KR101067816B1 - Composition for preventing and treating inflammatory diseases comprising inhibitor of AIMP2-DX2 as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing and treating inflammatory diseases comprising an inhibitor of AIMP2-DX2 as an active ingredient, and more specifically, to a composition for preventing and treating inflammatory diseases comprising an AIMP2-DX2 inhibitor as an active ingredient, The present invention relates to a composition for preventing and treating inflammatory diseases comprising an expression vector that inhibits the expression of AIMP2-DX2, and a method for screening a medicament for preventing or treating inflammatory diseases for screening a substance that inhibits the expression of AIMP2-DX2. In the present invention, AIMP2 / p38 promotes ubiquitination of TRAF2 to regulate TNF-α-induced cell death, and AIMP2-DX2, a splicing variant of AIMP2 / p38, acts as a competitive inhibitor to AIMP2, Inhibition of cell death by TNF-α by inhibiting ubiquitin has been shown to inhibit tumor expression and Cox-2, an inflammatory marker. Thus, AIMP2-DX2 inhibitors can be used for the purpose of preventing and treating inflammatory diseases.

AIMP2, AIMP2-DX2, TRAF2, TNF-α signaling, inflammation

Description

Composition for preventing and treating inflammatory diseases comprising inhibitor of AIMP2-DX2 as an active ingredient}

The present invention relates to a composition for preventing and treating inflammatory diseases comprising an inhibitor of AIMP2-DX2 as an active ingredient, and more specifically, to a composition for preventing and treating inflammatory diseases comprising an AIMP2-DX2 inhibitor as an active ingredient, The present invention relates to a composition for preventing and treating inflammatory diseases comprising an expression vector that inhibits the expression of AIMP2-DX2, and a method for screening a medicament for preventing or treating inflammatory diseases for screening a substance that inhibits the expression of AIMP2-DX2.

Tumor necrosis factor α (TNF α) is an intracellular mediator of immune responses produced by various cells, including activated macrophages and monocytes. Responses induced by TNF α are initiated through interaction with two distinct TNF α cell surface receptors, TNFαR1 and TNFαR2. TNF α binds to these cell surface receptors, leading to the activation of transcription factors such as nuclear factor κB (NFκB), which regulate the expression of various immune and inflammatory response genes. Upon binding of TNF α, the TNF α receptor interacts with various intracellular signal transduction proteins through the cytoplasmic domain. A group of intracellular signal transduction proteins known to bind TNF a receptors is a tumor necrosis factor receptor binding factor known as the "TRAF" family of receptor proteins. The TRAF family consists of a number of homologous proteins that share common structural features and bind to the TNF α receptor protein to transduce signals from the TNF α receptor protein. The TRAF protein appears to act as an adapter protein that binds the receptor to the downstream signaling cascade, instead of lacking the motif of enzymatic activity. TRAF2, a member of the TRAF family, binds to a number of TNF α receptor family proteins such as TNFαR1, TNFαR2, CD40 and CD30. In the case of TRAF2, direct binding of 8 or more intracellular molecules was confirmed. TRAF2 has been shown to play an important role in TNF α mediated activation of various transcription factors, particularly NFκB and C-jun N-terminal kinases (JNK / SAPK), which in turn result in the expression of immune / inflammatory responses. do. There are various disease states associated with regulatory pathways controlled by TNF α binding. In certain instances, TNF α binding causes an inflammatory response and ultimately a disease state. Therefore, it would be desirable to develop means to prevent diseases associated with TNF α receptor binding. In particular, it would be desirable to identify a method for preventing activation of an inflammatory response that may be initiated by TNF α activation.

Several aminoacyl-tRNA synthetases (ARSs) form large complexes with cofactors called ARS-interacting multi-functional proteins (AIMPs). Many components of these enzymes have already been reported to be involved in various signaling condensation with their unique mechanisms (Lee, SW, et. Al. , 2004. J. Cell Sci. 117: 3725-3734; Park, SG, et. Al., 2005., Trends Biochem. Sci. 30: 569-574). In addition to their specific enzymatic countparts, the three AIMPs have been reported to bind to each other to facilitate assembly of large complexes (Han, JM, et. Al., 2006. J. Biol. Chem., 281: 38663- 38667). The cofactors have also been reported to have a variety of regulatory functions. AIMP1 / p43 is angiogenesis (Park, SG, et. Al., 2002. J. Biol. Chem. 27 7: 45243-45248), immune response (Ko, Y.-G. et. Al., 2001, J Biol.Chem . 276: 23028-32303; Park, H., et.al. , 2002, J. Leukoc. Biol . 71: 223-230 ) and tissue regeneration (Park, SG, et.al. , 2005. Am. J. Pathol . 166: 387-398) and the role of hormones that regulate blood sugar (Park, SG, et. Al., 2006. Proc. Natl. Acad. Sci. USA 103: 14913-14918) Do it. It has also been suggested to regulate autoimmune diseases such as lupus (Han, JM, et. Al., 2007. Am. J. Pathol. 170: 2042-2054). AIMP3 / p18 is either DNA damaged (Park, BJ, et. Al., 2005. Cell 120: 209-221) or oncogenic stimuli (Park, BJ, et. Al., 2006. Cancer Res. , 66: 6913-6918. It is known as a tumor suppressor that suppresses cancer in response to).

AIMP2 / p38 plays a role in regulating cell proliferation. It binds to FUSE-binding protein (FBP), an upstream transcriptional activator of c-Myc, and promotes ubiquitination-dependent degradation of FBP in response to TGF-β signals (Kim, MJ, et. Al., 2003 .. Nat Genet 34:.. 330-336). In mice with AIMP2 deficiency, high levels of FBP are maintained during embryonic initiation, resulting in over-expression of c-Myc, and overexpression of lung epithelial cells, resulting in lung injury and death. Although AIMP2 is known to be involved in cell death by TNF-α (Ko, HS, et. Al., 2005. J. Neurosci. 25: 7968-7978), its mechanism of action or its association with inflammation Is unknown.

In addition, the inflammatory response is stimulated by external substances such as damage, bacteria, fungi, viruses, etc., and a series of complex physiological factors such as enzyme activation by various inflammatory mediators and immune cells, secretion of inflammatory mediators, fluid infiltration, cell migration, and tissue destruction. The reaction occurs, which is accompanied by symptoms such as erythema, edema, fever and pain. Inflammatory reactions restore the function of life by removing external infectious agents and regenerating damaged tissues.However, when inflammatory reactions occur excessively or continuously such as antigens are not removed or internal substances are caused, mucosal damage and tissue destruction occur. It can also lead to diseases such as cancer, inflammatory skin diseases, inflammatory bowel disease, and arthritis.

Until now, antihistamines, vitamin ointments, and corticosteroids have been mainly used for the treatment of such inflammatory diseases. However, these drugs have a temporary effect and often have severe side effects. Therefore, there is a need for the development of a new substance that has a therapeutic effect on inflammatory diseases. For example, ML-3000 (licofelone), developed by MERCK, is a dual inhibitor that inhibits the expression of COX-1,2 and 5-LOX. It has been reported to alleviate infarction, osteoarthritis and gastrointestinal side effects (Kulkarni S et al., 2007; 7 (3) 251-63, current topics in medicinal chemistry). Quercetin, found in many plants, has several effects, including inhibition of antihistamines, prevention of heart disease, anti-inflammatory effects, reduction of cancer induction (prostate cancer, ovarian cancer, breast cancer, gastric cancer, etc.) and detoxification of heavy metals.

Therefore, the present inventors conducted a study to elucidate the role of AIMP2 / P38 and AIMP2-DX2 in the regulation of TNF-α signaling through TRAF2. Regulates cell death and promotes tumor formation by inhibiting TNF-α cell death by inhibiting ubiquitin of TRAF2 by acting as a competitive inhibitor of AIMP2 / p38, a splicing variant of AIMP2 / p38 The present invention was completed by inhibiting the expression of the inflammatory marker Cox-2.

It is an object of the present invention to provide the use of AIMP2 / P38 and AIMP2-DX2 for the regulation of TNF-α signaling via TRAF2.

In order to achieve the object of the present invention, the present invention provides the use of AIMP2 / P38 and AIMP2-DX2 for regulating TNF-α signaling via TRAF2.

More specifically, the present invention provides a composition for the prevention and treatment of inflammatory diseases comprising an inhibitor of AIMP2-DX2 as an active ingredient.

In order to achieve the other object of the present invention, the present invention is for the prevention and treatment of inflammatory diseases comprising a vector comprising a polynucleotide encoding the iRNA or antisense RNA for the promoter and AIMP2-DX2 operably linked thereto To provide a composition.

In order to achieve another object of the present invention, the present invention

(a) pre-culture of cells expressing AIMP2-DX2 polypeptide with or without a test agent;

(b) measuring the expression level of AIMP2-DX2 in the cells pre-cultured with the test agent and comparing the expression level of the cells pre-cultured with the test agent to determine whether the test agent inhibits the expression of AIMP2-DX2. Making; And

(c) administering a test agent identified as inhibiting the expression of AIMP2-DX2 in step (b) to an animal having an inflammatory disease and examining whether it has a therapeutic effect. Provided are methods of screening drugs.

Hereinafter, the content of the present invention will be described in more detail.

The gene encoding the AIMP2 protein consisting of SEQ ID NO: 6 (SEQ ID NO: 5) is located on chromosome 7 (chromosome 7) and consists of four exons (FIG. 1A). The gene encoding AIMP2 consisting of SEQ ID NO: 2 (SEQ ID NO: 1) can also be used. The variant (AIMP2-DX2) (SEQ ID NO: 4) in which exon 2 was deleted in AIMP2 was named AIMP2-DX2. In the present invention, we have identified for the first time that AIMP2 is an important regulator of TNF-α signaling by mediating the ubiquitin of TRAF2 (FIGS. 5B and C). AIMP2 is thought to promote the binding of the E3 ubiquitin ligase c-IAP1 and TRAF2 (FIG. 6B) and to facilitate the delivery of ubiquitin to TRAF2 by recruiting c-IAP1 to TRAF2. In one embodiment of the invention c-IAP1 was used as one of the E3 ubiquitin ligase, but other enzymes such as Siah2 (Habelhah, H., et. Al., 2002., EMBO J. 21: 5756-5765.) May be possible. It is considered to be. In order to determine whether TRAF2 is a specific target for AIMP2, the affinity of TRAF6 and AIMP2, which are different forms of TRAF family proteins, was investigated, indicating that AIMP2 has a high affinity for TRAF6 (results not shown).

Investigation of the effect of AIMP2-DX2 on the pro-apoptotic acitvity of AIMP2 via TRAF2 showed that the expression of AIMP2-DX2 decreased the pro-apoptotic activity of AIMP2 (FIG. 2). The variant had the ability to bind to TRAF2 of full-length AIMP2 (FIGS. 3A-C), but failed to bind to c-IAP1, a type of E3 ligase (FIGS. 6C-E). This is thought to be because AIMP2-DX2 acts as a competitive inhibitor in AIMP2, which serves to deliver ubiquitin to TRAF2 (FIG. 3F).

Since TNF-α is known to be involved in regulating tumorigenesis, the expression of AIMP2-DX2 inhibits cell death induced by TNF-α, thereby susceptibility to tumor formation. Was supposed to increase). This could be supported by transfection of AIMP2-DX2 in the presence of TNF-α, resulting in increased colony formation (FIG. 2E). In the present invention, it was first identified that AIMP2 mediates the apoptotic activity of TNF-α through TRAF2, and this activity is regulated by AIMP2-DX2. In addition, it was confirmed that AIMP2-DX2 also influences the expression of the inflammatory marker Cox-2 (see FIG. 7).

Therefore, the composition of the present invention comprises an inhibitor of the exon 2 lacking AIMP2 variant (AIMP2-DX2) polypeptide as an active ingredient, can be used for the purpose of preventing and treating inflammatory diseases.

The AIMP2-DX2 polypeptide of the present invention is a splicing variant of AIMP2, a polypeptide missing the second exon of AIMP2. As shown in FIG. 1A, AIMP2 is composed of four exons, while full-length AIMP2 (AIMP2-F) is a polypeptide linked by splicing between these exons, whereas AIMP2-DX2 is missing a second exon. Polypeptide. Preferably, AIMP2-DX2 may have an amino acid sequence consisting of SEQ ID NO: 4 or SEQ ID NO: 147.

On the other hand, the AIMP2-DX2 polypeptide may be a functional equivalent to the polypeptide having an amino acid sequence represented by SEQ ID NO: 4 or SEQ ID NO: 147. The term 'functional equivalent' refers to a sequence homology with at least 60%, preferably 70%, more preferably 80% or more of the amino acid sequence represented by SEQ ID NO: 4 as a result of the addition, substitution, or deletion of amino acids. It refers to a polypeptide that exhibits substantially homogeneous activity with the AIMP2-DX2 polypeptide of the present invention. Here, the term "substantially homogeneous activity" means inhibiting the expression of Cox-2, which is an inflammatory marker, to participate in inflammatory diseases. Such functional equivalents include amino acid sequence variants in which some of the amino acids of the amino acid sequence represented by SEQ ID NO: 4 or SEQ ID NO: 147 are substituted, deleted or added. Substitutions of amino acids are preferably conservative substitutions. Examples of conservative substitutions of amino acids present in nature are as follows; Aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of amino acids is preferably located at portions not directly involved in the activity of the AIMP2-DX2 polypeptide of the invention. Also within the scope of these functional equivalents are polypeptide derivatives in which some chemical structures of the polypeptide have been modified while maintaining the basic backbone of the AIMP2-DX2 polypeptide and its physiological activity. For example, fusion proteins made by fusion with other proteins, such as Green Fluorescent Protein (GFP), while maintaining structural alterations and physiological activities to alter the stability, shelf life, volatility or solubility of the polypeptides of the present invention. .

In the present invention, the AIMP2-DX2 inhibitor means a substance that partially reduces or completely (substantially completely) inhibits the activity of AIMP2-DX2. Preferably, the AIMP2-DX2 inhibitor may be a substance that inhibits the expression of AIMP2-DX2. Inhibition of expression can be inhibited through regulation at the transcriptional stage or regulation at the post-transcriptional stage. Modulation at the transcriptional stage is a method for inhibiting the expression of genes known to those of skill in the art, for example, by inducing mutations in a promoter or gene region, thereby inhibiting promoter activity or protein function, and the expression of antisense genes. Method, “iRNA” or “microRNA” method, or the like.

Modulation at the post-transcriptional stage is a method for inhibiting protein expression known to those of skill in the art, eg, a gene encoding SEQ ID NO: 4, SEQ ID NO: 147 or a functional equivalent thereof (eg, SEQ ID NO: 3 or SEQ ID NO: 146) can be carried out by a method of inhibiting the stability of mRNA transcribed into a template, a method of inhibiting the stability of a protein or polypeptide, or a method of inhibiting the activity of a protein or polypeptide.

Preferably, the inhibition of the expression of AIMP2-DX2 in the present invention may be carried out by a method of intracellularly expressing antisense RNA or iRNA against AIMP2-DX2. Each of these methods may be a method known to those skilled in the art, but for example, a recombinant expression vector linking an antisense or iRNA polynucleotide to the AIMP2-DX2 polynucleotide to a promoter may be used to reduce the expression of AIMP2-DX2. You can. In this case, the polynucleotide encoding the polypeptide of SEQ ID NO: 4 or an equivalent thereof may preferably have a nucleotide sequence represented by SEQ ID NO: 3 or SEQ ID NO: 146.

In addition, the iRNA for the AIMP2-DX2 polynucleotide in the present invention recognizes that it can reduce the expression of the AIMP2-DX2 polynucleotide, preferably, the reduction is a gene silencing process after transcription of the target nucleic acid, more preferably It is performed by RNA interference. iRNA includes RNA of various forms or names known in the art such as siRNA, shRNA, and may preferably have a nucleotide sequence of SEQ ID NO: 8 to SEQ ID NO: 145, and may have a complementary base sequence for these.

Inflammatory diseases to which the AIMP2-DX2 inhibitor of the present invention is applied include, but are not limited to, inflammatory skin diseases, Crohn's desease, and inflammatory bowel diseases such as ulcerative colitis, peritonitis, osteomyelitis, cellulitis, meningitis, encephalitis, Pancreatitis, trauma-induced shock, bronchial asthma, allergic rhinitis, cystic fibrosis, stroke, acute bronchitis, chronic bronchitis, acute bronchiolitis, chronic bronchiolitis, osteoarthritis, gout, spondyloarthropathy, ankylosing spondylitis, lighter syndrome, psoriatic arthrosis, Enteropathic spondylitis, juvenile arthritis, ductile ankylosing spondylitis, reactive arthritis, infectious arthritis, post-infectious arthritis, gonococcal arthritis, tuberculosis arthritis, viral arthritis, fungal arthritis, syphilis arthritis, Lyme disease, 'vasculitis Syndrome 'associated arthritis, nodular polyarteritis, irritable vasculitis, leuko granulomatosis, rheumatoid polymyositis Pain, joint cell arteritis, calcium crystalline arthritis, pseudogout, non-articular rheumatoid, bursitis, hay salt, epicondylitis (tennis elbow), neuropathic joint disease (charco and joint), hemarthrosic, henoch -Purpura purpura, hypertrophic osteoarthritis, multiple psychotic retinopathy, surcoilosis, hemochromatosis, sickle cell disease and other hemoglobinopathies, hyperlipoproteinemia, hypomagglobulinemia, familial Mediterranean fever, Behart's disease, Systemic lupus erythematosus, recursive fever, psoriasis, multiple sclerosis, sepsis, septic shock, multiple organ dysfunction syndrome, acute respiratory distress syndrome, chronic obstructive pulmonary disease, rheumatoid arthritis, acute lung Acute lung injury and broncho-pulmonary dysplasia.

In addition, the inflammatory skin disease is not limited thereto, but skin inflammation, acute and chronic eczema, contact dermatitis, atopic dermatitis, seborrheic dermatitis, chronic simple thyroid gland, interrogation, deprivation dermatitis, papular urticaria, psoriasis, sun dermatitis And acne and the like.

On the other hand, the present invention provides a composition for preventing and treating inflammatory diseases comprising as an active ingredient an expression vector comprising a polynucleotide encoding an iRNA or antisense RNA for the promoter and AIMP2-DX2 operably linked thereto.

Expression vectors of the present invention include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like. Suitable expression vectors may include expression control elements such as promoters, operators, initiation codons, termination codons, polyadenylation signals and enhancers, and the like, and may be prepared in various ways according to the purpose.

Recombinant vectors of the invention can be introduced into host cells using methods known in the art. The method of introduction into the host cell is preferably calcium chloride method, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, liposome mediation ( known methods such as liposome-mediated method) can be used.

As the host cell, E. coli (Escherichia coli), Bacillus subtilis (Bacillus subtilis), Streptomyces (Streptomyces), Pseudomonas (Pseudomonas), Proteus Mira Billy's prokaryotic, such as (Proteus mirabilis) or Staphylococcus (Staphylococcus) host cells, fungi (e.g., Aspergillus (Aspergillus)), yeast (e.g., Pichia pass pastoris (Pichia pastoris), Mai processes Sergio non jiae as Saccharomyces (Saccharomyces cerevisiae), a break irradiation car Roman process ( Schizosaccharomyces), Neuro spokes la Klein Inc. (Neurospora crassa) as a lower eukaryotic cell, an insect cell, a plant cell, can use the cells of higher eukaryotic origin, including a mammal such as a host cell, but the same but are not limited to, preferably Preferably a human cell.

Meanwhile, standard recombinant DNA and molecular cloning techniques used in the present invention are well known in the art and described in the following literature (Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual) , 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989); by Silhavy, TJ, Bennan, ML and Enquist, LW, Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1984) and by Ausubel, FM et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987)).

In addition, the composition according to the present invention may be a pharmaceutical composition for preventing and treating inflammatory diseases.

The pharmaceutical composition according to the present invention may contain a pharmaceutically effective amount of an AIMP2-DX2 inhibitor or expression vector of the present invention alone or may include one or more pharmaceutically acceptable carriers. As used herein, the term “pharmaceutically effective amount” refers to an amount that exhibits a higher response than a negative control, and preferably an amount sufficient to treat or prevent an inflammatory disease.

The pharmaceutically effective amount of the AIMP2-DX2 inhibitor or the expression vector according to the present invention is 0.0001 to 100 mg / day / kg body weight, preferably 0.01 to 1 mg / day / kg body weight. However, the pharmaceutically effective amount may be appropriately changed depending on various factors such as the disease and its severity, the patient's age, weight, health condition, sex, route of administration and duration of treatment.

As used herein, "pharmaceutically acceptable" is a non-toxic composition that, when administered physiologically to humans, does not inhibit the action of the active ingredient and typically does not cause an allergic reaction such as gastrointestinal disorders, dizziness, or the like. Say Such carriers include all kinds of solvents, dispersion media, oil-in-water or water-in-oil emulsions, aqueous compositions, liposomes, microbeads and microsomes.

On the other hand, the pharmaceutical composition according to the present invention can be formulated with a suitable carrier depending on the route of administration. The route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but may be administered orally or parenterally. Parenteral routes of administration include, for example, several routes such as transdermal, nasal, abdominal, muscle, subcutaneous or intravenous.

In the case of oral administration of the pharmaceutical composition of the present invention, the pharmaceutical composition of the present invention is prepared in powder, granule, tablet, pill, dragee, capsule, liquid, gel according to a method known in the art together with a suitable oral carrier. , Syrups, suspensions, wafers and the like. Examples of suitable carriers include sugars, including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol and starch, cellulose, starch including corn starch, wheat starch, rice starch and potato starch, and the like. Fillers such as cellulose, gelatin, polyvinylpyrrolidone, and the like, including methyl cellulose, sodium carboxymethylcellulose, hydroxypropylmethyl-cellulose, and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid or sodium alginate and the like may optionally be added as a disintegrant. Furthermore, the pharmaceutical composition may further include an anticoagulant, a lubricant, a humectant, a perfume, an emulsifier, and a preservative.

In addition, when administered parenterally, the pharmaceutical compositions of the present invention may be formulated according to methods known in the art in the form of injections, transdermal and nasal inhalants together with suitable parenteral carriers. Such injections must be sterile and protected from contamination of microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media comprising water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycols, etc.), mixtures thereof and / or vegetable oils Can be. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanol amine or sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose Etc. can be used. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like may be further included. In addition, the injection may in most cases further comprise an isotonic agent such as sugar or sodium chloride.

In the case of transdermal administrations, ointments, creams, lotions, gels, external preparations, pasta preparations, linen preparations, air rolls and the like are included. As used herein, "transdermal administration" means that the pharmaceutical composition is topically administered to the skin such that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin. These formulations are described in Remington's Pharmaceutical Science , 15th Edition, 1975, Mack Publishing Company, Easton, Pennsylvania, a prescription generally known in pharmaceutical chemistry.

In the case of inhaled dosages, the compounds used according to the invention may be pressurized packs or by means of suitable propellants, for example dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be delivered conveniently from the nebulizer in the form of an aerosol spray. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in an inhaler or insufflator may be formulated to contain a compound, and a powder mixture of a suitable powder base such as lactose or starch.

Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

In addition, the pharmaceutical compositions according to the invention may comprise one or more buffers (e.g. saline or PBS), carbohydrates (e.g. glucose, mannose, sucrose or dextran), antioxidants, bacteriostatic agents, chelating agents (Eg, EDTA or glutathione), adjuvants (eg, aluminum hydroxide), suspending agents, thickening agents, and / or preservatives.

In addition, the pharmaceutical compositions of the present invention may be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.

In addition, the pharmaceutical composition of the present invention can be administered in combination with a known compound having the effect of preventing or treating an inflammatory disease.

In addition,

(a) pre-culture of cells expressing AIMP2-DX2 polypeptide with or without a test agent;

(b) measuring the expression level of AIMP2-DX2 in the cells pre-cultured with the test agent and comparing the expression level of the cells pre-cultured with the test agent to determine whether the test agent inhibits the expression of AIMP2-DX2. Making; And

(c) administering a test agent identified as inhibiting the expression of AIMP2-DX2 in step (b) to an animal having an inflammatory disease and examining whether it has a therapeutic effect. Provided are methods of screening drugs.

In the above, the animal is preferably a non-human animal. In addition, in the step (d), the 'therapeutic effect' means an effect of alleviating or ameliorating an inflammatory disease and its symptoms and an effect of inhibiting the progression of an inflammatory disease.

In the present invention, the term 'agent' or 'test agent' refers to any substance, molecule, element, compound, entity, or their substance. Combinations. For example, but not limited to, proteins, polypeptides, small organic molecules, polysaccharides, polynucleotides, and the like. It may also be a natural product, synthetic compound or chemical compound or a combination of two or more substances. Unless otherwise specified, agents, materials, and compounds may be used interchangeably.

Test agents that can be screened or identified by the methods of the present invention include polypeptides, beta-turn mimetics, polysaccharides, phospholipids, hormones, prostaglandins, steroids, aromatic compounds, heterocyclic compounds, benzodiazepines ), Oligomeric N-substituted glycines, oligocarbamates, saccharides, fatty acids, purines, pyrimidines or derivatives thereof, structural analogs or combinations thereof. Some test agents may be synthetic, and other test agents may be natural. The test agents can be obtained from a wide variety of sources, including libraries of synthetic or natural compounds. Combinatorial libraries can be produced with a variety of compounds that can be synthesized in a step-by-step fashion. Compounds of many combinatorial libraries can be prepared by encoded synthetic libraries (ESL) methods (WO 95/12608, WO 93/06121, WO 94/08051, WO 95/395503 and WO 95/30642). Libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts can be obtained from commercial sources or collected in the field. Known pharmacological agents can be applied to directed or random chemical formulas such as acylation, alkylation, esterification, amidification to produce structural analogs. The test agent may be a naturally occurring protein or fragment thereof. Such test preparations may be obtained from natural sources such as cell or tissue lysates. Libraries of polypeptide preparations can be obtained, for example, from cDNA libraries produced by conventional methods or commercially available. The test agent may be a peptide such as a peptide having about 5-30, preferably about 5-20, more preferably about 7-15 amino acids. The peptide may be a cleavage of a naturally occurring protein, random peptide or “biased” random peptide.

The test agent may also be a “nucleic acid.” Nucleic acid The test agent may be a naturally occurring nucleic acid, a random nucleic acid, or a “biased” random nucleic acid. For example, cleavage of the prokaryotic or eukaryotic genome can be used similarly as described above.

The test formulation may also be a small molecule (eg, a molecule having a molecular weight of about 1,000 or less). The method for screening small molecule modulating agents may preferably be subjected to a high throughput assay. Combination libraries of small molecule test formulations can be readily applied to the screening methods of the present invention as described above. Many assays are useful for such screening (Shultz, Bioorg. Med. Chem. Lett., 8: 2409-2414, 1998; Weller, Mol. Drivers., 3: 61-70, 1997; Fernandes, Curr. Opin. Chem. Biol., 2: 597-603, 1998; and Sittampalam, Curr. Opin. Chem. Biol., 1: 384-91, 1997).

Meanwhile, the drawings of the present invention may refer to the following description.

1 shows tissue-specific expression of splicing variants of AIMP2 that have been deleted exon 2. (A) p38 structural gene (SEQ ID NO: 5) consisting of four exons interspersed with three introns interspersed with 320 amino acids (NM_006303). The 312 amino acid (SEQ ID NO: 2) of AIMP2 may also be used for U24169 . The two forms appeared mostly similar in our experiments. The binding sites of the primers used for AIMP2-F (JK12 and JTV5) and AIMP2-DX2 (DX2-S2 and JTV5) were indicated. (B) Expression of AIMP2-F and AIMP2-DX2 was examined in other cells by RT-PCR using their specific primers indicated above. GAPDH is a loading control. (C) Western blot using antibodies that recognize AIMP2-F and AIMP2-DX2 in the same cell. Tubulin is a loading control. (D) It was confirmed that the overexpression and knock-down of AIMP2-F and AIMP2-DX2 in each cell. The exogeneous forms of AIMP2-F and AIMP2-DX2 were expressed as Myc-tagged proteins and detected in the band slightly above the endogeneous form. (E) Immuniglote protein extracted from various mouse tissues with anti-AIMP2 antibody. The band shown between AIMP2-F and AIMP2-DX2 appeared to be a nonspecific product.

Figure 2 shows the antagonistic effect of AIMP2-F and AIMP2-DX2 on TNF-α-induced cell death. (A) A549 cells were transfected with TNF-α-treated AIMP2-F and AIMP2-DX2 and their effects were monitored by Annexin V-positive cells on flow cytometry. (B) The results of transfection with siRNA for AIMP2-F and AIMP2-DX2 and the effects on TNF-α induced apoptosis were compared with the above. (C) 293 cells transfected with AIMP2-F and AIMP2-DX2 were treated with TNF-α and cell death was measured by sub-G1 measurement in flow cytometry. (D) The effects of AIMP2-F and AIMP2-DX2 treated with siRNAs were measured in 293 cells. (E) Embryonic 12.5d MEFs were transfected with AIMP2-F and AIMP2-DX2 and incubated for one week under selective pressure with G418, with and without TNF-α. Colony formation was monitored by Coomassie staining (left) and the numbers of colonies were shown graphically (right). (F) 293 cells treated with TNF-α were incubated for a predetermined time, and nuclei and cytoplasmic fractions were obtained to examine the effects of AIMP2-F and AIMP2-DX2 on the localization of nuclei induced by TNF-α of NF- k B. It is the result of investigation.

In Figure 3, AIMP2-F and AIMP2-DX2 show a competitive binding relationship with TRAF2. (A) AIMP2-F and AIMP2-DX2 bound to TRAF2 in 293 cells treated with TNF-α, showing co-immunoprecipitation over time. The extracted protein was co-immunoprecipitated with anti-TRAF2 antibody and co-immunoprecipitated AIMP2-F and AIMP2-DX2 were obtained by Western blot with anti-AIMP2 antibody. (B) AIMP2-F and AIMP2-DX2 were expressed with GST fusion protein. TRAF2 was synthesized by in vitro translation, mixed with GST, GST-AIMP2-F and GST-AIMP2-DX2, and then precipitated with glutathione-sepharose. GST-AIMP2-F and GST-AIMP2-DX2 were coimmunoprecipitated with TRAF2. (C) Another deletion variant of AIMP2 was expressed with the B42 fusion protein, combined with TRAF2 expressed with the LexA fusion protein, and tested by the yeast two hybrid method. Positive reactions formed blue colonies in yeat medium containing X-gal. (D) The binding of B42-KRS and -TRAF2 to AIMP2-F and AIMP2-DX2 was determined by forming blue colonies on X-gal plates using the yeast two hybrid assay. (E) The binding of KRS with AIMP2-F and AIMP2-DX2 was measured by co-immunoprecipitation method. KRS was immunoprecipitated with their specific antibodies against protein extracts extracted from 293 cells transfected with Myc-AIMP2-F or -DX2. Co-immunoprecipitation of AIMP2-F or -DX2 and KRS was measured by Western blot with anti-Myc antibody. Expression of KRS and Myc-tagged AIMP2 is shown by Western blotting with anti-KRS and -Myc antibodies in whole cell lysate (WCL), respectively. (F) 293 cells were transfected with Myc-AIMP2-F (1 mg) and a defined amount of Myc-AIMP2-DX2 and expression of endo- and exo-AIMP2-F and -DX2 with anti-AIMP2 antibody (left) Each was identified by a Weschem blot of whole cell lysate (WCL). TRAF2 was immunoprecipitated with specific antibodies and co-precipitated exo-AIMP2-F and -DX2 were measured with anti-Myc antibodies.

4 shows that AIMP2 downregulates TRAF2. (A) 293 cells were transfected with Myc-AIMP2-F or -DX2 and mixed with proteasome inhibitor MG132 and treated with TNF-α. Level changes in TRAF2 by transfection of AIMP2-F and AIMP2-DX2 were measured by western blotting with anti-TRAF2 antibody. The arrows indicate that they are tagged Myc-tagged AIMP2-F and -DX2. Actin was used as loading control. (B) Intracellular levels of TRAF2 following TNF-α treatment in AIMP2 ^{+ / +} and AIMP2 ^{− / −} MEFs were measured by Western blot of phosphorylation of GST-I k Ba (KA), a substrate of TRAF2 (IB) and IKK-b. Shown as the result of the routing. (C) The effect of AIMP2 on intracellular levels of TRAF2 was measured by pulse-chase experiments. 292 cells were transfected with EV, AIMP2-F or -DX2 and incubated for 1 hour in the presence of [ ³⁵ S] methionine. The cells were cultured in fresh medium and harvested for a predetermined time. TRAF2 was coimmunoprecipitated and the precipitated TRAF2 was measured by autoradiography. (D) Changes in TRAF2 levels were measured by phosphorylation of GST-I k B-a.

5 shows that AIMP2 mediates ubiquitination of TRAF2. (A) It shows the importance of TRAF2 for the pro-apoptotic activity of AIMP2 in the TNF-α signaling pathway. Lipofectamine 2000 (Invitrogen) was used to transfect AIMP2-F and -DX2 into TRAF2 ^{+ / +} and TRAF2 ^{− / −} mouse fibroblasts. Transfection efficiency was measured by GFP introduction. (B) AIMP2-F or -DX2 is expressed in different amounts with HA-tagged ubiquitin in 293 cells. TRAF2 was immunoprecipitated and its ubiquitination was measured by western blotting with anti-HA antibody. (C) AIMP2-F or -DX2 was introduced into 293 cells expressing Flag-tagged ubiquin variant, K48R or K63R and immunoprecipitated, followed by AIMP2-F or -DX2 for ubiquitination of Flag-tagged variant ubiquin and TRAF2. The effect was measured by Western blot.

6 shows that AIMP2 promotes binding of c-IAP1 and TRAF2. (A) To see the importance of c-IAP1 in the degradation of TRAF2 via AIMP2, c-IAP1 was inhibited by siRNA and the effect of AIMP2 on TRAF2 levels was confirmed by Western blot. Tubulin was used as a loading control. (B) Myc-AIMP-F and -DX2 were transfected into 293 cells with Flag-c-IAP1. Intracellular TRAF2 was immunoprecipitated with a specific antibody, and co-immunoprecipitation of AIMP2-F or -DX2 and c-IAP1 and AIMP2-F was Western blotted with anti-Myc and -Flag antibodies, respectively. (C) Flag-c-IAP1 was transfected with 293 cells with Myc-AIMP2-F or -DX2. Flag-c-IAP1 was immunoprecipitated with anti-Flag antibody, and immunoprecipitation of Myc-AIMP2-F or -DX2 was measured by western blot with anti-Myc antibody. (D) AIMP2-F and -DX2 were prepared by in vitro translation in the presence of [ ³⁵ S] methionine, mixed with GST or GST-c-IAP1 and precipitated with glutathione-sepharose. AIMP2 protein precipitated with GST or GST-c-IAP1 was detected by autoradiography. (E) AIMP2-F and -DX2 were expressed as GST fusion proteins, mixed with [ ³⁵ S] methione-labeled c-IAP1 and precipitated with glutathione-sepharose. c-IAP1 co-precipitated GST protein was detected by autoradiography.

7 shows that inhibition of AIMP2-DX2 inhibits the inflammatory response induced by TNF-α. If not treated with TNF-α control group (Si-cont), siRNA treatment group for full-length AIMP2 (Si-F, SEQ ID NO: 7) and siRNA treatment group for AIMP2-DX2 (Si-DX2, SEQ ID NO: 8 Neither expression of Cox-2 is induced. When treated with TNF-α, siRNA-treated groups for control and AIMP2 induced Cox-2 expression, but siRNA-treated groups for AIMP2-DX2 did not induce Cox-2 expression. This indicates that siRNA against AIMP2-DX2 inhibits the induction of inflammatory responses. Western blot results for AIMP2-F and AIMP2-DX2 showed that inhibition of AIMP2-F and AIMP2-DX2 occurred well by siRNA. Tubulin was used as the loading control.

8 shows that siRNAs against various AIMP2-DX2 inhibit inflammatory responses induced by TNF-α. When TNF-α was not treated (-), control (Si-cont) produced AIMP2-DX2 expression, even when TNF-α was treated (+). Expression of Cox-2 is enhanced when TNF-α is treated, but expression is inhibited upon treatment of siRNA against AIMP2-DX2. Non-specific bands (NS) were used as loading controls.

Therefore, in the present invention, AIMP2 / p38 promotes ubiquitination of TRAF2 to regulate cell death induced by TNF-α, and AIMP2-DX2, a splicing variant of AIMP2 / p38, acts as a competitive inhibitor with AIMP2 Inhibition of ubiquitin of TRAF2 inhibits cell death by TNF-α, thereby promoting tumor formation and inhibiting the expression of Cox-2, an inflammatory marker. Thus, AIMP2-DX2 inhibitors can be used for the purpose of preventing and treating inflammatory diseases.

Below. The present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

≪ Example 1 >

Cell culture and transfection

Human embryonic kidney cell line 293 cells were fed 5% CO ₂ by adding 10% Fetal bovine serum (FBS), 50 μg / ml penicillin / straptomycin to DMEM (Dulbeccos modified Eagles medium, Hyclone, USA) And cultured in a 37 ℃ cell incubator. TRAF2 labeled with Myc or Flag was provided by Lee Soo-young, Professor of Ewha Womans University, Korea. Wild-type and K48R or K63R variant ubiquitin clones were provided by Professor Jung Jin-ha of Seoul National University. Geneporter, GTS, USA and lipofectamine 2000 (Invitrogen, USA) were used as reagents for introduction, and originated from human and mouse (Sigma) and MG-132 (Calbiochem, USA). ) Were treated under serum-free conditions at concentrations of 30 ng / ml and 20 μM, respectively.

siRNAs were used for inhibition of wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2), whose sequences are AGAGCUUGCAGAGACAGGUUAGACU (SEQ ID NO: 7) and UCAGCGCCCCGUAAUCCUGCACGUG (SEQ ID NO: 8), respectively (Invitrogen, USA).

<Example 2>

Tissue Specific Expression of AIMP2 Splicing Variants Lacking Exon 2

To confirm the expression of the AIMP2 splicing variant lacking exon 2 (AIMP2-DX2), we prepared primers specific for the conjugation of exons 1 and 3 (DX2-S2) and various cell lines as shown in FIG. 1A. Reverse transcription polymerase chain reaction (RT-PCR) was performed using RNA obtained from

First, cells were obtained and then suspended by the addition of Trizol solution (Invitrogen, USA), and the cell extracts were allowed to stand at room temperature by adding 50% chloroform, followed by vortexing. After centrifugation at 14,000 rpm, 4 ℃ and the supernatant is taken to precipitate the RNA by adding isopropanol thereto. The supernatant is discarded by centrifugation in the same manner as above method, the pellet is taken and washed with 70% ethanol. Centrifuge again to remove ethanol and dissolve the pellet in distilled water. The absorbance was measured to quantify RNA.

As a result, although a variant lacking exon 2, AIMP2-DX2, was found in most cell lines, the expression level differed depending on the cell lines (FIG. 1B). Expression of the variant was further confirmed through sequencing of the isolated transcript.

Similar results of AIMP2-DX2 expression as described above were also seen through Western blot using antibodies recognizing the wild type and exon 2 bound variants of AIMP2 (FIG. 1C). In addition, Western blot using 293 cell line was able to observe the expression of wild type and exon 2-associated variants of AIMP2 (FIG. 1D). In order to distinguish between the two forms of AIMP2, the inventors have identified a Myc-labeled wild-type AIMP2 (Myc-tagged AIMP2-F) or Myc-labeled AIMP2 variant (Myc-tagged AIMP2-DX2). The cells were introduced and their expression compared. These exogenous Myc-tagged AIMP2-F and Myc-tagged AIMP2-DX2 were expressed in cells and showed bands at positions slightly higher than the original position on electrophoresis (FIG. 1D arrow). SiRNA was used to target the expression of variant AIMP2-DX2 lacking wild type AIMP2 or exon 2 artificially at the transcript stage. As a result, the two AIMP2 could be distinguished (FIG. 1D).

In addition, the inventors performed Western blot using various tissues of mice to confirm the tissue specific expression of AIMP2-DX2.

To investigate the tissue-specific distribution of AIMP2 variants lacking wild-type AIMP2 and exon 2, Lice buffer containing 1% Triton X-100, 0.1% SDS, and a protease inhibitor cocktail was added to different tissues of mice. I went to the homogenizer. Cultured cell lines were lysed in Lysis buffer with 0.5% Triton X-100 and Protease Inhibitor Cocktail. Extracted protein from cells ground to homogenizer was isolated by 10% SDS-PAGE. Proteoextract kits (ProteoExtract kit, Calbiochem) were used to obtain the nuclear fraction. As a result, wild-type AIMP2 showed similar expression levels in all tissues, whereas variants lacking exon 2 showed different expression levels in different tissues, and thus, the variants could be expected to play a specific role in specific tissues. (FIG. 1E).

<Example 3>

Determining Interfering Wild-type AIMP2 Apoptotic Activity of AIMP2 Variants Lacking Exon 2

We have identified whether wild-type AIMP2 and AIMP2 splicing variants show different activities in Tumor Necrosis Factor-α (TNF-α) signaling. First, wild-type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) were introduced into three A549 cells, and their effects on TNF-α-induced cell death were examined by Annexin V, an apoptosis marker. And flow cytometry. For flow cytometry, cells incorporating plasmids encoding wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) were incubated in the presence or absence of TNF-α and for 1 hour at 4 ° C. with 70% ethanol. Fixed and washed twice with cold phosphate buffered saline. Thereafter, 1 × 10 ⁶ cells were stained with PI (PI 50 μg / ml, sodium citrate 0.1%, NP40 0.3% and RNase A 50 μg / ml) for 40 minutes and analyzed by flow cytometry (FACS Calibur, Beckton-Dickinson). 20,000 cells per each sample were analyzed by Cell Quest Pro software program, and Annexin V (Invitrogen) staining was also performed to investigate TNF-α induced cell death.

As a result, the introduction of wild type AIMP2 and AIMP2 splicing variants (AIMP2-DX2) had little effect on cell death when TNF-α was not treated (FIG. 2A left). On the other hand, cells treated with TNF-α significantly increased cell death in wild-type AIMP2-introduced cells, but not in cells in which AIMP2 variant (AIMP2-DX2) lacking exon 2 was introduced (Figure 2A right). Conversely, we compared their effects on TNF-α dependent cell death using siRNAs specific for wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2). In other words, downregulation of wild type AIMP2 and exon 2 lacking AIMP2 variants (AIMP2-DX2) by siRNA did not particularly affect cell death without TNF-α treatment (FIG. 2B left). However, knock-down of AIMP2 variants lacking exon 2 (AIMP2-DX2) made the cells susceptible to TNF-α induced cell death (Figure 2B right), whereas wild-type AIMP2 did not affect apoptosis. . As a result of analyzing the cell portion of the sub G1 phase on the flow cytometer by performing the same experiment using the 293 cells, the present inventors were able to obtain a result similar to the above result (FIGS. 2C and D). Taken together, the results suggest that wild-type AIMP2 promotes cell death with TNF-α induction, whereas AIMP variants lacking exon 2 (AIMP2-DX2) inhibit the apoptosis hyperactivity of these wild-type AIMP2.

To further solidify this, we introduced wild-type AIMP2 and exon 2-deficient AIMP2 variants (AIMP2-DX2) into 12.5 days old mouse embryonic fibroblasts (MEF) and lacked TNF-α. Colony formation was compared below. In the absence of TNF-α, there was little difference in colony counts in both cells introduced wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2), which demonstrated a similar degree of introduction efficiency in this experiment. I gave it. However, when cells were cultured in the presence of TNF-α, the AIMP2 variant lacking exon 2 (AIMP2-DX2) produced more colonies compared to the wild-type or empty vector-introduced cells (FIG. 2E), which showed growth. Without precluding the possibility of a consequence of the difference, AIMP2 variants lacking exon 2 (AIMP2-DX2) support the blocking of TNF-α induced cell death. We then compared the effects of wild-type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) on nuclear bias in NF-kB (p65) known to be induced by TNF-α. As a result, wild-type AIMP2 suppressed TNF-α-induced nuclear bias of NF-kB, whereas the AIMP2 variant lacking exon 2 (AIMP2-DX2) had the opposite effect (FIG. 2F, center and left, respectively). Based on the above results, it was found that wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) can regulate TNF-α-induced cell death through their antagonism.

<Example 4>

Competitive Interaction with TRAF2 of Wild-type AIMP2 and AIMP2 Variants Lacking Exon 2 (AIMP2-DX2)

We investigated the mechanism of action of AIMP2 in TNF-α signaling mechanisms. Among the various potential targets of AIMP2, we chose TNF receptor-associated factor 2 (TRAF2). This is because, first, TRAF2 plays a pivotal role in the TNF-α signal mechanism. In addition, TNF-α induces ubiquitination of TRAF2 and AIMP2 mediated ubiquity of FBP, a target protein of AIMP2. We therefore tested whether TRAF2 could be the target of AIMP2 for ubiquity. 293 cells were treated with TNF-α and the interaction of AIMP2 with TRAF2 was examined by co-immunoprecipitation.

Cultured cells were lysed in Lysis buffer containing 0.5% triton X-100 and Protease Inhibitor Cocktail, and the lysed cells were centrifuged at 14,000 rpm for 30 minutes. Then, the protein was separated through SDS-PAGE. Cells were lysed in IP Lysis buffer buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl and 0.2% NP40) to investigate the interaction of TRAF2 with wild type AIMP2 or AIMP2 variants lacking exon 2 (AIMP2-DX2). . Protein extracts were incubated in normal IgG and protein G agarose for 2 hours and centrifuged to remove nonspecific IgG binding protein. Subsequently, the supernatant was reacted with TRAF2 antibody (Santa Cruz) while stirring at 4 ° C. for 2 hours, and protein G agarose was added. After three washes with cold Lysis buffer, the additives were dissolved in SDS sample buffer and separated by SDS-PAGE. 10% SDS-PAGE was used to identify AIMP2. Proteins were transferred to PVDF membranes and antibody precipitation was performed using anti-AIMP2 antibodies.

As a result, when cells were treated with TNF-α, AIMP2 bound to TRAF2 increased in proportion to time (Figure 3A top band). In the case of the variant lacking exon 2 (AIMP2-DX2), the cell level was lower than that of the wild type, but showed similar results (Fig. 3A lower band).

To determine whether both wild type AIMP2 and variants lacking exon 2 (AIMP2-DX2) form a conjugate directly with TRAF2, the inventors have indicated that glutathione-S-transferase (GST) is a label. Wild type AIMP2 (GST-AIMP2-F) and AIMP2 variant lacking exon 2 (GST-AIMP2-DX2) were prepared and the fusion protein was mixed with TRAF2 synthesized in vitro. TRAF2 precipitated with both GST-AIMP2-F and GST-AIMP2-DX2, but did not precipitate when mixed with GST alone (FIG. 3B). The results of the yeast to hybrid assay also showed that both wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) can react with TRAF2, and the 84-225th peptide site of AIMP2 is associated with this interaction. Showed that (FIG. 3C).

AIMP2 is known to have a strong interaction in lysyl-tRNA synthetase (KRS) and multi-tRNA synthetase complexes. Therefore, the researchers then examined whether the wild-type AIMP2 and exon 2-deficient AIMP2 variants (AIMP2-DX2) showed similar affinity for the KRS in East-to-hybrid assay and antibody precipitation. Although the two forms of AIMP2 showed similar binding to TRAF2 as described above, the AIMP2 variant lacking exon 2 (AIMP2-DX2) lost the binding ability as compared to wild type AIMP2 (FIGS. 3D and E). Since the AIMP2 variant lacking exon 2 (AIMP2-DX2) binds TRAF2 like the wild type, it blocks the TNF-α signal with the opposite effect on the TNF-α signal, so the present inventors It was checked whether the AIMP2 variant (AIMP2-DX2) was competitive with the wild type in reaction with TRAF2. First, AIMP2 variants lacking different amounts of exon 2 (AIMP2-DX2) were introduced and checked by antibody precipitation to see if they affected the interaction of wild type AIMP2 with TRAF2. As expression of the AIMP2 variant lacking exon 2 (AIMP2-DX2) increased, the interaction of wild type AIMP2 with TRAF2 increased (left of FIG. 3F). The opposite experiment was performed. Wild-type AIMP2 dose-dependently inhibited the interaction of TRAF2 with AIMP2 variant lacking exon 2 (AIMP2-DX2) (FIG. 3F right). Taken together, the AIMP2 variant lacking exon 2 (AIMP2-DX2) has been shown to block apoptosis hyperactivity of wild type AIMP2 through competitive interaction with TRAF2.

Example 5

Intracellular TRAF2 Level Down Confirmation Experiment of AIMP2

We investigated how wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) influence intracellular TRAF2 levels. The wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) were not significantly affected in the absence of TNF-α treatment (FIG. 4A left). However, when cells were treated with TNF-α, TRAF2 levels were reduced when wild-type AIMP2 was introduced, whereas the variant lacking empty vector or exon 2 (AIMP2-DX2) was not (center of FIG. 4A). Reduction of TRAF2 by wild type AIMP2 was not observed when cells were treated with MG132, a proteasome inhibitor, suggesting that reduction of TRAF2 by wild type AIMP2 was mediated by proteasome (right side of FIG. 4A). AIMP2 effects on TRAF2 levels were compared between wild type and AIMP2 deficient mouse embryo fibroblasts (AIMP2-/-MEF). TRAF2 levels were significantly higher in AIMP2 deficient mouse embryonic fibroblasts than wild type cells (Figure 4B upper panel). In order to confirm whether the difference in TRAF2 levels between the two cells is caused by IKK-β activity, the kinase activity of IKK-β was confirmed by confirming the phosphorylation of their substrate, IkB-α.

293 cells were collected in Lysis buffer (Cell Signal), and endogenous IKK-β was immunoprecipitated with anti-IKK-β monoclonal antibody (Cell Signal). In vitro kinase assay was performed in kinase buffer (Cell Signal) using GST-IkB-α (Santa Cruz) as a reaction substrate in the presence of [ ³² P] ATP. After washing the beads to remove unreacted ATP, sample buffer was added and proteins were removed from the beads and separated using 12% DS-PAGE. Gels were stained with Coomassie Blue, and phosphorylation of GST-IkB-α was confirmed using radiographic imaging.

 Phosphorylation of GST-IkB-α was significantly increased in cells lacking AIMP2 due to an increase in TNF-α (FIG. 4B lower panel). This shows the negative effect of AIMP2 on the intracellular levels of TRAF2.

We investigated the effect of wild-type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) on the turnover of TRAF2 through a pulse-chase experiment with [ ³⁵ S] methionine. Pulse-chase analysis was performed using [ ³⁵ S] methionine.

GST-AIMP2 or GST was expressed in E. coli Rosetta (DE3) strain, and the protein extract containing GST-AIMP2 or GST was added to glutathione in phosphate buffered saline buffer containing 1% Triton X-100 and 0.5% N-laurylarcosine. Mix with Sepharose at 4 ° C. for 2 hours. Human TRAF2 was prepared by adding a GST protein mixture with pcDNA3.1 / V5-His-TOPO-AIMP2 (or AIMP2-DX2) as the template in the presence of [ ³⁵ S] methionine to 1% Triton X-100, 0.5% N-lauryl After incubation for 6 hours at 4 ° C. in phosphate buffered saline containing arcosine, 1 mM DTT, 2 mM EDTA and 300 μM phenylmethylsulfonyl fluoride, 6 times with the same buffer containing 0.5% Triton X100 Washed and artificially synthesized. Then, proteins were separated from Sepharose beads, separated by SDS-PAGE, and confirmed by AIMP2 by radiograph.

Myc-labeled wild type AIMP2, exon 2-deficient AIMP2 variant (AIMP2-DX2) and pcDNA3 empty vector as control were introduced into 293 cells and cultured for 24 hours. Cells were then incubated for one hour in medium without methionine, and for one hour under conditions in which [ ³⁵ S] methionine (50 μ Ci / ml) was added. Radioactive methionine was removed with fresh medium, followed by incubation with TNF-α treatment. TRAF2 was immunoprecipitated and separated by 12% SDS-PAGE and confirmed by radiograph using BAS (FLA-3000, FujiFilm). TRAF2 was quantified using the Multi-gauge program (V3.0, FujiFilm). As a result, when wild-type AIMP2 was introduced into the cells and treated with TNF-α, the radioactive TRAF2 decreased more rapidly than the AIMP2 variant (AIMP2-DX2) lacking an empty vector or exon 2 (FIG. 4C). We also measured the phosphorylation of GST-IkB-α in the same manner as above to observe the level change of TRAF2. Phosphorylation of IkB was reduced with the introduction of exogenous wild type AIMP2 and increased by the variant lacking exon 2 (AIMP2-DX2) (FIG. 4D left). Transcript inhibition experiments with siRNA specific for each of the wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) showed opposite results to the phosphorylation of IkB-α (Fig. 4D right), consistent with the above results. Showed results.

<Example 6>

Significance of TRAF2 in AIMP2 Activity and Role of AIMP2 Variants Lacking Wild-type AIMP2 and Exon 2 in Localization of TRAF2 (AIMP2-DX2)

To determine whether TRAF2 is essential for the apoptosis hyperactivity of AIMP2, we compared the effect of AIMP2 on TNF-α induced cell death in TRAF2 + / + and TRAF2-/-mouse fibroblasts. TNF-α-induced cell death was subsequently promoted by introducing wild type AIMP2, but not the variant lacking exon 2 (AIMP2-DX2) in normal cells (Figure 5A left). The effect of AIMP2 on cell death in TRAF2-/-cells was not observed even in cell death by TNF-α. However, TRAF2-/-cells incorporating TRAF2 reduced cell death by TNF-α and partially restored the degree of cell death by the influx of additional AIMP2 (Figure 5A right). All these results indicate that TRAF2 is important for apoptosis hyperactivity of AIMP2 in the TNF-α signal mechanism.

Knowing that TRAF2 regulation by AIMP2 is crucial for TNF-α-induced cell death, we examined how AIMP2 regulates intracellular TRAF2 levels. Knowing that TRAF2 levels are regulated by its localization and showing that AIMP2 can reduce the level of TRAF2 through prothiasomes, it was checked whether AIMP2 mediated the localization of TRAF2 (FIG. 4A). In order to confirm AIMP2-dependent TRAF2 localization, HA-labeled ubiquitin was introduced into human embryonic kidney cell line 293 cells along with wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) and cultured for 24 hours. Cells were then treated with MG-132 (40 μM) for 4 hours to inhibit prothiasome activity and immunoprecipitated with anti-TRAF2 antibody (C-20, Santa Cruz). The precipitate was subjected to immunoblot with anti-HA antibody. In addition, Flag-labeled K48R or K63R variant ubiquitin was introduced and the binding of these to TRAF2 was examined by binding to anti-Rlag antibody (Santa Cruz). After blocking proteasome activity with their inhibitor MG132, it was introduced with Hark labeled ubiquitin to introduce wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2), and antibody precipitation using TRAF2 and antibodies thereof. The method was performed and localization was observed by immunoblot with anti-HA antibody. Although ubiquitous TRAF2 increased with the amount of wild-type AIMP2 introduced, its splicing variant (AIMP2-DX2) showed a slight and retrograde result in ubiquity of TRAF2 (FIG. 5B).

Ubiquitin can bind to different lysine product positions of the target protein and the products of localization vary depending on the binding position. For example, K48 and K63 are known to be involved in 26S proteasome mediated degradation and the activity of TNFα signals. To determine if the lysine product is used for AIMP2-dependent localization of TRAF2, we present an AIMP2 variant (AIMP2-DX2) lacking wild-type AIMP2 and exon 2 in cells with ubiquitin flagged and mutated K48R or K63R positions. Introduced. Cells were treated with MG132, immunoprecipitation with TRAF2 and its antibodies, and localization of TRAF2 was observed by Western blot using anti-Flas antibody. The introduction of wild type AIMP2 reduced ubiquitin mutated K48R position, but not ubiquitin mutated K63R position (FIG. 5C left and right). This means that AIMP2 mediates to associate with K48 rather than K63. In contrast, variants lacking exon 3 showed little or no opposite effects compared to wild type. Since localization at K48 is associated with degradation of target proteins, these results also support that AIMP2 reduces TRAF2 through TNF-α dependent localization.

<Example 7>

IMP1 and TRAF2 binding promoter confirmation test of AIMP2

Although the above results suggest that AIMP2 promotes the localization of TRAF2, it is not known how ubiquitin is transferred. AIMP2 by itself did not show the E1, E2 and E3 enzymatic activities, which are critical factors in the ubiquitin binding system. The inventors then checked whether AIMP2 promotes binding of E3 ubiquitin ligase to its target protein, modeling c-IAP1, E3 ubiquitin ligase, which is known to mediate the localization and degradation of TRAF2. As a first step, we examined the importance of c-IAP1 in the downflow regulation of AIMP2-dependent TRAF2. siRNA technology was used to investigate the expression of AIMP2 variants (AIMP2-DX2) that inhibited the expression of c-IAP1 and lacked wild-type AIMP2 and exon 2 and affected intracellular TRAF2 levels. TRAF2 was decreased in control cells in which only wild-type AIMP2 was introduced and increased by subsequent TNF-α treatment (FIG. 6A left). However, when the expression of c-IAP1 was inhibited by siRNA, the effect of AIMP2 on TRAF2 was not observed (right side of FIG. 6A), which supports the involvement of c-IAP1 in downflow regulation of AIMP2-dependent TRAF2. We then investigated whether AIMP2 promotes the binding of c-IAP1 and TRAF2. Flag-labeled c-IAP1 was introduced into 293 cells with wild type Myc-AIMP2 or variants lacking exon 2 (AIMP2-DX2). TRAF2 was then immunoprecipitated with an antibody specific to it, and antibody precipitation was performed with AIMP2 protein to identify it as an antibody specific for the target protein of c-IAP1.

The amount of c-IAP1 by this method was increased by wild type AIMP2 but not by variants lacking exon 2 (AIMP2-DX2) (FIG. 6B). This suggests a positive role of wild type AIMP2 in the binding of c-IAP1 and TRAF2.

Since wild-type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) bind with similar affinity to TRAF2, we identified whether they bind c-IAP1. Flag labeled IAP1 was introduced into 293 cells with wild type Myc-AIMP2 or exon 2 lacking variant (AIMP2-DX2), immunoprecipitated with anti-Flag antibody, and then AIMP2 variant lacking wild type AIMP2 and exon 2 (AIMP2-DX2) was confirmed by Western blot using anti-Myc antibody. Both proteins were expressed at similar levels, but only wild type AIMP2 reacted with c-IAP1 (FIG. 6C). This suggests that the variant lacking exon 2 (AIMP2-DX2) lost its ability to bind c-IAP1. This possibility was again confirmed by an in vitro pull-down assay.

First, wild type AIMP2 and AIMP2 variants lacking exon 2 (AIMP2-DX2) were artificially synthesized in the presence of [ ³⁵ S] methionine and mixed with G- or GST-labeled c-IAP1. GST protein was dropped into glutathione-sepharose beads and bound proteins were confirmed by radiograph. Wild type AIMP2 precipitated with GST labeled IAP1, but not variants (AIMP2-DX2) (FIG. 6D). Conversely, c-IAP1 was artificially synthesized in the presence of [ ³⁵ S] methionine and mixed with GST or GST-labeled wild type AIMP2 or AIMP2 variant lacking exon 2 (AIMP2-DX2). GST protein was dropped into glutathione-sepharose beads and bound proteins were confirmed by radiograph.

As above results, c-IAP1 was only detected in precipitation coupled with GST labeled wild type AIMP2, but not variants (AIMP2-DX2) (FIG. 6E). Both of these results demonstrate that the variant lacking exon 2 (AIMP2-DX2) does not mediate c-IA1 to TRAF2 due to lack of binding to c-IAP1.

<Example 8>

Identification of the effect of AIMP2-DX2 on Cox-2 expression

Based on the mechanism of action of AIMP2 / p38 and AIMP2-DX2 as described above, the effects of the expression of AIMP2-DX2 on the expression of Cox-2, an inflammatory marker, were examined. To this end, A549 cells were cultured in 35 mm Petri dishes, and si-control (si-cont), si-AIMP2-F (Si-F) or si-AIMP2-DX2 (si-DX2) (human; all Invitrogen) 10 μl was mixed with 5 μl of Lipofectamine 2000 and treated with cells. After 48 hours, only one side of each treatment group was treated with TNF-a (20ng / ml) and further incubated for 6 hours. Then, the cells were collected, lysed cells using PBS containing 1% NP-40 and 0.5% deoxycholate to prepare a sample, followed by SDS-PAGE. To this end, Western blots were performed using antibodies against Cox-2, AIMP2-F, and AIMP2-DX2.

As a result, as shown in FIG. 7, there was no expression of Cox-2 in the absence of treatment with TNF-α. It can be seen that the expression of -2 is induced. However, in the group treated with si-DX2, even if the TNF-α signal, it was confirmed that the expression of Cox-2 does not occur. Thus, it was found that inhibitors of AIMP2-DX2 inhibited the inflammatory response.

In addition, SEQ ID NO: 8 (lane 1 of Si-DX2 in FIG. 8), SEQ ID NO: 17 (lane 2 of Si-DX2 in FIG. 8), SEQ ID NO: 20 (lane 3 of Si-DX2 in FIG. 8), SEQ ID NO: 21 (Lane 4 of Si-DX2 of FIG. 8), SEQ ID NO: 24 (lane 5 of Si-DX2 of FIG. 8), SEQ ID NO: 23 (lane 6 of Si-DX2 of FIG. 8), SEQ ID NO: 106 (Si of FIG. 8 As a result of the method described above using the siRNA of -DX2 lane 7) and SEQ ID NO: 105 (lane 8 of Si-DX2 of FIG. 8), as shown in FIG. , Inhibiting the expression of AIMP2-DX2, and as a result it was found that inhibiting the expression of Cox-2. At this time, lanes 2 to 4 also treated the antisense sequence of the sequence at the same time.

In the present invention, AIMP2 / p38 promotes ubiquitination of TRAF2 to regulate TNF-α-induced cell death, and AIMP2-DX2, a splicing variant of AIMP2 / p38, acts as a competitive inhibitor to AIMP2, Inhibition of cell death by TNF-α by inhibiting ubiquitin has been shown to inhibit tumor expression and Cox-2, an inflammatory marker. Thus, AIMP2-DX2 inhibitors can be used for the purpose of preventing and treating inflammatory diseases.

Figure 1 shows tissue specific expression of AIMP2-DX2 deleted exon 2.

Figure 2 shows the antagonostic effect of AIMP2 and AIMP2-DX2 on cell death induced by TNF-α.

3 shows AIMP2 and AIMP2-DX2 and TRAF2 competitively binding.

4 shows that AIMP2 downregulates TRAF2.

5 shows that AIMP2 mediates the ubiquitin of TRAF2.

Figure 6 shows that AIMP2 promotes the binding of c-IAP1 and TRAF2.

Figure 7 shows that inhibition of AIMP2-DX2 inhibits the inflammatory response induced by TNF-α.

8 shows that siRNAs against various AIMP2-DX2 inhibit inflammatory responses induced by TNF-α.

<110> Seoul National University Industry Foundation          Neomics Co. LTD <120> Composition for preventing and treating inflammatory diseases          comprising inhibitor of AIMP2-DX2 as an active ingredient <130> NP08-0129 <150> KR10-2007-0114520 <151> 2007-11-09 <160> 147 <170> KopatentIn 1.71 <210> 1 <211> 935 <212> DNA <213> Homo sapiens <400> 1 tgccgatgta ccaggtaaag ccctatcacg ggggcggcgc gcctctccgt gtggagcttc 60 ccacctgcat gtaccggctc cccaacgtgc acggcaggag ctacggccca gcgccgggcg 120 ctggccacgt gcaggaagag tctaacctgt ctctgcaagc tcttgagtcc cgccaagatg 180 atattttaaa acgtctgtat gagttgaaag ctgcagttga tggcctctcc aagatgattc 240 aaacaccaga tgcagacttg gatgtaacca acataatcca agcggatgag cccacgactt 300 taaccaccaa tgcgctggac ttgaattcag tgcttgggaa ggattacggg gcgctgaaag 360 acatcgtgat caacgcaaac ccggcctccc ctcccctctc cctgcttgtg ctgcacaggc 420 tgctctgtga gcacttcagg gtcctgtcca cggtgcacac gcactcctcg gtcaagagcg 480 tgcctgaaaa ccttctcaag tgctttggag aacagaataa aaaacagccc cgccaagact 540 atcagctggg attcacttta atttggaaga atgtgccgaa gacgcagatg aaattcagca 600 tccagacgat gtgccccatc gaaggcgaag ggaacattgc acgtttcttg ttctctctgt 660 ttggccagaa gcataatgct gtcaacgcaa cccttataga tagctgggta gatattgcga 720 tttttcagtt aaaagaggga agcagtaaag aaaaagccgc tgttttccgc tccatgaact 780 ctgctcttgg gaagagccct tggctcgctg ggaatgaact caccgtagca gacgtggtgc 840 tgtggtctgt actccagcag atcggaggct gcagtgtgac agtgccagcc aatgtgcaga 900 ggtggatgag gtcttgtgaa aacctggctc ctttt 935 <210> 2 <211> 312 <212> PRT <213> Homo sapiens <400> 2 Met Pro Met Tyr Gln Val Lys Pro Tyr His Gly Gly Gly Ala Pro Leu   1 5 10 15 Arg Val Glu Leu Pro Thr Cys Met Tyr Arg Leu Pro Asn Val His Gly              20 25 30 Arg Ser Tyr Gly Pro Ala Pro Gly Ala Gly His Val Gln Glu Glu Ser          35 40 45 Asn Leu Ser Leu Gln Ala Leu Glu Ser Arg Gln Asp Asp Ile Leu Lys      50 55 60 Arg Leu Tyr Glu Leu Lys Ala Ala Val Asp Gly Leu Ser Lys Met Ile  65 70 75 80 Gln Thr Pro Asp Ala Asp Leu Asp Val Thr Asn Ile Ile Gln Ala Asp                  85 90 95 Glu Pro Thr Thr Leu Thr Thr Asn Ala Leu Asp Leu Asn Ser Val Leu             100 105 110 Gly Lys Asp Tyr Gly Ala Leu Lys Asp Ile Val Ile Asn Ala Asn Pro         115 120 125 Ala Ser Pro Pro Leu Ser Leu Leu Val Leu His Arg Leu Leu Cys Glu     130 135 140 His Phe Arg Val Leu Ser Thr Val His Thr His Ser Ser Val Lys Ser 145 150 155 160 Val Pro Glu Asn Leu Leu Lys Cys Phe Gly Glu Gln Asn Lys Lys Gln                 165 170 175 Pro Arg Gln Asp Tyr Gln Leu Gly Phe Thr Leu Ile Trp Lys Asn Val             180 185 190 Pro Lys Thr Gln Met Lys Phe Ser Ile Gln Thr Met Cys Pro Ile Glu         195 200 205 Gly Glu Gly Asn Ile Ala Arg Phe Leu Phe Ser Leu Phe Gly Gln Lys     210 215 220 His Asn Ala Val Asn Ala Thr Leu Ile Asp Ser Trp Val Asp Ile Ala 225 230 235 240 Ile Phe Gln Leu Lys Glu Gly Ser Ser Lys Glu Lys Ala Ala Val Phe                 245 250 255 Arg Ser Met Asn Ser Ala Leu Gly Lys Ser Pro Trp Leu Ala Gly Asn             260 265 270 Glu Leu Thr Val Ala Asp Val Val Leu Trp Ser Val Leu Gln Gln Ile         275 280 285 Gly Gly Cys Ser Val Thr Val Pro Ala Asn Val Gln Arg Trp Met Arg     290 295 300 Ser Cys Glu Asn Leu Ala Pro Phe 305 310 <210> 3 <211> 756 <212> DNA <213> Homo sapiens <400> 3 atgccgatgt accaggtaaa gccctatcac gggggcggcg cgcctctccg tgtggagctt 60 cccacctgca tgtaccggct ccccaacgtg cacggcagga gctacggccc agcgccgggc 120 gctggccacg tgcaggatta cggggcgctg aaagacatcg tgatcaacgc aaacccggcc 180 tcccctcccc tctccctgct tgtgctgcac aggctgctct gtgagcactt cagggtcctg 240 tccacggtgc acacgcactc ctcggtcaag agcgtgcctg aaaaccttct caagtgcttt 300 ggagaacaga ataaaaaaca gccccgccaa gactatcagc tgggattcac tttaatttgg 360 aagaatgtgc cgaagacgca gatgaaattc agcatccaga cgatgtgccc catcgaaggc 420 gaagggaaca ttgcacgttt cttgttctct ctgtttggcc agaagcataa tgctgtcaac 480 gcaaccctta tagatagctg ggtagatatt gcgatttttc agttaaaaga gggaagcagt 540 aaagaaaaag ccgctgtttt ccgctccatg aactctgctc ttgggaagag cccttggctc 600 gctgggaatg aactcaccgt agcagacgtg gtgctgtggt ctgtactcca gcagatcgga 660 ggctgcagtg tgacagtgcc agccaatgtg cagaggtgga tgaggtcttg tgaaaacctg 720 gctcctttta acacggccct caagctcctt aagtga 756 <210> 4 <211> 251 <212> PRT <213> Homo sapiens <400> 4 Met Pro Met Tyr Gln Val Lys Pro Tyr His Gly Gly Gly Ala Pro Leu   1 5 10 15 Arg Val Glu Leu Pro Thr Cys Met Tyr Arg Leu Pro Asn Val His Gly              20 25 30 Arg Ser Tyr Gly Pro Ala Pro Gly Ala Gly His Val Gln Asp Tyr Gly          35 40 45 Ala Leu Lys Asp Ile Val Ile Asn Ala Asn Pro Ala Ser Pro Pro Leu      50 55 60 Ser Leu Leu Val Leu His Arg Leu Leu Cys Glu His Phe Arg Val Leu  65 70 75 80 Ser Thr Val His Thr His Ser Ser Val Lys Ser Val Pro Glu Asn Leu                  85 90 95 Leu Lys Cys Phe Gly Glu Gln Asn Lys Lys Gln Pro Arg Gln Asp Tyr             100 105 110 Gln Leu Gly Phe Thr Leu Ile Trp Lys Asn Val Pro Lys Thr Gln Met         115 120 125 Lys Phe Ser Ile Gln Thr Met Cys Pro Ile Glu Gly Glu Gly Asn Ile     130 135 140 Ala Arg Phe Leu Phe Ser Leu Phe Gly Gln Lys His Asn Ala Val Asn 145 150 155 160 Ala Thr Leu Ile Asp Ser Trp Val Asp Ile Ala Ile Phe Gln Leu Lys                 165 170 175 Glu Gly Ser Ser Lys Glu Lys Ala Ala Val Phe Arg Ser Met Asn Ser             180 185 190 Ala Leu Gly Lys Ser Pro Trp Leu Ala Gly Asn Glu Leu Thr Val Ala         195 200 205 Asp Val Val Leu Trp Ser Val Leu Gln Gln Ile Gly Gly Cys Ser Val     210 215 220 Thr Val Pro Ala Asn Val Gln Arg Trp Met Arg Ser Cys Glu Asn Leu 225 230 235 240 Ala Pro Phe Asn Thr Ala Leu Lys Leu Leu Lys                 245 250 <210> 5 <211> 1236 <212> DNA <213> Homo sapiens <400> 5 ccgaacgccc gcagcagggt cagaagggag gtggccggtc tccgtcgtga cctctgacgg 60 tttctgagcg ttggcctttg gcacgcgcta cccccttttg ctttggttct gccatgccga 120 tgtaccaggt aaagccctat cacgggggcg gcgcgcctct ccgtgtggag cttcccacct 180 gcatgtaccg gctccccaac gtgcacggca ggagctacgg cccagcgccg ggcgctggcc 240 acgtgcagga agagtctaac ctgtctctgc aagctcttga gtcccgccaa gatgatattt 300 taaaacgtct gtatgagttg aaagctgcag ttgatggcct ctccaagatg attcaaacac 360 cagatgcaga cttggatgta accaacataa tccaagcgga tgagcccacg actttaacca 420 ccaatgcgct ggacttgaat tcagtgcttg ggaaggatta cggggcgctg aaagacatcg 480 tgatcaacgc aaacccggcc tcccctcccc tctccctgct tgtgctgcac aggctgctct 540 gtgagcactt cagggtcctg tccacggtgc acacgcactc ctcggtcaag agcgtgcctg 600 aaaaccttct caagtgcttt ggagaacaga ataaaaaaca gccccgccaa gactatcagc 660 tgggattcac tttaatttgg aagaatgtgc cgaagacgca gatgaaattc agcatccaga 720 cgatgtgccc catcgaaggc gaagggaaca ttgcacgttt cttgttctct ctgtttggcc 780 agaagcataa tgctgtcaac gcaaccctta tagatagctg ggtagatatt gcgatttttc 840 agttaaaaga gggaagcagt aaagaaaaag ccgctgtttt ccgctccatg aactctgctc 900 ttgggaagag cccttggctc gctgggaatg aactcaccgt agcagacgtg gtgctgtggt 960 ctgtactcca gcagatcgga ggctgcagtg tgacagtgcc agccaatgtg cagaggtgga 1020 tgaggtcttg tgaaaacctg gctcctttta acacggccct caagctcctt aagtgaattg 1080 ccgtaactga ttttaaaggg tttagatttt aagaatggtg ctctttcatg cctattatca 1140 gtaaggggac ttgtattaga gtcagagtct ttttatttag gccagttgtc aagtgtcaat 1200 aaaagcatca tgtaatttaa aaaaaaaaaa aaaaaa 1236 <210> 6 <211> 320 <212> PRT <213> Homo sapiens <400> 6 Met Pro Met Tyr Gln Val Lys Pro Tyr His Gly Gly Gly Ala Pro Leu   1 5 10 15 Arg Val Glu Leu Pro Thr Cys Met Tyr Arg Leu Pro Asn Val His Gly              20 25 30 Arg Ser Tyr Gly Pro Ala Pro Gly Ala Gly His Val Gln Glu Glu Ser          35 40 45 Asn Leu Ser Leu Gln Ala Leu Glu Ser Arg Gln Asp Asp Ile Leu Lys      50 55 60 Arg Leu Tyr Glu Leu Lys Ala Ala Val Asp Gly Leu Ser Lys Met Ile  65 70 75 80 Gln Thr Pro Asp Ala Asp Leu Asp Val Thr Asn Ile Ile Gln Ala Asp                  85 90 95 Glu Pro Thr Thr Leu Thr Thr Asn Ala Leu Asp Leu Asn Ser Val Leu             100 105 110 Gly Lys Asp Tyr Gly Ala Leu Lys Asp Ile Val Ile Asn Ala Asn Pro         115 120 125 Ala Ser Pro Pro Leu Ser Leu Leu Val Leu His Arg Leu Leu Cys Glu     130 135 140 His Phe Arg Val Leu Ser Thr Val His Thr His Ser Ser Val Lys Ser 145 150 155 160 Val Pro Glu Asn Leu Leu Lys Cys Phe Gly Glu Gln Asn Lys Lys Gln                 165 170 175 Pro Arg Gln Asp Tyr Gln Leu Gly Phe Thr Leu Ile Trp Lys Asn Val             180 185 190 Pro Lys Thr Gln Met Lys Phe Ser Ile Gln Thr Met Cys Pro Ile Glu         195 200 205 Gly Glu Gly Asn Ile Ala Arg Phe Leu Phe Ser Leu Phe Gly Gln Lys     210 215 220 His Asn Ala Val Asn Ala Thr Leu Ile Asp Ser Trp Val Asp Ile Ala 225 230 235 240 Ile Phe Gln Leu Lys Glu Gly Ser Ser Lys Glu Lys Ala Ala Val Phe                 245 250 255 Arg Ser Met Asn Ser Ala Leu Gly Lys Ser Pro Trp Leu Ala Gly Asn             260 265 270 Glu Leu Thr Val Ala Asp Val Val Leu Trp Ser Val Leu Gln Gln Ile         275 280 285 Gly Gly Cys Ser Val Thr Val Pro Ala Asn Val Gln Arg Trp Met Arg     290 295 300 Ser Cys Glu Asn Leu Ala Pro Phe Asn Thr Ala Leu Lys Leu Leu Lys 305 310 315 320 <210> 7 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> siRNA for AIMP2 <400> 7 agagcuugca gagacagguu agacu 25 <210> 8 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> siRNA for AIMP2-DX2 <400> 8 ucagcgcccc guaauccugc acgug 25 <210> 9 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> si-AIMP2-DX2 # 3 coding nucleic acid sequence 1 <400> 9 tcgaggccac gtgcaggtta cgggagtagg ccgtaatcct gcacgtggcc tttt 54 <210> 10 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> si-AIMP2-DX2 # 3 coding nucleic acid sequence 2 <400> 10 ctagaaaagg ccacgtgcag gattacggca gactcccgta atcctgcacg tggcc 55 <210> 11 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> si-AIMP2-DX2 # 4 coding nucleic acid sequence 1 <400> 11 tcgagctggc cacgtgcagg attacgagta ctggtaatcc tgcacgtggc cagctttt 58 <210> 12 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> si-AIMP2-DX2 # 4 coding nucleic acid sequence 2 <400> 12 ctagaaaagc tggccacgtg caggattacc agtactcgta atcctgcacg tggccagc 58 <210> 13 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> si-AIMP2-DX2 # 5 coding nucleic acid sequence 1 <400> 13 tcgacacgtg caggattacg gggcgagtac tggccccgta atcctgcacg tgtttt 56 <210> 14 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> si-AIMP2-DX2 # 5 coding nucleic acid sequence 2 <400> 14 ctagaaaaca cgtgcaggat tacggggcca gtactcgccc cgtaatcctg cacgtg 56 <210> 15 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> siRNA of AIMP2-F <400> 15 agucuaaccu gucucugcaa gcucu 25 <210> 16 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA sequence of AIMP2-DX2 <400> 16 tcgagctggc cacgtgcagg attacgagta ctggtaatcc tgcacgtggc cagctttt 58 <210> 17 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> AIMP2-DX2 siRNA 19mer # 1 <400> 17 cuggccacgu gcaggauua 19 <210> 18 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> AIMP2-DX2 siRNA of 19mer # 2 <400> 18 uggccacgug caggauuac 19 <210> 19 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> AIMP2-DX2 siRNA of 19mer # 3 <400> 19 ggccacgugc aggauuacg 19 <210> 20 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> 19mer of AIMP2-DX2 siRNA # 4 <400> 20 gccacgugca ggauuacgg 19 <210> 21 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> 19mer of AIMP2-DX2 siRNA # 5 <400> 21 ccacgugcag gauuacggg 19 <210> 22 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> 19mer of AIMP2-DX2 siRNA # 6 <400> 22 cacgugcagg auuacgggg 19 <210> 23 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> 19mer of AIMP2-DX2 siRNA # 7 <400> 23 acgugcagga uuacggggc 19 <210> 24 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> 19mer of AIMP2-DX2 siRNA # 8 <400> 24 cgugcaggau uacggggcg 19 <210> 25 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> 19mer of AIMP2-DX2 siRNA # 9 <400> 25 gugcaggauu acggggcgc 19 <210> 26 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> 19mer of AIMP2-DX2 siRNA # 10 <400> 26 ugcaggauua cggggcgcu 19 <210> 27 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 1 <400> 27 gcuggccacg ugcaggauua 20 <210> 28 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 2 <400> 28 cuggccacgu gcaggauuac 20 <210> 29 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 3 <400> 29 uggccacgug caggauuacg 20 <210> 30 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 4 <400> 30 ggccacgugc aggauuacgg 20 <210> 31 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 5 <400> 31 gccacgugca ggauuacggg 20 <210> 32 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 6 <400> 32 ccacgugcag gauuacgggg 20 <210> 33 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 7 <400> 33 cacgugcagg auuacggggc 20 <210> 34 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 8 <400> 34 acgugcagga uuacggggcg 20 <210> 35 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 9 <400> 35 cgugcaggau uacggggcgc 20 <210> 36 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 10 <400> 36 gugcaggauu acggggcgcu 20 <210> 37 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> 20mer of AIMP2-DX2 siRNA # 11 <400> 37 ugcaggauua cggggcgcug 20 <210> 38 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 1 <400> 38 cgcuggccac gugcaggauu a 21 <210> 39 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 2 <400> 39 gcuggccacg ugcaggauua c 21 <210> 40 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 3 <400> 40 cuggccacgu gcaggauuac g 21 <210> 41 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 4 <400> 41 uggccacgug caggauuacg g 21 <210> 42 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 5 <400> 42 ggccacgugc aggauuacgg g 21 <210> 43 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 6 <400> 43 gccacgugca ggauuacggg g 21 <210> 44 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 7 <400> 44 ccacgugcag gauuacgggg c 21 <210> 45 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 8 <400> 45 cacgugcagg auuacggggc g 21 <210> 46 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 9 <400> 46 acgugcagga uuacggggcg c 21 <210> 47 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 10 <400> 47 cgugcaggau uacggggcgc u 21 <210> 48 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 11 <400> 48 gugcaggauu acggggcgcu g 21 <210> 49 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> 21mer of AIMP2-DX2 siRNA # 12 <400> 49 ugcaggauua cggggcgcug a 21 <210> 50 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 1 <400> 50 gcgcuggcca cgugcaggau ua 22 <210> 51 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 2 <400> 51 cgcuggccac gugcaggauu ac 22 <210> 52 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 3 <400> 52 gcuggccacg ugcaggauua cg 22 <210> 53 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 4 <400> 53 cuggccacgu gcaggauuac gg 22 <210> 54 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 5 <400> 54 uggccacgug caggauuacg gg 22 <210> 55 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 6 <400> 55 ggccacgugc aggauuacgg gg 22 <210> 56 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 7 <400> 56 gccacgugca ggauuacggg gc 22 <210> 57 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 8 <400> 57 ccacgugcag gauuacgggg cg 22 <210> 58 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 9 <400> 58 cacgugcagg auuacggggc gc 22 <210> 59 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 10 <400> 59 acgugcagga uuacggggcg cu 22 <210> 60 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 10 <400> 60 acgugcagga uuacggggcg cu 22 <210> 61 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 11 <400> 61 cgugcaggau uacggggcgc ug 22 <210> 62 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 12 <400> 62 gugcaggauu acggggcgcu ga 22 <210> 63 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 22mer of AIMP2-DX2 siRNA # 13 <400> 63 ugcaggauua cggggcgcug aa 22 <210> 64 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 1 <400> 64 ggcgcuggcc acgugcagga uua 23 <210> 65 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 2 <400> 65 gcgcuggcca cgugcaggau uac 23 <210> 66 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 3 <400> 66 cgcuggccac gugcaggauu acg 23 <210> 67 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 4 <400> 67 gcuggccacg ugcaggauua cgg 23 <210> 68 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 5 <400> 68 cuggccacgu gcaggauuac ggg 23 <210> 69 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 6 <400> 69 uggccacgug caggauuacg ggg 23 <210> 70 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 7 <400> 70 ggccacgugc aggauuacgg ggc 23 <210> 71 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 8 <400> 71 gccacgugca ggauuacggg gcg 23 <210> 72 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 9 <400> 72 ccacgugcag gauuacgggg cgc 23 <210> 73 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 10 <400> 73 cacgugcagg auuacggggc gcu 23 <210> 74 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 11 <400> 74 acgugcagga uuacggggcg cug 23 <210> 75 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 12 <400> 75 cgugcaggau uacggggcgc uga 23 <210> 76 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 13 <400> 76 gugcaggauu acggggcgcu gaa 23 <210> 77 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> 23mer of AIMP2-DX2 siRNA # 14 <400> 77 ugcaggauua cggggcgcug aaa 23 <210> 78 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 1 <400> 78 gggcgcuggc cacgugcagg auua 24 <210> 79 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 2 <400> 79 ggcgcuggcc acgugcagga uuac 24 <210> 80 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 3 <400> 80 gcgcuggcca cgugcaggau uacg 24 <210> 81 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 4 <400> 81 cgcuggccac gugcaggauu acgg 24 <210> 82 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 5 <400> 82 gcuggccacg ugcaggauua cggg 24 <210> 83 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 6 <400> 83 cuggccacgu gcaggauuac gggg 24 <210> 84 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 7 <400> 84 uggccacgug caggauuacg gggc 24 <210> 85 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 8 <400> 85 ggccacgugc aggauuacgg ggcg 24 <210> 86 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 9 <400> 86 gccacgugca ggauuacggg gcgc 24 <210> 87 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 10 <400> 87 ccacgugcag gauuacgggg cgcu 24 <210> 88 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 11 <400> 88 cacgugcagg auuacggggc gcug 24 <210> 89 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 12 <400> 89 acgugcagga uuacggggcg cuga 24 <210> 90 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 13 <400> 90 cgugcaggau uacggggcgc ugaa 24 <210> 91 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 14 <400> 91 gugcaggauu acggggcgcu gaaa 24 <210> 92 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> 24mer of AIMP2-DX2 siRNA # 15 <400> 92 ugcaggauua cggggcgcug aaag 24 <210> 93 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 1 <400> 93 cgggcgcugg ccacgugcag gauua 25 <210> 94 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 2 <400> 94 gggcgcuggc cacgugcagg auuac 25 <210> 95 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 3 <400> 95 ggcgcuggcc acgugcagga uuacg 25 <210> 96 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 4 <400> 96 gcgcuggcca cgugcaggau uacgg 25 <210> 97 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 5 <400> 97 cgcuggccac gugcaggauu acggg 25 <210> 98 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 6 <400> 98 gcuggccacg ugcaggauua cgggg 25 <210> 99 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 7 <400> 99 cuggccacgu gcaggauuac ggggc 25 <210> 100 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 8 <400> 100 uggccacgug caggauuacg gggcg 25 <210> 101 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 9 <400> 101 ggccacgugc aggauuacgg ggcgc 25 <210> 102 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 10 <400> 102 gccacgugca ggauuacggg gcgcu 25 <210> 103 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 11 <400> 103 ccacgugcag gauuacgggg cgcug 25 <210> 104 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 12 <400> 104 cacgugcagg auuacggggc gcuga 25 <210> 105 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 13 <400> 105 acgugcagga uuacggggcg cugaa 25 <210> 106 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 14 <400> 106 cgugcaggau uacggggcgc ugaaa 25 <210> 107 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 15 <400> 107 gugcaggauu acggggcgcu gaaag 25 <210> 108 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> 25mer of AIMP2-DX2 siRNA # 16 <400> 108 ugcaggauua cggggcgcug aaaga 25 <210> 109 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 1 <400> 109 ccgggcgcug gccacgugca ggauua 26 <210> 110 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 2 <400> 110 cgggcgcugg ccacgugcag gauuac 26 <210> 111 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 3 <400> 111 gggcgcuggc cacgugcagg auuacg 26 <210> 112 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 4 <400> 112 ggcgcuggcc acgugcagga uuacgg 26 <210> 113 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 5 <400> 113 gcgcuggcca cgugcaggau uacggg 26 <210> 114 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 6 <400> 114 cgcuggccac gugcaggauu acgggg 26 <210> 115 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 7 <400> 115 gcuggccacg ugcaggauua cggggc 26 <210> 116 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 8 <400> 116 cuggccacgu gcaggauuac ggggcg 26 <210> 117 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 9 <400> 117 uggccacgug caggauuacg gggcgc 26 <210> 118 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 10 <400> 118 ggccacgugc aggauuacgg ggcgcu 26 <210> 119 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 11 <400> 119 gccacgugca ggauuacggg gcgcug 26 <210> 120 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 12 <400> 120 ccacgugcag gauuacgggg cgcuga 26 <210> 121 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 13 <400> 121 cacgugcagg auuacggggc gcugaa 26 <210> 122 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 14 <400> 122 acgugcagga uuacggggcg cugaaa 26 <210> 123 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 15 <400> 123 cgugcaggau uacggggcgc ugaaag 26 <210> 124 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 16 <400> 124 gugcaggauu acggggcgcu gaaaga 26 <210> 125 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> 26mer of AIMP2-DX2 siRNA # 17 <400> 125 ugcaggauua cggggcgcug aaagac 26 <210> 126 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 1 <400> 126 gccgggcgcu ggccacgugc aggauua 27 <210> 127 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 2 <400> 127 ccgggcgcug gccacgugca ggauuac 27 <210> 128 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 3 <400> 128 cgggcgcugg ccacgugcag gauuacg 27 <210> 129 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 4 <400> 129 gggcgcuggc cacgugcagg auuacgg 27 <210> 130 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 5 <400> 130 ggcgcuggcc acgugcagga uuacggg 27 <210> 131 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 6 <400> 131 gcgcuggcca cgugcaggau uacgggg 27 <210> 132 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 7 <400> 132 cgcuggccac gugcaggauu acggggc 27 <210> 133 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 8 <133> 133 gcuggccacg ugcaggauua cggggcg 27 <210> 134 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 9 <400> 134 cuggccacgu gcaggauuac ggggcgc 27 <210> 135 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 10 <400> 135 uggccacgug caggauuacg gggcgcu 27 <210> 136 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 11 <400> 136 ggccacgugc aggauuacgg ggcgcug 27 <210> 137 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 12 <400> 137 gccacgugca ggauuacggg gcgcuga 27 <210> 138 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 13 <400> 138 ccacgugcag gauuacgggg cgcugaa 27 <139> <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 14 <400> 139 cacgugcagg auuacggggc gcugaaa 27 <210> 140 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 15 <400> 140 acgugcagga uuacggggcg cugaaag 27 <210> 141 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 16 <400> 141 cgugcaggau uacggggcgc ugaaaga 27 <210> 142 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 17 <400> 142 gugcaggauu acggggcgcu gaaagac 27 <210> 143 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 27mer of AIMP2-DX2 siRNA # 18 <400> 143 ugcaggauua cggggcgcug aaagaca 27 <210> 144 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> shRNA sequence of mouse AIMP2-DX2 <400> 144 tcgagcgggc cacgtgcagg actattcaag agatagtcct gcacgtggcc cgctttt 57 <210> 145 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> mouse siRNA for AIMP2-DX2 <400> 145 gcgggccacg ugcaggacua uu 22 <210> 146 <211> 729 <212> DNA <213> Homo sapiens <400> 146 atgccgatgt accaggtaaa gccctatcac gggggcggcg cgcctctccg tgtggagctt 60 cccacctgca tgtaccggct ccccaacgtg cacggcagga gctacggccc agcgccgggc 120 gctggccacg tgcaggatta cggggcgctg aaagacatcg tgatcaacgc aaacccggcc 180 tcccctcccc tctccctgct tgtgctgcac aggctgctct gtgagcactt cagggtcctg 240 tccacggtgc acacgcactc ctcggtcaag agcgtgcctg aaaaccttct caagtgcttt 300 ggagaacaga ataaaaaaca gccccgccaa gactatcagc tgggattcac tttaatttgg 360 aagaatgtgc cgaagacgca gatgaaattc agcatccaga cgatgtgccc catcgaaggc 420 gaagggaaca ttgcacgttt cttgttctct ctgtttggcc agaagcataa tgctgtcaac 480 gcaaccctta tagatagctg ggtagatatt gcgatttttc agttaaaaga gggaagcagt 540 aaagaaaaag ccgctgtttt ccgctccatg aactctgctc ttgggaagag cccttggctc 600 gctgggaatg aactcaccgt agcagacgtg gtgctgtggt ctgtactcca gcagatcgga 660 ggctgcagtg tgacagtgcc agccaatgtg cagaggtgga tgaggtcttg tgaaaacctg 720 gctcctttt 729 <210> 147 <211> 243 <212> PRT <213> Homo sapiens <400> 147 Met Pro Met Tyr Gln Val Lys Pro Tyr His Gly Gly Gly Ala Pro Leu   1 5 10 15 Arg Val Glu Leu Pro Thr Cys Met Tyr Arg Leu Pro Asn Val His Gly              20 25 30 Arg Ser Tyr Gly Pro Ala Pro Gly Ala Gly His Val Gln Asp Tyr Gly          35 40 45 Ala Leu Lys Asp Ile Val Ile Asn Ala Asn Pro Ala Ser Pro Pro Leu      50 55 60 Ser Leu Leu Val Leu His Arg Leu Leu Cys Glu His Phe Arg Val Leu  65 70 75 80 Ser Thr Val His Thr His Ser Ser Val Lys Ser Val Pro Glu Asn Leu                  85 90 95 Leu Lys Cys Phe Gly Glu Gln Asn Lys Lys Gln Pro Arg Gln Asp Tyr             100 105 110 Gln Leu Gly Phe Thr Leu Ile Trp Lys Asn Val Pro Lys Thr Gln Met         115 120 125 Lys Phe Ser Ile Gln Thr Met Cys Pro Ile Glu Gly Glu Gly Asn Ile     130 135 140 Ala Arg Phe Leu Phe Ser Leu Phe Gly Gln Lys His Asn Ala Val Asn 145 150 155 160 Ala Thr Leu Ile Asp Ser Trp Val Asp Ile Ala Ile Phe Gln Leu Lys                 165 170 175 Glu Gly Ser Ser Lys Glu Lys Ala Ala Val Phe Arg Ser Met Asn Ser             180 185 190 Ala Leu Gly Lys Ser Pro Trp Leu Ala Gly Asn Glu Leu Thr Val Ala         195 200 205 Asp Val Val Leu Trp Ser Val Leu Gln Gln Ile Gly Gly Cys Ser Val     210 215 220 Thr Val Pro Ala Asn Val Gln Arg Trp Met Arg Ser Cys Glu Asn Leu 225 230 235 240 Ala Pro Phe              

Claims (8)

SEQ ID NO: 8, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 105, and SEQ ID NO: for a polynucleotide encoding an AIMP2 variant (AIMP2-DX2) polypeptide lacking exon 2 Inflammatory disease prevention and treatment composition comprising as an active ingredient an inhibitor of the AIMP2-DX2 polypeptide, iRNA, characterized in that it has a nucleotide sequence represented as selected from the group consisting of 106. The composition of claim 1, wherein the AIMP2-DX2 has an amino acid sequence represented by SEQ ID NO: 4 or SEQ ID NO: 147. delete delete The method of claim 1, wherein the inflammatory disease is an inflammatory skin disease, Crohn's desease, ulcerative colitis, peritonitis, osteomyelitis, cellulitis, meningitis, encephalitis, pancreatitis, traumatic shock, bronchial asthma, allergic rhinitis, cystic Fibrosis, stroke, acute bronchitis, chronic bronchitis, acute bronchiolitis, chronic bronchiolitis, osteoarthritis, gout, spondyloarthropathies, ankylosing spondylitis, lighter syndrome, psoriatic arthrosis, enteropathic spondylitis, juvenile arthrosis, juvenile ankylosing spondylitis, reactivity Arthritis, Infectious Arthritis, Post-Infectious Arthritis, Gonococcal Arthritis, Tuberculosis Arthritis, Viral Arthritis, Fungal Arthritis, Syphilis Arthritis, Lyme Disease, Arthritis Associated with 'Bellitis Syndrome', Nodular Polyarthritis, Irritable Vasculitis, Rugenic Granulation Myopathy, rheumatic polymyalgia, arterial cell arteritis, calcium crystalline arthrosis, pseudogout, non-tubules Rheumatism, bursitis, hay fever, epicondylitis (tennis elbow), neuropathic joints (charco and joint), hemarthrosic, henoch-schorine purpura, hypertrophic osteoarthritis, multiple cardiac reticulocytoma, surcoilosis (surcoilosis), hemochromatosis, sickle cell disease and other hemoglobinopathies, hyperlipoproteinemia, hypomagglobulinemia, familial Mediterranean fever, Behatt's disease, systemic lupus erythematosus, recursive fever, psoriasis, multiple sclerosis, sepsis, septic shock, Multiple organ dysfunction syndrome, acute respiratory distress syndrome, chronic obstructive pulmonary disease, rheumatoid arthritis, acute lung injury and broncho-pulmonary dysplasia Compositions selected from the group consisting of. The method of claim 5, wherein the inflammatory skin disease is skin inflammation, acute and chronic eczema, contact dermatitis, atopic dermatitis, seborrheic dermatitis, chronic simple mammary glands, interrogation, deprived dermatitis, papular urticaria, psoriasis, sun dermatitis and acne Compositions characterized in that selected from the group consisting of. Promoter and a nucleotide sequence represented as selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 105, and SEQ ID NO: 106 operably linked thereto; Inflammatory disease prevention and treatment composition comprising an expression vector comprising a polynucleotide encoding an iRNA for AIMP2-DX2 as an active ingredient. (a) pre-culture of cells expressing AIMP2-DX2 polypeptide with or without a test agent; (b) measuring the expression level of AIMP2-DX2 in the cells pre-cultured with the test agent and comparing the expression level of the cells pre-cultured with the test agent to determine whether the test agent inhibits the expression of AIMP2-DX2. Making; And (c) administering a test agent identified as inhibiting the expression of AIMP2-DX2 in step (b) to an animal having an inflammatory disease and examining whether it has a therapeutic effect. Method of screening drugs.

Images