two isoforms, one of approximately 2.6kb and a second of approximately 1.6kb.
  • the sequences of both of these isoforms form part of the present invention.
  • the invention relates to an isolated polynucleotide comprising or consisting essentially of a polynucleotide sequence of SEQUENCE ID NO: 3 or 4 (or any isoforms thereof) .
  • the invention also relates to an isolated polynucleotide encoding a polypeptide of the invention, or encoding a biologically active fragment or variant thereof.
  • the invention also relates to a recombinant polynucleotide comprising a promoter sequence operably linked to a polynucleotide of the invention.
  • the invention also relates to a cell transformed with a recombinant polynucleotide of the invention, and a transgenic organism comprising a recombinant polynuclotide of the invention.
  • the invention also provides a ligand to an isolated polypeptide of the invention.
  • ligands are described above, and include antibodies that bind specifically to the protein of SEQ ID NO: 1.
  • the invention also provides an isolated antibody raised against
  • the isolated polypeptide of the invention or (2) an immunogenic fragment of an extracellular portion of the polypeptide.
  • the invention also relates to an isolated antibody that binds specifically to the isolated polypeptide of the invention, especially the protein of SEQ ID NO: 1.
  • the immunogenic fragment of an extracellular portion of the polypeptide comprises a peptide having at least five contiguous amino acids from the extracellular portions of the amino acid sequence of SEQUENCE ID NO. 1 or SEQUENCE ID NO: 2.
  • the immunogenic fragment of an extracellular portion of the polypeptide comprises a peptide having at least five contiguous amino acids from the extracellular C-terminal or N-terminal portions of the amino acid sequence of SEQUENCE ID NO. 1 or SEQUENCE ID NO: 2.
  • the peptide comprises at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least twelve contiguous amino acids.
  • the peptide has less than 50, 40, 30, 20, and 15 amino acids.
  • the antibody is raised using a peptide comprising, or consisting essentially of, the amino acid sequence 131-146 of the human Cf5 protein. Methods of producing antibodies, both monoclonal and polyclonal, will be well known to those skilled in the art.
  • the invention also relates to a method of prevention or treatment of a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual comprising a step of treating the individual with an antibody of the invention.
  • pathologies characterised by dysregulated IGF-IR signalling include those that involve aberrant cell or tissue acidification, or aberrant cell migration, proliferation, invasion, or motility. Diseases or conditions associated with this pathology will be well know to those skilled in the art.
  • the disease or condition is selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling
  • the invention also relates to a medicament comprising an antibody of the invention.
  • the invention also relates to a pharmaceutical composition comprising an antibody of the invention in combination with a pharmaceutically acceptable excipient .
  • the invention also relates to a medicament comprising an agent capable of modulating Cf5 protein activity.
  • the agent is capable of attenuating Cf5 activity (i.e. siRNA molecules of SEQUENCE ID NO: 5 and 6) .
  • the agent is capable of modulating Cf5 activity.
  • the invention also relates to the use of a- medicament of the invention in the treatment of a pathology selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorragic origin) ; inflammatory disease; autoimmune disease; infectious disease; renal disease; restenosis; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); and pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, post operative trauma, prostheses, stents, angioplasty, and other implants, tissue inflammation/infection , burn healing, corneal repair) .
  • a pathology selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease
  • the invention also relates to the use of an agent that modulates Cf5 activity in the manufacture of a medicament for the treatment of pathologies characterised by aberrant VATP activity.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an agent that modulates Cf5 activity, optionally in combination with a pharmaceutically excipient.
  • the agent attenuates Cf5 activity.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an antibody or ligand of the invention in combination with a suitable carrier or pharmaceutical excipient .
  • Two isoforms of cf5 are expressed in multiple tissues in mouse and the protein is predicted to have four transmembrane domains.
  • CF5 mRNA and protein is induced by IGF-I.
  • B Western blots were prepared with protein lysates extracted from IGF-I stimulated R+ and Rat-1 cells and then probed with antibody recognizing endogenous CF5. Actin was used as a control for equal loading.
  • the CF5 protein is located in endosomes.
  • HeLa cells transiently expressing GFP-tagged CF5 were immunofluorescently co-stained for expression and examined for location of CF5, EEA-I, and the transferrin receptor. Colocalisation of HA-tagged CF5 with GFP-RABIl was examined in HeLa cells co-expressing these proteins.
  • B For EVA antibody uptake by live cells, MCF-7 cells were seeded at a density of 8xlO 4 cells on to serum-coated 10mm glass coverslips and allowed to attach for 24 hours. Then the media was changed to complete media containing polyclonal EVA antibody and monoclonal anti-HA antibody as negative control and the cells were put back in culture for 16 hours.
  • CF5 expression decreases cell viability and receptor mediated endocytosis.
  • A HeLa cells were transfected with 1OnM of siRNA directed towards cf5 or a control siRNA, and the cultures were examined 48hrs later under the 2Ox objective of a phase contrast microscope. Knockdown of cf5 expression was confirmed by RT- PCR.
  • B For growth assays, HeLa cells were transfected with siRNA and re-seeded into triplicate wells of a 24-well plate at a density of 3xlO 4 cells/well 24hrs later. Cells were counted every 24hrs for up to 72hrs by trypan blue exclusion. Knockdown of cf5 expression was confirmed by RT-PCR.
  • EVA levels are shown on the right inset.
  • F Quantification of total Transferrin Receptor (TfR) levels in HeLa and MCF7 cells transfected with siNeg or siEVA oligos. Data are representative of 2-3 experiments with each cell line. *p ⁇ 0.05, ** p ⁇ 0.01.
  • CF5 associates with the c subunit of the V-ATPase proton pump.
  • A A two hybrid screen was carried out using full length CF5 protein as bait and a cDNA library from HeLA cells. From this five putative CF5-interacting proteins were isolated and these are indicated in the table.
  • B To determine whether CF5 and the c subunit of the V-ATPase interacted in mammalian cells, expression vectors encoding CF5 and his-tagged C subunit were co-expressed in cells. Each protein was immunoprecipitated following western blotting to detect interacting proteins.
  • CF5 expression causes increased endosomal pH indicative of impaired V-ATPase mediated acidification.
  • primers were designed to mutate the stop codon of the cf5 coding sequence and to incorporate a Xhol restriction site at the 5' end and a BamHI restriction site at the 3' end of the amplified cf5 coding sequence.
  • the recombinant pcDNA3-Ha-cf5 vector was used as template DNA.
  • the sequences of the forward and reverse primers were as follows: 5' -CAATCTCGAGAACATGGCCCCGTCCA-3' and 5' -CGGTGGATCCAATGAGAAATCGCTGAG-B' , respectively (SEQUENCE ID NO's: 9 and 10), respectively), with the restriction sites underlined.
  • the PCR was performed on 50ng of template DNA as follows: 95°C for 5 minutes, 95 0 C for 30 seconds, 55°C for 30 seconds, 72°C for 1.5 minutes.
  • a synthetic peptide corresponding to amino acids 131-146 of the human CF5 protein sequence was generated and used in the immunization of rabbits (Davids Biotechnologie GmbH, R ⁇ ntgenstrasse 3, D-93055 Regensburg, Germany) . This peptide sequence is conserved in the mouse and rat CF5 homologues.
  • the antibodies were affinity purified by binding to and elution from immobilised peptide. The specificity of the antibody was confirmed by peptide competition assays in western blots and immunofluorescence on cells.
  • R+, R-, HeLa, Hek293T and MCF7 cells were maintained in Dulbecco' s modified Eagles' s medium (DMEM) (Biowhittaker, Verviers, Belgium) supplemented in ImM L-glutamine, 10% foetal bovine serum (FBS) , and 5mg/ml of penicillin and streptomycin antibiotics.
  • DMEM Dulbecco' s modified Eagles' s medium
  • FBS foetal bovine serum
  • 5mg/ml of penicillin and streptomycin antibiotics for IGF-I stimulations, R+, Rat-1 and MCF7 cells were starved of serum for 4hrs before stimulation with lOOng/ml IGF-I (Peprotech) for the indicated times.
  • Mouse anti-EEAl antibody was purchased from BD Transduction Laboratories (Cowley, Oxford, United Kingdom) .
  • the mouse anti- transferrin receptor antibody was from X.
  • Mouse anti- ⁇ -actin antibody was from Sigma-Ireland.
  • Anti-HA antibody (clone 16B12) was purchased from Covance (Berkeley, CA) .
  • HeLa cells were seeded at ⁇ a density of 6X10 4 cells onto serum-coated glass coverslips and allowed to attach for at least 16h.
  • the cells were washed with PBS, fixed with 3.7% formaldehyde in PBS for 15 minutes at room temperature and permeabilised with 0.1% TritonX-100 in PHEM for 5 minutes. Prior to incubation with primary antibody the cells were blocked with 5% goat serum in PBS. Primary antibody incubations were performed for Ih at room-temperature. The cells were then washed with PBS and incubated with Cy2- or Cy3- conjugated secondary antibody (Jackson ImmunoResearch Laboratories, Soham, Cambridgeshire, United Kingdom) before examination with a fluorescent microscope.
  • Whole cell lysates were prepared by lysing cells in ice-cold RIPA lysis buffer (150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0, 1 mM PMSF, 1 ⁇ M pepstatin, 2 mg/ml aprotinin, 1 ⁇ M NaVO/j) for 20 min on ice. Nuclei and non-lysed cells were removed by centrifugation at 14,000rpm for 20 min, and the remaining proteins were denatured by incubation with 5X SDS loading buffer at room-temperature for 30 min.
  • RIPA lysis buffer 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS
  • 50 mM Tris pH 8.0
  • 1 mM PMSF 1 ⁇ M pepstatin
  • 2 mg/ml aprotinin 1 ⁇ M NaVO/j
  • Proteins were resolved on 15% SDS-PAGE gels before transfer to nitrocellulose membranes (Schleicher & Schuell, Dublin, Ireland) . Membranes were blocked for Ih at room- temperature in 5% milk in Tris-buffered saline (TBS)-T (2OmM Tris, 15OmM NaCl, and 0.05% Tween 20, pH7.6). Primary antibodies were diluted in 5% milk/TBS-T and incubated with membranes at 4°C overnight.
  • TSS Tris-buffered saline
  • Membranes were washed with TBS-T before chemiluminescent detection of antibody binding by incubation with horseradish peroxidase-conjugated secondary antibody (DakoCytomation Denmark A/S, Glostrup, Denmark) at room-temperature for Ih.
  • the forward primer 5' GCCCGGCGCCGCAGCCCCATGGCCCCGTCC 3'
  • reverse primer 5' CCTCACCCCCTGGGTCAGAAATCGCTGAG 3' were used (SEQUENCE ID NO' s : 11 and 12, respectively).
  • PCR conditions were as follows: 94°C for 15min; 94°C, 30s; 52°C, 30s; 72°C for 90s, for 30-32 cycles for amplification of cf5, or 18-22 cycles for gapdh amplification.
  • siRNA Small interfering RNA
  • HeLa and MCF-7 cells at approximately 50% confluency were transfected with 1OnM siRNA oligonucleotides using the OligofectAMINE transfection reagent ( Invitrogen) , as per manufacturer's instructions.
  • OligofectAMINE transfection reagent Invitrogen
  • a non-targeting oligonucleotide from Ambion was used as a negative control to confirm oligonucleotide specificity.
  • Knockdown of cf5 expression was examined 48 to 96hrs after transfection both by RT-PCR, using cf5-specific primers, and by western blotting with the anti-CF5 polyclonal antibody.
  • the MATCHMAKER Yeast Two-hybrid System (Clontech) was used to isolate interacting proteins for CF5.
  • the cDNA fragment encoding the full-length cf5 coding sequence was amplified by PCR and sub-cloned into the pGBKT7 yeast expression vector, containing the GAL4 DNA binding domain. This was used as bait to screen a human fetal brain library, constructed in the pACT2 vector, containing the GAL4 DNA activation domain.
  • the bait and library constructs were sequentially transformed into the yeast AH109 strain by electroporation. Selection of colonies containing putative interacting proteins was carried out as per manufacturer's protocol. After isolation, the sequences of the plasmid inserts were identified (Macrogen, Korea) . BLAST searches were then performed to identify the genes represented by these sequences.
  • HeLa cells were starved of serum for 30 min before being pulsed with 50 ⁇ g/ml transferrin Alexa Fluor 488 (Molecular Probes, Eugene, OR) in 10% FBS/DMEM for 20 min at 37°C, 5% CO 2 .
  • the cells were washed three times in PBS and the extent of transferrin uptake was examined in the FLlH channel by flow cytometry using the FACScan (Becton Dickinson) .
  • SiRNA transfected HeLa and MCF7 cells were cultured in 6-well plates. The next day, the media was changed to complete media containing 0.5 mg/ml FITC-Dextran 40 KDa (FD40, Sigma), and cultured for further 2 hours. After this time the cells were washed twice with PBS, trypsinized and transferred to FACS tubes, centrifuged for 5 minutes at 1000 rpm, washed with HBSS and centrifuged again. The supernatant was removed and the pellets were kept on ice and resuspended in Hanks Balanced Saline Solution just before analysis in the FACS. The mean fluorescence detected in channels FLl and FL2 was quantified, and the FL1/FL2 ratio calculated for each sample.
  • FITC-Dextran 40 KDa FD40, Sigma
  • the 1.6kb isoform is the more predominantly expressed isoform in all tissues examined, and expression is highest in liver and kidney tissues.
  • the 2.5kb isoform is expressed at low levels compared to the 1.6kb isoform in all tissues except for the liver and kidney. In these tissues, expression of both isoforms is comparable.
  • the RXR dibasic motif located proximal to the fourth putative transmembrane domain, is predicted by the MnM-minimotif miner server to act as an ER export motif. This motif has previously been shown to be required for the export of glycosyltransferases from the ER (Claudio G. Giraudo and Hugo J. F. Maccioni, 2003) .
  • Cf5 expression is regulated in response to IGF-I stimulation
  • Cf5 was initially isolated from the R+ cell line that over- expresses the IGF-IR but to determine if cf5 is an IGF-I- responsive gene a Northern blot of RNA from IGF-I-stimulated R+ cells was probed for cf5.
  • the levels of the 2.5kb isoform decreased upon 8hrs of IGF-I stimulation, while levels of the 1.6kb isoform increased concomitantly (Figure 2A) .
  • IGF-I responsiveness of the CF5 protein was next examined by western blotting. The levels of the protein increased substantially upon 24 hours of IGF-I stimulation in both Rat-1 and R+ cells ( Figure 2B) . Actin levels were used to confirm equal protein loading.
  • CF5 localises to the recycling endosomes of the endocytic pathway
  • EEA-I early endosomal autoantigen-1
  • transferrin receptor is constitutively endocytosed from the plasma membrane and recycled through the endocytic pathway. It thus acts as a marker of all endosomes in the recycling pathway.
  • HA-CF5 and GFP-RABlI are low molecular weight GTPase that associates with the membranes of recycling endosomes.
  • CF5 colocalised with EEA-I to only a small extent but substantial colocalisation of CF5 with both the transferrin receptor and RABIl was observed.
  • a significant amount of CF5 was localised in a region adjacent to the nucleus that represents the perinuclear recycling compartment ( Figure 3) .
  • CF5 is expressed at the plasma membrane of all cell lines examined. CF5 itself is also recycled to and from the plasma membrane in endosomes. CF5 levels at the plasma membrane can be altered in response to serum starvation and by disruption of the microtubule network with nocadozole. Trafficking of CF5 in the cell was also directly observed by fluorescence time-lapse microscopy of HeLa cells over-expressing GFP-tagged CF5. The results demonstrate that CF5 is highly dynamic within the cell and is trafficked to and from the plasma membrane.
  • Endocytosis of transferrin is decreased in cells with reduced CF5 expression
  • Recycling pathways contribute to cell migration, specially through the regulation of integrins and growth factor receptors expression at the plasma membrane, ⁇ l integrin. levels were lower in cells transfected with CF5 siRNA than control cells, both in HeLa and MCF-7 cells (Fig4F) .
  • HeLa cells with suppressed CF5 exhibited significantly reduced migration towards FBS in Transwell assays. There was approximately 40% and 50% less migration in siCF51- and siCF52- transfected cultures, respectively compared with controls. Migration was examined at 48hrs post-transfection to ensure that results would not be affected by death of cells transfected with the Cf5-specific siRNA.
  • the 16K subunit of V- ATPase is a 16kDa protein and, as predicted for CF5, has four transmembrane domains. It is a component of the proton translocating sector of V-ATPase, which consists of a membrane- spanning hexamer that forms a pore in the membrane. Due to the similarity of these proteins it was considered that CF5 could be a novel homologue of the 16K but BLAST analysis revealed no significant similarity between these proteins. It is possible, however, that CF5 is a previously uncharacterised subunit of V- ATPase. If CF5 is a component of V-ATPase we hypothesised that knocking down CF5 would affect the function of the proton pump.
  • CF5 The role of CF5 in the function of V-ATPase in endosomal acidification was then examined by measuring the accumulation of the acid sensitive dye FITC in endosomes (Fig. 6A).
  • Fig. 6A The role of CF5 in the function of V-ATPase in endosomal acidification was then examined by measuring the accumulation of the acid sensitive dye FITC in endosomes.
  • FITC-dextran were then loaded with FITC-dextran for three hours, which allows accumulation in endosomes, and were then analyzed by flow cytometry for fluorescence emission. This demonstrated that the pH-dependent shift in FITC fluorescence observed in control cells was increased in CF5 siRNA-transfected cells. A similar effect was observed in Concanamycin-treated cells.
  • HA-CF5 could be co-precipitated with the A subunit (Fig. 5C).
  • Fig. 5C we also analyzed the interaction of endogenous CF5 with the V 1 sector by immunoprecipitating Asubunit in NRK and Hek293T cells and we could observe co-immunoprecipitation of endogenous CF5 (Fig 5C) .
  • Fig 5C co-immunoprecipitation of endogenous CF5
  • non-cell based assay systems may be used to identify compounds that interact with, i.e., bind to Cf5, and regulate the activity of Cf5 in regulating V- ATPase activity and/or ion/proton translocation (methods for monitoring V-ATPase activity and ion/proton translocation are described in Vasilyeva et al., J Biol Chem. 2000 Jan7;275 (1) :255-60, and Moffat JC: Biophys J. 2007 Sep 2007). Such compounds may act as antagonists or agonists of Cf5 activity and may be used to regulate cell metabolism and cellular sensitivity to radiation or chemotherapeutic exposure.
  • Cf5 peptides corresponding to different functional domains or subunit fusion proteins may be expressed and used in assays to identify compounds that interact with Cf5.
  • soluble regions of Cf5 may be recombinantly expressed and utilized in non-cell based assays to identify compounds that bind to Cf5.
  • the Cf5 may also be one which has been fully or partially isolated from cell membranes, or which may be present as part of a crude or semi- purified extract.
  • the basis of the assays used to identify compounds that bind to Cf5 involves preparing a reaction mixture of the Cf5 and the test compound under conditions and for time sufficient to allow the two components to interact and bind, thus forming a complex which can be removed and/or detected in the reaction mixture.
  • the identity of the bound test compound is then determined.
  • one method to conduct such an assay involves anchoring the protein, polypeptide, peptide, fusion protein or the test substance onto a solid phase and detecting Cf5/test compound complexes anchored on the solid phase at the end of the reaction.
  • the Cf5 reactant is anchored onto a solid surface, and the test compound, which is not anchored, may be labeled.
  • microtitre plates conveniently can be utilized as the solid phase.
  • the anchored component is immobilized by non- covalent or covalent attachments.
  • the surfaces may be prepared in advance and stored.
  • the non- immobilized component is added to the coated surfaces containing the anchored component.
  • unreacted components are removed (e.g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface.
  • the detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously non-immobilized component is pre- labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously non- immobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the solid surface; e. g., using a labeled antibody specific for the previously non- immobilized component.
  • reaction is conducted in a liquid phase, the reaction products separated from unreacted components using an immobilized antibody specific for V-H+-ATPase protein, fusion protein or the test compound, and complexes detected using a labeled antibody specific for the other component of the possible complex to detect anchored complexes.
  • a cell based assay system can be used to screen for compounds that modulate the activity of Cf5, the system employing cells that express Cf5.
  • a cell based assay system can be used to screen for compounds that modulate the expression of Cf5 within a cell.
  • An example of such cells are provided above (HeLa cells transiently expressing GFP-tagged CF5). Using such cells, libraries of compounds may be assayed in a high throughput manner to identify those compounds that are capable of modulating CF5 expression.
  • Assays may be designed to screen for compounds that regulate Cf5 expression at either the transcriptional or translational level.
  • DNA encoding a reporter molecule can be linked to a regulatory element of the Cf5 gene encoding Cf5 and used in appropriate intact cells, cell extracts or lysates to identify compounds that modulate Cf5 gene expression.
  • reporter genes may include but are not limited to chloramphenicol acetyltransferase (CAT), luciferase, p- glucuronidase (GUS) , growth hormone, or placental alkaline phosphatase (SEAP) .
  • Such constructs are introduced into cells thereby providing a recombinant cell useful for screening assays designed to identify modulators of Cf5 gene expression.
  • the level of reporter gene expression may be quantitated to determine the test compound's ability to regulate Cf5 expression.
  • Alkaline phosphatase assays are particularly useful in the practice of the invention as the enzyme is secreted from the cell. Therefore, tissue culture supernatant may be assayed for secreted alkaline phosphatase.
  • alkaline phosphatase activity may be measured by calorimetric, bioluminescent or chemiluminescent assays such as those described in Bronstein,I. et al. (1994, Biotechniques 17: 172-177) .
  • Such assays provide a simple, sensitive easily automatable detection system for pharmaceutical screening.
  • the level of Cf5 expression can be modulated using antisense or ribozyme approaches to inhibit or prevent translation of Cf5 mRNA transcripts or triple helix approaches to inhibit transcription of the Cf5 gene.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to Cf5mRNA. The antisense oligonucleotides will bind to the complementary mRNA transcripts and prevent translation..
  • ribozyme molecules designed to catalytically cleave Cf5 mRNA transcripts can also be used to prevent translation and expression of Cf5.
  • the invention provides methods of, and compositions for, treatment and prevention by administration to a subject in need of such treatment of a therapeutically or prophylactically effective amount of a therapeutic of the invention.
  • the subject may be an animal or a human, with or without an established cancer .
  • a therapeutic of the invention e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the therapeutic, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), construction of a therapeutic nucleic acid as part of a retroviral or other vector, etc.
  • Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
  • compositions may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.
  • compositions of the invention may be administered locally to the area in need of treatment; this may be achieved, for example and not by way of limitation, by topical application, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • the therapeutic can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317- 327.)
  • the therapeutic can be delivered in a controlled release system.
  • a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed., Eng. 14:201 (1987); Buchwald et al., Surgery 88:75 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)).
  • polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, FIa. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J.
  • a controlled release system can be placed in proximity of the therapeutic target, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)).
  • An antagonist of Cf5, such as a Cf5-specific antibody, may function as a therapeutic of the invention, and such antagonists may be produced using methods which are generally known in the art.
  • purified Cf5 may be used to produce antibodies or to screen libraries of pharmaceutical agents to identify those which specifically bind Cf5.
  • Antibodies to Cf5 may also be generated using methods that are well known in the art.
  • Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, and single chain antibodies, Fab fragments, and fragments produced by a Fab expression library.
  • Neutralizing antibodies i.e., those which inhibit dimer formation
  • Single chain antibodies may be potent enzyme inhibitors and may have advantages in the design of peptide mimetics, and in the development of immuno-adsorbents and biosensors (Muyldermans, S. (2001) J. Biotechnol. 74:277-302).
  • various hosts including goats, rabbits, rats, mice, camels, dromedaries, llamas, humans, and others may be immunized by injection with Cf5 or with any fragment or oligopeptide thereof which has immunogenic properties (especially the fragment specified above) .
  • various adjuvants may be used to increase immunological response.
  • adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, KLH, and dinitrophenol .
  • the oligopeptides, peptides, or fragments used to induce antibodies to Cf5 have an amino acid sequence consisting of at least about 5 amino acids, and generally will consist of at least about 10 amino acids. It is also preferable that these oligopeptides, peptides, or fragments are identical to a portion of the amino acid sequence of the natural protein. Short stretches of Cf5 amino acids may be fused with those of another protein, such as KLH, and antibodies to the chimeric molecule may be produced.
  • Monoclonal antibodies to Cf5 may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B- cell hybridoma technique, and the EBV-hybridoma technique.
  • chimeric antibodies such as the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity.
  • techniques developed for the production of “chimeric antibodies, " such as the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used.
  • techniques described for the production of single chain antibodies may be adapted, using methods known in the art, to produce Cf5-specific single chain antibodies.
  • Antibodies with related specificity, but of distinct idiotypic composition may be generated by chain shuffling from random combinatorial immunoglobulin libraries. (See, e.g., Burton, D. R. (1991) Proc. Natl. Acad. Sci. USA 88:10134-10137. )
  • Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature. (See, e.g., Orlandi, R. et al. (1989) Proc. Natl. Acad. Sci. USA 86:3833-3837; Winter, G. et al. (1991) Nature 349:293-299.)
  • Antibody fragments which contain specific binding sites for Cf5 may also be generated.
  • fragments include, but are not limited to, F(ab').sub.2 fragments produced by pepsin digestion of the antibody molecule and Fab fragments generated by reducing the disulfide bridges of the F(ab')2 fragments.
  • Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity. (See, e.g., Huse, W. D. et al. (1989) Science 246:1275-1281.)
  • immunoassays may be used for screening to identify antibodies having the desired specificity.
  • Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art.
  • Such immunoassays typically involve the measurement of complex formation between Cf5 and its specific antibody.
  • a two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering Cf5 epitopes is generally used, but a competitive binding assay may also be employed (Pound, supra).
  • Various methods such as Scatchard analysis in conjunction with radioimmunoassay techniques may be used to assess the affinity of antibodies for Cf5.
  • K a is defined as the molar concentration of Cf5-antibody complex divided by the molar concentrations of free antigen and free antibody under equilibrium conditions.
  • the K a determined for a preparation of monoclonal antibodies, which are monospecific for a particular Cf5 epitope, represents a true measure of affinity.
  • High- affinity antibody preparations with K a ranging from about 10 9 to 10 12 L/mole are preferred for use in immunoassays in which the Cf5-antibody complex must withstand rigorous manipulations.
  • Low-affinity antibody preparations with K a ranging from about 10 6 to 10 7 L/mole are preferred for use in immunopurification and similar procedures which ultimately require dissociation of Cf5, preferably in active form, from the antibody (Catty, D. (1988) Antibodies, Volume I: A Practical Approach, IRL Press, Washington D. C; Liddell, J. E. and A. Cryer (1991) A Practical Guide to Monoclonal Antibodies, John Wiley & Sons, New York N. Y. ) .
  • polyclonal antibody preparations may be further evaluated to determine the quality and suitability of such preparations for certain downstream applications.
  • a polyclonal antibody preparation containing at least 1-2 mg specific antibody/ml, preferably 5-10 mg specific antibody/ml is generally employed in procedures requiring precipitation of Cf5-antibody complexes. Procedures for evaluating antibody specificity, titer, and avidity, and guidelines for antibody quality and usage in various applications, are generally available.
  • compositions comprise a therapeutically effective amount of a therapeutic, and a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier for example
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the Therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like.
  • compositions can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E . W. Martin.
  • Such compositions will contain a therapeutically effective amount of the therapeutic, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
  • the formulation should suit the mode of administration.
  • the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to, ease pain at the, site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • composition is to be administered by infusion
  • it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • the amount of the therapeutic of the invention which will be effective in the treatment or prevention of cancer will depend on the type, stage and locus of the cancer, and, in cases where the subject does not have an established cancer, will depend on various other factors including the age, sex, weight, and clinical history of the subject.
  • the amount of therapeutic may be determined by standard clinical techniques.
  • in vivo and/or in vitro assays may optionally be employed to help predict optimal dosage ranges.
  • the precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the cancer, and should be decided according to the judgment of the practitioner and each patient's circumstances.
  • Routes of administration of a therapeutic include, but are not limited to, intramuscularly, subcutaneously or intravenously. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the compositions of the invention.

Abstract

Agents capable of modulating Cf5 protein activity in an individual are described and find use in the prevention or treatment of a pathology characterised by dysregulated IGF-IR signalling pathways such as cancer, cardiovascular disease, neurodegenerative disease, ischemia (of thrombotic or haemorrhagic origin), pathologies associated with dysfunctional bone remodelling, pathologies associated with dysfunctional tissue remodelling, inflammation and inflammatory disease, autoimmune disorders, infectious disease, renal disease, chronic and acute wounds, tissue damage, and restenosis. Also described is an agent capable of attenuating the Cf5 activity of a cancer cell for use in attenuating the drug/radiation resistance of a cancer cell.

Description

TREATMENT OF DISEASE
Introduction
The invention relates to a method of preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual in need thereof.
Background of the Invention
The IGF-IR and its ligands activate a conserved signalling pathway through PI3-Kinase and Akt that regulates the Forkhead and mTOR pathways necessary for survival, growth, and development. This complex signalling pathway overlaps the insulin pathway and is modulated by nutrients, growth factors, cytokines, and environmental signals to directly control metabolism, protein synthesis, cell growth, and cell-cycle progression. Ultimately it determines the survival or death of a cell or organism and may also control lifespan. Unsurprisingly, dysregulation of this pathway is associated with many human diseases including cancer, diabetes, cardiovascular disease, and neurodegenerative disorders. Some of the most frequently altered tumour-suppressor genes or oncogenes in cancers encode proteins that directly affect the IGF-IR signalling pathway. These include Akt, the lipid phosphatase PTEN, the tumour suppressor genes TCSl-TCS-2 complex (activated by the nutrient-sensing LKBl kinase-AMPK pathway to regulate mTOR) , and the DNA damage-activated tumour suppressor p53. The PI-3 kinase pathway also has complex amplification and feedback regulatory mechanisms that complicate the targeting of individual components of the pathway in the treatment of disease.
Signals from the IGF-IR also intersect with the RAS-MAP kinase pathways to promote the survival, differentiation, and motility of cells. Seminal studies on the activity of IGF-IR in tumours and on the role of IGF-IR signalling in facilitating oncogenic transformation and suppressing apoptosis provided a rationale for directly targeting the receptor. Inhibitory antibodies, kinase inhibitors, and siRNA can all suppress tumour cell proliferation in vitro and in vivo. At least three inhibitory antibodies are being tested in clinical trials and more are in pre-clinical development. IGF-IR signalling is also important in protecting the cardiac and neurologic systems as well as for bone marrow and immune-cell function. There is cause to hope that tumour cells may be sufficiently more dependent on its signals to allow safe therapeutic use of IGF-IR inhibitors, but this remains to be seen. Serum levels of IGFs and IGF binding protein 3 have been linked with increased risks of breast, prostate, colorectal, and lung cancer, but the correlation of increased IGF-IR expression levels in cancer tissue vs. normal tissue or in different stages of cancer progression is less clear. Thus, unlike some other molecular targets such as Her-2, EGFR, and BCR-AbI, the expression levels of IGF-IR in tumour cells may not be enough to predict their sensitivity to inhibitors or to select patient cohorts that may respond to IGF-IR inhibitors. This combined with the fact that IGF-IR inhibitors may be toxic to normal tissues adds new urgency to identifying the mediators and modulators of IGF-IR signalling that distinguish its activity in tumour cells from its activity in normal cells. These proteins may identify which tumours are responsive to IGF-IR inhibition and may also become more suitable targets for inhibiting this signalling pathway than the IGF-IR itself.
New mediators of IGF-IR function were identified in a screen for genes that were differentially expressed in IGF-IR- transformed (R+) cells when compared with IGF-IR null (R-) cells (derived from the IGF-IR knockout mouse (Sell, C, et al., 1994. Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts. MoI Cell Biol 14:3604-12.). A series of genes associated with different stages of cancer progression and new mediators of IGF-I signalling were identified in this screen (Loughran, et al., 2005. Mystique is a new insulin-like growth factor-I-regulated PDZ-LIM domain protein that promotes cell attachment and migration and suppresses Anchorage- independent growth. MoI Biol Cell 16:1811-22 and Loughran, G., M. 2005. Gene expression profiles in cells transformed by overexpression of the IGF-I receptor. Oncogene 24:6185-6193).
Statements of Invention
According to the invention, there is provided a method of preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual in need thereof, the method comprising a step of modulating Cf5 protein activity in the individual. Suitably, the method involves treating the individual with a therapeutically effective amount of an agent capable of modulating, and especially attenuating, Cf5 activity. In another embodiment, the method involves treating the individual with Cf5 protein, or a biologically active fragment of variant thereof.
In one embodiment, the pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways (including the IGF-IR signalling pathway) is one that involves aberrant cell or tissue acidification, or aberrant cell migration, proliferation, invasion, or motility. Diseases or conditions associated with this pathology will be well known to those skilled in the art. Typically, the disease or condition is selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis.
In one preferred embodiment, the pathology is cancer, and the agent capable of modulating Cf5 activity is an agent capable of attenuating Cf5 activity in a cancer cell. Typically, the cancer is selected from the group comprising: fibrosarcoma; myxosarcoma; liposarcoma; chondrosarcom; osteogenic sarcoma; chordoma; angiosarcoma; endotheliosarcoma; lymphangiosarcoma; lymphangioendotheliosarcoma; synovioma; mesothelioma; Ewing's tumor; leiomyosarcoma; rhabdomyosarcoma; colon carcinoma; pancreatic cancer; breast cancer; ovarian cancer; prostate cancer; squamous cell carcinoma; basal cell carcinoma; adenocarcinoma; sweat gland carcinoma; sebaceous gland carcinoma; papillary carcinoma; papillary adenocarcinomas; cystadenocarcinoma; medullary carcinoma; bronchogenic carcinoma; renal cell carcinoma; hepatoma; bile duct carcinoma; choriocarcinoma; seminoma; embryonal carcinoma; Wilms1 tumor; cervical cancer; uterine cancer; testicular tumor; lung carcinoma; small cell lung carcinoma; bladder carcinoma; epithelial carcinoma; glioma; astrocytoma; medulloblastoma; craniopharyngioma; ependymoma; pinealoma; hemangioblastoma; acoustic neuroma; oligodendroglioma; meningioma; melanoma; retinoblastoma; and leukemias. Typically, treatment of the cancer entails reducing one or more of survival, proliferation and migration of, or invasion by, cancer cells.
In a further embodiment, the invention provides a method of attenuating the drug/radiation resistance of a cancer cell comprising the steps of treating the cell with an agent capable of attenuating the Cf5 activity of the cell. In such cases, the agent sensitises the cancer cell to drug-based or radiation- based cancer therapies. Suitably, the cell is treated with a combination of a cytotoxic agent and an agent that attenuates the Cf5 activity of the cell.
In a further embodiment, the invention provides a method of prevention or treatment of metastases in an individual, typically an individual afflicted with an existing tumour such as a primary tumour, the method comprising the steps of treating the individual with an agent capable of attenuating the Cf5 activity of the cell. Suitably, the metastases is selected from the group comprising: bone metastases; lung metastases; liver metastases; bone marrow metastases; breast metastases; and brain metastases. The invention also relates to a method of inhibiting VATP function is a cell comprising the step of treating the cell with an agent capable of attenuating the Cf5 activity of the cell. This method may be usefully employed in the prevention or treatment of any disease, condition or pathology that involves aberrant cell or tissue acidification, or aberrant cell survival, proliferation, migration or invasion.
When the methods of the invention involve an agent that attenuates Cf5 activity, this should be taken to include an agent that suppresses the expression of Cf5 protein (i.e. interferes with expression of the Cf5 gene) , including suppression of transcription or translation, and an agent that directly inhibits Cf5 activity. In one preferred embodiment of the invention, expression of Cf5 is suppressed by means of RNA interference (RNAi) . RNA interference (RNAi) is an evolutionally highly conserved process of post-transcriptional gene silencing (PTGS) by which double stranded RNA (known as siRNA molecules), when introduced into a cell, causes sequence- specific degradation of mRNA sequences. The RNAi machinery, once it finds a double-stranded RNA molecule, cuts it up, separates the two strands, and then proceeds to destroy RNA molecules that are complementary to one of those segments, or prevent their translation into proteins. Thus, suppression of Cf5 expression may be achieved by treating an individual with siRNA molecules designed to target Cf5 mRNA, preferably a sequence in the Cf5 mRNA from nucleotides 158 to 183. More preferably, the siRNA molecules are designed to target a sequence in the human Cf5 mRNA selected from the group comprising: nucleotides 158 to 176; and nucleotides 165 to 183. The siRNA molecule A; 5'-UGGUGACGCACGUGAUGUAUU-S' (SEQUENCE ID NO: 5) specifically targets nucleotides 5'-TGGTGACGCACGTGATGTA- 3 at nucleotide positions 158-176 after the start codon of cF5. The siRNA molecule B: 5'-GCACGUGAUGUACAUGCAAUU-S' (SEQNUENCE ID NO: 6) specifically targets nucleotides 5'- GCACGTGATGTACATGCAA-3' at nucleotide positions 165-183 after the start codon of Cf5.
siRNA oligonucleotides designed to target mouse and rat Cf5 genes are provided in SEQUENCE ID NO's: 15 and 16.
Thus, the invention relates to an oligonucleotide selected from the group comprising: SEQUENCE ID NO: 5; SEQUENCE ID NO: 6; SEQUENCE ID NO: 15; and SEQUENCE ID NO: 16 . The invention also relates to a siRNA molecule designed to target human Cf5 mRNA, suitably a sequence in human Cf5 mRNA from nucleotides 158 to 176, or from nucleotides 165 to 183 after the start codon of Cf5. Further, the invention relates to a medicament comprising an oligonucleotide or siRNA molecule of the invention, optionally in combination with a suitable pharmaceutical excipient. Typically, the medicament is useful in the prevention or treatment of a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling in an individual such as, for example, one that involves aberrant cell or tissue acidification, or aberrant cell migration, proliferation, invasion, or motility. Diseases or conditions associated with this pathology will be well know to those skilled in the art. Typically, the disease or condition is selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis
Other types of gene knockdown tools will be well known to the person skilled in the filed of molecular biology. For example, micro RNA' s (miRNAs) are small (~22nt) non-coding RNAs (ncRNAs) that regulate gene expression at the level of translation. Each miRNA apparently regulates multiple genes and hundreds of miRNA genes are predicted to be present in mammals. Recently miRNAs have been found to be critical for development, cell proliferation and cell development, apoptosis and fat metabolism, and cell differentiation. Alternatively, small hairpin RNA (shRNA) molecules are short RNA molecules having a small hairpin loop in their tertiary structure tha may be employed to silence genes. The design of miRNA or shRNA molecules capable of silencing Cf5 will be apparent to those skilled in the field of miRNA or shRNA molecule design. As an alternative, the level of Cf5 expression can be modulated using antisense or ribozyme approaches to inhibit or prevent translation of Cf5 mRNA transcripts or triple helix approaches to inhibit transcription of the Cf5 gene. Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to Cf5mRNA. The antisense oligonucleotides will bind to the complementary mRNA transcripts and prevent translation. Ribozyme molecules designed to catalytically cleave Cf5 mRNA transcripts can also be used to prevent translation and expression of Cf5. (See, e. g. , PCT International PublicationW090/11364, published October 4,1990 ; Sarver et al. , 1990, Science 247: 1222-1225). In one embodiment, attenuation of Cf5 activity is achieved using an agent that directly inhibits Cf5 activity, wherein the agent is selected from the group comprising: a Cf5 ligand (such as a Cf5-specific antibody) ; amantadine or an amantadine-like molecule. Typically, when the pathology is a neurodegenerative disease, the agent is not memantine. The susceptibility to inhibition by amantadine-like agents is based on the amino acid sequence and predicted structure of the CF5 protein. CF5 has a buried arginine (Arg 34) in the first transmembrane domain next to a glutamine (glu 35), and it also has a buried tryptophan (Trp 51) four residues away from a histidine (His 56) in the second transmembrane domain. This suggests that CF5 may constitute a proton channel rather than a proton pump. Protonation of histidine side chains has been shown to be an essential mechanism in H+ channel conductance in the homotetrameric acid-activated M2 H+ channel from influenza A. M2 is a well-characterized proton channel that acidifies the viral core after it is endocytosed into cells and is an influenza drug target inhibited by amantadine (AMT) (see http://en.wikipedia.org/wiki/Amantadine). In M2 two juxtaposed histidines (His 37) facilitate hydrogen bonding and channel closure while protonation of a third histidine in the complex is associated with channel activation (Hu et al., 2006. Histidines, heart of the hydrogen ion channel from influenza A virus: toward an understanding of conductance and proton selectivity. Proc Natl Acad Sci U S A 103:6865-70).. Thus, the channel acts a sensor of pH and is activated in response to increase in H+ concentration. Proton channels like M2 are virtually uncharacterized in mammalian cells with the exception of a family of acid sensitive channels that bear no structural resemblance to CF5. CF5 may also be inhibitable by macrolide antibiotics concanamycin-like molecules and baflicomycin-like molecules, which have been shown to bind to and inhibit the c subunit of the V-ATpase.
In one embodiment of the invention, there is provided a method of preventing or treating cardiovascular disease in an individual in need thereof, the method comprising a step of modulating Cf5 protein activity in the individual. Typically, the cardiovascular disease is selected from the group comprising: cardiac hypertrophy; myocardial infarction; stroke; arteriosclerosis; and heart failure. In one embodiment, the method involves treating the individual with an agent that modulates Cf5 activity, suitably by modulating the expression of Cf5 or by modulating the activity of the Cf5 protein.. In an alternative embodiment, Cf5 activity may be modulated by treatment with IGF-IR or IGF-IR agonists or antagonists.
In one embodiment of the invention, there is provided a method of preventing or treating renal disease in an individual in need thereof, the method comprising a step of modulating Cf5 protein activity in the individual. Typically, the renal disease is selected from the group comprising: Duplicated ureter; Horseshoe kidney; Polycystic kidney disease; Renal dysplasia; Unilateral small kidney; Diabetic nephropathy; Glomerulonephritis; Hydronephrosis; Interstitial nephritis; Lupus nephritis; nephrotic syndrome; and acute renal failure; chronic renal failure. In one embodiment, the method involves treating the individual with an agent that modulates Cf5 activity, suitably by modulating the expression or activity of Cf5 or by acting as an agonist to the Cf5 protein. In an alternative embodiment, Cf5 activity may be modulated by treatment with IGF-IR. The invention also relates to a method of identifying or monitoring VATP activity in a biological system comprising the step of assaying the biological system for Cf5 activity. Suitably this assay involves determining Cf5 expression levels in the biological system. Thus, Cf5 acts as a surrogate marker of VATP activity. Expression levels may be determined by any means known in the art, i.e. at a protein or mRNA level.
The invention also relates to a method of identifying or monitoring IGF-IR signalling pathway activity in a biological system comprising the step of assaying the biological system for Cf5 activity. Suitably this assay involves determining Cf5 expression levels in the biological system. Thus, Cf5 acts as a surrogate marker of IGF-IR signalling pathway activity. Expression levels may be determined by any means known in the art, i.e. at a protein or mRNA level.
The invention also relates to a method of assessing the ability of an agent to modulate the VATP or IGF-IR signalling pathway activity of a biological system comprising the steps of treating the biological system with the agent and then assaying the system for expression of Cf5.
In this specification, the term "biological system" should be taken to include a cell, a cell line, a tissue sample, an organ, a unicellular or multicellular organism, or a lower or higher life form.
The invention also relates to a method of assessing the metastatic status of a cell or tissue comprising the step of assaying the cell for expression of Cf5, wherein an increased level of Cf5 expression compared to a reference level is indicative of the cell having metastatic potential. In other words, the Cf5 expression level is a surrogate prognostic marker or a component of a signature of metastatic potential, or indeed a diagnostic marker of cell metastases. Thus, while it is envisaged that Cf5 may act on it' s own as a diagnostic or prognostic variable of certain pathologies, or the activity of certain cellular signalling pathways or components of signalling pathways, it is likely that it's use as a prognostic or diagnostic variable will be in combination with other markers in the form of a panel of markers which together are capable of providing a profile or signature of cellular activity or pathologies.
The invention also provides methods of screening for compounds capable of modulating Cf5 activity, which compounds will find use in treating pathologies characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling in an individual such as, for example, one that involves aberrant cell or tissue acidification, or aberrant cell migration, proliferation, invasion, or motility. Diseases or conditions associated with this pathology will be well know to those skilled in the art. Typically, the disease or condition is selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis. Generally speaking, these methods all involve monitoring Cf5 activity at a protein expression level or a protein activity level.
Thus, the invention also relates to a method of identifying compounds useful in the treatment or prevention of pathologies characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways, comprising determining a reference level of activity of a CF5 protein, contacting the Cf5 protein with a candidate compound, and determining the level of activity of the contacted Cf5 protein, wherein a decrease or increase in the level of activity of the contacted Cf5 protein relative to the reference level of Cf5 activity is an indication that the candidate compound is useful in the treatment or prevention of pathologies characterised by dysregulated IGF-Ir signalling pathways.
Suitably, the invention relates to a method of identifying compounds useful in the treatment or prevention of cancer comprising determining a reference level of activity of a CF5 protein, contacting the Cf5 protein with a candidate compound, and determining the level of activity of the contacted Cf5 protein, wherein a decrease in the level of activity of the contacted Cf5 protein relative to the reference level of Cf5 activity is an indication that the candidate compound is useful in the treatment or prevention of cancer.
Alternatively, the invention relates to a method of identifying compounds useful in the treatment or prevention of cardiovascular disease comprising determining a reference level of activity of a CF5 protein, contacting the Cf5 protein with a candidate compound, and determining the level of activity of the contacted Cf5 protein, wherein modulation in the level of activity of the contacted Cf5 protein relative to the reference level of Cf5 activity is an indication that the candidate compound is useful in the treatment or prevention of cancer
In the screening methods of the invention, the Cf5 protein is preferably provided in the form of Cf5 expressing cells, and in which the level of activity is preferably determined by assaying for a level of expression of Cf5 protein in the cells. Thus, the invention provides a method of identifying an agent that modulates expression of Cf5 protein comprising the steps of providing a source of Cf5 expressing cells, treating the cells with a candidate agent, and assaying the cells for expression of Cf5 protein, wherein a decrease or increase in the level of expression of Cf5 protein in the treated cells relative to untreated cells is an indication that the candidate agent is useful in modulating expression of Cf5 protein.
The amino acid sequence of human Cf5 protein is provided in SEQUENCE ID NO: 1, and that of a mouse homolog is provided in SEQUENCE ID NO: 2. Accordingly, the invention relates to an isolated polypeptide comprising an amino acid sequence of SEQUENCE ID NO' s : 1 or 2, or a biologically active fragment or variant thereof.
The invention also relates to an isolated polypeptide consisting essentially of the amino acid sequence of SEQUENCE ID NO: 1 or SEQUENCE ID NO: 2, or a biologically active fragment or variant thereof.
In this specification, the term "biologically active" should be taken to mean that the fragment retains all or part of the biological functionality of the parent protein. Suitably, the fragment will retain the ability to promote the acidification, growth factor responsiveness, endocytosis, survival, proliferation, and/or motility/invasion of a cell relative to an untreated cell.
A "fragment" of the Cf5 protein means a contiguous stretch of amino acid residues of at least 5 amino acids, preferably at least 6 amino acids. Typically, the "fragment" will comprise at least 10, preferably at least 20, more preferably at least 30, and ideally at least 40 contiguous amino acids. In this regard, it would be a relatively straightforward task to make fragments of the protein and assess the biological activity activity of such fragments using the in-vitro models described below.
A "variant" of the Cf5 protein shall be taken to mean proteins having amino acid sequences which are substantially identical to wild-type Cf5 protein, especially human wild-type Cf5. Thus, for example, the term should be taken to include proteins or polypeptides that are altered in respect of one or more amino acid residues. Preferably such alterations involve the insertion, addition, deletion and/or substitution of 5 or fewer amino acids, more preferably of 4 or fewer, even more preferably of 3 or fewer, most preferably of 1 or 2 amino acids only. Insertion, addition and substitution with natural and modified amino acids is envisaged. The variant may have conservative amino acid changes, wherein the amino acid being introduced is similar structurally, chemically, or functionally to that being substituted. Typically, Cf5 proteins which have been altered by substitution or deletion of catalytically- important residues will be excluded from the term "variant". In this regard, substitution, deletion, insertion, addition or modification will in one embodiment be carried out on the non- transmembrane parts of the protein. Such parts of the protein will be evident from Figure 1. Generally, the variant will have at least 70% amino acid sequence homology, preferably at least 80% sequence homology, more preferably at least 90% sequence homology, and ideally at least 95%, 96%, 97%, 98% or 99% sequence homology with wild-type human Cf5. In this context, sequence homology comprises both sequence identity and similarity, i.e. a polypeptide sequence that shares 70% amino acid homology with wild-type human Cf5 is one in which any 70% of aligned residues are either identical to, or conservative substitutions of, the corresponding residues in wild-type human Cf5.
The term "variant" is also intended to include chemical derivatives of Cf5 protein, i.e. where one or more residues of Cf5 is chemically derivatized by reaction of a functional side group. Also included within the term variant are Cf5 molecules in which naturally occurring amino acid residues are replaced with amino acid analogues.
Proteins and polypeptides (including variants and fragments thereof) of and for use in the invention may be generated wholly or partly by chemical synthesis or by expression from nucleic acid. The proteins and peptides of and for use in the present invention can be readily prepared according to well- established, standard liquid or, preferably, solid-phase peptide synthesis methods known in the art (see, for example, J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, 2nd edition, Pierce Chemical Company, Rockford, Illinois (1984), in M. Bodanzsky and A. Bodanzsky, The Practice of Peptide Synthesis, Springer Verlag, New York (1984). The DNA sequence of the open reading frame (ORF) of the human and mouse Cf5 genes are provided in SEQUENCE ID NO: 3 and SEQUENCE ID NO: 4, respectively. The Accession Numbers for the human and mouse Cf5 genes are NM_017842 and BC022913. The human gene has been found to have two isoforms, one of approximately 2.6kb and a second of approximately 1.6kb. The sequences of both of these isoforms form part of the present invention. Accordingly, the invention relates to an isolated polynucleotide comprising or consisting essentially of a polynucleotide sequence of SEQUENCE ID NO: 3 or 4 (or any isoforms thereof) .. The invention also relates to an isolated polynucleotide encoding a polypeptide of the invention, or encoding a biologically active fragment or variant thereof.
The invention also relates to a recombinant polynucleotide comprising a promoter sequence operably linked to a polynucleotide of the invention. The invention also relates to a cell transformed with a recombinant polynucleotide of the invention, and a transgenic organism comprising a recombinant polynuclotide of the invention.
The invention also provides a ligand to an isolated polypeptide of the invention. Some suitable ligands are described above, and include antibodies that bind specifically to the protein of SEQ ID NO: 1.
The invention also provides an isolated antibody raised against
(1) the isolated polypeptide of the invention, or (2) an immunogenic fragment of an extracellular portion of the polypeptide. The invention also relates to an isolated antibody that binds specifically to the isolated polypeptide of the invention, especially the protein of SEQ ID NO: 1. Typically, the immunogenic fragment of an extracellular portion of the polypeptide comprises a peptide having at least five contiguous amino acids from the extracellular portions of the amino acid sequence of SEQUENCE ID NO. 1 or SEQUENCE ID NO: 2. Preferably, the immunogenic fragment of an extracellular portion of the polypeptide comprises a peptide having at least five contiguous amino acids from the extracellular C-terminal or N-terminal portions of the amino acid sequence of SEQUENCE ID NO. 1 or SEQUENCE ID NO: 2. Suitably, the peptide comprises at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least twelve contiguous amino acids. Suitably, the peptide has less than 50, 40, 30, 20, and 15 amino acids. In one preferred embodiment, the antibody is raised using a peptide comprising, or consisting essentially of, the amino acid sequence 131-146 of the human Cf5 protein. Methods of producing antibodies, both monoclonal and polyclonal, will be well known to those skilled in the art.
The invention also relates to a method of prevention or treatment of a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual comprising a step of treating the individual with an antibody of the invention. Typically, pathologies characterised by dysregulated IGF-IR signalling include those that involve aberrant cell or tissue acidification, or aberrant cell migration, proliferation, invasion, or motility. Diseases or conditions associated with this pathology will be well know to those skilled in the art. Typically, the disease or condition is selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling
(i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis . The invention also relates to a medicament comprising an antibody of the invention. The invention also relates to a pharmaceutical composition comprising an antibody of the invention in combination with a pharmaceutically acceptable excipient .
The invention also relates to a medicament comprising an agent capable of modulating Cf5 protein activity. Suitably, the agent is capable of attenuating Cf5 activity (i.e. siRNA molecules of SEQUENCE ID NO: 5 and 6) . Alternatively, the agent is capable of modulating Cf5 activity. The invention also relates to the use of a- medicament of the invention in the treatment of a pathology selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorragic origin) ; inflammatory disease; autoimmune disease; infectious disease; renal disease; restenosis; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); and pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, post operative trauma, prostheses, stents, angioplasty, and other implants, tissue inflammation/infection , burn healing, corneal repair) .
The invention also relates to the use of an agent that modulates Cf5 activity in the manufacture of a medicament for the treatment of pathologies characterised by aberrant VATP activity.
The invention also relates to a pharmaceutical composition comprising an agent that modulates Cf5 activity, optionally in combination with a pharmaceutically excipient. Typically, the agent attenuates Cf5 activity.
The invention also relates to a pharmaceutical composition comprising an antibody or ligand of the invention in combination with a suitable carrier or pharmaceutical excipient .
The invention will be more clearly understood from the following description of some embodiments thereof, provided by way of example only, with reference to the accompanying Figures .
Brief Description of the Figures
Figure 1
Two isoforms of cf5 are expressed in multiple tissues in mouse and the protein is predicted to have four transmembrane domains.
(A) A Northern blot of R+ and R- RNA was probed with mouse cf5 cDNA, followed by a probe to detect actin as a loading control.
(B) A murine multiple tissue Northern blot was probed for cf5 mRNA levels. (C) The mouse and human CF5 protein sequences were aligned and the predicted transmembrane domains are underlined. (D) Schematic representation of the predicted transmembrane topology of CF5. Figure 2
CF5 mRNA and protein is induced by IGF-I.
(A) RNA was extracted from R+ cells that were stimulated with IGF-I for the indicated times. A northern blot was prepared and probed with the cf5 cDNA or Igf-lr as a control. (B) Western blots were prepared with protein lysates extracted from IGF-I stimulated R+ and Rat-1 cells and then probed with antibody recognizing endogenous CF5. Actin was used as a control for equal loading.
Figure 3
The CF5 protein is located in endosomes.
(A) HeLa cells transiently expressing GFP-tagged CF5 were immunofluorescently co-stained for expression and examined for location of CF5, EEA-I, and the transferrin receptor. Colocalisation of HA-tagged CF5 with GFP-RABIl was examined in HeLa cells co-expressing these proteins. (B) For EVA antibody uptake by live cells, MCF-7 cells were seeded at a density of 8xlO4 cells on to serum-coated 10mm glass coverslips and allowed to attach for 24 hours. Then the media was changed to complete media containing polyclonal EVA antibody and monoclonal anti-HA antibody as negative control and the cells were put back in culture for 16 hours. Next day, the cells were washed, fixed, permeabilized and blocked as described above, before staining with anti-RabbitCy3 and anti-MouseCy2 conjugated antibodies and Hoestch for nuclear staining. Images were captured as described above using the 10Ox objective.
Figure 4 :
Suppression of CF5 expression decreases cell viability and receptor mediated endocytosis. (A) HeLa cells were transfected with 1OnM of siRNA directed towards cf5 or a control siRNA, and the cultures were examined 48hrs later under the 2Ox objective of a phase contrast microscope. Knockdown of cf5 expression was confirmed by RT- PCR. (B) For growth assays, HeLa cells were transfected with siRNA and re-seeded into triplicate wells of a 24-well plate at a density of 3xlO4 cells/well 24hrs later. Cells were counted every 24hrs for up to 72hrs by trypan blue exclusion. Knockdown of cf5 expression was confirmed by RT-PCR. (C) HeLa cells were transfected with siRNA and the percentage of apoptotic cells was determined 48hours later by quantitation of propidium iodide-positive cells. (D) Receptor-mediated endocytosis was examined in siRNA-transfected HeLa cells. Uptake of Alexa-488 labelled transferrin was quantified by flow cytometric analysis 48hrs after transfection. (E) (E) Transferrin Receptor expression at the cell surface of siEVA transfected cells. Cells were incubated with Tf-Alexa488 at 4C to prevent internalization of the Transferrin Receptor. The amount of Tf- Alexa488 bound to the cells was quantified using flow Cytometry and it is shown in the graph. EVA levels are shown on the right inset. (F) Quantification of total Transferrin Receptor (TfR) levels in HeLa and MCF7 cells transfected with siNeg or siEVA oligos. Data are representative of 2-3 experiments with each cell line. *p< 0.05, ** p<0.01.
Figure 5
CF5 associates with the c subunit of the V-ATPase proton pump. (A)A two hybrid screen was carried out using full length CF5 protein as bait and a cDNA library from HeLA cells. From this five putative CF5-interacting proteins were isolated and these are indicated in the table. (B) To determine whether CF5 and the c subunit of the V-ATPase interacted in mammalian cells, expression vectors encoding CF5 and his-tagged C subunit were co-expressed in cells. Each protein was immunoprecipitated following western blotting to detect interacting proteins. (C) Hek293T and NRK cells lysates were used to immunoprecipitate endogenous A subunit using polyclonal anti-Al antibody and examined for co-precipitation of endogenous EVA. BO, control with protein G beads with no antibody; Ig, immunoprecipitation with and irrelevant rabbit IgG.
Figure 6
Suppression of CF5 expression causes increased endosomal pH indicative of impaired V-ATPase mediated acidification. HeLa cells were transfected with siRNA targeted to CF5, or a control siRNA, or were treated with the V-ATPase inhibitor Concanamycin A. Cells were then loaded with FITC dextran, which accumulates in endosomes. The ratio of fluorescence intensity obtained when FITC-dextran at λ=495nm or λ=450nm is pH dependent, so the fluorescence of the cells was measured and the acid dependent shift in fluorescence was determined in each cell population by plotting the flourescence ratio (FL1/F12).
Detailed Description of the Invention
EXPERIMENTAL
Cloning of human cf5 cDNA cDNA encoding the human cf5 gene sequence (accession number NM_017842) was obtained from the I. M. A. G. E. Consortium. The open reading frame (nucleotides 98-538) was amplified by polymerase chain reaction (PCR) using the specific primers, WTCF5for - 5'-GCCGGATCCCCTCGAGCCATGGCCCCGTCC -3' - and WTCF5rev - 5'-CCTGGATCCTCGAGTCAGAAATCGCTGAT-B', respectively (SEQUENCE ID NO' s : 7 and 8, respectively). Xhol restriction sites were incorporated in the primers (underlined sequences). PCR conditions were as follows on Xμg of template DNA: The PCR product was cloned into the Xhol-digested pcDNA3-HA vector.
For cloning into the pEGFP-Nl expression vector primers were designed to mutate the stop codon of the cf5 coding sequence and to incorporate a Xhol restriction site at the 5' end and a BamHI restriction site at the 3' end of the amplified cf5 coding sequence. The recombinant pcDNA3-Ha-cf5 vector was used as template DNA. The sequences of the forward and reverse primers were as follows: 5' -CAATCTCGAGAACATGGCCCCGTCCA-3' and 5' -CGGTGGATCCAATGAGAAATCGCTGAG-B' , respectively (SEQUENCE ID NO's: 9 and 10), respectively), with the restriction sites underlined. The PCR was performed on 50ng of template DNA as follows: 95°C for 5 minutes, 950C for 30 seconds, 55°C for 30 seconds, 72°C for 1.5 minutes.
Sequence analysis To identify homologues of the mouse cf5 gene and protein database searches were performed using the basic local alignment search tool (BLAST) network services. SOSUI transmembrane prediction software was used to predict transmembrane domains in the CF5 protein sequence.
CF5 polyclonal antibody generation
A synthetic peptide corresponding to amino acids 131-146 of the human CF5 protein sequence was generated and used in the immunization of rabbits (Davids Biotechnologie GmbH, Rόntgenstrasse 3, D-93055 Regensburg, Germany) . This peptide sequence is conserved in the mouse and rat CF5 homologues. The antibodies were affinity purified by binding to and elution from immobilised peptide. The specificity of the antibody was confirmed by peptide competition assays in western blots and immunofluorescence on cells.
Cell culture and Transfection
R+, R-, HeLa, Hek293T and MCF7 cells were maintained in Dulbecco' s modified Eagles' s medium (DMEM) (Biowhittaker, Verviers, Belgium) supplemented in ImM L-glutamine, 10% foetal bovine serum (FBS) , and 5mg/ml of penicillin and streptomycin antibiotics. For IGF-I stimulations, R+, Rat-1 and MCF7 cells were starved of serum for 4hrs before stimulation with lOOng/ml IGF-I (Peprotech) for the indicated times.
For transient transfections of HeLa cells for immunofluorescent analysis, cells in 60mm tissue culture plates were transfected with 4μg of total DNA using SuperFect transfection reagent (Qiagen) as per manufacturers instructions. For immunoprecipatition assays, Hek293T cells in 100mm tissue culture plates were transfected with 6μg total DNA using the calcium phosphate transfection method (ref).
Antibodies and Immunofluorescence
Mouse anti-EEAl antibody was purchased from BD Transduction Laboratories (Cowley, Oxford, United Kingdom) . The mouse anti- transferrin receptor antibody was from X. Mouse anti-β-actin antibody was from Sigma-Ireland. Anti-HA antibody (clone 16B12) was purchased from Covance (Berkeley, CA) .
For immunofluorescence, HeLa cells were seeded at ^ a density of 6X104 cells onto serum-coated glass coverslips and allowed to attach for at least 16h. The cells were washed with PBS, fixed with 3.7% formaldehyde in PBS for 15 minutes at room temperature and permeabilised with 0.1% TritonX-100 in PHEM for 5 minutes. Prior to incubation with primary antibody the cells were blocked with 5% goat serum in PBS. Primary antibody incubations were performed for Ih at room-temperature. The cells were then washed with PBS and incubated with Cy2- or Cy3- conjugated secondary antibody (Jackson ImmunoResearch Laboratories, Soham, Cambridgeshire, United Kingdom) before examination with a fluorescent microscope.
Western blotting and Immunoprecipitation
Whole cell lysates were prepared by lysing cells in ice-cold RIPA lysis buffer (150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0, 1 mM PMSF, 1 μM pepstatin, 2 mg/ml aprotinin, 1 μM NaVO/j) for 20 min on ice. Nuclei and non-lysed cells were removed by centrifugation at 14,000rpm for 20 min, and the remaining proteins were denatured by incubation with 5X SDS loading buffer at room-temperature for 30 min. Proteins were resolved on 15% SDS-PAGE gels before transfer to nitrocellulose membranes (Schleicher & Schuell, Dublin, Ireland) . Membranes were blocked for Ih at room- temperature in 5% milk in Tris-buffered saline (TBS)-T (2OmM Tris, 15OmM NaCl, and 0.05% Tween 20, pH7.6). Primary antibodies were diluted in 5% milk/TBS-T and incubated with membranes at 4°C overnight. Membranes were washed with TBS-T before chemiluminescent detection of antibody binding by incubation with horseradish peroxidase-conjugated secondary antibody (DakoCytomation Denmark A/S, Glostrup, Denmark) at room-temperature for Ih.
For immunoprecipitation of endogenous CF5, 800μg of Hek293T total protein extract was pre-cleared with 20μl Protein G agarose beads by incubation with gentle rotation at 4°C for Ih. After pelleting of the beads by centrifugation at 3000rpm for 3min, the lysate was removed to a fresh tube and incubated with 5μl of the primary antibody at 4 0C overnight. Protein G beads (30μl) were then added for Ih at 4 0C with gentle rotation. The beads were then washed three times with ice-cold lysis buffer and bound proteins were removed from the beads by boiling for 5min in 30 μl of 2X SDS-PAGE loading buffer for western blot analysis.
RNA isolation and RT-PCR
Total RNA was isolated from R+, Rat-1, HeLa and MCF7 cells using Trizol reagent (Gibco-BRL) . cDNA was synthesised from total RNA using reverse-transcriptase with an oligo-dT primer. PCR was performed on 5μl of cDNA using specific primers and HotStartTaq polymerase (Qiagen) . For the amplification of human cf5 the forward primer: 5' GCCCGGCGCCGCAGCCCCATGGCCCCGTCC 3' and reverse primer: 5' CCTCACCCCCTGGGTCAGAAATCGCTGAG 3' were used (SEQUENCE ID NO' s : 11 and 12, respectively). For amplification of the mouse cf5 gene the following primers were used: For the amplification of the gapdh house-keeping gene the following forward and reverse primers, respectively, were used: 5' ACCACAGTCCATGCCATCAC 3', and 5' TCCACCACCCTGTTGCTGTA 3' (SEQUENCE ID NO's: 13 and 14, respectively). The PCR conditions were as follows: 94°C for 15min; 94°C, 30s; 52°C, 30s; 72°C for 90s, for 30-32 cycles for amplification of cf5, or 18-22 cycles for gapdh amplification.
Small interfering RNA (siRNA) construction and transfection To knock down cf5 expression specifically, two siRNAs targeted to the human cf5 mRNA were obtained from Dharmacon (Lafayette, CO) . The sequences of the siRNA oligonucleotides were as follows: 5'- UGGUGACGCACGUGAUGUAUU -3' (corresponding to nucleotides 158-176 after the start codon of cf5) and 5'- GCACGUGAUGUACAUGCAAUU -3' (corresponding to nucleotides 165- 183) (SEQUENCE ID NO' s : 5 and 6, respectively). HeLa and MCF-7 cells at approximately 50% confluency were transfected with 1OnM siRNA oligonucleotides using the OligofectAMINE transfection reagent ( Invitrogen) , as per manufacturer's instructions. A non-targeting oligonucleotide from Ambion was used as a negative control to confirm oligonucleotide specificity. Knockdown of cf5 expression was examined 48 to 96hrs after transfection both by RT-PCR, using cf5-specific primers, and by western blotting with the anti-CF5 polyclonal antibody.
Yeast two-hybrid screen
The MATCHMAKER Yeast Two-hybrid System (Clontech) was used to isolate interacting proteins for CF5. The cDNA fragment encoding the full-length cf5 coding sequence was amplified by PCR and sub-cloned into the pGBKT7 yeast expression vector, containing the GAL4 DNA binding domain. This was used as bait to screen a human fetal brain library, constructed in the pACT2 vector, containing the GAL4 DNA activation domain. The bait and library constructs were sequentially transformed into the yeast AH109 strain by electroporation. Selection of colonies containing putative interacting proteins was carried out as per manufacturer's protocol. After isolation, the sequences of the plasmid inserts were identified (Macrogen, Korea) . BLAST searches were then performed to identify the genes represented by these sequences.
Cell proliferation and apoptosis assays siRNA-transfected HeLa and MCF7 cells were reseeded at a density of 3X104 cells/well in triplicate wells of a 24-well tissue culture plate 24hrs after transfection. Cell proliferation in DMEM/10% FBS was assessed every 24 hours for the next 3 days by counting viable cells using the trypan blue exclusion method.
To analyze apoptosis of HeLa cells with decreased CF5 expression, the culture media and cells were collected 48hrs after siRNA transfection . The samples were pelleted and resuspended in PBS. Apoptotic cells were identified by the uptake of propidium iodide using flow cytometric analysis on a FACScan instrument (Becton-Dickinson, UK) . Analysis was performed using CellQuest software.
Transferrin receptor-mediated endocytosis assays
Forty-eight hours after siRNA transfection, HeLa cells were starved of serum for 30 min before being pulsed with 50μg/ml transferrin Alexa Fluor 488 (Molecular Probes, Eugene, OR) in 10% FBS/DMEM for 20 min at 37°C, 5% CO2. The cells were washed three times in PBS and the extent of transferrin uptake was examined in the FLlH channel by flow cytometry using the FACScan (Becton Dickinson) .
Endosomal acidification assays
SiRNA transfected HeLa and MCF7 cells were cultured in 6-well plates. The next day, the media was changed to complete media containing 0.5 mg/ml FITC-Dextran 40 KDa (FD40, Sigma), and cultured for further 2 hours. After this time the cells were washed twice with PBS, trypsinized and transferred to FACS tubes, centrifuged for 5 minutes at 1000 rpm, washed with HBSS and centrifuged again. The supernatant was removed and the pellets were kept on ice and resuspended in Hanks Balanced Saline Solution just before analysis in the FACS. The mean fluorescence detected in channels FLl and FL2 was quantified, and the FL1/FL2 ratio calculated for each sample. To create the calibration curve, cells were loaded with FD40 and treated as described above. The pellets were resuspended in a series of citric acid/phosphate (C/K) buffers based on Mcllvaine tables, with pH ranging from 4.0 to 6.5, and containing 5OmM sodium azide, 5OmM 2-deoxy-D-glucose, and lOμM Nigericin (all from Sigma) , in order to equilibrate the intracellular pH with the pH of the C/K buffer. The cells were incubated for 10 min on ice and the FLl and FL2 mean fluorescence values quantified. The FL1/FL2 ratio of these samples was then correlated with the pH value of the solutions used to equilibrate the cells, and the resulting equation used to estimate the endosomal pH value of the samples.
Identification and Structure of cf5 To identify genes that act as potential mediators of IGF-IR- regulated cellular transformation, SSH and cDNA arrays were performed to isolate genes differentially expressed between R- (SeIl et al., 1994) and R+ cells. A partial cDNA with identity to the 3'-UTR of a previously uncharacterised mouse gene (accession number: AK155824), designated here as cf5, was isolated from this screen. The cDNA clone of this gene was obtained from the IMAGE consortium and used to probe Northern blots of R+ and R- RNA. Two cf5 transcripts of ~2.5kb and ~1.6kb were detected on the Northern blot, both of which are more abundant in R+ compared to R- cell RNA (Figure IA) . Sequence analysis revealed that the difference in size between these splice variants is due to the presence of a larger 3'-UTR in the 2.5kb isoform. Both isoforms encode a protein of ~16.5kDa.
A murine multiple tissue Northern blot was probed for cf5 to determine the expression of this gene in different organs (Figure IB) . The 1.6kb isoform is the more predominantly expressed isoform in all tissues examined, and expression is highest in liver and kidney tissues. The 2.5kb isoform is expressed at low levels compared to the 1.6kb isoform in all tissues except for the liver and kidney. In these tissues, expression of both isoforms is comparable.
Bioinformatic analysis revealed a human cf5 homolog located on chromosome 12, whereas the mouse gene is located on chromosome 15. Alignment of the mouse with the human CF5 protein sequence revealed high sequence identity (90%) between the species (Figure 1C) . CF5 homologs were also detected in rat and zebrafish, but not in yeast, suggesting that the cf5 gene is not evolutionary conserved. No significant homology was observed between CF5 and any protein of known function. The transmembrane prediction server, SOSUI, predicted that the CF5 protein has four transmembrane domains (Figure ID). The RXR dibasic motif, located proximal to the fourth putative transmembrane domain, is predicted by the MnM-minimotif miner server to act as an ER export motif. This motif has previously been shown to be required for the export of glycosyltransferases from the ER (Claudio G. Giraudo and Hugo J. F. Maccioni, 2003) .
Cf5 expression is regulated in response to IGF-I stimulation
Cf5 was initially isolated from the R+ cell line that over- expresses the IGF-IR but to determine if cf5 is an IGF-I- responsive gene a Northern blot of RNA from IGF-I-stimulated R+ cells was probed for cf5. Interestingly, the levels of the 2.5kb isoform decreased upon 8hrs of IGF-I stimulation, while levels of the 1.6kb isoform increased concomitantly (Figure 2A) . IGF-I responsiveness of the CF5 protein was next examined by western blotting. The levels of the protein increased substantially upon 24 hours of IGF-I stimulation in both Rat-1 and R+ cells (Figure 2B) . Actin levels were used to confirm equal protein loading. These data suggest that both transcription and translation of cf5 is up-regulated in response to IGF-I stimulation.
CF5 localises to the recycling endosomes of the endocytic pathway To aid the characterisation of the novel CF5 protein, the cellular localisation of the protein was examined by immunofluorescence. HeLa cells transiently expressing GFP- tagged CF5 were co-stained for EEA-I (early endosomal autoantigen-1) , a marker of early endosomes, and for the transferrin receptor. The transferrin receptor is constitutively endocytosed from the plasma membrane and recycled through the endocytic pathway. It thus acts as a marker of all endosomes in the recycling pathway. The co- localisation of HA-CF5 and GFP-RABlI in HeLa cells transiently expressing both of these epitope tagged proteins was also examined. RABIl is a low molecular weight GTPase that associates with the membranes of recycling endosomes. CF5 colocalised with EEA-I to only a small extent but substantial colocalisation of CF5 with both the transferrin receptor and RABIl was observed. A significant amount of CF5 was localised in a region adjacent to the nucleus that represents the perinuclear recycling compartment (Figure 3) . These results suggest that CF5 localises to endosomes, and particularly to recycling endosomes. No significant colocalisation of CF5 with other membranous organelles, including mitochondria and the Golgi bodies, was observed (data not shown) . Immunofluorescent analysis of HeLa cells stained for endogenous CF5 showed the same pattern of staining as for the over-expressed protein. CF5 expression was also observed at the plasma membrane of all cells tested.. This was demonstrated by analysis of anti-CF5 antibody binding to non-permeabilized cells by flow cytometry and by antibody uptake assays (assessed by immunofluorescence Fig 3B) . From these assays it was also evident that CF5 at the plasma membrane of cells became internalized into cells. These data also conform that the C-terminus of the protein (which contains the epitope for the antibody) is extracellular (Fig 3B) . CF5 is expressed at the plasma membrane of all cell lines examined. CF5 itself is also recycled to and from the plasma membrane in endosomes. CF5 levels at the plasma membrane can be altered in response to serum starvation and by disruption of the microtubule network with nocadozole. Trafficking of CF5 in the cell was also directly observed by fluorescence time-lapse microscopy of HeLa cells over-expressing GFP-tagged CF5. The results demonstrate that CF5 is highly dynamic within the cell and is trafficked to and from the plasma membrane.
Silencing of CF5 expression induces apoptosis and suppresses endocytosis .
To determine if CF5 is an essential protein in cell function, the affect of knocking down its expression on cell viability was examined. A significant decrease in the number of HeLa cells was initially observed in samples transfected with cf5 specific siRNA oligonucleotides compared to control transfected samples by microscopic examination of the cultures 48 hours after siRNA transfection (Figure 4A) . This result was then confirmed by performing growth curves on transfected samples for up to 96 hours after siRNA transfection. The decrease in cell number was more significant in cells transfected with the siCF5B siRNA oligonucleotides compared to the siCF5A transfected cultures but there was a significant decrease in cell number in both of these samples compared to the siRNA negative control transfectants (Figure 4B). Reduction of cf5 expression was confirmed by RT-PCR and western blotting.
Controls were carried out to demonstrate that apoptosis occurred following defects in endocytosis and acidification
(see below) . The affect of over-expression of CF5 on cell growth in Rat-1 cells stably over-expressing the protein was also examined, but an increase in cell proliferation was not observed.
Signalling through the IGF-IR is known to be involved in protection from apoptosis and we have shown that CF5 protein expression is upregulated in response to IGF-I stimulation. Experiments were carried out to determine if CF5 could be involved in mediating IGF-IR function in the prevention of apoptosis. A significant and reproducible increase in the percentage of apoptotic cells in samples with decreased CF5 expression compared to control samples was observed (Figure 4C) , suggesting that CF5 is involved in mediating cell survival. This increase in apoptosis in cells with reduced CF5 expression was not rescued by stimulation with IGF-I.
Endocytosis of transferrin is decreased in cells with reduced CF5 expression
It has been observed that CF5 localises to the endosomes and plays a role in protecting cells from apoptosis. As it is well documented that endocytosis is an essential process in the regulation of mitogenic and survival signalling, , experiments were carried out to ascertain whether CF5 is involved in the regulation of endocytosis. Flow cytometric analysis demonstrated that the endocytosis of FITC-transferrin was significantly inhibited (up to 19%) in samples with decreased CF5 expression compared to control samples (Figure 4D). These results suggest that CF5 is important for the regulation of endocytic trafficking. Cell surface expression levels of the transferrin receptor were also deceased. (Fig. 4E) . Recycling pathways contribute to cell migration, specially through the regulation of integrins and growth factor receptors expression at the plasma membrane, βl integrin. levels were lower in cells transfected with CF5 siRNA than control cells, both in HeLa and MCF-7 cells (Fig4F) .
HeLa cells with suppressed CF5 exhibited significantly reduced migration towards FBS in Transwell assays. There was approximately 40% and 50% less migration in siCF51- and siCF52- transfected cultures, respectively compared with controls. Migration was examined at 48hrs post-transfection to ensure that results would not be affected by death of cells transfected with the Cf5-specific siRNA.
Altogether, these data indicate that CF5 suppression is lethal to the cells, and it also decreases cell migration. Without being bound by btheory, it is proposed that this is due to an essential function of CF5 in endocytosis, as its suppression affects the recycling of TfR and βl integrin.
CF5 associates with the vacuolar proton pump, V-ATPase
Having demonstrated that CF5 plays a role in the regulation of endocytosis, experiments were carried to identify interacting partners of CF5 in order to elucidate the role of this protein in this process. A yeast two-hybrid screen identified five putative CF5-interacting proteins (Figure 5A) . An incomplete cDNA sequence corresponding to the c subunit of the vacuolar H+ ATPase (V-ATPase) proton pump was isolated from the screen three times and the interaction of CF5 with this protein was confirmed by co-immunoprecipatition from Hek293T cells overexpressing both proteins (Figure 5B). The 16K subunit of V- ATPase is a 16kDa protein and, as predicted for CF5, has four transmembrane domains. It is a component of the proton translocating sector of V-ATPase, which consists of a membrane- spanning hexamer that forms a pore in the membrane. Due to the similarity of these proteins it was considered that CF5 could be a novel homologue of the 16K but BLAST analysis revealed no significant similarity between these proteins. It is possible, however, that CF5 is a previously uncharacterised subunit of V- ATPase. If CF5 is a component of V-ATPase we hypothesised that knocking down CF5 would affect the function of the proton pump.
The role of CF5 in the function of V-ATPase in endosomal acidification was then examined by measuring the accumulation of the acid sensitive dye FITC in endosomes (Fig. 6A). Cells were transfected with siRNA directed towards CF5 or controls, or with Concanamycin to inhibit V-ATPase activity. Cells were then loaded with FITC-dextran for three hours, which allows accumulation in endosomes, and were then analyzed by flow cytometry for fluorescence emission. This demonstrated that the pH-dependent shift in FITC fluorescence observed in control cells was increased in CF5 siRNA-transfected cells. A similar effect was observed in Concanamycin-treated cells. This indicates that knockdown of CF5 is associated with decreased acidity (higher pH) of endosomes, which is also observed with inhibition of V-ATPase function. This indicates that suppression of CF5 expression inhibits V-ATPase function in maintaining the acidity of endosomes and suggests that CF5 is a necessary component of V-ATPase function. CF5 is associated, not only with the c subunit, but with the entire V-ATPase holoenzyme. To test this, the A subunit of V-ATPase, a component of the Vi cytosolic sector, was immunoprecipitated from Hek293T cells transiently over- expressing HA-CF5. The results demonstrated that HA-CF5 could be co-precipitated with the A subunit (Fig. 5C). We also analyzed the interaction of endogenous CF5 with the V1 sector by immunoprecipitating Asubunit in NRK and Hek293T cells and we could observe co-immunoprecipitation of endogenous CF5 (Fig 5C) . Overall, these data indicate that CF5 interacts with the 16kDa c subunit, and is associated with the assembled V-ATPase holoenzyme .
Screening Methods
In accordance with the invention, non-cell based assay systems may be used to identify compounds that interact with, i.e., bind to Cf5, and regulate the activity of Cf5 in regulating V- ATPase activity and/or ion/proton translocation (methods for monitoring V-ATPase activity and ion/proton translocation are described in Vasilyeva et al., J Biol Chem. 2000 Jan7;275 (1) :255-60, and Moffat JC: Biophys J. 2007 Sep 2007). Such compounds may act as antagonists or agonists of Cf5 activity and may be used to regulate cell metabolism and cellular sensitivity to radiation or chemotherapeutic exposure. Cf5 peptides corresponding to different functional domains or subunit fusion proteins may be expressed and used in assays to identify compounds that interact with Cf5. To this end, soluble regions of Cf5 may be recombinantly expressed and utilized in non-cell based assays to identify compounds that bind to Cf5. The Cf5 may also be one which has been fully or partially isolated from cell membranes, or which may be present as part of a crude or semi- purified extract. The basis of the assays used to identify compounds that bind to Cf5 involves preparing a reaction mixture of the Cf5 and the test compound under conditions and for time sufficient to allow the two components to interact and bind, thus forming a complex which can be removed and/or detected in the reaction mixture. The identity of the bound test compound is then determined. For example, one method to conduct such an assay involves anchoring the protein, polypeptide, peptide, fusion protein or the test substance onto a solid phase and detecting Cf5/test compound complexes anchored on the solid phase at the end of the reaction. In one embodiment of such a method, the Cf5 reactant is anchored onto a solid surface, and the test compound, which is not anchored, may be labeled.
In practice, microtitre plates conveniently can be utilized as the solid phase. The anchored component is immobilized by non- covalent or covalent attachments. The surfaces may be prepared in advance and stored. In order to conduct the assay, the non- immobilized component is added to the coated surfaces containing the anchored component. After the reaction is completed, unreacted components are removed (e.g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously non-immobilized component is pre- labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously non- immobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the solid surface; e. g., using a labeled antibody specific for the previously non- immobilized component.
Alternatively, a reaction is conducted in a liquid phase, the reaction products separated from unreacted components using an immobilized antibody specific for V-H+-ATPase protein, fusion protein or the test compound, and complexes detected using a labeled antibody specific for the other component of the possible complex to detect anchored complexes.
In accordance with the invention, a cell based assay system can be used to screen for compounds that modulate the activity of Cf5, the system employing cells that express Cf5. In one embodiment, a cell based assay system can be used to screen for compounds that modulate the expression of Cf5 within a cell. An example of such cells are provided above (HeLa cells transiently expressing GFP-tagged CF5). Using such cells, libraries of compounds may be assayed in a high throughput manner to identify those compounds that are capable of modulating CF5 expression.
Assays may be designed to screen for compounds that regulate Cf5 expression at either the transcriptional or translational level. In one embodiment, DNA encoding a reporter molecule can be linked to a regulatory element of the Cf5 gene encoding Cf5 and used in appropriate intact cells, cell extracts or lysates to identify compounds that modulate Cf5 gene expression. Such reporter genes may include but are not limited to chloramphenicol acetyltransferase (CAT), luciferase, p- glucuronidase (GUS) , growth hormone, or placental alkaline phosphatase (SEAP) . Such constructs are introduced into cells thereby providing a recombinant cell useful for screening assays designed to identify modulators of Cf5 gene expression. Following exposure of the cells to the test compound, the level of reporter gene expression may be quantitated to determine the test compound's ability to regulate Cf5 expression. Alkaline phosphatase assays are particularly useful in the practice of the invention as the enzyme is secreted from the cell. Therefore, tissue culture supernatant may be assayed for secreted alkaline phosphatase. In addition, alkaline phosphatase activity may be measured by calorimetric, bioluminescent or chemiluminescent assays such as those described in Bronstein,I. et al. (1994, Biotechniques 17: 172-177) . Such assays provide a simple, sensitive easily automatable detection system for pharmaceutical screening.
In an embodiment of the invention, the level of Cf5 expression can be modulated using antisense or ribozyme approaches to inhibit or prevent translation of Cf5 mRNA transcripts or triple helix approaches to inhibit transcription of the Cf5 gene. Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to Cf5mRNA. The antisense oligonucleotides will bind to the complementary mRNA transcripts and prevent translation..
In yet another embodiment of the invention, ribozyme molecules designed to catalytically cleave Cf5 mRNA transcripts can also be used to prevent translation and expression of Cf5. (See, e. g. , PCT International PublicationW090/11364, published October 4,1990 ; Sarver et al. , 1990, Science 247: 1222-1225).
Therapeutic Compositions and Methods of Administration
The invention provides methods of, and compositions for, treatment and prevention by administration to a subject in need of such treatment of a therapeutically or prophylactically effective amount of a therapeutic of the invention. The subject may be an animal or a human, with or without an established cancer .
Various delivery systems are known and can be used to administer a therapeutic of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the therapeutic, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), construction of a therapeutic nucleic acid as part of a retroviral or other vector, etc. Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compositions may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.
It may be desirable to administer the compositions of the invention locally to the area in need of treatment; this may be achieved, for example and not by way of limitation, by topical application, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
Alternatively, the therapeutic can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317- 327.)
In yet another embodiment, the therapeutic can be delivered in a controlled release system. In one embodiment, a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed., Eng. 14:201 (1987); Buchwald et al., Surgery 88:75 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, FIa. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J. Neurosurg. 71:105 (1989)). In yet another embodiment, a controlled release system can be placed in proximity of the therapeutic target, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)). An antagonist of Cf5, such as a Cf5-specific antibody, may function as a therapeutic of the invention, and such antagonists may be produced using methods which are generally known in the art. In particular, purified Cf5 may be used to produce antibodies or to screen libraries of pharmaceutical agents to identify those which specifically bind Cf5. Antibodies to Cf5 may also be generated using methods that are well known in the art. Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, and single chain antibodies, Fab fragments, and fragments produced by a Fab expression library. Neutralizing antibodies (i.e., those which inhibit dimer formation) are generally preferred for therapeutic use. Single chain antibodies (e.g., from camels or llamas) may be potent enzyme inhibitors and may have advantages in the design of peptide mimetics, and in the development of immuno-adsorbents and biosensors (Muyldermans, S. (2001) J. Biotechnol. 74:277-302).
For the production of antibodies, various hosts including goats, rabbits, rats, mice, camels, dromedaries, llamas, humans, and others may be immunized by injection with Cf5 or with any fragment or oligopeptide thereof which has immunogenic properties (especially the fragment specified above) . Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, KLH, and dinitrophenol . Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially preferable . It is preferred that the oligopeptides, peptides, or fragments used to induce antibodies to Cf5 have an amino acid sequence consisting of at least about 5 amino acids, and generally will consist of at least about 10 amino acids. It is also preferable that these oligopeptides, peptides, or fragments are identical to a portion of the amino acid sequence of the natural protein. Short stretches of Cf5 amino acids may be fused with those of another protein, such as KLH, and antibodies to the chimeric molecule may be produced.
Monoclonal antibodies to Cf5 may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B- cell hybridoma technique, and the EBV-hybridoma technique.
(See, e.g., Kohler, G. et al. (1975) Nature 256:495-497;
Kozbor, D. et al. (1985) J. Immunol. Methods 81:31-42; Cote, R.
J. et al. (1983) Proc. Natl. Acad. Sci. USA 80:2026-2030; and
Cole, S. P. et al. (1984) MoI. Cell Biol. 62:109-120.)
In addition, techniques developed for the production of "chimeric antibodies, " such as the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used. (See, e.g., Morrison, S. L. et al. (1984) Proc. Natl. Acad. Sci. USA 81:6851-6855; Neuberger, M. S. et al. (1984) Nature 312:604-608; and Takeda, S. et al. (1985) Nature 314:452-454.) Alternatively, techniques described for the production of single chain antibodies may be adapted, using methods known in the art, to produce Cf5-specific single chain antibodies. Antibodies with related specificity, but of distinct idiotypic composition, may be generated by chain shuffling from random combinatorial immunoglobulin libraries. (See, e.g., Burton, D. R. (1991) Proc. Natl. Acad. Sci. USA 88:10134-10137. )
Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature. (See, e.g., Orlandi, R. et al. (1989) Proc. Natl. Acad. Sci. USA 86:3833-3837; Winter, G. et al. (1991) Nature 349:293-299.)
Antibody fragments which contain specific binding sites for Cf5 may also be generated. For example, such fragments include, but are not limited to, F(ab').sub.2 fragments produced by pepsin digestion of the antibody molecule and Fab fragments generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity. (See, e.g., Huse, W. D. et al. (1989) Science 246:1275-1281.)
Various immunoassays may be used for screening to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art. Such immunoassays typically involve the measurement of complex formation between Cf5 and its specific antibody. A two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering Cf5 epitopes is generally used, but a competitive binding assay may also be employed (Pound, supra). Various methods such as Scatchard analysis in conjunction with radioimmunoassay techniques may be used to assess the affinity of antibodies for Cf5. Affinity is expressed as an association constant, Ka, which is defined as the molar concentration of Cf5-antibody complex divided by the molar concentrations of free antigen and free antibody under equilibrium conditions. The Ka determined for a preparation of polyclonal antibodies, which are heterogeneous in their affinities for multiple Cf5 epitopes, represents the average affinity, or avidity, of the antibodies for Cf5. The Ka determined for a preparation of monoclonal antibodies, which are monospecific for a particular Cf5 epitope, represents a true measure of affinity. High- affinity antibody preparations with Ka ranging from about 109 to 1012 L/mole are preferred for use in immunoassays in which the Cf5-antibody complex must withstand rigorous manipulations. Low-affinity antibody preparations with Ka ranging from about 106 to 107 L/mole are preferred for use in immunopurification and similar procedures which ultimately require dissociation of Cf5, preferably in active form, from the antibody (Catty, D. (1988) Antibodies, Volume I: A Practical Approach, IRL Press, Washington D. C; Liddell, J. E. and A. Cryer (1991) A Practical Guide to Monoclonal Antibodies, John Wiley & Sons, New York N. Y. ) .
The titer and avidity of polyclonal antibody preparations may be further evaluated to determine the quality and suitability of such preparations for certain downstream applications. For example, a polyclonal antibody preparation containing at least 1-2 mg specific antibody/ml, preferably 5-10 mg specific antibody/ml, is generally employed in procedures requiring precipitation of Cf5-antibody complexes. Procedures for evaluating antibody specificity, titer, and avidity, and guidelines for antibody quality and usage in various applications, are generally available.
The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of a therapeutic, and a pharmaceutically acceptable carrier. In a specific embodiment, the term
"pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the Therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like.
The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E . W. Martin. Such compositions will contain a therapeutically effective amount of the therapeutic, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration.
In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to, ease pain at the, site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration. In the case of cancer, the amount of the therapeutic of the invention which will be effective in the treatment or prevention of cancer will depend on the type, stage and locus of the cancer, and, in cases where the subject does not have an established cancer, will depend on various other factors including the age, sex, weight, and clinical history of the subject. The amount of therapeutic may be determined by standard clinical techniques. In addition, in vivo and/or in vitro assays may optionally be employed to help predict optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the cancer, and should be decided according to the judgment of the practitioner and each patient's circumstances. Routes of administration of a therapeutic include, but are not limited to, intramuscularly, subcutaneously or intravenously. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the compositions of the invention.
The invention is not limited to the embodiments hereinbefore described which may be varied in both construction and detail without departing from the spirit of the invention.

Claims

Claims
1. A method of preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual in need thereof, the method comprising a step of modulating Cf5 protein activity in the individual.
2. A method as claimed in Claim 1 in which the pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways is selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling; pathologies associated with dysfunctional tissue remodelling; inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis.
3. A method as claimed in Claim 1 in which the pathology is cancer, and in which the method comprises administering to the individual an agent capable of attenuating Cf5 activity in a cancer cell.
4. A method as claimed in Claim 3 in which the cancer is selected from the group comprising: fibrosarcoma; myxosarcoma; liposarcoma; chondrosarcom; osteogenic sarcoma; chordoma; angiosarcoma; endotheliosarcoma; lymphangiosarcoma; lymphangioendotheliosarcoma; synovioma; mesothelioma; Ewing's tumor; leiomyosarcpma; rhabdomyosarcoma; colon carcinoma; pancreatic cancer; breast cancer; ovarian cancer; prostate cancer; squamous cell carcinoma; basal cell carcinoma; adenocarcinoma; sweat gland carcinoma; sebaceous gland carcinoma; papillary carcinoma; papillary adenocarcinomas; cystadenocarcinoma; medullary carcinoma; bronchogenic carcinoma; renal cell carcinoma; hepatoma; bile duct carcinoma; choriocarcinoma; seminoma; embryonal carcinoma; Wilms' tumor; cervical cancer; uterine cancer; testicular tumor; lung carcinoma; small cell lung carcinoma; bladder carcinoma; epithelial carcinoma; glioma; astrocytoma; medulloblastoma; craniopharyngioma; ependymoma; pinealoma; hemangioblastoma; acoustic neuroma; oligodendroglioma; meningioma; melanoma; retinoblastoma; and leukemias.
5. A method of attenuating the drug/radiation resistance of a cancer cell comprising the steps of treating the cell with an agent capable of attenuating the Cf5 activity of the cell.
6. A method as claimed in Claim 5 in which the cell is treated with a combination of a cytotoxic agent and an agent that attenuates the Cf5 activity of the cell.
7. A method of prevention or treatment of metastases in an individual afflicted with a primary tumour, the method comprising the steps of treating the individual with an agent capable of attenuating the Cf5 activity of the cell.
8. A method as claimed in Claim 7 in which the metastases is selected from the group comprising: bone metastases; lung metastases; liver metastases; bone marrow metastases; breast metastases; and brain metastases.
9. A method of inhibiting VATP function is a cell comprising the step of treating the cell with an agent capable of attenuating the Cf5 activity of the cell.
10. A method as claimed in any of Claims 1 to 9 in which the agent modulates Cf5 activity by means selected from the group comprising: modulation of Cf5 expression; and modulation of Cf5 activity.
11. A method as claimed in Claim 10 in which Cf5 expression is suppressed by means of siRNA.
12. A method as claimed in Claim 11 in which siRNA molecules are designed to target a sequence in the Cf5 mRNA selected from the group comprising: nucleotides 158 to 176 after the Cf5 start codon; and nucleotides 165 to 183 after the Cf5 start codon.
13. A method as claimed in Claims 11 or 12 in which the siRNA molecules are selected from the group comprising: SEQUNECE ID NO: 5; and SEQUENCE ID NO: 6.
14. A method as claimed in any of Claims 1 to 10 in which the agent inhibits Cf5 activity, wherein the agent is selected from the group comprising: a Cf5 ligand; and amantadine or an amantadine-like molecule; and a macrolide antibiotic such as a concanamycin-like molecule or a baflicomycin-like molecule.
15. A method as claimed in Claim 2 in which the pathology is cardiovascular disease, and in which Cf5 activity is modulated.
16. A method as claimed in Claim 15 in which the cardiovascular disease is selected from the group comprising: cardiac hypertrophy; myocardial infarction; stroke; arteriosclerosis; and heart failure.
17. A method as claimed in Claim 15 or 16 in which Cf5 activity is modulated by modulating the expression or activity of Cf5..
18. A method of identifying or monitoring VATP activity in a cell comprising the step of assaying the cell for Cf5 activity.
19. A method of identifying or monitoring IGF-IR signalling pathway activity in a cell comprising the step of assaying the cell for CF5 activity.
20. A method of assessing the ability of an agent to attenuate the VATP or IGF-IR signalling pathway activity of a cell comprising the steps of treating the cell with the agent and then assaying the cell for expression of Cf5.
21. A method of assessing the metastatic status of a cell or tissue comprising the step of assaying the cell for expression of Cf5, wherein an increased level of Cf5 expression compared to a reference level is indicative of metastatic potential.
22. A method of identifying compounds useful in the treatment or prevention of a pathology characterised by a dysregulated growth, proliferation, survival, migratory, and invasive signalling pathway, comprising determining a reference level of activity of a CF5 protein, contacting the Cf5 protein with a candidate compound, and determining the level of activity of the contacted Cf5 protein, wherein a decrease in the level of activity of the contacted Cf5 protein relative to the reference level of Cf5 activity is an indication that the candidate compound is useful in the treatment or prevention of cancer.
23. A method as claimed in Claim 22 in which the Cf5 protein is provided in the form of Cf5 expressing cells, and in which the level of activity is determined by assaying for a level of expression of Cf5 protein in the cells .
24. A method as claimed in any of Claims 22 or 23, wherein the pathology characterised by a dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways is selected from the group comprising: cancer; cardiovascular disease; neurodegenerative disease; ischemia
(of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling; pathologies associated with dysfunctional tissue remodelling; inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis.
25. A method of identifying an agent that suppresses expression of Cf5 protein comprising the steps of providing a source of Cf5 expressing cells, treating the cells with a candidate agent, and assaying the cells for expression of Cf5, wherein a decrease in the level of expression of Cf5 protein in the treated cells relative to untreated cells is an indication that the candidate agent is useful in suppressing expression of Cf5 protein.
26. A ligand to an isolated polypeptide of SEQ ID NO. 1 or SEQ ID NO. 2. .
27. An antibody raised against (a) an isolated polypeptide of SEQ ID NO. 1 or SEQ ID NO. 2, or (b) an immunogenic fragment of an extracellular portion of a polypeptide of (a) .
28. An antibody as claimed in Claim 27, wherein the immunogenic fragment of an extracellular portion of the polypeptide comprises a peptide having at least five contiguous amino acids from the extracellular portions of the amino acid sequence of SEQ ID NO. 1 or 2.
29. An antibody as claimed in Claim 28, wherein the immunogenic fragment of an extracellular portion of the polypeptide comprises a peptide having at least five contiguous amino acids from the extracellular C-terminal or N-terminal portions of the amino acid sequence of SEQ ID NO. 1 or 2.
30. An antibody as claimed in Claims 28 or 29 in which the peptide comprises at least seven contiguous amino acids.
31. An antibody as claimed in Claim 30 in which the peptide comprises at least nine contiguous amino acids.
32. An antibody as claimed in any of Claims 27 to 31 which is raised against a peptide comprising the amino acid sequence of amino acids 131 to 146 of human Cf5 protein (SEQ ID NO. 1) .
33. An antibody as claimed in any of Claims 27 to 33 which is labelled.
34. A method of diagnosing a disease or condition associated with dysregulated Cf5 expression in an individual comprising a step of administering an antibody of any of Claims 27 to 33 to the individual or to a biological sample obtained from the individual, and correlating the levels of Cf5 detected with the disease or condition .
35. Use of an agent that is capable of modulating the expression or activity of Cf5 as a medicament.
36. Use of an agent that is capable of attenuating the expression or activity of Cf5 as a medicament.
37. Use of an antibody or ligand of any of Claims 26 to 33 as a medicament.
38. A siRNA molecule capable of targeting the Cf5 gene.
39. A siRNA molecule selected from the group comprising: SEQ ID NO: 5 or 6.
40. Use of an siRNA molecule of Claim 38 or 39 as a medicament .
41. A pharmaceutical composition comprising an agent that attenuates the activity of Cf5 and a suitable carrier or pharmaceutical excipient.
42. A pharmaceutical composition as claimed in Claim 41 in which the agent comprises a siRNA molecule of Claims 37 or
38.
43. A pharmaceutical composition as claimed in Claim 41 in which the agent comprises an antibody of any of Claims 27 to 33.
44. A pharmaceutical composition as claimed in Claim 41 in which the agent comprises a ligand of Claim 26.
45. A pharmaceutical composition as claimed in any of Claims 41 to 44, and further including an effective amount of a cytotoxic agent.
PCT/IE2007/000117 2006-12-01 2007-11-30 Treatment of disease by modulating cf5 protein WO2008065636A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US87208006P 2006-12-01 2006-12-01
US60/872,080 2006-12-01

Publications (2)

Publication Number Publication Date
WO2008065636A2 true WO2008065636A2 (en) 2008-06-05
WO2008065636A3 WO2008065636A3 (en) 2009-09-24

Family

ID=39327036

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IE2007/000117 WO2008065636A2 (en) 2006-12-01 2007-11-30 Treatment of disease by modulating cf5 protein

Country Status (1)

Country Link
WO (1) WO2008065636A2 (en)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020042389A1 (en) * 1998-12-03 2002-04-11 Tanja Ligensa IGF-1 receptor interacting proteins
US20040142381A1 (en) * 2002-07-31 2004-07-22 Hubbard Stevan R. Methods for designing IGF1 receptor modulators for therapeutics
US20040213792A1 (en) * 2003-04-24 2004-10-28 Clemmons David R. Method for inhibiting cellular activation by insulin-like growth factor-1
WO2005011673A1 (en) * 2003-07-22 2005-02-10 Instituto Biomar S.A. Use of antitumoral compounds
WO2005035561A1 (en) * 2003-10-14 2005-04-21 University College Cork - National University Of Ireland, Cork Igf-i responsive gene and use thereof
WO2005117936A2 (en) * 2004-05-07 2005-12-15 The University Of North Carolina At Chapel Hill Method for enhancing or inhibiting insulin-like growth factor-i
WO2006100195A1 (en) * 2005-03-21 2006-09-28 Zambon S.P.A. Use of macrolides for treating intestinal inflammation

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020042389A1 (en) * 1998-12-03 2002-04-11 Tanja Ligensa IGF-1 receptor interacting proteins
US20040142381A1 (en) * 2002-07-31 2004-07-22 Hubbard Stevan R. Methods for designing IGF1 receptor modulators for therapeutics
US20040213792A1 (en) * 2003-04-24 2004-10-28 Clemmons David R. Method for inhibiting cellular activation by insulin-like growth factor-1
WO2005011673A1 (en) * 2003-07-22 2005-02-10 Instituto Biomar S.A. Use of antitumoral compounds
WO2005035561A1 (en) * 2003-10-14 2005-04-21 University College Cork - National University Of Ireland, Cork Igf-i responsive gene and use thereof
WO2005117936A2 (en) * 2004-05-07 2005-12-15 The University Of North Carolina At Chapel Hill Method for enhancing or inhibiting insulin-like growth factor-i
WO2006100195A1 (en) * 2005-03-21 2006-09-28 Zambon S.P.A. Use of macrolides for treating intestinal inflammation

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
COLLIS S ET AL: "ENHANCED RADIATION AND CHEMOTHERAPY-MEDIATED CELL KILLING OF HUMAN CANCER CELLS BY SIRNA-SILENCING OF DNA REPAIR FACTORS" PROCEEDINGS OF THE ANNUAL MEETING OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, NEW YORK, NY, vol. 44, 1 July 2003 (2003-07-01), page 375, XP001155167 ISSN: 0197-016X *
FLOYD S ET AL: "The Insulin-like Growth Factor-I-mTOR Signaling Pathway Induces the Mitochondrial Pyrimidine Nucleotide Carrier to Promote Cell Growth" MOLECULAR BIOLOGY OF THE CELL, BETHESDA, MD, US, vol. 18, no. 9, 27 June 2007 (2007-06-27), pages 3545-3555, XP009089428 ISSN: 1059-1524 *
LEROITH DEREK ET AL: "The insulin-like growth factor system and cancer." CANCER LETTERS 10 JUN 2003, vol. 195, no. 2, 10 June 2003 (2003-06-10), pages 127-137, XP002522048 ISSN: 0304-3835 *
LIM J -H ET AL: "Bafilomycin induces the p21-mediated growth inhibition of cancer cells under hypoxic conditions by expressing hypoxia-inducible factor-1[alpha]" MOLECULAR PHARMACOLOGY 2006 US, vol. 70, no. 6, 2006, pages 1856-1865, XP002496572 ISSN: 0026-895X 1521-0111 *
LOUGHRAN G ET AL: "IDENTIFICATION AND CHARACTERIZATION OF IGF-IR-REGULATED GENES THAT CONTRIBUTE TO THE SURVIVAL, GROWTH, AND MOTILITY OF TUMOUR CELLS" GROWTH HORMONE AND IGF RESEARCH, CHURCHILL LIVINGSTONE, LONDON, GB, vol. 14, no. 2, 1 April 2004 (2004-04-01), page 105, XP008040610 ISSN: 1096-6374 *
MULKEEN A ET AL: "siRNA-mediated gene silencing in colorectal cancer: A novel anti-angiogenic targeted therapy" JOURNAL OF SURGICAL RESEARCH, ACADEMIC PRESS INC., SAN DIEGO, CA, US, vol. 121, no. 2, 1 October 2004 (2004-10-01), pages 279-280, XP004606048 ISSN: 0022-4804 *
O'CALLAGHAN K M ET AL: "CHARACTERISATION OF AN IGF-I RESPONSIVE GENE THAT ENCODES A NEW ENDOSOMAL PROTEIN" MOLECULAR BIOLOGY OF THE CELL, BETHESDA, MD, US, vol. 15, no. SUPPL. S, 1 November 2004 (2004-11-01), page 322A, XP009081794 ISSN: 1059-1524 *
PUD D ET AL: "The efficacy of the NMDA receptor antagonist amantadine in the treatment of neuropathic cancer pain: A double blind, randomized, placebo-controlled trial" EUROPEAN JOURNAL OF CANCER, PERGAMON PRESS, OXFORD, GB, vol. 33, 1 September 1997 (1997-09-01), page S53, XP004283485 ISSN: 0959-8049 *
VASILYEVA E ET AL: "Cysteine scanning mutagenesis of the noncatalytic nucleotide binding site of the yeast V-ATPase." THE JOURNAL OF BIOLOGICAL CHEMISTRY 7 JAN 2000, vol. 275, no. 1, 7 January 2000 (2000-01-07), pages 255-260, XP002522047 ISSN: 0021-9258 cited in the application *

Also Published As

Publication number Publication date
WO2008065636A3 (en) 2009-09-24

Similar Documents

Publication Publication Date Title
El Maï et al. The telomeric protein TRF2 regulates angiogenesis by binding and activating the PDGFRβ promoter
US20160138027A1 (en) Treatment of diseases and conditions associated with dysregulation of mammalian target of rapamycin complex 1 (mtorc1)
JP6014904B2 (en) ERAP1-derived peptides and uses thereof
Bai et al. TMEPAI inhibits TGF-β signaling by promoting lysosome degradation of TGF-β receptor and contributes to lung cancer development
WO2008032876A1 (en) Preventive or remedy for er-negative and her2-negative breast cancer and method of screening the same
JP2010512730A (en) TTK as a tumor marker and therapeutic target for lung cancer
JP5590693B2 (en) Biomarkers for estimating prognosis of cancer patients and use thereof
CN107249636B (en) Antitumor agent containing CKAP4 as target molecule
EP2566965B1 (en) Antagonists of sema3e/plexind1 interaction as anti-cancer agents
US20120213801A1 (en) Phosphorylated Twist1 and cancer
KR101771070B1 (en) Methods for screening anti-cancer agents inhibiting interactions between MRS and CDK4
WO2008065636A2 (en) Treatment of disease by modulating cf5 protein
WO2020253608A1 (en) Antagonists of camkii-delta 9 and uses thereof
WO2005111213A1 (en) Target gene mimitin of myc
US9540694B2 (en) HEYL as a therapeutic target and a diagnostic marker for neoplasia and uses therefor
US20080026409A1 (en) Salt-sensitive hypertension
JP5920904B2 (en) Novel anticancer agent and screening method thereof
WO2011132955A2 (en) Use of hades as tumor suppressor target
JP2011518541A (en) C2orf18 as a target gene for cancer therapy and cancer diagnosis
WO2006132248A1 (en) Method for ubiquitination of runx
Malonis et al. Rnf11 sequestration of Smurf2 on membranes antagonizes Smad7 down-regulation of TGFβ signaling
KR20210039234A (en) Novel use of GIT having anti-senescence activity
US20120301895A1 (en) Methods of modulating binding of son of sevenless to phosphatidic acid and identifying compounds that modulate such binding
WO2008065637A1 (en) Treatment of disease
WO2010148370A1 (en) 14-3-3 sigma as a biomarker of basal breast cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07827130

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07827130

Country of ref document: EP

Kind code of ref document: A2