JP2010512730A - TTK as a tumor marker and therapeutic target for lung cancer - Google Patents

Abstract

Disclosed herein are a method for measuring TTK kinase activity against EGFR and a method for screening for modulators of this kinase activity. Also disclosed are methods and pharmaceutical compositions for preventing and / or treating lung cancer using or comprising this modulator. Also provided are lung cancer diagnostic methods using TTK kinase activity against EGFR protein as an indicator, and methods for evaluating and prognosing lung cancer.

Description

  This application claims the benefit of US Provisional Patent Application No. 60 / 874,791, filed on Dec. 13, 2006, the entire disclosure of which is incorporated herein by reference for all purposes.

  The present invention relates to lung cancer, and more particularly to its diagnosis and treatment.

  Lung cancer is one of the most common causes of cancer death worldwide, and non-small cell lung cancer (NSCLC) accounts for nearly 80% of such cases (Greenlee, RT, et al., (2001) CA Cancer J Clin, 51: 15-36. Small cell lung cancer (SCLC) accounts for 15-20% of all lung cancers (Chute JP et al., (1999) J Clin Oncol .; 17: 1794-801 (non-patent document 2), Simon GR et al., ( 2003) Chest .; 123 (1 Suppl): 259S-271S (non-patent document 3)). Although many genetic changes associated with the development and progression of lung cancer have been reported, the exact molecular mechanism remains unclear (Sozzi, G. Eur J Cancer, (2001) 37 Suppl 7: S63-73. (Non-Patent Document 4)). During the last decade, newly developed cytotoxic drugs, including paclitaxel, docetaxel, gemcitabine and vinorelbine, have emerged and offer multiple treatment options for patients with advanced NSCLC. However, new therapies can only provide a slight survival benefit compared to conventional treatments based on cisplatin (Schiller, JH et al. (2002) N Engl J Med, 346: 92-8. Non-patent document 5); Kelly, K., et al. (2001) J Clin Oncol, 19: 3210-8 (non-patent document 6)). Therefore, the development of new therapeutic strategies such as molecular targeted agents, antibodies, and cancer vaccines is eagerly desired.

  Systematic analysis of the expression levels of thousands of genes using cDNA microarray technology is an effective approach to identify unknown molecules involved in the oncogenic pathway, and new therapies and diagnostics Can be investigated as a candidate target for development. For the diagnosis, treatment and prevention of NSCLC by concentrating tumor cells from 101 lung cancer tissues by laser capture microdissection and then analyzing the genome-wide expression profile of NSCLC cells on a cDNA microarray containing 27,648 genes An attempt has been made to isolate a novel molecular target (Kikuchi T, et al. Oncogene. 2003 Apr10; 22 (14): 2192-205. (Non-patent Document 7); Kikuchi T, et al. Int J Oncol. 2006 Apr; 28 (4): 799-805. (Non-patent document 8); Kakiuchi S, et al., Mol Cancer Res. 2003 May; 1 (7): 485-99. ); Hum Mol Genet. 2004 Dec15; 13 (24): 3029-43. Epub 2004 Oct 20. (Non-Patent Document 10); Taniwaki M, et al, Int J Oncol. 2006 Sep; 29 (3): 567- 75. (Non-patent document 11)). In the course of genome-wide cDNA microarray analysis, 642 up-regulated genes and 806 down-regulated genes were identified as diagnostic markers and therapeutic targets for NSCLC (WO 2004/31413) Are incorporated herein by reference)).

  Epidermal growth factor receptor (EGFR) plays an important role in human cancer growth and survival in various tissues by stimulating ligands such as EGF that lead to EGFR autophosphorylation and activate EGFR signaling pathway Fulfill. cDNA and tissue microarray analysis identified TTK as overexpressed in the majority of lung cancers and was further associated with poor prognosis. Furthermore, suppression of endogenous TTK expression by siRNA treatment was shown to result in significant growth inhibition of non-small cell lung cancer cells. Screening candidate substrates for TTK kinase using a panel of antibodies against phosphoproteins associated with cancer cell signaling resulted in the identification of EGFR as an intracellular target for TTK. Furthermore, it was discovered that phosphorylation of EGFR tyrosine-992 and serine-967 by TTK occurs independently of EGF stimulation, leading to activation of PLCγ and phosphorylation of MAPK. In addition, a point mutation was identified in the tyrosine kinase domain of the TTK gene in two patients with metastatic brain tumors derived from primary lung adenocarcinoma and in the lung cancer cell line RERF-LC-AI. In vitro, TTK mutants increased the ability of mammalian cells to invade. At the same time, these data indicate that the function of TTK as an oncogene and its activation plays an important role in intracellular stimulation of EGFR-MAPK signaling in cancer cells, between TTK kinase and EGFR independent of the presence of EGF Have been shown to play an important role in lung cancer formation. Thus, the present invention suggests that targeting TTK enzyme activity is a promising therapeutic strategy for the treatment of lung cancer patients.

WO 2004/31413

Greenlee, R. T., et al., (2001) CA Cancer J Clin, 51: 15-36 Chute JP et al., (1999) J Clin Oncol .; 17: 1794-801 Simon GR et al., (2003) Chest .; 123 (1 Suppl): 259S-271S Sozzi, G. Eur J Cancer, (2001) 37 Suppl 7: S63-73 Schiller, J. H. et al. (2002) N Engl J Med, 346: 92-8 Kelly, K., et al. (2001) J Clin Oncol, 19: 3210-8 Kikuchi T, et al. Oncogene. 2003 Apr10; 22 (14): 2192-205 Kikuchi T, et al. Int J Oncol. 2006 Apr; 28 (4): 799-805 Kakiuchi S, et al., Mol Cancer Res. 2003 May; 1 (7): 485-99 Hum Mol Genet. 2004 Dec15; 13 (24): 3029-43. Epub 2004 Oct 20 Taniwaki M, et al, Int J Oncol. 2006 Sep; 29 (3): 567-75

  In the course of screening for new molecular targets for the diagnosis, treatment and prevention of human cancer, a genome-wide expression profile analysis of 101 lung cancers was performed on a cDNA microarray containing 27,648 genes combined with laser microdissection ( Kikuchi T, et al. Oncogene. 2003 Apr 10; 22 (14): 2192-205 .; Kikuchi T, et al. Int J Oncol. 2006 Apr; 28 (4): 799-805 .; Kakiuchi S, et al ., Mol Cancer Res. 2003 May; 1 (7): 485-99 .; Kakiuchi S, et al., Hum Mol Genet. 2004 Dec 15; 13 (24): 3029-43. Epub 2004 Oct 20 .; Taniwaki M, et al, Int J Oncol. 2006 Sep; 29 (3): 567-75.). The results indicate that the gene encoding TTK protein kinase (aka hMps1) is often overexpressed in the majority of primary lung cancers.

  Epidermal growth factor receptor (EGFR) is recognized as an important mediator of growth signaling pathways (Carpenter G. Annu Rev Biochem. 1987; 56: 881-914 .; Wells C. Int J Biochem Cell Biol. 1999 Jun; 31 (6): 637-43.). Abnormal EGFR activity has been shown to result from genetic and epigenetic changes and promote cell proliferation resulting in tumor development in many tumors (Salomon DS, et al., Crit Rev Oncol Hematol. 1995 Jul; 19 (3): 183-232 .; Mendelson J. Clin Cancer Res. 2000 Mar; 6 (3): 747-53.). Therefore, an agent that selectively inhibits EGFR signaling is under development. In response to this, anti-EGFR monoclonal antibodies, cetuximab (Erbitux), and EGFR tyrosine kinase small molecule inhibitors such as gefitinib (Iressa) and erlotinib (Tarceva) The drug has been used in clinical practice (Dowell J, et al., Nat Rev Drug Discov. 2005 Jan; 4 (1): 13-4 .; Herbst RS, et al., Nat Rev Cancer. 2004 Dec; 4 ( 12): 956-65.). Stimulation of its ligand, such as EGF, causes structural changes in EGFR and autophosphorylation that activates EGFR signaling pathways, including the MAPK (mitogen activated protein kinase) cascade and c-Src (cellular Src) cascade ( Yarden Y. Eur J Cancer. 2001 Sep; 37 Suppl 4: S3-8 .; Pal SK & Pegram M. Anticancer Drugs. 2005 Jun; 16 (5): 483-94 .; Tice DA, et al., Proc Natl Acad Sci US A. 1999 Feb 16; 96 (4): 1415-20.). c-Src phosphorylates the cytoplasmic tail of EGFR in the presence of EGF and activates the EGFR signal (Yarden Y. Eur J Cancer. 2001 Sep; 37 Suppl 4: S3-8 .; Pal SK & Pegram M Anticancer Drugs. 2005 Jun; 16 (5): 483-94 .; Tice DA, et al., Proc Natl Acad Sci US A. 1999 Feb 16; 96 (4): 1415-20.). However, no kinase has yet been reported that phosphorylates EGFR and consequently activates the EGFR pathway in a manner independent of EGF.

  Evidence disclosed herein is the phosphorylation of EGFR Tyr-992 and Ser-967 independent of EGF and the subsequent activity of downstream MAPK signals that are considered essential for tumor growth / survival Demonstrates that TTK plays an important role in the formation of lung cancer by chemicalization. These data suggest that novel signaling between TTK and EGFR independent of the presence of EGF is a promising target for the development of new therapeutics for lung cancer.

  Also, various amino acid substitutions such as leucine to proline (L72P) at codon 72, serine to threonine at codon 76 (S76T), tyrosine to cysteine at codon 574 (Y574C), proline to glutamine at codon 789 (P789Q) and codon 856. Disclosed herein is a variant TTK protein consisting of a substitution of leucine to isoleucine (K856I) in Table 4 (Table 4). The missense mutation (Y574C) at codon 574 on the TTK kinase domain found in the RERF-LC-AI cell line did not exist in the SNP database (JSNP: http://snp.ims.u-tokyo.ac. jp / index_en.html; DBSNP: http://www.ncbi.nlm.nih.gov/projects/SNP/). In addition, two missense mutations were identified in the TTK kinase domain of clinical specimens of two metastatic brain tumors from primary lung adenocarcinoma. The mutation resulted in two amino acid substitutions: valine to phenylalanine (V610F) at codon 610 and glutamine to histidine (Q753H) at codon 753. Matched normal brain tissue was available for these two patients, showing only the wild-type DNA sequence, suggesting that the mutation occurred physically during tumor formation or progression.

  Mutant TTK (Y574C) transformed cells showed higher autophosphorylation levels compared to non-transformed cells, indicating that the mutation could promote TTK kinase activity. Furthermore, it was confirmed that the invasion ability of the mutant TTK (Y574C) transformed cells was significantly enhanced by the Matrigel invasion assay using the mutant TTK construct. These results undoubtedly indicate that TTK mutations derived from RERF-LC-AI cells may be activated mutations involved in lung cancer formation.

(*) : 転写開始点からの位置
(**) : 非コード領域
# : キナーゼドメインにおける位置
(!) : 以前に報告された (Table 4) List of TTK mutations in lung cancer cell lines

(*): Position from the transfer start point
(**): Non-code area
#: Position in kinase domain
(!): Reported previously

  Thus, the present invention is believed to be indispensable for TGF-9 independent phosphorylation of EGFR by TTK and EGF of Ser-967, and subsequent downstream, which is considered essential for tumor growth and / or survival. Based on the discovery of activation of the MAPK signal.

  The present invention also provides a method for diagnosing lung cancer or a predisposition for developing lung cancer, comprising measuring a TTK expression level and a TTK kinase activity level against EGFR in a subject-derived biological sample. An increase in said level compared to a normal control level indicates that the subject has lung cancer or is at risk for developing lung cancer. In particular, TTK kinase activity for EGFR is independent of EGF, and one of the phosphorylation sites of EGFR is Tyr-992 or Ser-967.

The present invention also provides a method for assessing or determining the prognosis of lung cancer. In some embodiments, the method includes the following steps:
detecting TTK expression levels and / or phosphorylated EGFR levels in a sample from a subject whose lung cancer prognosis is assessed or determined; and
b. A poor prognosis is indicated when high levels of TTK expression and / or phosphorylated EGFR levels are detected.

  In particular, TTK kinase activity for EGFR is independent of EGF, and the phosphorylation site of EGFR is Tyr-992 or Ser-967.

  In a further embodiment, the invention features a method of measuring TTK kinase activity, the method comprising incubation of a polypeptide under conditions suitable for EGFR phosphorylation by TTK. Suitable polypeptides include TTK polypeptides or functional equivalents thereof, and EGFR polypeptides or functional equivalents thereof.

  For example, the TTK polypeptide can have the amino acid sequence of SEQ ID NO: 2. Alternatively, as long as the resulting polypeptide retains the biological activity of SEQ ID NO: 2, the TTK polypeptide has an amino acid sequence that has been altered by substitution, deletion or insertion of one or more amino acids of SEQ ID NO: 2. Can have. Biological activity of the polypeptide of SEQ ID NO: 2 includes, for example, promoting cell proliferation and TTK kinase activity against EGFR. Furthermore, as long as the resulting polynucleotide encodes a protein that retains the biological activity of the polypeptide of SEQ ID NO: 2, eg, a region comprising Asp-647 of SEQ ID NO: 2, the polypeptide is SEQ ID NO: 2. Can be in the form of a 857-amino acid protein encoded by a polynucleotide that hybridizes to the nucleotide sequence of SEQ ID NO: 1 under stringent conditions such as 1 open reading frame or under low or high conditions.

  The EGFR polypeptide can have the amino acid sequence of SEQ ID NO: 4 (GenBank Accession No. NP_005219). In cells, EGFR is cleaved at the N-terminal domain to form a 1186 residue protein (SEQ ID NO: 42). As long as the resulting polypeptide retains the target region of TTK kinase in SEQ ID NO: 4, e.g., a region containing Tyr-992 and Ser-967 in the cleaved form of EGFR, the EGFR polypeptide is SEQ ID NO: 4 One or more amino acids may have an amino acid sequence modified by substitution, deletion or insertion. Furthermore, as long as the resulting polynucleotide retains the TTK kinase target site of SEQ ID NO: 4, the EGFR polypeptide is open reading frame of SEQ ID NO: 3 (GenBank Accession No. NM_005228), or low or high In the form of a 1210 amino acid protein encoded by a polynucleotide that hybridizes to the nucleotide sequence of SEQ ID NO: 3.

  In the context of the present invention, TTK kinase activity against EGFR can be defined by detection of phosphorylation in phosphorylated EGFR, particularly Tyr-992 (FIG. 4e). TTK kinase activity against EGFR can be detected by a conventional method such as Western blot analysis using an antibody for phosphorylated EGFR. Phosphorylation can occur either in vitro or in vivo. In in vitro phosphorylation, the purified recombinant TTK polypeptide can be incubated with a cell line using ATP as the phosphate donor, or with a whole extract prepared from the recombinant EGFR polypeptide. For in vivo phosphorylation, endogenously or exogenously co-expressed TTK and EGFR can be used. Suitable synthesis conditions include known basic buffer conditions such as, for example, Tris-HCl.

  The invention further detects TTK polypeptide or functional equivalent thereof and EGFR polypeptide or functional equivalent thereof by incubating in the presence of ATP as a phosphate donor and measuring phosphorylated EGFR levels. To identify agents that modulate (eg, increase or decrease) the activity of TTK kinases against EGFR. A decrease in phosphorylated EGFR levels compared to normal control levels indicates that the test agent is an inhibitor of TTK kinase. Compounds that inhibit (eg, reduce) TTK kinase activity against EGFR are useful for treating, preventing or alleviating symptoms of lung cancer. For example, such compounds can inhibit the growth of lung cancer cells. Alternatively, an increase in level or activity relative to a normal control level indicates that the test agent is an enhancer of TTK kinase activity against EGFR. As used herein, the expression normal control level refers to the level of TTK kinase activity against EGFR detected in the absence of the test compound. For example, phosphorylation of EGFR by TTK is independent from EGF, and examples of phosphorylation sites of EGFR are Tyr-992 and Ser-967.

  The invention also includes compositions and methods for treating or preventing lung cancer by contacting lung cancer cells with a compound identified as described above. In a further aspect, there is provided the use of a compound identified as described above and the manufacture of a pharmaceutical composition suitable for treating or preventing lung cancer. For example, a method of treating lung cancer may comprise a composition comprising a pharmaceutically effective amount of a compound identified as described above and a pharmaceutical carrier, such as a human patient who has been diagnosed with the disease state. Administering to a non-human mammal.

  The present invention also provides a kit for detecting TTK kinase activity against EGFR. The reagents are preferably packaged together in the form of a kit. Reagents can be packaged in separate containers, eg phosphorylated EGFR detection reagents such as TTK polypeptide, EGFR polypeptide, phosphorylated EGFR (Tyr992) or phosphorylated EGFR (Ser967), control reagents (positive and / or negative) ), And / or a detectable label. Instructions for performing the assay (eg, written, tape, VCR, CD-ROM, etc.) are preferably included in the kit. The assay format of the kit can include any kinase assay known in the art.

  The present invention relates to various amino acid substitutions of TTK in the kinase domain, particularly mutations resulting in amino acid substitutions; valine at codon 610 to phenylalanine (V610F), codon 753, available for two patients each. Glutamine to histidine (Q753H), and a tyrosine to cysteine missense mutation (Y574C) at codon 574 on the TTK kinase domain found in the RERF-LC-AI cell line, which was not present in the SNP database Based in part on the discovery. Mutation of TTK (Y574C or Q753H) promotes TTK kinase activity and invasion ability, so a mutation in TTK derived from RERF-LC-AI cells (Y574C or Q753H) may be an activated mutation involved in lung cancer formation . Therefore, the present invention provides a method for predicting lung cancer metastasis, particularly brain tumor metastasis of lung cancer using TTK kinase domain mutation, for example, Y574C or Q753H as an index.

  In other embodiments, the present invention also includes administering to a subject a composition comprising a double-stranded molecule that reduces TTK (SEQ ID NO: 1) or EGFR (SEQ ID NO: 3) gene expression. Or provide preventive methods. The double-stranded molecule comprises a sense nucleic acid and an antisense nucleic acid, the sense nucleic acid comprising a ribonucleotide sequence that matches the sequence of SEQ ID NO: 62 or 63 as the target sequence.

  Alternatively, the present invention also provides a lung cancer treatment comprising a pharmaceutically effective amount of a double-stranded molecule that reduces TTK (SEQ ID NO: 1) or EGFR (SEQ ID NO: 3) gene expression and a pharmaceutically acceptable carrier and Prophylactic compositions are provided.

  Furthermore, the present invention provides an inhibitory polypeptide selected from the group of ISSILEKGERLPQPPICTI (SEQ ID NO: 44), DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) and FRELIIEFSKMARDPQRYL (SEQ ID NO: 46). The invention further provides a medicament or method for using these inhibitory polypeptides for the treatment and / or treatment of lung cancer.

  The present invention also provides an inhibitory polypeptide selected from the group of ISSILEKGERLPQPPICTI (SEQ ID NO: 44), DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) and FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) or a polynucleotide encoding them. The present invention relates to a method for treating and / or preventing lung cancer comprising a step of administering.

  These and other objects and features of the invention will become more fully apparent when the following detailed description is read in conjunction with the accompanying figures and examples. However, it is to be understood that both the foregoing summary of the invention and the following detailed description are preferred embodiments and do not limit the invention or other alternative embodiments of the invention. In particular, while the invention is described herein with reference to a number of specific embodiments, it will be understood that the specification is illustrative of the invention and is not to be construed as limiting the invention. Various modifications and applications may occur to those skilled in the art without departing from the spirit and scope of the invention as set forth in the appended claims. Similarly, other objects, features, benefits and advantages of the present invention will be apparent from this summary and specific embodiments described below and will be readily apparent to those skilled in the art. Such objects, features, advantages and effects may be considered in conjunction with the appended examples, data, figures and all reasonable inferences derived therefrom, either alone or in references cited in the specification. It is clear from the above.

  With respect to the specific objects and subjects listed above, it is well understood by those skilled in the art that one or more aspects of the present invention can address a particular object. On the other hand, one or more other aspects can address certain other purposes. In every aspect of the present invention, each object cannot be equally applied in every aspect. Thus, the subject matter herein can be considered in the alternative with respect to any one aspect of the present invention.

  Various aspects and applications of the present invention will become apparent to those skilled in the art upon review of the brief description of the drawings and the following detailed description of the invention and preferred embodiments thereof.

FIG. 1 shows TTK expression verification in primary lung cancer and cell lines. Part a shows TTK expression in clinical samples of NSCLC (T) and corresponding normal lung tissue (N) examined by semi-quantitative RT-PCR. Part b shows TTK expression in lung cancer cell lines examined by semi-quantitative RT-PCR. Part c shows the expression of TTK protein in 7 lung cancer cell lines, normal airway epithelial cells (SAEC) and 2 normal lung fibroblasts (CCD19Lu and MRC-5) detected by Western blot analysis. Part d provides representative images of immunohistochemical analysis of TTK protein in lung adenocarcinoma (ADC), squamous cell carcinoma (SCC) and small cell lung cancer (SCLC) tissues. Magnification × 200. Part e shows the expression of TTK in A549 cells (left panel) and LC319 cells (right panel) by immunohistochemical analysis. Cells were fixed and stained with anti-TTK antibody and Alexa Fluor 488-conjugated goat anti-mouse IgG as secondary antibody. TTK was visualized in green and cell nuclei in blue (DAPI). Part f shows the results of Western blot analysis using an anti-TTK antibody, confirming that TTK is localized in the cytoplasm and nuclear fraction of A549 cells (left panel) and LC319 cells (right panel). FIG. 2 shows TTK expression in primary lung cancer and its prognostic evaluation. Part a shows the results of immunohistochemical evaluation of TTK protein expression in tissue microarrays. Examples show strong, weak or no expression of TTK expression in lung SCC and no expression in normal lung. Magnification x100. Part b shows the results of Kaplan-Meier analysis of tumor-specific survival of patients with non-small cell lung cancer (NSCLC) based on TTK expression (P <0.0001 by log rank test). FIG. 3 shows the growth promoting effect of TTK and the activation of cell invasion activity by TTK. Part a is the expression of TTK in response to si-TTK (si-TTK-1, -2) or control siRNA (luciferase (LUC) or scramble (SCR)) in LC319 cells analyzed by semi-quantitative RT-PCR Is shown (upper left panel). The viability of LC319 cells was assessed by MTT assay in response to si-TTK, -LUC, or -SCR (lower left panel). Colony formation assay of LC319 cells transfected with specific siRNA or control plasmid (lower right panel). Part b shows TTK protein expression of TTK constant transfectants of HEK293 cells in Western blot analysis. In part c, control cells transfected with transfectants or mock vectors expressing TTK at low levels (clone 1) and high levels (clone 2) were cultured in triplicate, and MTT assay was performed at each time point. It shows that cell viability was evaluated. Part d shows the growth curves of TTK steady-state transfectants of HEK293 cells or mock HEK293 cells transplanted subcutaneously into nude mice (5 × 10 ⁶ TTK-introduced HEK293 cells / mouse). Part e shows the results of a Matrigel invasion assay showing increased invasion ability of NIH-3T3 cells transfected with TTK, catalytically inactive TTK-KD (kinase dead), or mock vector. The number of infiltrating cells that passed through the matrigel-coated filter was shown. FIG. 4 relates to direct phosphorylation of EGFR in Tyr-992 by TTK protein kinase. Part a shows the results of Tyr-992 phosphorylation of EGFR in COS-7 cells that transiently overexpressed TTK. COS-7 cells that hardly expressed endogenous TTK were transfected with a TTK expression vector, a catalyst-inactivated TTK-KD (D647A) expression vector, or a mock vector. Whole cell extracts from these cells were used for Western blot analysis using a total of 31 antibodies against various phosphoproteins associated with cancer cell signaling (see Table 2). The blot was stripped and reprobed to confirm the addition of equal amounts of total EGFR or ACTB. The total band of EGFR is about 175 kDa. Part b shows the results of the interaction between EGFR and endogenous TTK in lung cancer cells. Immunoprecipitation was performed with anti-TTK antibody and A549 cell extract in the presence (100 nM) or absence of EGF. The immunoprecipitate was donated to Western blot analysis to detect endogenous EGFR. IP: immunoprecipitation, IB: immunoblot part c shows the results of phase contrast images of A549 cells into which AG1478 treatment or siRNA (oligo) for TTK or siRNA (oligo) for EGFR were introduced. Untreated A549 cells served as controls. Part d shows the results of an in vitro kinase assay by incubating purified recombinant TTK protein with whole cell extracts isolated from COS-7 cells. Following in vitro kinase assay, samples were donated to Western blot analysis using anti-phosphorylated EGFR antibodies (Tyr-845, Tyr-992, Tyr-1045, Tyr-1068, Tyr-1148 and Tyr-1173). The blot was stripped and reprobed to confirm equal addition of total EGFR or ACTB (left panel). COS-7 cells maintained in serum-free medium for 24 hours were exposed to EGF (100 nM) at 37 ° C. for 5 or 15 minutes. COS-7 cells without exposure to EGF treatment served as controls. Whole cell extracts from these cells were used for Western blot analysis (right panel) using these anti-phosphorylated EGFR antibodies. All bands shown are about 175 kDa. Part e is a schematic representation of the EGFR deletion mutation (DEL). A GST fusion protein with three partial EGFR sequences in the cytoplasmic region was constructed (deletion mutant). Individual mutants are shown as bars with amino acid residue numbers at both ends. Extracellular domain, transmembrane region (TM), tyrosine kinase domain, Src phosphorylation site (Tyr-845), and tyrosine autophosphorylation sites (Tyr-992, Tyr-1045, Tyr-1068, Tyr-1148 and Tyr- 1173) is indicated. All three EGFR deletion mutants (EGFR DEL) are kinase deletion constructs. Part f shows the results of visualization of the three recombinant EGFR-DELs added to SDS-PAGE by Coomassie Brilliant Blue staining (upper panel). In vitro kinase assay by incubating purified recombinant TTK with three deletion mutants of EGFR as substrate (lower panel). After the kinase reaction, samples were donated to Western blot analysis using anti-phosphorylated EGFR antibody. The blot was stripped and reprobed to confirm the addition of an equal amount of GST. Part g shows the results of an in vitro kinase assay by incubating recombinant TTK (as kinase) and catalytically active recombinant GST-tagged EGFR (active rhEGFR, Upstate as substrate). After the kinase reaction, samples were donated for Western blot analysis using anti-phosphotyrosine antibodies. The kinase activity of active rhEGFR was detected in the presence of ATP (lane 2, # indicates autophosphorylation of active rhEGFR). Phosphorylation of active rhEGFR pretreated with EGFR tyrosine kinase inhibitor (AG1378) was not detected in the absence of recombinant TTK (lane 3), but was detected in the presence of recombinant TTK (lane 4) . An autophosphorylated form of recombinant TTK (arrow) and a phosphorylated form of active rhEGFR by recombinant TTK were shown. Part h shows immunohistochemistry of representative surgical excision samples including NSCLC (pulmonary ADC and SCC) and SCLC as well as normal lung using anti-phosphorylated EGFR (Tyr-992) antibody on tissue microarray The result of the static staining is shown (× 200). Part i shows the results of Kaplan-Meier analysis of tumor-specific survival of NSCLC patients based on phosphorylated EGFR (Tyr-992) expression (P <0.0001 by log rank test). Part j shows the poor prognosis of patients with NSCLC and the associated results of TTK and phosphorylated EGFR (Tyr-992). 366 NSCLC cases were divided into 3 groups; group 1 (63 cases) with strong positive staining for both TTK and phosphorylated EGFR (Tyr-992), group 2 (74 cases) with both markers negative staining Group 3 (229 cases), all other cases. Parts k and l show the results of phosphorylated EGFR (Tyr-992) immunofluorescence analysis in COS-7 cells that transiently overexpressed TTK. COS-7 cells that hardly express endogenous TTK were transfected with a TTK expression vector or an empty vector (mock), maintained in serum-free medium for 12 hours, and then washed and fixed. TTK-Alexa488, phosphorylated EGFR (Tyr-992) Alexa594 or cell nucleus (DAPI) were visualized in green, red, or blue, respectively. Internalization of phosphorylated EGFR (Tyr-992) was observed in cells transfected with TTK expression plasmid (k). The arrow indicates the localization of phosphorylated EGFR (Tyr-992) (l). Part m shows phosphorylated EGFR (Tyr-992) levels detected by immunofluorescence analysis in A549 cells transfected with RNAi (oligo) against TTK (si-TTK). RNAi-mediated suppression of TTK reduced EGFR phosphorylation at Tyr-992. FIG. 5 shows the results of induction of phosphorylated EGFR (Tyr-992) and downstream signal activation in a TTK-dependent tumorigenic system. Part a shows the expression level of TTK and the phosphorylation level of EGFR (Tyr-992) in A549 cells arrested at mitosis by colcemid treatment (0, 100, 200 nM) (WAKO) for 24 hours. They were detected by Western blot analysis using anti-TTK and pEGFR (Tyr-992) antibodies (upper and third panel). In order to evaluate the mobility shift of TTK or EGFR band by phosphorylation, the cell extract was treated with lambda protein phosphatase (λ-PPase; New England Biolab) with or without phosphatase buffer or buffer for 1 hour at 37 ° C. . This treatment abolished the mobility shift of the TTK and EGFR bands detected by Western blotting (second and fourth panels). Part b detected by Western blot analysis in A549 cells transfected with RNAi (oligo) against TTK, TTK, phosphorylated EGFR (Tyr-992), total EGFR, phosphorylated PLCγ1 (Tyr-771), total PLCγ1, phosphorous The expression levels of oxidized p44 / 42MAPK (Thr202 / Tyr204) and total p44 / 42MAPK are shown. RNAi-mediated suppression of TTK reduced phosphorylation of both EGFR (Tyr-992), PLCγ1 (Tyr-771) and p44 / 42MAPK (Thr202 / Tyr204). Part c shows the results of immunofluorescence analysis of phosphorylated p44 / 42MAPK in COS-7 cells that transiently overexpress TTK. Transfected cells were maintained in serum free medium for 12 hours, then washed and fixed. Flag-TTK-Alexa488, phosphorylated p44 / 42MAPK (Thr202 / Tyr204) -Alexa594 or cell nucleus (DAPI) were visualized in green (upper panel), red (middle panel) or blue, respectively. Phosphorylation of p44 / 42MAPK was observed only in TTK transfected cells but not in TTK non-transfected cells (lower panel). Part d shows the results of co-immunoprecipitation of PLCγ1 and EGFR in COS-7 cells transfected with TTK-vector, TTK-KD-vector, or empty vector (mock). EGFR was immunoprecipitated from whole cell extracts of these cells using anti-EGFR antibody. The immunoprecipitate was analyzed by Western blotting. FIG. 6 shows the results of direct phosphorylation of EGFR in Ser-967 by TTK protein kinase. Part a is recombinant EGFR-DEL-2 (wild type) or EGFR-DEL-2 mutant in which Tyr-992 residue is replaced by alanine (Y992A) in the presence of [γ- ³² P] ATP The results of an in vitro kinase assay performed by incubating with TTK are shown. The products were separated by SDS-PAGE and phosphorylation was visualized by autoradiography. Part b shows the levels of TTK, phosphorylated EGFR (Ser-967) and total EGFR protein detected by Western blot analysis in lung cancer cell lines. Part c shows the results of phosphorylated EGFR (Ser-967) in COS-7 cells transiently overexpressed with TTK, detected by immunofluorescence analysis. COS-7 cells that hardly expressed endogenous TTK were transfected with a TTK expression vector. TTK-Alexa594, phosphorylated EGFR (Ser-967) -Alexa488 or cell nucleus (DAPI) were visualized in red (right panel), green (middle panel) and blue (left panel), respectively. TTK overexpression induced phosphorylation of EGFR (Ser-967). Part d shows the phosphorylation level of EGFR (Ser-967) detected by immunofluorescence analysis of A549 cells transfected with RNAi (oligo) against TTK. Inhibition of TTK via RNAi decreased phosphorylation of EGFR (Ser-967). Part e shows the results of immunohistochemical evaluation of phosphorylated EGFR (Ser-967) expression in tissue microarrays. Examples show strong, weak and no expression of phosphorylated EGFR (Ser-967) expression. Magnification x100. Part f shows the results of Kaplan-Meier analysis of tumor specific survival in NSCLC patients based on phosphorylated EGFR (Ser-967) expression (P <0.0001 by log rank test). FIG. 7 shows the results of suppression of cell proliferation / invasion by targeting the TTK-EGFR pathway. Part a shows the results of the MTT assay, showing the enhanced growth-promoting effect of TTK's steady-state transfectants. HEK293 cell TTK or mock stationary transfectants were each cultured in triplicate, and cell viability was assessed by MTT assay at each time point. These constant transfectants were transfected with RNAi (oligo) against EGFR (si-EGFR). Part b shows the results of a Matrigel invasion assay showing the increased invasion ability of HEK293's TTK- or mock stationary transfectants. These constant transfectants were transfected with si-EGFR. Part c shows the results of suppression of proliferation of lung cancer cells by cell-permeable EGFR peptide (11R-EGFR) detected by MTT assay. Peptides transfected into A549 cells overexpressing TTK. Proliferation inhibitory effect of 11R-EGFR899-917, 11R-EGFR918-936 or 11R-EGFR937-955 derived from the TTK binding region of EGFR (left panel). Most effective 11R-EGFR937-955 peptide-derived scrambled peptide treatments did not show growth inhibitory effects on cell viability as measured by MTT assay (right panel). Column, relative absorbance of triplicate assay; bar, SD. FIG. 8 relates to an activated mutation of TTK in human lung cancer. Part a shows the results of sequence analysis of TTK mutation in lung cancer. Left panel, point mutation (Y574C; arrow) that resulted in an amino acid substitution in the tyrosine kinase domain of TTK found in the lung cancer cell line RERF-LC-AI. Representative wild type sequences are shown as references. Center and right panels, point mutations (arrows) resulting in amino acid substitutions in the TTK tyrosine kinase domain (V610F in 2 cases, Q753H in 8 cases) in two metastatic brain tumors from primary lung adenocarcinoma. Also shown are portions corresponding to wild-type DNA sequences from paired normal brain tissue. Part b shows the results of Western blot analysis using an anti-Flag antibody that detects mutations TTK (Y574C) and (Q753H) exogenously expressed in NIH-3T3 cells. Phosphorylated TTK was indicated by an arrow. Part c and d show the increased invasion ability of NIH-3T3 cells introduced with wt-TTK-vector, TTK-KD-vector, mutant TTK (Y574C) -vector, or mutant TTK (Q753H) -vector, or mock vector The results of a Matrigel invasion assay are shown. Infiltrated cells that passed through a Matrigel-coated filter evaluated by Giemsa staining (× 200) (c), and the number of cells counted (d) FIG. 9 shows TTK expression in clinical samples. TTK expression in clinical specimens of early primary NSCLC (stage I-IIIA), advanced primary NSCLC (stage IIIB-IV), and ADC (T) -derived metastatic brain tumors and normal lung tissue (N), semiquantitative RT -Reviewed by PCR (top panel). The concentration measurement intensity of the PCR product was quantified by image analysis software (lower panel).

DETAILED DESCRIPTION OF THE INVENTION It should be understood that these are not limited to the specific methodologies and protocols described herein as they can be modified for routine testing and optimization. It is also to be understood that the terminology used herein describes only a particular version or example and is not intended to limit the scope of the invention. As used herein and in the appended claims, the singular forms “a”, “an”, and “the” are clearly different in context. It should be noted that multiple references are included except when referring to. Thus, for example, reference to “a cell” is to refer to one or more cells and their equivalents known to those skilled in the art.

  Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. However, in case of conflict, the present specification, including definitions, will control. Therefore, in the context of the present invention, the following definitions apply:

  In the context of the present invention, a TTK polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2, or the resulting polypeptide is functionally equivalent to the polypeptide of SEQ ID NO: 2. Alternatively, it may be a polypeptide having SEQ ID NO: 2 in which a plurality of amino acids are modified by substitution, deletion or insertion. In addition, the TTK polypeptide is a 857 amino acid protein encoded by the open reading frame of SEQ ID NO: 1, or under stringent conditions such as low or high, the resulting polynucleotide is a polypeptide of SEQ ID NO: 2. It can also take the form of a polypeptide that hybridizes to the nucleotide sequence of SEQ ID NO: 1, which encodes a protein functionally equivalent to the peptide.

  In the context of the present invention, the term “functionally equivalent” means that the protein of interest retains the biological activity of the underlying protein. The biological activity of SEQ ID NO: 2 includes, for example, promoting cell proliferation and TTK kinase activity against EGFR. In the context of the present invention, a protein functionally equivalent to TTK preferably has kinase activity against EGFR. Whether or not the target protein has the target activity can be determined by the present invention. For example, kinase activity against EGFR can be measured by incubating the polypeptide under conditions suitable for EGFR phosphorylation and detecting phosphorylated EGFR levels. For example, the phosphorylation site of EGFR by TTK is Tyr992 or Ser967.

  A protein functionally equivalent to the human TTK protein encoded by the DNA identified by the above hybridization technique or gene amplification technique usually has high homology with the amino acid sequence of the human TTK protein. In the context of the present invention, the term “high homology” refers to a homology of 40% or more, preferably 60% or more, more preferably 80% or more, even more preferably 95% or more. Protein homology can be determined according to the algorithm in “Wilbur, W. J. and Lipman, D. J. (1983) Proc. Natl. Acad. Sci. USA 80, 726-30”.

  In the context of the present invention, the term “stringency” in the context of hybridization refers to the relative stringency of the hybridization standard being utilized. Examples of suitable low stringency conditions include, for example, 42 ° C., 2 × SSC, 0.1% SDS, or preferably 50 ° C., 2 × SSC, 0.1% SDS. Preferably, highly stringent conditions are used. Examples of suitable high stringency conditions are, for example, 3 x 20 min washes with 2 x SSC and 0.01% SDS at room temperature, then 3 x 20 min washes with 1 x SSC and 0.1% SDS at 37 ° C. , And 2 × 20 min washes with 1 × SSC, 0.1% SDS at 50 ° C. However, several factors such as temperature and salt concentration can affect the stringency of hybridization, and those skilled in the art can appropriately select the factors to achieve the required stringency.

  In the context of the present invention, the term “control level” refers to the mRNA or protein expression level detected in a control sample and includes both (a) a normal control level or (b) a lung cancer specific control level. The control level can be a single expression pattern derived from a single reference population or a single expression pattern derived from multiple expression patterns. For example, in the context of the present invention, the control level may be a database of expression patterns from previously tested cells. The term “normal control level” refers to the level of gene expression detected in a healthy individual or in a population of individuals known to be free of cancer, eg, lung cancer. A healthy individual is an individual who does not have clinical symptoms of cancer, particularly lung cancer. On the other hand, “lung cancer control level” refers to the expression level of a gene found in a population suffering from lung cancer.

  In the context of the present invention, gene expression or gene product activity is at least 0.1 fold, at least 0.2 fold, at least 1 fold, at least 2 fold, at least 5 fold, or at least 10 fold or more compared to a control level. When increased, the expression level of a particular gene is considered “increased”. TTK gene expression can be detected by detecting TTK mRNA from a patient-derived tissue sample, for example, by RT-PCR or Northern blot analysis, or TTK-encoded protein, for example, by immunohistochemical analysis of a patient-derived tissue sample It can be determined by detecting.

  In the context of the present invention, a sample from a subject can be any body tissue or fluid sample obtained from a test subject, eg, a patient suffering from or suspected of having cancer, more particularly lung cancer. For example, the tissue can include epithelial cells. More particularly, the tissue can be lung cancer cells, such as epithelial cells of non-small cell lung cancer or small cell lung cancer. Alternatively, the sample may be a body fluid such as blood, serum or plasma.

  The present invention relates to the treatment and prevention of cancer. In the context of the present invention, treating cancer or preventing the onset of cancer includes any of the following steps, including inhibition of cancer cell growth, regression of cancer, and suppression of cancer development. Such therapeutic and prophylactic effects are preferably statistically significant. For example, at the time of observation, at a significance level of 5% or less, the therapeutic or prophylactic effect of a pharmaceutical composition against a cell proliferative disorder is compared to an untreated control. For example, Student's t test, Mann-Whitney U test or ANOVA can be used for statistical analysis.

  Further, in the context of the present invention, the term “prevention” includes any activity that reduces the mortality or morbidity burden of the disease. Prevention can occur at primary, secondary and tertiary prevention levels. While primary prevention reduces disease development, secondary prevention and secondary prevention as well as reducing the adverse effects of established disease and reducing disease-related complications by restoring function Tertiary levels include activity to prevent disease progression and development of symptoms.

  In the context of the present invention, an “effective” treatment is a treatment that results in a decrease in TTK levels or EGFR phosphorylation levels or a decrease in lung cancer size, prevalence, or metastatic potential in a subject. “Effective” when treatment is applied prophylactically means that the treatment delays or prevents the development of lung cancer or reduces the clinical symptoms of lung cancer. Assessment of lung cancer can be performed using standard clinical protocols. Furthermore, the effectiveness of the treatment can be determined in connection with any known method for the diagnosis or treatment of lung cancer. For example, lung cancer is diagnosed routinely by histopathology or by identifying symptomatic abnormalities.

  Additional definitions are scattered throughout the following text and can be applied.

Overview:
Despite the development of the development of molecular targeted drugs for the treatment of cancer, the range of responding tumor types remains very limited (Ranson, M., et al. 2002) J Clin Oncol, 20: 2240-50 .; Blackledge, G. and Averbuch, S. (2004) Br J Cancer, 90: 566-72.). Therefore, there is an urgent need to develop new anticancer agents that are highly specific for malignant cells with minimal or no side effects. A powerful strategy towards these goals is identified on the basis of genetic information obtained on cDNA microarrays along with high-throughput screening of their effects on cell proliferation and cancer induced by induction of loss-of-function phenotypes by the RNAi system. Combining cell up-regulated gene screening and validation of drug target potential by analyzing hundreds of clinical samples on tissue microarrays (Sauter, G., et al. (2003) Nat Rev Drug Discov , 2: 962-72 .; Kononen, J., et al. (1998) Nat Med, 4: 844-7.). Following such a strategy, not only TTK is often co-overexpressed in clinical NSCLC samples and cell lines, but also high expression levels of gene products are used in disease progression as well as NSCLC cell proliferation. It is indispensable to.

  Epidermal growth factor receptor (EGFR) has been recognized as an important mediator of various proliferation signaling pathways (Carpenter G. Annu Rev Biochem. 1987; 56: 881-914 .; Wells C. Int J Biochem Cell Biol. 1999 Jun; 31 (6): 637-43.). Abnormal EGFR activity resulting from genetic and epigenetic changes has been shown to increase cell proliferation and drive tumor progression in many tumors (Salomon DS, et al., Crit Rev Oncol Hematol 1995 Jul; 19 (3): 183-232 .; Mendelson J. Clin Cancer Res. 2000 Mar; 6 (3): 747-53.). Therefore, drugs that selectively inhibit EGFR signaling are under development, and clinically used examples include anti-EGFR monoclonal antibodies, cetuximab (Erbitux), and EGFR tyrosine such as gefitinib (Iressa) and erlotinib (Tarceva) Includes small molecule inhibitors of kinases (Dowell J, et al., Nat Rev Drug Discov. 2005 Jan; 4 (1): 13-4 .; Herbst RS, et al., Nat Rev Cancer. 2004 Dec; 4 (12): 956-65.). Stimulation of ligands such as EGF causes conformational changes and autophosphorylation that activates the EGFR signaling pathway, including the MAPK (mitogen activated protein kinase) cascade and the c-Src (cellular Src) cascade (Yarden Y. Eur J Cancer. 2001 Sep; 37 Suppl 4: S3-8 .; Pal SK & Pegram M. Anticancer Drugs. 2005 Jun; 16 (5): 483-94 .; Tice DA, et al., Proc Natl Acad Sci US A. 1999 Feb 16; 96 (4): 1415-20.). c-Src phosphorylates the cytoplasmic tail of EGFR in the presence of EGF and activates the EGFR signal (Yarden Y. Eur J Cancer. 2001 Sep; 37 Suppl 4: S3-8 .; Pal SK & Pegram M. Anticancer Drugs 2005 Jun; 16 (5): 483-94 .; Tice DA, et al., Proc Natl Acad Sci US A. 1999 Feb 16; 96 (4): 1415-20.). However, until now, no kinase has been reported that phosphorylates EGFR and consequently activates the EGFR pathway in a manner independent of EGF.

  However, TTK is thought to be essential for EGFR Tyr-992 or Ser-967 EGF-independent phosphorylation and tumor growth / survival and is important in lung cancer formation by subsequent activation of downstream MAPK signals A rationale for playing a role is provided herein. Thus, the data suggest that EGFR, independent of the presence of TTK and EGF, represents a candidate target for the development of new therapeutics for lung cancer.

Prognostic evaluation of lung cancer:
As described above, the present invention is based in part on the discovery of novel intracellular target molecules of TTK kinase, EGFR. The present invention is also based on the finding that high expression levels of TTK and / or high levels of phosphorylated EGFR are associated with poor prognosis in lung cancer patients. In particular, the lung cancer is non-small cell lung cancer (NSCLC). In view of the evidence provided herein, TTK expression and / or TTK kinase activity against EGFR or EGFR phosphorylation levels are associated with poor prognosis in cancer patients, and thus the present invention assesses prognosis in lung cancer patients or Provide a way to measure. For example, the phosphorylation site of EGFR is Tyr-992 or Ser-967. An example of such a method includes the following steps:
detecting TTK expression level or EGFR phosphorylation level in a sample collected from a subject whose lung cancer prognosis is evaluated or measured; and
b. A process with a poor prognosis when elevated levels of TTK expression or phosphorylated EGFR are detected.

  In the context of the method, a sample is taken from the subject. An example of a preferred treatment used in the context of the present invention is lung tissue obtained from a lung cancer patient by biopsy or surgical resection. In the context of the present invention, a test sample is considered to have an elevated level of TTK expression or EGFR phosphorylation if the TTK expression level or EGFR phosphorylation level detected in the test sample is higher than the control level. In the context of the present invention, examples of effective control levels include phosphorylation of EGFR levels selected from a reference value for TTK expression or a group associated with good prognosis. The reference value can be obtained by any method known in the prior art. For example, an average value ± 2 S.D or an average value ± 3 S.D can be used as the reference value. Alternatively, poor prognosis can be determined when intense staining is observed by immunohistochemical analysis of the sample tissue.

In the context of the present invention, the expression level of TTK is detected by any one of the methods selected from the group consisting of:
(a) A method for detecting the presence of mRNA encoding the amino acid sequence of SEQ ID NO: 2:
(b) A method for detecting the presence of a protein having the amino acid sequence of SEQ ID NO: 2:
(c) A method for detecting the biological activity of a protein having the amino acid sequence of SEQ ID NO: 2.

  In the context of the present invention, the biological activity of mRNA, protein or protein can be detected by any method. Methods for detecting a given protein, messenger RNA or biological activity thereof are well known to those skilled in the art. For example, mRNA can be detected using known PCR or hybridization-based techniques. Alternatively, any immunoassay format can be applied to protein detection. Furthermore, the biological activity of TTK, such as the kinase activity of TTK against EGFR, can be detected using any suitable assay method as described herein. For example, the TTK kinase activity of EGFR can be detected with the 992 amino acid residue tyrosine of SEQ ID NO: 42 or the 967 amino acid residue serine.

  In the context of the present invention, the level of phosphorylation of EGFR can be detected by measuring the amount of phosphorylated EGFR, eg Tyr-992 or Ser-967 phosphorylated EGFR. Methods for detecting phosphorylated EGFR are well known to those skilled in the art. For example, immunoassays using specific antibodies are useful.

  In the context of the present invention, a poor prognosis determination is to stop further treatment, for example to stop further treatment that reduces the quality of life, to treat the cancer in a different way than previously used, or more aggressively cancer Can be used to determine whether or not to treat. In other words, prognostic assessment by phosphorylation of TTK or EGFR is the most appropriate for clinicians, using only routine tissue sampling procedures, for individual lung cancer patients who do not have information on the clinical progression of conventional disease. Allows pre-selection of treatment.

  Furthermore, the methods of the invention can be used to evaluate the effectiveness of a course of treatment. For example, in a mammal with a cancer where the biological sample has been found to contain elevated levels of TTK expression or EGFR phosphorylation, the efficacy of anti-cancer therapy monitors TTK expression levels or EGFR phosphorylation levels over time Can be evaluated. For example, a decrease in TTK expression level or EGFR phosphorylation level in a biological sample obtained from a mammal after the course of treatment is effective compared to the level observed in a sample obtained from that mammal before or early in treatment. Can indicate treatment.

  Alternatively, according to the present invention, intermediate results can be provided in addition to other test results for assessing or determining a subject's prognosis. Such intermediate results are useful for a doctor, nurse or other practitioner to assess, determine or estimate the prognosis of a subject. Additional information that may be combined with intermediate results obtained by the present invention to assess prognosis includes the subject's clinical symptoms and physical conditions.

As described above, the present invention also provides a kit for assessing or determining the progression of lung cancer. The kit includes any one component selected from the group consisting of:
(a) A reagent for detecting the presence of mRNA encoding the amino acid sequence of SEQ ID NO: 2:
(b) a reagent for detecting a protein having the amino acid sequence of SEQ ID NO: 2 or a protein having an amino acid sequence of tyrosine 992 amino acid residues or serine 976 amino acid residues in SEQ ID NO: 42; and
(c) A reagent for detecting the biological activity of a protein having the amino acid sequence of SEQ ID NO: 2.

  TTK had kinase activity against EGFR, and its expression level and phosphorylated EGFR level (Tyr-992 or Ser-967) showed shorter tumor-specific survival. Furthermore, phosphorylation of EGFR in Tyr-992 or Ser-967 by TTK is independent of EGF stimulation. Therefore, phosphorylation of EGFR mediated by TTK is effective as a diagnostic parameter for lung cancer, such as non-small cell lung cancer.

  The present invention also provides a kit for evaluating or determining lung cancer or a predisposition to developing lung cancer in a subject, the kit comprising a reagent for detecting TTK kinase activity against EGFR. The kit is effective in the diagnosis of lung cancer, such as non-small cell lung cancer. Furthermore, the kinase activity of TTK against EGFR, such as EGFR phosphorylation by TTK independent of EGF, can also be detected using any suitable reagent.

TTK kinase activity against EGFR:
Selective phosphorylation of EGFR by TTK is demonstrated herein. Therefore, in another aspect, the present invention provides a method for measuring the kinase activity of TTK against EGFR. Such a method may include the following steps:
a. Incubating EGFR or a functional equivalent thereof and TTK under conditions suitable for EGFR phosphorylation by TTK. TTK is selected from the following group:
i. Polypeptide having the amino acid sequence of SEQ ID NO: 2 (TTK)
ii. a polypeptide in which one or more amino acids of SEQ ID NO: 2 are modified by substitution, deletion or insertion, wherein the resulting polypeptide has the amino acid sequence of SEQ ID NO: 2; A polypeptide having equivalent biological activity;
iii. A polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide having the nucleotide sequence of SEQ ID NO: 1, wherein the resulting polypeptide is the amino acid sequence of SEQ ID NO: 2. A polypeptide having biological activity equivalent to a polypeptide having
b. detecting phosphorylated EGFR levels; and
c. A step of measuring the kinase activity of TTK by correlation with the phosphorylated EGFR level detected in step (b).

In the context of the present invention, conditions suitable for EGFR phosphorylation can be provided with incubation of EGFR and TTK in the presence of a phosphate donor. In the present invention, a preferred phosphate donor is ATP. Conditions suitable for EGFR phosphorylation by TTK also include cultured cells expressing the polypeptide. For example, the cell may be a transformed cell having therein an expression vector containing a polynucleotide encoding the polypeptide. In another embodiment, the phosphorylation reaction to EGFR is kinase assay buffer (e.g. 50 mM Tris, pH7.4, 10 mM MgCl 2, 2 mM dithiothreitol, 1 mM NaF, 0.2 mM ATP) and EGFR in 60 minutes 30 ° C. in a This is done by incubating TTK. In the context of the present invention, a functional equivalent of EGFR is an EGFR fragment that may contain a TTK-mediated phosphorylation site for EGFR, Tyr992 or Ser967. For example, a fragment of EGFR can be included in the amino acid sequence of SEQ ID NO: 43.

After incubation, phosphorylated EGFR levels can be detected with antibodies that recognize phosphorylated EGFR. Prior to detection of phosphorylated EGFR, EGFR can be separated from other elements or cell lysates of EGFR expressing cells. For example, gel electrophoresis can be used to separate EGFR. Alternatively, EGFR can be captured by contacting EGFR with a carrier having an anti-EGFR antibody. When a labeled phosphate donor is used, phosphorylated EGFR levels can be detected by label tracking. For example, radiolabeled ATP (eg, ³² P-ATP) was used as a phosphate donor where the radioactivity of isolated EGFR correlates with phosphorylated EGFR levels.

  In the context of the present invention, the kinase activity of TTK in a biological sample can be assessed. For example, the biological sample of the present invention may contain cancer tissue or cancer cell lines derived from a patient. In the biological sample, TTK kinase activity is effective as a reliable marker indicating lung cancer or evaluating or determining prognosis. The present invention further provides a reagent for measuring the kinase activity of TTK against EGFR. Examples of such reagents include EGFR and phosphate donors. In the present invention, a kit for measuring the kinase activity of TTK against EGFR is also provided. The kit can include a reagent of the present invention and a detection reagent for detecting phosphorylated EGFR levels. A preferred detection reagent is an antibody that specifically recognizes phosphorylated EGFR from non-phosphorylated EGFR. For example, in the present invention, preferred antibodies recognize phosphorylated EGFR at Tyr992 or Ser967.

Diagnosis method:
The invention also provides a method of diagnosing lung cancer in a subject or predicting a predisposition to lung cancer, the method comprising determining TTK expression or EGFR phosphorylation levels in a biological sample from the subject, compared to a normal control level An increase in the level indicates that the subject has or is at risk of developing lung cancer. Any sample from the subject to be diagnosed can be used in the present invention. A preferred example used in the context of the present invention is lung tissue obtained by biopsy or surgical resection. For example, the phosphorylation site of EGFR by TTK is Tyr992 or Ser967.

  Or according to this invention, the intermediate result for investigating the state of object can be provided. Such intermediate results can be combined with further information to assist a doctor, nurse, or other health care professional in diagnosing that the subject is suffering from a disease. Furthermore, the present invention relates to a method for screening a person in need of further lung cancer diagnosis. Persons who show a positive result after screening are advised to receive further screening tests or medical treatment to see if they are truly affected by lung cancer.

  Alternatively, the present invention can be used to detect cancer cells in a subject-derived tissue and provide a doctor with information useful for diagnosing that the subject suffers from lung cancer. Thus, the present invention requires determining (eg, measuring) the level of TTK kinase activity against EGFR in a subject-derived sample. In the present invention, the lung cancer diagnosis method also includes a method for testing or detecting lung cancer. Alternatively, in the present invention, diagnosing lung cancer also refers to suspicion, risk, or possibility of lung cancer in a subject.

  The diagnostic method of the present invention includes the step of determining (eg, measuring) TTK expression. The use of the TTK gene sequence can be detected and measured using conventional techniques well known to those skilled in the art. For example, Northern blot hybridization analysis can be used to determine the expression of the TTK gene. Hybridization probes typically comprise at least 10, at least 20, at least 50, at least 100, or at least 200 consecutive nucleotides of a TTK sequence. As another example, sequences are used to construct primers that specifically replicate TTK nucleic acids, for example, in amplification-based detection methods, such as reverse transcription-based polymerase chain reaction (RT-PCR). As another example, an antibody against TTK, such as an anti-TTK polyclonal antibody or an anti-TTK monoclonal antibody, can be used in an immunoassay such as immunohistochemical analysis, Western blot analysis or ELISA.

  Alternatively, TTK expression can be detected by biological activity. For example, biological activities are cell proliferation activity as well as invasive activity and kinase activity against EGFR Tyr997 or Ser967. The method for detecting kinase activity has been described above.

  Moreover, the diagnostic method of the present invention includes a step of determining the phosphorylation level of EGFR. For example, the phosphorylation site of EGFR is Tyr992 or Ser967. Antibodies that specifically recognize phosphorylation except non-phosphorylated forms can be used in immunoassays, such as immunohistochemical analysis, Western blot or ELISA.

  The level of TTK expression or EGFR phosphorylation detected in a test cell population, such as a tissue sample from a subject, can be compared to those in a reference cell population. The reference cell population can comprise one or more cells with known comparison parameters, such as lung cancer cells or normal lung epithelial cells (non-lung cancer cells).

  Regardless of the presence or predisposition of lung cancer, the level of TTK expression or EGFR phosphorylation in the test cell population relative to the reference cell population depends on the composition of the reference cell population. For example, if the reference cell population consists of non-lung cancer cells, similarity between the test cell population and the reference cell population indicates that the test cell population is non-lung cancer. Conversely, if the reference cell population consists of lung cancer cells, the similarity in gene expression between the test cell population and the reference cell population indicates that the test cell population contains lung cancer cells.

  A TTK expression level or EGFR phosphorylation level in a test cell population is `` changed '' if it changes 1.1 fold, 1.5 fold, 2.0 fold, 5.0 fold, 10.0 fold, 10.0 fold or more from the level in the reference cell population Or “different”.

  Differential gene expression between the test cell population and the reference cell population can be normalized to a control gene, such as a housekeeping gene. For example, the control gene is known not to differ depending on the cancerous or non-cancerous state of the cell. The expression level of the control gene can thus be used to normalize signal levels in the test and reference cell populations. Exemplary control genes include, but are not limited to, β-actin, glyceraldehyde 3-phosphate dehydrogenase, and ribosomal protein P1, for example.

  The test cell population can be compared to multiple reference cell populations. Each of the plurality of reference cell populations may differ in known parameters. Thus, the test cell population is compared to a first reference cell population known to contain, for example, lung cancer cells, as well as a second reference cell population known to contain non-lung cancer cells (normal cells), for example. obtain. The test cell population can be included in a tissue or cell sample from a control known to contain or be suspected of containing lung cancer cells.

  The test cell population can be obtained from body tissue or fluid, such as biological fluid (eg blood, sputum, saliva). For example, the test cell population can be purified from lung tissue. Preferably, the test cell population comprises epithelial cells. The epithelial cells are preferably from tissues known to be or suspected of being lung cancer.

  The cells in the reference cell population are preferably of a similar tissue type as the cells in the test cell population. Depending on the situation, the reference cell population is a cell line, such as a lung cancer cell line (ie a positive control), or a normal non-lung cancer cell line (ie a negative control). Alternatively, the control cell population can be a database of molecular information obtained from cells whose parameters or conditions are known.

  The subject is preferably a mammal. Exemplary mammals include, but are not limited to, humans, non-human primates, mice, rats, dogs, cats, horses or cows.

  The present invention also provides a kit for detecting the kinase activity of TTK against EGFR. Examples of components included within the kit include EGFR, antibodies that bind to phosphorylated EGFR, such as anti-phosphorylated EGFR (Tyr992) antibody or anti-phosphorylated EGFR (Ser967) antibody, and detection labels that detect the antibody including. Antibodies that recognize phosphorylated Tyr992 or Ser967 of EGFR are commercially available. Alternatively, it is known that the antibody or a fragment containing Tyr992 or Ser967 residues can be obtained by immunization with phosphorylated EGFR at Tyr992 or Ser967.

  TTK cDNA consists of 2,984 nucleotides including the 2,571 nucleotide open reading frame defined in SEQ ID NO: 1 (GenBank Accession No. NM_003318). The open reading frame encodes a 857 amino acid protein having the amino acid sequence defined in SEQ ID NO: 2 (GenBank Accession No. NP_003309). Mps1 (TTK is its human homolog) was first discovered as a factor required for centrosome replication in the filing yeast and was subsequently shown to have an essential function in the spindle checkpoint.

Screening method:
The invention also relates to the finding that TTK has kinase activity against EGFR. For example, the phosphorylation site of EGFR by TTK is Tyr992 or Ser967, and the phosphorylation is independent of EGF. Thus, one aspect of the invention involves identifying test compounds that regulate TTK-mediated phosphorylation of EGFR. Accordingly, the present invention provides a novel method for identifying compounds that modulate the kinase activity of TTK against EGFR. For example, the present invention provides a method for identifying an agent that modulates the kinase activity of TTK against EGFR, the method comprising the following steps:
Incubating TTK with EGFR or a functional equivalent thereof selected from the group consisting of TTK and TTK in the presence of a test compound under conditions suitable for phosphorylation of EGFR by TTK:
i. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 (TTK);
ii. A polypeptide comprising an amino acid sequence in which one or more amino acids of SEQ ID NO: 2 have been substituted, deleted or inserted, and the resulting polypeptide consists of the amino acid sequence of SEQ ID NO: 2 A polypeptide having a biological activity equivalent to the polypeptide.
iii. A polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 1, wherein the resulting polypeptide is derived from the amino acid sequence of SEQ ID NO: 2. A polypeptide having a biological activity equivalent to that of the polypeptide.
b. detecting phosphorylated EGFR levels; and
c. comparing the control level with the phosphorylated EGFR level, wherein an increase or decrease in the phosphorylated EGFR level compared to the control level indicates that the test compound modifies TTK kinase activity against EGFR.

  Agents identified by this method constitute candidate compounds that can delay or inhibit the progression of lung cancer, for example, by inhibiting TTK-mediated phosphorylation of EGFR. Thus, the present invention provides a method of screening for compounds that modify TTK kinase activity against EGFR, such as phosphorylation of EGFR by TTK, independent of EGF. For example, the phosphorylation site of EGFR is Tyr992 or Ser967. The above method comprises contacting a functional equivalent having kinase activity against TTK or EGFR with a functional equivalent capable of phosphorylation by EGFR or TTK with one or more candidate compounds to reduce phosphorylated EGFR levels. It is implemented by evaluating. For example, a functional equivalent of EGFR capable of phosphorylation by TTK may comprise a TTK-mediated phosphorylation site of EGFR, Tyr992 or Ser967. More preferably, the fragment of EGFR can comprise the 889 amino acid to 1045 amino acid region of SEQ ID NO: 42. Compounds that modulate EGFR phosphorylation by TTK or functional equivalents are thereby identified.

Accordingly, the present invention also provides a method for screening a compound for treating and / or preventing lung cancer, comprising the following steps:
a. identifying a test compound that modifies the kinase activity of TTK against EGFR by the method described above; and
b. selecting a compound that reduces phosphorylated EGFR levels relative to a control level.

Another aspect of the invention also provides a kit for detecting the ability of a test compound to modulate TTK kinase activity against EGFR. Such a kit can include the following components:
A) a polypeptide selected from the group consisting of:
i. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 (TTK);
ii. A polypeptide comprising an amino acid sequence in which one or more amino acids of SEQ ID NO: 2 have been substituted, deleted or inserted, and the resulting polypeptide consists of the amino acid sequence of SEQ ID NO: 2 A polypeptide having a biological activity equivalent to the polypeptide.
iii. A polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polypeptide having the nucleic acid sequence of SEQ ID NO: 1, wherein the resulting polypeptide is derived from the amino acid sequence of SEQ ID NO: 2. A polypeptide having a biological activity equivalent to the polypeptide comprising; and
B) EGFR or its functional equivalent:
C) Reagent for detecting phosphorylated EGFR

Furthermore, this invention also provides a kit for detecting the ability of a test compound to modify TTK kinase activity against EGFR. Such a kit can include the following components:
A) Cells expressing a polypeptide selected from the group consisting of EGFR or a functional equivalent thereof and:
i. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 (TTK);
ii. A polypeptide comprising the amino acid sequence of SEQ ID NO: 2, wherein one or more amino acids of SEQ ID NO: 2 are substituted, deleted or inserted, wherein the resulting polypeptide is SEQ ID NO: A polypeptide having a biological activity equivalent to a polypeptide consisting of two amino acid sequences.
iii. A polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polypeptide having the nucleic acid sequence of SEQ ID NO: 1, wherein the resulting polypeptide is derived from the amino acid sequence of SEQ ID NO: 2. A polypeptide having a biological activity equivalent to the polypeptide comprising; and
B) Reagent for detecting phosphorylated EGFR.

  In the present invention, the functional equivalent of EGFR is a fragment consisting of the amino acid sequence of SEQ ID NO: 43. Furthermore, the kit can further comprise a phosphate donor. A preferred phosphate donor is ATP. The reagent for detection in the kit of the present invention may also contain an antibody that recognizes phosphorylated Tyr992 or Ser967 of EGFR as a reagent for detecting phosphorylated EGFR.

  The present invention further provides a composition for treating or preventing lung cancer. The composition comprises a pharmaceutically effective amount of a compound that decreases TTK kinase activity against EGFR and a pharmaceutically acceptable carrier. As mentioned above, in the context of the present invention, the term “functional equivalent” means that the protein of interest retains the biological activity of the native protein. In this case, it is EGFR kinase activity. Whether or not the protein of interest has a target activity can be determined according to the present invention. For example, EGFR kinase activity can be detected by incubating with a polypeptide under conditions suitable for EGFR phosphorylation and detecting phosphorylated EGFR levels. For example, phosphorylation of EGFR by TTK is Tyr992 or Ser967.

  Methods for preparing proteins that are functionally equivalent to a given protein are well known to those of skill in the art and include conventional methods for introducing mutations into proteins. For example, those skilled in the art can prepare proteins functionally equivalent to human TTK protein by introducing appropriate mutations into the amino acid sequence of human TTK protein via site-specific mutation (Hashimoto-Gotoh, T. et al. (1995), Gene 152, 271-5; Zoller, MJ, and Smith, M. (1983), Methods Enzymol. 100, 468-500; Kramer, W. et al. (1984), Nucleic Acids Res. 12, 9441-56; Kramer W, and Fritz HJ. (1987) Methods. Enzymol. 154, 350-67; Kunkel, TA (1985), Proc. Natl. Acad. Sci. USA. 82, 488-92; Kunkel (1991 ), Methods Enzymol. 204, 125-39). Amino acid mutations may occur in nature. Proteins suitable for use in the context of the present invention include proteins having the amino acid sequence of human TTK protein with one or more amino acids mutated, and the resulting mutant protein is functionally equivalent to human TTK protein. It is. The number of amino acids mutated in such variants is usually 25 amino acids or less, preferably 10 to 15 amino acids or less, more preferably 5 to 6 amino acids or less, and even more preferably 2 to 3 amino acids or less. In order to maintain the kinase activity against EGFR, it is preferable to preserve the kinase domain in the amino acid sequence of the mutant protein. For example, the TTK Asp647 cannot be altered to maintain the kinase domain of TTK.

  Mutated or modified proteins, proteins with amino acid sequences modified by substitution, deletion or insertion of one or more amino acid residues of an amino acid sequence are known to retain their original biological activity (Mark, DF et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-6, Zoller, MJ & Smith, M., Nucleic Acids Research (1982) 10, 6487-500, Wang, A et al., Science (1984) 224, 1431-3, Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-13).

  The amino acid residue to be mutated is preferably mutated to another amino acid that preserves the properties of the amino acid side chain (a method known as “conservative amino acid substitution”). Typical amino acid side chain properties are hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G , H, K, S, T) and side groups having the following functional groups or common characteristics: aliphatic side chains (G, A, V, L, I, P); side chains containing hydroxyl groups (S , T, Y); side chains containing sulfur atoms (C, M); side chains containing carboxylic acids and amides (D, N, E, Q); side chains containing bases (R, K, H); and Side chains containing aromatic functional groups (H, F, Y, W). Note that the inserted letter indicates the single letter code for the amino acid.

  An example of a protein in which one or more amino acid residues are inserted or added to the amino acid sequence of human TTK protein (SEQ ID NO: 2) is a fusion protein comprising human TTK protein. Fusion proteins suitable for use in the context of the present invention include, for example, fusions of human TTK protein and other peptides or proteins. For the fusion protein, using techniques well known to those skilled in the art, for example, a DNA encoding another peptide or protein and a DNA encoding the human TTK protein of the present invention are combined in frame, and the fusion DNA is converted into an expression vector. It can be produced by inserting and expressing in a host. The peptide or protein fused to the protein of the present invention is not limited.

  Known peptides that can be used as peptides to be fused with the TTK protein include, for example, FLAG (Hopp, TP et al., (1988) Biotechnology 6, 1204-10), 6xHis containing 6 His (histidine) residues. , 10xHis, influenza agglutinin (HA), human c-mys fragment, VSP-GP fragment, p18HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen fragment, lck tag, α-tubulin fragment, B- Tags, protein C fragments, etc. are included. Examples of proteins that can be fused with the protein of the present invention include GST (glutathione-S-transferase), influenza agglutinin (HA), immunoglobulin constant region, β-galactosidase, MBP (maltose binding protein) and the like.

  The fusion protein can be prepared by fusing a commercially available DNA encoding the above-mentioned fusion peptide or protein with the DNA encoding the protein of the present invention and expressing the prepared fusion DNA.

  Alternative methods known in the art for isolating functionally equivalent proteins are, for example, those using hybridization techniques (Sambrook, J. et al., (1989) Molecular Cloning 2nd ed. 9.47. -9.58, Cold Spring Harbor Lab. Press). One skilled in the art can readily isolate DNA having high homology to all or part of a TTK DNA sequence encoding a TTK protein (eg, SEQ ID NO: 1) Can be used to isolate a protein functionally equivalent to human TTK protein. Proteins used in the present invention include proteins encoded by DNA that hybridizes with all or part of the DNA sequence encoding human TTK protein, and proteins that are functionally equivalent to human TTK protein. included. These proteins include mammalian homologues (eg, proteins encoded by monkey, mouse, rabbit and bovine genes) corresponding to proteins derived from humans or rats. When isolating a cDNA having high homology to DNA encoding human TTK protein from an animal, it is particularly preferable to use a tissue derived from testis or lung cancer.

  Hybridization conditions for isolating DNA encoding a functionally equivalent protein of the human TTK protein can be routinely selected by those skilled in the art. For example, pre-hybridization at 68 ° C for 30 minutes or more using “Rapid-hyb buffer” (Amersham Life Sciences), adding a labeled probe, and heating at 68 ° C for 1 hour or more Hybridization can be performed. The subsequent washing step can be performed, for example, under low stringent conditions. Typical low stringency conditions are, for example, 42 ° C, 2x SSC, 0.1% SDS, or preferably 50 ° C, 2x SSC, 0.1% SDS. It is more preferable to use highly stringent conditions. Typical high stringency conditions include, for example, three 20 minute washes with 2x SSC, 0.01% SDS at room temperature, followed by a 20 minute wash with 1x SSC, 0.1% SDS at 37 ° C 3 And two 20 minute washes with 1x SSC, 0.1% SDS at 50 ° C. However, some factors, such as temperature and salt concentration, can affect the stringency of hybridization, and those skilled in the art will routinely adequately determine the factors to achieve the required stringency. You can choose appropriately.

  Instead of hybridization, gene amplification methods such as polymerase chain reaction (PCR) are used, based on the sequence information of the DNA encoding human TTK protein (SEQ ID NO: 2) (SEQ ID NO: 1) Using the synthesized primers, DNA encoding a protein functionally equivalent to the human TTK protein can be isolated.

  A protein functionally equivalent to a human TTK protein encoded by DNA isolated through the above hybridization technique or gene amplification technique usually has high homology to the amino acid sequence of the human TTK protein. In the context of the present invention, the term “high homology” refers to a homology of 40% or more, preferably 60% or more, more preferably 80% or more, even more preferably 95% or more. Protein homology can be determined according to the algorithm in “Wilbur, W. J. and Lipman, D. J. (1983) Proc. Natl. Acad. Sci. USA 80, 726-30”.

  Proteins useful in the context of the present invention change in amino acid sequence, molecular weight, isoelectric point, presence or absence of sugar chains, or shape depending on the cell or host used to produce it or the purification method utilized. You may have. Needless to say, as long as it is a functional equivalent of the human TTK protein (SEQ ID NO: 2), it is effective in the context of the present invention.

  Proteins useful in the context of the present invention can be prepared as recombinant or natural proteins by methods well known to those skilled in the art. The recombinant protein can be prepared, for example, by the following steps: inserting DNA encoding the protein of the present invention (eg, DNA having the nucleic acid sequence of SEQ ID NO: 1) into an appropriate expression vector; Introducing into an appropriate host cell; obtaining the extract; chromatography using the column on which the extract is chromatographed, for example, ion exchange chromatography, reverse phase chromatography, gel filtration or an antibody against the protein of the present invention. A step of purifying a protein by subjecting it to chromatography or combining two or more of the above-mentioned columns.

  In addition, proteins useful in the context of the present invention are expressed in host cells (eg, animal cells and E. coli) as fusion proteins with glutathione-S-transferase proteins or as recombinant proteins supplemented with multiple histidines. In some cases, the expressed recombinant protein can be purified using a glutathione column or a nickel column.

  After purification of the fusion protein, the region other than the target protein can be removed by cleaving with thrombin or factor Xa as necessary.

  The natural protein is isolated by a method known to those skilled in the art, for example, by contacting an extract of a tissue or cell that expresses the protein of the present invention with an affinity column bound with an antibody that binds to the TTK protein described below. Is possible. The antibody can be a polyclonal antibody or a monoclonal antibody.

In the present invention, the kinase activity of TTK or its functional equivalent can be determined by methods known in the art. For example, TTK and EGFR can be incubated with ATP under appropriate assay conditions for phosphorylation of EGFR by TTK. In the present invention, typical conditions for phosphorylation of EGFR include contacting EGFR or cell extract with TTK, and incubating them. In the present invention, EGFR phosphorylation conditions are provided by incubation of EGFR and TTK in the presence of a phosphate donor. ATP is an example of a suitable phosphate donor. For example, radiolabeled ATP can be a phosphate donor. Increased radiolabeled EGFR can be detected by any suitable method. For example, in a radioactive assay, radiolabeled EGFR is detected with a scintillation counter. On the other hand, in non-radioactive assays, phosphorylated EGFR is detected using an antibody that binds to phosphorylated EGFR, such as Western blot assay or ELISA. For example, suitable conditions for phosphorylation of EGFR by TTK are described below:
Reaction mixture:
50 mM Tris-HCl (pH 7.4),
10 mM MgCl ₂ ,
2 mM dithiothreitol,
1 mM NaF,
0.2 mM ATP

  The reaction mixture is mixed with the sample containing the identified TTK and incubated at 30 ° C. for 60 minutes. The reaction was stopped by adding Laemmli sample buffer and heating at 95 ° C. for 5 minutes. Proteins were separated by Western blot using SDS-PAGE followed by antibody binding to phosphorylated EGFR.

  Alternatively, the kinase activity of TTK against EGFR can be assessed based on radiolabeled EGFR by a scintillation counter. Phosphorylated EGFR can be detected by antibody-based detection systems such as ELISA or Western blot assays. Alternatively, phosphorylated EGFR can be detected by mass spectrometry, such as MALDI-TOF-MS. For example, the phosphorylation site of EGFR by TTK is Tyr992 or Ser967. The kinase activity of TTK against EGFR in Tyr992 or Ser967 can be detected using an antibody specific for phosphorylated EGFR (Tyr992 or Ser967).

A variety of low-throughput and high-throughput enzyme assay formats are known in the art and can be readily adapted for detection or measurement of the level of EGFR phosphorylation by TTK. For high-throughput assays, EGFR is preferably immobilized on a solid support such as a multiwell plate, slide or chip. After the reaction, phosphorylated EGFR can be detected on the solid support by the method described above. In order to detect phosphorylated EGFR, for example, an antibody that binds to phosphorylated EGFR can be used. For example, the phosphorylation site of EGFR by TTK is Tyr992 or Ser967. EGFR phosphorylation at Tyr992 or Ser967 by TTK can be detected using specific antibodies against phosphorylated EGFR (Tyr992 or Ser967). Alternatively, it is possible to use a P ³² labeled ATP as a phosphate donor. Phosphorylated EGFR can be tracked by radioactive P ^32. To facilitate such an assay, the solid support can be coated with streptavidin and EGFR labeled with biotin. One skilled in the art can determine an appropriate assay format based on the desired throughput capability of the screen.

  Optional test compounds include, for example, cell extracts, cell culture supernatants, products of microbial fermentation, extracts from marine organisms, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic low molecular compounds and natural Although it contains a compound, it is not limited to this, and can be used in the screening method of the present invention. The test compounds of the present invention are: (1) a biological library, (2) a parallel solid-phase or liquid-phase library that can be handled spatially, and (3) a synthetic library method that requires deconvolution. Using any of a number of approaches in combinatorial library methods known in the art, including (4) “one bead one compound” library method, and (5) synthetic library method using affinity chromatography selection Can also be obtained. Biological library methods using affinity chromatography selection are limited to peptide libraries, but the other four approaches are applicable to peptide, non-peptide oligomer, or small molecule libraries of compounds (Lam ( 1997) Anticancer Drug Des. 12: 145-67). Examples of methods for synthesizing molecular libraries can be found in the art (DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6909-13; Erb et al. (1994) Proc Natl. Acad. Sci. USA 91: 11422-6; Zuckermann et al. (1994) J. Med. Chem. 37: 2678-85; Cho et al. (1993) Science 261: 1303-5; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2061; Gallop et al. (1994) J. Med. Chem. 37: 1233-51.). The library of compounds may be presented in solution (Houghten (1992) Bio / Techniques 13: 412-21.) Or beads (see Lam (1991) Nature 354: 82-4.) And chips (Fodor (1993) Nature 364: 555-6.), Bacteria (US Pat.No. 5,223,409), spores (US Pat.No. 5,571,698; 5,403,484, and 5,223,409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1865-9.) Or phage (Scott and Smith (1990) Science 249: 386-90 .; Devlin (1990) Science 249: 404-6 .; Cwirla et al. (1990) Proc Natl. Acad. Sci. USA 87: 6378-78 .; Felici (1991) J. Mol. Biol. 222: 301-10 .; US patent application 2002103360).

  The compound identified by the screening method of the present invention is a candidate for drug development that inhibits the kinase activity of TTK against EGFR, and can be applied to the treatment or prevention of lung cancer. In particular, the kinase activity of TTK against EGFR is EGF-dependent. Alternatively, the phosphorylation site of EGFR is Tyr992 or Ser967.

  Furthermore, a compound obtained by converting a part of the structure of a compound that inhibits the kinase activity of TTK against EGFR by addition, deletion and / or substitution is also included in the compound obtained by the screening method of the present invention.

Treatment and prevention of lung cancer:
The present invention provides a composition for treating or preventing lung cancer comprising any of the compounds selected by the screening method of the present invention.

  When administering a compound identified by the method of the present invention as a medicament for humans and other mammals such as mice, rats, guinea pigs, rabbits, cats, dogs, sheep, pigs, cows, monkeys, baboons, and chimpanzees The identified compounds can be administered directly or in dosage forms using conventional pharmaceutical preparation methods. For example, if desired, the drug may be injected orally as sugar-coated tablets, capsules, elixirs and microcapsules, or parenterally in sterile liquid or sterile suspension of water or any other liquid pharmaceutically acceptable Can be taken. For example, the compound may be administered in a pharmaceutically acceptable carrier or culture medium, particularly sterile water, physiological saline, vegetable oil, emulsifier, Can be mixed with suspending agents, surfactants, stabilizers, fragrances, excipients, solvents, preservatives, binders, and others. The amount of the active ingredient in these preparations should be an appropriate dose within the indicated range.

  Examples of additives that can be mixed to form tablets and capsules include, for example, binders such as gelatin, corn starch, gum tragacanth and gum arabic, excipients such as crystalline cellulose, swelling such as corn starch, ceratin and alginic acid Agents, lubricating oils such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, and flavorings such as peppermint, red oil and cherries. Where the unit dosage form is a capsule, a liquid carrier such as oil can also be included in the above ingredients. Sterile mixtures for injection can be prepared in conventional drug embodiments using a solvent such as distilled water used for injection.

  Other isotonic solutions, including saline, glucose, and adjuvants such as D-sorbitol, D-mannose, D-mannitol and sodium chloride can be used as an aqueous solution for injection. These can be used in combination with suitable solubilizers such as alcohols, especially polyalcohols such as ethanol, propylene glycol and polyethylene glycol, polysorbate 80 ™ and nonionic active agents such as HCO-50.

  Sesame oil and soybean oil are examples of suitable oily liquids that can be used in combination with benzyl benzoate or benzyl alcohol as solubilizers, buffers such as phosphate buffer or sodium acetate buffer, hydrochloric acid It may be formulated with an analgesic such as procaine, a stabilizer such as benzyl alcohol or phenol, and an antioxidant. The prepared injection may be filled into a suitable ampoule.

  Methods known to those skilled in the art can be used to administer the pharmaceutical composition of the present invention to a subject. For example, intraarterial injection, intravenous injection, or transdermal injection, and intranasal administration, transbronchial administration, intramuscular administration, or buccal administration. The dosage and method can vary depending on the weight and age of the subject and the chosen method of administration. However, those skilled in the art can routinely select appropriate administration methods and dosages. If the compound can be encoded by DNA, the DNA can be inserted into a vector for gene therapy, and the vector can be administered to a subject for treatment. The dosage and method may also vary depending on the subject's weight, age, and symptoms. However, those skilled in the art can optimally select them.

  For example, the dose of the compound that binds to TTK and modulates its activity depends on the symptoms, but when administered orally to a normal adult (body weight 60 kg), an appropriate dose is generally about 0.1 mg to about 100 mg per day. Preferably about 1.0 mg to about 50 mg per day, more preferably about 1.0 mg to about 20 mg per day.

  When administered parenterally, normal adults (60 kg body weight) will be injected into normal adults (body weight 60 kg), depending on the subject, target organ, symptoms and method of administration, but about 0.01 to 30 mg per day, preferably about 0.1 to about 20 mg per day And, more preferably, an intravenous injection of about 0.1 to 10 mg per day is convenient. In the case of other animals, it is possible to administer an amount converted to a body weight of 60 kg.

  In another embodiment, the invention includes a pharmaceutical composition or therapeutic composition comprising one or more therapeutic compounds described herein. The pharmaceutical formulation is suitable for oral, rectal, nasal, topical (including buccal and sublingual), vaginal or parenteral (including intramuscular, subcutaneous and intravenous) administration, or administration by inhalation or gas infusion Can be included. The formulations can be conveniently presented and prepared in individual doses as required by any of the methods used in the prior art of pharmacy. All pharmaceutical methods herein include the step of bringing into association the active compound with liquid carriers or finely divided solid carriers, optionally both, and if necessary, shaping the product into the desired formulation. .

  Pharmaceutical formulations suitable for oral administration can conveniently be presented as discrete units, such as capsules, cachets or tablets, each as an active ingredient as a powder or granule, as a solution, suspension, or emulsion. Of a predetermined amount. The active ingredient is also presented as a bolus, electuary or paste and can be present in pure form, ie without a carrier. Tablets and capsules for oral administration can contain conventional excipients such as binders, fillers, lubricants, disintegrants, or wetting agents. A tablet may be made by compression or molding, optionally with one or more formulation ingredients. Compressed tablets are optionally mixed with binders, lubricants, inert diluents, lubricants, surfactants or dispersants, and the active ingredient is compressed with a suitable machine, eg in a free-flowing form such as powders or granules You may prepare by. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods known in the art. Oral fluid preparations exist, for example, in the form of aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or are dry products that are composed with water or other suitable solvent prior to use. Can be presented as: Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous solvents (which may include edible oils) or preservatives. Furthermore, the tablets can optionally be prepared so as to provide a slow or controlled release of the active ingredient therein.

  Formulations for parenteral administration include aqueous and non-aqueous sterile injectable solutions that may contain antioxidants, buffers, bacteriostats, and solutes that make the target recipient's blood and formulation isotonic, and Aqueous and non-aqueous sterile suspensions are included which may include suspending and thickening agents. The formulation may be provided in unit-dose containers or multi-dose containers, such as sealed ampoules and vials, only added immediately prior to use of a sterile liquid carrier such as saline, water for injection. It may be stored in the necessary freeze-dried (freeze-dried) state. Alternatively, the formulation may be provided for continuous infusion. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

  Formulations for rectal administration may be presented as suppositories with standard carriers such as cocoa butter or polyethylene glycol. Formulations for topical administration in the mouth, such as in the mouth or sublingual, include sucrose, medicinal candy containing the active ingredient in a flavored base such as acacia or tragacanth, and gelatin and glycerin, or sucrose and acacia A lozenge containing the active ingredient in a base such as For intranasal administration of the active ingredients, the compounds of the invention can be used in the form of liquid sprays or dispersible powders or drops. Drops may be formulated with an aqueous or non-aqueous base which also contains one or more dispersants, solubilizers or suspending agents. Liquid sprays may be conveniently delivered from pressurized packs.

  For administration by inhalation, the compounds of the invention are conveniently delivered from any convenient method of delivering an inhaler, nebulizer, pressurized pack or other aerosol spray. The pressurized pack may contain a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve that delivers a fixed amount.

  Alternatively, for administration by inhalation or insufflation, the compounds of the invention may take the form of a dry powder composition, for example a mixed powder of the compound and a suitable powder base such as lactose or starch. Powder compositions may be provided in unit dosage forms, such as capsules, cartridges, gelatin or blister packs, from which powders can be administered with the aid of an inhaler or inhaler.

  If desired, the above formulations may be adapted and used to provide sustained release of the active ingredient. The pharmaceutical composition of the present invention may also contain other active ingredients such as antibacterial substances, immunosuppressants or preservatives.

  In addition to the ingredients specifically mentioned above, the formulations of the present invention may contain other drugs customary in the art in view of the type of formulation concerned, e.g. formulations suitable for oral administration are taste-masked It should be understood that an agent may be included.

  Preferred unit dosage formulations are those containing an effective amount of the active ingredients described below or an appropriate fraction thereof.

  For each of the aforementioned conditions, the composition can be administered orally or by injection in a dosage range of about 0.1 to about 250 mg / kg daily. The dosage range for human adults is usually about 5 mg to about 17.5 g per day, preferably about 5 mg to about 10 g per day, and most preferably about 100 mg to about 3 g per day. Presented tablets or other unit dosage forms provided in separate units conveniently contain such doses or amounts effective as multiples thereof, e.g., units comprising about 5 mg to about 500 mg, usually about 100 mg to about 500 mg. Can be included.

  The pharmaceutical composition is preferably administered orally or by injection (intravenous or subcutaneous), and the precise amount administered to the subject is the responsibility of the attending physician. However, the dose used will depend on many factors, including the age of the subject, sex, the exact disease being treated, and its severity. In addition, the route of administration can vary depending on the condition and its severity.

Diagnosing Lung Cancer Metastasis The present invention is based in part on the discovery of various amino acid substitutions in the kinase domain of TTK, particularly mutations that promoted TTK kinase activity and its ability to infiltrate. In view of the evidence provided herein that one or more amino acid substitutions in the kinase domain of TTK are associated with lung cancer metastasis, the present invention provides a method for predicting lung cancer metastasis. An example of the method includes the following steps: detecting one or more mutations in the kinase domain of TTK. If a mutation is detected, it indicates a high risk of lung cancer metastasis. In the context of the present invention, one or more amino acid substitutions in the kinase domain of TTK are: valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2, glutamine to histidine at codon 753 (Q753H) and tyrosine at codon 574. To cysteine (Y574C). Detection can be accomplished by sequencing, mini-sequencing, hybridization, restriction fragment analysis, oligonucleotide ligation assays or allele specific PCR.

Herein, it is shown that the presence of previously unknown TTK mutations correlates with a high risk of lung cancer metastasis. Based on this finding, the present invention also provides methods and reagents for the detection of the TTK mutation. For example, the invention provides a method for detecting one or more mutations in TTK, the mutations comprising at least valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2 and glutamine to histidine at codon 753 (Q753H). And selected from the group consisting of tyrosine to cysteine (Y574C) at codon 574. The method of the present invention comprises the following steps:
a) contacting the polypeptide of interest or cDNA encoding the polypeptide with a binding reagent that recognizes any one of the mutations of the polypeptide or cDNA encoding the polypeptide,
b) detecting the polypeptide or cDNA encoding it and a binding reagent; and
c) A step showing TTK mutation when binding of the drug in step b) is detected.

  In the present invention, a binding reagent that recognizes any one of the polypeptide mutations is preferably valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2, glutamine to histidine (Q753H) at codon 753, and the codon An antibody that binds to a polypeptide having at least one mutation selected from the group consisting of tyrosine to cysteine (Y574C) at 574 and does not substantially bind to the polypeptide of SEQ ID NO: 2. Furthermore, the antibody may be a monoclonal or polyclonal antibody, or a fragment thereof comprising an antigen binding region. In the present invention, the antibody can be obtained by a conventional method of immunization of an immunologically active fragment containing a TTK polypeptide or a mutation thereof. Alternatively, screening of antibody variable regions that recognize TTK mutations from antibody libraries can be performed using TTK mutants as antigens.

  In the present invention, preferred antibodies specifically recognize TTK variants. The antibody is applied as a TTK mutation-specific antibody. Alternatively, in the present invention, preferred TTK mutation-specific antibodies do not substantially bind to the polypeptide of SEQ ID NO: 2. In the context of the present invention, an antibody that does not substantially bind to the TTK wild type having the amino acid sequence of SEQ ID NO: 2 is generally less than 30% reactive with the TTK wild type compared to the TTK mutation. Preferably 20% or less, more preferably 10% or less.

  In the present invention, the TTK mutation is selected from the group consisting of valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2, glutamine to histidine (Q753H) at codon 753, and tyrosine to cysteine (Y574C) at codon 574. Contains at least one mutation. Such mutants can be prepared by conventional methods for introducing site-specific mutations into proteins. For example, those skilled in the art can prepare proteins having mutations by introducing site-specific mutations into the amino acid sequence of human TTK protein via site-directed mutagenesis (Hashimoto-Gotoh, T. et al. 1995), Gene 152, 271-5; Zoller, MJ, and Smith, M. (1983), Methods Enzymol. 100, 468-500; Kramer, W. et al. (1984), Nucleic Acids Res. 12, 9441 -56; Kramer W, and Fritz HJ. (1987) Methods. Enzymol. 154, 350-67; Kunkel, TA (1985), Proc. Natl. Acad. Sci. USA. 82, 488-92; Kunkel (1991) , Methods Enzymol. 204, 125-39).

  In the present invention, the TTK mutation can also be detected by measuring the nucleic acid sequence of the DNA encoding the TTK mutant. For example, primers or probes that anneal to the cDNA (or mRNA) of a region include valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2, glutamine to histidine (Q753H) at codon 753, tyrosine to cysteine at codon 574 ( Y574C).

  Furthermore, the present invention also provides a reagent for detecting one or more mutations in TTK. The mutation is at least one mutation selected from the group consisting of valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2, glutamine to histidine (Q753H) at codon 753, and tyrosine to cysteine at codon 574 (Y574C). Yes, the reagent comprises a binding agent that recognizes either one of the polypeptide or the mutation of the cDNA encoding it.

  In addition, a polynucleotide encoding a TTK mutation containing a mutation site or a fragment thereof is effective as a control sample for detecting the mutation. Accordingly, the present invention provides a nucleotide sequence of SEQ ID NO: 1 comprising one or more mutations selected from the group consisting of A1870G (for Y574C), G1977T (for V610F), and G2408C (for Q753H). An isolated polynucleotide having, or a fragment thereof comprising one or more mutations is provided. For example, in mutation detection using a hybridization technique, a TTK mutation polynucleotide can be used as a positive control. In the present invention, any fragment of a TTK variant polynucleotide can be used as the control as long as it does not contain at least one mutation. The preferred length of the TTK variant polynucleotide fragment is usually 25 bases or more, 50 bases or more, 100 bases or more, and more preferably 200 bases or more.

  Polypeptides encoding TTK variants or fragments thereof containing mutation sites are also useful as control samples for mutation detection. Accordingly, the present invention relates to an isolated polypeptide having the amino acid sequence of SEQ ID NO: 2, or one or more of one or more mutations selected from the group consisting of V610F, Q753H and Y574C A fragment thereof containing the mutation is provided. For example, in mutation detection using an immunoassay technique, a polypeptide of a TTK variant can be used as a positive control. In the present invention, any fragment of a TTK variant polypeptide can be used as such a control as long as it does not contain at least one mutation. Variants of TTK polypeptides can also be detected by molecular mass analysis of whole peptides or fragments thereof. For example, a preferred technique for molecular mass spectrometry is MALDI-TOF MS. The length of the TTK variant polypeptide fragment is usually 10 amino acid residues or more, preferably 20 amino acid residues or more, or 50 amino acid residues or more, and more preferably 100 amino acid residues or more.

The present invention relates to an inhibitory polypeptide comprising ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46). In a preferred embodiment, the inhibitory polypeptide is ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46), a polypeptide functionally equivalent to the polypeptide, or against EGFR A polynucleotide encoding a polypeptide lacking TTK kinase activity is included. It is a novel finding according to the present invention that EGFR fragments inhibit lung cancer cell growth.

  A polypeptide comprising a selected amino acid sequence of the present invention, wherein the polypeptide comprises ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46), and cancer cells Any length is possible as long as it inhibits growth. For example, the length of the amino acid sequence can range from 19 to 76 residues, preferably 19 to 57 residues, and even more preferably 19 to 38 residues.

  The polypeptides of the present invention can comprise two or more “selected amino acid sequences”. Two or more “selected amino acid sequences” may be the same or different amino acid sequences. Furthermore, the “selected amino acid sequences” can be linked directly. Alternatively, they can be arranged with any intervening sequence among them.

  Furthermore, the present invention relates to polypeptides homologous to ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) polypeptides specifically disclosed herein (ie, sequence homology). Share sex). In the present invention, a polypeptide homologous to the ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) polypeptide is the addition of one or more amino acid residues, It includes any mutation selected from deletions, substitutions and insertions, and is a functional equivalent. The term “functional equivalent” refers to having a function of inhibiting TTK kinase activity against EGFR and a function of inhibiting cell proliferation. Therefore, in the present invention, a polypeptide functionally equivalent to the ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) peptide is ISSILEKGERLPQPPICTI (SEQ ID NO: 44). Alternatively, it is preferable to have an amino acid mutation at a site other than the DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) sequence. The amino acid sequence of a polypeptide functionally equivalent to ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) peptide in the present invention is ISSILEKGERLPQPPICTI (SEQ ID NO: 44). ) Or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) sequences are conserved, 60% or more, usually 70% or more, preferably 80% or more, more preferably 90% or more, or 95 % Or more, and even more preferably 98% or more have homology to the “selected amino acid sequence”. Amino acid sequence homology can be measured using known art algorithms such as the default BLAST or ALIGN set.

The polypeptides of the present invention can be chemically synthesized from any position based on the selected amino acid sequence. Methods used in conventional peptide chemistry can be used for polypeptide synthesis methods. In particular, the methods include those described in the following documents and Japanese patent publications:
Peptide Synthesis, Interscience, New York, 1966; The Proteins, Vol. 2, Academic Press Inc., New York, 1976;
Peptide Synthesis, Maruzen (Inc.), 1975;
Fundamental and Experimental Peptide Synthesis, Maruzen (Inc.), 1985;
Development of Pharmaceuticals, Vol. 14: Peptide Synthesis, Hirokawa Shoten, 1991;
International Publication WO99 / 67288.

  The polypeptides of the present invention can also be synthesized by known genetic engineering techniques. Examples of genetic engineering techniques are as follows. In particular, DNA encoding the desired peptide is introduced into a suitable host cell from which transformed cells are prepared. The polypeptide of the present invention can be obtained by recovering the polypeptide produced by this transformed cell. Alternatively, the desired polypeptide can be synthesized in vitro using an in vitro translation system in which the elements necessary for protein synthesis are reconstituted.

When genetic engineering techniques are used, the polypeptide of the present invention can be expressed as a fusion protein having peptides having different amino acid sequences. A vector that expresses the desired fusion protein is ligated with a polynucleotide encoding a different peptide from the polynucleotide encoding the polypeptide of the present invention so that they are in the same reading frame, and then the resulting nucleotide. It can be obtained by introducing it into an expression vector. The fusion protein is expressed by transforming a suitable host with the resulting vector. Different peptides used in the fusion protein formed include the following peptides:
FLAG (Hopp et al., (1988) BioTechnology 6, 1204-10),
6xHis, 10xHis, consisting of 6 His (histidine) residues
Influenza hemagglutinin (HA),
Human c-myc fragment,
VSV-GP fragment,
p18 HIV fragment,
T7-tag,
HSV-tag,
E-tag,
SV40T antigen fragment,
lck tag,
a-tubulin fragment,
B-tag,
Protein C fragment,
GST (glutathione-S-transferase),
HA (influenza hemagglutinin),
Immunoglobulin constant region,
a-galactosidase, and
MBP (maltose binding protein).

  The polypeptide of the present invention can be obtained by treating a fusion protein produced using an appropriate protease and then recovering the desired polypeptide. To purify the polypeptide, the fusion protein can be pre-captured using affinity chromatography that binds to the fusion protein, and then the captured fusion protein can be protease treated. Using protease treatment, the desired polypeptide is separated from the affinity chromatography and the high purity desired polypeptide is recovered.

  The polypeptides of the present invention include modified polypeptides. In the present invention, the term “modified” means, for example, binding to another substrate. Therefore, in the present invention, the polypeptide of the present invention may further contain another substrate such as a cell membrane permeable substance. Other substrates include organic compounds such as peptides, lipids, saccharides, and various natural or synthetic polymers. The polypeptides of the present invention can have any modification as long as the polypeptides retain the desired activity of inhibiting TTK kinase activity against EGFR. In certain embodiments, the inhibitory polypeptide may compete directly with EGFR that binds to TTK. Modifications can also provide additional functions in the polypeptides of the invention. Examples of additional functions include targeting, transportability, and stabilization.

  In the present invention, a preferable example of modification includes introduction of a cell membrane permeable substance, for example. Usually, intracellular structures are separated from the outside by cell membranes. Therefore, it is difficult to efficiently introduce the extracellular matrix into the cell. Cell membrane permeability is imparted to the polypeptides of the present invention by modifying the polypeptide with a cell membrane permeable substance. As a result, by contacting a cell with a polypeptide of the invention, the polypeptide can be delivered into the cell to act there.

“Cell membrane permeable substance” refers to a substrate that can permeate mammalian cell membranes to enter the cytoplasm. For example, certain liposomes fuse with the cell membrane to release the contents into the cell. On the other hand, certain types of polypeptides penetrate into the cytoplasmic membrane of mammalian cells as they enter the cell. In contrast to the polypeptide having the activity of entering such cells, the cytoplasmic membrane and the like are preferred as a substrate in the present invention. In particular, the present invention includes polypeptides having the general formula:
[R]-[D];
[R] represents a cell membrane permeable substance; [D] represents a fragment sequence containing ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46). In the above general formula, [R] and [D] can be directly or indirectly linked by a linker. Peptides, compounds with multiple functional groups, or others can be used as linkers. In particular, an amino acid sequence comprising -GGG- can be used as a linker. Alternatively, a cell membrane permeable substance and a polypeptide comprising a selected sequence can be bound to the surface of the microparticle. [R] can be linked at any position of [D]. In particular, [R] can be linked to the N-terminal or C-terminal of [D], or to the amino acid side chain constituting [D]. Furthermore, one or more [R] molecules can be linked to one molecule of [D]. [R] molecules can be introduced at different positions on the [D] molecule. Alternatively, [D] can be modified with many [R] s linked together.

For example, a variety of naturally occurring or artificially synthesized polypeptides with cell membrane permeability have been reported (Joliot A. & Prochiantz A., Nat Cell Biol. 2004; 6: 189-96) . All of these known cell membrane permeable substances can be used to modify polypeptides in the present invention. In the present invention, for example, any substrate selected from the following group can be used as the cell-permeable substrate described above:
[Polyarginine]; Matsushita et al., (2003) J. Neurosci .; 21, 6000-7.
[Tat / RKKRRQRRR] (SEQ ID NO: 47) Frankel et al., (1988) Cell 55, 1189-93.
Green & Loewenstein (1988) Cell 55, 1179-88.
[Penetratin / RQIKIWFQNRRMKWKK] (SEQ ID NO: 48)
Derossi et al., (1994) J. Biol. Chem. 269, 10444-50.
[Buforin II / TRSSRAGLQFPVGRVHRLLRK] (SEQ ID NO: 49)
Park et al., (2000) Proc. Natl Acad. Sci. USA 97, 8245-50.
[Transport / GWTLNSAGYLLGKINLKALAALAKKIL] (SEQ ID NO: 50)
Pooga et al., (1998) FASEB J. 12, 67-77.
[MAP (Model Amphipathic Peptide) / KLALKLALKALKAALKLA] (SEQ ID NO: 51)
Oehlke et al., (1998) Biochim. Biophys. Acta. 1414, 127-39.
[K-FGF / AAVALLPAVLLALLAP] (SEQ ID NO: 52)
Lin et al., (1995) J. Biol. Chem. 270, 14255-8.
[Ku70 / VPMLK] (SEQ ID NO: 53)
Sawada et al., (2003) Nature Cell Biol. 5, 352-7.
[Ku70 / PMLKE] (SEQ ID NO: 61)
Sawada et al., (2003) Nature Cell Biol. 5, 352-7.
[PRION / MANLGYWLLALFVTMWTDVGLCKKRPKP] (SEQ ID NO: 54)
Lundberg et al., (2002) Biochem. Biophys. Res. Commun. 299, 85-90.
[pVEC / LLIILRRRIRKQAHAHSK] (SEQ ID NO: 55)
Elmquist et al., (2001) Exp. Cell Res. 269, 237-44.
[Pep-1 / KETWWETWWTEWSQPKKKRKV] (SEQ ID NO: 56)
Morris et al., (2001) Nature Biotechnol. 19, 1173-6.
[SynB1 / RGGRLSYSRRRFSTSTGR] (SEQ ID NO: 57)
Rousselle et al., (2000) Mol. Pharmacol. 57, 679-86.
[Pep-7 / SDLWEMMMVSLACQY] (SEQ ID NO: 58)
Gao et al., (2002) Bioorg. Med. Chem. 10, 4057-65.
[HN-1 / TSPLNIHNGQKL] (SEQ ID NO: 59)
Hong & Clayman (2000) Cancer Res. 60, 6551-6.

  In the present invention, the polyarginine listed above as an example of a cell membrane permeable substance is composed of any number of arginine residues. In particular, it is constituted, for example, by consecutive 5-20 arginine residues. The preferred number of arginine residues is 11 (SEQ ID NO: 60).

Pharmaceutical composition comprising ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) The polypeptide of the present invention inhibits the growth of lung cancer cells. Therefore, the present invention comprises, as an active ingredient, a polypeptide comprising ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46), or a polynucleotide encoding them. Provide therapeutic and / or prophylactic drugs for cancer. Alternatively, the present invention relates to a method for treating and / or preventing lung cancer comprising the step of administering the polypeptide of the present invention. Furthermore, the present invention relates to the use of a polypeptide of the present invention in the manufacture of a pharmaceutical composition for treating and / or preventing lung cancer. Furthermore, the present invention also provides a polys selected from peptides comprising ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) for the treatment and / or prevention of lung cancer. Relates to peptides.

  Alternatively, the inhibitory polypeptides of the present invention can be used to induce apoptosis of cancer cells. Accordingly, the present invention comprises a polypeptide comprising ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) as well as a polynucleotide encoding them as active ingredients. An agent for inducing apoptosis of cells is provided. The apoptosis inducer of the present invention can be used to treat cell proliferative diseases such as cancer. Alternatively, the present invention relates to a method for inducing apoptosis of cells comprising the step of administering the polypeptide of the present invention. Furthermore, the present invention relates to the use of a polypeptide of the present invention in the manufacture of a pharmaceutical composition that induces apoptosis in cells.

  The inhibitory polypeptides of the present invention induce apoptosis in TTK expressing cells such as lung cancer. On the other hand, TTK expression has not been observed in most normal organs. In some normal organs, TTK expression levels are relatively low compared to lung cancer tissue. Therefore, the polypeptide of the present invention can induce apoptosis particularly in lung cancer cells.

  The present invention for human and other mammals such as mice, rats, guinea pigs, rabbits, cats, dogs, sheep, pigs, cows, monkeys, baboons and chimpanzees as prepared pharmaceuticals for lung cancer treatment or apoptosis induction in cells The isolated compound can be administered directly, or can be prepared into an appropriate dosage form using known methods for preparing pharmaceuticals. For example, if desired, the pharmaceutical may be administered parenterally in the form of sugar-coated tablets, capsules, elixirs and microcapsules orally in the form of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid. Can be administered. For example, in the unit dosage forms required for generally acceptable pharmaceutical manufacture, the compound may be a pharmaceutically acceptable carrier or medium, particularly sterile water, saline, vegetable oil, emulsifier, suspension, surface It can be mixed with active substances, stabilizers, flavoring agents, excipients, solvents, preservatives and binders. Depending on the amount of active ingredient in these formulations, a suitable dose within a specific range can be determined.

  Examples of additives that can be mixed in tablets and capsules include binders such as gelatin, corn starch, gum tragacanth and gum arabic, mediums such as crystalline cellulose, eg swelling agents such as corn starch, gelatin and alginic acid, eg stearin Lubricating oils such as magnesium acid, sweeteners such as sucrose, lactose or saccharin, and flavoring agents such as mint, wintergreen oil and cherries. Where the unit dosage form is a capsule, a liquid carrier such as oil can be further included in the above ingredients. A sterile mixture for injection can be prepared, for example, using a solution such as distilled water for injection according to the recognition of ordinary pharmaceutical products.

  Other isotonic solutions including physiological saline, glucose and adjuvants such as D-sorbitol, D-mannose, D-mannitol and sodium chloride can be used as aqueous solutions for injection. These in combination with suitable solubilizers such as alcohols, especially ethanol; and polyhydric alcohols such as propylene glycol and polyethylene glycol; and nonionic surfactants such as polysorbate 80 ™ and HCO-50 Can be used.

  Sesame oil or soybean oil can be used as an oily liquid, and they can also be used in combination with benzyl benzoate or benzyl alcohol as a solubilizer, and they can also be used in phosphate buffer and sodium acetate buffer. May be formulated with analgesics such as procaine hydrochloride, stabilizers such as benzyl alcohol and phenol, and antioxidants. The adjusted injection may be filled into a suitable ampoule.

  Methods known to those skilled in the art are used to administer a pharmaceutical compound of the invention to a patient, for example, by intraarterial, intravenous, or subcutaneous injection, and also by intranasal, transtracheal, intramuscular, or oral administration. Can be done. The dose and administration method vary depending on the weight and age of the patient, as in the administration method. However, those skilled in the art can select them on a daily basis. The DNA encoding the polypeptide of the present invention can be inserted into a vector for gene therapy, and the vector can be administered for therapy. The dose and method of administration vary depending on the patient's weight, age and symptoms, and those skilled in the art can select them appropriately. For example, the dose of a compound that binds to a polypeptide of the present invention to modulate their activity, when orally administered to a normal adult (body weight 60 kg), varies slightly depending on the symptoms, but is about 0.1 per day mg to about 100 mg, preferably about 1.0 mg to about 50 mg per day, more preferably about 1.0 mg to about 20 mg per day.

  When administering a compound parenterally to a normal adult (body weight 60 kg) in an injection form, there are some differences depending on the patient, target organ, symptom, and administration method, but from about 0.01 mg to about 30 mg per day, preferably It is convenient to inject a dose of about 0.1 mg to 20 mg per day, more preferably about 0.1 mg to about 10 mg per day intravenously. In the case of other animals, an appropriate dose can be similarly calculated by converting to a body weight of 60 kg.

TTK or EGFR siRNA
TTK or EGFR gene siRNA can be used to reduce the expression level of TTK or EGFR gene. For example, siRNA of TTK or EGFR gene is effective for the treatment of lung cancer. In particular, the siRNA of the present invention binds to the corresponding mRNA, thereby promoting the degradation of the mRNA and / or inhibiting the expression of the protein encoded by the TTK or EGFR gene, thereby inhibiting the function of the protein Can act by doing.

  The terms “polynucleotide” and “oligonucleotide” are used interchangeably herein with a generally accepted single letter code unless otherwise indicated or implied. The term applies to nucleic acid (nucleotide) polymers in which one or more nucleic acids are linked by ester bonds. A polynucleotide or oligonucleotide can consist of DNA, RNA, or a combination thereof.

  As used herein, the term “double-stranded molecule” refers to a nucleic acid molecule that inhibits expression of a target gene, such as a small interfering RNA (siRNA; eg, a double-stranded ribonucleic acid (dsRNA) or a small hairpin. RNA (shRNA) and small interfering DNA / RNA (siD / R-NA; for example, DNA and RNA double-stranded chimera (dsD / R-NA) or DNA and RNA small hairpin chimera (shD / R-NA) ))including.

  In addition, siRNA against TTK or EGFR gene can be used to decrease the expression level of TTK or EGFR gene. As used herein, the term “siRNA” means a double-stranded RNA molecule that prevents translation of a target mRNA. Standard techniques for introducing siRNA into cells can be used, including methods using DNA transcribed from RNA as a template. In the context of the present invention, the siRNA consists of a sense nucleic acid sequence and an antisense nucleic acid sequence for SEQ ID NO: 62 or 63. siRNAs are constructed such that, for example, a hairpin, a single stranded transcript has both the sense and complementary antisense sequences of the target gene. The siRNA may be dsRNA or shRNA.

  As used herein, the term “dsRNA” refers to an RNA bimolecular construct that includes sequences that are complementary to each other and anneal together through complementary sequences to form a double-stranded RNA molecule. Double-stranded nucleotide sequences include RNA molecules having nucleotide sequences selected from non-coding regions of the target gene as well as “sense” or “antisense” RNA selected from the protein coding sequence of the target gene sequence. But you can.

  As used herein, the term “shRNA” refers to a siRNA having first and second regions complementary to each other, ie, a stem-loop structure comprising sense and antisense strands. The degree of complementarity and orientation of the regions is sufficient for bases to pair between the regions, the first region and the second region are joined by a loop region, and the loop is a nucleotide (or nucleotide in the loop region) Resulting in a lack of base pairing between the analogues). The loop region of shRNA is a single-stranded region interposed between the sense strand and the antisense strand, and can also be referred to as “intervening single strand”.

  As used herein, the term “siD / R-NA” refers to a double-stranded polynucleotide molecule composed of both RNA and DNA, including RNA and DNA hybrids and chimeras, which prevents translation of the target mRNA. means. In this specification, a hybrid refers to a molecule in which a polynucleotide comprising DNA and a polynucleotide comprising RNA are hybridized to each other to form a double-stranded molecule, while a chimera constitutes a double-stranded molecule. Indicates that one or both of the strands comprising RNA and DNA. Standard techniques for introducing siD / R-NA into cells are used. siD / R-NA comprises a TTK or EGFR sense nucleic acid sequence (also referred to as “sense strand”), a TTK or EGFR antisense nucleic acid sequence (also referred to as “antisense strand”) or both. siD / R-NA may be constructed, for example, as a hairpin, such that a single transcript has both the sense and complementary antisense nucleic acid sequences of the target sequence. siD / R-NA may be either dsD / R-NA or shD / R-NA.

  As used herein, the term “dsD / R-NA” is a bimolecular arrangement that includes sequences complementary to each other and anneals together through complementary sequences to form a double-stranded polynucleotide molecule. Means a thing. A double-stranded nucleotide sequence is a polynucleotide having a nucleotide sequence selected from a non-coding region of the target gene as well as a “sense” or “antisense” polynucleotide sequence selected from the protein coding sequence of the target gene sequence May be included. Either or both of the dsD / R-NA molecules are composed of both RNA and DNA (chimeric molecules), or one molecule is composed of RNA and the other is composed of DNA ( Hybrid duplex).

  As used herein, the term `` shD / R-NA '' refers to siD / R-NA having a stem-loop structure, and includes first and second regions complementary to each other, i.e., a sense strand and an antisense strand. Including. The degree of complementarity and orientation of the regions is sufficient for bases to pair between the regions, the first region and the second region are joined by a loop region, and the loop is a nucleotide (or nucleotide in the loop region) Resulting in a lack of base pairing between the analogues). The loop region of shD / R-NA is a single-stranded region interposed between the sense strand and the antisense strand, and may also be referred to as “intervening single strand”.

  The double-stranded molecule of the present invention may comprise one or more modified nucleotides and / or non-phosphodiester bonds. Chemical modifications well known in the art can improve the stability, effectiveness and / or cellular uptake of double-stranded molecules. One skilled in the art will appreciate other types of chemical modifications that can be incorporated into the molecule (WO03 / 070744; WO2005 / 045037). In one embodiment, the modifications can be utilized to improve resistance to degradation or uptake. Examples of such modifications include phosphorothioate linkages, 2'-O-methyl-4 'linked ribonucleotides, 2'-O-methyl ribonucleotides (especially in the sense strand of double-stranded molecules), 2'-deoxy -Includes fluororibonucleotides, 2'-deoxyribonucleotides, "universal base" nucleotides, 5'-C-methyl nucleotides, and inverted deoxyabasic residue incorporation (US20060122137).

  In other embodiments, the modifications can be used to improve the stability or targeting efficiency of the double-stranded molecule. Modifications include chemical cross-linking between two complementary strands of a double-stranded molecule, chemical modification of the 3 ′ or 5 ′ end of one strand of a double-stranded molecular strand, sugar modification, nucleobase modification and / or backbone Includes modified, 2-fluoro modified ribonucleotides and 2'-deoxy ribonucleotides (WO2004 / 029212). In other embodiments, the modifications can be used to increase or decrease the affinity for complementary nucleotides in the target mRNA and / or complementary double-stranded molecular strand (WO2005 / 044976). For example, unmodified pyrimidine nucleotides can be replaced with 2-thio, 5-alkynyl, 5-methyl, or 5-propynyl pyrimidine. Furthermore, unmodified purines can be substituted with 7-deaza, 7-alkyl or 7-alkenylpurines. In other embodiments, when the double-stranded molecule is a double-stranded molecule with a 3 ′ overhang, the 3′-terminal nucleotide overhanging nucleotide can be replaced by deoxyribonucleotides (Elbashir SM et al., Genes Dev 2001 Jan 15, 15 (2): 188-200). For further details, public documents such as US20060234970 are available. The present invention is not limited to these examples, and any known chemical modification can be made to the double-stranded molecule of the present invention as long as the resulting molecule retains the ability to inhibit target gene expression. .

  Furthermore, the double-stranded molecule of the present invention may include both DNA and RNA, such as dsD / R-NA or shD / R-NA. In particular, DNA strand and RNA strand hybrid polynucleotides or DNA-RNA chimeric polynucleotides exhibit increased stability. A mixture of DNA and RNA, ie a hybrid double-stranded molecule consisting of a DNA strand (polynucleotide) and an RNA strand (polynucleotide), including both DNA and RNA in one or both single strands (polynucleotide) Chimeric double-stranded molecules or the like may be formed to improve the stability of the double-stranded molecule. As long as the hybrid of DNA strand and RNA strand has an activity of inhibiting the expression of the gene when introduced into a target gene-expressing cell, the sense strand is DNA and the antisense strand is RNA, or vice versa. Any of hybrids may be used. Preferably, the sense strand polynucleotide is DNA and the antisense strand polynucleotide is RNA. Similarly, as long as it has an activity that inhibits the expression of the gene when introduced into the target gene-expressing cell, the chimeric double-stranded molecule is composed of DNA and RNA in both sense strand and antisense strand. Alternatively, either one of the sense strand and the antisense strand may be composed of DNA and RNA.

  In order to improve the stability of the double-stranded molecule, the molecule preferably contains as much DNA as possible, while in order to induce the inhibition of expression of the target gene, the molecule is in a range that induces sufficient expression inhibition. Is required to be within RMA. A preferred example of the chimeric double-stranded molecule is RNA in the upstream partial region of the double-stranded molecule (ie, the region adjacent to the target sequence or its complementary sequence in the sense strand or antisense strand). Preferably, the upstream partial region refers to the 5 'side (5' end) of the sense strand and the 3 'side (3' end) of the antisense strand. The upstream partial region is preferably a domain consisting of 9 to 13 nucleotides counting from the end of the target sequence or complementary sequence in the sense or antisense strand of the double-stranded molecule. In addition, a preferred example of a chimeric double-stranded molecule is that at least the upstream half region of the polynucleotide (the 5 ′ region of the sense strand and the 3 ′ region of the antisense strand) is RNA, and the other half is DNA. Including those having a length of 19 to 21 nucleotides. In such a chimeric double-stranded molecule, the effect of inhibiting the expression of the target gene is very high when the entire antisense strand is RNA (US20050004064).

  In the present invention, the double-stranded molecule may form a hairpin structure. For example, short hairpin RNA (shRNA) and small hairpin type consisting of DNA and RNA (shD / R-NA). shRNA or shD / R-NA is a sequence of RNA or a mixture of RNA and DNA that produces a robust hairpin turn that can be used for silencing gene expression via RNA interference. . The shRNA or shD / R-NA preferably comprises a sense target sequence and an antisense target sequence on a single strand, the sequences being separated by a loop sequence. Usually, the hairpin structure is cleaved by cellular machinery to become dsRNA or dsD / R-NA and then binds to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNA that matches the target sequence of dsRNA or dsD / R-NA.

  In other embodiments, halogenated RNA, RNA partially substituted for DNA, or methylated RNA can be used to confer RNAase resistance to siRNA. Nucleic acid derivatives that confer RNAase resistance are also included in double-stranded RNA. In the present invention, the double-stranded molecule may include a double-stranded molecule composed of ribonucleotides, modified ribonucleotides or ribonucleotide derivatives.

  TTK or EGFR gene siRNA hybridizes to the target mRNA and reduces or inhibits production of the polypeptide encoded by the TTK or EGFR gene by binding to normal single-stranded mRNA transcripts, and protein translation and expression Disturb. In the context of the present invention, the siRNA is preferably 500, 200, 100, 50 or 25 nucleotides or less in length. More preferably, the siRNA is 19-25 nucleotides long. Typical nucleic acid sequences for the production of TTK or EGFR siRNA comprise the nucleotide sequence of SEQ ID NOs: 63 or 64 as the target sequence. To increase the inhibitory activity of the siRNA, one or more uridine (“u”) nucleotides can be added to the 3 ′ end of the antisense strand of the target sequence. “U” is added in at least two, generally 2 to 10, preferably 2 to 5. The added “u” forms a single strand at the 3 ′ end of the antisense strand of the siRNA.

  The siRNA of the TTK or EGFR gene can be directly introduced into the cell in a form that can bind to the mRNA transcript. Alternatively, DNA encoding siRNA can be carried in a vector.

  The vector can be, for example, a TTK or EGFR gene target sequence into an expression vector having a functionally linked control sequence adjacent to the TTK or EGFR sequence so that expression of both strands is possible (by transcription of the DNA molecule). It is produced by cloning (Lee, NS, et al., (2002) Nature Biotechnology 20: 500-5). RNA molecules that are antisense to the TTK or EGFR gene mRNA are transcribed by the first promoter (eg, the 3 ′ promoter sequence of the cloned DNA), and RNA molecules that are the sense strand for the TTK or EGFR gene mRNA are the first. Transcribed by two promoters (eg, 5 ′ promoter sequence of cloned DNA). The sense and antisense strands hybridize in vivo to produce an siRNA construct for silencing the TTK or EGFR gene. Alternatively, the two constructs can be utilized to create the sense and antisense strands of the siRNA construct. A cloned TTK or EGFR gene can encode a construct with secondary structure, such as a hairpin, and a single transcript has both the sense and complementary antisense sequences of the target sequence.

A loop sequence consisting of any nucleotide sequence can be positioned between the sense and antisense sequences to form a hairpin loop structure. Accordingly, the present invention also provides an siRNA having the general formula 5 ′-[A]-[B]-[A ′]-3 ′, wherein
[A] is a ribonucleotide sequence that matches the TTK or EGFR gene sequence,
[B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides, and
[A ′] provides a ribonucleotide sequence having the complementary sequence of [A].
Region [A] hybridizes to [A ′], after which a loop consisting of region [B] is formed.

  The loop sequence is preferably 3 to 23 nucleotides in length. The loop sequence can be selected, for example, from the group consisting of the following sequences (ambion.com/techlib/tb/tb_506.html, found on the World Wide Web). In addition, a loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J. M., et al., (2002) Nature 418: 435-8.).

CCC, CCACC or CCACACC: Jacque, JM, et al., (2002) Nature, Vol. 418: 435-8.
UUCG: Lee, NS, et al., (2002) Nature Biotechnology 20: 500-5 .; Fruscoloni, P., et al., (2003) Proc. Natl. Acad. Sci. USA 100 (4): 1639- 44.
UUCAAGAGA: Dykxhoorn, DM, et al., (2003) Nature Reviews Molecular Cell Biology 4: 457-67.

Thus, in certain embodiments, the loop sequence can be selected from the group consisting of CCC, UUCG, CCACC, CCACACC and UUCAAGAGA. A preferred loop sequence is UUCAAGAGA (“ttcaagaga” in DNA). Exemplary hairpin siRNAs suitable for use in the context of the present invention include:
For TTK-siRNA;
AACAAGAUGUGUUAAAGUGUUUU- [b] -AAAACACUUUAACACAUCUUGUU (to the target sequence of SEQ ID NO: 62)
For EGFR-siRNA;
AAGUAACAAGCUCACGCAGUUUU- [b] -AAAACUGCGUGAGCUUGUUACUU (for the target sequence of SEQ ID NO: 63)

  Suitable siRNA nucleotide sequences can be designed using the siRNA design computer program available from the Ambion website on the World Wide Web at ambion.com/techlib/misc/siRNA_finder.html. The computer program selects nucleotide sequences for siRNA synthesis based on the following protocol.

  The regulatory sequences adjacent to the TTK or EGFR gene sequences are the same or different so that their expression can be regulated independently or temporally or spatially. . The siRNA is transcribed into the cell by cloning the TTK or EGFR gene template into a vector containing an RNA polymerase III transcription unit, eg, from a nuclear small RNA (snRNA) U6 or human H1 RNA promoter, respectively. In order to introduce the vector into the cell, a transfection facilitating agent can be used. FuGENE (Roche Diagnostics), Lipofectamine 2000 (Invitrogen), Oligofectamine (Invitrogen), and Nucleofector (Wako Pure Chemical) are effective as transfection promoters.

  The siRNA of the present invention is effective in inhibiting the expression of the polypeptide of the present invention and thereby suppressing the biological activity of the polypeptide of the present invention. Moreover, the expression inhibitor containing the siRNA of the present invention is effective in that it can inhibit the biological activity of the polypeptide of the present invention. Therefore, a composition comprising one or more siRNAs of the present invention is effective for the treatment of lung cancer. Alternatively, the present invention provides the use of an inhibitory nucleic acid comprising siRNA or a vector expressing the nucleic acid for the manufacture of a pharmaceutical composition for the treatment or prevention of lung cancer. Furthermore, the present invention also provides a vector for expressing the inhibitory nucleic acid containing siRNA or a nucleic acid for treating or preventing lung cancer.

Method for treating or preventing lung cancer
Patients with tumors characterized by over-expression of TTK or EGFR are treated by administering TTK or EGFR siRNA, respectively. siRNA therapy is used to inhibit TTK or EGFR expression in patients suffering from or at risk of developing lung cancer. The patient is identified by standard methods for a particular tumor type. Lung cancer cells are diagnosed by CT, MRI, ERCP, MRCP, computed tomography, or ultrasound, for example. Treatment is effective if it leads to clinical utility, such as a decrease in TTK or EGFR expression, or a decrease in tumor size, morbidity, or metastatic potential in a subject. “Effective” when the treatment is applied prophylactically means that the treatment delays or prevents the formation of the tumor or prevents or reduces the clinical symptoms of the tumor. Utility is measured in relation to any known method for diagnosis or treatment of a particular tumor type.

  siRNA therapy is performed by administering siRNA to a patient via a standard vector encoding the siRNA of the invention and / or a gene delivery system that delivers a synthetic siRNA molecule. In general, synthetic siRNA molecules are chemically stabilized to prevent nuclease degradation in vivo. Methods for preparing chemically stabilized RNA molecules are well known in the art. In general, the molecule includes a modified backbone and nucleotides to prevent the action of ribonuclease. For example, other modifications are also possible, as cholesterol-binding siRNAs have shown improved pharmacological properties (Song et al. Nature Med. 9: 347-351 (2003)).

  Suitable gene delivery systems can include liposomes, receptor-mediated delivery systems, or viral vectors such as herpes viruses, retroviruses, adenoviruses and adeno-associated viruses. The therapeutic nucleic acid composition is prepared in a pharmaceutically acceptable carrier. The therapeutic composition can also include a gene delivery system as described above. A pharmaceutically acceptable carrier is a biologically compatible solvent suitable for administration to animals, such as physiological saline. A therapeutically effective amount of the compound is an amount that can produce a pharmaceutically desirable result, such as reduced production of a TTK or EGFR gene product in a treated animal, reduced cell growth such as proliferation, or reduced tumor growth. is there.

  Parenteral administration, such as intravenous, subcutaneous, intramuscular and intraperitoneal delivery routes, can be used to deliver TTK or EGFR siRNA compositions. For the treatment of lung cancer, direct injection near the tissue or site of the cancer is effective.

  Patient dosage depends on a number of factors, including patient size, body surface area, age, the specific nucleic acid being administered, sex, time and route of administration, overall health, and other drugs being administered in combination Rely on. The dosage for intravenous injection of nucleic acid is about 106 to 1022 copies of the nucleic acid molecule.

  Polynucleotides are administered by standard methods such as injection into the interstitial space of tissues such as muscle or skin, introduction into the bloodstream or body cavity, and inhalation or gas infusion. A polynucleotide is administered or delivered to an animal using a pharmaceutically acceptable liquid carrier, such as an aqueous or partially aqueous liquid carrier. Polynucleotides are associated with liposomes (eg, cationic or anionic liposomes). A polynucleotide contains genetic information necessary for expression by a target cell, such as a promoter.

Pharmaceutical Compositions Comprising siRNA Accordingly, the present invention includes drugs and methods effective for either or both prevention and treatment of lung cancer. These drugs and methods include siRNA that inhibits expression of TKK (SEQ ID NO: 62) or EGFR (SEQ ID NO: 63) in an amount effective to achieve attenuation or arrest of disease cell proliferation . More specifically, in the context of the present specification, a therapeutically effective amount means an effective amount that prevents progression of a subject undergoing treatment or reduces existing symptoms.

  Individuals treated using the methods of the present invention include any individual suffering from lung cancer. Such individuals can include, for example, vertebrates such as mammals including humans, dogs, cats, horses, cows, or goats, or other animals, particularly commercially important animals or livestock animals.

  In the context of the present invention, suitable pharmaceutical formulations are oral, rectal, nasal, topical (including buccal and sublingual), vaginal or parenteral (intramuscular, subcutaneous and intravenous) administration, or inhalation or gas infusion. Including pharmaceutical formulations suitable for administration by. Preferably administration is intravenous. The preparation is appropriately enclosed by volume unit.

  Pharmaceutical formulations suitable for oral administration include capsules, cachets or tablets, each containing a predetermined amount of active ingredient. Suitable formulations also include powders, granules, solutions, suspensions and emulsions. The active ingredient is optionally administered as a bolus, electuary or paste. Tablets and capsules for oral administration are, for example, fillers such as sugars including lactose, sucrose, mannitol or sorbitol, such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropylmethylcellulose Conventional additives such as cellulose preparations such as sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP), binders, lubricants, and / or humidifiers. If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

  A tablet may be made by compression or molding, optionally with one or more pharmaceutical ingredients. Compressed tablets are suitable if the active ingredient in free-flowing form, such as powders or granules, is optionally mixed with a binder, lubricant, inert diluent, lubricant, surfactant and / or dispersant. Can be adjusted by compression in a simple machine. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art. Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, and dry products for constitution with water or other suitable solvent prior to use. May be provided as The liquid preparation may contain conventional additives such as suspending agents, emulsifiers, non-aqueous solvents (which may include edible oils), pH maintainers, and / or preservatives. Tablets may optionally be formulated so as to provide sustained or controlled release of the active ingredient therein. The tablet package may contain one tablet to be taken monthly.

  Formulations suitable for parenteral administration optionally include anti-oxidants, buffers, bacteriostats, and aqueous and non-aqueous sterile injections that may include solutes that make the target recipient's blood and formulation isotonic, And aqueous and non-aqueous sterile suspensions including suspending agents and / or thickeners. Formulations may be provided in unit-dose containers or multi-dose containers such as sealed ampoules and vials, requiring only the addition of a sterile liquid carrier such as saline or water for injection just before use. May be stored in a freeze-dried state. Alternatively, the formulation may be provided for continuous infusion. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

  Formulations suitable for rectal administration include suppositories with standard carriers such as cocoa butter or polyethylene glycol. Formulations suitable for topical administration in the mouth, eg buccal or sublingual, include sucrose and medicinal candy containing the active ingredient in a flavored base such as acacia or tragacanth, and gelatin and glycerin, or sucrose and acacia A lozenge containing the active ingredient in a base such as For intranasal administration, liquid sprays, dispersible powders or drops of the compounds of the invention may be used. Drops may be formulated with an aqueous or non-aqueous base which also contains one or more dispersants, solubilizers and / or suspending agents.

  For administration by inhalation, the compounds are conveniently delivered from an insufflator, nebulizer, pressurized pack or other convenient aerosol spray delivery method. The pressurized pack may contain a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve that delivers a fixed amount.

  Alternatively, for administration by inhalation or insufflation, the compound may take the form of a dry powder composition, for example a mixed powder of the compound and a suitable powder base such as lactose or starch. Powder compositions may be provided in unit dosage forms, such as capsules, cartridges, gelatin or blister packs, from which powders can be administered with the aid of an inhaler or insufflator.

  Other formulations include implantable devices and adhesive patches that release therapeutic agents.

  If desired, the above formulations may be adapted and used to provide sustained release of the active ingredient. The pharmaceutical composition may also contain other active ingredients such as antibacterial agents, immunosuppressive agents and / or preservatives.

  In addition to the ingredients specifically mentioned above, the formulations of the present invention may contain other drugs customary in the prior art, taking into account the type of formulation concerned, for example formulations suitable for oral administration It should be understood that an agent may be included.

  For example, depending on the route of administration, depending on the concentration of the test compound administered, or whether the treatment uses a protein, a nucleic acid encoding the test compound, or a drug containing cells capable of secreting the test compound as an active ingredient It will be apparent to those skilled in the art that additional excipients may be more preferred.

  The pharmaceutical compositions of the present invention can be prepared in a manner known per se, for example by processes such as usual mixing, dissolution, granulation, dragee formation, grinding, emulsification, encapsulation, entrapping or lyophilization. Can be manufactured. Proper formulation is dependent upon the route of administration chosen.

Examples Example 1: Materials and methods
(a) Lung cancer cell lines and tissue samples Lung cancer cell lines were grown in monolayers in an appropriate medium supplemented with 10% fetal calf serum (FCS) and maintained in a humidified air atmosphere at 37 ° C. and 5% CO2. Primary lung cancer and metastatic brain tumors from lung adenocarcinoma samples were obtained with informed consent as previously described (Kikuchi et al., Oncogene. 2003 Apr 10; 22 (14): 2192-205 ., Int J Oncol. 2006 Apr; 28 (4): 799-805., Taniwaki et al., Int J Oncol. 2006 Sep; 29 (3): 567-75.). From patients undergoing surgery at Saitama Cancer Center (Saitama, Japan), 366 formalin-fixed primary tumors (234 adenocarcinomas (ADC), 104 squamous cell carcinomas (SCC), 28 cases) Large cell carcinoma (LCC)) and adjacent normal lung tissue samples were used in this invention. A total of 12 SCLC tissue samples were also obtained at Saitama Cancer Center.

(b) Semi-quantitative RT-PCR analysis Total RNA was extracted from cultured cells and clinical tissues using Trizol reagent (Life Technologies, Inc.) according to the manufacturer's protocol. Extracted RNA and normal human tissue poly (A) RNA were treated with DNase (Nippon Gene) and reverse transcribed using oligo (dT) 20 primer and Superscript II reverse transcriptase (Invitrogen). Semi-quantitative RT-PCR testing was performed using the following synthetic gene specific primers or a-actin (ACTB) specific primers as internal standards:
TTK,
5'-TCTTGAATCCCTGTGGAAATC-3 '(SEQ ID NO: 5) and
5'-TGCTATCCACCCACTATTCCA-3 '(SEQ ID NO: 6);
ACTB,
5'-GAGGTGATAGCATTGCTTTCG-3 '(SEQ ID NO: 7) and
5'-CAAGTCAGTGTACAGGTAAGC-3 '(SEQ ID NO: 8).
The PCR reaction was optimized for the number of cycles to ensure product strength within the logarithmic phase of amplification.

(c) Northern blot analysis A human multi-tissue blot (BD Biosciences Clontech) was hybridized with ³² P-labeled TTK PCR product. TTK full-length cDNA was prepared by RT-PCR using primers. Prehybridization, hybridization and washing were performed according to the supplier's recommendations. The blot was autoradiographed for 72 hours at room temperature using an intensifying screen.

(d) Western blot analysis Cells are RIPA buffer containing protease inhibitor cocktail set III (CALBIOCHEM) and phosphatase inhibitors (1 mM sodium fluoride, 1 mM sodium orthovanadate, 2 mM imidazole, 4 mM sodium tartrate). Solution [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% NP-40, 0.5% deoxychorate-Na, 0.1% SDS] was dissolved. Cytoplasm and nuclear extract were isolated by NE-PER nuclear and cytoplasmic extraction reagent (PIERCE). Protein samples were separated on SDS-polyacrylamide gels and electrically transferred onto Hybond-ECL nitrocellulose membrane (GE Healthcare Bioscience). Blots include mouse monoclonal anti-Mps1 (TTK) antibody (Upstate), rabbit polyclonal anti-phosphorylated EGFR antibody (Tyr-845, Tyr-992, Tyr-1045, Tyr-1068, Tyr-1148, and Tyr-1173; Cell Signaling Technology, Inc.), rabbit polyclonal anti-EGFR antibody (Cell Signaling Technology, Inc.), rabbit polyclonal anti-phosphorylated PLCγ1 (Tyr-771) antibody (Cell Signaling Technology, Inc.), rabbit polyclonal anti-PLCγ1 antibody (Cell Signaling Technology) , Inc.), rabbit polyclonal anti-phosphorylated p44 / 42 MAPK (Thr202 / Tyr204) antibody (Cell Signaling Technology, Inc.), rabbit polyclonal anti-p44 / 42 MAPK antibody (Cell Signaling Technology, Inc.), mouse monoclonal anti-Flag Incubated with antibody (SIGMA) or mouse monoclonal anti-β-actin antibody (SIGMA). Anti-phosphorylated EGFR (Ser-967) antibody was produced against Ser-967 phosphorylated synthetic peptide and purified on the phosphorylated peptide column. Antigen-antibody complexes were detected using a secondary antibody conjugated to horseradish peroxidase (GE Healthcare Bioscience). Protein bands were visualized with ECL Western blotting detection reagent (GE Healthcare Bioscience).

(e) Immunocytochemical analysis Cultured cells were fixed with 10% trichloroacetic acid in 4% paraformaldehyde solution for 15 minutes at 37 ° C or on ice for 15 minutes. The fixed cells were incubated for 10 minutes in PBS (−) containing 0.1% Triton X-100, and then washed with PBS (−). Prior to the primary antibody reaction, the fixed cells were covered with CAS-BLOCK (ZYMED Laboratories Inc.) for 10 minutes to prevent non-specific antibody binding. Cells were then immunized with mouse monoclonal anti-Mps1 (TTK) antibody (Upstate) and rabbit polyclonal anti-phosphorylated EGFR (Tyr-992) (Cell Signaling Technology, Inc.) or polyclonal anti-phosphorylated-p44 / 42 MAPK (Thr202 / Tyr204 ) Antibody (Cell Signaling Technology, Inc.) or mouse monoclonal anti-Flag antibody (SIGMA). The antibody was stained with an anti-mouse secondary antibody conjugated to Alexa Fluor 488 (Molecular Probes) and an anti-rabbit secondary antibody conjugated to Alexa Fluor 594 (Molecular Probes). DNA was stained with 4 ′, 6-diamidino-2-phenylindole (DAPI). Images were observed and evaluated using a confocal microscope at wavelengths of 488, 594 nm (TCS SP2 AOBS: Leica Microsystems).

(f) Immunohistochemistry and tissue microarray To investigate the presence of TTK or phosphorylated EGFR (Tyr-992) protein in clinical samples, tissue sections were stained using ENVISION + Kit / horseradish peroxidase (HRP) (DakoCytomation) . Briefly, after blocking endogenous peroxidase and protein, anti-human TTK antibody (NOVUS Biologicals, Inc.) or anti-phosphorylated EGFR (Tyr-992) antibody (Cell Signaling Technology, Inc.) or anti-phosphorylated EGFR ( Ser-967) antibody (described above) was added and the tissue sections were incubated with HRP-labeled anti-rabbit IgG as a secondary antibody. A chromogenic substrate was added and the sample was counterstained with hematoxin.

  Tumor tissue microarrays were constructed as previously published (Chin et al., Mol Pathol. 2003 Oct; 56 (5): 275-9 .; Callagy et al., Diagn Mol Pathol. 2003 Mar; 12 (1 ): 27-34., J Pathol. 2005 Feb; 205 (3): 388-96.). Based on the visual arrangement with the corresponding HE-stained sections on the slide, the tissue part for sampling was selected. Three, four or five tissue cores (diameter 0.6 mm; height 3-4 mm) taken from the donor tumor block were placed in the recipient paraffin block using a tissue microarrayer (Beecher Instruments). A core of normal tissue area was taken from each case with a hole. 5 μm sections obtained from the microarray block were used for immunohistochemical analysis. Positive for TTK or phosphorylated EGFR (Tyr-992) or phosphorylated EGFR (Ser-967) protein, respectively, negative by 3 independent investigators without prior knowledge of clinicopathological data (score 3211d as 0) Semi-quantitatively by recording staining intensity as weak ((1+) or strong positive (2+). If all evaluators defined them as such, the case was strongly positive (2 Only confirmed in (+).

(g) Statistical analysis Tissue microarray analysis of clinicopathological variables such as age, gender, histopathology findings, smoking history, tumor size (pT), and lymph node metastasis (pN) using contingency tables We attempted to correlate with TTK and / or phosphorylated EGFR (Tyr-992) and / or phosphorylated EGFR (Ser-967) positivity determined by. Tumor-specific survival curves were calculated from the date of surgery to the time of death related to NSCLC, or from the latest follow-up results. Kaplan-Meier curves were calculated for each relevant variable, and TTK and / or phosphorylated EGFR (Tyr-992) and / or (Ser-967) expression, and the difference in survival within the patient subgroups, Analysis was performed using a log rank test. Using Cox's proportional hazard regression model, a univariate analysis was performed to determine the association between clinicopathological variables and cancer-related mortality.

(h) RNA interference assay
(i) Vector-based assays A vector-based RNA interference (RNAi) system, psiH1BX3.0, designed to synthesize siRNA in mammalian cells has been previously established (Suzuki et al., 2003, 2005 Kato et al, 2005; Furukawa et al, 2005). A 10 ig siRNA expression vector was introduced into NSCLC cell lines LC319 and A549 that overexpress TTK endogenously using 30 ig Lipofectamine 2000 (Invitrogen). Transduced cells were cultured in the presence of the appropriate concentration of geneticin (G418) for 5 days, after which cell number and viability were assessed by Giemsa staining and triplicate MTT assays. The target sequence of the synthetic oligonucleotide for RNAi is as follows:
Control 1 (luciferase: Photinus pyralis luciferase gene), 5'-CGTACGCGGAATACTTCGA-3 '(SEQ ID NO: 9);
Control 2 (Scramble: chloroplast Euglena gracilis gene encoding 5S and 16S rRNA), 5'-GCGCGCTTTGTAGGATTCG-3 '(SEQ ID NO: 10);
siRNA-TTK (si-TTK-1), 5'-ACAGTGTTCCGCTAAGTGA-3 '(SEQ ID NO: 11);
siRNA-TTK (si-TTK-2), 5'-ATCACGGACCAGTACATCT-3 '(SEQ ID NO: 12).
In order to validate the RNAi system, individual control siRNAs (luciferase and Scramble) were tested by semi-quantitative RT-PCR, and transiently reduced expression of the corresponding target gene introduced into COS-7 cells. confirmed. Downregulation of TTK expression by si-TTK was not confirmed by the controls, but was confirmed by semi-quantitative RT-PCR in the cell lines used in this assay.

(ii) Oligo-based assays Oligo-siRNAs (Dharmacon, Inc., Lafayette, CO) (600 pM) were prepared in 30 μl of Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol and applied to the appropriate lung cancer cell line. Introduced. A ribonucleotide sequence consistent with the following sequence was used as the oligo-siRNA.
RNAi-TTK (oligo): CAAGATGTGTTAAAGTGTTTT (SEQ ID NO: 62); and
RNAi-EGFR (oligo): GTAACAAGCTCACGCAGTTTT (SEQ ID NO: 63).

(i) Cell Proliferation Assay The proliferation effect of TTK in mammalian cells was also examined using COS-7 and NIH-3T3 cells transiently transfected with a plasmid expressing TTK or mock plasmid. Cells were cultured for 14 days in DMEM containing 10% FCS and geneticin and subjected to MTT assay.

(j) Dephosphorylation analysis To obtain mitotically quiescent cells, cultured cells were treated with colcemid (WAKO) for 24 hours before extracts were prepared for Western blot analysis. For phosphatase treatment, cell extracts were incubated with lambda phosphatase (New England Biolabs) and phosphatase buffer or buffer alone for 1 hour at 37 ° C. and then analyzed by immunoblot.

(k) Preparation of recombinant TTK
The full-length TTK cDNA was subcloned into the pFastBac HT vector. The recombinant shuttle vector is transformed into the baculovirus genome (bacmid DNA) in DH10Bac competent cells (Invitrogen) using Tn7 site-specific translocation according to the manufacturer's instructions for the Bac-to-Bac expression system (Invitrogen). It was. Recombinant bacmid DNA was identified, purified, introduced into Sf9 cells (Invitrogen) (recombinant baculovirus) and used for subsequent infections. Log phase Sf-9 cells were infected with recombinant baculovirus at an infection efficiency (MOI) of 1, and then infected Sf-9 cells were grown in suspension at 27 ° C. for 72 hours. Sf-9 cell extracts were collected and His fusion proteins were purified using HiTrap HP columns (GE Healthcare Biosciences) using standard protocols. A point mutation (Ala) was introduced at codon 647 (Asp) to construct a catalytically inactive TTK (TTK-KD). TTK-KD was cloned into pGEX6T vector (GE Healthcare Bioscience). The GST fusion protein was expressed in E. coli strain BL21 and purified by glutathione sepharose 4B (GE Healthcare Bioscience) according to standard protocols.

(l) In vitro kinase assay
To investigate the phosphorylation of proteins by TTK, purified recombinant His-tagged TTK is a total extract prepared from cell lines or purified GST-tagged proteins containing various cytoplasmic regions of EGFR and kinase assays The cells were incubated in buffer (50 mM Tris, pH 7.4, 10 mM MgCl2, 2 mM dithiothreitol, 1 mM NaF, 0.2 mM ATP) at 30 ° C. for 60 minutes. The reaction was stopped by the addition of Laemmli sample buffer and heated at 95 ° C. for 5 minutes. Proteins were separated by SDS-PAGE followed by Western blot or ³² P incorporation analysis.

(m) Tumor growth in nude mouse xenograft model
TTK transfectants were collected and 5x10 ⁶ cells were suspended in phenol red free matrigel (BD Bioscience) with reduced growth factors, and 6 weeks old nu / nu BalbC female mice (Charles River Laboratories) It was injected subcutaneously into the right dorsal side. Tumor size was measured using a ruler and tumor volume was calculated using the formula V = (W / 2) ² x L. W is the distance of the tumor width, and L is the vertical length.

(n) TTK-expressing stationary transfectant
TTK-expressing steady-state transfectants were established according to standard protocols. The present inventors transfected HEK293 cells and NIH3T3 cells with TTK expression plasmid (pCAGGS-n3FH-TTK) or mock plasmid (pCAGGS-n3FH) using FuGENE 6 transfection reagent (Roche Diagnostics). Transfected cells were cultured in DMEM containing 10% FCS and G418, after which individual colonies were trypsinized and screened for constant transfectants by limiting dilution assays. TTK expression was measured in each clone by RT-PCR, Western blotting, and immunostaining. HEK293 or NIH3T3 transfectants that constantly express TTK were seeded in 6-well plates (5 × 10 ⁴ cells / well) and maintained for 7 days in medium containing 10% FCS and 0.4 mg / ml G418. At each time point, cell proliferation was assessed by MTT assay using Cell Counting Kits (WAKO). All experiments were done in triplicate.

(o) TTK mutation analysis
Total RNA was extracted from the NSCLC cell line using the RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. The extracted RNA was treated with DNase I (Nippon Gene) and reverse transcribed using oligo (dT) primer and SuperScript II reverse transcriptase (Invitrogen). TTK amplification was performed using synthetic TTK specific primers.
5'-GTGTTTGCGGAAAGGAGTTT-3 '(SEQ ID NO: 13),
5'-CAACCAGTCCTCTGGGTTGT-3 '(SEQ ID NO: 14);
5'-AACTCGGGAACTGTTAACCAAA-3 '(SEQ ID NO: 15),
5'-GTGCATCATCTGGCTCTTGA-3 '(SEQ ID NO: 16);
5'-TGTTCCGCTAAGTGATGCTC-3 '(SEQ ID NO: 17),
5'-GCAAATTTCTTGCAGTTTGCTC-3 '(SEQ ID NO: 18);
5'-TCAAGAGCCAGATGATGCAC-3 '(SEQ ID NO: 19),
5'-TCTTTTCCTCCTCTGAAAGCA-3 '(SEQ ID NO: 20);
5'-AAGCTGTAGAACGTGGAGCAG-3 '(SEQ ID NO: 21),
5'-CATCTTGTGGTGGCATGTTC-3 '(SEQ ID NO: 22);
5'-CGGTTCACTTGGGCATTTAC-3 '(SEQ ID NO: 23),
5'-CCAAATCTCGGCATTCTGAT-3 '(SEQ ID NO: 24);
5'-AGCCCAGATTGTGATGTGAA-3 '(SEQ ID NO: 25),
5'-TTGATTCCGTTTTATTCTTCAGG-3 '(SEQ ID NO: 26);
5'-TCAAGGAACCTCTGGTGTCA-3 '(SEQ ID NO: 27),
5'-GACAGGTTGCTCAAAAGTGG-3 '(SEQ ID NO: 28);
5'-ACTGGCAGATTCCGGAGTTA-3 (SEQ ID NO: 29) ',
5'-CAACTGACAAGCAGGTGGAA-3 '(SEQ ID NO: 30);
5'-GACACCAAGCAGCAATACCTTGG-3 '(SEQ ID NO: 31),
5'-AACACCTGAAATACCTTGCTTGAAC-3 '(SEQ ID NO: 32);
5'-ATGAATGCATTTCGGTTAAAGG-3 '(SEQ ID NO: 33),
5'-TTTCCACACTCCATTACCATG-3 '(SEQ ID NO: 34);
5'-ACAGTGATAAGATCATCCGAC-3 '(SEQ ID NO: 35),
5'-ACACTTGTTGTATCTGGTTGC-3 '(SEQ ID NO: 36);
5'-TTTCTGATAGTTGATGGAATGC-3 '(SEQ ID NO: 37),
5'-GAAATCTGATTAATTATCTGCTG-3 '(SEQ ID NO: 38);
5'-TGATGTTTGGTCCTTAGGATG-3 '(SEQ ID NO: 39),
5'-ATTTCTTCAGTGGTTCCCTTG-3 '(SEQ ID NO: 40) and
5'-AGCTCCTGGCTCATCCCTAT-3 '(SEQ ID NO: 41),
5'-TGCTATCCACCCACTATTCCA-3 '(SEQ ID NO: 6)
Next, sequence analysis of the PCR product was performed using an ABI Prism 3700 DNA sequencer (Applied Biosystems).

(p) Matrigel invasion assay Using FuGENE 6 transfection reagent (Roche Diagnostics) according to the manufacturer's instructions, NIH-3T3 or COS-7 cells were treated with TTK (pCAGGS-n3FH-TTK), TTK-KD (D647A), Plasmids expressing mutant TTK (derived from RERF-LC-AI cells) or mock plasmid (pCAGGS-n3FH) were transfected. Transfected cells were collected and suspended in DMEM without FCS. Before the cell suspension was prepared, a dry layer of Matrigel matrix (Becton Dickinson Labware) was rehydrated with DMEM for 2 hours at room temperature. Next, DMEM containing 10% FCS was added to each lower chamber of the 24-well Matrigel invasion chamber and cell suspension was added to each insert in the upper chamber. Insert plates were incubated at 37 ° C. for 22 hours. After incubation, infiltrating cells that passed through the matrigel-coated insert were fixed and stained by Giemsa.

(q) synthesized cell-penetrating peptide
The 17-31 amino acid peptide sequence corresponding to the portion of the EGFR protein that contains the potential TTK interaction region is covalently linked to the membrane transducing 11 polyarginine sequence at its NH2 terminus (Hayama, S, et al. Cancer Res. 66, 10339-48 (2006), Futaki S, et al. J Biol Chem. 276, 5836-5840 (2001)). Three cell penetrating peptides were synthesized:
11R-EGFR889-907: RRRRRRRRRRR-GGG-KPYDGIPASEISSILEKGE;
11R-EGFR899-917: RRRRRRRRRRR-GGG-ISSILEKGERLPQPPICTI (SEQ ID NO: 44);
11R-EGFR918-936: RRRRRRRRRRR-GGG-DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45);
11R-EGFR937-955: RRRRRRRRRRR-GGG-FRELIIEFSKMARDPQRYL (SEQ ID NO: 46);
11R-EGFR958-976: RRRRRRRRRRR-GGG-QGDERMHLPSPTDSNFYRA;
11R-EGFR983-1001: RRRRRRRRRRR-GGG-MDDVVDADEYLIPQQGFFS; and
11R-EGFR965-994: RRRRRRRRRRR-GGG-LPSPTDSNFYRALMDEEDMDDVVDADEYLI.
The most efficient Scramble peptide from the 11R-EGFR937-955 peptide was synthesized as a control: Scramble, RRRRRRRRRRR-GGG-EFMAELLRYFRPQSKRDII.
The peptide was purified by preparative reverse phase high pressure liquid chromatography. A549 cells were incubated with 11R peptide for 5 days at concentrations of 2.5, 5, and 7.5 μmol / L. The medium was changed every 48 hours with each peptide at the appropriate concentration and cell viability was assessed by MTT assay 5 days after treatment.

Example 2: TTK expression in lung tumors and normal tissues More than 50% of lung cancer and more than 5 times analyzed by cDNA microarray to explore new molecular targets for the development of lung cancer therapeutics and / or diagnostic markers The genes that showed expression were screened first. Of the 27,648 genes screened, the gene encoding TTK protein kinase was identified as often overexpressed in various types of lung cancer. This expression level was confirmed in 11 of 14 additional NSCLC cases (5 out of 7 adenocarcinomas (ADC), 6 out of 7 squamous cell carcinomas (SCC)) (FIG. 1a). Furthermore, up-regulation of TTK was observed in all 23 lung cancer cell lines (FIG. 1b). Furthermore, TTK expression in lung tumors was confirmed in all seven lung cancer cell lines by examining the expression of endogenous TTK protein by Western blot analysis using an anti-TTK antibody (FIG. 1c). Northern blotting using TTK cDNA as a probe identified a 3.0 kb transcript specifically in the testis among the 24 normal human tissues examined (data not shown). Intracellular localization of TTK in NSCLC cell lines, A549 and LC319, was examined by immunocytochemical and Western blot analysis using anti-TTK antibodies and was found to be mainly localized in the cytoplasm and nucleus (FIG. 1e). And 1f).

Example 3: Association between poor prognosis and overexpression of TTK
To confirm the biological and clinicopathological significance of TTK, TTK protein expression was clinically monitored by tissue microarrays containing SCLC tissue from 12 patients and NSCLC tissue from 366 patients. It was examined by NSCLC. TTK positive staining was observed in 68.6% (251/366) of surgically resected NSCLC and 66.7% (8/12) of SCLC, while no staining was observed in any normal lung tissue (Figure 2a). Next, the correlation between various clinicopathological parameters and their positive staining was examined in 366 NSCLC patients. TTK expression levels on the tissue array were classified from negative (score 0) to weak / strong positive (score 1+ to 2+) (Figure 2a; see Example 1). Of the 366 NSCLC cases studied, TTK was strongly stained in 135 (36.9%; score 2+), weakly stained in 116 (31.7%; score 1+), and not stained in 115 ( 31.4%; score 0). Gender (high in male; P = 0.0006 Fisher's exact test), histological classification (high in SCC; P = 0.0206 chi-square test), pT stage (high in T2, T3, T4; P <0.0001 chi-square test ), And pN stage (high in N1, N2; P = 0.0006 chi-square test) was significantly associated with strong TTK positivity (score 2+) (Table 1a). The Kaplan-Meier method showed a significant relationship between strong positive TTK staining and tumor-specific survival in NSCLC (P <0.0001 log rank test) (Figure 2b). Univariate analysis revealed age (? 65 vs <65), gender (male vs female), histological classification (non-ADC vs ADC), pT stage (T2, T3, T4 vs T1), pN stage (N1, N2 (N0), and strong TTK positivity (score 2+ vs 1 +, 0) were all significantly associated with tumor-specific poor survival in NSCLC patients (Table 1b, top). In multivariate analysis of prognostic factors, age, pT stage, pN stage and strong TTK positivity were shown to be independent prognostic factors (Table 1b, bottom).

ADC, 腺癌; SCC, 扁平上皮癌; LCC, 大細胞癌
P < 0.05 (カイ二乗検定)
NS, 有意差なし
SCC 対 他 (ADC + LCC) (Table 1a) Relationship between TTK positivity in NSCLC tissues and patient characteristics (n = 366)

ADC, adenocarcinoma; SCC, squamous cell carcinoma; LCC, large cell carcinoma
P <0.05 (chi-square test)
NS, no significant difference
SCC vs. Other (ADC + LCC)

1SCC, 扁平上皮癌
* P < 0.05
NS, 有意差なし (Table 1b) Cox proportional hazard model analysis of prognostic factors in patients with NSCLC

1SCC, squamous cell carcinoma
* P <0.05
NS, no significant difference

Example 4: Suppression of lung cancer cell growth by siRNA against TTK
To assess whether TTK is important for lung cancer cell growth / survival, two control plasmids (luciferase (LUC) or siRNA against Scramble (SCR)) and siRNA against TTK (si-TTK-1 and- Plasmids expressing 2) were constructed and transfected into LC319 and A549 cells, respectively (representative data for LC319 is shown in FIG. 3a). The amount of TTK transcript in the two NSCLC cell lines transfected with si-TTK-1 was significantly reduced compared to the two control siRNAs (Figure 3a, upper left panel). Cell viability and colony numbers of cells transfected with si-TTK-1 as measured by MTT and colony formation assays were significantly reduced compared to the two control siRNAs (Figure 3a, lower left and right panels). ). si-TTK-2 showed a weak decrease in TTK expression and a slight growth inhibitory effect. This result suggested the effect of TTK proliferation in NSCLC cells.

Example 5: Growth promotion effect by TTK
To determine whether TTK plays an important role in cell proliferation, a HEK293-derived transfectant that steadily expresses TTK was established. Growth of HEK293 cells expressing exogenous TTK was promoted to a significant degree consistent with the expression level of TTK compared to the growth of control cells transfected with mock vector (FIGS. 3b and 3c) . TTK-introduced HEK293 cells implanted subcutaneously in mice also exhibited a high growth rate compared to control cells (FIG. 3d). This result suggested the effect of promoting TTK proliferation in NSCLC cells.

Example 6: Activation of intracellular invasive activity by TTK Immunohistochemical analysis in tissue microarrays showed that lung cancer patients with TTK strong positive tumors had shorter cancer-specific survival times than TTK negative patients In order to investigate whether TTK plays a role in cell invasion ability, we performed a Matrigel invasion assay. Infiltration of NHI-3T3 cells transfected with TTK expression vector through Matrigel was significantly promoted compared to control cells transfected with mock or TTK-KD vector, and TTK is a highly malignant expression of lung cancer cells It was suggested that it may be involved in the mold (Fig. 3e).

Example 7: Identification of EGFR as a novel substrate protein for TTK To elucidate the function of TTK kinase in carcinogenesis, we identify a substrate protein that is phosphorylated by TTK and activates cell proliferation signals. Tried. Immunoblot screening of kinase substrates for TTK was performed using a cell lysate of COS-7 cells transfected with a TTK expression vector and a series of antibodies specific for phosphoproteins associated with cancer cell signals. (See Example 1). A total of 31 phosphorylated proteins were screened (Table 2). EGFR Tyr-992 was found to be significantly phosphorylated in cells transfected with the TTK expression vector compared to those using the mock vector (FIG. 4a). In this screen, various phosphorylated Tyr residues within the cytoplasmic domain of EGFR (Tyr-845, Tyr-992, Tyr-1045, Tyr-1068, Tyr-1148, and Tyr-1173) (Amos S, et al. , J Biol Chem. 2005 Mar 4; 280 (9): 7729-38.Epub 2004 Dec 23; Biscardi JS, et al., J Biol Chem. 1999 Mar 19; 274 (12): 8335-43; Honegger A, et al., EMBO J. 1988 Oct; 7 (10): 3045-52; Sorkin A, et al., J Biol Chem. 1991 May 5; 266 (13): 8355-62; Wang XQ, et al., J Biol Chem. 2003 Dec 5; 278 (49): 48770-8. Epub 2003 Sep 25.) and those that recognize phosphorylated Ser-1046 / 1047 (Countaway JL, et al., J Biol Chem. 1992 Jan 15; 267 (2): 1129-40; Gamou S & Shimizu N. J Cell Physiol. 1994 Jan; 158 (1): 151-9.), A total of seven phosphorylation specific antibodies And only Tyr-992 phosphorylation was found (data not shown). In order to confirm the specific phosphorylation of Tyr-992 by TTK kinase, COS-7 cells were transfected with a catalytically inactive TTK-KD expression vector. Not detected (Figure 4a). These data suggest that TTK kinase activity can regulate Tyr-992 phosphorylation very selectively in the EGFR signal.

Table 2 List of phosphorylation specific antibodies used for immunoblot screening of substrate proteins against TTK kinase

  Endogenous binding between TTK and EGFR in lung cancer cells was also examined by immunoprecipitation experiments using extracts from A549 cells, and the interaction between these two proteins was detected regardless of EGF stimulation (Figure 4b). To further investigate the relationship of TTK to EGFR signaling, TTK or EGFR function was suppressed in A549 cells and the cell morphology was observed microscopically. Treated with EGFR tyrosine kinase inhibitor, AG1478 (triphostin 4- (3-chloroanilino) -6,7-dimethoxyquinazoline), similar to cells transfected with RNAi-TTK (oligo) or RNAi-EGFR (oligo) The A549 cells were very large with many nuclei (Fig. 4c). These results support that TTK is associated with an EGF-independent intracellular EGFR activation signal.

  To further confirm the specific phosphorylation of EGFR Tyr-992 by TTK, an in vitro kinase assay was performed by incubating whole cell extracts prepared from COS-7 cells and purified His-tagged TTK. It was. To investigate individual phosphorylation sites, phosphorylation-specific antibodies against EGFR (Tyr-845, Tyr-992, Tyr-1045, Tyr-1068, corresponding to various phosphorylated Tyr residues in the cytoplasmic domain of EGFR) Tyr-1148, and Tyr-1173) were applied. Western blot analysis showed dose-dependent phosphorylation of EGFR Tyr-992 by recombinant TTK, while no phosphorylation of other Tyr residues in EGFR was detected (Figure 4d, left panel). On the other hand, all these Tyr residues were phosphorylated by stimulation of EGFR with the ligand EGF in COS-7 cells, suggesting that each phosphorylated EGFR-specific antibody can accurately recognize each phosphorylation site (Fig. 4d, right panel). Evidence that EGF stimulation in COS-7 cells induces phosphorylation of all six Tyr residues further supports the specific kinase activity of TTK against EGFR Tyr-992.

  EGFR tyrosine phosphorylation sites were further evaluated by TTK using GST-tagged proteins containing various cytoplasmic regions of EGFR as substrates (EGFR-DEL1, -DEL2, and -DEL3; FIG. 4e). GST-tagged EGFR protein was produced in E. coli and subjected to in vitro kinase assay using purified recombinant TTK, followed by Western blot analysis with anti-phosphorylated Tyr992 EGFR antibody. Phosphorylation of EGFR Tyr-992 in GST-tagged EGFR-DEL2 protein (amino acids 889-1045) is promoted in a TTK dose-dependent manner, whereas GST-tagged EGFR-DEL1 (amino acids 692-891), EGFR-DEL2 and EGFR- Other tyrosine residues in the DEL3 (amino acids 1046-1186) protein were not phosphorylated at all (Figure 4f). In the presence of ATP by in vitro kinase assay using catalytically active recombinant GST-tagged human EGFR (active-rhEGFR; Upstate) and subsequent Western blot analysis using anti-phosphotyrosine antibody Active-rhEGFR was shown to undergo autophosphorylation on tyrosine (FIG. 4g, lane 2). This phosphorylation was dose-dependently inhibited by the EGFR tyrosine kinase inhibitor, AG1478 (triphostin 4- (3-chloroanilino) -6,7-dimethoxyquinazoline) (data not shown). However, as shown in FIG. 4g, lane 4, phosphorylation of active-rhEGFR by TTK was not inhibited by AG1478. This result further confirmed the direct phosphorylation of EGFR by TTK.

  Immunohistochemical analysis was further performed with anti-phosphorylated EGFR (Tyr-992) antibody using a tissue microarray consisting of 336 NSCLC and 12 SCLC tissues. Of 366 NSCLC cases, 123 cases (33.6%) showed strong phosphorylated EGFR (Tyr-992) staining (score 2+), 121 cases (33.1%) had weak staining (score 1+), 122 cases No staining was observed at (33.3%) (score 0), whereas staining for phosphorylated EGFR (Tyr-992) was not observed in any of the examined normal lung tissues (FIG. 4h). Of the 12 SCLCs, 3 (25%) were positive for phosphorylated EGFR (Tyr-992). Of the 336 cases, 203 were positive (scored as 1+ to 2+) for both TTK and phosphorylated EGFR (Tyr-992) tumors, and 74 were negative for both proteins. Of the 366 cases, 48 were positive only for TTK, and 41 were positive only for phosphorylated EGFR (Tyr-992). The fact that the phosphorylated EGFR (Tyr-992) positive pattern was significantly consistent with TTK positive in these tumors (÷ 2 = 72.585; P <0.0001) independently confirmed the results obtained by the in vitro assay. Strong expression (score 2+) of phosphorylated EGFR (Tyr-992) in NSCLC is gender (high in men; P = 0.0086 Fisher exact test), histological classification (high in SCC; P = 0.0483 chi-square Test), pT stage (high at T2, T3, T4; P = 0.0006 chi-square test), pN stage (high at N1, N2; P <0.0001 chi-square test), and tumor-specific survival (P <0.0001 log) (Table 3a; FIG. 4i). In univariate and subsequent multivariate analysis of prognostic factors, age, pT stage, pN stage, and strong phosphorylated EGFR (Tyr-992) positive were shown to be independent prognostic factors (Table 3b, top and bottom) ). NSCLC patients whose tumors did not express TTK or phosphorylated EGFR (Tyr-992) had the longest survival benefit, while those with strong positive values for both markers had the shortest tumor-specific survival (P < 0.0001, log rank test; FIG. 4j).

ADC, 腺癌; SCC, 扁平上皮癌; LCC, 大細胞癌
* P < 0.05 (カイ二乗検定)
NS, 有意差なし (Table 3a) Association between phosphorylated EGFR positivity in NSCLC tissues and patient characteristics (n = 366)

ADC, adenocarcinoma; SCC, squamous cell carcinoma; LCC, large cell carcinoma
* P <0.05 (chi-square test)
NS, no significant difference

1 SCC, 扁平上皮癌
* P < 0.05
NS, 有意差なし (Table 3b) Cox proportional hazard model analysis of prognostic factors in patients with NSCLC

1 SCC, squamous cell carcinoma
* P <0.05
NS, no significant difference

  Next, the necessity of EGF for phosphorylation of EGFR by TTK was examined. Microscopically, TTK is overexpressed exogenously in serum-deficient COS-7 cells and phosphorylated EGFR (Tyr-992) is detected as a small spot around the nucleus in cells that express only TTK. Observed (Figures 4k and 4l). Endogenous phosphorylated EGFR (Tyr-992) was localized in the nucleus of serum-deficient A549 cells that overexpress TTK endogenously (Figure 4m, left panel), but RNAi-TTK Reduction of TTK protein by (oligo) significantly reduced phosphorylated EGFR (Tyr-992) (FIG. 4m, right panel). This data suggested TTK-induced phosphorylation of EGFR at Tyr-992 and its internalization that occurred independently of EGF stimulation.

Example 8: Activation of MAPK signal by phosphorylated EGFR (Tyr-992) in the TTK-dependent tumorigenic pathway Next, the phosphorylation level of EGFR Tyr-992 was examined in the mitotic phase of A549 cells, where TTK Expression levels were significantly elevated (Figure 5a). The phosphorylation level of EGFR in Tyr-992 was consistent with the expression level of phosphorylated TTK. In order to evaluate whether large expression of TTK is essential for EGFR Tyr-992 in cancer cells, the expression of TTK mRNA was selectively knocked down in A549 cells using siRNA against TTK (RNAi-TTK (oligo)). Reduction of TTK protein by RNAi-TTK (oligo) decreased phosphorylation of EGFR Tyr-992 (FIG. 5b), indicating that endogenous TTK in lung cancer cells induces EGFR phosphorylation.

  EGFR Tyr-992 is known to be the binding site for two adapter proteins, phospholipase Cγ (PLCγ) and Shc, and its phosphorylation is required for activation (phosphorylation) of these adapter proteins 15-17. The Therefore, the present inventors examined the phosphorylation levels of these adapter proteins after down-regulating TTK expression by RNAi-TTK (oligo). Decreased phosphorylation of phosphorylated PLCγ and p44 / 42 MAPK was observed as RNAi-TTK (oligo) decreased phosphorylated EGFR Tyr-992, whereas this RNAi increased the amount of PLCγ or p44 / 42 MAPK protein. Had no effect (Figure 5b). Immunocytochemical analysis revealed that phosphorylated p44 / 42 MAPK was accumulated in the nuclei of COS-7 cells transfected with the TTK expression vector (FIG. 5c). Furthermore, the interaction between PLCγ and EGFR was confirmed by immunoprecipitation experiments using extracts from COS-7 cells transfected with a TTK expression vector, while their binding was either TTK-KD or Little was observed in cells transfected with the mock vector (FIG. 5d).

Example 9: Identification of a novel phosphorylation site (Ser-967) by TTK in EGFR
GST-tagged EGFR-DEL2 protein phosphorylated by TTK was detected as a double band (FIG. 4f, right panel). To confirm whether EGFR Tyr-992 is the only phosphorylation site on EGFR, a [γ- ³² P] ATP in vitro kinase assay was performed using a GST-tagged EGFR-DEL2 with Tyr-992 replaced with alanine. (Y992A) was performed using protein. This mutation significantly reduced the intensity of the lower band, but not the intensity of the upper band (FIG. 6a). That fact prompted us to screen for other TTK-dependent phosphorylation sites on EGFR. MALDI tandem mass spectrometry analysis was performed using GST-tagged EGFR-DEL2 protein in vitro phosphorylated by TTK, and phosphorylation of EGFR Ser-967 was detected (data not shown). Next, an anti-phosphorylated EGFR (Ser-967) antibody was produced for immunization using Ser-967 phosphorylated synthetic peptide, and the expression pattern of TTK, phosphorylated EGFR (Ser-967) and total in lung cancer cells EGFR was examined by Western blotting. Interestingly, the phosphorylation level of EGFR Ser-967 in NSCLC cells was significantly correlated with the protein expression level of TTK (FIG. 6b), indicating that EGFR Ser-967 was phosphorylated by TTK. Next, TTK was overexpressed in COS-7 cells, and it was observed microscopically that phosphorylated EGFR (Ser-967) increased in the nucleus of TTK expressing cells (FIG. 6c). Immunocytochemical analysis demonstrated that endogenous phosphorylated EGFR (Ser-967) was localized in the nucleus of A549 cells overexpressing endogenous TTK (Figure 6d, left panel), but RNAi- Inhibition of TTK protein expression by TTK (oligo) significantly reduced the level of phosphorylated EGFR Ser-967 (FIG. 6d, right panel). These results suggest TTK-induced phosphorylation of EGFR in Ser-967 and its nuclear translocation that occurs independently of EGF stimulation.

  Immunohistochemical analysis was also performed on anti-phosphorylated EGFR (Ser-967) antibodies using a tissue microarray consisting of 374 NSCLC, and a pattern of phosphorylated EGFR (Ser-967) positive was observed in TTK in these tumors. Significant agreement with the positive was found (P <0.0001) and the results obtained by the in vitro assay were independently confirmed. Strong expression of phosphorylated EGFR (Ser-967) in NSCLC was significantly correlated with tumor-specific survival (P <0.0001 by log rank test) (Figures 6e and 6f; details are shown in Tables 4a and 4b) . These evidences also indicate that phosphorylation of EGFR by TTK at Ser-976 can significantly affect the growth and malignant nature of lung cancer cells.

ADC, 腺癌; SCC, 扁平上皮癌
他, 大細胞癌および腺扁平上皮癌
*ADC 対 他の組織学的診断
⁺P < 0.05 (Fisherの直接確率検定)
NS, 有意差なし (Table 4a) Correlation of nuclear EGFR positivity and patient characteristics in NSCLC tissues (n = 351)

ADC, adenocarcinoma; SCC, squamous cell carcinoma, etc., large cell carcinoma and adenosquamous cell carcinoma
* ADC vs. other histological diagnoses
⁺ P <0.05 (Fisher's exact test)
NS, no significant difference

¹ ADC, 腺癌
* P < 0.05 (Table 4b) Cox proportional hazards model analysis of prognostic factors in NSCL patients

¹ ADC, adenocarcinoma
* P <0.05

Example 10: Inhibition of cell proliferation / invasion by targeting the TTK-EGFR pathway
To further investigate the involvement of EGFR in TTK-induced cell proliferation / invasion, we next introduced RNAi-EGFR (oligo) into a HEK293-derived transfectant that constantly expresses TTK. . The proliferation of HEK293 cells was hardly decreased by RNAi-EGFR (oligo) (P = 0.2439) (control cells transfected with mock vector), but TTK-induced cell proliferation was significantly decreased by RNAi-EGFR (P = 0.0032) (Figure 7a). Invasion in TTK-introduced HEK293 cells through Matrigel was significantly promoted compared to control cells (P <0.0001), and TTK-induced cell invasion was reduced to near base levels by RNAi-EGFR (P <0.0001). Control cell infiltration was slightly reduced by RNAi-EGFR (oligo) (P <0.0001) (P <0.0161) (Figure 7b).

  Next, the biological significance of the binding of TTK and EGFR protein and its potential as a therapeutic target for lung cancer were examined. As shown in FIG. 3c, phosphorylation of EGFR Tyr-992 in GST-tagged EGFR-DEL2 protein (amino acids 889-1045) was promoted in a TTK dose-dependent manner, whereas EGFR-DEL4 (amino acids 977-1045) protein The N-terminal truncated form of EGFR-DEL2 referred to as was not phosphorylated by Tyr-992 (data not shown). These experiments suggested that the 88 amino acid polypeptide in EGFR (amino acids 889-976) plays an important role for interaction with TTK. In order to investigate the functional significance of the interaction between TTK and EGFR for the growth or survival of lung cancer cells, we developed a bioactive cell penetrating peptide that is predicted to inhibit the binding of these two proteins. . Seven different peptides of 19 or 30 amino acid sequence containing EGFR codon 889-1001 were synthesized (see Example 1). These peptides were covalently linked at the NH2 terminus to membrane transmissible 11 arginine residues (11R). The effect on proliferation was assessed by adding seven 11R-EGFR peptides to the media of A549 cells, 11R-EGFR899-917 (SEQ ID NO: 44), 11R-EGFR918-936 (SEQ ID NO: 45) or Treatment with 11R-EGFR937-955 (SEQ ID NO: 46) peptide significantly reduced cell viability as measured by MTT assay (FIG. 7c).

Example 11: Activated mutation of TTK in lung cancer Oncogenic protein kinase activation by somatic mutation in the kinase domain is one of the general mechanisms of tumorigenesis (Herbst, RS, et al., Nat Rev Cancer 4, 956-965. (2004); Pal, SK and Pegram, M., Anticancer Drugs. 16, 483-494. (2005)). To investigate the presence of mutational activation of TTK, the TTK kinase domain was directly sequenced using mRNA prepared from 36 lung cancer cell lines and 60 clinical lung cancer tissue samples (30 primary) NSCLC and 30 primary NSCLC-derived metastatic brain tumors). A missense mutation was found at codon 574 (Y574C) of the RERF-LC-AI cell line and was not reported in the SNP database (JSNP: http://snp.ims.u-tokyo.ac.jp/index_en) DBSNP: http://www.ncbi.nlm.nih.gov/projects/SNP/) (FIG. 8a, left panel). In addition, two missense mutations were identified in clinical specimens of two metastatic brain tumors derived from primary lung adenocarcinoma. The mutation resulted in an amino acid substitution; valine to phenylalanine (V610F) at codon 610 (case 2; FIG. 8a, middle panel) and glutamine to histidine (Q753H) at codon 753 (case 8; FIG. 8a, right panel) . Corresponding normal brain tissue from these two patients shows only wild-type DNA sequences, indicating that these two mutations occurred somatically during tumor formation or progression.

  In order to evaluate the functional properties of mutant TTK identified by mutation analysis, two mutant TTK proteins (Y574C or Q753H) were expressed in cultured mammalian cells. Autophosphorylated TTK (phospho-TTK) levels are significantly higher in NIH-3T3 cells expressing mutant TTK than in cells transfected with wild-type TTK (wt-TTK) expression vectors. It was shown that the kinase activity can be promoted (FIG. 8b). Since the invasion ability of NIH-3T3 cells was enhanced by transient expression of wt-TTK (FIG. 3e), a Matrigel invasion assay was then performed using NIH-3T3 cells transfected with the TTK-Y574C construct. Transfection of NIH-3T3 cells with mutant TTK (Y574C or Q753H) resulted in a significant increase in the number of infiltrating cells compared to wt-TTK transfection (FIGS. 8c and 8d). These results indicate that TTK mutations in the kinase domain are considered to belong to the category of hyperactive mutations that can contribute to lung cancer progression.

Consideration
Mps1 (TTK is its human homolog) was first discovered in budding yeast as a factor required for centrosome replication (Winey M, et al., J Cell Biol. 1991 Aug; 114 (4): 745-54 ), And was later shown to have an important function in the spindle checkpoint (Weiss E & Winey M. J Cell Biol. 1996 Jan; 132 (1-2): 111-23.). In humans, overexpression of TTK has been found in several cancers, but its functional significance in carcinogenesis remains unclear (Stucke VM, et al., EMBO J. 2002 Apr 2; 21 (7): 1723-32.).

It has been shown herein that treatment of NSCLC cells with specific siRNA against TTK reduces its expression and results in growth suppression. The growth promoting effect of TTK introduction in mammalian cells also supports its oncogenic function. The results obtained by in vitro and in vivo assays suggest that TTK plays an important role in human cancer, and that screening for molecules targeting the TTK pathway provides a promising therapeutic approach for lung cancer treatment. EGFR, whose pathway is related to carcinogenesis in various tissues, is disclosed herein as a novel intracellular target molecule for TTK kinase. Also shown herein is the discovery by tissue microarray analysis that NSCLC patients with high levels of TTK and phosphorylated EGFR (Tyr-992 or Ser-967) show shorter tumor-specific survival. ing. EGFR autophosphorylation has been shown to play an important role in the activation of the MAPK cascade following EGF stimulation. Of the phosphorylation sites of EGFR, Tyr-992 has been proven to be a high binding affinity site for PLCγ and is required for EGF-stimulated PLCγ activation (Rotin D, et al., EMBO J. 1992 Feb; 11 (2): 559-67.). PLCγ activates the Ras / MAPK cascade by periodic variation in inositol 1,4,5-triphosphate production and cytoplasmic Ca ²⁺ (Schmidt-Ullrich RK, Oncogene. 2003 Sep 1; 22 (37): 5855 -65.) Activation of the MAP kinase pathway is associated with cell division, and its abnormal activity is presumed to be associated with uncontrolled cell growth occurring in tumors (Pal SK & Pegram M. Anticancer Drugs. 2005 Jun; 16 (5 ): 483-94.). Interestingly, the data herein show that phosphorylation of EGFR at Tyr-992 and Ser-967 by TTK is independent of EGF stimulation. EGFR Ser-967 phosphorylation has been reported to be constitutive phosphorylation (Elisabetta et al., 2005), but was not associated with any role in its function. EGFR phosphorylation at Ser-967 was mainly detected in nuclear EGFR. Nuclear EGFR has recently been reported as a transcription factor or transcription coactivator (Lin et al., Nat Cell Biol. 3: 802-8 (2001)). Our data showed that EGFR phosphorylation at Ser-967 may be important for nuclear translocation of EGFR during lung cancer formation.

  The DNA sequence of the TTK kinase domain in 36 lung cancer cell lines and 60 primary and metastatic NSCLC was also examined, from which one lung squamous cell carcinoma cell line with an activating mutation that promotes cell invasive activity was Identified. Point mutations were also found in two cases of brain metastatic lesions of adenocarcinoma. Interestingly, abundant expression of TTK protein kinase was observed in the majority of various histological types of lung cancer samples, with higher expression observed in advanced stage tumors, especially in brain metastases (FIG. 9). Previous reports have also shown that the EGFR-PLCγ signaling pathway plays a particularly important role in invasive and metastatic sites of prostate cancer, breast cancer and squamous cell carcinoma of the head and neck (Chen P, et al., J Cell Biol. 1994 Feb; 124 (4): 547-55 .; Chen P, et al., J Cell Biol. 1994 Nov; 127 (3): 847-57 .; Thomas SM, et al., Cancer Res 2003 Sep 1; 63 (17): 5629-35.). These in vitro and in vivo data show that TTK plays an important role as a key molecule associated with brain metastasis through activation of the EGFR-PLCγ signaling pathway and is specific for lung cancer patients carrying TTK mutations. The population showed more potential for brain metastatic disease.

  In summary, the present invention is expected to develop a new strategy for the treatment of lung cancer patients by targeting EGFR signaling in cells by activated TTK kinase and targeting TTK enzyme activity. For the first time.

Industrial Applicability As demonstrated herein, TTK has kinase activity against EGFR, and inhibition of this activity leads to inhibition of cell proliferation of lung cancer cells. Therefore, an agent that inhibits the kinase activity of TTK against EGFR has therapeutic utility as an anticancer agent for the treatment of lung cancer. For example, the phosphorylation site of EGFR by TTK is Try922 or Ser967, which is phosphorylation independent of EGF.

  The present invention also provides a method for screening an anticancer agent that inhibits TTK kinase activity against EGFR. EGFR is recognized as an important mediator of the growth signaling pathway. Thus, it is expected that candidate compounds that inhibit key steps for cell proliferation can be identified by the present invention.

  Furthermore, the present invention shows that treatment of lung cancer cells with siRNA against TTK suppresses its expression and suppresses TTK kinase activity against EGFR in Tyr-992 or Ser-967, thus preventing cancer cell proliferation. It shows that it suppresses. This data implies that upregulation of TTK function and kinase activity of TTK against EGFR are general features of lung cancer formation. Thus, selective inhibition of TTK kinase activity can be a promising therapeutic strategy for the treatment of lung cancer patients.

  Alternatively, lung cancer can be detected using TTK kinase activity against EGFR as a diagnostic marker.

  Furthermore, it has been shown herein that high levels of TTK expression and / or phosphorylated EGFR are significantly associated with poor prognosis in patients with lung cancer. Therefore, the prognosis of lung cancer can be evaluated or determined by measuring TTK expression level and / or phosphorylated EGFR (Tyr992 or Ser967).

  In the present invention, it has also been shown that TTK mutations are associated with a high risk of lung cancer metastasis. Therefore, risk assessment of lung cancer metastasis can be achieved by detecting the mutation. Furthermore, a method for detecting a TTK mutation is also provided by the present invention.

  All patents, patent applications and publications cited herein are incorporated by reference in their entirety. However, this invention should not be construed as an admission that the invention is not entitled to antedate prior disclosure by the prior invention.

  Although the invention has been described in detail and with reference to specific embodiments thereof, the foregoing description is illustrative and explanatory in nature and is intended to exemplify the invention and its preferred embodiments. Should be understood. Those skilled in the art will readily appreciate through routine experimentation that various changes and modifications can be made without departing from the spirit and scope of the invention. As will be appreciated by one skilled in the art, further advantages and features will become apparent from the appended claims, along with the claims that are to be determined by reasonable equivalents. Thus, the invention is intended to be defined not by the above description, but by the following claims and their equivalents.

Claims (47)

A method for assessing the prognosis of lung cancer comprising the following steps:
a. detecting either or both of TTK expression level and EGFR phosphorylation level in a sample taken from a subject to assess prognosis of lung cancer, and
b. showing a poor prognosis when an increase in either or both of the TTK expression level and EGFR phosphorylation level is detected compared to the control level. The method of claim 1, wherein the TTK expression level is detected by any one method selected from the group consisting of:
(a) a method for detecting the presence of mRNA encoding the amino acid sequence of SEQ ID NO: 2,
(b) a method for detecting the presence of a protein comprising the amino acid sequence of SEQ ID NO: 2, and
(c) A method for detecting the biological activity of a protein comprising the amino acid sequence of SEQ ID NO: 2.   The method according to claim 2, wherein the biological activity of (c) is a kinase activity against EGFR.   2. The method of claim 1, wherein the phosphorylation level of EGFR is detected with 992 amino acid residue tyrosine or 967 amino acid residue serine of SEQ ID NO: 42. A kit for assessing prognosis of lung cancer comprising any one component selected from the group consisting of:
(a) a reagent for detecting an mRNA encoding the amino acid sequence of SEQ ID NO: 2,
(b) a protein comprising the amino acid sequence of SEQ ID NO: 2, or a reagent for detecting tyrosine of the 992 amino acid residue of SEQ ID NO: 42 or serine of the 967 amino acid residue, and
(c) A reagent for detecting the biological activity of a protein comprising the amino acid sequence of SEQ ID NO: 2.   A method of diagnosing a predisposition to developing lung cancer or lung cancer comprising determining TTK expression level or EGFR phosphorylation level in a biological sample from a subject, wherein the expression in the sample is compared to a normal control level of the gene A method wherein an increase in level or phosphorylation level indicates that the subject is suffering from or at risk for developing lung cancer.   The method of claim 6, wherein the expression level of the sample is at least 10% higher than the normal control level. 7. The method of claim 6, wherein the TTK expression level is determined by a method selected from the group consisting of:
a) a method of detecting mRNA encoding the amino acid sequence of SEQ ID NO: 2;
b) a method for detecting a protein comprising the amino acid sequence of SEQ ID NO: 2, and
c) A method for detecting the biological activity of a protein comprising the amino acid sequence of SEQ ID NO: 2.   9. The method of claim 8, wherein the biological activity is kinase activity against EGFR.   7. The method of claim 6, wherein the EGFR phosphorylation level is detected with 992 amino acid residue tyrosine or 967 amino acid residue serine of SEQ ID NO: 42.   The method of claim 6, wherein the subject-derived biological sample comprises epithelial cells.   The method of claim 6, wherein the biological sample comprises lung cells.   The method of claim 6, wherein the biological sample comprises epithelial cells derived from lung tissue.   A kit for diagnosing a subject's lung cancer or a predisposition to developing lung cancer, comprising a reagent for detecting the kinase activity of TTK against EGFR.   The kit according to claim 14, wherein the kinase activity of TTK against EGFR is phosphorylation of EGFR by TTK independent of EGF. A method for measuring the kinase activity of TTK against EGFR comprising the following steps:
incubating EGFR or a functional equivalent thereof with TTK under conditions suitable for EGFR phosphorylation by TTK, wherein TTK is selected from the group consisting of:
i. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 (TTK);
ii. A polypeptide comprising an amino acid sequence in which one or more amino acids of SEQ ID NO: 2 are substituted, deleted or inserted, and the resulting polypeptide consists of the amino acid sequence of SEQ ID NO: 2 A polypeptide having a biological activity equivalent to the polypeptide;
iii. a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 1, wherein the resulting polypeptide is an amino acid of SEQ ID NO: 2 A polypeptide having a biological activity equivalent to a polypeptide comprising the sequence;
b. detecting phosphorylated EGFR levels; and
c. A step of measuring TTK kinase activity by correlating with the phosphorylated EGFR level detected in step (b).   17. The method of claim 16, wherein the functional equivalent of EGFR is a fragment comprising the amino acid sequence of SEQ ID NO: 43.   17. The method of claim 16, wherein phosphorylated EGFR levels are detected with 992 amino acid residues tyrosine or 967 amino acid residues serine of SEQ ID NO: 42. A method for identifying an agent that alters TTK kinase activity against EGFR comprising the following steps:
a step of incubating EGFR or a functional equivalent thereof with TTK in the presence of a test compound under conditions suitable for phosphorylation of EGFR by TTK, wherein TTK is selected from the group consisting of Steps that are peptides:
i. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 (TTK);
ii. A polypeptide comprising an amino acid sequence in which one or more amino acids of SEQ ID NO: 2 are substituted, deleted or inserted, and the resulting polypeptide consists of the amino acid sequence of SEQ ID NO: 2 A polypeptide having a biological activity equivalent to the polypeptide;
iii. a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 1, wherein the resulting polypeptide is an amino acid of SEQ ID NO: 2 A polypeptide having a biological activity equivalent to a polypeptide comprising the sequence;
b. detecting phosphorylated EGFR levels; and
c. Comparing a control level with a phosphorylated EGFR level, wherein an increase or decrease in phosphorylated EGFR level compared to a normal control level indicates that the test compound modifies TTK kinase activity against EGFR.   20. The method of claim 19, wherein the functional equivalent of EGFR is a fragment comprising the amino acid sequence of SEQ ID NO: 43.   20. The method of claim 19, wherein phosphorylated EGFR levels are detected with 992 amino acid residues tyrosine or 967 amino acid residues serine of SEQ ID NO: 42. A method for screening a compound for treating and / or preventing lung cancer, comprising the following steps:
a step of incubating EGFR or a functional equivalent thereof with TTK in the presence of a test compound under conditions suitable for phosphorylation of EGFR by TTK, wherein TTK is selected from the group consisting of Steps that are peptides:
i. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 (TTK);
ii. A polypeptide comprising an amino acid sequence in which one or more amino acids of SEQ ID NO: 2 are substituted, deleted or inserted, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 2; A polypeptide having an equivalent biological activity;
iii. A polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 1, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 2. A polypeptide having a biological activity equivalent to the polypeptide;
b. detecting phosphorylated EGFR levels; and
c. selecting a compound that reduces phosphorylated EGFR levels compared to control levels.   23. The method of claim 22, wherein the functional equivalent of EGFR is a fragment comprising the amino acid sequence of SEQ ID NO: 43.   23. The method of claim 22, wherein phosphorylated EGFR levels are detected with 992 amino acid residue tyrosine or 967 amino acid residue serine of SEQ ID NO: 42. A kit comprising the following components for detecting the ability of a test compound to alter the kinase activity of TTK against EGFR:
A) A polypeptide selected from the group consisting of:
i. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 (TTK);
ii. A polypeptide comprising an amino acid sequence in which one or more amino acids of SEQ ID NO: 2 are substituted, deleted or inserted, and the resulting polypeptide consists of the amino acid sequence of SEQ ID NO: 2 A polypeptide having a biological activity equivalent to the polypeptide;
iii. a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 1, wherein the resulting polypeptide is an amino acid of SEQ ID NO: 2 A polypeptide having a biological activity equivalent to a polypeptide comprising the sequence;
B) an EGFR or EGFR fragment comprising the amino acid sequence of SEQ ID NO: 43; and
C) Reagent for detecting phosphorylated EGFR. A kit comprising the following components for detecting the ability of a test compound to alter the kinase activity of TTK against EGFR:
A) EGFR or EGFR fragment comprising the amino acid sequence of SEQ ID NO: 43, and a cell expressing a polypeptide selected from the group consisting of:
i. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 (TTK);
ii. A polypeptide comprising an amino acid sequence in which one or more amino acids of SEQ ID NO: 2 are substituted, deleted or inserted, and the resulting polypeptide consists of the amino acid sequence of SEQ ID NO: 2 A polypeptide having a biological activity equivalent to the polypeptide;
iii. a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 1, wherein the resulting polypeptide is an amino acid of SEQ ID NO: 2 A polypeptide having a biological activity equivalent to a polypeptide comprising the sequence;
B) Reagent for detecting phosphorylated EGFR. A method for predicting metastasis of lung cancer comprising the following steps:
a. detecting one or more mutations of TTK in the kinase domain;
b. A process that indicates a high risk of lung cancer metastasis if a mutation is detected.   One or more mutations of TTK in the kinase domain are from valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2, glutamine to histidine (Q753H) at codon 753, and tyrosine to cysteine at codon 574 (Y574C). 28. The method of claim 27, selected from the group consisting of: A method of detecting one or more mutations in TTK comprising the steps of: valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2, glutamine to histidine at codon 753 (Q753H) And at least one mutation selected from the group consisting of tyrosine to cysteine (Y574C) at codon 574, the method:
a) contacting the polypeptide of interest or cDNA encoding the polypeptide with a binding agent that recognizes any one of the mutations of the polypeptide or cDNA encoding the polypeptide,
b) detecting the polypeptide or cDNA encoding it and a binding agent; and
c) A step in which a TTK mutation is indicated when binding of the drug in step b) is detected.   The binding agent is at least one selected from the group consisting of valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2, glutamine to histidine (Q753H) at codon 753, and tyrosine to cysteine (Y574C) at codon 574. 30. The method of claim 29, wherein the method is an antibody that binds to a polypeptide comprising a mutation, and wherein the binding agent does not substantially bind to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2.   The reagent includes a binding agent that recognizes either one of the polypeptide or the cDNA mutation encoding it, wherein the mutation is valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2, and glutamine to histidine at codon 753 ( Q753H), and a reagent that detects one or more mutations of TTK, which is at least one mutation selected from the group consisting of tyrosine to cysteine (Y574C) at codon 574.   The binding agent is at least one selected from the group consisting of valine to phenylalanine (V610F) at codon 610 of SEQ ID NO: 2, glutamine to histidine (Q753H) at codon 753, and tyrosine to cysteine (Y574C) at codon 574. 32. The reagent of claim 31, wherein the reagent binds to a polypeptide comprising a mutation and does not substantially bind to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2.   An isolated polynucleotide comprising a mutant nucleic acid sequence of SEQ ID NO: 1 comprising one or more mutations selected from the group consisting of A1870G (for V610F), G1977T (for Q753H) and G2408C (for Y574C) Or a fragment thereof comprising said one or more mutations.   An isolated polypeptide comprising a mutated amino acid sequence of SEQ ID NO: 2, comprising one or more mutations selected from the group consisting of V610F, Q753H and Y574C, or a substance comprising said one or more mutations fragment. (a) a polypeptide comprising ISSILEKGERLPQPPICTI (SEQ ID NO: 44), DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46), and
(b) a polypeptide functionally equivalent to a polypeptide selected from the group consisting of ISSILEKGERLPQPPICTI (SEQ ID NO: 44), DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) and FRELIIEFSKMARDPQRYL (SEQ ID NO: 46),
At least one polypeptide selected from the group consisting of polypeptides lacking the biological function of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, or
A method for treating or preventing lung cancer, comprising a step of administering a polynucleotide encoding a polypeptide selected from the polypeptides of (a) and (b). (a) a polypeptide comprising ISSILEKGERLPQPPICTI (SEQ ID NO: 44), DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46), and
(b) a polypeptide functionally equivalent to a polypeptide selected from the group consisting of ISSILEKGERLPQPPICTI (SEQ ID NO: 44), DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) and FRELIIEFSKMARDPQRYL (SEQ ID NO: 46),
At least one polypeptide selected from the group consisting of polypeptides lacking the biological function of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, or
A composition for treating or preventing lung cancer, comprising a pharmaceutically effective amount of a polynucleotide encoding a polypeptide selected from the polypeptides of (a) and (b), and a pharmaceutically acceptable carrier. A polypeptide selected from the group consisting of:
(a) a polypeptide comprising ISSILEKGERLPQPPICTI (SEQ ID NO: 44), DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46), and
(b) an amino acid sequence of a polypeptide functionally equivalent to a polypeptide selected from the group consisting of ISSILEKGERLPQPPICTI (SEQ ID NO: 44), DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) and FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) A polypeptide comprising:
A polypeptide lacking the biological function of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2.   A polynucleotide encoding the polypeptide of claim 37.   38. The polypeptide of claim 37, wherein the biological function is cell proliferation activity.   38. The polypeptide of claim 37, comprising 19 to 57 residues.   38. The polypeptide of claim 37, modified with a cell membrane permeable substance. General formula:
[R]-[D]
Wherein [R] represents a cell membrane permeable substance; and [D] is ISSILEKGERLPQPPICTI (SEQ ID NO: 44) or DVYMIMVKCWMIDADSRPK (SEQ ID NO: 45) or FRELIIEFSKMARDPQRYL (SEQ ID NO: 46) An amino acid sequence of a fragment sequence comprising; or an amino acid sequence of a polypeptide functionally equivalent to a polypeptide comprising the fragment sequence;
The polypeptide lacks the biological function of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2,
[R] and [D] are connected directly or indirectly with a linker comprising an amino acid sequence consisting of GGG,
42. The polypeptide of claim 41. 43. The polypeptide of claim 42, wherein the cell membrane permeable substance is any one selected from the group consisting of:
Polyarginine;
Tat / RKKRRQRRR / SEQ ID NO: 47;
Penetratin / RQIKIWFQNRRMKWKK / SEQ ID NO: 48;
Buforin II / TRSSRAGLQFPVGRVHRLLRK / SEQ ID NO: 49;
Transportan / GWTLNSAGYLLGKINLKALAALAKKIL / SEQ ID NO: 50;
MAP (model amphipathic peptide) / KLALKLALKALKAALKLA / SEQ ID NO: 51;
K-FGF / AAVALLPAVLLALLAP / SEQ ID NO: 52;
Ku70 / VPMLK / SEQ ID NO: 53
Ku70 / PMLKE / SEQ ID NO: 61;
Prion / MANLGYWLLALFVTMWTDVGLCKKRPKP / SEQ ID NO: 54;
pVEC / LLIILRRRIRKQAHAHSK / SEQ ID NO: 55;
Pep-1 / KETWWETWWTEWSQPKKKRKV / SEQ ID NO: 56;
SynB1 / RGGRLSYSRRRFSTSTGR / SEQ ID NO: 57;
Pep-7 / SDLWEMMMVSLACQY / SEQ ID NO: 58; and
HN-1 / TSPLNIHNGQKL / SEQ ID NO: 59.   44. The polypeptide of claim 43, wherein the polyarginine is Arg 11 (RRRRRRRRRRR / SEQ ID NO: 60).   A method of treating or preventing lung cancer comprising administering to a subject a composition comprising a double-stranded molecule that decreases gene expression of TTK (SEQ ID NO: 1) or EGFR (SEQ ID NO: 3), comprising: The method wherein the double stranded molecule comprises a sense nucleic acid and an antisense nucleic acid, the sense nucleic acid comprising a ribonucleotide sequence corresponding to the sequence of SEQ ID NO: 62 or 63 as a target sequence.   46. The method of claim 45, wherein the composition comprises a transfection facilitating agent.   For treating or preventing lung cancer comprising a pharmaceutically effective amount of a double-stranded molecule that decreases gene expression of TTK (SEQ ID NO: 1) or EGFR (SEQ ID NO: 3), and a pharmaceutically acceptable carrier The composition of claim 1, wherein the double-stranded molecule comprises a sense nucleic acid and an antisense nucleic acid, the sense nucleic acid comprising a ribonucleotide sequence corresponding to the sequence of SEQ ID NO: 62 or 63 as a target sequence.

Images