WO2006132248A1

WO2006132248A1 - Method for ubiquitination of runx

Info

Publication number: WO2006132248A1
Application number: PCT/JP2006/311333
Authority: WO
Inventors: Gen Kudo; Takehiko Takata; Haruna Hayasaka; Hirofumi Doi; Yasuhiro Kikuchi
Original assignee: Daiichi Pharmaceutical Co., Ltd.
Priority date: 2005-06-07
Filing date: 2006-06-06
Publication date: 2006-12-14

Abstract

[PROBLEMS] To find a protein capable of interacting with RUNX to regulate the action of RUNX, provide a means for regulating the action of RUNX and provide a means useful for the prevention and/or treatment of a disease caused by RUNX abnormality. [MEANS FOR SOLVING PROBLEMS] It is found that NEDD4 which is a HECT E3 ligase can ubiquitinate RUNX to cause the degradation of RUNX. Based on this finding, there are provided a method for the ubiquitination of RUNX or a method for the degradation of RUNX which is characterized by using NEDD4; a ubiquitinating agent or a degrading agent for RUNX; a method for the inhibition of the ubiquitination or the degradation of RUNX by NEDD4; a ubiquitination inhibitor or a degradation inhibitor for RUNX; a method for the identification of a compound capable of inhibiting or enhancing the ubiquitination of RUNX; a method for the identification of a compound capable of inhibiting or enhancing the binding between RUNX and NEDD4; a reagent kit; and a method for the prevention and/or treatment of a disease caused by RUNX abnormality.

Description

Specification

RUNX's Ubiquity Method Technology Field

[0001] The present invention relates to a RUNX (Runt—related transcription factor) ubiquitination method and degradation method. More specifically, the present invention relates to a RUNX ubiquitin method and decomposition method characterized by coexistence of RUNX and NEDD4 (Neural precursor cell Expressed, developmentally down-regulated 4).

[0002] The present invention also relates to a RUNX ubiquitinating agent and degrading agent.

[0003] The present invention further relates to a method for inhibiting RUNX ubiquitin and degradation. More specifically, the present invention relates to a method for inhibiting RUNX ubiquitin and degradation by NEDD4, characterized by inhibiting at least one of the binding of NEDD4 and RUNX, the enzyme activity of NEDD4, and the expression of NEDD4. .

[0004] The present invention also relates to a RUNX ubiquitin inhibitor and degradation inhibitor of NEDD4.

[0005] The present invention further relates to a polynucleotide having a partial base sequence ability of NEDD4. The present invention also relates to a polynucleotide comprising a partial base sequence of NEDD4 and a double-stranded polynucleotide comprising a complementary base sequence of the base sequence.

[0006] The present invention also relates to a method for promoting osteogenesis and an agent for promoting osteogenesis. More specifically, the present invention relates to an osteogenesis promoting method and an osteogenesis promoter characterized by inhibiting the expression and Z or function of NEDD4.

[0007] The present invention further relates to a method for inhibiting tumor growth and a tumor growth inhibitor. More details

The present invention relates to a method for inhibiting tumor growth and a tumor growth inhibitor, characterized by inhibiting the expression and Z or function of NEDD4.

[0008] The present invention also relates to a method for identifying a compound that inhibits or promotes RUNX ubiquitin by NEDD4, and a method for identifying a compound that inhibits or promotes the binding of NEDD4 to RUNX.

[0009] The present invention further relates to a method for identifying a compound capable of promoting bone formation.

[0010] The present invention also relates to a method for identifying a compound capable of suppressing tumor growth. [0011] The present invention further includes NEDD4, a polynucleotide encoding NEDD4, a vector containing the polynucleotide, and a transformant containing the vector, and a polynucleotide encoding RUNX and RUNX. And a reagent kit comprising at least one of a vector containing the polynucleotide and a transformant containing the vector.

[0012] The present invention also relates to a disease caused by an abnormality in RUNX, for example, a disease caused by an increase or decrease in the function and Z or expression of RUNX, specifically a preventive and Z or therapeutic agent for cancer diseases, etc. , And prevention and Z or treatment methods.

[0013] The present invention further relates to a preventive and Z or therapeutic agent for diseases associated with bone loss, and a preventive and Z or therapeutic method.

Background art

[0014] RUNX is a protein characterized by having a Runt domain, and many family proteins are known. The Runt domain has been identified as (1) AML1 associated with acute myeloid leukemia in humans, acute myelocytic leukemia 1), (2) Retronoles hennoenser ~~ [a transcription factor that binds to a common core. CBF (core binding factor), and (3) the alpha subunit of PEBP2 (polyomavirus enhancer binding protein 2), a transcription factor identified as an enzyme that regulates gene expression and DNA replication in poliovirus. It is a highly homologous sequence with about 130 amino acid residues.

[0015] RUNX is known to form a heterodimer with ΡΕΒΡ2 CBF j8 subunit (PEBP2 j8 ZCBF j8) and act as a transcription factor. The Runt domain is responsible for both DNA binding and heterodimerization with the j8 subunit, and is an important domain for the action of RUNX as a transcription factor.

[0016] RUNX is known to have three types of family proteins in mammals, namely RUNX1, RUNX2 and RUNX3 (Non-patent Documents 1 and 2). Homology between human RUNX3 and human RUNX1 and human RUNX2 is 57% and 54%, respectively, at the amino acid level

[0017] The RUNX family acts as a transcription factor and plays an important role in normal differentiation and tumorigenesis Fulfill.

[0018] RUNX1 is present on human chromosome 21 (21q22) and has been identified as the gene with the most frequent chromosomal translocation in acute myeloid leukemia (AML) (Non-patent Document 3). On the other hand, it has been reported that RUNX1 also plays a crucial role in regulating the differentiation of hematopoietic cells (Non-patent Documents 4 and 5). In AML, a reciprocal translocation (t (8; 21)) in which the long arms of chromosomes 8 and 21 are interchanged is frequently observed, and this chromosomal translocation acts on dominant negative for RUNX1. It is known that chimeric proteins are produced. It has been reported that when RUNX1 is expressed in large quantities in proliferating cells expressing this chimeric protein, cell proliferation is suppressed and differentiation is promoted (Non-patent Document 6). On the other hand, even in leukemia cells without chromosomal translocation, loss of RUNX1 transcriptional activity due to point mutations has been reported, and this loss of function seems to play an important role in the development of leukemia. (Non-patent document 7).

[0019] RUNX2 is an important transcription factor involved in bone formation, and is essential for chondrocyte differentiation 'maturation, osteoblast differentiation and bone marrow formation (Non-patent Documents 26 and 27). In RUNX2 knockout mice, both membranous ossification and endochondral ossification are deficient, so the skeleton is formed only from cartilage (Non-patent Document 8). The skeleton is constructed by membranous ossification directly formed by osteoblasts and endochondral ossification where the cartilage is replaced by bone after the cartilage is formed. Both osteoblasts and chondrocytes differentiate from mesenchymal stem cells. Differentiation of these cells from mesenchymal stem cells involves site force-in such as BMP (bone morphogenetic protein) and various transcription factors. Since RUNX2 binds to the transcription factor Smadl, which is involved in the induction of bone morphogenetic gene expression by BMP stimulation, it is thought to be involved in bone formation signals via BMP stimulation (Non-patent Document 28). ). RUNX2 affects the differentiation of bone cells and also expresses bone matrix genes (Collal, Colla2, osteopontin, osteocalcin, bone sialoprotein). It has been shown to be active (Non-patent Document 29).

[0020] On the other hand, it has been reported that overexpression of RUNX2 causes abnormalities in T cell differentiation and is involved in lymphoma formation by synergistic action with c myc (Non-patent Document 9). [0021] Since RUNX3 binds to Smad, an intracellular mediator of TGF-j8 (tumor growth factor-j8), it is considered to be involved in TGF-β signaling (Non-patent Document 10). Mutations of TGF-β receptor and Smad are known in many cancers (Non-patent Document 11), and RUNX3 is also considered to be involved in cancer. RUNX3 is highly expressed in normal gastric mucosal epithelium (Non-patent Document 12), but when RUNX3 is knocked out, mucosal thickening due to increased proliferation of gastric mucosal epithelial cells is observed. This increase in cell proliferation has been shown to be due to suppression of apoptosis. In addition, gastric mucosal epithelial cells of RUNX3 knockout mice are resistant to the growth-inhibiting action of TGF-β, suggesting that mucosal thickening is caused by abnormal TGF-β signaling due to RUNX3 deficiency (non- Patent Document 13). This is supported by the fact that mucosal thickening due to proliferation of gastric mucosal epithelial cells is also observed in TGF-β knockout mice (Non-patent Documents 14). In addition, RUNX3 is deficient in human esophageal cancer SEG-1 cells and is resistant to the production of TGF-β. However, when RUNX3 is expressed, the reactivity is restored (Non-Patent Document 15). . These events suggest that RUNX3 is involved in cancer through the TGF-β signal.

[0022] Several reports have already been made on the relationship between human cancer and RUNX3. RUNX3 is located on chromosome 1 (1ρ36), where many tumor suppressor genes are present. This region is frequently defective in gastric cancer, colon cancer, bile duct cancer, and spleen cancer. The expression of RUNX3 in gastric cancer cells decreased with the progression of cancer, and the expression of RUNX3 gene decreased in about 90% of stage 4 gastric cancer (Non-patent Document 13). In addition, it has been reported that RUNX3 gene expression decreased in more than 60% of bile duct cancer, spleen cancer and colon cancer cell lines (Non-patent Documents 16 and 17). The cause of decreased RUNX3 expression is thought to be due to hemizygous deletion and methylation of the promoter region of RUNX3. The tumor formation inhibitory effect of RUN X3 has been confirmed in animal experiments using a transplant model.When RUNX3 gene was expressed in RU NX3-deficient human gastric cancer cells, tumor growth after transplantation of nude mice was significantly suppressed (non- Patent Document 13).

[0023] NEDD4 is an H £ LC Γ (homologous to the papillomavirus K6-associated protein car boxyl terminus) type ubiquitin ligase. NEDD4 is a C2 domain involved in binding to membrane lipids in the N-terminal region, four WW domains involved in binding to the substrate in the middle, and a ubiquitin 触媒 catalytic domain in the C-terminal region and ubiquitin ligase activity It has a HECT domain that indicates (Non-patent Document 18).

[0024] The ubiquitin proteasome system is a selective and active proteolytic mechanism that regulates various physiological phenomena such as the cell cycle and signal transduction, and is thus involved in maintaining homeostasis of proteins and cells. (Non-patent document 19). Ubiquitin is an evolutionarily conserved protein with 76 amino acid residues existing in eukaryotes, which is covalently linked in a chain to the target protein and acts as a degradation signal. The binding of ubiquitin to the target protein occurs by the continuous catalysis of ubiquitin activity enzyme (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin ligase (E3). Among these enzymes, ubiquitin ligase (E3) is important as an enzyme responsible for substrate selectivity. The ubiquitinated target protein is degraded by the proteasome that recognizes ubiquitin bound in a chain to the protein. Abnormalities in the ubiquitin proteasome system lead to protein deficiency due to excessive degradation of the target protein, or protein accumulation due to inhibition of target protein degradation, thereby causing various diseases. Specifically, for example, the involvement of the ubiquitin proteasome system in cancer diseases has been reported (Non-patent Document 20).

[0025] The tissue distribution of NEDD4 is highly expressed in muscle in normal tissues. Also, in some cancer cell lines, such as the human eclampsia cancer cell line HeLa, the human lung cancer cell line A549, and the human leukemia cell line K562, the expression of NEDD4 is increased at the mRNA level! It has been reported (Non-patent Document 21). In addition, NEDD4 is known to decrease in expression with neuronal differentiation (Non-patent Document 22).

[0026] As a substrate for NEDD4, Bel 10 which is a regulator of NF-κΒ (nuclear factor-κΒ) has been reported (Non-patent Document 23). Another substrate for NEDD4 is amyloid-sensitive epithelial sodium channel (ENaC) (Non-patent Document 24).

[0027] There are several reports on the involvement of the ubiquitin proteasome system in the stability of RUNX. For example, the intracellular stability of RUNX2 is controlled in a ubiquitin-dependent manner (Non-patent Document 30). HECT type E already as E3 ligase of RUNX2 Smurfl (Smad ubiquitination regulatory factor 1) known as 3 ligase has been reported (Non-patent Document 31). It has been reported that treatment with proteasome inhibitors induces osteoblast differentiation in vitro and promotes bone formation in individuals (Non-patent Documents 31 and 32). However, the expression level of RUNX2 and the Smad signal in knockout mice of Smurfl are not different from those of wild-type mice, and it is unclear whether RUNX2 is degraded in vivo in a Smurfl-dependent manner (Non-patent Document 33) . It has also been reported that RUNX3 is ubiquitinated and degraded by Smurfl and Smurf 2 (Non-patent Document 25).

[0028] However, ubiquitination of the RUNX family by NEDD4 has not been reported. The homology between NEDD4 and Smurfl and Smurf 2 is 39% and 43%, respectively, at the low amino acid level.

[0029] Non-Patent Document 1: Lund A. H. et al., “Cancer Cell”, 2002, No. 1, No. 3, p. 213-215.

Non-Patent Document 2: Otto F. et al., “Journal of Cellular Biochemistry”, 2003, No. 89, No. 1, p. 9-1

8 ₀

Non-Patent Document 3: Miyoshi H. et al., "Proceedings of the National Academy of Sciences of fhe United ¾ tates of America" 1991, 88th, 23rd, p. 10431-10434.

Non-Patent Document 4: Okuda T. et al., “Cell”, 1996, 84, No. 2, p. 321—330.

Non-Patent Document 5: Wang Q. et al., “Cell”, 1996, 87th, No. 4, p. 6 97—708.

Non-Patent Document 6: Kitabayashi I. et al., “EMBO Journal”, 1998, Vol. 17, No. 11, p. 2994—3004.

Non-Patent Document 7: Osato M. et al., “Blood”, 1999, No. 93, No. 6, p. 1817-1824. Non-Patent Document 8: Otto F. et al., “Cell”, 1997, 89th, No. 5, p. 765—771.

Non-Patent Document 9: Valliant F. et al., “Oncogene”, 1999, No. 18, No. 50, p. 7124-7134.

Non-Patent Document 10: Ito Y. et al., “Current Opinion in Genetics and Development”, 2000, 13th, No. 1, p. 43— 47.

Non-Patent Document 11: Kawabata M. et al., “Journal of Biochemistry J, 1999, 125th, No. 1, p. 9-16.

Non-Patent Document 12: Osaki M. et al., “European Journal of Clinical Investigation”, 2004, No. 34, No. 9, p. 605 — 612.

Non-Patent Document 13: Li Q. L. et al., “Cell”, 2002, No. 109, No. 1, p. 11 3-124.

Non-Patent Document 14: Crawford S. E. et al., “Cell”, 1998, 93rd, No. 7, p. 1159-1170.

Non-Patent Document 15: Torquati A. et al., “Surgery”, 2004, Vol. 136, No. 2, p. 310-316.

Non-Patent Document 16: Wada M. et al., “Oncogene”, 2004, 23rd, No. 13, p. 2401—2407.

Non-Patent Document 17: Goel A. et al., “International Journal of Cancer”, 2004, 112, 5, p. 7 54-759.

Non-Patent Document 18: Harvey K. F. et al., “Trends in-cell biology (

Trends in Cell Biology), 1999, No. 9, No. 5, p. 166-169.

Non-Patent Document 19: Hershko A. et al., “Annual Review of Biochemistry”, 1998, 67th, p. 425-4 Non-Patent Document 20: Burger AM et al., “Eurpoean Journal of Cancer”, 2004, No. 40, No. 15, p. 22 17-2229.

Non-Patent Document 21: Anan T. et al., “Genes to Cells”, 1998, No. 3, No. 11, p. 751-763.

Non-Patent Document 22: Kumar S. et al., “Biochemical and Biophysical Research Communications”, 1992, No. 185, No. 3, p. 1155-1161.

Non-Patent Document 23: Scharschmidt E et al., “Molecular and Cellular Biology”, 2004, Vol. 24, No. 9, p. 3860-3873.

Non-Patent Document 24: Staub O. et al., “EMBO Journal J, 1996, Vol. 15, No. 10, p. 2371-2380.

Non-Patent Document 25: Jin Y. H. et al., “The Journal of Biological Chemistry”, 2004, No. 279, No. 28, p. 29409-29417.

Non-Patent Document 26: Komori, “Journal of Cellular Biochemistry”, 2005, Vol. 95, p. 445-453. Non-Patent Document 27: Himeno, M. et al., "Journal of Bone and Mineral Research", 2002, 17th, p. 1297-1305.

Non-Patent Document 28: Hanai, J. I. et al., “The Journal of Biological Chemistry”, 1999, No. 274, p. 3 1577-31582.

Non-Patent Document 29: Komori, T., “Journal of Cellular Biochemistry”, 2002, 87th, p. 1-8.

Non-Patent Document 30: HTintut, Y.) et al., “The Journal of Biological Chemistry”, 1999, 274th p. 28875—28879.

Non-Patent Document 31: Zhao M. et al., “The Journal of Biological Chemistry”, 2003, No. 278, p. 279 39-27944.

Non-Patent Document 32: Garrett, L R. et al., “The Journal of Clinical Investigation”, 2003, 111, p. 1771—1782. .

Non-Patent Document 33: Yamashita, M. et al., “Cell”, 2005, 121, p. 101-113.

Disclosure of the invention

Problems to be solved by the invention

[0030] RUNX is a protein that acts as a transcription factor and plays an important role in normal differentiation and tumorigenesis. Abnormalities in RUNX cause, for example, abnormal differentiation and tumor formation. Therefore, by regulating the action of RUNX, it is possible to prevent and Z or treat diseases caused by abnormal RUNX.

[0031] An object of the present invention is to find and provide a protein that interacts with RUNX to regulate its action. The subject of the present invention includes providing means for adjusting the action of RUNX. Furthermore, the subject of the present invention includes providing a useful means for the prevention and Z or treatment of diseases caused by abnormalities in RUNX, such as cancer diseases. Means for solving the problem

[0032] In order to solve the above-mentioned problems, the present inventors made diligent efforts and predicted in silico that NE DD4, which is a HECT-type E3 ligase, interacts with RUNX3.

[0033] Then, it was demonstrated that NEDD4 ubiquitinated RUNX, thereby reducing the stability of RUNX. Specifically, (D NEDD4 binds to RUNX3 intracellularly, (2) RUNX3 is ubiquitinated by NEDD4, and (3) NEDD4 reduces RUNX3 stability. Furthermore, (4) NEDD4 binds to RUNX1 in cells, (5) RUNX1 is ubiquitinated by NEDD4, and (6) NEDD4 reduces RUNX1 stability. (7) Cancer details In the cell, the N-terminal amino acid residue is deleted and the short-chain NEDD4 is expressed, and (8) the short-chain NEDD4 and RUNX1, RUNX2, and RUNX3 bind to each other. And (9) RUNX1, RUNX2 and RUNX3 were demonstrated to be ubiquitined by short-chain NEDD4.

[0034] From the verification results in the present invention, NEDD4 binds to RUNX to catalyze the ubiquitination of RUNX, and as a result, the ubiquitinated RUNX is degraded by the ubiquitin proteasome system and its stability decreases Can do. RUNX degradation is regulated by the ubiquitin proteasome system involving NEDD4, thereby regulating the function of RUNX, for example, as a transcription factor, resulting in various physiological phenomena involving RUNX, such as the cell cycle. And signal transduction are regulated.

Therefore, by regulating the RUNX ubiquitination by NEDD4, it is possible to regulate the degradation of RUNX, thereby regulating the function of RUNX, for example, the function as a transcription factor. By regulating the function of RUNX, diseases caused by abnormal RUNX can be prevented and Z or treated.

[0036] Specifically, inhibition of RUNX ubiquitination by NEDD4 can inhibit degradation of RUNX by the ubiquitin proteasome system, thereby inhibiting reduction of RUNX. By inhibiting the reduction of RUNX, the physiological phenomena involved in RUNX can be recovered, so that diseases caused by the reduction of RUNX and its function can be prevented and / or treated. Moreover, by promoting RUNX ubiquitin by NEDD4, degradation of RUNX by the ubiquitin proteasome system can be promoted, so RUNX can be reduced. By reducing RUNX, physiological phenomena involving RUNX can be inhibited, so that diseases caused by increased RUNX or enhanced function can be prevented and / or treated.

[0037] In the present invention, NEDD4 or short-chain NEDD4 also binds to RUNX to catalyze the ubiquitination of RU NX, whereas it binds to RUNX but does not have E3 ligase activity. Type NEDD4 mutants and inactive short chain NEDD4 mutants have demonstrated that RUNX is not ubiquitinous. The inactive NEDD4 mutant and the inactive short NEDD4 mutant all bind to RUNX but have no E3 ligase activity. The inventors believe that antagonistic inhibition of binding between NEDD4 or short-chain NEDD4 and RUNX results in inhibition of RUNX ubiquitination by NEDD4 or short-chain NEDD4.

[0038] Thus, NEDD4 E3 ligase activity is important for RUNX ubiquitination by NEDD4, and it binds to RUNX but does not have E3 ligase activity! /, NEDD4 inactive mutant Revealed that RUNX ubiquitin can be inhibited.

[0039] Further, in the present invention, a double-stranded polynucleotide capable of inhibiting the expression of NEDD4 was identified. The double-stranded polynucleotide is specifically a double-stranded RNA having a polynucleotide strength consisting of a polynucleotide having a partial base sequence ability of a polynucleotide encoding NEDD4 and a complementary base sequence of the partial base sequence, Reduced the expression of NEDD4. Hereinafter, such double-stranded RNA is sometimes referred to as NEDD4 siRNA or Nedd4 siRNA.

[0040] In the present invention, a NEDD4 inactive mutant that binds to a double-stranded polynucleotide and RUNX that can inhibit NEDD4 expression but does not have E3 ligase activity. It was found that the model cell promotes bone breakdown by BMP stimulation. Based on this, the present inventors believe that inhibiting the expression and Z or function of NEDD4 promotes bone differentiation and, as a result, promotes bone formation.

[0041] Further, in the present invention, it has been found that the growth of a double-stranded polynucleotide strength human tumor cell line capable of inhibiting the expression of NEDD4 is suppressed. Based on this, the present inventors believe that tumor growth can be suppressed by inhibiting the expression and Z or function of NEDD4.

[0042] The present invention has been completed based on these findings.

That is, the present invention relates to a RUNX ubiquity method characterized in that RUNX and NEDD4 coexist.

[0044] The present invention also relates to the above-mentioned RUNX ubiquitination method, wherein RUNX is any one selected from human RUNX1, human RUNX2 and human RUNX3.

[0045] Furthermore, the present invention relates to a RUNX ubiquitinating agent comprising NEDD4.

[0046] Furthermore, in the present invention, RUNX is derived from human RUNX1, human RUNX2, and human RUNX3. The RUNX ubiquitinating agent is any one selected.

[0047] Further, the present invention uses the RUNX ubiquitin method described above.

It relates to the decomposition method of X.

[0048] Furthermore, the present invention relates to a method for decomposing RUNX, characterized in that RUNX is processed using the RUNX ubiquitinating agent.

[0049] Furthermore, the present invention relates to a decomposing agent for RUNX comprising NEDD4.

[0050] The present invention also relates to a method for inhibiting RUNX ubiquitin, which comprises inhibiting the binding of RUNX and NEDD4.

[0051] Further, the present invention uses the protein represented by the amino acid sequence set forth in SEQ ID NO: 11 of the sequence listing and the protein represented by Z or the amino acid sequence set forth in SEQ ID NO: 12 above. The present invention relates to a method for inhibiting RUNX ubiquitination.

[0052] Furthermore, the present invention relates to a method for inhibiting RUNX ubiquitin 匕, which comprises inhibiting the enzyme activity of NEDD4.

[0053] The present invention also relates to a RUNX ubiquitin-inhibiting method characterized by inhibiting the expression of NEDD4.

[0054] Further, the present invention relates to a RUNX ubiquitin-inhibiting method characterized by using a double-stranded polynucleotide capable of inhibiting NEDD4 expression.

[0055] Furthermore, the present invention relates to a method of inhibiting RUNX ubiquitin 匕 characterized by using any one double-stranded polynucleotide selected from the following group:

(i) a double-stranded polynucleotide comprising a polynucleotide represented by the base sequence set forth in SEQ ID NO: 21 and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 22,

(ii) a double-stranded polynucleotide comprising a polynucleotide represented by the base sequence set forth in SEQ ID NO: 23 and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 24, and

(iii) A double-stranded polynucleotide comprising a polynucleotide represented by the base sequence set forth in SEQ ID NO: 25 and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 26.

[0056] The present invention also relates to any one of the aforementioned RUNX ubiquitination inhibiting methods, wherein RUNX is any force 1 selected from human RUNX1, human RUNX2 and human RUNX3.

[0057] Further, the present invention provides a partial base sequence of a polynucleotide encoding NEDD4, wherein The present invention relates to a polynucleotide having any one base sequence ability selected from the base sequences described in column numbers 21 to 26.

[0058] Furthermore, the present invention provides a double-stranded polynucleotide comprising a polynucleotide having a partial base sequence ability of a polynucleotide encoding NEDD4, and a polynucleotide having a complementary base sequence ability of the partial base sequence, With respect to any one double-stranded polynucleotide selected from the group of:

[0059] Further, the present invention provides a protein represented by the amino acid sequence set forth in SEQ ID NO: 11 in the sequence listing, and a protein represented by Z or a protein represented by the amino acid sequence set forth in SEQ ID NO: 12.

Relates to X ubiquitin inhibitors.

[0060] The present invention further comprises a double-stranded polynucleotide capable of inhibiting the expression of NEDD4.

It relates to RUNX ubiquitination inhibitors.

[0061] Furthermore, the present invention relates to a RUNX ubiquitination inhibitor comprising the double-stranded polynucleotide.

[0062] The present invention also relates to the RUNX ubiquitination inhibitor, wherein RUNX is any one selected from human RUNX1, human RUNX2 and human RUNX3.

[0063] Further, the present invention relates to a method for inhibiting RUNX degradation, characterized by using any one of the aforementioned methods for inhibiting RUNX ubiquitination.

[0064] Furthermore, the present invention relates to a method for inhibiting RUNX degradation, characterized by using the RUNX ubiquitination inhibitor.

[0065] The present invention also includes a protein represented by the amino acid sequence set forth in SEQ ID NO: 11 in the sequence listing, and a protein represented by Z or a protein represented by the amino acid sequence set forth in SEQ ID NO: 12.

It relates to an X degradation inhibitor. [0066] The present invention further comprises a double-stranded polynucleotide capable of inhibiting the expression of NEDD4.

It relates to RUNX degradation inhibitors.

[0067] Furthermore, the present invention relates to a RUNX degradation inhibitor comprising the double-stranded polynucleotide.

[0068] The present invention also relates to a method for promoting osteogenesis, which comprises inhibiting the expression and Z or function of NEDD4.

[0069] Furthermore, the present invention uses a protein represented by the amino acid sequence set forth in SEQ ID NO: 11 of the sequence listing and a protein represented by Z or the amino acid sequence set forth in SEQ ID NO: 12 The present invention relates to a formation promotion method.

[0070] Furthermore, the present invention relates to a method for promoting osteogenesis, comprising using a double-stranded polynucleotide capable of inhibiting the expression of NEDD4.

[0071] The present invention also relates to a method for promoting osteogenesis, comprising using the double-stranded polynucleotide.

[0072] Furthermore, the present invention provides a bone formation promoter comprising a protein represented by the amino acid sequence set forth in SEQ ID NO: 11 of the sequence listing and a protein represented by Z or the amino acid sequence set forth in SEQ ID NO: 12. About.

[0073] Furthermore, the present invention relates to an osteogenesis promoter comprising a double-stranded polynucleotide capable of inhibiting NEDD4 expression.

[0074] The present invention also relates to an osteogenesis promoter comprising the double-stranded polynucleotide.

[0075] Furthermore, the present invention relates to a method for suppressing tumor growth, which comprises inhibiting the expression and Z or function of NEDD4.

[0076] Furthermore, the present invention is characterized by using a protein represented by the amino acid sequence set forth in SEQ ID NO: 11 of the sequence listing and a protein represented by Z or the amino acid sequence set forth in SEQ ID NO: 12. The present invention relates to a method for inhibiting tumor growth.

[0077] The present invention also relates to a method for inhibiting tumor growth, comprising using a double-stranded polynucleotide capable of inhibiting NEDD4 expression.

[0078] Further, the present invention relates to a method for inhibiting tumor growth, characterized by using the double-stranded polynucleotide. [0079] Furthermore, the present invention provides a tumor growth inhibitor comprising a protein represented by the amino acid sequence represented by SEQ ID NO: 11 in the sequence listing and a protein represented by Z or the amino acid sequence represented by SEQ ID NO: 12. About.

[0080] The present invention also relates to a tumor growth inhibitor comprising a double-stranded polynucleotide capable of inhibiting NEDD4 expression.

[0081] Furthermore, the present invention relates to a tumor growth inhibitor comprising the double-stranded polynucleotide.

[0082] Furthermore, the present invention provides a method for identifying a compound that inhibits or promotes RUNX ubiquitin by NEDD4, comprising contacting NEDD4 and Z or RUNX with a compound (test compound), Using a system that uses a signal that detects RUNX ubiquitin by NEDD4 and a system that uses Z or a marker, and detects the presence or absence or change of this signal and Z or marker, the test compound is The present invention relates to an identification method including a step of determining whether or not to inhibit or promote RUNX ubiquitin.

[0083] The present invention also relates to a method for identifying a compound that inhibits or promotes the binding of NEDD4 and RUNX, wherein NEDD4 and Z or RUNX are contacted with a compound, and then! The ability to inhibit the binding of NEDD4 and RUNX by detecting the presence or absence or change of the signal and Z or marker using a system that uses the signal and Z or marker resulting from binding. Alternatively, the present invention relates to an identification method including a step of determining whether or not to promote power.

[0084] Further, the present invention relates to a method for identifying a compound capable of promoting bone formation, which comprises the step of measuring whether or not a test compound has a force that inhibits the expression and Z or function of SNEDD4.

[0085] Furthermore, the present invention is a process power for measuring whether a test compound is capable of inhibiting the expression and Z or function of NEDD4. The bone formation is any one process selected from the following group: Relates to methods for identifying compounds that can promote:

(D) Determine whether the test compound is capable of inhibiting the expression of NEDD4 by contacting the test compound with a polynucleotide encoding D NEDD4 and then measuring NED D4 The process of

(2) Using NEDD4 and Z or RUNX in contact with a test compound, a signal that detects ubiquitination of NEDD4 and Z or RUNX by NEDD4 and a system that uses Z or single force, Determining whether the test compound inhibits NEDD4 and Z or RUNX ubiquitin by NEDD4 by detecting the presence or absence or change of Z or a marker;

and

(3) NEDD4 and Z or RUNX is brought into contact with the test compound, and then the presence or absence of the signal and Z or the marker using a system using the signal and Z or marker generated by the binding of NEDD4 and RUNX Alternatively, a step of determining whether or not the test compound is capable of inhibiting the binding of NEDD4 and RUNX by detecting a change.

[0086] The present invention further includes the step of measuring whether or not a test compound that has been shown to inhibit the expression and Z or function of NEDD4 can promote bone formation. The present invention relates to a method for identifying a compound that can be promoted.

[0087] Furthermore, the present invention relates to a method for identifying a compound capable of suppressing tumor growth, which comprises a step of measuring whether or not a test compound is capable of inhibiting the expression and Z or function of NEDD4.

[0088] Furthermore, the present invention is a process power for measuring whether or not a test compound is capable of inhibiting the expression and Z or function of NEDD4. The tumor growth is any one process selected from the following group: Relates to a method for identifying compounds capable of inhibiting

(D. The step of determining whether or not the test compound is capable of inhibiting the expression of NEDD4 by contacting the test compound with a polynucleotide encoding D NEDD4 and then measuring NED D4,

(2) Using NEDD4 and Z or RUNX in contact with a test compound, a signal that detects ubiquitination of NE DD4 and Z or RUNX by NEDD4 and a system that uses Z or single force, By detecting the presence or absence or change of Z or marker, the test compound is And determining whether or not to inhibit ubiquitin of Z or RUNX,

and

(3) NEDD4 and Z or RUNX are brought into contact with the test compound, and then the presence or absence of the signal and Z or marker using a system using the signal and Z or marker generated by binding of NEDD4 and RUNX Alternatively, a step of determining whether or not the test compound is capable of inhibiting the binding of NEDD4 and RUNX by detecting a change.

[0089] The present invention further comprises the step of measuring whether or not a test compound that has been shown to inhibit the expression and Z or function of NEDD4 can suppress tumor growth. The present invention relates to a method for identifying a compound that can be produced.

[0090] Furthermore, the present invention relates to NEDD4, a polynucleotide encoding NEDD4, a recombinant vector containing the polynucleotide and a transformant containing the recombinant vector, and at least one of RUNX, RUNX And a reagent kit containing at least one of a recombinant vector containing the polynucleotide and a transformant containing the recombinant vector.

[0091] Furthermore, the present invention provides a preventive and Z or therapeutic agent for a disease caused by increased RUNX function and Z or expression, comprising an effective amount of the RUNX ubiquitinating agent and Z or the RUNX degrading agent. About.

[0092] The present invention also relates to prevention and Z or treatment of a disease caused by a decrease in RUNX function and Z or expression, comprising an effective amount of the RUNX ubiquitination inhibitor and Z or the RUNX degradation inhibitor. It relates to the agent.

Furthermore, the present invention uses the method or agent of at least one of the RUNX ubiquitination method, the RUNX ubiquitinating agent, the RUNX decomposition method, and the RUNX decomposition agent. The present invention relates to a method for the prevention and Z or treatment of diseases caused by RUNX function and increased Z or expression.

[0094] Furthermore, the present invention provides at least any one of the RUNX ubiquitination inhibiting method, the RU NX ubiquitination inhibitor, the RUNX degradation inhibiting method, and the RUNX degradation inhibitor. RU characterized by using any method or agent The present invention relates to a method for preventing and / or treating a disease caused by decreased function or Z or expression of NX.

[0095] The present invention also relates to a preventive and Z or therapeutic agent for diseases associated with bone loss, comprising an effective amount of the osteogenesis promoter.

[0096] Further, the present invention relates to prevention and Z or treatment of a disease accompanied by bone loss, characterized by using at least one agent or method of the osteogenesis promoting agent and the osteogenesis promoting method. Regarding the method.

[0097] Furthermore, the present invention relates to a preventive and Z or therapeutic agent for cancer diseases comprising an effective amount of the tumor growth inhibitor.

[0098] The present invention also relates to a method for the prevention and Z or treatment of cancer diseases, characterized by using at least one agent or method of the tumor growth inhibitor and the tumor growth inhibition method. .

The invention's effect

[0099] According to the present invention, a RUNX ubiquitin method and a decomposition method can be provided. For example, a RUNX ubiquitination method and decomposition method characterized by coexistence of RUNX and NEDD4 can be provided. It can also provide RUNX ubiquitinating and degrading agents. Furthermore, the present invention can provide a method for inhibiting RUNX ubiquitination and degradation by NEDD4. For example, it is possible to provide a method for inhibiting RUNX ubiquitination and degradation, which comprises inhibiting at least one of binding of NEDD4 and RUNX, enzyme activity of NEDD4, and expression of NE DD4. In addition, an inhibitor of RUNX ubiquitin by NEDD4 and an inhibitor of RUNX degradation by NEDD4 can be provided. Further, it is possible to provide a method for identifying a compound that inhibits or promotes RUNX ubiquitin by NED D4, and a method for identifying a compound that inhibits or promotes the binding of NEDD4 and RUNX. Further, NEDD4, a polynucleotide encoding NEDD4, a vector containing the polynucleotide, and at least one of the transformants containing the vector, a polynucleotide encoding RUNX, RUNX, and the polynucleotide And a reagent kit comprising at least one of a vector containing the vector and a transformant containing the vector. Sarako, due to RUNX abnormality Diseases that result from increased or decreased RUNX function and Z or expression

Specifically, a preventive and Z or therapeutic agent for cancer diseases and the like, and a preventive and Z or therapeutic method can be provided.

[0100] Further, according to the present invention, it is possible to provide an osteogenesis promoting method and an osteogenesis promoter characterized by inhibiting the expression and Z or function of NEDD4. Furthermore, the present invention can provide a method for identifying a compound capable of promoting bone formation. In addition, it is possible to provide a preventive and Z or therapeutic agent and a preventive and Z or therapeutic method for diseases associated with bone loss.

[0101] Thus, according to the present invention, RUNX ubiquitination can be performed using, for example, NEDD4. In addition, RUNX ubiquitin by NEDD4 can be promoted using compounds obtained by the method of identifying compounds that promote RUNX ubiquitin by NEDD4. By promoting RUNX ubiquitination by NEDD4, degradation of RUNX can be promoted. Therefore, prevention and Z or treatment of diseases caused by increased RUNX and enhanced function can be expected.

[0102] In addition, RUNX ubiquitination by NEDD4, for example, by inhibiting the binding of NEDD4 to RUNX using an inactive NEDD4 mutant that binds to RUNX but has no E3 ligase activity, Can inhibit. Moreover, RUNX ubiquitin caused by NEDD4 can be inhibited using a compound obtained by the method for identifying a compound that inhibits RUNX ubiquitin caused by NEDD4. By inhibiting RUNX ubiquitination by NEDD4, degradation of RUNX can be inhibited. Therefore, prevention and Z or treatment of diseases caused by reduction of RUNX and its function can be expected.

[0103] Furthermore, the ability to bind bone formation, for example, bone formation caused by BMP-2 stimulation, for example, the ability to bind to RUNX ¾3 Inactive NEDD4 mutant that does not have ligase activity, or a duplex that can inhibit the expression of NEDD4 It can be facilitated using polynucleotides. In addition, bone formation, for example, bone formation by BMP-2 stimulation, can be promoted using the compound obtained by the method for identifying a compound capable of promoting bone formation according to the present invention. By using these compounds that can promote bone formation, prevention and Z or treatment of diseases accompanied by bone loss can be expected.

[0104] Furthermore, tumor growth, for example, inactive NEDD4 mutants that bind to RUNX but have E3 ligase activity, or double-stranded polynucleotides that can inhibit the expression of NEDD4 Can be suppressed using tides. Moreover, tumor growth can be suppressed using a compound obtained by the method for identifying a compound capable of suppressing tumor growth according to the present invention. By using these compounds capable of suppressing tumor growth, prevention and Z or treatment of diseases associated with tumor growth, such as cancer diseases, can be expected.

[0105] Thus, by regulating RUNX ubiquitination by NEDD4 or short-chain NEDD4, degradation of RUNX can be regulated, and as a result, RUNX functions, for example, functions as transcription factors can be regulated. By regulating the function of RUNX, prevention and Z or treatment of diseases caused by abnormal RUNX can be expected. Moreover, by inhibiting the expression and Z or function of NEDD4, bone formation can be promoted, and prevention and Z or treatment of diseases associated with bone loss can be expected. Furthermore, by inhibiting the expression and Z or function of NEDD4, tumor growth can be suppressed, and prevention and Z or treatment of diseases associated with tumor growth such as cancer diseases can be expected.

Brief Description of Drawings

[0106] FIG. 1 is a diagram showing the results of in silico prediction of the interaction between RUNX3 and NEDD4. A local alignment was done between RUNX3 and NEDD4, and the area showing the high! And score was shown. The amino acid sequence is represented by one letter. The numbers in the figure mean the position of the N-terminal amino acid in each region shown in the amino acid sequence of RUNX3 or NED D4. (Example 1)

[0107] [Figure 2] Results of in vivo binding of human RUNX3 and human NEDD4 detected by immunoprecipitation using cultured human cells transiently co-expressing FLAG—RUNX3 and My c NEDD4 FIG. Panels A and B show the results of immunoblotting using anti-Myc antibody and anti-FLAG antibody, respectively, for immunoprecipitates with anti-FLAG antibody. In the figure, + and 1 indicate the presence or absence of each expression plasmid, IP indicates a sample immunoprecipitated using anti-FLAG M2 antibody, and cell lysate indicates a V-cell lysate sample that has not been immunoprecipitated. The numbers listed in the left column of the figure are the molecular weights of the molecular weight markers. Only in samples prepared from cells co-expressing Myc-NEDD4 and FLAG-RUNX3, coprecipitation of Myc-NEDD4 and FLAG-RUNX3 was observed by immunoprecipitation using anti-FLAG M2 antibody (Panel A). On the other hand, from FLAG—RUNX3 non-expressing cells No coprecipitation of Myc-NEDD4 was observed in the prepared sample. My C—NEDD4 expression was similar in both samples (Panel A). It was also confirmed that FLAG-RUNX3 expressed in the cells was recovered by anti-FLAG M2 antibody (panel B). (Example 2)

[0108] [Figure 3] In vivo ubiquitination of human RUNX3 by human NEDD4, immunoprecipitation using human cultured cells transiently co-expressing FLAG—RUN X3, Myc—NEDD4 and HA—ubiquitin It is a figure which shows the result examined by the method. Panels A and B show the results of immunoblotting using an anti-FLAG antibody and an anti-HA antibody, respectively, for the immunoprecipitates obtained from the anti-FLAG antibody. Panel C shows the results of immunoblotting using anti-Myc antibody for cell lysate. In the figure, + and indicate the presence or absence of each expression plasmid. The numbers listed in the left column are the molecular weight markers. In addition to the samples prepared with cell forces that co-expressed FLAG—RUNX3, Myc—NEDD4 and HA—Ub, multiple proteins with higher molecular weight than FLAG—RUNX3 were detected (Panel A). Increased FLAG—RU NX3 with HA-Ub added (Panel: B). On the other hand, in samples prepared from cells co-expressed with Myc-NEDD4 (C967A) in which E3 ligase activity was inactivated instead of Myc-NEDD4, the amount of high molecular weight protein detected was small (Panel A). ), And the amount of FLAG-RUNX3 with HA-Ub added and its degree of ubiquitination was significantly lower (Panel: B). Myc-NEDD4 expression in cells co-expressed with FLAG—RUNX3, Myc—NEDD4 and HA—Ub, and Myc—NEDD4 (C967A) instead of Myc—NEDD4 The expression of C967A) was similar (Panel C). (Example 3)

[0109] [Fig. 4] Results of Western blotting on the effects of human NEDD4 on the stability of human RUNX3 using human cultured cells in which FLAG-RUNX3 and Myc-NEDD4 were transiently co-expressed. FIG. Panels A, B and C show the results of immunoblotting using anti-FLAG antibody, anti-Myc antibody and anti-actin antibody, respectively. In the figure, + and 1 indicate the presence or absence of each expression plasmid, and the number indicates the amount of DNA introduced. The numbers listed in the right column of the figure are the molecular weights of the molecular weight markers. is there. Depending on the amount of NEDD4 expression plasmid introduced, a decrease in FLAG-RUNX3 was observed (Panel A). On the other hand, no decrease in FLAG-RUNX3 was observed in samples prepared from cells transfected with the expression plasmid of NEDD4 (C967A) in which E3 ligase activity was inactivated (panel A). It was confirmed that Myc—NEDD4 was expressed depending on the amount of NEDD4 expression plasmid introduced, and that Myc—NEDD4 (C967A) was expressed by the NEDD4 (C967A) expression plasmid (Panel B). In addition, the expression level of actin, which is a control, was almost the same in all samples (panel C). (Example 4)

[Figure 5] Human NEDD4 binding to human RUNX1 and human NEDD4 in vitro ubiquitin 4 using human cultured cells transiently co-expressing FLAG—RUNX1, Myc—NEDD4 and HA—ubiquitin. It is a figure which shows the result examined by the immunoprecipitation method. Panels A, B and C show the results of immunoblotting with anti-Myc antibody, anti-FLAG antibody and anti-HA antibody, respectively, for immunoprecipitates with anti-FLAG antibody. Panel D shows the results of immuno plotting of cell lysate with anti-Myc antibody. In the figure, + and-indicate the presence or absence of each expression plasmid. The numerical value described in the left column of the figure is the molecular weight of the molecular weight marker. Myc—NEDD4 and FLAG—RUNX1 co-precipitated in samples prepared from cells co-expressed with Myc-NED D4, FLAG—RUNX1 and HA—Ub (panel A), higher molecular weight than FLAG—RUNX1 (Panel B) and an increase in FLAG-RUNX1 with HA-Ub attached (Panel C). On the other hand, Myc—NEDD4 (C967A), FLAG—RUNX1 and HA, which have inactivated E3 ligase activity.

— Myc—NEDD4 (C967A) and FL AG—RUNX1 coprecipitation was observed in samples prepared from Ub co-expressed cells (Panel A), but few high molecular weight proteins were detected (Panel A). B) Also, the amount of FLAG-RUNX1 with HA-Ub attached and the degree of ubiquitination were low (Panel C). FLAG—RUNX1, Myc—NEDD4 and HA—Uc co-expressed cells Myc—NEDD4 expression, and Myc

— Myc—NEDD4 (C967A) expression was similar in cells co-expressed with Myc—NEDD4 (C967A) instead of NEDD4 (Panel D). (Example 5) [0111] [Fig. 6] Results of Western blotting on the effects of human NEDD4 on the stability of human RUNX1 using human cultured cells that transiently co-expressed FLAG—RUNX1 and Myc—NEDD4 FIG. Panels A, B and C show the results of immunoblotting using anti-FLAG antibody, anti-Myc antibody and anti-actin antibody, respectively. In the figure, + and 1 indicate the presence or absence of each expression plasmid, and the number indicates the amount of DNA introduced. The numbers listed in the right column of the figure are the molecular weights of the molecular weight markers. Depending on the amount of NEDD4 expression plasmid introduced, a decrease in FLAG-RUNX1 was observed (Panel A). On the other hand, no decrease in FLAG-RUNX1 was observed in samples prepared from cells transfected with the expression plasmid of NEDD4 (C967A) in which E3 ligase activity was inactivated (panel A). It was confirmed that Myc—NEDD4 was expressed depending on the amount of NEDD4 expression plasmid introduced, and that Myc—NEDD4 (C967A) was expressed by the NEDD4 (C967A) expression plasmid (Panel B). In addition, the expression level of actin, which is a control, was almost the same in all samples (panel C). (Example 6)

[0112] [Fig. 7] The size of endogenous NEDD4 detected in human cancer cell lines was compared with human NEDD4 transiently expressed in human cell lines and short-chain human NEDD4 by Western blotting. It is a figure which shows a result. Panel A shows HEK293T cells expressing short-chain NEDD4 (lane 1), short-chain NEDD4 (C867A) with inactivated E3 ligase activity (lane 2), or Myc—NEDD4 (lane 3). The results of immunoblotting using an anti-NEDD4 antibody are shown for cell lysate and human breast cancer cell line T-4 7D cell lysate (lane 4). Panel B shows the results of immunoblotting using anti-NEDD4 antibody for cell lysates from various human cancer cell lines. The numbers in the left column of the figure are the molecular weights of the molecular weight markers. (Example 7)

[0113] [Figure 8] Binding of short-chain human NEDD4 and human RUNX1, and in vivo ubiquitination of human RUNX1 by short-chain human NEDD4, FLAG—RUNX1, Myc—short-chain NEDD4 and HA— FIG. 4 is a diagram showing the results of examination by immunoprecipitation using cultured human cells in which ubiquitin is transiently co-expressed. Panels A, B and C show anti-Myc antibody, anti-FLAG antibody and anti-HA anti-HA antibody anti-FLAG antibody immunoprecipitates, respectively. The result of having performed immunoblotting by a body is shown. Panel D shows the results of immunoblotting with anti-Myc antibody for cell lysate. In the figure, + and 1 indicate the presence or absence of each expression plasmid. The numbers listed in the left column of the figure are the molecular weights of the molecular weight markers. Myc—short chain type NEDD4, FLAG—RUNX1 and HA—Ub were co-expressed in samples prepared from cells co-precipitated with Myc—short chain type NEDD4 and FLAG—RUNX1 (Panel A). — Multiple proteins with a molecular weight higher than RUNX1 were detected (Panel B), and an increase in FLAG—RUNX1 with HA—Ub added was observed (Panel C). On the other hand, samples prepared from cells co-expressed with Myc—short chain type NEDD4 (C867A), FLAG—RUNX1 and HA—Ub, in which E3 ligase activity was inactivated, Myc—short chain type NEDD4 (C867A) ) And FLAG—RUNX1 were co-precipitated (Panel A), but no high molecular weight protein was detected (Panel B), and HA—Ub added FLAG—RUNX1 and its ubiquitin. The degree of conversion was extremely low (Panel C). FLAG—RUNX1, Myc—Short-chain NEDD4 and HA—Ub co-expressed Myc—Short-chain NEDD4 expression, and Myc—Short-chain NE DD4 instead of Myc—Short-chain NEDD4 (C867A) Expression of My c-short chain NEDD4 (C867A) in cells co-expressed was similar (Panel D). (Example 8) [Fig. 9] Binding of short-chain human NEDD4 and human RUNX3, and in vivo ubiquitination of human RUNX3 by short-chain human NEDD4, FLAG—RUNX3, Myc—short-chain NEDD4 and FIG. 5 is a diagram showing the results of examination by immunoprecipitation using human cultured cells in which HA-ubiquitin is transiently co-expressed. Panels A, B and C show the results of immunoblotting with anti-Myc antibody, anti-FLAG antibody and anti-HA antibody, respectively, for the immunoprecipitates with anti-FLAG antibody. Panel D shows the results of immunoblotting with anti-Myc antibody for cell lysate. In the figure, + and 1 indicate the presence or absence of each expression plasmid. The numbers listed in the left column of the figure are the molecular weights of the molecular weight markers. Myc—short chain NEDD4 and FLAG—RUNX3 co-precipitated in samples prepared from cells co-expressed with Myc—short chain NEDD4, FLAG—RUNX3 and HA—Ub (Panel A), FLAG—RUNX3 Multiple proteins with higher molecular weights were detected (Panel B) and an increase in FLAG—RUNX3 with HA—Ub added was observed. (Panel C). On the other hand, samples prepared from cells co-expressed with Myc short-chain NEDD4 (C867A) and FLAG-RUNX3 and HA-Ub co-expressed with E3 ligase activity showed that Myc short-chain NEDD4 (C867A ) And FLAG—RUNX3 co-precipitated (Panel A), but no high molecular weight protein was detected (Panel B), and the amount of FLAG—RUNX3 with HA—U b added and its ubiquitin The degree of conversion was low (Panel C). FLAG—RUNX3, Myc short chain NEDD4 and HA—Ub co-expressed Myc short chain NEDD4, and Myc short chain NEDD4 instead of Myc short chain NEDD4 (C867A) Expression of Myc-short-chain NEDD4 (C867A) in the cultured cells was similar (Panel D). (Example 8)

[Fig. 10] Short-chain human NEDD4 and human RUNX2 binding, and short-chain human NEDD4 in vivo ubiquitin of human RUNX2, FLAG— RUNX2, Myc short-chain NEDD4 and HA ubiquitin transiently co-expressed FIG. 6 is a view showing the results of examination by immunoprecipitation using cultured human cells. Panel A, Panel B and Panel C show the results of immunoblotting with anti-Myc antibody, anti-FLAG antibody and anti-HA antibody, respectively, for the immunoprecipitates with anti-FLAG antibody. Panel D shows the results of immunoblotting with anti-Myc antibody for cell lysate. In the figure, + and 1 indicate the presence or absence of each expression plasmid, respectively. The numbers in the left column of the figure are the molecular weight markers. Samples prepared from cells co-expressed with Myc short-chain NEDD4, FLAG-RUNX2 and HA-Ub showed coprecipitation of Myc short-chain NEDD4 and FLAG-RUNX2 (Panel A). Several proteins with higher molecular weight than FLAG—RUNX2 were detected (Panel B), and increased FLAG—RUNX2 with HA—Ub added (Panel C). On the other hand, samples prepared from cells co-expressed with Myc-short-chain NE DD4 (C867A), FLAG-RUNX2 and HA-Ub co-expressed with E3 ligase activity were inactive. ) And FLAG—RUNX2 (Panel A), but no high molecular weight protein was detected (Panel B), nor was HA—Ub-enhanced FLAG—RUNX2 detected. (Panel C). FLAG—RUNX2, Myc short chain type NEDD4 and HA— Ub co-expressed cells Myc short chain type NEDD4 expression, and Myc short chain type NEDD4 instead of Myc short chain type NEDD4 4 Expression of Myc short-chain NEDD4 (C867A) in cells co-expressed with C867A was similar (Panel D). (Example 9)

[0116] [Fig. 11] In mouse C2C12 cells, short-chain human NE DD4 (C867A) with inactivated E3 ligase activity enhances alkaline phosphatase (ALP) activity under BMP-2 stimulation. FIG. An empty vector (Empty vector), short-chain human NEDD4 expression plasmid or short-chain human NEDD4 (C867A) expression plasmid was introduced into cells, cultured for 3 days under 300 ηgZml BMP-2 stimulation, and ALP activity in the cells Was measured. Each data shows the relative value of ALP activity in BMP-2 untreated empty vector-introduced cells (mean value SD, n = 6). In the figure, short human NEDD4 and short human NEDD4 (C867A) are simply indicated as NEDD4 and NEDD4 (C867A), respectively. As a result of statistical analysis using Welch's t-test, ALP activity in BMP 2 treated short-chain human NEDD4 (C867A) expression plasmid-introduced cells and ALP activity in BMP 2-treated empty vector-introduced cells (*: P <0. 05). (Example 10)

[0117] [Figure 12] In mouse C2C12 cells, Nedd4 knockdown by mouse Nedd4 siRNA inhibited the expression of endogenous Nedd4 (Panel B), and as a result, ALP activity of the cells was enhanced under BMP-2 stimulation. (Panel A) is a drawing showing that. Negative control siRNA (Negative control siRNA) or mouse Nedd4 siRNA was introduced into the cells, cultured for 3 days under 600 ngZml of BMP-2 stimulation, and ALP activity in the cells was measured (panel A). Each data shows the relative value with respect to the ALP activity in the empty vector-transfected cells not treated with BMP-2 (mean SD, n = 6). As a result of statistical analysis using Welch's t-test, there was a significant difference between ALP activity in BMP-2 treated negative control siRNA-transfected cells and mouse Nedd4 siRNA-transfected cells. (*: P <0. 05). Nedd4 knockdown effect by mouse Nedd4 siRNA was evaluated by Western blotting (Panel B). Intensity indicates the relative value of the concentration of Nedd4 band detected in each cell with respect to the concentration of Nedd4 band detected in BMP-2 untreated negative control siRNA-introduced cells. When calculating the relative value, it is detected in each cell. The concentration of Nedd4 band was corrected by the concentration of Actin band. (Example 11)

[0118] [Figure 13] In the human eclampsia cancer cell line HeLa, NEDD4 knockdown by human NEDD4 siRNA inhibited endogenous NEDD4 expression (panel B), and as a result, the proliferation of the cells was suppressed ( Panel A). Negative control (Negati ve control) siRNA or human NEDD4 siRNA (D42055—757 or D42055—1053) were cultured in cells for 3 days after transfection, and cell proliferation was measured (panel)

A). The growth rate is shown as the ratio of the growth of the human NEDD4 siRNA treatment group to the growth of the negative control siRNA treatment group (mean person SD, n = 4). After confirming the variance by F-test, statistical analysis using Student's t-test or Welch's t-test showed that the negative control siRNA treatment group and the human NEDD4 siRNA treatment group Significant differences were observed (*: p <0.05). The endogenous NEDD4 knockdown effect of human NEDD4 siRNA was evaluated by Western blotting (panel)

B). Intensity in the figure represents the relative value of the concentration of the human NEDD4 band detected in the human NEDD4 siRNA treatment group relative to the concentration of the human NEDD4 band detected in the negative control siRNA treatment group. (Example 12)

[0119] [Fig. 14] In human gastric cancer cell line NCI-N87, NEDD4 knockdown by human NEDD4 siRNA inhibited endogenous NEDD4 expression (panel B), and as a result, the growth of the cells was suppressed (panel) A) is a drawing showing this. Negative control siRNA or human NEDD4 siRNA (D42055-757, D42055-1 053 or D42055-1376) were cultured in cells for 4 days after transfection, and cell proliferation was measured (Panel A). The growth rate is shown as the ratio of the growth of the human NEDD4 siRNA treatment group to the growth of the negative control siRNA treatment group (mean SD SD, n = 4). After confirming the variance by F-test, statistical analysis was performed using Student's t-test or Welch's t-test. As a result, there was a significant difference between the growth of the negative control siRNA treatment group and the growth of the human NEDD4 siRNA treatment group. Differences were noted (*: p <0. 05). The endogenous NEDD4 knockdown effect of human NEDD4 siRNA was evaluated by Western blotting (Panel: B). Intensity indicates negative control siRNA treatment. The relative value of the concentration of the human NEDD4 band detected in the human NEDD4 siRNA treatment group relative to the concentration of the human NEDD4 band detected in the physical group is shown. (Example 12)

BEST MODE FOR CARRYING OUT THE INVENTION

[0120] Hereinafter, embodiments of the present invention will be described in more detail.

As used herein generically, it means an isolated or synthetic full-length protein; an isolated or synthetic full-length polypeptide; or an isolated or synthetic full-length oligopeptide. The term “protein” may be used. Here, the protein, polypeptide or oligopeptide includes two or more amino acids linked to each other by peptide bonds or modified peptide bonds. In the following, amino acids may be represented by one or three letters.

[0121] As used herein, isolated full length DNA and Z or RNA; synthetic full length DNA and Z or RNA; isolated DNA and Z or RNA oligonucleotides; or synthetic DNA and Z or RNA The term “polynucleotide” is sometimes used as a generic term to refer to RNA oligonucleotides. Where such DNA and Z or RNA have a minimum size of 2 nucleotides

[0122] In the present invention, the possibility that RUNX3 interacts with NEDD4, a HECT-type E3 ligase, was predicted in silico, and the possibility was experimentally verified. As a result, (1) NEDD4 binds to RUNX3 in cells, (2) RUNX3 is ubiquitinated by NEDD4, and (3) NEDD4 reduces RUNX3 stability. did. Furthermore, (4) NEDD4 binds to RUNX1 in cells, (5) RUNXl is ubiquitinated by NE DD4, and (6) NEDD4 reduces RUNX1 stability. In addition, (7) in cancer cells, the N-terminal amino acid residue is deleted! /, And the short-chain NEDD4 is expressed, and (8) the short-chain NEDD4 and RUNX1, RUNX2 and RUNX3 bind to each other, and (9) RUNX1, RUNX2 and RUNX3 are ubiquitinated by short-chain NE DD4

[0123] From the results of this demonstration, NEDD4 combined with RUNX to catalyze the ubiquitination of RUNX, As a result, the inventors believe that ubiquitinated RUNX is degraded by the ubiquitin proteasome system and its stability decreases.

[0124] By regulating the degradation of RUNX by the ubiquitin proteasome system involving NEDD4, the functions of RUNX, for example, functions as a transcription factor, are regulated. As a result, various physiological phenomena involving RUNX, For example, the cell cycle and signal transduction are regulated.

[0125] Therefore, by regulating RUNX ubiquitination by NEDD4, degradation of RUNX can be regulated, thereby regulating the function of RUNX, for example, as a transcription factor. By regulating the function of RUNX, diseases caused by abnormal RUNX can be prevented and Z or treated.

[0126] "Ubiquitination" means modification of a protein by ubiquitin by covalently binding one or more ubiquitins to one molecule of protein. Ubiquitin is covalently bound to a lysine residue in the target protein. Similar to protein ubiquitination, multiple ubiquitins are bound to a protein in a chain by further covalently binding another ubiquitin to a lysine residue in ubiquitin bound to a lysine residue in the target protein.

[0127] "Ubiquitin" is a protein consisting of 76 amino acids that is universally present in eukaryotes.

Highly conserved in evolution. Ubiquitin is linked to the target protein by covalent bonds in a chain in the ubiquitin proteasome system known as the proteolytic mechanism.

Acts as a proteolytic marker. That is, when a protein is ubiquitinated, ubiquitin bound to the protein in a chain form becomes a label for the degradation of the protein, and the protein is degraded by the proteasome that recognizes the label.

[0128] The binding of ubiquitin to the target protein occurs by the continuous catalytic action of ubiquitin-active enzyme (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin ligase (E3). Among these enzymes, ubiquitin ligase (E3) is important as an enzyme responsible for substrate selectivity. Ubiquitin ligase (E3) is also referred to as E3 ligase.

Here, “target protein” means a protein to be ubiquitinated. “Substrate” means a molecule that is catalyzed by an enzyme.

[0130] The "ubiquitin proteasome system" is a selective and active proteolytic mechanism. Yes, it regulates various physiological phenomena such as cell cycle and signal transduction, and is involved in maintaining homeostasis of proteins and cells (Non-patent Document 19). The ubiquitinated target protein is degraded by the proteasome that recognizes ubiquitin bound in a chain to the protein. Abnormalities in the ubiquitin proteasome system lead to protein deficiency due to excessive degradation of the target protein, or protein accumulation due to inhibition of target protein degradation, thereby causing various diseases. Specifically, for example, the involvement of the ubiquitin proteasome system in cancer diseases has been reported (Non-patent Document 20).

[0131] "NEDD4" is a HECT-type E3 ligase involved in the ubiquitin proteasome system, a proteolytic mechanism. NEDD4 has a C2 domain that is involved in binding to membrane lipids, four WW domains that are involved in binding to substrates, and a HECT domain that is the catalytic domain of ubiquitin and exhibits E3 ligase activity (Non-patent Document 18). .

[0132] In protein ubiquitination involving NEDD4, examples of NEDD4 substrates include RUNX. In addition, since many of E3 ligases have self-ubiquitin activity, self-protein can be mentioned as a substrate for NEDD4.

In the present specification, when simply referred to as NEDD4, it means wild-type NEDD4 having E3 ligase activity.

[0134] "E3 ligase activity" refers to ubiquitin that recognizes a target protein as a substrate in ubiquitin protein, and is activated by ubiquitin activity enzyme (E1) and bound to ubiquitin-binding enzyme (E2). It means the action of binding to the target protein.

[0135] Specifically, the E3 ligase activity of NEDD4, for example, in RUNX ubiquitination, recognizes RUNX as a substrate and is activated by ubiquitin activating enzyme (E1). This is the action of NEDD4 that binds ubiquitin bound to) to RUNX. The E3 ligase activity of NEDD4 specifically refers to, for example, self-protein ubiquitin, which recognizes self-protein as a substrate and is activated by ubiquitin-activating enzyme (E1). This is the action of NEDD4 that binds ubiquitin bound to) to self-proteins.

[0136] The measurement of E3 ligase activity can be performed using the binding of ubiquitin to the target protein by E3 ligase as an index. The binding of ubiquitin to the target protein was ubiquitinated. It can be measured by detecting the target protein. Detection of the ubiquitinated target protein can be performed by a known method such as Western blotting (see Examples 3, 5, 8 and 9).

) o

[0137] The measurement of the EDD ligase activity of NEDD4 can be specifically performed by, for example, using RUNX as a substrate and detecting RUNX that has been ubiquitinated. Alternatively, self-protein can be used as a substrate and ubiquitinated self-protein can be detected.

[0138] NEDD4 is preferably a protein encoded by a human-derived polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1, for example. The protein encoded by the human-derived polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1 is preferably a human-derived protein represented by the amino acid sequence set forth in SEQ ID NO: 2. The amino acid sequence described in SEQ ID NO: 2 is registered as P46934 in the Swiss plot database.

[0139] NEDD4 is not limited to the above protein, has sequence homology with the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1, and has the same structural features and the same as the protein. Any protein is included as long as it is a protein having a biological function. Further, the polynucleotide encoding NEDD4 is not limited to the above-mentioned polynucleotide, and has a sequence homology with the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1 and a protein encoded by the polynucleotide. As long as it is a polynucleotide encoding a protein having similar structural characteristics or biological functions, any polynucleotide is also included.

[0140] The sequence homology is usually 50% or more of the entire amino acid sequence or base sequence, preferably at least 70%. More preferably, it is 70% or more, more preferably 80% or more, even more preferably 90% or more, and even more preferably 95% or more.

[0141] The protein having sequence homology with the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1 contains one or more amino acid sequences in the amino acid sequence of the protein encoded by the polynucleotide For example, 1 to: L00, preferably 1 to 30, more preferably 1 to 20, more preferably 1 to 10, particularly preferably 1 to several amino acid residues. It includes proteins represented by amino acid sequences with mutations such as deletion, substitution, addition or insertion. In addition, in the polynucleotide having sequence homology with the polynucleotide represented by the nucleotide sequence shown in SEQ ID NO: 1, in the nucleotide sequence, one or more, for example, 1 to 300, preferably 1 to 90, Preferably, it includes a polynucleotide represented by a base sequence having a mutation such as deletion, substitution, addition or insertion of 1 to 60 nucleotides, more preferably 1 to 30, particularly preferably 1 to several nucleotides. It is. The degree of mutation and the position thereof are the same as the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1 in the protein having the mutation or the protein encoded by the polynucleotide having the mutation. As long as it has the following structural features and biological functions, it is not particularly limited. Proteins and polynucleotides having mutations may be naturally occurring or artificially introduced with mutations.

[0142] The structural features of the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1 include, for example, the C2 domain involved in binding to membrane lipids, and the WW domain involved in binding to substrates It is a catalytic domain of ubiquitin and a HECT domain that exhibits E3 ligase activity. The structural features similar to those of the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1 are domains having sequence homology and similar functions to the above-described domain existing in the protein. Means. The sequence homology of the domain is preferably at least 70%, more preferably 70% or more, even more preferably 80% or more, even more preferably 90% or more, and even more preferably 95% or more. It is.

[0143] Examples of the biological function of the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1 include E3 ligase activity. The biological function of this protein includes binding to RUNX. Preferred examples of RUNX that binds to this protein include human-derived RUNX1, RUNX2, and RUNX3. The RUNX that binds to the present protein is not limited to those exemplified, and can be any RUNX family protein as long as it binds to the present protein.

[0144] The E3 ligase activity of the protein to be examined can be measured by measuring the ubiquitination of the target protein of the E3 ligase, for example, RUNX. RUNX conversion to ubiquitin This measurement can be performed using the RUNX ubiquitin method described later.

[0145] The measurement of the binding between the protein to be examined and RUNX can be performed using a protein binding assay known per se. Specifically, the protein and RUNX are allowed to coexist in vivo or in vitro, and then complex formation of the protein and RUNX is performed by Western blotting, immunoprecipitation, pull-down, two-hybrid, and fluorescence resonance energy. The binding between the protein and RUNX can be measured by measuring using a known method such as the Luge-Issage transfer method.

[0146] A protein having sequence homology with the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1 and having the same structural characteristics and biological function as the protein is: A protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 3 is preferable. The protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 3 is preferably a protein represented by the amino acid sequence set forth in SEQ ID NO: 4. The nucleotide sequence set forth in SEQ ID NO: 3 and the amino acid sequence set forth in SEQ ID NO: 4 are registered in the NCBI database as accession numbers NM-0 06154 and NP-006145, respectively.

[0147] The protein encoded by the polynucleotide represented by the nucleotide sequence represented by SEQ ID NO: 3 is the N-terminal first protein of the protein encoded by the polynucleotide represented by the nucleotide sequence represented by SEQ ID NO: 1. The second power is a protein from which the 100th amino acid residue at the 100th is deleted. In other words, the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 3 is the N-terminal side first force of the protein represented by the amino acid sequence set forth in SEQ ID NO: 2 and the 100th 100 It is a protein in which one amino acid residue is deleted.

[0148] The protein encoded by the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 3 may be referred to as "short-chain NEDD4". In contrast, a protein encoded by a polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1 may be referred to as “full-length NEDD4J”.

[0149] “Short-chain NEDD4J has a full-length NEDD4 with a deleted amino acid residue at the N-terminal side, but, like full-length NEDD4, has a C2 domain, a WW domain, and a HECT domain. A protein that functions as a HECT-type E3 ligase. In the present specification, when simply referred to as short-chain NEDD4, it means short-chain NEDD4 having E3 ligase activity.

[0151] “RUNX” is a protein characterized by having a Runt domain, forms a heterodimer with PEBP2 β / C BF | 8, and acts as a transcription factor. RUNX has a number of family proteins. In mammals, three types of family proteins are known, namely RUNX 1, RUNX2 and RUNX3 (Non-patent Documents 1 and 2). Homology between human RUNX3 and human RUNX1 and human RUNX2 is 57% and 54%, respectively, at the amino acid level.

[0152] In the present invention, RUNX is preferably RUNX1, RUNX2, and RUNX3. RUNX is not limited to those exemplified, and may be a RUNX family protein as long as it is bound to NEDD4 and ubiquitinated.

[0153] RUNX1 is preferably a protein encoded by a human-derived polynucleotide represented by the base sequence described in SEQ ID NO: 5, for example. The protein encoded by the human-derived polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 5 is preferably a human-derived protein represented by the amino acid sequence set forth in SEQ ID NO: 6. The base sequence described in SEQ ID NO: 5 and the amino acid sequence described in SEQ ID NO: 6 are registered in the NCBI database as accession numbers NM-001754 and NP-001745, respectively.

[0154] RUNX2 is preferably a protein encoded by a human-derived polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 7, for example. The protein encoded by the human-derived polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 7 is preferably a human-derived protein represented by the amino acid sequence set forth in SEQ ID NO: 8. The base sequence described in SEQ ID NO: 7 and the amino acid sequence described in SEQ ID NO: 8 are registered in the NCBI database as accession numbers NM-004348 and NP-004339, respectively.

[0155] RUNX3 is preferably a protein encoded by a human-derived polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 9, for example. The protein encoded by the human-derived polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 9 is preferably a human-derived protein represented by the amino acid sequence set forth in SEQ ID NO: 10. The base sequence described in SEQ ID NO: 9 and the amino acid sequence described in SEQ ID NO: 10 are respectively stored in the NCBI database. The session numbers are registered as NM-004350 and NP-004341.

[0156] RUNX is not limited to the above protein, and has sequence homology with the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in any one of SEQ ID NOS: 5, 7, and 9. Any protein is included as long as the protein has the same structural characteristics and biological function as the protein. In addition, the polynucleotide encoding RUNX is not limited to the above-mentioned polynucleotide, and has sequence homology with the polynucleotide represented by the nucleotide sequence of SEQ ID NO: 5, 7, and 9, and As long as the polynucleotide encodes a protein having the same structural characteristics and biological function as the protein encoded by the polynucleotide, any of the polynucleotides is also included.

[0157] The sequence homology is usually 50% or more of the entire amino acid sequence or base sequence, preferably at least 70%. More preferably, it is 70% or more, more preferably 80% or more, even more preferably 90% or more, and even more preferably 95% or more.

[0158] A protein having sequence homology with the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in any one of SEQ ID NOs: 5, 7, and 9 includes a protein encoded by the polynucleotide. 1 or more, such as 1 to: LOO, preferably 1 to 30, more preferably 1 to 20, more preferably 1 to 10, particularly preferably 1 to several amino acid residues. Proteins represented by amino acid sequences in which mutations such as deletions, substitutions, additions or insertions exist are included. In addition, in the polynucleotide having sequence homology with the polynucleotide represented by the nucleotide sequence described in any one of SEQ ID NOs: 5, 7, and 9, one or more, for example, 1 to 300, in the nucleotide sequence, Preferably, it is represented by a nucleotide sequence having a mutation such as deletion, substitution, addition or insertion of 1 to 90, more preferably 1 to 60, still more preferably 1 to 30, and particularly preferably 1 to several nucleotides. Polynucleotides are included. The degree of mutation and the position thereof are represented by the nucleotide sequence of SEQ ID NO: 5, 7, and 9, wherein the protein having the mutation or the protein encoded by the polynucleotide having the mutation is selected from The protein is not particularly limited as long as it has the same structural characteristics and biological function as the protein encoded by the polynucleotide. Proteins and polynucleotides with mutations can be naturally occurring In addition, an artificially introduced mutation may be used.

[0159] The structural feature of the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in any one of SEQ ID NOs: 5, 7, and 9 is, for example, the Runt domain. The structural characteristics of the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in any one of SEQ ID NOs: 5, 7, and 9 are similar to the Runt domain present in the protein and have the same sequence homology. This means a Runt domain with the following functions. The sequence homology of the Runt domain is preferably at least 70%, more preferably 70% or more, further preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more. It is.

[0160] Examples of the biological function of the protein encoded by the polynucleotide represented by the nucleotide sequence set forth in any one of SEQ ID NOs: 5, 7, and 9 include transcription factor activity.

[0161] "Transcription factor activity" refers to a transcription device that synthesizes RNA from DNA, recognizes and binds to a characteristic nucleotide sequence in the DNA, and directly or indirectly (in eukaryotes). This means the action of regulating transcription positively or negatively (including basic transcription factors).

[0162] The transcription factor activity can be measured using a known transcription activity measurement method. RUN X forms a dimer with PEBP2 β / CBF β and is involved in the expression of various genes as a transcription factor (Non-patent Document 2). RUNX transcription factor activity can be measured, for example, by creating a vector in which a reporter gene is linked in place of the gene downstream of the promoter or enhancer site of the gene in which the dimer acts as a transcription factor. It can be carried out by contacting RUNX with an excised cell such as a eukaryotic cell and measuring the presence or absence and change of the reporter gene. As a reporter gene, a gene generally used in reporter assembly can be used. For example, a gene having an enzyme activity such as luciferase, 13 galactosidase, or chloramphee-cholacetyl transferase can be used. The expression of the reporter gene can be measured by detecting the gene product itself or the activity of the gene product. For example, the expression of a reporter gene as described above is up to the gene product itself. Alternatively, it can be measured by detecting the enzyme activity of the gene product.

[0163] (RUNX ubiquitin method, decomposition method, ubiquitinating agent and decomposing agent)

One embodiment of the present invention relates to a RUNX ubiquitin method using NEDD4, and a RUNX decomposition method using the method.

[0164] Further, one embodiment of the present invention is a RUNX ubiquitinating agent comprising NEDD4 and

RUNX decomposition agent.

[0165] Furthermore, one embodiment of the present invention relates to a method for decomposing RUNX, characterized by treating RUNX using a RUNX ubiquitinating agent.

[0166] The RUNX ubiquitin method characterized by using NEDD4 and the RUNX decomposition method characterized by using the method can be carried out by coexisting NEDD4 and RUNX.

[0167] The coexistence of NEDD4 and RUNX can be carried out under both in vivo and in vitro conditions.

[0168] Coexistence of NEDD4 and RUNX can preferably be performed in cells. Specifically, eukaryotic cells or cultured cell lines that have been found to express RUNX are used, and a vector containing a polynucleotide encoding NEDD4 is transfected into the cells or cell lines. By allowing NEDD4 and RUNX to coexist in a cell, a RUNX ubiquitination method and a RUNX degradation method characterized by using this method can be carried out (see Examples 3, 5, 8 and 9). In addition, using eukaryotic cells or cultured cell lines that do not express RUNX, both the vector containing the polynucleotide encoding NEDD4 and the vector containing the polynucleotide encoding RUNX are transfected into the cells or cell lines. By coexisting NEDD4 and RUNX in the cell, a RUNX ubiquitination method and a RUNX degradation method characterized by using the method can be carried out.

[0169] When performing a RUNX decomposition method characterized in that NEDD4 and RUNX coexist in a cell and using this method, NE DD4 and RUNX are combined as described above. A vector containing a polynucleotide encoding ubiquitin can be further transfected into the expressed or expressed cells. [0170] When coexistence of NEDD4 and RUNX in vitro, ubiquitin-active enzyme (E1), ubiquitin-binding enzyme (E2) and ubiquitin are required in addition to NEDD4 for the ubiquitination reaction of the target protein. Therefore, it is appropriate to use these enzymes and ubiquitin together with NEDD4. In addition, when the RUNX degradation method using NEDD4 is carried out, it is preferable to use the proteasome together with these enzymes and ubiquitin since the proteanome is involved in the degradation of the ubiquitinated target protein. Proteasomes can also be prepared with cellular power with proteasomes. As preferred cells, for example, human erythrocytes can be used. The proteanome can be prepared by the method of Emma Rich et al. (“The Journal of Biological Chemistry”, 2000, Vol. 275, p. 21140-21148). Yes! / ヽ can also use a commercially available proteasome. For example, proteasomes can be purchased from AFFINITI Research Products Ltd.

[0171] Detection of ubiquitin can be measured by detection of a ubiquitinated target protein.

Detection of the ubiquitinated target protein can be performed by a known method such as Western blotting (see Examples 3, 5, 8 and 9). When a target protein having an increased molecular weight is detected after the ubiquitin reaction, compared to before the ubiquitin reaction of the target protein, it can be determined that the target protein has been ubiquitinated.

[0172] Detection of protein degradation can be performed by a known method such as Western blotting (see Examples 4, 6, 8 and 9). It can be determined that the target protein has been degraded when the amount of the target protein is reduced after the ubiquitin reaction, compared to before the ubiquitin reaction of the target protein.

[0173] RUNX ubiquitinating agent and RUNX degrading agent are characterized by comprising NEDD4. Using the RUNX ubiquitinating agent according to the present invention, the RUNX ubiquitination method and the RUNX decomposition method can be carried out.

[0174] (RUNX ubiquitin inhibition method, degradation inhibition method, ubiquitination inhibitor and degradation inhibitor)

One embodiment of the present invention provides a method for inhibiting RUNX ubiquitin and uses the inhibition method The present invention relates to a method for inhibiting RUNX degradation. The method for inhibiting RUNX ubiquitin and the method for inhibiting degradation of RUNX, which is characterized by using the inhibition method, can be carried out under in vitro and in vitro conditions.

[0175] Further, one embodiment of the present invention relates to a RUNX ubiquitin-inhibitor and a degradation inhibitor.

[0176] Further, one embodiment of the present invention relates to a method for inhibiting RUNX degradation, which comprises using a RUNX ubiquitination inhibitor.

[0177] In the present invention, from the results of experiments using RUNX1, RUNX2, and RUNX3 and NEDD4, NEDD4 binds to RUNX to catalyze the ubiquitination of RUNX. It was found that the stability of the product is degraded by the degradation.

[0178] Accordingly, the inventors believe that inhibiting the action of NEDD4 on RUNX can inhibit RUNX ubiquitin 匕. In addition, if RUNX ubiquitin is inhibited, RUNX will not be recognized by the proteasome, so inhibiting RUNX ubiquitination can prevent degradation of RUNX by the ubiquitin proteasome system. That is, by inhibiting the action of NEDD4 on RUNX, degradation of RUNX can be inhibited.

[0179] Inhibiting NEDD4's action on RUNX can be achieved by inhibiting NEDD4 expression and Z or function.

[0180] "NEDD4 functions" means the functions that NEDD4 has! As described above, NEDD4 functions as follows: NEDD4 enzyme activity, and NEDD4 and other proteins such as

An example of the connection with RUNX.

[0181] "Inhibiting NEDD4 function" means reducing or eliminating the function of NEDD4. Inhibiting the function of NEDD4 can be exemplified by inhibiting the enzyme activity of NEDD4 or binding of NEDD4 to other proteins such as RUNX.

[0182] The method for inhibiting RUNX ubiquitination can be carried out by inhibiting at least one of the binding of RUNX and NEDD4, the enzyme activity of NEDD4, and the expression of NEDD4. [0183] Specifically, the method for inhibiting RUNX ubiquitination includes, for example, a compound that inhibits the binding of RUNX to NEDD4, a compound that inhibits the enzyme activity of NEDD4, and a compound that inhibits the expression of NEDD4. This can be done by using at least 1. Here, compounds having such an inhibitory effect (for example, polypeptides having competitive inhibitory effects, antibodies, low-molecular compounds, etc.) are referred to as inhibitors.

[0184] RUNX ubiquitination inhibitor and RUNX degradation inhibitor are compounds that inhibit the binding of RUNX and NEDD4, compounds that inhibit the enzyme activity of NEDD4, and compounds that inhibit the expression of NEDD 4 1 At least.

[0185] "Binding of RUNX and NEDD4" means that RUNX and NEDD4 interact with each other by a non-covalent bond such as a hydrogen bond, a hydrophobic bond, or an electrostatic interaction so as to form a complex. Means. In this case, it is sufficient that RUNX and NEDD4 are partly connected. For example, the amino acids that make up RUNX or NEDD4 may contain amino acids that are not involved in the binding of RUNX and NEDD4! /.

[0186] “Inhibiting the binding of RUNX and NEDD4” means reducing or eliminating the amount of the complex formed from RUNX and NEDD4.

[0187] The measurement of the binding between RUNX and NEDD4 can be carried out by a method known per se, such as Western blotting, immunoprecipitation, pull-down, two-hybrid, and fluorescence resonance energy transfer. These methods can be used in combination.

[0188] The compound that inhibits the binding of RUNX and NEDD4 is preferably a compound that specifically inhibits the binding, and more preferably a low molecular weight compound that specifically inhibits the binding. To specifically inhibit the binding of RUNX and NEDD4 means that the binding is strongly inhibited, but the binding between other proteins is not inhibited or is weakly inhibited.

[0189] The compound that inhibits the binding of RUNX and NEDD4 can be, for example, an inactive mutant of NEDD4 (hereinafter sometimes referred to as inactive NEDD4). As a preferred inactive NED D4, an inactive NE DD4 having the ability to bind to RUNX and having no E3 ligase activity can be used. Such inactive NEDD4 can inhibit the action of NEDD4 on RUNX by binding to RUNX in competition with wild-type NEDD4. Therefore, such inactive NEDD4 can inhibit RUNX ubiquitination. Inactive NEDD4 is designed by designing a desired protein based on the amino acid sequence of NEDD4 and producing it using a known method. It can obtain by sorting using the method of.

[0190] An "inactive mutant of NEDD4" is a NEDD4 mutant in which mutations such as amino acid deletion, substitution, addition or insertion have been introduced into NEDD4, compared to wild-type NEDD4. This means a NEDD4 mutant whose E3 ligase activity is attenuated or lost. Inactive NEDD4 may be naturally occurring or artificially mutated.

[0191] The mutation site in inactive NEDD4 is, for example, a site necessary for NEDD4 E3 ligase activity in the amino acid sequence of NEDD4. Specifically, this site is, for example, the 967th cysteine residue in the amino acid sequence set forth in SEQ ID NO: 2. The cysteine residue corresponds to the 867th cysteine residue in the amino acid sequence shown in SEQ ID NO: 4. The cysteine residue is an active site of E3 ligase activity to which ubiquitin binds, and is an amino acid residue essential for NEDD4 E3 ligase activity.

[0192] Inactive NEDD4 is preferably a protein represented by the amino acid sequence of SEQ ID NO: 11 or SEQ ID NO: 12, for example. The protein represented by the amino acid sequence shown in SEQ ID NO: 11 is a protein represented by the amino acid sequence in which the 967th cysteine residue is substituted with an alanine residue in the amino acid sequence shown in SEQ ID NO: 2. The protein represented by the amino acid sequence shown in SEQ ID NO: 12 is a protein represented by the amino acid sequence in which the 867th cysteine residue is substituted with an alanine residue in the amino acid sequence shown in SEQ ID NO: 4 (hereinafter referred to as the amino acid sequence shown below). , Sometimes referred to as inactive short chain NEDD4).

[0193] None of the inactive NEDD4 binds to RUNX but does not have E3 ligase activity and does not ubiquitinate RUNX (see Examples 3, 4, 5, 6, 8, and 9). From these results, these inactive mutants, in turn, competitively inhibit the binding of NEDD4 or short-chain NEDD4 to RUNX, and as a result, RUNX ubiquitin by NEDD4 or short-chain NEDD4. The inventors believe that they can inhibit wrinkles.

[0194] The compound that inhibits the binding of RUNX and NEDD4 may be a polypeptide that also has an amino acid sequence at the site where RUNX and NEDD4 bind. Such polypeptides are Binding between proteins can be competitively inhibited. Such a polypeptide can be obtained by designing the amino acid sequence of RUNX or NEDD4 and selecting one that inhibits the binding of RUNX and NEDD4 from those synthesized by a peptide synthesis method known per se. A polypeptide in which mutations such as deletion, substitution, addition or insertion of one to several amino acid residues are introduced into the identified polypeptide is also encompassed in the scope of the present invention. The polypeptide into which such a mutation is introduced preferably inhibits the binding of RUNX and NEDD4. Polypeptides having mutations may be naturally occurring or artificially introduced with mutations. These polypeptides can be obtained by a general production method described later.

[0195] Further, the compound that inhibits the binding of RUNX and NEDD4 may be an antibody that recognizes RUNX or NEDD4, and an antibody that inhibits the binding of RUNX and NEDD4, or a fragment thereof. Such an antibody can be obtained by a known antibody production method using RUNX or NEDD4 itself, or a fragment thereof, preferably a polypeptide consisting of the amino acid sequence of the site where RUNX and NEDD4 bind to each other as an antigen.

[0196] The compound that inhibits the binding of RUNX and NEDD4 may also be an aptamer that specifically recognizes RUNX or NEDD4 and inhibits the binding of RUNX and NEDD4. The aptamer can be a nucleic acid aptamer or a peptide aptamer, and a powerful aptamer can be a known method (eg, Hermann T. et al., “Science”, 2000, 287th, No. 5454, p. 820-825; Burgstaller P. et al., “Current Opinion in Drug Discovery and Development”, 2002, V. 5, 690-700; and Hop pe-Seyler F. et al., "Current Molecular Medicine", 2004, IV, 5, p. 529-538. ) Can be obtained using the method described in).

[0197] "Enzyme activity of NEDD4" means the E3 ligase activity of NEDD4.

[0198] "Inhibiting NEDD4 enzyme activity" means reducing or eliminating NEDD4 E3 ligase activity. [0199] A compound that inhibits the enzyme activity of NEDD4 can be obtained using the compound identification method described below. The compound that inhibits the enzyme activity of NEDD4 may be, for example, an antibody or a fragment thereof that inhibits the enzyme activity of NEDD4, and is an abutama that specifically binds to NEDD4 and has an action of inhibiting the activity. You can also An antibody or aptamer can be obtained by the above-mentioned method. By measuring the inhibitory action of these enzyme activities of NEDD4 by the method described in the compound identification method described later, the action of inhibiting the enzyme activity of NEDD4 can be obtained. Antibody or abutama can be obtained.

[0200] "Expression of NEDD4" means that gene information of DNA encoding NEDD4 is transferred to mRNA, or is transcribed into mRNA and translated as the amino acid sequence of protein (NEDD4) Say.

[0201] “Inhibits NEDD4 expression” means that the gene information of DNA encoding NEDD4 is transcribed into mRNA, or is transcribed into mRNA and translated as the amino acid sequence of protein (NEDD4) By interfering with at least one of the various reactions that occur during the process, the transcription of the NEDD4 gene means that the production of NEDD4 by translation is prevented.

[0202] A compound that inhibits the expression of NEDD4 can be obtained using the compound identification method described below. The compound that inhibits the expression of NEDD4 can be, for example, an antisense oligonucleotide of a polynucleotide encoding NEDD4 or a double-stranded polynucleotide that can inhibit the expression of NEDD4.

[0203] In the present invention, a double-stranded polynucleotide capable of inhibiting the expression of NEDD4 has been identified. Specifically, this double-stranded polynucleotide is a double-stranded RNA that also has the power of a polynucleotide having a partial base sequence ability of a polynucleotide encoding NEDD4 and a polynucleotide comprising a complementary base sequence of the partial base sequence. .

[0204] Specific examples of the double-stranded polynucleotide capable of inhibiting the expression of NEDD4 include the following double-stranded polynucleotide: (i) a polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 21 A double-stranded polynucleotide comprising a nucleotide and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 22, (ii) a polynucleotide represented by the base sequence set forth in SEQ ID NO: 23 and the base sequence set forth in SEQ ID NO: 24 (Iii) a polynucleotide represented by the base sequence set forth in SEQ ID NO: 25 And a double-stranded polynucleotide comprising the polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 26. Each of these double-stranded polynucleotides is a double-stranded RNA comprising a polynucleotide consisting of a partial sequence of a polynucleotide encoding NEDD4 derived from human and a polynucleotide consisting of a complementary base sequence of the partial base sequence. Yes, endogenous NEDD4 expression was reduced when transfected into human cancer cell lines (Example 12).

[0205] The double-stranded polynucleotide that can be used in the present invention is not limited to those exemplified above, and any double-stranded polynucleotide can be used as long as it is a double-stranded polynucleotide that can inhibit the expression of NEDD4. But it can be.

[0206] Examples of double-stranded polynucleotides that can inhibit NEDD4 expression include short double-stranded polynucleotides that can inhibit NED D4 expression by RNA interference, ie, siRNA (small interfering RNA) against NEDD4 ( Elbashir SM et al., “Nature”, 2001, 411, p. 494-498; and Pad dison PJ et al., “Genes and Development”, 2002 Year 16th, p. 948-958).

[0207] The siRNA for NEDD4 is composed of RNA consisting of a partial sequence of NEDD4 mRNA (sense RNA) and RNA consisting of a base sequence complementary to the base sequence of the RNA (antisense RNA) based on the sequence of NEDD4 mRNA. A double-stranded RNA is produced by designing and synthesizing by a chemical synthesis method known per se, and making the obtained RNA noislative, and its intermediate force can also inhibit the expression of NEDD4. It can be acquired by selecting. Selection of siRNA that can inhibit NEDD4 expression involves transfecting the double-stranded RNA to be examined in cells expressing NEDD4, measuring the expression level of endogenous NEDD4, and inhibiting the expression level. It can be implemented by selecting what to obtain. It is preferable that the sense RNA and the antisense RNA constituting the siRNA each consist of several or about ten or more nucleotides. In addition, it is preferable that one or several nucleotide sequences called an overhang sequence are bound to the 3 ′ end of each nucleotide. The overhang sequence has the effect of protecting RNA from nuclease power. The overhang sequence is not particularly limited as long as it does not inhibit the RNA interference effect of the RNA, preferably 1 to 10, more preferably 1 to 4, more preferably 2 Any of those having nucleotide strength can be used. Specifically, a sequence that also includes deoxythymidylate (eg, TT), a sequence that also includes uridylate (eg, UU), a sequence that is linked to deoxythymidylate, followed by any nucleotide (eg, TN) t An array can be illustrated. More preferably, two deoxythymidylate sequences are used as overhang sequences because they can be synthesized inexpensively and are more resistant to nucleases. The overhang sequence is bound to the ribose hydroxyl group at the 3 'end of each of sense RNA and antisense RNA by a diester bond.

Examples of siRNA that can inhibit the expression of NEDD4 by RNA interference techniques include shRNA. shRNA is a short double-stranded RNA with a hairpin structure and, like siRNA, suppresses gene expression by RNA interference (Paddison PJ et al., “Genes and Development (Genes and Development). ”, 2002, 16th pp. 948-958). shRNA has a hairpin-like structure because sense RNA and antisense RNA are linked by, for example, an oligonucleotide, and a sense RNA-derived portion and an antisense RNA-derived portion form a double strand. In addition to sense RNA and antisense RNA, shRNA is designed based on the nucleotide sequence of NEDD4 mRNA by designing RNA containing oligonucleotides that link these two RNAs and form a loop structure. Can be obtained by producing a short double-stranded RNA having a hairpin structure and selecting one that can inhibit the expression of NEDD4. The selection of shRNAs that can inhibit NEDD 4 expression is achieved by transfecting short double-stranded RNA with a hairpin structure that expresses NEDD4! It can be carried out by measuring the amount and selecting one that can inhibit the expression level. It is preferable that the ^ terminus of the sense RNA and the ^ terminus of the oligonucleotide forming the loop structure are combined, and further the oligonucleotide linking the ^ terminus of the oligonucleotide forming the loop structure and the ^ terminus of the antisense RNA. Hope to be. An oligonucleotide that forms a loop structure means an oligonucleotide that exists between a sense RNA and an antisense RNA and that can link both RNAs and itself forms a loop structure. The design of such oligonucleotides is described in the literature (Paddison PJ et al., “Genes and Development”, 2002, Vol. 16, p. 948-95. It can be implemented with reference to the description in 8). Preferably 4 to 23, more preferably 4 or 8 nucleotides are desirable. For example, sequences such as TTCAAGAGA (Ambion or Oligoengine), AACGTT, TTAA, CAAGCTTC and the like can be mentioned. Formation of a duplex having a hairpin structure can be carried out by annealing a sense RNA-derived portion and an antisense RNA-derived portion by a conventional method.

[0209] An embodiment of the present invention includes the double-stranded polynucleotide. Preferably, the following double-stranded polynucleotide can be exemplified: (i) consisting of a polynucleotide represented by the base sequence set forth in SEQ ID NO: 21 and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 22 A heavy chain polynucleotide, (ii) a double-stranded polynucleotide comprising a polynucleotide represented by the base sequence set forth in SEQ ID NO: 23 and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 24, and (iii) a sequence A polynucleotide represented by the nucleotide sequence represented by No. 25 and a double-stranded polynucleotide comprising the polynucleotide represented by the nucleotide sequence represented by SEQ ID No. 26.

[0210] In the embodiment of the present invention, there is also a single-stranded polypeptide constituting the double-stranded polynucleotide, for example, a polynucleotide represented by the nucleotide sequence set forth in any one of SEQ ID NOs: 21 to 26. included.

[0211] The RUNX ubiquitin inhibition method and the RUNX degradation inhibition method according to the present invention are preferably performed using the NEDD4 inactive mutant and the double-stranded polynucleotide capable of inhibiting the expression of NEDD4. it can. More preferably, the method for inhibiting RUNX ubiquitination and the method for inhibiting RUNX degradation according to the present invention can be performed using at least one selected from the following proteins and double-stranded polynucleotides: SEQ ID NO: 1 A protein represented by the amino acid sequence described; a protein represented by the amino acid sequence represented by SEQ ID NO: 12; a polynucleotide represented by the base sequence represented by SEQ ID NO: 21 and the base sequence represented by SEQ ID NO: 22. A double-stranded polynucleotide comprising the polynucleotide represented by the base sequence set forth in SEQ ID NO: 23 and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 24; and A duplex comprising the polynucleotide represented by the base sequence set forth in SEQ ID NO: 25 and the polynucleotide represented by the base sequence set forth in SEQ ID NO: 26 Strand polynucleotide. [0212] The RUNX ubiquitin inhibitor and the RUNX degradation inhibitor according to the present invention are preferably selected for the NEDD4 inactive mutant and the double-stranded polynucleotide force capable of inhibiting the expression of NEDD4. Contains an effective amount of at least one. More preferably, the RUNX ubiquitin inhibitor and the RUNX degradation inhibitor according to the present invention comprise an effective amount of at least one selected from the following proteins and double-stranded polynucleotides: SEQ ID NO: 11 A protein represented by the amino acid sequence described; a protein represented by the amino acid sequence represented by SEQ ID NO: 12; a polynucleotide represented by the nucleotide sequence represented by SEQ ID NO: 21; and a base sequence represented by SEQ ID NO: 22. A double-stranded polynucleotide comprising the polynucleotide represented; a polynucleotide represented by the base sequence set forth in SEQ ID NO: 23 and a polynucleotide represented by the polynucleotide represented by the base sequence set forth in SEQ ID NO: 24 And a duplex comprising the polynucleotide represented by the base sequence set forth in SEQ ID NO: 25 and the polynucleotide represented by the base sequence set forth in SEQ ID NO: 26 Li nucleotide.

[0213] Using the RUNX ubiquitination inhibitor according to the present invention, the RUNX ubiquitination inhibition method and the RUNX degradation inhibition method can be carried out.

[0214] (Pharmaceutical composition)

One aspect of the present invention relates to a pharmaceutical composition comprising an effective amount of the RUNX ubiquitinating agent according to the present invention and Z or the RUNX decomposing agent according to the present invention as active ingredients. Another aspect of the present invention relates to a pharmaceutical composition comprising the RUNX ubiquitin inhibitor according to the present invention and Z or the RUNX degradation inhibitor according to the present invention as an effective ingredient.

[0215] A RUNX ubiquitinating agent according to the present invention, a RUNX decomposing agent according to the present invention, and a pharmaceutical composition comprising the ubiquitinating agent and an effective amount of Z or the RUNX decomposing agent, In addition, it can be used as a preventive and Z or therapeutic agent for diseases caused by reduction of RUNX degradation by the ubiquitination. These drugs and pharmaceutical compositions can be used to implement prevention and Z or treatment methods for such diseases.

[0216] The RUNX ubiquitin inhibitor according to the present invention, the RUNX degradation inhibitor according to the present invention, and the pharmaceutical composition comprising the ubiquitin inhibitor and Z or the RUNX degradation inhibitor in an effective amount, RUNX ubiquitination and RUNX by ubiquitination It can be used as a preventive and z or therapeutic agent for diseases caused by increased degradation of These drugs and pharmaceutical compositions can be used to implement prevention and Z or treatment methods for such diseases.

[0217] RUNX1 is involved in hematopoietic cell sorting and is a causative gene of leukemia (Non-patent Documents 4 and 5). Specifically, there are reports showing that loss of RUNX1 function is involved in the development of leukemia (Non-patent Documents 6 and 7). Based on this, the inventors believe that reduction of RUNX1 is involved in the onset and exacerbation of cancer diseases such as leukemia.

[0218] By inhibiting the ubiquitination of RUNX1 by NEDD4 and the degradation of RUNX1 by the ubiquitination, reduction of RUNX1 can be inhibited, resulting in prevention and Z or treatment of cancer diseases such as leukemia. Is thinking.

[0219] RUNX2 is an important transcription factor involved in bone formation, and is essential for chondrocyte differentiation 'maturation, osteoblast differentiation and bone marrow formation (Non-patent Documents 26 and 27). For example, since bone formation is not observed in RUNX2 knockout mice, it is considered that the defect causes bone formation failure (Non-patent Document 8). Since RUNX2 binds to the transcription factor Smadl, which is involved in the induction of bone morphogenetic gene expression by BMP stimulation, it is thought that RUNX2 is involved in bone formation signals via BMP stimulation (Non-Patent Documents). 28). RU NX2 acts on the differentiation of bone cells, and also expresses bone matrix genes (Collal, Colla2, osteopontin, osteocalcin), bone sialoprotein, etc. Has been shown to be active (Non-patent Document 29). From these, the inventors believe that reduction of RUNX2 is associated with abnormal bone formation, such as bone loss.

[0220] In fact, osteogenesis model cells stimulated with BMP-2 are inactivated NEDD4 that binds to RUNX but does not have E3 ligase activity, or siRNA that can inhibit the expression of NEDD4. Using it, it was demonstrated in the present invention that inhibition of NEDD4 expression and Z or function increases alkaline phosphatase activity, which is an indicator of bone formation (see Examples 10 and 11). Bone-type alkaline phosphatase present in the osteoblastic membrane reflects early osteoblast activity, for example, when pre-osteoblasts differentiate into osteoblasts and then transition from the proliferative phase to the substrate synthesis phase. ing. That is, NEDD4 Inhibition of expression and Z or function can be thought to promote osteoblast ossification by BMP-2 stimulation.

[0221] BMP is a site force-in that induces bone tissue by differentiating and proliferating undifferentiated mesenchymal stem cells into chondrocytes and osteoblasts in vivo. BMP-2 has been shown to be expressed early in the fracture healing process and is involved in the progression of a series of cascades in bone repair. In addition, when BMP is applied to muscles, bone is formed ectopically, and when it is applied to the bone surface, callus-like osteogenesis occurs. Based on these facts, it is considered that BMP-2 is used to repair bone tissues such as fractures, bone defects, and root surgery (Chen, D. et al., “Growth Factor”). 2004, 22nd, 4th, p. 233-241). In addition, osteoporosis is a disease in which the bone balance is unbalanced due to decreased osteoblast function and increased bone resorption, resulting in bone loss and increased fractures. Therefore, the enhancement of BMP-2 signal is It is thought to reinforce both the restoration of osteoblast function and the promotion of fracture healing for the disease.

[0222] Thus, in the present invention, inhibition of NEDD4 expression and Z or function increases the alkaline phosphatase activity of bone formation model cells stimulated with BMP-2, and, as described above, the short chain type. We found that NEDD4 and RUNX2 combined. Based on these findings, inhibition of NEDD4 expression and Z or function resulted in bowel I inhibition of RUNX2 ubiquitination by NEDD4 in RUNX2, which is involved in osteogenesis signals by BMP-2 stimulation. It can be considered that this promoted the osteogenic signal. As a result of the promotion of the bone formation signal, it can be considered that the bone differentiation of the bone formation model cell is promoted and its alkaline phosphatase activity is increased.

[0223] By inhibiting NEDD4 expression and Z or function, RUNX 2 ubiquitination by NEDD4 and degradation of RUNX2 by the ubiquitination can be inhibited, and RUNX2 can be stabilized. As a result, osteogenesis signals involving RUNX2 can be promoted, and osteoblast differentiation and osteogenesis can be further promoted. The inventors believe that by promoting osteoblast differentiation and bone formation in this way, it is possible to prevent and Z or treat abnormal bone formation, such as bone loss disease, more specifically osteoporosis, for example. ing.

[0224] One embodiment of the present invention based on this finding relates to an osteogenesis promoter characterized by inhibiting the expression and Z or function of NEDD4. The osteogenesis promoter according to the present invention is preferably an osteogenesis promoter by RUNX, more preferably RUNX2. The bone formation promoter according to the present invention comprises at least one of a compound that inhibits the function of NEDD4 and a compound that inhibits the expression of NEDD4.

[0225] Preferably, the osteogenesis promoter according to the present invention is represented by an inactive NEDD4 that binds to RUNX but does not have E3 ligase activity, for example, the amino acid sequence set forth in SEQ ID NO: 11 in the Sequence Listing. An osteogenesis promoter comprising an effective amount of a protein and a protein represented by Z or the amino acid sequence set forth in SEQ ID NO: 12.

[0226] Furthermore, the osteogenesis promoter according to the present invention may be an osteogenesis promoter comprising a double-stranded polynucleotide capable of inhibiting the expression of NEDD4. Preferred examples of the double-stranded polynucleotide contained in the osteogenesis promoter according to the present invention include the following double-stranded polynucleotides: (i) a polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 21 A double-stranded polynucleotide comprising a nucleotide and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 22; (ii) a polynucleotide represented by the base sequence set forth in SEQ ID NO: 23 and the base set forth in SEQ ID NO: 24 A double-stranded polynucleotide comprising a polynucleotide represented by the sequence; and (iii) a polynucleotide represented by the base sequence described in SEQ ID NO: 25 and a polynucleotide represented by the base sequence described in SEQ ID NO: 26 A double-stranded polynucleotide consisting of The three types of double-stranded polynucleotides exemplified above are double-stranded polynucleotides comprising human-derived polynucleotides. The promotion of bone formation by these three types of double-stranded polynucleotides has not been studied. However, these three types of double-stranded polynucleotides inhibited NEDD4 expression (see Example 12), and also derived from mouse-derived double-stranded polynucleotides (represented by the nucleotide sequence set forth in SEQ ID NO: 19). Inhibition of NEDD4 expression using a polynucleotide and a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 20 promoted alkaline phosphatase activity, an indicator of bone formation, in mouse cell lines (Example 10). Therefore, the inventors consider that the three types of double-stranded polynucleotides have a bone formation promoting action. [0227] The osteogenesis promoting method of the present invention can be used to implement the osteogenesis promoting method.

[0228] One aspect of the present invention also relates to a pharmaceutical composition comprising an effective amount of the osteogenesis promoter according to the present invention as an active ingredient. Such a pharmaceutical composition can be used as a preventive and Z or therapeutic agent for abnormal bone formation, such as bone loss diseases, more specifically osteoporosis. These agents and pharmaceutical compositions can be used to implement prevention and Z or treatment methods for such diseases.

[0229] RUNX2 has also been reported that its overexpression causes abnormalities in T cell differentiation and is involved in lymphoma formation through synergistic action with c-myc (Non-patent Document 9). Based on this, the inventors think that increased RUNX2 calorie is involved in the development and exacerbation of lymphoma.

[0230] The inventors believe that RUNX2 can be degraded by ubiquitinating RUNX2 with NEDD4, resulting in prevention and Z or treatment of lymphoma.

[0231] Since RUNX3 binds to Smad, an intracellular mediator of TGF-β, it is considered to be involved in TGF-β signaling (Non-patent Document 10). Mutations in the TGF-β receptor and Smad have been observed in many cancers (Non-patent document 11), and RUNX3 is thought to be involved in cancer via the TGF- | 8 signal (Non-patent document 12). 14 and 15). In addition, there have already been several reports on the relationship between RUNX3 and human cancer diseases such as stomach cancer, colon cancer, bile duct cancer, and spleen cancer (Non-patent Documents 13, 16 and 17). In addition, the tumor formation inhibitory effect of RUN X3 has been confirmed in animal experiments using a transplant model (Non-patent Document 13). From these, the inventors think that the reduction of RUNX3 is involved in the onset and exacerbation of cancer diseases such as gastric cancer, colon cancer, bile duct cancer, and spleen cancer.

[0232] RUNX2 has been reported to be involved in lymphoma formation through synergism with c-myc (Non-patent Document 9), while RUNX3 has been reported to be involved in tumor growth inhibition (Non-patent Document 9). References 10-17), the extent of RUNX's involvement in tumorigenesis and tumor growth inhibition and its mechanism are not clear. In the present invention, it has become clear that NEDD4 ubiquitinates RUNX, but the difference in the degree of ubiquitin by NEDD4 for each RUNX family protein such as RUNX1, RUNX2, and RUNX3 is not clear.

[0233] However, in the present invention, the inventors found that RUNX is ubiquitinated by NEDD4. (See Examples 3, 5, 8 and 9), and in human uterine cervical cancer cell line HeLa and human gastric cancer cell line NCI-N87, using siRNA that can inhibit the expression of NEDD4, It was found that tumor growth was suppressed by inhibiting expression (see Example 12).

[0234] NEDD4 expression is increased at the mRNA level in several cancer cell lines, such as the human eclampsia cancer cell line HeLa, the human lung cancer cell line A549, and the human leukemia cell line K562! Has been reported (Non-patent Document 21). However, there are no reports suggesting an increase in the expression of NEDD4 in human clinical specimens or a link between NEDD4 and cancer diseases.

[0235] Thus, in the present invention, inhibition of NEDD4 expression suppresses tumor growth, and as described above, short-chain NEDD4 binds to RUNX, and RUNX force SNEDD4 causes ubiquitin secretion. I found out that RUNX3 is thought to be involved in tumor growth inhibition. Based on these findings, the inventors believe that suppression of tumor growth by inhibiting the expression of NEDD4 may be related to the inhibition of RUNX3 ubiquitination by NEDD4 and stabilization of RUNX3. Therefore, the inventors think that tumor growth can be suppressed not only by the expression of NEDD4 but also by inhibiting the function of NEDD4.

[0236] One embodiment of the present invention based on this finding relates to a tumor growth inhibitor characterized by inhibiting the expression and Z or function of NEDD4. The tumor growth inhibitor according to the present invention comprises at least any one of a compound that inhibits the function of NEDD4 and a compound that inhibits the expression of NEDD4.

[0237] Preferably, the tumor growth inhibitor according to the present invention binds to RUNX but does not have E3 ligase activity, and is represented by inactive NEDD4, for example, the amino acid sequence set forth in SEQ ID NO: 11 of the Sequence Listing. And a tumor growth inhibitor comprising an effective amount of the protein represented by Z or the amino acid sequence represented by SEQ ID NO: 12.

[0238] Furthermore, the tumor growth inhibitor according to the present invention may be a tumor growth inhibitor comprising a double-stranded polynucleotide capable of inhibiting the expression of NEDD4. Preferred examples of the double-stranded polynucleotide contained in the tumor growth inhibitor according to the present invention include the following double-stranded polynucleotide: (i) a polynucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 21 Nucleotides and sequences A double-stranded polynucleotide comprising the polynucleotide represented by the nucleotide sequence represented by No. 22; (ii) the polynucleotide represented by the nucleotide sequence represented by SEQ ID No. 23 and the nucleotide sequence represented by SEQ ID No. 24; A double-stranded polynucleotide comprising the polynucleotide represented by: and (iii) a duplex comprising the polynucleotide represented by the base sequence set forth in SEQ ID NO: 25 and the polynucleotide represented by the base sequence set forth in SEQ ID NO: 26 Polynucleotide. Of the above-exemplified double-stranded polynucleotides, the following three types of double-stranded polynucleotides are double-stranded polynucleotides having a human-derived polynucleotide ability. All of these three types of double-stranded polynucleotides inhibited cell growth as a result of transfection into human cancer cell lines (see Example 12).

[0239] The method for inhibiting tumor growth can be carried out using the tumor growth inhibitor according to the present invention.

[0240] One aspect of the present invention also relates to a pharmaceutical composition comprising an effective amount of the tumor growth inhibitor according to the present invention as an active ingredient. Such a pharmaceutical composition can be used as a preventive and Z or therapeutic agent for diseases associated with tumor growth, such as cancer diseases, more specifically, cancer diseases such as stomach cancer, colon cancer, bile duct cancer, liver cancer and the like. . These agents and pharmaceutical compositions can be used to implement prevention and Z or treatment methods for such diseases.

[0241] More specifically, inhibition of NEDD4 expression and Z or function can inhibit RUNX3 degradation by RUNX3 ubiquitination by NED D4 and stabilize RUNX3. As a result, tumor growth is suppressed by RUNX3. Thus, by suppressing tumor growth, it is possible to prevent and Z or treat diseases associated with tumor growth, such as cancer diseases, more specifically cancer diseases such as gastric cancer, colon cancer, bile duct cancer, and liver cancer. The inventors think.

[0242] The pharmaceutical composition according to the present invention is usually preferably prepared as a pharmaceutical composition containing one or more pharmaceutical carriers in addition to the active ingredient.

[0243] The amount of the active ingredient contained in the pharmaceutical preparation according to the present invention is appropriately selected from a wide range. Usually, it is appropriate that the amount is in the range of about 0.0001 to 70% by weight, preferably about 0.0001 to 5% by weight.

[0244] The pharmaceutical carrier includes a filler, a bulking agent, a binder, a moistening agent, a disintegrant, a lubricant, a diluent, an excipient, and the like that are generally used according to the form of use of the preparation. used. They are It is appropriately selected and used depending on the administration form of the resulting preparation.

[0245] More specifically, water, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polybutylpyrrolidone, carboxyvinyl polymer, sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin , Xanthan gum, gum arabic gum, casein, gelatin, agar, glycerin, propylene glycol, polyethylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, ratatose, etc. . These may be used singly or in combination of two or more according to the dosage form of the pharmaceutical composition.

[0246] Various components that can be used in normal protein preparations, for example, stabilizers, bactericides, buffering agents, tonicity agents, chelating agents, surfactants, and pH adjusters are appropriately used as desired. Say it with a word.

[0247] As the stabilizer, for example, human serum albumin, ordinary L-amino acid, saccharide, cellulose derivative and the like can be used. These can be used alone or in combination with a surfactant or the like. In particular, according to this combination, the stability of the active ingredient may be further improved. The L amino acid is not particularly limited, and may be any of glycine, cysteine, glutamic acid and the like. Sugars are not particularly limited, for example, monosaccharides such as glucose, mannose, galactose and fructose, sugar alcohols such as mannitol, inositol and xylitol, disaccharides such as sucrose, maltose and lactose, dextran, hydroxypropyl starch, Any of polysaccharides such as chondroitin sulfate and hyaluronic acid, and derivatives thereof may be used. The cellulose derivative is not particularly limited, and may be any of methyl cellulose, ethyl cenololose, hydroxy ethino reseno relose, hydroxypropino reseno relose, hydroxy open propyl methyl cellulose, carboxymethyl cellulose sodium and the like.

[0248] As the surfactant, any of an ionic surfactant and a nonionic surfactant can be used. Surfactants include, for example, polyoxyethylene glycol sorbitan alkyl ester, polyoxyethylene alkyl ether, sorbitan monoacyl ester, and fatty acid glyceride. [0249] Buffering agents include, for example, boric acid, phosphoric acid, acetic acid, citrate, ε-aminocaproic acid, dartamic acid and Ζ or a salt thereof (for example, sodium salt, potassium salt, calcium salt, magnesium salt thereof) Alkali metal salts such as alkaline earth metal salts).

[0250] As the tonicity agent, for example, sodium chloride sodium, potassium salt sodium, saccharide, and glycerin can be used.

[0251] As the chelating agent, for example, sodium edetate or quenate can be used.

[0252] The medicine and pharmaceutical composition according to the present invention can be used as a solution preparation, and after freezing, drying and storing it, it contains water, physiological saline, etc. It can also be used after it is dissolved in a buffer solution or the like to prepare an appropriate concentration.

[0253] The dose range of the medicine and the pharmaceutical composition is not particularly limited, and the effectiveness of the contained ingredient, the administration form, the administration route, the type of the disease, the nature of the subject (weight, age, medical condition and use of other medicines) Or the like) and the judgment of the doctor in charge. In general, a suitable dose is, for example, in the range of about 0.01 μg to 100 mg, preferably about 0.1: g to lmg, per kg of body weight of the subject. However, these dosage changes can be made using general routine experimentation for optimization well known in the art. The above dosage can be divided into once to several times a day, and may be administered intermittently at a rate of once every several days or weeks! /.

[0254] When administering the pharmaceutical composition according to the present invention, the pharmaceutical composition may be used alone or in combination with other compounds or medicines necessary for the prevention and Z or treatment of the target disease. May be. For example, you may mix | blend the active ingredient of the medicine for anti-tumor etc.

[0255] The route of administration can be selected from systemic administration or local administration! In this case, an appropriate administration route is selected according to the disease, symptom and the like. For example, examples of parenteral routes include normal intravenous administration and intraarterial administration, as well as subcutaneous, intradermal, intramuscular administration and the like. It can also be administered by the oral route. Furthermore, transmucosal administration or transdermal administration is possible. When used for cancer diseases, it can be administered directly to the tumor by injection or the like.

[0256] As the dosage form, various forms can be selected according to the purpose. Typical examples include solid dosage forms such as tablets, pills, powders, powders, fine granules, granules, capsules, aqueous preparations, ethanol solution preparations, suspensions, fat emulsions, and ribosome preparations. , Cyclodextrin, etc. Liquid dosage forms such as clathrate, syrup, elixir and the like. Depending on the route of administration, these can be further administered orally, parenterally (instillations, injections), nasal preparations, inhalants, vaginal preparations, suppositories, sublingual, eye drops, ear drops, ointments, creams And can be prepared, molded and prepared according to conventional methods.

[0257] (Compound identification method)

One embodiment of the present invention relates to a method for identifying a compound that inhibits or promotes RUNX ubiquitin.

[0258] RUNX ubiquitination can be thought to be performed by NEDD4 participating as an E3 ligase and binding to RUNX to catalyze RUNX ubiquitination.

[0259] Accordingly, the method for identifying a compound that inhibits or promotes RUNX ubiquitination is preferably a method for identifying a compound that inhibits or promotes RUNX ubiquitination by NEDD4.

[0260] The method for identifying a compound according to the present invention can be carried out using a pharmaceutical screening system known per se. For example, a method for identifying a compound that inhibits or promotes RUNX ubiquitin by NEDD4 can be carried out using the method generally used in screening for inhibitors of E3 ligase. In screening of E3 ligase inhibitors, the substrate in vivo or E3 ligase itself is used as the substrate for E3 ligase. In this identification method, RUNX or NEDD4 itself can be used as a substrate for NEDD4. In the identification method using RUNX as the substrate, in addition to the compound that inhibits the enzyme activity of NEDD4, a compound that inhibits the binding of NEDD4 and RUNX can be obtained, so it is more preferable to use RUNX as the substrate. ,.

[0261] A method for identifying a compound that inhibits or promotes RUNX ubiquitin can be performed using, for example, an experimental system using the RUNX ubiquitin method according to NEDD4 of the present invention. The experimental system using the RUNX ubiquitination method by NEDD4 according to the present invention refers to an experimental system in which NEDD4 and RUNX coexist and RUNX is ubiquitinated by NEDD4. The compound identified by the identification method using such an experimental system includes a compound that inhibits or promotes the enzyme activity of NEDD4, and a compound that inhibits or promotes the binding of NEDD4 to RUNX. [0262] Specifically, in such an experimental system, a signal (hereinafter referred to as a test compound) is brought into contact with NEDD4 and / or RUNX, and a signal capable of detecting RUNX ubiquitination by NEDD4 and Use a system that uses Z or a marker to detect the presence or absence or change of this signal and Z or marker and whether or not the test compound inhibits RUNX ubiquitination by NEDD4 By determining whether to do so, compounds that inhibit or promote RUNX ubiquitination by NEDD4 can be identified.

[0263] The test compound can coexist in the RUNX ubiquitin reaction by NEDD4, or the test compound can be previously contacted with NEDD4 and Z or RUNX, followed by the RUNX ubiquitination reaction by NEDD 4. it can. Signal produced by RUNX ubiquitin by NEDD4 or marker power of ubiquitin ときに When test compound is contacted with NE DD4 and Z or RUNX, compared to when test compound is not contacted If it shows a change such as decrease or disappearance, it can be determined that the test compound inhibits RUNX ubiquitination by NED D4. In contrast, when the test compound is brought into contact with NEDD4 and Z or RUNX, the signal or marker force is increased or generated compared to when the test compound is not brought into contact with the test compound. If indicated, it can be judged that the test compound promotes RUNX ubiquitination by NEDD4.

[0264] Such an experimental system can be performed under both in vivo and in vitro conditions.

[0265] In an in vitro experimental system, ubiquitin activity enzyme (E1), ubiquitin-conjugating enzyme (E2), and ubiquitin are required in addition to NEDD4 in the ubiquitination reaction of the target protein. Are suitable for use together.

[0266] The in vivo experimental system may preferably be an experimental system using eukaryotic cells or cultured cell lines expressing both NEDD4 and RUNX, for example. In addition, eukaryotic cells or cultured cell lines expressing RUNX or NEDD4 can be used. Furthermore, a eukaryotic cell or cultured cell line that expresses both NEDD4 and RUNX, or a cell that further expresses ubiquitin in a eukaryotic cell or cultured cell line that expresses NEDD4 or RUNX can be used. The expression of these proteins in cells uses appropriate vectors containing a polynucleotide encoding NEDD4, appropriate vectors containing a polynucleotide encoding RUNX, and appropriate vectors containing a polynucleotide encoding Z or ubiquitin. This can be achieved by transfecting these vectors into cells using conventional genetic engineering techniques.

[0267] In an experimental system using cells expressing both NEDD4 and RUNX, treat the cells with a test compound and use a signal and Z or marker that can detect RUNX ubiquitination by NEDD4 The system is used to detect this signal and the presence or absence or change of Z or the best, and to determine whether the test compound is able to inhibit or promote the ability of NEDD4 to inhibit RUNX ubiquitin. By determining, compounds that inhibit or promote RUNX ubiquitin by NEDD4 can be identified. When cells are treated with a test compound, the signal generated by RUNX ubiquitination by NEDD4 or the marker of ubiquitin decreases or disappears compared to when cells are not treated with the test compound. The test compound can be determined to inhibit RUNX ubiquitination by NEDD4. On the other hand, when the signal or marker shows a change such as an increase or occurrence when the cell is treated with the test compound compared to when the cell is not treated with the test compound, Test compounds can be judged to promote RUNX ubiquitination by NEDD4.

[0268] In the above in vitro or in vivo experimental system, compounds that inhibit the enzyme activity of NEDD4 can be identified by measuring self-ubiquitin activity by NEDD4 without using RUNX. Compounds that inhibit the enzymatic activity of NEDD4 can inhibit RUNX ubiquitination by NEDD4. Therefore, compounds that can inhibit RUNX ubiquitination by NEDD4 can also be identified by measuring self-ubiquitination by NEDD4 without using RUNX in the above experimental system.

[0269] Detection of ubiquitin can be measured by detection of a ubiquitinated target protein.

Detection of the ubiquitinated target protein can be performed by a known method such as Western blotting (see Examples 3, 5, 8 and 9). The ubiquitin reaction of the target protein If a target protein having an increased molecular weight is detected after the ubiquitin reaction compared to before, it can be determined that the target protein has been ubiquitinated. In addition, by using ubiquitin labeled with an appropriate labeling substance, ubiquitinated labeled protein can be easily detected using the labeling substance as an index, and thus the use of such a labeled ubiquitin is useful. . The ability to use tag peptides such as HA-tag and FLAG-tag as labeling substances is not limited to these, and as long as it is a substance that does not inhibit NEDD4 ubiquitination of RUNX Can also be used. The labeling substance can be detected using a detection method known per se. For example, tag peptides can be detected by anti-tag peptide antibodies. In this case, detection can be more easily carried out by using an antibody labeled with HRP (Hosradish peroxidase), alkaline phosphatase, a radioisotope, a fluorescent substance or piotin as an anti-tag peptide antibody. Alternatively, a secondary antibody labeled with the above enzyme, radioisotope, fluorescent substance, piotin or the like may be used.

[0270] Specifically, methods for identifying a compound that inhibits or promotes RUNX ubiquitination by NEDD4 include, for example, an appropriate vector containing a polynucleotide encoding RUNX, an appropriate vector containing NEDD4, and an HA-tag. Can be carried out using cells transfected with an appropriate vector containing a polynucleotide encoding ubiquitin attached to the N-terminus (see Examples 3, 5, 8 and 9). After the cells are treated with the test compound, the cells are collected, lysed by an appropriate method to prepare cell lysate, ubiquitinated RUNX contained in the cell lysate is measured, and the test compound is used. When ubiquitinated RUNX is reduced or eliminated compared to untreated cells, the test compound can be determined as a compound that inhibits RUNX ubiquitination by NEDD4. In contrast, when ubiquitination RUNX increases, the test compound can be determined as a compound that promotes RU NX ubiquitination by NEDD4. The ubiquitination RUNX contained in the cell lysate can be measured, for example, by detecting ubiquitin bound to RUNX with an HRP-labeled anti-HA antibody.

[0271] In addition, any method can be used without limitation as long as it is generally used in screening for inhibitors of ubiquitin E3 ligase. When screening specimens, a system using a fluorescence resonance energy transfer assay (FRET Assay), a dissociation-enhanced lanthanum-defluorinated assay (DELFIA Assay), or electrochemiluminescence (ECL) should be used. Applied systems, systems that apply Scintillation Kimi City 1 Atsei (SPA), etc. can be used suitably (Yi Sun, “Methods in Enzymology”, 2005, No. 3 99) , P. 654—663). At this time, RUNX can be used as a substrate for ubiquitination, and self-ubiquitin activity using NEDD4 itself as a substrate can be detected, but it is desirable to use RUNX as a substrate.

[0272] One embodiment of the present invention also relates to a method for identifying a compound that inhibits or promotes the binding of NEDD4 to RUNX.

[0273] A method for identifying a compound that inhibits or promotes the binding between NEDD4 and RUNX can be carried out using a protein binding assay generally used in screening for binding inhibitors for IJ.

[0274] A method for identifying a compound that inhibits or promotes the binding of NEDD4 and RUNX can be carried out, for example, using an experimental system in which NEDD4 and RUNX coexist and NEDD4 and RUNX are combined.

[0275] In such an experimental system, a test compound is brought into contact with NEDD4 and Z or RUNX, and a system using a signal and Z or marker that can detect the binding of NEDD4 and RUNX is used. By detecting the presence or absence or change of this signal and Z or marker and determining whether the test compound inhibits or promotes the binding of NEDD4 to RUNX. And compounds that inhibit or promote the binding of RUNX.

[0276] The test compound can coexist in the binding reaction of NEDD4 and RUNX, or the test compound can be previously contacted with NEDD4 and Z or RUNX, and then the binding reaction of NEDD4 and RUNX can be performed. Signal or binding marker force generated by binding of NEDD4 and RUNX When test compound is brought into contact with NEDD4 and Z or RUNX, it decreases or disappears compared to when test compound is not in contact with force If there is a change, it can be determined that the test compound inhibits the binding of NEDD4 and RUNX. this On the other hand, the signal or marker increases or occurs when the test compound is brought into contact with NEDD4 and Z or RU NX compared to when the test compound is not brought into contact with the test compound. If it shows a change, it can be determined that the test compound promotes the binding of NEDD4 and RUNX.

[0277] Such experimental systems can be performed under both in vivo and in vitro conditions.

[0278] An in vitro experimental system can be carried out with reference to identification methods generally used in screening for protein binding inhibitors. The in vitro experimental system can be, for example, an experimental system in which NE DD4 and RUNX are reacted in vitro and the binding of both proteins is detected by a pull-down method.

[0279] The in vivo experimental system may preferably be an experimental system using eukaryotic cells or cultured cell lines expressing both NEDD4 and RUNX, for example. Eukaryotic cells or cultured cell lines expressing RUNX or NEDD4 can also be used in such experimental systems. Expression of these proteins in the cells is accomplished by conventional genetic engineering techniques using appropriate vectors containing a polynucleotide encoding NEDD4 and appropriate vectors containing a polynucleotide encoding Z or RUNX. This can be achieved by transformation.

[0280] The binding between NEDD4 and RUNX can be performed by a known protein detection method such as immunoprecipitation method, pull-down method, two-hybrid method, western blotting and fluorescence resonance energy transfer method, or a combination of these methods. In addition, it can be carried out by detecting the complex formed by NEDD4 and RUNX. In order to facilitate detection of a complex of NEDD4 and RUNX, NEDD4 and Z or RUNX are preferably labeled with an appropriate labeling substance. As the labeling substance, tag peptides such as FLAG-tag, Myc tag and HA-tag can be preferably used. Detection of the labeling substance can be performed using a detection method known per se. For example, tag peptides can be detected by anti-tag peptide antibodies. At this time, detection can be performed more easily by using an antibody labeled with HRP (horseradish peroxidase), alkaline phosphatase, radioisotope, fluorescent substance or piotin as an anti-tag peptide antibody. The Alternatively, a secondary antibody labeled with the above enzyme, radioisotope, fluorescent substance, piotin or the like may be used.

[0281] Specifically, a method for identifying a compound that inhibits or promotes the binding of NEDD4 and RUNX includes, for example, an appropriate vector containing a polynucleotide encoding RUNX with a FLAG-tag added to the N-terminus, and This can be carried out using cells transfected with an appropriate vector containing a polynucleotide encoding NEDD4 with a Myc-tag attached to the N-terminus (see Example 2). After the cells are treated with the test compound, the cells are collected, lysed by an appropriate method to prepare cell lysate, and the complex of NEDD4 and RUNX contained in the cell lysate is detected. Measurement of the complex contained in the cell lysate can be carried out by immunoprecipitation using an anti-FLAG antibody followed by Western blotting using an anti-Myc antibody. Quantities of NEDD4 and RUNX complex detected when cells are treated with test compound If cells are not treated with test compound, sometimes reduced or disappeared compared to the amount of complex detected On the other hand, it can be determined that the test compound inhibits the binding of NE DD4 and RUNX. In contrast, the amount of complex of NEDD4 and RUNX detected when cells are treated with the test compound Increased compared to the amount of complex detected when cells are not treated with the test compound It can be determined that the test compound promotes the binding of NEDD4 and RUNX.

[0282] A method for identifying a compound that inhibits or promotes the binding of NEDD4 and RUNX can also be performed using a known two-hybrid method. For example, a plasmid that expresses NE DD4 and a DNA binding protein as a fusion protein, a plasmid that expresses RUNX and a transcriptional activation protein as a fusion protein, and a plasmid containing a reporter gene such as lacZ connected to an appropriate promoter gene can be used in yeast or true. The expression level of the reporter gene when the cells are treated with a test compound after transfection into a cell such as a nuclear cell, and the expression level of the reporter gene when the cell is not treated with the test compound Compare. If the expression level of the reporter gene in the cells treated with the test compound is reduced or disappeared compared to the expression level of the reporter gene in the cells not treated with the test compound, the test compound may be NEDD4 and RUNX. It can be determined that binding is inhibited. In contrast, the expression level of the reporter gene in the cells treated with the test compound is Not treated with the compound! When the expression level of the reporter gene in the cell increases, it can be determined that the test compound promotes the binding between NEDD4 and RUNX.

[0283] The compound identified by the identification method is a compound that inhibits or promotes the binding of NEDD4 and RUNX.

[0284] In the present invention, a method for identifying a compound that inhibits or promotes the expression of NEDD4 can also be carried out. A method for identifying a compound that inhibits the expression of NEDD4 can be carried out using an experimental system capable of measuring the expression of NEDD4. In such an experimental system, a polynucleotide encoding NEDD4 and a test compound were allowed to coexist and their expression was measured, and the change in expression compared to the measurement result in the absence of the test compound. By detecting (decrease, disappearance or increase), compounds that inhibit or promote NEDD4 expression can be identified.

[0285] The experimental system that can measure the expression of NEDD4 can be specifically an experimental system that expresses NEDD4 using cells transfected with an expression vector containing a polynucleotide encoding NEDD4. In such an experimental system, after treating the cells with a test compound, the cells are collected, lysed by an appropriate method to prepare cell lysate, and NEDD4 contained in the cell lysate is detected. . The amount of NEDD4 detected when cells are treated with the test compound. If the amount of NEDD4 is reduced or disappears compared to the amount of NEDD4 detected when cells are not treated with the test compound, the test compound is It can be determined that expression is inhibited. In contrast, the amount of NEDD4 detected when cells are treated with the test compound. When the amount of NEDD4 detected when cells are not treated with the test compound increases, Can be determined to promote the expression of NEDD4.

[0286] The expression of NEDD4 can be measured by directly detecting NEDD4 by a known protein detection method such as Western blotting. In addition, NEDD4 can be easily measured by introducing a signal serving as an expression index into an experimental system and detecting the signal. As a signal serving as an expression index, for example, a labeling substance can be used. NEDD4 can be easily measured by labeling NEDD4 with a labeling substance and measuring the labeling substance. FLAG -tag, Myc— tag And tag peptides such as HA-tag can be preferably used. Detection of the labeling substance can be carried out using a known detection method. For example, tag peptides can be detected with anti-tag peptide antibodies. In this case, detection can be more easily carried out by using an antibody labeled with HRP (horseradish bar oxidase), alkaline phosphatase, radioisotope, fluorescent substance or piotin as an anti-tag peptide antibody. Alternatively, use a secondary antibody labeled with the above enzyme, radioisotope, fluorescent substance, or piotin.

[0287] In addition, an experimental system that can measure the expression of NEDD4 creates a vector in which a reporter gene is linked instead of the polynucleotide downstream of the promoter region of the polynucleotide encoding NEDD4, It may be an experimental system using a cell that has been cleaved, such as a eukaryotic cell. In such an experimental system, the expression level of the reporter gene when the cells are treated with the test compound is compared with the expression level of the reporter gene when the cells are not treated with the test compound. If the expression level of the reporter gene in the cell treated with the test compound is not treated with the test compound and decreases or disappears compared to the expression level of the reporter gene in the cell, the test compound is NEDD4 Can be determined to inhibit the expression of. On the other hand, if the expression level of the reporter gene in the cell treated with the test compound increases without comparison with the expression level of the reporter gene in the cell without treatment with the test compound, the test sample The compound can be determined to promote the expression of NEDD4. As a reporter gene, a gene generally used in reporter assembly can be used, and for example, a gene having an enzyme activity such as luciferase, j8-galactosidase, or chloramphee-cholase transferase can be used. The expression of the reporter gene can be detected by detecting the activity of the gene product, for example, the enzyme activity in the case of the reporter gene.

[0288] As a test compound, for example, a chemical library, a compound derived from a natural product, or a compound obtained by drug design based on the primary structure or three-dimensional structure of NEDD 4 and RUNX can be used. . Alternatively, a compound obtained by drug design based on the structure of a polypeptide consisting of the amino acid sequence of the binding site of NEDD4 and RUNX is also suitable as the test compound. [0289] Another embodiment of the present invention relates to a method for identifying a compound capable of promoting bone formation. The method for identifying a compound capable of promoting bone formation according to the present invention is characterized by measuring whether a test compound is capable of inhibiting the expression and Z or function of NEDD4.

[0290] In the present invention, BMP is inhibited by inhibiting the expression and Z or function of NEDD4.

It was found that the alkaline phosphatase activity (see Examples 10 and 11), which is an index of bone formation, was increased in the osteogenic model cells stimulated in 2. Since the short-chain NEDD4 and RUNX2 bind as described above, inhibition of NEDD4 expression and Z or function causes inhibition of ubiquitin による by RUNX2 NEDD4, which is involved in bone formation signals induced by BMP-2 stimulation. As a result, it can be considered that RUNX2 was stabilized and the bone formation signal was thereby promoted. As a result of the promotion of the bone formation signal, it can be considered that the bone differentiation of the bone formation model cell is promoted and its alkaline phosphatase activity is increased.

[0291] That is, a compound that inhibits the expression and Z or function of NEDD4 may cause inhibition of RUNX2's ubiquitination by NEDD4, thereby promoting RUNX2's stabilization and the resulting osteogenic signal. it can. Such compounds can be thought to promote bone differentiation and bone formation by promoting bone formation signals.

[0292] A method for identifying a compound capable of promoting bone formation, characterized by measuring whether a test compound inhibits NEDD4 expression, is a method for identifying a compound that inhibits the above-mentioned NEDD4 expression. Can be implemented. When the test compound inhibits the expression of NEDD4, it can be determined that the test compound can promote bone formation.

[0293] The function of NEDD4 can be evaluated, for example, by measuring its E3 ligase activity and its ability to bind to RUNX. The E3 ligase activity of NEDD4 can be measured, for example, by detecting RUNX or self-ubiquitin using RUNX or NED D4 as a substrate. Preferably, the ubiquitin activity is detected using RUNX as a substrate.

[0294] Therefore, a method for identifying a compound capable of promoting bone formation, characterized by measuring the power of the test compound to inhibit the function of NEDD4, is described, for example, by NEDD4. It can be carried out using a method for identifying a compound that inhibits RUNX ubiquitin. In addition, NEDD4 itself can be used as a substrate instead of RUNX, and a compound that inhibits self-ubiquitination by NEDD4 can be identified. When the test compound inhibits RUNX ubiquitin or auto-ubiquitin caused by NEDD4, it can be determined that the test compound can promote bone formation.

[0295] In addition, the method for identifying a compound capable of promoting bone formation is characterized in that the test compound measures the force or inability to inhibit the function of NEDD4. For example, the above-mentioned binding method of NEDD4 and RUNX is inhibited. It can carry out using the identification method of the compound to do. When the test compound inhibits the binding of NEDD 4 and RUNX, it can be determined that the test compound can promote bone formation.

[0296] Among the RUNX family proteins, RUNX2 is known to play an important role in bone formation, and therefore it is characterized by measuring whether or not a test compound inhibits the function of NEDD4. In the method for identifying a compound that can promote bone formation, RUNX2 is preferably used.

[0297] In the method for identifying a compound capable of promoting bone formation according to the present invention, the test compound that has been shown to inhibit NEDD4 expression and Z or function by the above-described identification method is further used. It may be an identification method that further includes a step of measuring force dynamism capable of promoting the above.

[0298] As an experimental system that can measure the promotion of bone formation, for example, an experimental system using osteogenic model cells can be used. For example, mouse C2C12 cells can be used as osteogenesis model cells. Mouse C2C12 cells are myoblasts and are derived from the same mesenchymal stem cells as osteoblasts and chondrocytes. C2C12 cells show typical osteoblastic phenotypes upon stimulation with BMP-2, such as increased alkaline phosphatase activity and osteocalcin production. It has been used as a model cell (Katagiri T. et al., “The Journal of Cell Biology”, 1994, 127, p. 1755—1766).

[0299] Specifically, in an experimental system using osteogenesis model cells, after culturing the cells in the presence of site force-in that promotes osteogenesis, bone formation markers in the cells are added. taking measurement Thus, the promotion of bone formation of the cells can be measured. When cells are cultured in the presence of cytoforce in, when osteogenesis markers are increased compared to when cells are cultured in the absence of site force in, the cell's bone function and bone formation are reduced. It can be judged that it was promoted.

[0300] For example, BMP-2 can be preferably used as a site force-in that promotes bone formation. Moreover, as a bone formation marker, for example, alkaline phosphatase or osteocalcin can be used. The site force-in and the bone formation marker that promote bone formation are not limited to these, and any site force-in or marker that is generally used for evaluation of bone formation can be used. The bone formation marker can be measured by a generally used method for measuring a bone formation marker.

[0301] In an experimental system using such bone formation model cells, a test compound that can promote bone formation can be identified by treating the cells with the test compound. When the bone formation marker in the cell treated with the test compound increases with respect to the cell compared with the bone formation marker when treated with the test compound, it is judged that the bone differentiation and bone formation of the cell are promoted. it can.

[0302] One embodiment of the present invention also relates to a method for identifying a compound capable of suppressing tumor growth. The method for identifying a compound capable of suppressing tumor growth according to the present invention is characterized in that the test compound measures the power and inability to inhibit the expression and Z or function of NEDD4.

[0303] In the present invention, it was found that NEDD4 binds to RUNX3 and ubiquitinates RUNX3 (Examples 2 and 3). It was also found that inhibition of NEDD4 expression suppresses the growth of human cancer cell tumor lines (see Example 12).

[0304] That is, a compound that inhibits the expression and Z or function of NEDD4 is thought to cause inhibition of RUNX3 ubiquitination by NEDD4, resulting in stabilization of RUNX3 and thereby suppression of tumor growth.

[0305] A method for identifying a compound capable of suppressing tumor growth, characterized by measuring whether a test compound inhibits the expression of NEDD4, is a compound that inhibits the expression of NEDD4 as described above. The identification method can be used. When NEDD4 expression is inhibited by the test compound, it can be determined that the test compound can suppress tumor growth.

[0306] NEDD4 functions by, for example, measuring its E3 ligase activity and its ability to bind to RUNX. Can be evaluated. The ligase activity of NEDD4 can be measured, for example, by detecting RUNX ubiquitination or self-ubiquitination using RUNX or NEDD4 as a substrate. Preferably, the ubiquitin activity is detected using RUNX as a substrate.

[0307] Therefore, a method for identifying a compound capable of suppressing tumor growth, characterized by measuring the power of the test compound to inhibit NEDD4 function, is, for example, RUNX ubiquitination by NEDD4. It can be carried out by using a method for identifying a compound that inhibits the above. In addition, NEDD4 itself can be used as a substrate instead of RUNX, and it can be carried out by identifying compounds that inhibit self-ubiquitination by NEDD4. When the test compound inhibits RUNX ubiquitin or self-ubiquitin caused by NEDD 4, it can be determined that the test compound can suppress tumor growth.

[0308] The binding ability of NEDD4 and RUNX is generally used in screening for binding inhibitors, and can be performed using the protein binding assay.

[0309] Therefore, a method for identifying a compound capable of suppressing tumor growth, characterized by measuring the power of the test compound to inhibit the function of NEDD4, includes, for example, the above-mentioned binding of NEDD4 and RUNX. This can be carried out using a method for identifying a compound to be inhibited. When the test compound inhibits the binding of NEDD4 and RUNX, it can be determined that the test compound can suppress tumor growth.

[0310] Among the RUNX family proteins, RUNX3 is known to play an important role in tumor growth suppression. Therefore, it is characterized by measuring the power of the test compound to inhibit the function of NEDD4. It is preferable to use RUNX3 as RUNX in the method for identifying compounds that can suppress tumor growth! /.

[0311] In the method for identifying a compound capable of suppressing tumor growth according to the present invention, the test compound that has been shown to inhibit the expression and Z or function of NEDD4 by the above-described identification method is further used. The identification method may further include a step of measuring a force force that can be suppressed.

[0312] As an experimental system capable of measuring suppression of tumor growth, for example, an experimental system using a human cancer cell line can be used. In such an experimental system, by treating cancer cells with a test compound, When the growth of cancer cells is suppressed as compared with cancer cells not treated with the test compound, it can be determined that the test compound can suppress tumor growth.

[0313] (Reagent kit)

One embodiment of the present invention relates to a reagent kit. This reagent kit encodes at least one of NEDD4, a polynucleotide encoding NEDD4, a recombinant vector containing the polynucleotide, and a transformant containing the recombinant vector, and RUNX and RUN X. A reagent kit comprising at least one of a polynucleotide containing the polynucleotide, a recombinant vector containing the polynucleotide, and a transformant containing the recombinant vector. The reagent kit further comprises at least one of ubiquitin, a polynucleotide encoding ubiquitin, a recombinant vector containing the polynucleotide, and a transformant containing the recombinant vector. It can be. This reagent kit can be used, for example, in the method for identifying a compound according to the present invention.

[0314] The reagent kit according to the present invention may contain a required substance such as a signal and Z or a marker, a buffer, and a salt used in the identification method. In addition, stabilizers and substances such as Z or preservatives may be included. When formulating, it is advisable to introduce formulation methods for each substance to be used.

[0315] (Acquisition of NEDD4, RUNX and ubiquitin)

[0316] NEDD4, RUNX and ubiquitin are preferably human-derived proteins. However, mammalian-derived proteins having the same functions and structural homology as the human-derived proteins, such as mice, It can be a protein such as mah, hidge, ushi, nu, monkey, cat, bear, rat or rabbit. The polynucleotides encoding NEDD4, RUNX and ubiquitin are preferably human-derived polynucleotides, but mammals having the same functions and structural homology as the human-derived proteins. As long as it is a polynucleotide encoding a protein derived from, it can be a polynucleotide derived from, for example, mouse, horse, hidge, ushi, dog, monkey, cat, bear, rat, or rabbit. The properties and functions of NEDD4, RUNX and ubiquitin include, for example, the binding of NEDD4 and RU NX, the binding of ubiquitin to RUNX by NEDD4 (ubiquitination), and the ligase activity of NEDD 4. [0317] NEDD4, RUNX and ubiquitin were either expressed in genetically engineered cells or biological samples prepared, cell-free or chemically synthesized products, or further purified from them It may be a thing. In addition, cells in which at least one of NEDD4, RU NX and ubiquitin is expressed by a genetic engineering technique can also be used. NEDD4, RUNX, and ubiquitin are genetically linked to other proteins or polypeptides on the N-terminal side or C-terminal side, either directly or indirectly through linker peptides, as long as their properties and functions are affected. It may be attached using engineering techniques. Other proteins and polypeptides include, for example, enzymes such as dartathione S-transferase (GST), β-galatatosidase, horseradish peroxidase (HR Ρ) or alkaline phosphatase (ALP), His-tag, Myc-tag Tag peptides such as HA-tag, FLAG-tag or Xpress-tag can be used.

[0318] Any known method can be used as a genetic engineering technique. For example, the method described in the book (edited by Sambrook et al., “Molecular Cloning, Laboratory Manual, Second Edition”, 1989, Cold Spring Harbor Laboratory; edited by Masami Muramatsu, “Laboratory-Genetic Engineering” 1988, Maruzen Co., Ltd .; Ulmer, KM, Science, 1983, 219th, p. 666-671; edited by Ehrlich, HA, PCR Technology, DNA Amplification Principles and Applications ”(see 1989, Stotton Press etc.) can be used.

[0319] Polynucleotides encoding NEDD4, RUNX, and ubiquitin can be easily obtained from, for example, appropriate sources in which the expression of each polynucleotide is observed using a cloning method known per se. As the origin of these polynucleotides, various cells and tissues in which the expression of the polynucleotide has been confirmed, or cultured cells derived therefrom can be used. As a source of a polynucleotide encoding NEDD4, for example, cells derived from human muscle or muscle tissue can be used. As the origin of the polynucleotide encoding RUNX, for example, various cancer cell lines can be used. As the origin of the polynucleotide encoding ubiquitin, for example, cells derived from human brain and brain tissue can be used.

[0320] Isolation of total RNA from origin, isolation and purification of mRNA, acquisition of cDNA and its cloning, etc. can all be performed according to conventional methods. In addition, commercially available cDNA libraries Can also be used. The method for selecting a desired clone as well as the cDNA library is not particularly limited, and a conventional method can be used. For example, a plaque hybridization method using a probe that selectively binds to a target DNA sequence, a colony hybridization method, or a combination of these methods can be used. As a probe used here, DNA chemically synthesized based on information on the nucleotide sequences of polynucleotides encoding NEDD4, RUNX and ubiquitin, respectively, can be generally used. In addition, sense primers and antisense primers designed based on the nucleotide sequence information of the polynucleotide can be used as such probes. Selection of the target clone from the cDNA library can be performed, for example, by confirming the expressed protein for each clone using a known protein expression system and using the biological function as an index.

[0321] Other genetic engineering methods include PCR (Ulmer, KM, "Science", 1983, 219th, p. 666-671; edited by Ehrlich, HA; "PCR Technology, Principles and Applications of DNA Amplification ”, 1989, Stockton Press; Saiki RK; et al.,“ Science ”, 1985, No. 230, p. 1350-1354)) Can be suitably used. If it is difficult to obtain a full-length cDNA library, the RACE method ("Experimental Medicine", 1994, No. 12, IV, p. 35-), especially the 5'-RACE method ( Frohman MA et al., “Proceedings of the National Academy of Sciences of The United States of America”, 1988, 85th, Proceedings of the National Academy of Sciences of the United States of America. Adopting S., No. 23, p. 8998-9002) is suitable. Primers used for PCR can be appropriately designed based on the DNA sequence information of DNA, and can be obtained by synthesis according to conventional methods. Isolation and purification of the amplified DNAZRNA fragment can be performed by a conventional method. For example, DNAZRNA fragments can be isolated and purified by gel electrophoresis or the like.

[0322] As long as the function of the encoded protein, for example, the expression of the encoded protein or the function of the expressed protein is not inhibited, the polynucleotide may be, for example, GST, β-galactosidase, HRP or ALP. Enzymes such as His-tag, Myc-tag, or HA-tag, FLAG-tag or Xpress-tag etc. The nucleotide can be one or more added polynucleotides. The attachment of these polynucleotides can be performed by conventional genetic engineering techniques.

[0323] By constructing a recombinant vector containing a polynucleotide encoding NEDD4, RUNX and ubiquitin, respectively, and expressing the polynucleotide in an appropriate host cell using the recombinant vector, NEDD4, RUNX and ubiquitin are used. Among them, cells expressing at least 1 can be obtained. Moreover, NEDD4, RUNX and ubiquitin can be prepared from the cells by a known method.

[0324] The vector DNA is not particularly limited as long as it can replicate in the host, and is appropriately selected depending on the type of host and intended use. The vector DNA may be one obtained by extracting a naturally occurring one, or a part of the DNA other than that required for replication. Representative vector DNAs are, for example, vector DNAs derived from plasmids, butteriophages and viruses. As plasmid DNA, for example, a plasmid derived from E. coli, a plasmid derived from Bacillus subtilis, or a plasmid derived from yeast can be used. For example, λ phage can be used as the pacteriophage DNA. Examples of virus-derived vector DNA include vectors derived from animal viruses such as retrovirus, vaccinia virus, adenovirus, papovavirus, SV40, fowlpox virus, and pseudorabies virus, or insect viruses such as baculovirus. You can use vectors. In addition, vector DNA derived from a transposon, an insertion element, or a yeast chromosomal element can be used. Alternatively, a vector DNA prepared by combining them, for example, a vector DNA (such as cosmid phage phagemid) prepared by combining genetic elements of plasmid and butteriophage can be used. Moreover, either an expression vector or a cloning vector can be used as desired.

[0325] It is necessary to incorporate the gene into the vector DNA so that the function of the target gene is exerted, and at least the target gene sequence and the promoter are constituent elements. In addition to these elements, a gene sequence carrying information regarding replication and control, for example, a ribosome binding sequence, a terminator, a signal sequence, a cis-element such as an enhancer, a splicing signal, and a selectable marker may be selected as desired. Combine one or more gene sequences into a vector DNA by a method known per se be able to. As a selection marker, for example, a dihydrofolate reductase gene, an ampicillin resistance gene, or a neomycin resistance gene can be used.

[0326] As a method for incorporating the target gene sequence into the vector DNA, a method known per se can be applied. For example, the target gene sequence is treated with an appropriate restriction enzyme, cleaved at a specific site, mixed with vector DNA treated in the same manner in V, and religated by ligase. Alternatively, the desired recombinant vector can also be obtained by ligating an appropriate linker to the target gene sequence and inserting it into the multicloning site of the appropriate vector.

[0327] A transformant can be obtained by transfecting a recombinant vector containing polynucleotides encoding NEDD4, RUNX and ubiquitin, respectively, into a host. If an expression vector is used as the vector DNA, cells expressing at least one of these polynucleotides can be obtained, and NEDD4, RUNX or ubiquitin can be produced by using the cells by a known method. The transformant can be further transfected with one or more vector DNAs containing a desired polynucleotide other than polynucleotides encoding NEDD4, RUNX and ubiquitin, respectively.

[0328] Prokaryotic and eukaryotic! / Slack can also be used as hosts. Prokaryotes include, for example, the genus Escherichia such as Escherichia coli, the Bacillus genus such as Bacillus subtilis, the Syudomonas genus such as Pseudomonas putida, and the Rhizobium meriroti (Rhizobium). Bacteria belonging to the genus Rhizobium such as meliloti) can be used. As eukaryotes, yeasts such as Saccharomyces cerevisiae and Schizosaccharomyces pombe, insect cells such as Sf9 and Sf21, monkey kidney-derived cells (COS cells, Vero cells), Chinese hamsters Animal cells such as ovary cells (CHO cells), mouse L cells, rat GH3 cells, and human HEK293T cells can be used. Preferably animal cells are used.

[0329] Transfection of vector DNA into a host cell can be carried out by a method known per se. For example, a standard method described in a book (Sambrook et al. Ng, Laboratories-Second Edition ", 1989, Cold Sp It can be implemented by the Ringnober Laboratory. As a more preferable method, an integration method into a chromosome can be used in consideration of gene stability. For convenience, an autonomous replication system using extranuclear genes can be used. Specific methods include, for example, calcium phosphate transfer, DEAE-dextran mediated transfer, microinjection, cationic lipid mediated transfer, electoral position, transduction, scrape loading. ), Ballistic introduction and infection.

[0330] NEDD4, RUNX, and ubiquitin are cells, biological samples, or cell-free or chemically synthesized products that express genetically engineered polynucleotides encoding NEDD4, RUNX, and ubiquitin, respectively. However, it may be purified or further purified from these. In addition, these proteins can be expressed in cells containing a polynucleotide encoding the protein. The cell may be a transformant obtained by transfecting a vector containing a polynucleotide encoding RUNX and ubiquitin, respectively.

[0331] NEDD4, RUNX, and ubiquitin can be further modified without significant changes in function, such as modification of its constituent amino groups or carboxyl groups, for example, by amidation. In addition, it is labeled by adding another protein or the like to the N-terminal side or C-terminal side directly or indirectly using a genetic engineering method through a linker peptide or the like. May be. Preferably, a label that does not inhibit the basic properties of the protein is desirable. Examples of proteins to be added include enzymes such as GST, β-galatatosidase, HRP or ALP, tag peptides such as His-tag, Myc-tag, HA-tag, FLAG-tag or Xpress-tag, fluoro Fluorescent dyes such as fluorescein isothiocyanate or phycoerythrin, maltose binding protein, Fc fragment of immunoglobulin or piotin can be used, but not limited thereto. It can also be labeled with a radioisotope. One or a combination of two or more substances can be added for labeling. By measuring the substance itself used for labeling or its function, this protein can be easily detected or purified, and for example, the interaction between this protein and other proteins can be detected. [0332] Specifically, for example, these proteins are obtained by culturing a transformant obtained by transfecting a vector DNA containing NEDD4, RUNX or ubiquitin, and then recovering the target protein from the obtained culture. Can be manufactured. The transformant can be cultured using culture conditions and culture methods known per se optimal for each host. Culturing can be performed using the present protein expressed by the transformant itself or its function as an index. Some may be cultured using the present protein itself or the amount of the protein produced in or outside the host as an index, and subculture or batch culture may be performed using the amount of transformant in the medium as an index. You may go.

[0333] When the target protein is expressed in the cell or on the cell membrane of the transformant, the target protein is extracted by crushing the transformant. When the target protein is secreted outside the transformant, use the culture solution as it is, or use a culture solution from which the transformant has been removed by centrifugation or the like.

[0334] NEDD4, RUNX or ubiquitin can also be produced by common chemical synthesis methods. For example, the methods described in the book (“Peptide Synthesis”, Maruzen Co., Ltd., 1975 and “Peptide Synthesis”, Interscience, New York, 1996) are used. Not limited to these, known methods can be widely used. Known methods for chemically synthesizing proteins include solid-phase synthesis methods and liquid-phase synthesis methods. Any of these methods can be used. More specifically, such a protein synthesis method is based on amino acid sequence information, in which each amino acid is sequentially linked one by one to extend the chain, and the so-called stepwise longong method, This includes a fragment condensation method in which several fragments having several strengths are synthesized in advance and then each fragment is subjected to a coupling reaction, and the protein can be synthesized by any of them. The condensation methods used in the above protein synthesis can also follow conventional methods, for example, azide method, mixed acid anhydride method, DCC method, active ester method, redox method, DPPA (diphenylphosphoryl azide) method, DCC + The methods such as potassium (1-hydroxybenzotriazole, Ν-hydroxysuccinamide, Ν-hydroxy-5-norbornene-1,2,3-dicarboximide), and the Wordword method can be used. Moreover, these proteins can be produced using a commercially available amino acid synthesizer. [0335] NEDD4, RUNX or ubiquitin having a mutation introduced therein can also be used in the present invention. Proteins, polypeptides and means for introducing mutations into polypeptides are known per se, such as Ulmer's technology (KM Ulmer, Science), 1983, 219, p. 666-671. ). From the viewpoint of not changing the basic properties (physical properties, functions, immunological activity, etc.) in introducing such mutations, for example, homologous amino acids (polar amino acids, nonpolar amino acids, hydrophobic amino acids). Mutual substitution between acids, hydrophilic amino acids, positively charged amino acids, negatively charged amino acids, aromatic amino acids, etc.) is readily envisioned. Furthermore, these usable polypeptides can be altered to a degree without significant or altered functions, such as modification of their constituent amino groups or carboxyl groups, for example by amido.

[0336] NEDD4, RUNX or ubiquitin can be purified and / or separated by various separation methods utilizing its physical properties, chemical properties, etc., if desired. Separation and Z or purification can be performed using the function of the protein as an indicator. As the separation operation method, for example, ammonium sulfate precipitation, ultrafiltration, gel chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography, dialysis method and the like can be used alone or in appropriate combination. Preferably, based on the amino acid sequence information of the present protein, a specific antibody against them is prepared and specifically adsorbed using the antibody, for example, affinity chromatography using a column to which the antibody is bound. It is recommended to use graphy.

[0337] Hereinafter, the present invention will be specifically described based on examples, but the present invention is not limited to the following examples.

Example 1

[0338] (In silico search for proteins that interact with RUNX3)

Prediction of a protein having a function of interacting with RUNX3 was carried out as follows according to the in silico prediction method described in International Publication No. WO01Z67299: (i) Oligopeptide having a certain length of amino acid sequence of RUNX3 (Ii) search the database for proteins having the amino acid sequence of each oligopeptide or an amino acid sequence homologous to the amino acid sequence, and (iii) local alignment between the obtained protein and RUNX3. (Iv) Predict that a protein with a high local alignment score interacts with RUNX3.

[0339] As a result of the analysis (Fig. 1), NEDD4 was found as a protein predicted to have a function of interacting with RUNX3. Oligopeptides consisting of partial amino acid sequences of RUNX3 FPYSA T (SEQ ID NO: 13), AELRNA (SEQ ID NO: 15) and LSVAGM (SEQ ID NO: 17), homologous oligopeptides FEYSAT (SEQ ID NO: 14), AEELNA (SEQ ID NO: 16) ) And GRVAGM (SEQ ID NO: 18) were found in the amino acid sequence of NEDD4.

Example 2

[0340] (Combination analysis of RUNX3 and NEDD4)

The binding of human RUNX3 and human NEDD4 was examined by immunoprecipitation using a transient co-expression system in cultured human cells.

[0341] <Materials and methods>

A human RUNX3 expression plasmid was constructed as described below. Human RUNX3 cDNA was purchased from Open Biosystems (clone number MHS1011-74936). The ORF was amplified by PCR using the purchased human RUNX3 cDNA in a cage, primers with EcoRI and Xhol sites attached, and the nucleotide sequence was confirmed by sequencing. Subsequently, the obtained ORF region was incorporated into an animal cell expression plasmid pCMV-Tag2 (STRATAGENE) for expressing an N-terminal FLAG-tag binding protein at the EcoRlZXhoI site to construct a human RUNX3 expression plasmid. From this human RUNX3 expression plasmid, N-terminal FLAG-tag binding human RUNX3 (hereinafter referred to as FLAG-RUNX3) is expressed. The deduced amino acid sequence encoded by the cloned human RUNX3 cDNA was the same as that published in the NCBI protein database accession number NP-004341 (registered gene name is RUNX3).

[0342] A human NEDD4 expression plasmid was constructed as described below. Human NEDD4 cDNA was prepared based on the nucleotide sequence of the KIAA0093 clone (NCBI accession number D42055). The base sequence of the KIAA0093 clone was considered to have a deletion of 218 bp on the end side compared to the genomic sequence. In view of this, cDNA was prepared by further extending 218 bp to the ^ -terminal side of the base sequence of the KIAA0093 clone with reference to the genome sequence. Extension 218 bp per minute was obtained from human skeletal muscle-derived cDNA (QUICK-clone cDNA 製 Clontech) by PCR, and the nucleotide sequence was confirmed by sequencing. Acquired human NEDD4 cDNA, after adding the Myc-tag coding sequence at the 5 'end was incorporated into the expression for animal cell bra plasmid _P CI (Promega Corp.) to construct a human NEDD4 expression plasmid. This human NEDD4 expression plasmid expresses N-terminal Myc-tag-linked human NEDD4 (hereinafter referred to as Myc-NEDD4). The deduced amino acid sequence encoded by the cloned human NEDD4 cDNA was the same as that published in Swiss-Prot database accession number P4 6934 (registered gene name is NEDD4).

Immunoprecipitation experiments were performed as described below. Number of cells 1. Seed OX 10 ⁶ HEK293T cells in a 6cm dish, and after sputum culture in DMEM medium containing 10% fetal bovine serum (FBS) at 37 ° C under 5% CO / 95 air , Human NEDD4 expression plasmid

2%

1. 75 g was transfected into cells using FUGENE6 (Roche diagnostics) with 0.25 μg of human RUNX3 expression plasmid. Instead of the human RUNX3 expression plasmid, the human RUNX3 gene is incorporated! /, Na! /, PCMV—Tag2 vector (hereinafter referred to as empty vector) is transfected in the same way as a control. used. After culturing for 2 days, the cells were washed with phosphate buffered saline (hereinafter abbreviated as PBS) and collected using a cell scraper. Recovered cells containing protease inhibitor cocktail Complete, Mini (Roche diagnostics) (20 mM Tris-HCl (pH 8.0) / 150 mM NaCl / 0.5% TritonX-100 / 5 mM NaF / 5 mM Na VO) ) And add 500 L

3 4

The cells were suspended in the suspension and allowed to stand for 20 minutes on ice to lyse the cells. Thereafter, the supernatant was collected by centrifugation at 15, 0 OOrpm for 15 minutes at 4 ° C and used as a cell lysate. Subsequently, 50% of ~ 50% of protein G sepharose 4 FastFlow (manufactured by Amersham Biosciences) was added to the cell lysate and mixed by inversion at 4 ° C for 1 hour. After centrifugation at 10, OOOrpm for 15 seconds at 4 ° C, add 0.5 L of anti-FLAG M2 antibody (Sigma) to the collected supernatant, and mix by inverting at 4 ° C for 2 hours. 40 / zL of protein G sepharose 4 FastFlow 50% slurry was newly added, and the mixture was mixed again by inversion at 4 ° C for 2 hours. Protein G sepharos e 4 FastFlow was collected by centrifugation, washed 3 times with lysis buffer, and then 20 / zL of 2X SDS sample buffer was prepared and heat-treated at 100 ° C for 5 minutes as an SDS-PAGE sample. used. Samples were separated by 5-20% SDS-PAGE, and then Western blotting was performed using peroxidase-labeled anti-c-Myc antibody (Nacalai Testa) Myc-NEDD4 and peroxidase-labeled anti-FLAG M2 antibody (Sigma) Detected FLAG-RUNX3. Detection was performed using an ECL western blotting detection kit (manufactured by Amersh am Biosciences).

[0344] <Result>

As shown in panel A of Fig. 2, Myc- NEDD4 and FLAG-RUNX3 co-expressed cell force Only in the prepared sample, immunoprecipitation using anti-FLAG M2 antibody (denoted as IP in the figure) Myc- Co-precipitation of NEDD4 and FLAG—RUNX3 was observed. In contrast, in the sample prepared from cells not expressing FLAG-RUNX3, coprecipitation of Myc-NEDD4 by immunoprecipitation using anti-FLAG M2 antibody was not observed. This indicates that the coprecipitation of Myc-NEDD4 observed by immunoprecipitation using anti-FLA G M2 antibody is not due to nonspecific adsorption of Myc-NEDD4 to agarose beads. Binding of Myc-NED D4 to FLAG-RUNX3 It was judged that it shows. The expression of Myc-NED D4 was similar in both samples (see the lane labeled as cell lysate in panel A in Figure 2). It was also confirmed that FLAG-RUNX3 expressed in cells was recovered by anti-FLAG M2 antibody! / (Figure 2 panel B).

[0345] From the above results, it was revealed that human NEDD4 and human RUNX3 bind intracellularly.

Example 3

[0346] (In vivo ubiquitination of RUNX3 by NEDD4)

In vivo ubiquitination of RUNX3 by NEDD4 was examined by immunoprecipitation using human cultured cells in which human RUNX3, human NEDD4 and human ubiquitin were transiently co-expressed. In addition, using a human NEDD4 mutant whose E3 ligase activity was inactivated by the introduction of the mutation (hereinafter sometimes referred to as E3 ligase inactive human NEDD4) Was examined.

[0347] <Materials and methods>

The expression plasmid prepared in Example 2 was used as the human RUNX3 expression plasmid. This human RUNX3 expression plasmid expresses FLAG-RUNX3.

[0348] The expression plasmid prepared in Example 2 was used as the human NEDD4 expression plasmid. Myc-NEDD4 is expressed by this human NEDD4 expression plasmid.

[0349] Human NEDD4 (C967A), which is a human NEDD4 mutant in which a mutation was introduced into the HECT domain, was used as a human NEDD4 mutant. Human NEDD4 (C967A) is a human NEDD4 mutant in which the 967th cysteine residue is substituted with an alanine residue in the amino acid sequence of human NEDD4, thereby inactivating the E3 ligase activity.

[0350] The human NEDD4 (C967A) expression plasmid is a human NEDD4 expression plasmid (see Example 2), and is a primer that can introduce a substitution of the 967th cysteine residue of human NEDD4 to an alanine residue. Was designed and synthesized, and was constructed using the Quick Change Site—Directed Mutagenesis kit, manufactured by STRATAGENE. The constructed expression plasmid was sequenced to confirm that the mutation was introduced into the expression plasmid. This human NEDD4 (C967 A) expression plasmid expresses N-terminal Myc-tag binding human NEDD4 (C967A) (hereinafter referred to as Myc-NEDD4 (C967A)).

[0351] A human ubiquitin (Ub) expression plasmid was constructed as described below. Human Ub cDNA was obtained by PCR from human brain-derived cDNA (QUICK-clone cDNA ゝ Clontech), and the nucleotide sequence was confirmed by sequencing. Subsequently, the Ub expression plasmid was constructed by incorporating human Ub cDNA into an animal cell expression plasmid pCMV-HA (Clontech) for expressing the N-terminal HA tag binding protein. This Ub expression plasmid expresses N-terminal HA-tag binding Ub (hereinafter referred to as HA-Ub). The deduced amino acid sequence encoded by the cloned Ub cDNA was identical to that published in NCBI protein database accession number NP-0666289 (registered gene name is UBC).

[0352] In vivo ubiquitination experiments were performed as described below. Number of cells 1. OX 10 ⁶ H Seed EK293T cells in a 6cm dish, and cultured in 10% FBS-containing DMEM medium at 37 ° C under 5% CO / 95% air.

2

1 g, human NEDD4 expression plasmid 2.0 g, and human Ub expression plasmid 0.25 μg were transfected into cells using FuGENE6 (Roche diagnostics). In addition, instead of the human NEDD4 expression plasmid, cells transfected with human NEDD4 (C967A) expression plasmid were prepared in the same manner. Furthermore, cells transfected with only the human RUNX3 expression plasmid and cells transfected with the human RUNX3 expression plasmid and the human Ub expression plasmid were prepared in the same manner and used as controls. The total amount of DNA introduced was corrected with an empty vector. Cells cultured for 2 days after transfection were treated in the same manner as in Example 2 to prepare cell lysate. Next, 40 μL of 50% slurry of senolevate [This protein G sepharose 4 FastFlow (Amersham Biosciences)] was added and mixed by inversion at 4 ° C for 1 hour. After that, centrifuge at 10, OOOrpm for 15 seconds at 4 ° C, add anti-FLAG M2 antibody (manufactured by Sigma) 0. to the collected supernatant, and mix by inverting at 4 ° C for 2.5 hours. 4. Add 40 L of protein G sepharose 4 FastFlow 50% slurry again, and 4 again. Inverted at C for 2 hours. Protein G sepharose 4 FastFlow is collected by centrifugation, washed 3 times with a lysis buffer (same composition as in Example 2), 20 μL of 2 X SDS sample buffer is added, and heated at 100 ° C for 5 minutes The treated sample was used as an SDS-PAGE sample. Samples were separated by 5-20% SDS-PAGE, and then Western blotting was performed using peroxidase-labeled anti-c-Myc antibody (manufactured by Nacalai Testa) for Myc-NEDD 4 and Myc-NEDD4 (C967A). FLAG-RUNX3 was detected with a FLAG M2 antibody (manufactured by Sigma), and HA-Ub was detected with a peroxidase-labeled anti-HA antibody (manufactured by Roche di agnostics). Detection was performed using 7 ECL western blotting detection kits (Amersham Biosciences).

As shown in panel A of Figure 3, in the samples prepared by co-expression of FLAG—RUNX3, Myc—NEDD4 and HA—Ub, multiple proteins with higher molecular weight than FLAG—RUNX3 Detected by immunoprecipitation using FLAG M2 antibody It was. On the other hand, a sample prepared from a cell co-expressed with Myc-NED D4 (C967A) in which E3 ligase activity was inactivated instead of Myc-NEDD4, however, had a protein with a higher molecular weight than FLAG-RUNX3. Although detected, the amount was less than that of samples prepared from cells expressing Myc-NEDD4. Myc—NEDD4 expression in cells co-expressed with FLAG—RUNX3, Myc—NE DD4 and HA—Ub, and Myc-NEDD4 (C967A) instead of Myc—NEDD4 ) Expression was similar (Panel C in Figure 3).

[0354] As shown in Panel B of Figure 3, samples prepared from cells co-expressing FLAG—RUNX3, Myc—NEDD4, and HA—Ub were used for immunoprecipitation and anti-antibody using anti-FLAG M2 antibody. The protein strength detected by immunoblotting using HA antibody Myc—NE DD4 was also increased. The cell strength was also significantly increased compared to the prepared sample. The detected protein is FLAG-RUNX3 with HA-Ub added. That is, in samples prepared from cells co-expressing FLAG-RUNX3, Myc-NEDD4 and HA-Ub, an increase in FLAG-RUNX3 with HA-Ub attached was observed. On the other hand, FLAG-RUNX3 with HA-Ub added was detected in the sample prepared from cells co-expressed with Myc-NEDD4 (C967A) instead of Myc-NEDD4. Myc—NEDD4 expressing cell strength was also significantly lower than that of the prepared sample.

[0355] From these results, it was clarified that human RUNX3 is ubiquitinated in human cells by human NEDD4 (Panel B in Fig. 3), and that human RUNX3 is polymerized (Fig. 3). Panel A). Furthermore, it was found that E3 ligase activity of human NEDD4 is important for ubiquitination and macromolecularization of human RUNX3 by human NEDD4. Example 4

[0356] (Effect of NEDD4 on the stability of RUNX3)

The effect of NEDD4 on the stability of RUNX3 was examined by Western blotting using human cultured cells in which human RUNX3 and human NEDD4 were transiently co-expressed.

[0357] <Materials and methods> The expression plasmid prepared in Example 2 was used as the human RUNX3 expression plasmid. This human RUNX3 expression plasmid expresses FLAG-RUNX3.

[0358] The expression plasmids prepared in Examples 2 and 3 were used as the human NEDD4 expression plasmid and the human NEDD4 (C967A) expression plasmid. Myc-NEDD4 is expressed by this human NEDD4 expression plasmid. In addition, Myc—NEDD4 (C967A) is expressed by this human NEDD4 (C967A) expression plasmid.

[0359] Intracellular stability experiments were performed as described below. Inoculate 2.5 x 10 ⁵ HEK293 T cells into each well of a 6-well plate and in 10% FBS-containing DMEM medium at 37 ° C under conditions of 5% CO / 95% air After culture, human RUNX3 expression plasmid

2

0. l; z g was transfected into cells using FuGENE6 (Roche di agnostics) with human NEDD4 expression plasmid 1.0-2. In addition, cells were prepared by transfecting 2.0 g of a human NEDD4 (C967A) expression plasmid in the same manner instead of the human NEDD4 expression plasmid. Furthermore, cells transfected with only the human RUNX3 expression plasmid were prepared in the same manner and used as a control. The total amount of DNA introduced was corrected with an empty vector. The day after transfection, cells were washed with PBS and harvested using trypsin Z ethylenediaminetetraacetic acid (EDTA) solution. The collected cells were lysed by adding 60 μL of lysis buffer (Cell Signaling), suspending with pipetting, and then allowing to stand on ice for 5 minutes. Thereafter, the supernatant was collected by centrifugation at 15, OOOrpm for 10 minutes at 4 ° C and used as cell lysate. Next, an equal volume of 2 X SDS sample buffer was added to the cell lysate and calcined at 100 ° C for 5 minutes and used as an SDS-PAGE sample. Samples of the same protein mass are separated by 5- 20% SDS-PAGE, and anti-FLAG M2 antibody (manufactured by Sigma), anti-c-Myc antibody (manufactured by Santa Cruz Biotechnology) and anti-actin (Actin) antibody (Santa Western blotting using Cruz Biotechnology) was performed. Detection was carried out using a fluorescently labeled secondary antibody with an Odyssey imaging system (Aloka).

[0360] <Result>

Depending on the amount of human NEDD4 expression plasmid introduced as shown in panel A of Figure 4, FLA G— A decrease in RUNX3 was observed. On the other hand, no decrease in FLAG-RUNX3 was observed in samples prepared from cells transfected with the human NEDD4 (C967A) expression plasmid. Myc—NEDD4 is expressed depending on the amount of human NEDD4 expression plasmid introduced! This was confirmed as shown in Panel B of 4. In addition, the expression level of actin, which is a control, was almost the same in the sample of the deviation (panel C in Fig. 4).

[0361] These results revealed that human NEDD4 decreased the intracellular stability of human RUNX3. It was also found that the decrease in human RUNX3 stability by human NEDD4 is related to the E3 ligase activity of human NE DD4.

Example 5

[0362] (Binding of NEDD4 and RUNX1 and in vivo ubiquitination of RUNX1 by NEDD4)

The binding of NEDD4 and RUNX1 and the in vivo ubiquitination of RUNX1 by NEDD4 were examined by immunoprecipitation using human cultured cells transiently co-expressing human RUNX1, human NEDD4 and human ubiquitin. A similar study was conducted using E3 ligase inactive human NEDD4.

[0363] <Materials and methods>

The human RUNX1 expression plasmid was constructed as described below. Human RUNX1 cDNA was obtained from human kidney-derived cDNA (QUCIK-clone cDNA Clontech) by PCR using primers with EcoRI and Xhol sites added, and the nucleotide sequence was confirmed by sequencing. The obtained cDNA was incorporated at the EcoRl / XhoI site into an animal cell expression plasmid pCMV-Tag2 (STRATAGENE) for expressing an N-terminal FLAG-tag binding protein to construct a human RUNX1 expression plasmid. This human RU NX1 expression plasmid expresses N-terminal FLAG-tag binding human RUNXl (hereinafter referred to as FLAG-RUNX1). The deduced amino acid sequence encoded by the cloned human RUNX1 cDNA was the same as that published in the NCBI protein database accession number NP-001745 (registered gene RUNX1). [0364] The expression plasmids prepared in Examples 2 and 3 were used as the human NEDD4 expression plasmid and the human NEDD4 (C967A) expression plasmid, respectively. This human NEDD4 expression plasmid expresses Myc—NEDD4. In addition, Myc—NEDD4 (C967A) is expressed by this human NEDD4 (C967A) expression plasmid.

[0365] The expression plasmid prepared in Example 3 was used as the human ubiquitin (Ub) expression plasmid. This human Ub expression plasmid expresses HA-Ub.

[0366] In vivo ubiquitination experiments were performed as described below. Number of cells 1. Seed EK 10 ⁶ EK293T cells in 6cm dish, 10% FBS-containing DMEM medium at 37 ° C under 5% CO / 95% air condition-after sputum culture, human RUNX1 expression Plasmid 0

2

.1 g, human NEDD4 expression plasmid 2.0 g, and human Ub expression plasmid 0.25 μg were transfected into cells using FuGENE6 (Roche diagnostics). In addition, instead of the human NEDD4 expression plasmid, cells transfected with human NEDD4 (C967A) expression plasmid were prepared in the same manner. Furthermore, cells transfected with human RUNX1 expression plasmid and human Ub expression plasmid were prepared in the same manner and used as a control. The total amount of DNA introduced was corrected with an empty vector. Cells cultured for 2 days after transfection were treated in the same manner as in Example 2 to prepare cell lysates. Next, 40 μL of 50% slurry of protein G sepharose 4 FastFlow (manufactured by Amersham Biosciences) was added to the cell lysate and mixed by inverting at 4 ° C. for 1 hour. Then, centrifuge at 10, OOOrpm for 15 seconds at 4 ° C, and add 0.5 L of anti-FLA G M2 antibody (manufactured by Sigma) to the collected supernatant for 2.5 hours at 4 ° C. After mixing by inversion, 40 L of protein G sepharose 4 FastFlow 50% slurry was newly added and mixed again by inversion at 4 ° C for 2 hours. Protein G sepharose 4 FastFlow is collected by centrifugation, washed 3 times with lysis buffer (same composition as in Example 2), then 20 / z L 2 X SDS sample buffer is prepared, and 5 ° C at 100 ° C. What was heat-processed for minutes was used as a SDS-PAGE sample. Samples were separated by 5-20% SDS-PAGE, and Western blotting was performed using peroxidase-labeled anti-c-Myc antibody (manufactured by Nacalai Testa) for Myc-NEDD4 and Myc-NEDD4 (C967A), and peroxidase-labeled anti-FLAG. M2 antibody (manufactured by Sigma) and FLAG—RUNX1 and peroxidase-labeled anti-HA antibody (Roc he diagnostics) and HA-Ub were detected. Detection was carried out using an ECL western blotting detection kit (Amersham Biosciences).

[0367] <Result>

As shown in panel A of Figure 5, samples prepared from cells co-expressing FLAG-RUNX1, Myc-NEDD4 and HA-Ub were subjected to immunoprecipitation using anti-FLAG M2 antibody to Myc-NEDD4. And FLAG—RUNX1 coprecipitation was observed. In addition, coprecipitation of Myc-NEDD4 (C967A) and FLAG-RUNX1 was observed in samples prepared from cells co-expressed with Myc-NEDD4 (C967A), FLAG-RUNX1 and HA-Ub.

[0368] As shown in Panel B of Figure 5, in the sample prepared by co-expression of FLAG—RUNX1, Myc—NEDD4 and HA-Ub, multiple samples with higher molecular weight than FLAG—RUNX1 Protein power was detected by immunoprecipitation using anti-FLAG M2 antibody. On the other hand, almost no high molecular weight protein was detected in the sample prepared with cell force co-expressed with Myc-NED D4 (C967A) in which E3 ligase activity was inactivated instead of Myc-NEDD4. Myc—NEDD4 expression in cells co-expressed with FLAG—RUNX1, Myc—NEDD4 and HA—Ub, and Myc—NEDD4 (C967A) instead of Myc—NEDD4 Myc—NEDD4 ( The expression of C9 67A) was similar (Panel D in Figure 5).

[0369] As shown in panel C of FIG. 5, samples prepared from cells co-expressing FLAG—RUNX1, Myc—NEDD4 and HA—Ub showed immunoprecipitation using anti-FLAG M2 antibody and The protein strength detected by immunoblotting using anti-HA antibody Myc-NE DD4 was also significantly increased compared to the prepared sample. The detected protein is FLAG-RUNX1 with HA-Ub added. That is, in samples prepared from cells co-expressing FLAG-RUNX1, Myc-NEDD4 and HA-Ub, an increase in FLAG-RUNX1 with HA-Ub attached was observed. On the other hand, FLAG-RUNX1 with HA-Ub added was also detected in samples prepared from cells co-expressed with Myc-NEDD4 (C967A) instead of Myc-NEDD4. Myc—Needs also prepared for cell force expressing NEDD4 It was low compared.

[0370] From these results, it was revealed that human NEDD4 and human NEDD4 (C967A)! Bind to human RUNX 1 in cells (panel A in Fig. 5). It was also revealed that human RUNX1 is ubiquitinated in human cells by human NEDD4 (Fig. 5, panel C), and that human RUNX1 is polymerized (Fig. 5, panel B). Furthermore, it was found that E3 ligase activity of human NEDD4 is important for ubiquitination and macromolecularization of human RUNX1 by human NE DD4.

Example 6

[0371] (Effect of NEDD4 on RUNX1 stability)

The effect of NEDD4 on the stability of RUNX1 was examined by Western blotting using human cultured cells in which human RUNX1 and human NEDD4 were transiently co-expressed.

[0372] <Materials and methods>

The expression plasmid prepared in Example 5 was used as the human RUNX1 expression plasmid. This human RUNX1 expression plasmid expresses FLAG-RUNX1.

[0373] The expression plasmids prepared in Examples 2 and 3 were used as the human NEDD4 expression plasmid and the human NEDD4 (C967A) expression plasmid, respectively. With this human NEDD4 expression plasmid, Myc—NEDD4 is expressed. In addition, Myc—NEDD4 (C967A) is expressed by this human NEDD4 (C967A) expression plasmid.

[0374] Intracellular stability experiments were performed as described below. HEK293T cells were transfected with 0.1 g of human RUN XI expression plasmid and 1.0 to 2.0 g of human NEDD4 expression plasmid in the same manner as described in Example 4. In addition, instead of human NEDD4 expression plasmid, cells were prepared by transfecting 2.0 g of human NEDD4 (C967A) expression plasmid in the same manner. Furthermore, cells transfected with only the human RUNX1 expression plasmid were prepared in the same manner and used as a control. The total amount of DNA introduced was corrected with an empty vector. On the day after the transfer, cells were collected by the same method as described in Example 4 to prepare cell lysate. Next, an equal volume of 2X SDS sample buffer was added to the cell lysate and heat-treated at 100 ° C for 5 minutes. Were used as SDS-PAGE samples. Samples of the same protein amount were separated with 5-20% SDS-PAGE, anti-FLAG M2 antibody (Sigma), anti-c-Myc antibody ZA-14 (Santa Cruz Biotechnology) and 饥 actin rod / c — Western blotting using 11 (Santa Cruz Biotec hnology) was performed. Detection was performed with an Odyssey Imaging System (Aloka) using a fluorescently labeled secondary antibody.

[0375] <Result>

As shown in panel A of FIG. 6, a decrease in FL AG-RUNX1 was observed depending on the amount of human NEDD4 expression plasmid introduced. On the other hand, a decrease in FLAG-RUNX1 was not observed in samples prepared from cells transfected with the human NEDD4 (C967A) expression plasmid. Figure 6 shows that Myc—NEDD4 force human NEDD4 expression plasmid is expressed depending on the amount of plasmid introduced, and that Myc—NEDD4 (C967A) force human NEDD4 (C967A) expression plasmid is expressed. It was confirmed as shown in B. In addition, the expression level of actin, which is a control, was almost the same as that of the misaligned sample (panel C in FIG. 6).

[0376] These results revealed that human NEDD4 decreased the intracellular stability of human RUNX1. It was also found that the decrease in human RUNX1 stability by human NEDD4 is related to the E3 ligase activity of human NEDD 4.

Example 7

[0377] (Comparison with endogenous NEDD4)

The size of endogenous NEDD4 detected in human cancer cell lines was compared with the size of human NEDD4 transiently expressed in cultured human cell lines and the size of short human NEDD4 by Western blotting.

[0378] <Materials and methods>

The expression plasmid prepared in Example 2 was used as the human NEDD4 expression plasmid. This human

Myc—NEDD4 is expressed by the NEDD4 expression plasmid.

[0379] As the short-chain human NEDD4, the first force on the N-terminal side of human NEDD4 (SEQ ID NO: 2) is also 10th.

A protein lacking the 0th 100 amino acid residues was used.

[0380] Short-chain human NEDD4 whose E3 ligase activity was inactivated by mutation Mutants were used. As a short-chain human NEDD4 mutant, a short-chain human NEDD4 (C867A), which is a short-chain human NEDD4 mutant with a mutation introduced in the HECT domain, was prepared. Short-chain human NEDD4 (C867A) is a short-chain human in which the 867th cysteine residue was replaced with an alanine residue in the amino acid sequence of short-chain human NEDD4, thereby inactivating E3 ligase activity. NEDD4 mutant. The 867th cysteine residue in short-chain human NEDD4 corresponds to the 967th cysteine residue in human NEDD4.

[0381] A short human NEDD4 expression plasmid was constructed as described below. Of the ORF region of the human NEDD4 gene, a region encoding the 101st to 1000th amino acid sequences of human NEDD4 (hereinafter referred to as short human NEDD4 cDNA) is amplified by PCR and sequenced. The base sequence was confirmed. PCR was performed using the human NEDD4 expression plasmid prepared in Example 2 as a saddle and primers added with EcoRI site and Xhol site. The acquired short human NEDD4 cDNA was incorporated into an animal cell expression plasmid pCI (Promega) to construct a short human NEDD4 expression plasmid. The deduced amino acid sequence encoded by the cloned short-chain human NEDD4 cDNA is identical to the amino acid sequence published in the N CBI database under the accession number NP-006145 (KIAA0093), and Swiss-Prot It matched the amino acid sequence from the 101st to the 1000th amino acid sequence published in the database accession number P46934 (registered gene name is NEDD4).

[0382] The short-chain human NEDD4 (C867A) expression plasmid is a short-chain human NEDD4 expression plasmid, and the substitution of the 867th cysteine residue of a short-chain human NEDD4 with an alanine residue is introduced. The primers obtained were designed and synthesized and used to construct the QuikChange Site—Directed Mutagenesis kit (manufactured by STRATAGENE). The sequence of the constructed expression plasmid was performed, and it was confirmed that a mutation was introduced into the expression plasmid.

[0383] Gene expression and immunoblotting were performed as described below. HEK293T cells with 1.0 x 10 ⁶ cells are seeded in 6cm dishes and cultured in spear culture at 37 ° C under 5% CO / 95% air in DMEM medium containing 10% FBS. Expression plasmid

2

, Short human NEDD4 expression plasmid and short human NEDD4 (C867A) expression plasmid One of the plasmids, 1.0 g, was transfected into cells using FuGENE6 (Roche diagnostics). Using cells cultured for 2 days after transfection, cells were collected by the same method as described in Example 4 to prepare cell lysate.

[0384] Endogenous NEDD4 expressed in human cancer cell lines was detected in breast cancer-derived cell lines (T-4 7D cells, MDA-MB-468 cells and BT-20 cells), colon cancer cell lines (SW480 cells). Cell lysates), lung cancer cell lines (A549 cells), myeloid leukemia cell lines (K562 cells and HL-60 cells), lymphoid leukemia cells (MOLT-4 cells), gastric cancer cell lines (MKN28 cells and MKN74 cells) Was carried out. Cell lysates of cancer cell lines other than MKN28 and MKN74 cells were purchased from SantaCruz. MKN28 cells and MKN74 cells are treated with RIPA buffer (50 mM Tris-HCl (pH 8.0) / 150 mM NaCl / 1% Triton X-100 / 0.1% SDS) containing the protease inhibitor cocktail Complete Mini (Roche di agnostics). / 0. 1% DOC) to prepare a cell lysate.

[0385] An equivalent amount of 2 X SDS sample buffer was added to the above cell lysate and heat-treated at 100 ° C for 5 minutes, and used as an SDS-PAGE sample. These samples were separated by 5-20% SDS-PAGE, and NEDD4 was detected by Western blotting using an anti-NEDD4 antibody (H-135, manufactured by SantaCruz). Detection was performed using an ECL western blotting detection kit (Amersham Biosciences).

[0386] <Result>

Short-chain human NEDD4 was detected in HEK293 cells transfected with a short-chain human NEDD4 expression plasmid (Panel A in FIG. 7, lane 1). Short-chain human NEDD4 (C867A) was detected in HEK293 cells transfected with a short-chain human NE DD4 (C867A) expression plasmid (Panel A in FIG. 7, lane 2).

[0387] On the other hand, in the analysis using HEK293 cells transfected with a human NEDD4 expression plasmid, the positions of short human NEDD4 and short human NE DD4 (C867A) in addition to the human NEDD4 band (Fig. A band was observed in panel A, lanes 1 and 2 (Fig. 7, panel A, lane 3). This suggests that HEK293 cells are endogenous. The resulting short-chain human NEDD4 is expressed.

[0388] In the analysis using T 47D cells, no human NEDD4 band was observed, and the positions of short human NEDD4 and short human NEDD4 (C867A) (Panel A, lanes 1 and 2 in Figure 7). (See Fig. 7 panel A, lane 4). This suggests that human NEDD4 is hardly expressed in T-47D cells, and that short-chain human NEDD4 is expressed.

[0389] In the analysis using cancer cell lines other than T-47D cells, a band was observed at the band position observed in the analysis using T-47D cells (Panel B in Fig. 7). Based on this, it is considered that short-chain human NEDD4 is expressed in cancer cell lines other than T47D cells, as in T47D cells.

[0390] From these results, NEDD4 expressed mainly in cancer cell lines is considered to be short-chain NEDD4.

Example 8

[0391] (Binding of short-chain NEDD4 to RUNX1 or RUNX3, and in vivo ubiquitination of RUNX1 or RUNX3 by short-chain NEDD4)

We investigated the binding of short-chain NEDD4 to RUNX1 or RUNX3 and the in vivo ubiquitination of RUNX1 or RUNX3 by short-chain NEDD4. It was carried out by immunoprecipitation using human cultured cells co-expressed. A similar study was performed using short-chain human NEDD4 (C867A) in which E3 ligase was inactivated.

[0392] <Materials and methods>

[0393] The expression plasmid prepared in Example 2 was used as the human RUNX3 expression plasmid. This human RUNX3 expression plasmid expresses FLAG-RUNX3.

[0394] A Myc-tag binding short human NEDD4 expression plasmid was constructed as described below.

Short-chain human NEDD4 cDNA (see Example 7) was added to the ^ -end with a Myc-tag coding sequence, and then incorporated into an animal cell expression plasmid pC Promega). A tag-binding short human NEDD4 expression plasmid (hereinafter referred to as Myc short human NEDD4 expression plasmid) was constructed. This Myc short-chain human NEDD4 expression plasmid expresses Myc short-chain human NEDD4 (hereinafter referred to as Myc short-chain NEDD4).

[0395] A Myc-tag binding short human NEDD4 (C867A) expression plasmid was constructed as described below. Short-chain human NEDD4 (C867A) cDNA (see Example 7) was added with a Myc-tag coding sequence at its 5 'end, and then incorporated into an animal cell expression plasmid pCI (manufactured by Promega). A tag-binding short human NEDD4 (C867A) expression plasmid (hereinafter referred to as Myc short human NEDD4 (C867A) expression plasmid) was constructed. The Myc-short human NEDD4 (C867A) expression plasmid expresses Myc-short human NEDD4 (C867A) (hereinafter referred to as Myc short-chain NEDD4 (C867A)).

[0396] The expression plasmid prepared in Example 3 was used as the human ubiquitin (Ub) expression plasmid. This human Ub expression plasmid expresses N-terminal HA-tag-linked human Ub (hereinafter referred to as HA-Ub).

[0397] In vivo ubiquitination experiments were performed as described below. In HEK293T cells, human RUNX1 expression plasmid or human RUNX3 expression plasmid 0.1 g together with Myc short human NEDD4 expression plasmid 2.0 g and human Ub expression plasmid 0.25 μg, the method described in Example 4 Transfection was carried out in the same way. In addition, instead of the Myc short-chain human NEDD4 expression plasmid, cells transfected with Myc short-chain human NEDD4 (C867A) expression plasmid 2. O / zg were prepared in the same manner. Furthermore, cells transfected with human RUNX1 expression plasmid or human RUNX3 expression plasmid in the same manner as human Ub expression plasmid were prepared and used as controls. The total amount of DNA introduced was corrected with an empty vector. Cells cultured for 2 days after transfection were treated in the same manner as in Example 2 to prepare cell lysate. Subsequently, 40 L of a 50% slurry of protein G sepnarose 4 FastFlow (Amersham Biosciences: ^) was added to the cell lysate and mixed by inverting at 4 ° C for 1 hour. Then, centrifuge at 10, OOOrpm for 15 seconds at 4 ° C, add 0.5 L of anti-FLAG M2 antibody (Sigma) to the collected supernatant, and invert 4 ° C for 2.5 hours After mixing, 40 μL of protein G sepharose 4 FastFlow 50% slurry was freshly added and mixed again by inversion at 4 ° C for 2 hours. Prot Recover ein G sepharose 4 FastFlow by centrifugation, wash 3 times with lysis buffer (same composition as described in Example 2), add 20 μL of 2 X SDS sample buffer, and then at 100 ° C for 5 minutes. The heat-treated sample was used as an SDS-PAGE sample. Samples were separated by 5-20% SDS-PAGE, and Myc short-chain NE DD4 and Myc short-chain NEDD4 (C867A) using peroxidase-labeled anti-c Myc antibody (Nacalai Testa) by Western blotting. ), FLAG-RUNX1 and FLAG-RUNX3 were detected using a peroxidase-labeled anti-FLAG M2 antibody (Sigma), and HA-Ub was detected using a peroxidase-labeled anti-HAZ3F10 antibody (Roche diagnostics). Detection was performed using an ECL western blotting detection kit (Amersham Biosciences).

[0398] <Result>

As shown in Panel A of Figure 8, Myc short chain was obtained by immunoprecipitation using anti-FLAG M2 antibody in a sample prepared by co-expression of FLAG-RUNX1, Myc short chain type NEDD4 and HA-Ub. Co-precipitation of type NEDD4 and FLAG—RUNX1 was observed. In addition, coprecipitation of Myc short chain type NEDD4 (C867A) and FL AG— RUNX1 was observed in samples prepared with cell force co-expressing Myc short chain type NEDD4 (C867A), FLAG—RUNX1 and HA—Ub. .

[0399] As shown in panel B of Figure 8, in samples prepared from cells co-expressing FLAG—RUNX1, Myc short chain type NEDD4 and HA—Ub, multiple proteins with higher molecular weight than FLAG—RUNX1 It was detected by immunoprecipitation using an anti-FLAG M2 antibody. On the other hand, in addition to the Myc short chain type NEDD4, a sample of the cell force prepared by co-expressing Myc short chain type NEDD4 (C867A) in which the E3 ligase activity was inactivated was used. Was hardly detected. FLAG—RUNX1, Myc short chain NEDD4 and HA— Ub co-expressed Myc short chain NE DD4 expression, and Myc -short chain NEDD4 instead of Myc -short chain NEDD4 (C8 67A) Expression of Myc short-chain NEDD4 (C867A) in co-expressed cells was similar (Panel D in Figure 8).

[0400] FLAG—RUNX1, Myc short chain NEDD4 and H, as shown in Panel C of Figure 8 In samples prepared from cells co-expressed with A—Ub, the protein detected by immunoprecipitation using anti-FLAG M2 antibody and immunoblotting using anti-HA antibody expressed My c—short-chain NEDD4 Compared with the prepared sample, the increased cell force was significantly increased. The detected protein is FLAG-RUNX1 with HA-Ub added. In other words, samples prepared from cells coexpressed with FLAG-RUNX1, Myc short-chain NEDD4 and HA-Ub showed an increase in FLAG-RUNX1 with HA-Ub added. On the other hand, FLAG-RUNX1 with HA-Ub added was also detected in a sample prepared by co-expression of Myc short-chain NEDD4 (C86 7A) instead of Myc short-chain NEDD4. The amount and the degree of ubiquitination were significantly lower than those of the cell-force-prepared samples expressing Myc short-chain NEDD4.

[0401] As shown in Figure 9 panel A, immunoprecipitation using anti-FLAG M2 antibody was performed on samples prepared from cells co-expressing FLAG-RUNX3, Myc short chain type NEDD4 and HA-Ub. Myc short-chain NEDD4 and FLAG—RUNX3 were co-precipitated. In addition, coprecipitation of Myc short chain type NEDD4 (C867A) and FL AG— RUNX3 was observed in samples prepared with cell force co-expressing Myc short chain type NEDD4 (C867A), FLAG-RUNX3 and HA-Ub. .

[0402] As shown in panel B of Figure 9, in samples prepared from cells co-expressing FLAG-RUNX3, Myc short chain type NEDD4 and HA-Ub, multiple proteins with higher molecular weight than FLAG-RUNX3 It was detected by immunoprecipitation using an anti-FLAG M2 antibody. On the other hand, in addition to the Myc short chain type NEDD4, a sample of the cell force prepared by co-expressing Myc short chain type NEDD4 (C867A) in which the E3 ligase activity was inactivated was used. Was hardly detected. FLAG—RUNX3, Myc short chain NEDD4 and HA— Ub co-expressed Myc short chain NE DD4 expression, and Myc -short chain NEDD4 instead of Myc -short chain NEDD4 (C8 67A) Expression of Myc short-chain NEDD4 (C867A) in co-expressed cells was similar (Panel D in Figure 9).

[0403] As shown in panel C of Figure 9, anti-FLAG M2 antibody was used in samples prepared by co-expression of FLAG-RUNX3, Myc short chain type NEDD4 and HA-Ub. Proteins detected by immunoprecipitation and immunoblotting using anti-HA antibody increased significantly compared to samples prepared with strong cell strength that did not express Myc-short chain type NEDD4. The detected protein is FLAG-RUNX3 with HA-Ub added. In other words, samples prepared from cells co-expressed with FLAG—RUNX3, Myc—short-chain NEDD4, and HA—Ub showed an increase in FLAG—RUNX3 with HA-Ub added. On the other hand, FLAG-RUNX3 with HA-Ub added was also detected in a sample prepared by co-expression of Myc-short chain type NEDD4 (C86 7A) instead of Myc-short chain type NEDD4 However, the amount and degree of ubiquitination were significantly lower than those of the cell-force prepared samples expressing Myc-short chain type NEDD 4.

[0404] These results showed that short-chain human NEDD4 and short-chain human NEDD4 (C867A) bind to human RUNX1 intracellularly (Panel A in Fig. 8). It was also revealed that human RUNX1 is ubiquitinated in cells by short-chain human NEDD4 (Panel C in Fig. 8), and that human RUNX1 is polymerized (Panel B in Fig. 8). . Furthermore, it was found that E3 ligase activity of short human NEDD4 is important for ubiquitination and higher molecularization of human RUNX1 by short human NEDD4.

[0405] Furthermore, it was revealed that short-chain human NEDD4 and short-chain human NEDD4 (C867A) bind to human RU NX3 intracellularly (Panel A in Fig. 9). It was also revealed that human RUNX3 is ubiquitinated in cells by short-chain human NEDD4 (Panel C in Figure 9), and that human RUNX3 is polymerized (Panel B in Figure 9). Furthermore, it was found that E3 ligase activity of short-chain human NEDD4 is important for ubiquitination and high molecularization of human RUNX3 by short-chain human NEDD4.

Example 9

[0406] (the binding of short-chain NEDD4 and RUNX2, and in vi v _o Yubikichin of RUNX2 due to the short-chain type NEDD4)

Binding of Short Chain NEDD4 and RUNX2, and in vi v _o Yubikichin of RUNX2 by short chain type NEDD4, human RUNX2, using human short form human NEDD4 and human cultured cells were transiently co-expressing Hitoyubikichin The immunoprecipitation method was used. A similar study was performed using short-chain human NEDD4 (C867A) in which the E3 ligase was inactivated. [0407] <Materials and methods>

The human RUNX2 expression plasmid was constructed as described below. Human RUNX2 cDNA was obtained from human bone marrow-derived cDNA (QUCIK—clone cDNA ゝ Clontech) by PCR using primers with EcoRV site and Xhol site added, and the nucleotide sequence was confirmed by sequencing. The obtained cDNA was incorporated at the EcoRVZXhoI site into an animal cell expression plasmid pCMV-Tag2 (STRATAGENE) for expressing an N-terminal FLAG-tag binding protein to construct a human RUNX2 expression plasmid. The human RUNX2 expression plasmid expresses N-terminal FLAG-tag-linked human RUNX2 (hereinafter referred to as FLAG-RUNX2). The deduced amino acid sequence encoded by the cloned human RUNX2 cDNA was identical to that disclosed in the NCBI protein database accession number NP-004339 (registered gene RUNX2).

[0408] As the Myc short-chain human NEDD4 expression plasmid and the Myc short-chain human NEDD4 (C867 A) expression plasmid, the expression plasmid prepared in Example 8 was used. This Myc short human NEDD4 expression plasmid expresses Myc short human NEDD4. This Myc short human NEDD4 (C867A) expression plasmid expresses Myc short human NE DD4 (C867A).

[0409] The expression plasmid prepared in Example 3 was used as the human ubiquitin (Ub) expression plasmid. This human Ub expression plasmid expresses HA-Ub.

[0410] In vivo ubiquitination experiments were performed as described below. In HEK293T cells, human RUNX2 expression plasmid 0. 1 _8, Myc-in short form human NEDD4 expression plasmid 2. 0 g, and a method similar to that described for human Ub expression plasmid 0. 25 g in Example 4 Transfusion. In addition, instead of the Myc short-chain human NEDD4 expression plasmid, cells were prepared by transfecting 2.0 g of Myc short-chain human NEDD4 (C867A) expression plasmid in the same manner. Furthermore, cells transfected with human RUNX2 expression plasmid and human Ub expression plasmid were prepared in the same manner and used as controls. The total amount of DNA introduced was corrected with an empty vector. Cell lysate was prepared by treating cells cultured for 2 days after transfection in the same manner as in Example 2. Next, Senolehuise ~~ Tokoko protein G sepharose 4 FastFlow (Amersham Bioscienc es) 50% slurry was mixed at 40 / z L and mixed by inversion at 4 ° C for 1 hour. Then, centrifuge at 1,00 Orpm for 15 seconds at 4 ° C, add anti-FLAG M2 antibody (Sigma) 0. to the collected supernatant, and mix by inverting for 2.5 hours at 4 ° C. 40 L of protein G sepha rose 4 FastFlow 50% slurry was newly added, and the mixture was mixed again by inversion at 4 ° C for 2 hours. Protein G sepharose 4 FastFlow is collected by centrifugation, washed 3 times with lysis buffer (same composition as described in Example 2), and then 20 μL of 2 X SDS sample buffer is added, and 100 ° A sample heat-treated for 5 minutes at C was used as an SDS-PAGE sample. Samples were separated by 5-20% SDS-PAGE, and Myc short chain type NEDD4 and Myc short chain type NEDD4 (C867A) were analyzed by Western blotting using peroxidase-labeled anti-c Myc antibody (manufactured by Nacalai Testa). FLAG-RUNX2 was detected using a peroxidase-labeled anti-F LAG M2 antibody (manufactured by Sigma), and HA-Ub was detected using a peroxidase-labeled anti-HAZ3F10 antibody (manufactured by Roche diagnostics). Performed using i¾ECL western blotting detection kit (Amersham Biosciences)

[0411] <Result>

As shown in panel A of Figure 10, samples prepared from cells co-expressing FLAG-RUNX2, Myc short-chain NEDD4 and HA-Ub were subjected to Myc-by immunoprecipitation using anti-FLAG M2 antibody. Short-chain NEDD4 and FLAG-RUNX2 were co-precipitated. In addition, coprecipitation of Myc short-chain NEDD4 (C867A) and FLAG-RUNX2 was observed in cells prepared using cell force co-expressed Myc short-chain NEDD4 (C867A), FLAG-RUNX2 and HA-Ub. It was.

[0412] As shown in Panel B of Figure 10, multiple samples with higher molecular weight than FLAG-RUNX2 in samples prepared from cells co-expressing FLAG-RUNX2, Myc short-chain NEDD4 and HA-Ub Was detected by immunoprecipitation using anti-FLAG M2 antibody. On the other hand, in the sample prepared by the cell co-expressing Myc short chain type NEDD4 (C867A) in which E3 ligase activity was inactivated instead of Myc short chain type NEDD4, such high molecular weight protein Was hardly detected. FLAG— RUNX2, Myc short chain NEDD4 and HA— Myc short chain NE in cells co-expressed with Ub Expression of DD4 and Myc-short chain NEDD4 (C867A) in cells co-expressed with Myc-short chain NEDD4 (C867A) instead of Myc-short chain NEDD4 were comparable ( Panel D in Figure 10).

[0413] As shown in panel C of Figure 10, FLAG-RUNX2, Myc-short-chain NEDD4 and HA-Ub co-expressed samples were immunized with anti-FLAG M2 antibody. Proteins detected by immunoblotting using sedimentation and anti-HA antibody increased significantly compared to samples prepared with strong cell strength that did not express Myc-short chain type NEDD4. The detected protein is FLAG-RUNX2 with HA-Ub added. In other words, samples prepared from cells co-expressing FLAG—RUNX2, Myc—short-chain NEDD4, and HA—Ub showed an increase in FLAG—RUNX2 with HA-Ub added. On the other hand, in samples prepared from cells co-expressed with Myc—short chain type NEDD4 (C86 7A) instead of Myc—short chain type NEDD4, 1 ^^}-1 ^ UNX2 No band was detected.

[0414] These results revealed that short-chain human NEDD4 and short-chain human NEDD4 (C867A) were bound to human RUNX2 in cells (panel A in Fig. 10). In addition, human RUNX2 is ubiquitinated by short-chain human NEDD4 in cells (Panel C in Fig. 10), and human RUNX2 is polymerized (Panel B in Fig. 10). became. Furthermore, it was found that the E3 ligase activity of short human NEDD4 is important for the ubiquitination and molecularization of human RUNX2 by short human NEDD4. Example 10

[0415] (Effect of inactive NEDD4 on BMP-2 bone function)

To examine the effect of NEDD4's E3 ligase activity on BMP-2 bone differentiation, E3 ligase-inactive human NEDD4 was transiently expressed in cultured mouse cells, and alkaline phosphatase (hereinafter referred to as bone formation marker) (Abbreviated as ALP) activity was measured

[0416] Bone differentiation was examined using mouse cultured cell C2C12 cells. C2C12 cells are mouse myoblasts and are derived from the same mesenchymal stem cells as osteoblasts and chondrocytes. C2 C12 cells are stimulated by BMP-2 stimulation and are typically osteoblastic phenotypes such as ALP activity. It has been used as a model cell for osteogenesis depending on BMP-2 signal (Katagiri T. et al., “The Journal of Cell Biology (The Journal of Cell Biology), 1994, 127, p. 1755—1766).

[0417] BMP is a site force-in that induces bone tissue by differentiating and proliferating undifferentiated mesenchymal stem cells into chondrocytes and osteoblasts in vivo. BMP-2 has been shown to be expressed early in the fracture healing process and is involved in the progression of a series of cascades in bone repair.

[0418] <Materials and methods>

Short-chain human NEDD4 (C867A) was used as E3 ligase inactive human NEDD4. The Myc-tag-linked short human NEDD4 (C867A) expression plasmid is designed and synthesized using primers that can introduce substitution of the 867th cysteine residue of a short human NEDD 4 to an alanine residue. It was constructed using a Quick Change Site Directed Mutagenesis Kit (manufactured by STRATAGENE). The constructed expression plasmid was sequenced to confirm that the mutation was introduced into the expression plasmid. The Myc short-chain human NEDD4 (C867A) expression plasmid expresses N-terminal Myc-tag-linked short-chain human NEDD4 (C867A) (hereinafter referred to as Myc-short chain NEDD4 (C867A)).

[0419] The expression plasmid prepared in Example 8 was used as the Myc-tag binding short-chain human NEDD4 expression plasmid. This Myc short-chain human NEDD4 expression plasmid expresses N-terminal Myc-tag binding short-chain human NEDD4 (hereinafter referred to as Myc short-chain NEDD4).

[0420] The effect of E3 ligase inactive human NEDD4 on the bone differentiation effect of BMP 2 was examined as described below. Mouse myoblast C2C12 cells were cultured in DMEM medium containing 10% FBS at 37 ° C for 2 days under conditions of 5% CO / 95% air.

2

Was collected with trypsin ZEDTA and collected, and 2 μg of Myc-short human NEDD4 (C867A) expression plasmid was transfected into cells by electroporation using Nucleofector (Amaxa). In addition, instead of the Myc short-chain human NEDD 4 (C867A) expression plasmid, cells transfected with the Myc short-chain human NEDD4 expression plasmid were prepared in the same manner. In addition, these expression plasmids Instead, cells transfected with an empty vector (animal cell expression plasmid pCI) were prepared in the same manner and used as a control. Next, 1.6 × 10 ⁵ cells were seeded on each well of the 6-well plate, and after culturing, the culture medium was treated with phenol red-free DMEMZ 5% Thiacol-dextran-treated FCS (Hyclone The medium was replaced with a medium supplemented with BMP-2 (R & D Systems) to a final concentration of 300 ngZml. After culturing for 3 days in the presence of BMP-2, the cells were collected, and a cell lysate was prepared with a lysis buffer (20 mM Tris (pH 8.0) /0.1% Triton X-100). After measuring the protein concentration of the cell lysate, ALP activity (Ab595nmZminZg) in each 20 g protein was measured using BluPhos Microwell Phosphatase Substrate System (KPL).

[0421] Cell force of BMP-2 untreated empty vector introduction For the ALP activity of the prepared cell lysate, transfer Myc short human NEDD4 (C867A) expression plasmid or Myc short human NE DD4 expression plasmid. Calculate the relative value of ALP activity of the prepared cell lysate, and use the obtained relative value to calculate short-chain human NEDD4 or short-chain human NEDD4 (C867A) The impact of. Statistical processing was performed on the obtained data. F-test was performed for the variance of ALP activity data of each treatment group, and Student's t test (Welch's t-test) or Welch's t test (Welch's t-test) was performed for the difference between the mean values.

[0422] <Result>

Under BMP-2 stimulation, there was no significant difference between the ALP activity of cells expressing short-chain human NEDD4 and the ALP activity of cells transfected with empty vectors. In contrast, short-chain human NEDD4 (C867A) -expressing cells stimulated with BMP-2 showed an ALP activity increase of about 1.4 times that of empty vector-introduced cells ( (Figure 11). Short human NEDD4 (C867A) is E3 ligase inactive short human NEDD4.

[0423] These results revealed that NEDD4 contributes to the enhancement of BMP-2-induced bone dysfunction of E3 ligase.

Example 11

[0424] (Effect of NEDD4 knockdown on bone differentiation of BMP 2) In order to examine the effect of endogenous NEDD4 on the bone differentiation effect of BMP 2, mouse NEDD4 was knocked down by transfecting siRNA in mouse cultured cells, and ALP activity as a bone formation marker was measured.

[0425] <Materials and methods>

NM-010890-stealth-360 purchased from Invitrogen was used as the siRNA for mouse NEDD4 (published in NCBI database with accession number NM-010890!). As a control siRNA, a negative control siRNA manufactured by QIAGEN was used.

[0426] The nucleotide sequences of sense RNA and antisense RNA constituting siRNA of mouse NEDD4 (hereinafter referred to as Nedd4) are shown below.

Sense RNA: 5'— GGAGUUGAAUCCGAAUUCCCUGGAA— 3 ′ (SEQ ID NO: 19)

Antisense RNA: 5 '-UUCCAGGGAAUUCGGAUUCAACUCC-3' (SEQ ID NO: 20)

[0427] siRNA was introduced into cells as described below. Mouse myoblast C2C12 cells with 4 × 10 ⁵ cells were seeded in a 6 cm dish and cultured in a DMEM medium containing 10% FBS at 37 ° C. under conditions of 5% CO 2/95% air. On the other hand, 500 1 OPTI—ME

2

10 μl of Lipofectamione 2000 (Lipofectamione 2000, manufactured by Invitrogen) was added to the M medium and incubated at room temperature for 5 minutes. Then mix with 500 1 OPTI-MEM medium supplemented with 250 pmol Nedd4 siRNA or negative control siRNA (total lml) and incubate for additional 20 min at room temperature to prepare siRNA / 1 ipof ectamine2000 mixture did. The culture medium for the above cells was replaced with 3 ml of OPTI-MEM, and siRNAZlipofectamine 2000 mixture was added.

[0428] The effect of Nedd4 siRNA on bone differentiation of BMP-2 was examined as described below. After siRNA is introduced into the cells and cultured for 6 hours, the culture medium is treated with phenol red-free Caro DMEMZ 5% Thiacol-dextran treated FCS (Hyclone) and BMP-2 (R & D Systems) to a final concentration of 600 ngZml. The medium was replaced with After culturing for 3 days in the presence of BMP-2, the cells were collected and lysis buffer (20 mM Tris (p A cell lysate was prepared with H8.0) /0.1% Triton X-100). After measuring the protein concentration in the cell lysate, the ALP activity (Ab595nmZminZg) in each 20 μg protein was measured using Blu Phos Microwell Phosphatase Substrate System (KPL).

[0429] ALP activity of cell lysate prepared from cells transfected with Nedd4 siRNA compared to ALP activity of cell lysate prepared from cells transfected with negative control siRNA under no addition of BMP-2 The relative value was calculated, and the effect of Nedd4 siRNA on the bone differentiation effect of BMP-2 was evaluated based on the obtained relative value. Statistical processing was performed on the obtained data. For the variance of ALP activity data of each treatment group, F test was performed, and for difference in mean value, Student's t test or Welch's t test was performed.

[0430] Confirmation of intracellular Nedd4 knockdown by Nedd4 siRNA was performed by Western blotting. A portion of the cell lysate prepared above was supplemented with 5 X SDS sample buffer and heated at 100 ° C for 5 minutes to use as an SDS-PAGE sample. Samples were separated by 5-20% gel, and Western blotting using anti-NEDD4 antibody H-135 (Santa Cruz Biotechnology) and anti-actin antibody C-11 (Santa Cruz Biotechnology) was performed. The detection and quantification of the protein band was performed with an Odyssey imaging system (Aloka) using a fluorescently labeled secondary antibody. The relative value of the concentration of Nedd4 band detected in each cell relative to the concentration of Nedd4 band detected in BMP-2 untreated negative control siRNA-introduced cells was calculated. When calculating the relative value, the concentration of the Nedd 4 band detected in each cell was corrected by the concentration of the actin band.

[0431] <Result>

In Nedd4 siRNA-treated cells, ALP activity by BMP-2 stimulation was increased approximately 2-fold compared to negative control siRNA-treated cells (Panel A in Fig. 12).

[0432] Nedd4 expression was markedly inhibited in Nedd4 siRNA-treated cells (panel B in Figure 12). Nedd4 knockdown rate by Nedd4 siRNA was more than 50%.

[0433] From the above results, it was found that inhibition of NEDD4 expression enhances bone mineralization by BMP-2 stimulation. Example 12

[0434] (Effect of NEDD4 knockdown on proliferation of human cancer cell lines)

In order to examine the effects of endogenous NEDD4 on the growth of human cancer cell lines, endogenous NEDD4 was knocked down by transfection of NEDD4 siRNA in human cancer cell lines, and the proliferation of the cancer cell lines was measured.

[0435] <Materials and methods>

[0436] Human eclampsia cancer cell line HeLa and human gastric cancer cell line NCI-N87 were used as human cancer cell lines.

[0437] siRNA of human NEDD4 (published in NCBI database with accession number NM—006154) was purchased from Invitrogen using D42055—stealth—757, D42 055—stealth—1053 and D42055—stealth—1376 did. In addition, QIAGEN's negative control siRNA was used as the control siRNA.

[0438] The base sequence of sense RNA and antisense RNA constituting human NEDD4 siRNA is shown below.

[0439] D42055— stealth— 757

Sense RNA: 5, — GGACAACCUAACAGAUGCUGAGAAU— 3, (SEQ ID NO: 2 1)

Antisense RNA: 5'— AUUCUCAGCAUCUGUUAGGUUGUCC— 3 '(SEQ ID NO: 22)

[0440] D42055— stealth— 1053

Sense RNA: 5'— GCAGAAGAGGCAGCUUACAAGCCUA— 3 ′ (SEQ ID NO: 2 3)

Antisense RNA: 5 '-UAGGCUUGUAAGCUGCCUCUUCUGC-3' (SEQ ID NO: 24)

[0441] D42055— stealth— 1376

Sense RNA: 5'—GCACCAAAUGGGAGGCCUUUCUUUA—3 '(SEQ ID NO: 25)

Antisense RNA: 5 '-U AAAG AAAGGCCUCCC AUUUGGUGC-3' (Column number 26)

[0442] Transfection of siRNA into cells was performed as described below. HeLa cells were seeded on a 24-well plate at 2.5 × 10 ⁴ / well and cultured in DMEM medium containing 10% FBS at 37 ° C under conditions of 5% CO / 95% air. After, Transfuxi

2

Used for Yeon. A siRNAZ lipofectamine 2000 mixed solution for transfection was prepared as follows. 200 _i (manufactured by Invitrogen) 4 1 lipoic Hue transfected § Min 2000 in OPTI MEM I medium ul was添Ka卩was incubated for 5 minutes at room temperature. Then, it was mixed with 200 1 Opti-MEM I medium supplemented with 80 pmol of each siRNA (total 400 1) and incubated at room temperature for another 20 minutes. After adding 100 µ 1 of the prepared siRNA / lipofectamine 200 00 mixture to the culture medium of each well (each group _η = 4) (siRNA introduction amount is equivalent to 20 pm olZweU) and exposing to cells for 5 hours The medium was changed. On the other hand, NCI-N87 cells were seeded on a 24 well plate at 5 X 10 ⁴ Zwell, and in 10% FBS-containing RPMI164 0 medium at 37 ° C, 5% CO / 95% air for 2 days. After incubation, transfer

2

Used for excision. A siRNA / lipofectamine 2000 mixed solution for transfection is prepared in the same manner as above, and added to the medium (siRNA introduction amount is equivalent to ² OpmolZwell) and exposed to cells for 6.5 hours. Exchanged.

[0443] The effects of human NEDD4 siRNA on the growth of human cancer cell lines were examined as described below. After introducing siRNA into cells, HeLa cells and NCI-N87 cells were cultured for 3 days and 4 days, respectively. Thereafter, the medium is replaced with a medium containing tetrazolium salt WST-8 reagent (viable cell count reagent SF, manufactured by Nacalai Testa). After incubation for a certain period of time, a portion of the medium is collected and the absorbance is measured at 450 nm. Proliferation was measured. The growth rate of each NEDD4 siRNA treatment group was calculated by the ratio (%) of the growth of each NEDD4 siRNA treatment group to the negative control siRNA treatment group.

[0444] Statistical processing was performed on the obtained data. Dispersion of growth rate of each siRNA treatment group! In the meantime, we performed the F test, the difference between the mean values, and the student t test or Welch t test.

[0445] Confirmation of intracellular NEDD4 knockdown by human NEDD4 siRNA was performed by Western blotting as shown below. After measuring cell proliferation with WST-8, Cells were collected with trypsin ZEDTA and combined, and RIPA buffer (150 mM NaCl / 50 mM Tris—HC1 pH 8.0 / 1% NP-40 / 0.5% deoxycholate sodium salt / Cells were lysed with 0.1% SDS) to prepare a cell lysate (cell lysate). To this, 2 X SDS sample buffer was added and heated at 100 ° C for 5 minutes, and used as an SDS-PAGE sample. This sample was separated on a 5-20% acrylamide gel, and the primary antibody was labeled with anti-NEDD4 antibody H-135 and anti-beta-tubulin antibody H-235 (Santa Cruz Biotechnology). Western blotting using a goat anti-rabbit IgG antibody (Alexa Fluor 680, goat anti-rab bit IgG, manufactured by Molecular Probe) was performed. The detection and quantification of the protein band was performed by an Odyssey imaging system (Aloka). The knockdown effect of NEDD4 by siRNA was evaluated based on the ratio of the concentration of protein band detected in each NEDD 4 siRNA treatment group to the concentration of NEDD4 protein band detected in the negative control siRNA treatment group.

[0446] <Result>

In HeLa cells, growth was suppressed by about 30-40% by knockdown with NEDD4 siRNA (D42055—stealth—757 or D42055—stealth—1053) (panel A in FIG. 13). The knockdown rate of NEDD4 under these conditions was 80% or more (Panel in Fig. 13: B).

[0447] In NCI-N87 cells, proliferation was suppressed by about 30% by knockdown with NEDD4 siRNA (D42055- stealth-757, D42 055-stealth-one 1053, or D42055-stealth-one 1376) (Fig. 14). Panel A). The knockdown rate of NEDD4 under this condition was about 70% (Panel B in Fig. 14).

[0448] From the above results, it was found that knocking down NEDD4 suppresses proliferation in HeLa cells and NCI-N87 cells.

Industrial applicability

[0449] According to the present invention, a method for ubiquitinating RUNX using NEDD4 or short-chain NEDD4 can be provided. Compounds that inhibit RUNX ubiquitin 匕 by NEDD4 or short-chain NEDD4 using this method, or compounds that promote ubiquitin ュ The identification method can be provided. NEDD4, or a compound that promotes RUNX ubiquitination by NEDD4 or short-chain NEDD4 can be used to promote RUNX ubiquitination by NEDD4 or short-chain NED D4, thereby promoting RUNX degradation it can. RUNX ubiquitination with NEDD4 or short-chain NEDD4 using inactive NEDD4, a double-stranded polynucleotide that inhibits the expression of NEDD4, or a compound that inhibits RUNX ubiquitination with NEDD4 or short-chain NEDD4 Can be inhibited, thereby inhibiting the degradation of RUNX.

[0450] Thus, by regulating RUNX ubiquitin and its degradation, it is possible to prevent and Z or treat diseases caused by RU NX abnormalities. Since RUNX is considered to be involved in tumor formation and exacerbation of cancer diseases, various cancer diseases can be prevented and / or treated according to the present invention. Further, since RUNX2 is considered to be involved in bone formation, the present invention can prevent and Z or treat bone loss diseases.

[0451] Further, according to the present invention, it is possible to provide a method for identifying a compound capable of promoting bone formation, characterized by identifying a compound that inhibits the function of NEDD4 or short-chain NEDD4. Since the compound obtained by this identification method is a compound capable of promoting bone formation, it can be used as an effective component for prevention and Z or treatment of osteoporosis such as bone loss disease.

[0452] The present invention is useful for basic research and drug development regarding RUNX degradation mechanism, transcription mechanism involving RUNX, and diseases caused by RUNX abnormality. Furthermore, the present invention can be used for the prevention and Z or treatment of diseases caused by abnormalities in RUNX, such as cancer diseases. In addition, the present invention is useful for the prevention of bone loss diseases such as osteoporosis and the development of Z or therapeutic agents.

Sequence listing free text

[0453] SEQ ID NO: 1: Polynucleotide encoding human NEDD4 (SEQ ID NO: 2).

SEQ ID NO: 2: human NEDD4.

SEQ ID NO: 3: A polynucleotide encoding a protein (SEQ ID NO: 4) in which the 100th amino acid residue at the N-terminal side of human NEDD4 (SEQ ID NO: 2) has also been deleted. SEQ ID NO: 4: A protein from which the 100th amino acid residue at the N-terminal side of human NEDD4 (SEQ ID NO: 2) has also been deleted.

SEQ ID NO: 5: Polynucleotide encoding human RUNX1 (SEQ ID NO: 6).

SEQ ID NO: 6: human RUNX1.

SEQ ID NO: 7: Polynucleotide encoding human RUNX2 (SEQ ID NO: 8).

SEQ ID NO: 8: human RUNX2.

SEQ ID NO: 9: Polynucleotide encoding human RUNX3 (SEQ ID NO: 10).

SEQ ID NO: 10: human RUNX3.

SEQ ID NO: 11: Inactive mutant of human NEDD4 (SEQ ID NO: 2).

SEQ ID NO: 12: Inactive mutant of a protein (SEQ ID NO: 4) in which the 100th amino acid residue in the N-terminal side of human NEDD4 (SEQ ID NO: 2) is deleted in the 100th amino acid.

SEQ ID NO: 13: Human RU having high homology with a partial sequence of human NEDD4 (SEQ ID NO: 2)

A partial sequence of NX3 (SEQ ID NO: 10).

SEQ ID NO: 14: Partial sequence of human NE DD4 (SEQ ID NO: 2) having high homology with the partial sequence of human RUNX3 (SEQ ID NO: 10).

SEQ ID NO: 15: Partial sequence of human RU NX3 (SEQ ID NO: 10) having high homology with the partial sequence of human NEDD4 (SEQ ID NO: 2).

SEQ ID NO: 16: Partial sequence of human NE DD4 (SEQ ID NO: 2) having high homology with the partial sequence of human RUNX3 (SEQ ID NO: 10).

SEQ ID NO: 17: Partial sequence of human RU NX3 (SEQ ID NO: 10) having high homology with the partial sequence of human NEDD4 (SEQ ID NO: 2).

SEQ ID NO: 18: Partial sequence of human NE DD4 (SEQ ID NO: 2) having high homology with the partial sequence of human RUNX3 (SEQ ID NO: 10).

SEQ ID NO: 19: sense RNA constituting siRNA for mouse Nedd4

SEQ ID NO: 20: Antisense RNA constituting siRNA against mouse Nedd4

SEQ ID NO: 21: sense RNA constituting siRNA against human NEDD4

Sequence number 22: Antisense RNA which comprises siRNA with respect to human NEDD4.

Sequence number 23: The sense RNA which comprises siRNA with respect to human NEDD4. SEQ ID NO: 24: antisense RNA constituting siRNA against human NEDD4 <SEQ ID NO: 25: sense RNA constituting siRNA against human NEDD4

SEQ ID NO: 26: antisense RNA constituting siRNA against human NEDD4

Claims

The scope of the claims

[1] RUNX (Runt—related transcription factor and NEDD4 (Neural precursor cell Expressed, developmentally down—regulated 4)).

[2] The RUNX ubiquitination method according to claim 1, wherein RUNX is any one selected from human RUNX1, human RUNX2 and human RUNX3.

[3] A RUNX ubiquitinizing agent comprising NEDD4.

[4] The RUNX ubiquitinating agent according to claim 3, wherein RUNX is any one selected from human RUNX1, human RUNX2 and human RUNX3.

[5] The RUNX ubiquitin method according to claim 1 or 2 is used.

UNX disassembly method.

[6] A method for decomposing RUNX, characterized in that RUNX is treated using the RUNX ubiquitinating agent according to claim 3 or 4.

[7] A RUNX decomposer comprising NEDD4.

[8] A method for inhibiting RUNX ubiquitination characterized by inhibiting the binding of RUNX and NEDD4.

[9] The RUNX according to claim 8, wherein a protein represented by the amino acid sequence represented by SEQ ID NO: 11 in the sequence listing and a protein represented by the amino acid sequence represented by Z or SEQ ID NO: 12 are used. Method for inhibiting ubiquitination.

[10] A method for inhibiting RUNX ubiquitin 匕, which comprises inhibiting the enzyme activity of NEDD4.

[11] A method for inhibiting RUNX ubiquitin 匕, which comprises inhibiting the expression of NEDD4.

[12] RU characterized by using a double-stranded polynucleotide capable of inhibiting the expression of NEDD4

NX ubiquitination inhibition method.

[13] A method for inhibiting RUNX ubiquitination, characterized by using one double-stranded polynucleotide selected from the following group:

(ii) the polynucleotide represented by the base sequence set forth in SEQ ID NO: 23 and the sequence described in SEQ ID NO: 24 A double-stranded polynucleotide comprising a polynucleotide represented by the nucleotide sequence of:

14. The method for inhibiting RUNX ubiquitination according to any one of claims 8 to 13, wherein RUNX is any one selected from human RUNX1, human RUNX2 and human RUNX3.

[15] A polynucleotide having a nucleotide sequence ability selected from the nucleotide sequences set forth in SEQ ID NOs: 21 to 26, which is a partial nucleotide sequence of a polynucleotide encoding NEDD4.

[16] A double-stranded polynucleotide comprising a polynucleotide having a partial base sequence ability of a polynucleotide encoding NEDD4 and a polynucleotide having a complementary base sequence ability of the partial base sequence, and selected from the following group: One force double-stranded polynucleotide:

[17] A RUNX ubiquitin 匕 inhibitor comprising a protein represented by the amino acid sequence set forth in SEQ ID NO: 11 in the sequence listing and a protein represented by Z or the amino acid sequence set forth in SEQ ID NO: 12.

[18] A RUNX ubiquitination inhibitor comprising a double-stranded polynucleotide capable of inhibiting NEDD4 expression.

[19] RUNX ubiquitin inhibitor comprising one double-stranded polynucleotide, optionally selected from the group:

(iii) the polynucleotide represented by the base sequence set forth in SEQ ID NO: 25 and the sequence described in SEQ ID NO: 26 A double-stranded polynucleotide comprising a polynucleotide represented by the nucleotide sequence:

20. The RUNX ubiquitination inhibitor according to any one of claims 17 to 19, wherein RUNX is any one selected from human RUNX1, human RUNX2 and human RUNX3.

[21] A method for inhibiting RUNX degradation, comprising using the method for inhibiting RUNX ubiquitin according to any one of claims 8 to 14.

[22] A method for inhibiting degradation of RUNX, characterized by using the RUNX ubiquitin inhibitor according to any one of claims 17 to 20.

[23] A RUNX degradation inhibitor comprising a protein represented by the amino acid sequence set forth in SEQ ID NO: 11 in the sequence listing and a protein represented by Z or the amino acid sequence set forth in SEQ ID NO: 12.

[24] A RUNX degradation inhibitor comprising a double-stranded polynucleotide capable of inhibiting NEDD4 expression.

[25] RUNX degradation inhibitor comprising a single double-stranded polynucleotide, optionally selected from the group:

[26] A method for promoting osteogenesis characterized by inhibiting the expression and Z or function of NEDD4.

[27] A method for promoting osteogenesis, comprising using a protein represented by the amino acid sequence represented by SEQ ID NO: 11 in the sequence listing and a protein represented by Z or the amino acid sequence represented by SEQ ID NO: 12.

[28] A method for promoting osteogenesis, comprising using a double-stranded polynucleotide capable of inhibiting the expression of NEDD4.

[29] A method for promoting osteogenesis characterized by using one double-stranded polynucleotide selected from the following group: (i) a double-stranded polynucleotide comprising a polynucleotide represented by the base sequence set forth in SEQ ID NO: 21 and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 22,

[30] An osteogenesis promoter comprising a protein represented by the amino acid sequence represented by SEQ ID NO: 11 in the sequence listing and a protein represented by Z or the amino acid sequence represented by SEQ ID NO: 12.

[31] An osteogenesis promoter comprising a double-stranded polynucleotide capable of inhibiting NEDD4 expression.

[32] A bone formation promoter comprising any one single-strand polynucleotide selected from the following group:

[33] A method for suppressing tumor growth, comprising inhibiting the expression and Z or function of NEDD4

[34] A method for inhibiting tumor growth, comprising using a protein represented by the amino acid sequence represented by SEQ ID NO: 11 in the sequence listing and a protein represented by Z or the amino acid sequence represented by SEQ ID NO: 12.

[35] A method for suppressing tumor growth, comprising using a double-stranded polynucleotide capable of inhibiting the expression of NEDD4.

[36] A method for inhibiting tumor growth, which comprises using one double-stranded polynucleotide that is selected from the following group:

(i) a double-stranded polynucleotide comprising a polynucleotide represented by the base sequence set forth in SEQ ID NO: 21 and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 22, (ii) a double-stranded polynucleotide comprising a polynucleotide represented by the base sequence set forth in SEQ ID NO: 23 and a polynucleotide represented by the base sequence set forth in SEQ ID NO: 24, and

[37] A tumor growth inhibitor comprising a protein represented by the amino acid sequence set forth in SEQ ID NO: 11 in the sequence listing and a protein represented by Z or the amino acid sequence set forth in SEQ ID NO: 12.

[38] A tumor growth inhibitor comprising a double-stranded polynucleotide capable of inhibiting NEDD4 expression.

[39] A tumor growth inhibitor comprising any one single-stranded polynucleotide selected from the following group:

[40] A method for identifying compounds that inhibit or promote RUNX ubiquitination by NEDD4, and contact NEDD4 and Z or RUNX with a compound (test compound) to detect RUNX ubiquitination by NEDD4 The ability of the test compound to inhibit RUNX ubiquitin by NEDD4 by detecting the presence or absence or change of this signal and Z or marker. Or an identification method that includes the step of deciding whether or not to promote.

[41] A method for identifying a compound that inhibits or promotes the binding of NEDD4 and RUNX, wherein NEDD4 and Z or RUNX are contacted with a compound, and then the signal and Z or marker generated by the binding of NEDD4 and RUNX. Determine whether the compound inhibits or promotes the binding of NEDD4 to RUNX by detecting the presence or absence or change of the signal and Z or marker using a system using The identification method including the process to do.

[42] A method for identifying a compound capable of promoting bone formation, the method comprising a step of measuring the power / inability of a compound (test compound) to inhibit NE DD4 expression and Z or function.

[43] The determination method according to claim 42, wherein the test compound is a process for determining whether the test compound is capable of inhibiting the expression and Z or function of NEDD4. :

and

[44] The method according to claim 42 or 43, further comprising the step of determining whether a test compound that has been shown to inhibit the expression and Z or function of NEDD4 can promote bone formation. Identification method.

[45] A method for identifying a compound capable of suppressing tumor growth, comprising a step of measuring whether a compound (test compound) inhibits NEDD4 expression and Z or function.

[46] The process of determining whether the test compound has the ability to inhibit the expression and Z or function of NEDD4. Law:

(1) contacting a polynucleotide encoding NEDD4 with a test compound and then measuring NED D4 to determine whether the test compound is capable of inhibiting the expression of NEDD4;

and

[47] The identification method according to claim 45 or 46, further comprising the step of measuring the force / potency of a test compound that has been shown to inhibit the expression and Z or function of NEDD4 to suppress tumor growth. .

[48] at least one of NEDD4, a polynucleotide encoding NEDD4, a recombinant vector containing the polynucleotide, and a transformant containing the recombinant vector

A reagent kit comprising one and at least one of RUNX, a polynucleotide encoding RUNX, a recombinant vector containing the polynucleotide, and a transformant containing the recombinant vector.

[49] RUNX ubiquitinating agent according to claim 3 and Z or RUN according to claim 7.

A preventive and Z or therapeutic agent for diseases caused by increased RUNX function and Z or expression, comprising an effective amount of an X degrading agent.

[50] The RUNX ubiquitination inhibitor according to any one of claims 17 to 20 and an RUNX degradation inhibitor according to any one of Z or 23 to 25. A preventive and Z or therapeutic agent for diseases caused by decreased RUNX function and Z or expression.

[51] RUNX ubiquitination method according to claim 1 or 2, RUNX ubiquitination agent according to claim 3, RUNX degradation method according to claim 5 or 6, and claim 7 A method for preventing and / or treating a disease caused by increased RUNX function and Z or expression, characterized by using at least one method or agent among RUNX degradation agents.

[52] The method for inhibiting RUNX ubiquitination according to claims 8 to 14, the RUNX ubiquitination inhibitor according to claims 17 to 20, the method for inhibiting RUNX degradation according to claims 21 and 22, and the claim Use of at least one method or agent of RUNX degradation inhibitors described in 23 to 25, prevention of disease caused by reduced RUNX function and / or expression and / or Z or Method of treatment.

[53] A preventive and Z or therapeutic agent for diseases accompanied by bone loss, comprising an effective amount of the osteogenesis promoter according to any one of claims 30 to 32.

[54] Accompanied by bone loss, characterized by using at least one agent or method of the osteogenesis promoting agent according to claims 30 to 32 and the osteogenesis promoting method according to claim 26 to 29. Disease prevention and Z or treatment methods.

[55] A prophylactic and Z or therapeutic agent for cancer diseases, comprising an effective amount of the tumor growth inhibitor of claim 37 to 39 according to claim 1.

[56] A cancer disease characterized by using at least one agent or method of the tumor growth inhibitor according to claims 37 to 39 and the tumor growth inhibitory method according to claims 33 to 36. Prevention and Z or treatment methods.