WO2008065637A1 - Treatment of disease - Google Patents

Treatment of disease Download PDF

Info

Publication number
WO2008065637A1
WO2008065637A1 PCT/IE2007/000118 IE2007000118W WO2008065637A1 WO 2008065637 A1 WO2008065637 A1 WO 2008065637A1 IE 2007000118 W IE2007000118 W IE 2007000118W WO 2008065637 A1 WO2008065637 A1 WO 2008065637A1
Authority
WO
WIPO (PCT)
Prior art keywords
pncl
cells
protein
activity
cell
Prior art date
Application number
PCT/IE2007/000118
Other languages
French (fr)
Other versions
WO2008065637A9 (en
Inventor
Rosemary O'connor
Original Assignee
University College York - National University Of Ireland, Cork
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University College York - National University Of Ireland, Cork filed Critical University College York - National University Of Ireland, Cork
Publication of WO2008065637A1 publication Critical patent/WO2008065637A1/en
Publication of WO2008065637A9 publication Critical patent/WO2008065637A9/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present invention relates to methods of preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual, such as diseases or conditions associated with aberrant mammalian target of rapamycin (iriTOR) activity, or AMP-activated protein kinase (AMPK) activity.
  • a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual, such as diseases or conditions associated with aberrant mammalian target of rapamycin (iriTOR) activity, or AMP-activated protein kinase (AMPK) activity.
  • iriTOR mammalian target of rapamycin
  • AMPK AMP-activated protein kinase
  • IGF Insulin and Insulin-like growth factor
  • IR or IGF-IR insulin or IGF-I receptors
  • Increased IGF-IR expression and activity have been associated with many human cancers, and over-expression of the IGF-IR in murine tumor models promotes an invasive and metastatic phenotype.
  • tumour-suppressor genes or oncogenes in cancers encode proteins that directly affect the ancient and hightly conserved signalling pathway from the IGF-IR via the IRS adapter proteins to the lipid kinase PI3 kinase, the serine threonine kinase Akt, and the serine threonine kinase iriTOR.
  • PI-3 kinase and Akt are both oncogenes, while tumour suppressors that regulate this pathway include the lipid phosphatase PTEN, the tuberous sclerosis complex (TSCl/TSC- 2), the LKBl kinase, and the DNA damage-activated tumour suppressor p53.
  • Akt phosphorylates and inhibits TSC2, which regulates the small GTPase protein Rheb, which in turn activates mTOR.
  • the TSC complex and mTOR are regulated by AMPK.
  • IGF-I signalling and Akt in regulating energy metabolism and glycolysis in tumour cells is receiving renewed attention.
  • Tumour cells have long been recognized to have the ability to metabolize glucose and produce ATP rapidly through enhanced rates of glycolysis. This phenotype associated with increased production of lactic acid was described by Warburg in the 1920s, and it can be detected using positron emission tomography (PET).
  • PET positron emission tomography
  • Enhanced glycolysis is thought to confer cancer cells with a distinct competitive edge over normal cells by providing adequate ATP for rapid proliferation under hypoxic conditions, and has also been proposed to protect cells from oxidative stress.
  • Activated Akt can directly enhances glycolysis by increasing levels of cell surface nutrient transporters for glucose and by regulating the expression and location of mitochondrial hexokinases, which catalyze the first step of glucose metabolism
  • Enhanced glycolysis in cancer cells has generally been associated with decreased oxidative phosphorylation in the mitochondria (Oxphos potential).
  • glycolysis and oxidative phosphorylation are tightly coupled, and glucose metabolism may regulate changes in mitochondrial physiology that occur in tumour cells. This was recently demonstrated by blocking glucose to lactate conversion by shRNA targeting of Lactate dehydrogenase, which resulted in increased oxidative phosphorylation in neu-mammary tumour cells.
  • p53 has also recently been implicated in regulating mitochondrial oxidative phosphorylation by regulating expression of a key component of the cytochrome C oxidase complex, the Synthesis of Cytochrome C oxidase 2 (SCo2) protein. This protein is decreased in cells with mutated p53 which recapitulates the Warburg glycolytic phenotype.
  • IGF-I-and Insulin- mediated activation of the mTOR pathway and its regulation by AMPK and the nutrient or energy status of cells is a central mechanism that is deregulated in diabetes and metabolic disorders associated with insulin resistance.
  • AMPK is activated by a wide variety of metabolic stresses including hypoxia, ischemia, oxidative or hyperosmotic stress, exercise, and glucose deprivation.
  • AMPK Upon activation AMPK triggers catabolic processes that generally lead to the production of ATP, and it promotes energy conservation by switching off anabolic processes that consume ATP.
  • skeletal muscle AMPK stimulates glucose uptake and lipid oxidation.
  • AMPK In adipose tissue AMPK decreases lipolysis and lipogenesis. AMPK also reduces insulin secretion by the pancreas. Altogether the actions of AMPK in these three insulin responsive tissues results in decreasing circulating glucose, reducing plasma lipid, reducing fat accumulation, and enhancing insulin sensitivity.
  • Adipocyte-derived leptin is thought to control appetite through inhibiting AMPK in the hypothalmus .
  • Low levels of AMPK activity are associated with obesity and type II diabetes, and AMPK is the target for the widely prescribed anti-diabetic drug metformin. (AMPK can also be activated by the AMP analogue AICAR in cells) .
  • the actions of exercise in preventing diabetes and high blood pressure are also thought to be mediated through AMPK.
  • IGF-I stimulates short term AMPK activation and over longer time suppresses its activation.
  • Short-term IGF-I- stimulated AMPK activation may be a component of the mTOR signalling pathway via AMPK and proliferator-activator receptor-ID. (PGC-I . D.. that is necessary for mitochondrial biogenesis in response to exercise and other adaptive responses .
  • the present invention is based on the findings that a previously known, but uncharacterised, protein, PNCl, is upregulated in cancer cell lines compared with non- transformed cells, and that suppression of the expression of the protein in cell lines suppresses cell size and cell proliferation, while attenuating IGF-I mediated activation of the mammalian target of rapamycin (mTOR) pathway and increasing in AMP-activated protein kinase activity.
  • mTOR mammalian target of rapamycin
  • the gene encoding human PNCl is located on chromosome 1
  • nucleotide sequence of it' s mouse homolog is provided in SEQUENCE ID NO: 2.
  • amino acid sequence of the human and mouse gene products are provided in SEQUENCE ID NO's: 3 and
  • amino acid sequence of a human isoform of PNCl (Q96CQ1) is provided in SEQUENCE ID NO: 5.
  • a method of preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual in need thereof comprising a step of modulating PNCl protein activity in the individual.
  • the method involves administering to the individual an agent that modulates, ideally attenuates, PNCl activity in the individual .
  • the pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways is one that involves aberrant cell survival, migration, proliferation, invasion, or motility.
  • Diseases or conditions associated with this pathology will be well know to those skilled in the art.
  • the disease or condition is selected from the group comprising: cancer; high blood pressure; hypertension; metabolic disease; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis) ; pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis.
  • the pathology characterised by aberrant cell survival, migration, proliferation, invasion, or motility is selected from the group comprising: cancer; high blood pressure; neurodegenerative disease; and metabolic disease.
  • the pathologies are characterised by either or both of aberrant mTOR activity. and aberrant AMPK activity. The person skilled in the art will be aware of pathologies associated with these characteristics.
  • the pathology is cancer, and in which the individual is treated with an agent capable of attenuating PNCl protein activity in a cancer cell.
  • the cancer is selected from the group comprising: fibrosarcoma; myxosarcoma; liposarcoma; chondrosarcom; osteogenic sarcoma; chordoma; angiosarcoma; endotheliosarcoma; lymphangiosarcoma; lymphangioendotheliosarcoma; synovioma; mesothelioma; Ewing's tumor; leiomyosarcoma; rhabdomyosarcoma; colon carcinoma; pancreatic cancer; breast cancer; ovarian cancer; prostate cancer; squamous cell carcinoma; basal cell carcinoma; adenocarcinoma; sweat gland carcinoma; sebaceous gland carcinoma; papillary carcinoma; papillary adenocarcinomas; cystadenocarcinoma; medullary carcinoma;
  • the cancer is selected from the group comprising: breast; cervical; prostate; and leukemias, and/or their metastases.
  • the pathology is metabolic disease or elevated blood pressure
  • the individual is suitably treated with an agent capable of attenuating cellular PNCl protein activity.
  • the metabolic disease is selected from the group comprising: diabetes (especially type II diabetes) ; metabolic syndrome; and obesity.
  • the invention also relates to a method of inhibiting mTOR function in a biological system comprising the step of treating the biological system with an agent capable of attenuating the PNCl protein activity of the biological system.
  • the invention also relates to a method of assessing mTOR activity in an individual comprising a step of assessing PNCl activity in the individual.
  • the invention also relates to a method of assessing mitochondrial functionin an individual comprising a step of assessing PNCl activity in the individual, wherein the level of PNCl activity is associated with the level of micrchondrial function.
  • the invention also relates to amethod of assessing the cancer status of an individual comrpsing a step of determining the PNCl protein activity in the individual, wherein increased PNCl activity compared to a reference activity for a healthy individual is indicative of presence or risk of cancer.
  • the PNCl activity will be assessed in biological sample obtained from the individual, such as a cell or tissue sample.
  • the invention also relates to a method of increasing AMPK function in a biological system comprising the step of treating the biological system with an agent capable of attenuating the PNCl protein activity of the biological system.
  • biological system should be taken to mean a cell, a cell line, a tissue, an organ, or an organism.
  • RNA interference RNA interference
  • RNA interference is an evolutionally highly conserved process of post- transcriptional gene silencing (PTGS) by which double stranded RNA (known as siRNA molecules), when introduced into a cell, causes sequence-specific degradation of mRNA sequences.
  • PTGS post- transcriptional gene silencing
  • siRNA molecules double stranded RNA
  • the RNAi machinery once it finds a double- stranded RNA molecule, cuts it up, separates the two strands, and then proceeds to destroy RNA molecules that are complementary to one of those segments, or prevent their translation into proteins.
  • suppression of PNCl expression may be achieved by treating an individual with siRNA molecules designed to target PNCl mRNA, preferably a sequence in the PNCl mRNA selected from the group comprising : nucleotides 311-332 (from the start codon) in human gene and nucleotides 304-325 (from the start codon) in the mouse gene (aatttggttggagttgcacca) .
  • the invention relates to a siRNA molecule designed to target PNCl mRNA, suitably a sequence in human PNCl mRNA from nucleotides 311 to 332 after the start codon of PNCl.
  • SEQUENCE ID NO: 6 (aauuugguuggaguugcacca ) provides a siRNA molecule that targets PNCl. Further, the invention relates to a medicament comprising: an oligonucleotide or siRNA molecule of the invention; an siRNA molecule capable of targeting human PNCl mRNA; or an siRNA molecule sold by
  • the medicament is useful in the prevention or treatment of a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual such as, for example, one that involves aberrant cell survival, migration, proliferation, invasion, or motility. Diseases or conditions associated with this pathology will be well know to those skilled in the art.
  • the disease or condition is selected from the group comprising: cancer; high blood pressure; hypertension; metabolic diseases; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis
  • miRNAs are small ( ⁇ 22nt) non-coding RNAs (ncRNAs) that regulate gene expression at the level of translation.
  • ncRNAs non-coding RNAs
  • miRNAs have been found to be critical for development, cell proliferation and cell development, apoptosis and fat metabolism, and cell differentiation.
  • small hairpin RNA (shRNA) molecules are short RNA molecules having a small hairpin loop in their tertiary structure tha may be employed to silence genes.
  • the design of miRNA or shRNA molecules capable of silencing PNCl will be apparent to those skilled in the field of miRNA or shRNA molecule design.
  • the level of PNCl expression can be modulated using antisense or ribozyme approaches to inhibit or prevent translation of PNCl mRNA transcripts or triple helix approaches to inhibit transcription of the PNCl gene.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to PNCl mRNA. The antisense oligonucleotides will bind to the complementary mRNA transcripts and prevent translation.
  • Ribozyme molecules designed to catalytically cleave PNCl mRNA transcripts can also be used to prevent translation and expression of PNCl. (See, e. g. , PCT International PublicationW090/11364 , published October 4,1990 ; Sarver et al. , 1990, Science 247: 1222-1225).
  • the agent inhibits PNCl activity
  • the agent is suitably a pyrimidine nucleotide analogue, examples of which will be well known to those skilled in the art (Holy et al.,(1999) Structure-Antiviral Activity Relationship in the
  • the individual is suitably treated with an agent capable of effecting an increase in PNCl activity, typically in cells of the neuraxis.
  • the agent is PNCl protein, or a biologically active fragment or variant thereof.
  • the PNCl protein is human PNCl protein, ideally recombinant human PNCl protein.
  • the agent is capable of increasing expression of the PNCl gene.
  • the agent for treating neurodegeneration is targeted to the cells of the neuraxis by means of gene therapy, suitably employing a viral delivery vector such as a lentvirus or a adeno- associated virus.
  • neurodegenerataive should be taken to include diseases selected from the group comprising: amyotrophic lateral sclerosis (ALS) , or variants thereof including primary lateral sclerosis and spinal muscular atrophy; prion disease; Huntington's disease; Parkinson's disease; Alzheimer's disease; Multiple sclerosis (MS); hereditary neuropathies; tauopathies; and diseases involving cerebellar degeneration.
  • ALS amyotrophic lateral sclerosis
  • MS Multiple sclerosis
  • tauopathies diseases involving cerebellar degeneration.
  • the invention also relates to the use of an agent capable of modulating PNCl activity as a medicament.
  • the agent is selected from the group comprising: an agent capable of inhibiting PNCl protein; and an agent capable of attenuating PNCl expression.
  • the agent is an siRNA molecule targeted to the PNCl mRNA.
  • the invention also relates to the use of PNCl protein, or a biologically active fragment, variant or isoform thereof, as a medicament.
  • biologically active should be taken to mean that the fragment retains all or part of the biological functionality of the parent protein.
  • the fragment will retain the ability to cause an increase in mitochondrial function or biogenesis, or an increase in cell size, survival, or proliferation of relative to an untreated cell, or to cause an increase in cellular or mitochondrial UTP levels relative to an untreated cell.
  • a “fragment” of the PNCl protein means a contiguous stretch of amino acid residues of at least 5 amino acids, preferably at least 6 amino acids.
  • the "fragment” will comprise at least 10, preferably at least 20, more preferably at least 30, and ideally at least 40 contiguous amino acids.
  • a "variant" of the PNCl protein shall be taken to mean proteins having amino acid sequences which are substantially identical to wild-type PNCl protein, especially human wild- type PNCl.
  • the term should be taken to include proteins or polypeptides that are altered in respect of one or more amino acid residues.
  • such alterations involve the insertion, addition, deletion and/or substitution of 5 or fewer amino acids, more preferably of 4 or fewer, even more preferably of 3 or fewer, most preferably of 1 or 2 amino acids only. Insertion, addition and substitution with natural and modified amino acids is envisaged.
  • the variant may have conservative amino acid changes, wherein the amino acid being introduced is similar structurally, chemically, or functionally to that being substituted.
  • variants PNCl proteins which have been altered by substitution or deletion of catalytically- important residues will be excluded from the term "variant".
  • substitution, deletion, insertion, addition or modification will in one embodiment be carried out on the non-transmembrane parts of the protein.
  • the variant will have at least 60% amino acid sequence homology, preferably at least 70% or 80% sequence homology, more preferably at least 90% sequence homology, and ideally at least 95%, 96%, 97%, 98% or 99% sequence homology with wild- type human PNCl.
  • sequence homology comprises both sequence identity and similarity, i.e.
  • a polypeptide sequence that shares 70% amino acid homology with wild-type human PNCl is one in which any 70% of aligned residues are either identical to, or conservative substitutions of, the corresponding residues in wild-type human PNCl.
  • variant is also intended to include isoforms of PNCl, especially isoforms of human and mouse PNCl.
  • variant is also intended to include chemical derivatives of PNCl protein, i.e. where one or more residues of PNCl is chemically derivatized by reaction of a functional side group. Also included within the term variant are PNCl molecules in which naturally occurring amino acid residues are replaced with amino acid analogues.
  • Proteins and polypeptides (including variants and fragments thereof) of and for use in the invention may be generated wholly or partly by chemical synthesis or by expression from nucleic acid.
  • the proteins and peptides of and for use in the present invention can be readily prepared according to well-established, standard liquid or, preferably, solid- phase peptide synthesis methods known in the art (see, for example, J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, 2nd edition, Pierce Chemical Company, Rockford, Illinois (1984), in M. Bodanzsky and A. Bodanzsky, The Practice of Peptide Synthesis, Springer Verlag, New York (1984) .
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an agent capable of modulating PNCl activity and a suitable carrier or pharmaceutical excipient.
  • the invention also provides a ligand to PNC.
  • the invention also provides an antibody raised against, and/or which binds specifically to, PNCl, especially recombinant PNCl, or an immunogenic fragment thereof, especially an immunogenic fragment from an extracellular portion of the protein.
  • the immunogenic fragment of an extracellular portion of the polypeptide comprises a peptide having at least five contiguous amino acids from the extracellular portions of the amino acid sequence of SEQUENCE ID NO. 3 or SEQUENCE ID NO: 5.
  • the immunogenic fragment of an extracellular portion of the polypeptide comprises a peptide having at least five contiguous amino acids from the extracellular C-terminal or N-terminal portions of the amino acid sequence of SEQUENCE ID NO. 3 or SEQUENCE ID NO: 5.
  • the peptide comprises at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least twelve contiguous amino acids.
  • the peptide has less than 50, 40, 30, 20, and 15 amino acids.
  • the invention also relates to a method of prevention or treatment of a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual comprising a step of treating the individual with an antibody of the invention.
  • pathologies characterised by such dysregulated signalling include those that involve aberrant cell survival, migration, proliferation, invasion, or motility.
  • Diseases or conditions associated with this pathology will be well know to those skilled in the art.
  • the disease or condition is selected from the group comprising: cancer; hypertension; increased blood pressure; metabolic disease; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e.
  • the invention also relates to a medicament comprising an antibody of the invention.
  • the invention also relates to a pharmaceutical composition comprising an antibody of the invention in combination with a pharmaceutically acceptable excipient .
  • the invention also relates to a method of identifying or monitoring insulin-like growth factor (IGF) signalling pathway activity in a biological system comprising the step of assaying the biological system for PNCl activity.
  • IGF insulin-like growth factor
  • the invention also relates to a method of identifying or monitoring AMPK activity in a biological system comprising the step of assaying the biological system for PNCl activity.
  • the method involves determining the PNCl activity of a cell relative to a reference cell having normal metabolism, wherein modulated PNCl activity compared to a reference level is indicative of modulated biogenesis in the cell.
  • PNCl activity may be determined by assaying PNCl expression, PNCl activity, or mitochondrial UTP accumulation levels.
  • the method involves initially stimulating the cells with insulin or IGF-IR.
  • the invention also relates to a method of assessing the transformation status of a cell comprising the step of assaying the cell for expression of PNCl, wherein an increased level of PNCl expression compared to a reference level is indicative of a transformed cell or a propensity to transform.
  • PNCl expression functions as a diagnostic and prognostic marker of cellular transformation.
  • the reference level of PNCl is obtained from a non- tumorigenic cell line, such, for example peripheral blood mononuclear cells or fibroblasts.
  • PNCl expression levels may act as a surrogate marker of cells that are transformed, undergoing transformation, or about to undergo transformation .
  • the invention also relates to a method of identifying highly metabolic cells comprising the step of assaying the cell for expression of PNCl, wherein an elevated level of PNCl expression compared to a reference level is indicative of a highly metabolic cell.
  • the invention also relates to a method of identifying compounds useful in the treatment or prevention of pathologies associated with dysregulated IGF-IR signalling, such as diseases or conditions characterised by aberrant mTOR activity or AMPK activity, comprising determining a reference level of activity of PNCl protein, contacting the PNCl protein with a candidate compound, and determining the level of activity of the contacted PNCl protein, wherein a decrease in the level of activity of the contacted PNCl protein relative to the reference level of PNCl activity is an indication that the candidate compound is useful in the treatment or prevention of pathologies associated with dysregulated growth, proliferation, survival, migratory, and invasive signalling.
  • the pathologies associated with such dysregulated signalling pathways are selected from the group comprising: cancer; high blood pressure; hypertension; metabolic diseases; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling
  • tissue grafting i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.
  • inflammation and inflammatory disease i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.
  • inflammation and inflammatory disease autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis
  • the PNCl protein is provided in the form of PNCl expressing cells, such as, for example, liver cells, muscle cells or adipose tissue, . that are ideally stimulated with IGF-I or insulin.
  • the level of PNCl activity may be correlated with a level of expression of PNCl protein in the cells, and wherein the reference level of PNCl activity is suitably the level of PNCl expression in a cell not stimulated by insulin or IGF-I.
  • PNCl activity may also be correlated with mitochondrial UTP accumulation levels where decreased UTP levels in mitochondria of treated cells is indicative that the candidate agent decreases the activity of PNCl.
  • PNCl activity may also be correlated with levels of reactive oxygen species in the cell or mitochondria where decreased reactive oxygen species levels of treated cells is indicative that the candidate agent decreases the activity of PNCl.
  • the invention also provides a method of identifying an agent that suppresses expression of PNCl protein comprising the steps of providing a source of PNCl expressing cells, treating the cells with a candidate agent, and assaying the cells for expression of PNCl, wherein a decrease in the level of expression of PNCl protein in the treated cells relative to untreated cells is an indication that the candidate agent is useful in suppressing expression of PNCl protein.
  • the cells are assayed for over- expression of PNCl using an antibody of the invention.
  • the invention also provides a method of identifying an agent that inhibits PNCl protein activity, comprising the steps of providing a source of PNCl expressing cells, treating the cells with a candidate agent, and assaying the cells for accumulated UTP levels in mitochondria from the cells, wherein a decrease in the level of UTP in mitochondria of the treated cells relative to untreated cells is an indication that the candidate agent is useful in suppressing expression of PNCl protein.
  • the above screening methods may be usefully employed in identifying agents suitable for treatment or prevention of pathologies associated with aberrant mTOR activity or AMPK activity such as, for example, cancer; high blood pressure; and metabolic diseases including type II diabetes.
  • MCF-7 and MCF-IOA cells were cultured in complete medium and RNA was isolated for generation of cDNA and RT-
  • MCF-7 cells were pre-treated with either PD89059 (MAP kinase inhibitor), LY294002 (PI-3 Kinase inhibitor) , or Rapamycin (mTOR inhibitor) for 30 min prior to IGF-I stimulation. At the indicated times RNA was isolated and used to generate cDNA for PCR as described in (A) .
  • PD89059 MAP kinase inhibitor
  • LY294002 PI-3 Kinase inhibitor
  • Rapamycin mTOR inhibitor
  • PNCl is localised to the mitochondrial membrane and causes an increase in cell size.
  • MCF7 cells were transiently transfected with pEGFPNl- PNCl and then incubated with 25nM mitotracker dye. Cells were fixed and images obtained with a confocal microscope. HeLa cells were transiently transfected with Ha-PNCl and then were imunolabelled with the anti-Ha antibody (green) and the human anti-mito antibody (red) (B and C) . MCF-7 cells were transfected with the pcDNA vector encoding Ha- PNCl or empty vector and clones of each transfected pool were isolated. (B) Forward angle light scatter was used to assess cell size by FACS analysis of MCF-7/Ha-PNCl cells compared with vector controls.
  • the solid histograms represent the control cells while the empty histograms represent MCF-7/HaPNCl cells. These are representative of several analyses of cells at different stages of culture in complete medium. The expression levels of the Ha-PNCl protein are shown in the inset western blot of lysates prepared from MCF-7 cells.
  • C To measure proliferative rate MCF-7 Ha/PNCl clones and Ha-PNCl/Neo cells were seeded at 3xl0 4 per well in complete medium or in serum free medium and cell number was assessed in triplicate wells at the indicated times using trypan blue exclusion.
  • MCF-7/Ha-PNCl and MCF-7/Neo cells were transfected with siRNA oligonucleotides directed towards human and mouse PNCl, with a control siRNA or with oligofectamine alone (mock) .
  • A Western Blot analysis of cell lysates prepared from MCF-7/Ha-PNCl cells transfected with siRNA oligonucleotide directed towards human and mouse PNCl, control siRNA or mock transfection at 48, 72, and 96 hours.
  • MCF-7/Neo cells at 72 hours after transfection with PNCl siRNA or mock transfection.
  • Levels of mRNA for the folate and dicarboxylate mitochondrial carriers and the IGF-IR are also shown to measure specificity of siRNA.
  • the bar charts represent the relative mean volume of the mRNA levels show in the gels.
  • MCF-7 vector or MCF-7/Ha-PNCl was transfected with siRNA directed to PNCl or mock transfected (top panels) .
  • the cells were treated with Rapamycin or were left untreated (control) (bottom panels) .
  • Cell size was measured by analysis of forward light scatter (FSC-H) by flow cytometry.
  • FSC-H forward light scatter
  • DU145 and HeLa cells were transfected with siRNA directed towards PNCl or a control siRNA.
  • Cells were analyzed by flow cytometry 732 hours after transfection.
  • D Cell proliferation rates were assessed in MCF-7/Neo and MCF-7/PNC-1 cells at 24, 48, 72 and 96 hours after siRNA transfection.
  • MCF-7 cells were transfected with siRNA directed towards a control siRNA. Following 48 hours cultured cellular nucleotides were extracted as outlined in Materials and Methods and analyzed by reverse phase HPLC using pure nucleotides as reference standards. The top panels are representative regions of the chromatograms for control siRNA and PNCl siRNA-transfected cells. The histogram represents the average amounts of nucleotides expressed as a percentage of GTP which was set a 100% as an internal reference. Results represent the average of three transfected cell populations for the control and five separate cell populations for the PNCl siRNA where PNCl levels were reduced by 70% as measured by qPCR.
  • D-Galactosamine suppresses IGF-I-mediated activation of the mTOR pathway.
  • MCF-7 cells starved from serum were pre-incubated with 25mM D-Galactosamine, or not, for two hours before stimulation with IGF-I for the indicated times.
  • Cell lysates were prepared for western blotting with anti-phospho-Erk, anti- phospho-Akt, anti-phoso-S6Kl antibodies (Thr 389) , and anti phohospo-4E-BPl antibodies. The blots were then reprobed with anti-ERK, anti-AKT, anti-S6Kl, and anti-Actin antibodies as loading controls.
  • FIG. 8 MCF-7/Neo and MCF-7/Ha-PNCl cells were starved for 4 hours and then stimulated with IGF-I for the indicated times . Lysates were prepared and proteins and analysed by western blotting with anti-phosphp AMPK antibodies and antii-AMPK or anti-actin antibodies as loading controls.
  • B Two clones of HeLA cells stably expressing shRNA targeting PNCl or a scrambled shRNA were cultured in medium containing 10%FBS, lysed and prepared for western blotting with anti- phosphoAMPK or anti-actin antibodies. The levels of PNCl mRNA in the HeLA cell clones is shown in the bar chart.
  • FIG. 9 (A) MCF-7/Neo (control) and MCF-7/Ha-PNCl cells were cultured in complete medium for 24 hours, then washed and incubated in PBS containing lOuM H2DCFDA fluorescent probe for 15 minutes in the dark at 20°C. (B) MCF-7 cells were transfected with siRNA directed towards pnclor a control siRNA. Following 48 hours culture, cells were washed and incubated in PBS containing lOuM H 2 DCFDA fluorescent probe for 15 minutes in the dark at 2O 0 C. For both A and B cells were analyzed by flow cytometery and the data are presented as a representative of three separate experiments with similar results. The solid histogram represents the control and the line represents the MCF-7/HaPNCl cell clones in A or the siRNA-transfected cells in B.
  • IGF-I-mediated activation of the Akt/mTOR pathway and its integration with mitochondrial function is an important mechanism in nutrient responses and insulin resistance.
  • the functions of PNCl described in transformed cells are likely to be similar in cells such as muscle, liver and adipose tissue that respond to insulin stimulation and in which nutrient mediated regulation of the mTOR and AMPK pathways is essential for normal metabolism.
  • the expressed sequence tag clone of mouse PNCl was obtained from the IMAGE consortium.
  • PNCl The expressed sequence tag clone of mouse PNCl (PNCl) was obtained from the IMAGE consortium.
  • primers for PNCl were designed incorporating the restriction sites Xhol and Apal.
  • the sequence of these oligonucleotides is as follows: mPNCl 5' GCGCTCGAGGCGGGCCATGGCG 3' (SEQUENCE ID NO: 7).
  • Reverse primer mPNCl 5' GGCGGGCCCAGTAAGCACGCTC 3' (SEQUENCE ID NO: 8) .
  • the PCR products were ligated into the pEGFPCl plasmid that had been digested with Xhol and Apal.
  • the pcDNA3 vector encoding Ha- mPNCl was generated by ligating the insert from pEGFPCl-PNCl into a modified version of pcDNA3 plasmid encoding the Ha peptide.
  • the coding sequence for human PNCl was generated by ligating the insert from pEGFPCl-PNCl into a modified version of pcDNA3 plasmid encoding the Ha peptide.
  • hPNCl was amplified by PCR from testis cDNA, and the Ndel and HindIII restriction sites were introduced for ligation into pRUN. The sequences of all PCR products were verified by DNA sequencing.
  • MCF-7 cells were cultured in medium containing G418 (Calbiochem, Nottingham, UK) (lmg/ml) and individual clones were selected and screened for expression of Ha-PNCl by western blotting.
  • G418 Calbiochem, Nottingham, UK
  • IGF-I lOOng/mL PeproTech, Rocky- Hill, NJ
  • PNCl mRNA expression cells were grown to a confluence of approximately 70%, serum starved (for 4 h in the case of R+ cells and for 12 h in the case of MCF-7, R-, and 3T3L1 cells), and then stimulated with either IGF-I or insulin.
  • Blots were probed with Ci 32 P CTP (1 x 10 6 cpm/ml) -labeled PNCl by the random oligonucleotide primer method (NEBlot: New England Biolabs, Hertfordshire, UK) . Blots were washed twice at 42°C using 2 X SSC, 0.1% (w/v) SDS, and washed once using 0.5 x SSC and 0.1% (w/v) for 2 x 5min. Blots were scanned for signal using a phosphorimager .
  • PNCl full length cDNA was sub-cloned into the pTRCHis vector (Invitrogen) for prokaryotic expression vector of a his- tagged protein and into the pGEX-2T plasmid (Invitorgen) for expression of a N-terminal GST-tagged protein in E. coli.
  • Protein expression was induced by IPTG induction and was extracted from E. coli by lysosome digestion, followed by centrifugation of the cell lysate at 131, OOOxgin a sucrose gradient (40-53%) prepared in 1OmM Tris-HCl, 0. ImM EDTA, pH 7.0.
  • the pellet was re-suspended in the Tris buffer and after further centrifugation the pellet was re-suspended in ice cold 1.2% w/v sarkosyl in 1OmM Tris-HCl, 0. ImM EDTA, pH 7 and centrifuged.
  • the supernatant containing his-tagged HH3 protein was then stored at -80°C or affinity purified using by Nickel resin chromatography under denaturing conditions (8M urea) using the Probond resinTM following the manufacturer's instructions ( Invitrogen) .
  • the protein was re-natured by extensive dialysis into 1OmM Tris buffer containing 0.01% Triton-X detergent.
  • Rabitts were immunized with 500ug of purified protein followed by two boosts of 500ug and 350ug. Antisera were obtained and affinity purified by adsorption to nitrocellulose immobilized PNCl protein followed by elution with 0.2M glycine buffer pH 2.15 and neutralisation with IM K 2 HPO 4 buffer pH7 and extensive dialysis.
  • Cells were cultured in CM at 3 x 10 4 cells per well in a 24- well plate. To monitor cell growth, cells were removed to Eppendorf tubes using trypsin-EDTA and centrifuged at 1000 rpm for 3 min. The cell pellets were then resuspended in lOO ⁇ l of medium and counted using trypan blue exclusion.
  • Cellular protein extracts were prepared by lysing in lysis buffer (Tris-HCl, pH 7.4, 15OmM NaCl, 1% Nonidet P-40) , plus the tyrosine phosphate inhibitor Na 3 VO 4 , (ImM) and the protease inhibitors phenylmethlysulfonyl fluoride (ImM), pepstatin (IDm), and aprotinin (1.5 ⁇ g/ml). After incubation at 4°C for 20 min, nuclear and cellular debris were removed by micro-centrifugation at 14,000rpm for 15 min at 4°C. For western blot analysis proteins were resolved by SDS-PAGE on 4-15% gradient gels and transferred to nitrocellulose membranes.
  • lysis buffer Tris-HCl, pH 7.4, 15OmM NaCl, 1% Nonidet P-40
  • the anti-Ha antibody 12CA5 was from Roche Molecular Biochemicals (East Wales, UK) .
  • the anti-actin monoclonal antibody was from Sigma. Secondary antibodies conjugated with horse radish peroxidase were used for detection with enhanced chemiluminescence (ECL, Amersham Biosciences) .
  • SiRNA oligonucleotides, shRNA and transfection Small interfering RNAs (siRNA) (Elbashir et al., 2001) oligonucleotides were obtained from MWG (Ebersberg, Germany) .
  • An oligonucleotide complementary to both the human and mouse sequence of the pncl gene (aauuugguuggaguugcacca SEQUENCE ID NO: 6) corresponding to nucleotides 311-332 in human gene and nucleotides 304-325 in mouse gene after the start codon.
  • Two other pre-designed oligonucleotides specific for the human gene were obtained from Ambion (siRNAl ID no. 123672 and siRNA3: ID No: 123672.
  • a negative control siRNA (negative control nol) was also obtained from Ambion. Transfection was carried out using OligofectAMINE transfection reagent (Invitrogen) with concentrations of oligonucleotide ranging fromlOnM to 20OnM. All concentrations tested showed similar specific effects on suppressing protein expression and decreasing cell size. For most experiments 5OnM of oligonucleotide was used. Expression of the transfected Ha-PNCl protein was assessed by western blotting using the anti-Ha antibody. RNA levels were assessed using semi-quantitative or quantitative RT-PCR 48-96 h after transfection.
  • Stable transfectants of HeLA cells expressing shRNA from the pSuper vector were generated after transfection with lipofectamine and selection in geneticin. Cells were cloned and a different clones with PNCl stably expressed by 50-70% of that in vector-transfected cells were isolated.
  • RNA was later reverse transcribed by M-MLV reverse transcriptase with oligo dTi 2 -i 8 (Invitrogen) priming and 37°C incubation for I hour.
  • Quantitative PCR was carried out using the ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA) with QuantiTect SYBR Green technology (Qiagen) .
  • HH3 forward primer, 5 ' -GCTCTGCAGCTTTTATCACAAATTC-S ' (SEQUENCE ID NO: 9) and reverse primer, 5 ' -AACGTAACGAGCACACTGGAGTG-S ' (SEQUENCE ID NO: 10); GAPDH: forward primer, 5 1 - CCCATGTTCGTCATGGGTGTGA-3 ' (SEQUENCE ID NO: 11) and reverse primer, 5 ' -TGGTCATGAGTCCTTCCACGATACC-3 ' (SEQUENCE ID NO: 12)).
  • the cell or mitochondrial pellet was gently resuspended in an ice-cold 6% solution of trichloroacetic acid to precipitate protein. Samples were incubated on ice for 10 minutes, and centrifuged at 20,80Og for 10 minutes at 4°C. The protein pellet was discarded, and, to remove the acid, an equal volume of 7.0 % trioctylamine in Freon (1,1,2 trichlorotrifluoroethane) was added to the retained supernatant. The mixture was shaken vigorously, and then centrifuged at 20,800 g for 5 minutes at 4°C. The nucleotides were recovered in the upper aqueous phase.
  • Chromatographic separation of the nucleotide pools was achieved using reverse phase, ion-pairing HPLC on a Vydac C18 column (250 x 4.6 mm, 5Dm particle size) fitted with a C18 guard column.
  • the mobile phase consisted of buffer A (4.0 mM tetrabutylammonium bisulphate, 100 mM KH 2 PO 4 , pH 6.0) and Buffer B, which was prepared by adding 30% methanol to Buffer A. Buffers were filtered and degassed before use. Separation was achieved at 1 ml/minute using the following gradient: 0-20% buffer B over 8 minutes, 20-70% B over 12 minutes and then a decrease to 0% B over 5 minutes. Nucleotide standard solutions, prepared using a 5'- nucleotide and nucleoside kit from Sigma, were used to validate peak positions.
  • SSH Suppressive subtractive hybridization
  • This gene is located on human chromosome 1 (Ip36.22), and its product (Q9BSK2) has another isoform (Q96CQ1) with 60 % identity that is located on chromosome 3.
  • the nucleic acid sequence of the gene is provided in SEQUENCE ID NO: and the amino acid sequence of the protein is provided in SEQUENCE ID NO:
  • Pncl mRNA was detected in the breast carcinoma cell line MCF-7, but not in the non-tumorigenic breast epithelial cell line MCFlOA (Fig. 3A) .
  • pncl mRNA was detected in the Jurkat T lymphocytic leukemia cell line, but not in primary T lymphocytes. (Fig. 2A). This indicates that there is generally increased PNCl expression in transformed cells.
  • IGF- I or insulin R+ cells were starved of serum, then stimulated with IGF-I, and analyzed by northern blotting for pncl expression.
  • pncl mRNA was low in starved cells but was rapidly induced after 2 hours of IGF-I stimulation (Fig. 2C) .
  • MCF-7 cells pncl mRNA expression was induced by 4 hours stimulation with IGF-I (Fig. 2C) with a further increase after 24 hours.
  • R-cells were used to investigate whether pncl transcription was responsive to insulin.
  • Pncl mRNA expression was not detectable in starved R- cells but was induced by insulin after 2 and 4 hours, and a further induction was observed after 8 and 12 hours (Fig. 2C) .
  • a similar pattern of pncl induction was observed in the 3T3L1 pre-adipocyte cell line (not shown) .
  • Induction of pncl mRNA by IGF-I in MCF-7 cells was found to be dependent on the activity of the PI-3 kinase and mTOR pathways, but not on the Erk mitogen activated protein kinase (MAPK) pathway. This was determined by pharmacological inhibition of each of these three pathways with LY29004 (PI3-kinase inhibitor), Rapamycin (mTOR inhibitor) and PD98059 (Mek inhibitor) before IGF-I stimulation (Fig. 2D) .
  • LY29004 PI3-kinase inhibitor
  • Rapamycin mTOR inhibitor
  • PD98059 Mek inhibitor
  • PNCl causes an increase in cell size. Plasmids encoding PNCl as either a GFP- or Ha-fusion protein were transiently transfected into MCF-7 or HeLa cells. Confocal microscopy showed that GFP-PNCl was co-localized with mitoTracker, which specifically labels mitochondria (Fig. 3A) . HeLa cells transiently expressing Ha-PNCl were co-stained with an anti-Ha antibody and a human anti-mito antibody, which labels mitochondrial membranes. This experiment demonstrated that Ha-PNCl became localized to mitochondrial membranes. Over-expression of PNCl had no discernible effect on mitochondrial membrane polarization as assessed with the JCl probe (data not shown) , which indicates that it does not alter the integrity of the mitochondrial membrane.
  • siRNA oligonucleotides directed against PNCl were used to suppress its expression in either MCF-7, MCF-7/Ha- PNCl, Dul45 prostate carcinoma, or HeLa cervival carcinoma cell lines.
  • the Ha antibody was used to detect over- expressed PNCl protein, and RT-PCR was used to detect endogenous PNCl mRNA.
  • Ha-PNCl protein expression was reduced at 2, 3, and 4 days in MCF-7/HaPNCl cells transfected with PNCl siRNA compated with control
  • RT-PCR analysis demonstrated that endogenous PNCl mRNA was reduced in PNCl siRNA-treated MCF-7/Neo cells, but mRNAs for the folate and dicarboxylate mitochondrial carriers (Fiermonte et al., 1998; Titus and Moran, 2000) were not reduced (shown in Figure 4B at 72 hours after transfection) .
  • Cell size was reduced in MCF-7/Neo, MCF-7/Ha- PNCl cultures at 48, 72, and 96 hours after transfection with PNCl siRNA. Data shown compare mock transfected cells with PNCl siRNA-transfected cells after 96 hours (Fig. 4C) .
  • PNCl suppression decreases mitochondrial UTP levels.
  • Total cellular nucleotides were extracted from PNCl siRNA- transfected MCF-7 cells and controls and were assessed by HPLC analysis using purified nucleotide as references. Due to a decrease in proliferation of MCF-7 cells transfected with PNCl siRNA the total amount of nucleotides extracted was always lower than in cells transfected with control siRNA. The GTP peak was thus used as an internal standard and the quantity of other nucleotides are expressed as a percentage of the quantity of GTP. As can be seen in Figure 6A the levels of total cellular UTP were lower in the PNCl siRNA-treated cells compared with the controls.
  • ATP and ADP were not significantly different and the ratio of ADP:ATP appeared to be unaltered. The latter result was confirmed using a luminescence-based assay for cellular ATP (not shown) .
  • Nucleotide levels in mitochondrial fractions that were isolated from cells by differential centrifugation were assessed. This demonstrated that UTP levels were significantly lower in PNCl siRNA-transfected MCF-7 cells compared with controls, while ADP, ATP and GTP were not altered signifcantly (Fig. 6B). It was also noted that the ADP:ATP ratio, which is higher in isolated mitochondria than in total cell extracts, was not altered by suppression of PNCl. Expression of the mitochondrial marker cytochome C and the cytoplasmic marker paxillin in the same amount of total protein demonstrated that the mitochondrial fraction was uncontaminated (Fig.6C).
  • Activation of mTOR is only moderately affected by PNCl expression .
  • IGF-I-mediated activation of Akt in MCF-7/Ha-PNCl cells was investigated. As can be seen in Figure 7A, IGF-I-mediated phosphorylation of Akt was similar in MCF-7/Ha-PNCl and MCF-
  • D-Galactosamine suppresses IGF-I-mediated activation of the mTOR pathway.
  • IGF-I-mediated activation cells were MCF-7 cells were incubated with D-galactosamine for 2 hours in serum starved cultures, and then stimulated with IGF-I. As can be seen in Figure 7, IGF-I-mediated phosphorylation of Erk was similar whether cells were treated with D-GAL or not. However, in D-GAL treated cells phosphorylation of Akt was reduced slightly, and phosphorylation of S6K1 and 4EBPl was reduced to a large extent compared to untreated cells.
  • PNCl expression regulates cellular ROS levels: PNCl expression may elicit a mitochondrial retrograde or stress signaling response, which is associated with increased cellular ROS and has been proposed as an important mechanism of communication between mitochondria and nucleus in response to physiological and pathological stimuli .
  • This retrograde signalling can influence cellular phenotype and cause epithelial mesenchymal transitions associated with development and tumour metastasis (Butow, R. A., and Avadhani, N. G. (2004). MoI Cell 14, 1-15). Amuthan, et al., . (2002).. Oncogene 21, 7839-7849)
  • non-cell based assay systems may be used to identify compounds that interact with, i. e. bind to PNCl, and regulate the enzymatic activity of PNCl.
  • Such compounds may act as antagonists or agonists of PNCl activity and may be used to regulate cell metabolism.
  • PNCl peptides corresponding to different functional domains or subunit fusion proteins may be expressed and used in assays to identify compounds that interact with PNCl.
  • soluble regions of PNCl may be recombinantly expressed and utilized in non-cell based assays to identify compounds that bind to PNCl.
  • the PNCl may also be one which has been fully or partially isolated from cell membranes, or which may be present as part of a crude or semi- purified extract.
  • the basis of the assays used to identify compounds that bind to PNCl involves preparing a reaction mixture of the PNCl and the test compound under conditions and for time sufficient to allow the two components to interact and bind, thus forming a complex which can be removed and/or detected in the reaction mixture.
  • the identity of the bound test compound is then determined.
  • one method to conduct such an assay involves anchoring the protein, polypeptide, peptide, fusion protein or the test substance onto a solid phase and detecting PNCl/test compound complexes anchored on the solid phase at the end of the reaction.
  • the PNCl reactant is anchored onto a solid surface, and the test compound, which is not anchored, may be labeled.
  • microtitre plates conveniently can be utilized as the solid phase.
  • the anchored component is immobilized by non-covalent or covalent attachments.
  • the surfaces may be prepared in advance and stored.
  • the non-immobilized component is added to the coated surfaces containing the anchored component.
  • unreacted components are removed (e.g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface.
  • the detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously non- immobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously non-immobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the solid surface; e. g., using a labeled antibody specific for the previously non-immobilized component .
  • reaction is conducted in a liquid phase, the reaction products separated from unreacted components using an immobilized antibody specific for PNCl protein, fusion protein or the test compound, and complexes detected using a labeled antibody specific for the other component of the possible complex to detect anchored complexes.
  • a cell based assay system can be used to screen for compounds that modulate the activity of PNCl, the system employing cells that express PNCl.
  • a cell based assay system can be used to screen for compounds that modulate the expression of PNCl within a cell.
  • Assays may be designed to screen for compounds that regulate PNCl expression at either the transcriptional or translational level.
  • DNA encoding a reporter molecule can be linked to a regulatory element of the PNCl gene encoding PNCl and used in appropriate intact cells, cell extracts or lysates to identify compounds that modulate PNCl gene expression.
  • reporter genes may include but are not limited to chloramphenicol acetyltransferase (CAT), luciferase, p-glucuronidase (GUS), growth hormone, or placental alkaline phosphatase (SEAP) .
  • Such constructs are introduced into cells thereby providing a recombinant cell useful for screening assays designed to identify modulators of PNCl gene expression. Following exposure of the cells to the test compound, the level of reporter gene expression may be quantitated to determine the test compound's ability to regulate PNCl expression. Alkaline phosphatase assays are particularly useful in the practice of the invention as the enzyme is secreted from the cell.
  • tissue culture supernatant may be assayed for secreted alkaline phosphatase.
  • alkaline phosphatase activity may be measured by calorimetric, bioluminescent or chemiluminescent assays such as those described in Bronstein, I . et al. (1994, Biotechniques 17: 172-177) .
  • Such assays provide a simple, sensitive easily automatable detection system for pharmaceutical screening.
  • the level of PNCl expression can be modulated using RNA interference, antisense or ribozyme approaches to inhibit or prevent translation of PNCl mRNA transcripts or triple helix approaches to inhibit transcription of the PNCl gene.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to PNCl mRNA. The antisense oligonucleotides will bind to the complementary mRNA transcripts and prevent translation.
  • ribozyme molecules designed to catalytically cleave PNCl mRNA transcripts can also be used to prevent translation and expression of PNCl.
  • Cellular or mitochondrial UTP levels may be employed as a surrogate marker of PNCl protein activity, and hence as of identifying any modulation in the proteins activity in response to treatment with a candidate agent. Methods of extracting and quantifying cellular and mitochondrial UTP levels are described herein, and will also be well known to those skilled in the art. For example, HPLC analysis may be employed in the quantification employing purified nucleotides as references. Further, PNCl expressing MCF-7 cells may be employed as the source of PNCl-expressing cells .
  • PNCl is also useful as a marker of mitochondria integrity because suppression of PNCI and subsequent lack of accumulation of UTP in mitochondria results in a signal from the mitochondria to the cytoplasm that results in decreased cell growth and proliferation and possible autophagy
  • the invention provides methods of, and compositions for, treatment and prevention by administration to a subject in need of such treatment of a therapeutically or prophylactically effective amount of a therapeutic of the invention.
  • the subject may be an animal or a human, with or without an established disease.
  • a therapeutic of the invention e.g • / encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the therapeutic, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), construction of a therapeutic nucleic acid as part of a retroviral or other vector, etc.
  • Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
  • compositions may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent .
  • compositions of the invention may be desirable to administer locally to the area in need of treatment; this may be achieved, for example and not by way of limitation, by topical application, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • the therapeutic can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327.)
  • the therapeutic can be delivered in a controlled release system.
  • a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref.
  • polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, FIa. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al . , J.
  • a controlled release system can be placed in proximity of the therapeutic target, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)).
  • An antagonist of PNCl such as a PNCl-specific antibody, may function as a therapeutic of the invention, and such antagonists may be produced using methods which are generally known in the art.
  • purified PNCl may be used to produce antibodies or to screen libraries of pharmaceutical agents to identify those which specifically bind PNCl.
  • Antibodies to PNCl may also be generated using methods that are well known in the art.
  • Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, and single chain antibodies, Fab fragments, and fragments produced by a Fab expression library.
  • Neutralizing antibodies i.e., those which inhibit dimer formation
  • Single chain antibodies may be potent enzyme inhibitors and may have advantages in the design of peptide mimetics, and in the development of immuno- adsorbents and biosensors (Muyldermans, S. (2001) J. Biotechnol. 74:277-302).
  • various hosts including goats, rabbits, rats, mice, camels, dromedaries, llamas, humans, and others may be immunized by injection with PNCl or with any fragment or oligopeptide thereof which has immunogenic properties (especially the fragment specified above) .
  • various adjuvants may be used to increase immunological response.
  • adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, KLH, and dinitrophenol .
  • BCG Bacilli Calmette-Guerin
  • Corynebacterium parvum are especially preferable.
  • the oligopeptides, peptides, or fragments used to induce antibodies to PNCl have an amino acid sequence consisting of at least about 5 amino acids, and generally will consist of at least about 10 amino acids. It is also preferable that these oligopeptides, peptides, or fragments are identical to a portion of the amino acid sequence of the natural protein. Short stretches of PNCl amino acids may be fused with those of another protein, such as KLH, and antibodies to the chimeric molecule may be produced.
  • Monoclonal antibodies to PNCl may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique. (See, e.g., Kohler, G. et al. (1975) Nature 256:495-497; Kozbor, D. et al. (1985) J. Immunol. Methods 81:31-42; Cote, R. J. et al. (1983) Proc. Natl. Acad. Sci . USA 80:2026-2030; and Cole, S. P. et al . (1984) MoI. Cell Biol. 62:109-120.)
  • chimeric antibodies such as the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity.
  • techniques developed for the production of "chimeric antibodies” such as the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used.
  • techniques described for the production of single chain antibodies may be adapted, using methods known in the art, to produce PNCl- specific single chain antibodies.
  • Antibodies with related specificity, but of distinct idiotypic composition may be generated by chain shuffling from random combinatorial immunoglobulin libraries. (See, e.g., Burton, D. R. (1991) Proc. Natl. Acad. Sci . USA 88:10134-10137.)
  • Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature. (See, e.g., Orlandi, R. et al. (1989) Proc. Natl. Acad. Sci. USA 86:3833-3837; Winter, G. et al . (1991) Nature 349:293-299.)
  • Antibody fragments which contain specific binding sites for PNCl may also be generated.
  • fragments include, but are not limited to, F(ab').sub.2 fragments produced by pepsin digestion of the antibody molecule and Fab fragments generated by reducing the disulfide bridges of the F(ab')2 fragments.
  • Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity. (See, e.g., Huse, W. D. et al. (1989) Science 246:1275-1281. )
  • immunoassays may be used for screening to identify antibodies having the desired specificity.
  • Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art.
  • Such immunoassays typically involve the measurement of complex formation between PNCl and its specific antibody.
  • a two- site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering PNCl epitopes is generally used, but a competitive binding assay may also be employed (Pound, supra) .
  • K a is defined as the molar concentration of PNCl-antibody complex divided by the molar concentrations of free antigen and free antibody under equilibrium conditions.
  • K a association constant
  • the K a determined for a preparation of monoclonal antibodies, which are monospecific for a particular PNCl epitope, represents a true measure of affinity.
  • High- affinity antibody preparations with K a ranging from about 10 9 to 10 12 L/mole are preferred for use in immunoassays in which the PNCl-antibody complex must withstand rigorous manipulations.
  • Low-affinity antibody preparations with K a ranging from about 10 6 to 10 7 L/mole are preferred for use in immunopurification and similar procedures which ultimately require dissociation of PNCl, preferably in active form, from the antibody (Catty, D. (1988) Antibodies, Volume I: A Practical Approach, IRL Press, Washington D. C; Liddell, J. E. and A. Cryer (1991) A Practical Guide to Monoclonal Antibodies, John Wiley & Sons, New York N.Y.).
  • polyclonal antibody preparations may be further evaluated to determine the quality and suitability of such preparations for certain downstream applications.
  • a polyclonal antibody preparation containing at least 1-2 mg specific antibody/ml, preferably 5-10 mg specific antibody/ml is generally employed in procedures requiring precipitation of Cf5-antibody complexes. Procedures for evaluating antibody specificity, titer, and avidity, and guidelines for antibody quality and usage in various applications, are generally available.
  • compositions comprise a therapeutically effective amount of a therapeutic, and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the Therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E. W. Martin.
  • Such compositions will contain a therapeutically effective amount of the therapeutic, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
  • the formulation should suit the mode of administration.
  • the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to, ease pain at the, site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • the amount of the therapeutic of the invention which will be effective in the treatment or prevention of cancer will depend on the type, stage and locus of the cancer, and, in cases where the subject does not have an established cancer, will depend on various other factors including the age, sex, weight, and clinical history of the subject.
  • the amount of therapeutic may be determined by standard clinical techniques.
  • in vivo and/or in vitro assays may optionally be employed to help predict optimal dosage ranges.
  • the precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the cancer, and should be decided according to the judgment of the practitioner and each patient's circumstances. Routes of administration of a therapeutic include, but are not limited to, intramuscularly, subcutaneously or intravenously. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the compositions of the invention.

Abstract

Agents capable of modulating PNCl protein activity in an individual are described for use in preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways, such as cancer and metabolic disease. The individual is treated with an agent capable of attenuating PNCl protein activity in a cancer cell. The agent is selected from the group comprising: an agent capable of inhibiting PNCl protein; and an agent capable of attenuating PNCl expression. The invention also relates to the use as a medicament of an agent capable of modulating PNCl protein activity.

Description

TREATMENT OF DISEASE
Introduction
The present invention relates to methods of preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual, such as diseases or conditions associated with aberrant mammalian target of rapamycin (iriTOR) activity, or AMP-activated protein kinase (AMPK) activity. In particular, the invention relates to methods of preventing or treating cancer, neurodegenerative disease, and metabolic diseases such as type II diabetes and obesity.
Background of the Invention
Insulin and Insulin-like growth factor (IGF) regulate metabolism, cell survival, growth, and proliferation through the insulin or IGF-I receptors (IR or IGF-IR) and their downstream signalling pathways. Increased IGF-IR expression and activity have been associated with many human cancers, and over-expression of the IGF-IR in murine tumor models promotes an invasive and metastatic phenotype. Some of the most frequently altered tumour-suppressor genes or oncogenes in cancers encode proteins that directly affect the ancient and hightly conserved signalling pathway from the IGF-IR via the IRS adapter proteins to the lipid kinase PI3 kinase, the serine threonine kinase Akt, and the serine threonine kinase iriTOR. PI-3 kinase and Akt are both oncogenes, while tumour suppressors that regulate this pathway include the lipid phosphatase PTEN, the tuberous sclerosis complex (TSCl/TSC- 2), the LKBl kinase, and the DNA damage-activated tumour suppressor p53. Akt phosphorylates and inhibits TSC2, which regulates the small GTPase protein Rheb, which in turn activates mTOR. The TSC complex and mTOR are regulated by AMPK. Unsurprisingly, there is significant interest in targeting the IGF-IR and components of its signalling pathway for the treatment of cancer.
The role of IGF-I signalling and Akt in regulating energy metabolism and glycolysis in tumour cells is receiving renewed attention. Tumour cells have long been recognized to have the ability to metabolize glucose and produce ATP rapidly through enhanced rates of glycolysis. This phenotype associated with increased production of lactic acid was described by Warburg in the 1920s, and it can be detected using positron emission tomography (PET). Enhanced glycolysis is thought to confer cancer cells with a distinct competitive edge over normal cells by providing adequate ATP for rapid proliferation under hypoxic conditions, and has also been proposed to protect cells from oxidative stress. Activated Akt can directly enhances glycolysis by increasing levels of cell surface nutrient transporters for glucose and by regulating the expression and location of mitochondrial hexokinases, which catalyze the first step of glucose metabolism
Enhanced glycolysis in cancer cells has generally been associated with decreased oxidative phosphorylation in the mitochondria (Oxphos potential). However, glycolysis and oxidative phosphorylation are tightly coupled, and glucose metabolism may regulate changes in mitochondrial physiology that occur in tumour cells. This was recently demonstrated by blocking glucose to lactate conversion by shRNA targeting of Lactate dehydrogenase, which resulted in increased oxidative phosphorylation in neu-mammary tumour cells. Intriguingly, p53 has also recently been implicated in regulating mitochondrial oxidative phosphorylation by regulating expression of a key component of the cytochrome C oxidase complex, the Synthesis of Cytochrome C oxidase 2 (SCo2) protein. This protein is decreased in cells with mutated p53 which recapitulates the Warburg glycolytic phenotype.
IGF-I-and Insulin- mediated activation of the mTOR pathway and its regulation by AMPK and the nutrient or energy status of cells is a central mechanism that is deregulated in diabetes and metabolic disorders associated with insulin resistance. AMPK is activated by a wide variety of metabolic stresses including hypoxia, ischemia, oxidative or hyperosmotic stress, exercise, and glucose deprivation. Upon activation AMPK triggers catabolic processes that generally lead to the production of ATP, and it promotes energy conservation by switching off anabolic processes that consume ATP. In skeletal muscle AMPK stimulates glucose uptake and lipid oxidation. In liver it inhibits glucose and lipid synthesis, but increases lipid oxidation. In adipose tissue AMPK decreases lipolysis and lipogenesis. AMPK also reduces insulin secretion by the pancreas. Altogether the actions of AMPK in these three insulin responsive tissues results in decreasing circulating glucose, reducing plasma lipid, reducing fat accumulation, and enhancing insulin sensitivity. Adipocyte-derived leptin is thought to control appetite through inhibiting AMPK in the hypothalmus . Low levels of AMPK activity are associated with obesity and type II diabetes, and AMPK is the target for the widely prescribed anti-diabetic drug metformin. (AMPK can also be activated by the AMP analogue AICAR in cells) . The actions of exercise in preventing diabetes and high blood pressure are also thought to be mediated through AMPK.
Regulation of AMPK activity by IGF-I and insulin is very complex. IGF-I stimulates short term AMPK activation and over longer time suppresses its activation. Short-term IGF-I- stimulated AMPK activation may be a component of the mTOR signalling pathway via AMPK and proliferator-activator receptor-ID. (PGC-I . D.. that is necessary for mitochondrial biogenesis in response to exercise and other adaptive responses .
A differential screen of genes expressed in R+ cells (cells transformed by over-expressing the IGF-IR) and R- cells (cells derived from an IGF-IR knockout mouse (Sell, C. et al., 1994. Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts. MoI Cell Biol 14:3604-12.)) identified a group of genes associated with cancer cell metabolism and migration (Loughran, et al.,. 2005. Mystique is a new insulin- like growth factor-I-regulated PDZ-LIM domain protein that promotes cell attachment and migration and suppresses Anchorage- independent growth. MoI Biol Cell 16:1811-22 and Loughran, et al., 2005. Gene expression profiles in cells transformed by overexpression of the IGF-I receptor. Oncogene 24:6185-6193). Statements of Invention
The present invention is based on the findings that a previously known, but uncharacterised, protein, PNCl, is upregulated in cancer cell lines compared with non- transformed cells, and that suppression of the expression of the protein in cell lines suppresses cell size and cell proliferation, while attenuating IGF-I mediated activation of the mammalian target of rapamycin (mTOR) pathway and increasing in AMP-activated protein kinase activity.
The gene encoding human PNCl is located on chromosome 1
(Ip36.22) and its sequence is provided in SEQUENCE ID NO: 1.
The nucleotide sequence of it' s mouse homolog is provided in SEQUENCE ID NO: 2. The amino acid sequence of the human and mouse gene products are provided in SEQUENCE ID NO's: 3 and
4, respectively. The amino acid sequence of a human isoform of PNCl (Q96CQ1) is provided in SEQUENCE ID NO: 5.
According to the invention, there is provided a method of preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual in need thereof, the method comprising a step of modulating PNCl protein activity in the individual. Typically, the method involves administering to the individual an agent that modulates, ideally attenuates, PNCl activity in the individual .
In one embodiment, the pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways (which include IGF-IR signalling pathways) is one that involves aberrant cell survival, migration, proliferation, invasion, or motility. Diseases or conditions associated with this pathology will be well know to those skilled in the art. Typically, the disease or condition is selected from the group comprising: cancer; high blood pressure; hypertension; metabolic disease; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis) ; pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis.
In one embodiment, the pathology characterised by aberrant cell survival, migration, proliferation, invasion, or motility is selected from the group comprising: cancer; high blood pressure; neurodegenerative disease; and metabolic disease. In one embodiment, , the pathologies are characterised by either or both of aberrant mTOR activity. and aberrant AMPK activity. The person skilled in the art will be aware of pathologies associated with these characteristics.
Preferably, the pathology is cancer, and in which the individual is treated with an agent capable of attenuating PNCl protein activity in a cancer cell. Suitably, the cancer is selected from the group comprising: fibrosarcoma; myxosarcoma; liposarcoma; chondrosarcom; osteogenic sarcoma; chordoma; angiosarcoma; endotheliosarcoma; lymphangiosarcoma; lymphangioendotheliosarcoma; synovioma; mesothelioma; Ewing's tumor; leiomyosarcoma; rhabdomyosarcoma; colon carcinoma; pancreatic cancer; breast cancer; ovarian cancer; prostate cancer; squamous cell carcinoma; basal cell carcinoma; adenocarcinoma; sweat gland carcinoma; sebaceous gland carcinoma; papillary carcinoma; papillary adenocarcinomas; cystadenocarcinoma; medullary carcinoma; bronchogenic carcinoma; renal cell carcinoma; hepatoma; bile duct carcinoma; choriocarcinoma; seminoma; embryonal carcinoma; Wilms' tumor; cervical cancer; uterine cancer; testicular tumor; lung carcinoma; small cell lung carcinoma; bladder carcinoma; epithelial carcinoma; glioma; astrocytoma; medulloblastoma; craniopharyngioma; ependymoma; pinealoma; hemangioblastoma; acoustic neuroma; oligodendroglioma; meningioma; melanoma; retinoblastoma; and leukemias .
In a preferred embodiment, the cancer is selected from the group comprising: breast; cervical; prostate; and leukemias, and/or their metastases.
Generally, when the pathology is metabolic disease or elevated blood pressure, the individual is suitably treated with an agent capable of attenuating cellular PNCl protein activity. Typically, the metabolic disease is selected from the group comprising: diabetes (especially type II diabetes) ; metabolic syndrome; and obesity.
The invention also relates to a method of inhibiting mTOR function in a biological system comprising the step of treating the biological system with an agent capable of attenuating the PNCl protein activity of the biological system. The invention also relates to a method of assessing mTOR activity in an individual comprising a step of assessing PNCl activity in the individual. . The invention also relates to a method of assessing mitochondrial functionin an individual comprising a step of assessing PNCl activity in the individual, wherein the level of PNCl activity is associated with the level of micrchondrial function.
The invention also relates to amethod of assessing the cancer status of an individual comrpsing a step of determining the PNCl protein activity in the individual, wherein increased PNCl activity compared to a reference activity for a healthy individual is indicative of presence or risk of cancer. Generally, the PNCl activity will be assessed in biological sample obtained from the individual, such as a cell or tissue sample.
The invention also relates to a method of increasing AMPK function in a biological system comprising the step of treating the biological system with an agent capable of attenuating the PNCl protein activity of the biological system.
In this specification, the term "biological system" should be taken to mean a cell, a cell line, a tissue, an organ, or an organism.
When the methods of the invention involve an agent that attenuates PNCl activity, this should be taken to include an agent that suppresses the expression of PNCl protein (i.e. interferes with expression of the pncl gene) , including suppression of transcription or translation, and an agent that directly inhibits PNCl activity. Further, PNCl should be taken to include PNCl and it' s documented isoforms, including Q96CQ1 located on chromosome 3 and HuBMSC-MCP located on chromosome 11. In one preferred embodiment of the invention, expression of PNCl is suppressed by means of RNA interference (RNAi). RNA interference (RNAi) is an evolutionally highly conserved process of post- transcriptional gene silencing (PTGS) by which double stranded RNA (known as siRNA molecules), when introduced into a cell, causes sequence-specific degradation of mRNA sequences. The RNAi machinery, once it finds a double- stranded RNA molecule, cuts it up, separates the two strands, and then proceeds to destroy RNA molecules that are complementary to one of those segments, or prevent their translation into proteins. Thus, suppression of PNCl expression may be achieved by treating an individual with siRNA molecules designed to target PNCl mRNA, preferably a sequence in the PNCl mRNA selected from the group comprising : nucleotides 311-332 (from the start codon) in human gene and nucleotides 304-325 (from the start codon) in the mouse gene (aatttggttggagttgcacca) .
Thus, the invention relates to a siRNA molecule designed to target PNCl mRNA, suitably a sequence in human PNCl mRNA from nucleotides 311 to 332 after the start codon of PNCl.
SEQUENCE ID NO: 6 (aauuugguuggaguugcacca ) provides a siRNA molecule that targets PNCl. Further, the invention relates to a medicament comprising: an oligonucleotide or siRNA molecule of the invention; an siRNA molecule capable of targeting human PNCl mRNA; or an siRNA molecule sold by
AMBION under the reference siRNAl ID No. 123672 or siRNA3 ID No.123672, optionally in combination with a suitable pharmaceutical excipient. Typically, the medicament is useful in the prevention or treatment of a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual such as, for example, one that involves aberrant cell survival, migration, proliferation, invasion, or motility. Diseases or conditions associated with this pathology will be well know to those skilled in the art. Typically, the disease or condition is selected from the group comprising: cancer; high blood pressure; hypertension; metabolic diseases; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis
Other types of gene knockdown tools will be well known to the person skilled in the filed of molecular biology. For example, micro RNA' s (miRNAs) are small (~22nt) non-coding RNAs (ncRNAs) that regulate gene expression at the level of translation. Each miRNA apparently regulates multiple genes and hundreds of miRNA genes are predicted to be present in mammals. Recently miRNAs have been found to be critical for development, cell proliferation and cell development, apoptosis and fat metabolism, and cell differentiation. Alternatively, small hairpin RNA (shRNA) molecules are short RNA molecules having a small hairpin loop in their tertiary structure tha may be employed to silence genes. The design of miRNA or shRNA molecules capable of silencing PNCl will be apparent to those skilled in the field of miRNA or shRNA molecule design. As an alternative, the level of PNCl expression can be modulated using antisense or ribozyme approaches to inhibit or prevent translation of PNCl mRNA transcripts or triple helix approaches to inhibit transcription of the PNCl gene. Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to PNCl mRNA. The antisense oligonucleotides will bind to the complementary mRNA transcripts and prevent translation. Ribozyme molecules designed to catalytically cleave PNCl mRNA transcripts can also be used to prevent translation and expression of PNCl. (See, e. g. , PCT International PublicationW090/11364 , published October 4,1990 ; Sarver et al. , 1990, Science 247: 1222-1225).
Where the agent inhibits PNCl activity, the agent is suitably a pyrimidine nucleotide analogue, examples of which will be well known to those skilled in the art (Holy et al.,(1999) Structure-Antiviral Activity Relationship in the
Series of Pyrimidine and Purine N- [2- (2-
Phosphonomethoxy) ethyl ] Nucleotide Analogues. 1. Derivatives Substituted at the Carbon Atoms of the Base. J. Med. Chem.
42, 2064-2086) .
Where the method of the invention is a method of treating a neurodegenerative disease, the individual is suitably treated with an agent capable of effecting an increase in PNCl activity, typically in cells of the neuraxis. In one embodiment, the agent is PNCl protein, or a biologically active fragment or variant thereof. Typically, the PNCl protein is human PNCl protein, ideally recombinant human PNCl protein. In an alternative embodiment, the agent is capable of increasing expression of the PNCl gene.
In a preferred embodiment of the invention, the agent for treating neurodegeneration is targeted to the cells of the neuraxis by means of gene therapy, suitably employing a viral delivery vector such as a lentvirus or a adeno- associated virus.
In this specification, the term neurodegenerataive should be taken to include diseases selected from the group comprising: amyotrophic lateral sclerosis (ALS) , or variants thereof including primary lateral sclerosis and spinal muscular atrophy; prion disease; Huntington's disease; Parkinson's disease; Alzheimer's disease; Multiple sclerosis (MS); hereditary neuropathies; tauopathies; and diseases involving cerebellar degeneration.
The invention also relates to the use of an agent capable of modulating PNCl activity as a medicament. Suitably, the agent is selected from the group comprising: an agent capable of inhibiting PNCl protein; and an agent capable of attenuating PNCl expression. In one embodiment, the agent is an siRNA molecule targeted to the PNCl mRNA.
The invention also relates to the use of PNCl protein, or a biologically active fragment, variant or isoform thereof, as a medicament. In this specification, the term "biologically active" should be taken to mean that the fragment retains all or part of the biological functionality of the parent protein. Suitably, the fragment will retain the ability to cause an increase in mitochondrial function or biogenesis, or an increase in cell size, survival, or proliferation of relative to an untreated cell, or to cause an increase in cellular or mitochondrial UTP levels relative to an untreated cell.
A "fragment" of the PNCl protein means a contiguous stretch of amino acid residues of at least 5 amino acids, preferably at least 6 amino acids. Typically, the "fragment" will comprise at least 10, preferably at least 20, more preferably at least 30, and ideally at least 40 contiguous amino acids. In this regard, it would be a relatively straightforward task to make fragments of the protein and assess the biological activity activity of such fragments using the in-vitro models described below.
A "variant" of the PNCl protein shall be taken to mean proteins having amino acid sequences which are substantially identical to wild-type PNCl protein, especially human wild- type PNCl. Thus, for example, the term should be taken to include proteins or polypeptides that are altered in respect of one or more amino acid residues. Preferably such alterations involve the insertion, addition, deletion and/or substitution of 5 or fewer amino acids, more preferably of 4 or fewer, even more preferably of 3 or fewer, most preferably of 1 or 2 amino acids only. Insertion, addition and substitution with natural and modified amino acids is envisaged. The variant may have conservative amino acid changes, wherein the amino acid being introduced is similar structurally, chemically, or functionally to that being substituted. Typically, PNCl proteins which have been altered by substitution or deletion of catalytically- important residues will be excluded from the term "variant". In this regard, substitution, deletion, insertion, addition or modification will in one embodiment be carried out on the non-transmembrane parts of the protein. Generally, the variant will have at least 60% amino acid sequence homology, preferably at least 70% or 80% sequence homology, more preferably at least 90% sequence homology, and ideally at least 95%, 96%, 97%, 98% or 99% sequence homology with wild- type human PNCl. In this context, sequence homology comprises both sequence identity and similarity, i.e. a polypeptide sequence that shares 70% amino acid homology with wild-type human PNCl is one in which any 70% of aligned residues are either identical to, or conservative substitutions of, the corresponding residues in wild-type human PNCl. The term "variant" is also intended to include isoforms of PNCl, especially isoforms of human and mouse PNCl.
The term "variant" is also intended to include chemical derivatives of PNCl protein, i.e. where one or more residues of PNCl is chemically derivatized by reaction of a functional side group. Also included within the term variant are PNCl molecules in which naturally occurring amino acid residues are replaced with amino acid analogues.
Proteins and polypeptides (including variants and fragments thereof) of and for use in the invention may be generated wholly or partly by chemical synthesis or by expression from nucleic acid. The proteins and peptides of and for use in the present invention can be readily prepared according to well-established, standard liquid or, preferably, solid- phase peptide synthesis methods known in the art (see, for example, J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, 2nd edition, Pierce Chemical Company, Rockford, Illinois (1984), in M. Bodanzsky and A. Bodanzsky, The Practice of Peptide Synthesis, Springer Verlag, New York (1984) .
The invention also relates to a pharmaceutical composition comprising an agent capable of modulating PNCl activity and a suitable carrier or pharmaceutical excipient..
The invention also provides a ligand to PNC.
The invention also provides an antibody raised against, and/or which binds specifically to, PNCl, especially recombinant PNCl, or an immunogenic fragment thereof, especially an immunogenic fragment from an extracellular portion of the protein. Typically, the immunogenic fragment of an extracellular portion of the polypeptide comprises a peptide having at least five contiguous amino acids from the extracellular portions of the amino acid sequence of SEQUENCE ID NO. 3 or SEQUENCE ID NO: 5. Preferably, the immunogenic fragment of an extracellular portion of the polypeptide comprises a peptide having at least five contiguous amino acids from the extracellular C-terminal or N-terminal portions of the amino acid sequence of SEQUENCE ID NO. 3 or SEQUENCE ID NO: 5. Suitably, the peptide comprises at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least twelve contiguous amino acids. Suitably, the peptide has less than 50, 40, 30, 20, and 15 amino acids. Methods of producing antibodies, both monoclonal and polyclonal, will be well known to those skilled in the art.
The invention also relates to a method of prevention or treatment of a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual comprising a step of treating the individual with an antibody of the invention. Typically, pathologies characterised by such dysregulated signalling include those that involve aberrant cell survival, migration, proliferation, invasion, or motility. Diseases or conditions associated with this pathology will be well know to those skilled in the art. Typically, the disease or condition is selected from the group comprising: cancer; hypertension; increased blood pressure; metabolic disease; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis. The invention also relates to a medicament comprising an antibody of the invention. The invention also relates to a pharmaceutical composition comprising an antibody of the invention in combination with a pharmaceutically acceptable excipient . The invention also relates to a method of identifying or monitoring insulin-like growth factor (IGF) signalling pathway activity in a biological system comprising the step of assaying the biological system for PNCl activity.
The invention also relates to a method of identifying or monitoring AMPK activity in a biological system comprising the step of assaying the biological system for PNCl activity.
There is also provided a method to assess the status of mitochondrial integrity or indeed biogenesis in cells. PNCl induction by IGF-I or insulin is necessary to allow accumulation of UTP in mitochondria, and suppression of its expression results in a mitochondria-derived signal that decreases cell growth and leads to enhanced AMPK activity. Thus, the method involves determining the PNCl activity of a cell relative to a reference cell having normal metabolism, wherein modulated PNCl activity compared to a reference level is indicative of modulated biogenesis in the cell. PNCl activity may be determined by assaying PNCl expression, PNCl activity, or mitochondrial UTP accumulation levels. Typically, the method involves initially stimulating the cells with insulin or IGF-IR.
The invention also relates to a method of assessing the transformation status of a cell comprising the step of assaying the cell for expression of PNCl, wherein an increased level of PNCl expression compared to a reference level is indicative of a transformed cell or a propensity to transform. Thus, PNCl expression functions as a diagnostic and prognostic marker of cellular transformation. Suitably, the reference level of PNCl is obtained from a non- tumorigenic cell line, such, for example peripheral blood mononuclear cells or fibroblasts. Thus, PNCl expression levels may act as a surrogate marker of cells that are transformed, undergoing transformation, or about to undergo transformation .
The invention also relates to a method of identifying highly metabolic cells comprising the step of assaying the cell for expression of PNCl, wherein an elevated level of PNCl expression compared to a reference level is indicative of a highly metabolic cell.
The invention also relates to a method of identifying compounds useful in the treatment or prevention of pathologies associated with dysregulated IGF-IR signalling, such as diseases or conditions characterised by aberrant mTOR activity or AMPK activity, comprising determining a reference level of activity of PNCl protein, contacting the PNCl protein with a candidate compound, and determining the level of activity of the contacted PNCl protein, wherein a decrease in the level of activity of the contacted PNCl protein relative to the reference level of PNCl activity is an indication that the candidate compound is useful in the treatment or prevention of pathologies associated with dysregulated growth, proliferation, survival, migratory, and invasive signalling. Typically, the pathologies associated with such dysregulated signalling pathways are selected from the group comprising: cancer; high blood pressure; hypertension; metabolic diseases; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling
(i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis
In a preferred embodiment of the screening method of the invention, the PNCl protein is provided in the form of PNCl expressing cells, such as, for example, liver cells, muscle cells or adipose tissue, . that are ideally stimulated with IGF-I or insulin. In such examples, the level of PNCl activity may be correlated with a level of expression of PNCl protein in the cells, and wherein the reference level of PNCl activity is suitably the level of PNCl expression in a cell not stimulated by insulin or IGF-I. PNCl activity may also be correlated with mitochondrial UTP accumulation levels where decreased UTP levels in mitochondria of treated cells is indicative that the candidate agent decreases the activity of PNCl. PNCl activity may also be correlated with levels of reactive oxygen species in the cell or mitochondria where decreased reactive oxygen species levels of treated cells is indicative that the candidate agent decreases the activity of PNCl.
The invention also provides a method of identifying an agent that suppresses expression of PNCl protein comprising the steps of providing a source of PNCl expressing cells, treating the cells with a candidate agent, and assaying the cells for expression of PNCl, wherein a decrease in the level of expression of PNCl protein in the treated cells relative to untreated cells is an indication that the candidate agent is useful in suppressing expression of PNCl protein. Typically, the cells are assayed for over- expression of PNCl using an antibody of the invention.
The invention also provides a method of identifying an agent that inhibits PNCl protein activity, comprising the steps of providing a source of PNCl expressing cells, treating the cells with a candidate agent, and assaying the cells for accumulated UTP levels in mitochondria from the cells, wherein a decrease in the level of UTP in mitochondria of the treated cells relative to untreated cells is an indication that the candidate agent is useful in suppressing expression of PNCl protein.
The above screening methods may be usefully employed in identifying agents suitable for treatment or prevention of pathologies associated with aberrant mTOR activity or AMPK activity such as, for example, cancer; high blood pressure; and metabolic diseases including type II diabetes.
The invention will be more clearly understood from the following description of some embodiments thereof, provided by way of example only, with reference to the accompanying Figures.
Brief Description of the Figures
Figure 1
PNCl mRNA is abundant in R+ cells compared with R- cells and encodes a mitochondrial carrier protein. (A) RNA was isolated from R+ and R- cells and used to generate northern blots. This blot and a murine multiple tissue blot (B) were probed with radiolabelled probes derived from the murine PNCl cDNA. Both were re-probed for actin expression to demonstrate RNA loading.
Figure 2.
PNCl mRNA expression in cells and induction by IGF-I and insulin (A) MCF-7 and MCF-IOA cells were cultured in complete medium and RNA was isolated for generation of cDNA and RT-
PCR using PNCl-specific primers or GAPDH primers. (B) R+ cells were starved from serum and stimulated with IGF-I
(10OnM) for the indicated times at which RNA was isolated. Northern blots were probed with radiolabelled human PNCl cDNA and for actin. MCF-7 cells were serum starved and then stimulated with IGF-I for the indicated times at which times RNA was isolated to generate cDNA for semi quantitative RT- PCR using PNCl-specific primers. As a control RT-PCR from the same samples was carried out using primers directed to the kinase domain of the IGF-IR. R- cells serum starved and stimulated with 1OnM insulin for the indicated times and RNA was isolated for preparation of cDNA and RT-PCR using PNCl and GAPDH primers. (C) MCF-7 cells were pre-treated with either PD89059 (MAP kinase inhibitor), LY294002 (PI-3 Kinase inhibitor) , or Rapamycin (mTOR inhibitor) for 30 min prior to IGF-I stimulation. At the indicated times RNA was isolated and used to generate cDNA for PCR as described in (A) .
Figure 3. PNCl is localised to the mitochondrial membrane and causes an increase in cell size.
(A) MCF7 cells were transiently transfected with pEGFPNl- PNCl and then incubated with 25nM mitotracker dye. Cells were fixed and images obtained with a confocal microscope. HeLa cells were transiently transfected with Ha-PNCl and then were imunolabelled with the anti-Ha antibody (green) and the human anti-mito antibody (red) (B and C) . MCF-7 cells were transfected with the pcDNA vector encoding Ha- PNCl or empty vector and clones of each transfected pool were isolated. (B) Forward angle light scatter was used to assess cell size by FACS analysis of MCF-7/Ha-PNCl cells compared with vector controls. The solid histograms represent the control cells while the empty histograms represent MCF-7/HaPNCl cells. These are representative of several analyses of cells at different stages of culture in complete medium. The expression levels of the Ha-PNCl protein are shown in the inset western blot of lysates prepared from MCF-7 cells. (C) To measure proliferative rate MCF-7 Ha/PNCl clones and Ha-PNCl/Neo cells were seeded at 3xl04per well in complete medium or in serum free medium and cell number was assessed in triplicate wells at the indicated times using trypan blue exclusion.
Figure 4.
Knockdown of PNCl with siRNA reduces cell size and proliferation in MCF-7 cells.
MCF-7/Ha-PNCl and MCF-7/Neo cells were transfected with siRNA oligonucleotides directed towards human and mouse PNCl, with a control siRNA or with oligofectamine alone (mock) . (A) Western Blot analysis of cell lysates prepared from MCF-7/Ha-PNCl cells transfected with siRNA oligonucleotide directed towards human and mouse PNCl, control siRNA or mock transfection at 48, 72, and 96 hours.
(B) Semi quantitative RT-PCR showing level of PNCl iriRNA in
MCF-7/Neo cells, at 72 hours after transfection with PNCl siRNA or mock transfection. Levels of mRNA for the folate and dicarboxylate mitochondrial carriers and the IGF-IR are also shown to measure specificity of siRNA. The bar charts represent the relative mean volume of the mRNA levels show in the gels. (C) MCF-7 vector or MCF-7/Ha-PNCl was transfected with siRNA directed to PNCl or mock transfected (top panels) . Alternatively, the cells were treated with Rapamycin or were left untreated (control) (bottom panels) . Cell size was measured by analysis of forward light scatter (FSC-H) by flow cytometry. DU145 and HeLa cells were transfected with siRNA directed towards PNCl or a control siRNA. Cells were analyzed by flow cytometry 732 hours after transfection. (D) Cell proliferation rates were assessed in MCF-7/Neo and MCF-7/PNC-1 cells at 24, 48, 72 and 96 hours after siRNA transfection.
Figure 5.
Suppression of PNCl expression reduces UTP accumulation in mitochondria . (A) MCF-7 cells were transfected with siRNA directed towards a control siRNA. Following 48 hours cultured cellular nucleotides were extracted as outlined in Materials and Methods and analyzed by reverse phase HPLC using pure nucleotides as reference standards. The top panels are representative regions of the chromatograms for control siRNA and PNCl siRNA-transfected cells. The histogram represents the average amounts of nucleotides expressed as a percentage of GTP which was set a 100% as an internal reference. Results represent the average of three transfected cell populations for the control and five separate cell populations for the PNCl siRNA where PNCl levels were reduced by 70% as measured by qPCR. Statistical significance of difference was evaluated using a Student's two-sided t-test. (B) Mitochondria were extracted from MCF-7 cells transfected with either control or PNCl siRNA. Nucleotides were extracted and analyzed by HPLC as described above. Results are from three (negative control) or four (HH3 siRNA) individualy transfected cell populations where PNCl levels were reduced by 70% as measured by qPCR. Statistical significance of difference was evaluated using a Student's two-sided t-test, with ** corresponding to p<0.001. (C) Western blot analysis of cytoplasmic and mitochondrial fractions, showing the cytoplasmic marker paxillin and the mitochondrial marker VDAC. Gels were loaded with 30 mg total protein per fraction.
Figure 6. Effects of PNCl over-expression or suppression on mTOR pathway.
(A) MCF-7/Neo and MCF-7/Ha-PNCl cells were starved for 4 hours and then stimulated with IGF-I for the indicated times. Lysates were prepared and proteins and analysed by western blotting with anti-phosph-Akt (S473), and anti- phoso-S6Kl antibodies (Thre 389 and Thre 421/424) . The blots were also reprobed with anti-Akt anti-HA, anti-S6Kl, and anti-Actin antibodies. (B) MCF-7/HaPNC-l cells transfected with siRNA directed towards mouse and human PNCl, control siRNA or were unstransfected. 72 hours following transfection cells were starved for 4 hours and then stimulated with IGF-I for the indicated times. Rapamycin was added for 30 min prior to stimulation with IGF-I. Lysates were prepared and analysed by western blotting with anti- phospho-AKT, anti-phospho-S6Kl (Thre 389) , and anti phospho- 4E-BP1 antibodies. The blots were also reprobed with anti- Akt, anti-HA, anti-S6Kl, and anti-Actin antibodies.
Figure 7.
D-Galactosamine suppresses IGF-I-mediated activation of the mTOR pathway. MCF-7 cells starved from serum were pre-incubated with 25mM D-Galactosamine, or not, for two hours before stimulation with IGF-I for the indicated times. Cell lysates were prepared for western blotting with anti-phospho-Erk, anti- phospho-Akt, anti-phoso-S6Kl antibodies (Thr 389) , and anti phohospo-4E-BPl antibodies. The blots were then reprobed with anti-ERK, anti-AKT, anti-S6Kl, and anti-Actin antibodies as loading controls.
Figure 8 (A) MCF-7/Neo and MCF-7/Ha-PNCl cells were starved for 4 hours and then stimulated with IGF-I for the indicated times . Lysates were prepared and proteins and analysed by western blotting with anti-phosphp AMPK antibodies and antii-AMPK or anti-actin antibodies as loading controls. (B) Two clones of HeLA cells stably expressing shRNA targeting PNCl or a scrambled shRNA were cultured in medium containing 10%FBS, lysed and prepared for western blotting with anti- phosphoAMPK or anti-actin antibodies. The levels of PNCl mRNA in the HeLA cell clones is shown in the bar chart.
Figure 9 (A) MCF-7/Neo (control) and MCF-7/Ha-PNCl cells were cultured in complete medium for 24 hours, then washed and incubated in PBS containing lOuM H2DCFDA fluorescent probe for 15 minutes in the dark at 20°C. (B) MCF-7 cells were transfected with siRNA directed towards pnclor a control siRNA. Following 48 hours culture, cells were washed and incubated in PBS containing lOuM H2DCFDA fluorescent probe for 15 minutes in the dark at 2O0C. For both A and B cells were analyzed by flow cytometery and the data are presented as a representative of three separate experiments with similar results. The solid histogram represents the control and the line represents the MCF-7/HaPNCl cell clones in A or the siRNA-transfected cells in B.
Detailed Description of the Invention
The contribution of mitochondria to the growth and proliferation of cancer cells and the integration of mitochondrial function with the IGF-I and mTOR signaling pathways, glycolysis, and energy metabolism is an important, but largely unexplored, area of biology. The present findings with PNCl indicate that insulin and IGF-I induce the expression of the mitochondrial UTP carrier to promote cell growth. PNCl transports pyrimidine nucleotides with preference for UTP, suggesting that insulin and IGF-I promote increased UTP transport into the mitochondria as a means of promoting cell growth and proliferation. Suppression of PNCl results in reduced mitochondrial UTP accumulation, reduced cell size, and reduced cell proliferation. This is accompanied by increased activation of AMPK. These observations suggest that the increased expression of PNCl in transformed cells is a mechanism by which mitochondrial function is enhanced to enhance mitochondrial UTP levels and promote tumour growth. The data also indicate that the IGF-I- activated πiTOR signalling pathway directly regulates mitochondrial function, and that PNCl-mediated accumulation of UTP in mitochondria is essential for normal metabolism and cell growth.
IGF-I-mediated activation of the Akt/mTOR pathway and its integration with mitochondrial function is an important mechanism in nutrient responses and insulin resistance. Thus, the functions of PNCl described in transformed cells are likely to be similar in cells such as muscle, liver and adipose tissue that respond to insulin stimulation and in which nutrient mediated regulation of the mTOR and AMPK pathways is essential for normal metabolism.
MATERIALS AND METHODS
Cloning of PNCl
The expressed sequence tag clone of mouse PNCl (PNCl) was obtained from the IMAGE consortium. To generate full-length PNCl for cloning in frame with the GFP at the C terminus oligonucleotides primers for PNCl were designed incorporating the restriction sites Xhol and Apal. The sequence of these oligonucleotides is as follows: mPNCl 5' GCGCTCGAGGCGGGCCATGGCG 3' (SEQUENCE ID NO: 7). Reverse primer: mPNCl 5' GGCGGGCCCAGTAAGCACGCTC 3' (SEQUENCE ID NO: 8) . The PCR products were ligated into the pEGFPCl plasmid that had been digested with Xhol and Apal. The pcDNA3 vector encoding Ha- mPNCl was generated by ligating the insert from pEGFPCl-PNCl into a modified version of pcDNA3 plasmid encoding the Ha peptide. To generate the bacterial expression vector pRUN, the coding sequence for human PNCl
(hPNCl) was amplified by PCR from testis cDNA, and the Ndel and HindIII restriction sites were introduced for ligation into pRUN. The sequences of all PCR products were verified by DNA sequencing.
Cell Culture, IGF-I/Insulin stimulation and Transfection MCF-7 breast carcinoma cells, R- cells, R+ cells, and HeLa cells were all maintained in Dulbecco' s modified Eagles medium supplemented with 10% (v/v) FBS, 1OmM L-glutamine, and antibiotic (all from Biowhittaker, Verviers, Belguim) . This is complete medium (CM) . HeLa cells were transiently transfected with pcDNA3 encoding Ha-PNCl or empty pcDNA3 vector (4μg of DNA) using LipofectaAMINE 2000 (Invitrogen, Paisley, UK) . To generate stable transfectants MCF-7 cells were cultured in medium containing G418 (Calbiochem, Nottingham, UK) (lmg/ml) and individual clones were selected and screened for expression of Ha-PNCl by western blotting. To analyze signaling response cells were starved from FBS before stimulation with IGF-I (lOOng/mL PeproTech, Rocky- Hill, NJ) . To analyze PNCl mRNA expression cells were grown to a confluence of approximately 70%, serum starved (for 4 h in the case of R+ cells and for 12 h in the case of MCF-7, R-, and 3T3L1 cells), and then stimulated with either IGF-I or insulin. To inhibit signalling pathways cells were incubated with 30μm PD89059 (MAP kinase inhibitor) , 20μm LY294002 (PI-3 Kinase inhibitor) , or 2OnM Rapamycin (mTOR inhibitor) for 30 minutes prior to stimulation with IGF-I. All inhibitors were from Calbiochem, . Northern Blot Analysis
Total RNA was isolated from R+ cells using Trizol Reagent (Gibco-BRL, Paisley, UK), separated on 1.5% (w/v) denaturing formaldehyde gels and transferred to nylon membranes (Hybond-N Amersham Corp, Buckinghamshire, UK) . Prehybridization and hybridization were carried out at 42°C in 50% formamide, 5 x SSC, 4 x Denhardt' s solution, 0.1% SDS, and salmon sperm DNA (lOOul/ml, Sigma, Dublin). Blots were probed with Ci32P CTP (1 x 106 cpm/ml) -labeled PNCl by the random oligonucleotide primer method (NEBlot: New England Biolabs, Hertfordshire, UK) . Blots were washed twice at 42°C using 2 X SSC, 0.1% (w/v) SDS, and washed once using 0.5 x SSC and 0.1% (w/v) for 2 x 5min. Blots were scanned for signal using a phosphorimager .
Production of recombinant PNCl protein and antibody generation; PNCl full length cDNA was sub-cloned into the pTRCHis vector (Invitrogen) for prokaryotic expression vector of a his- tagged protein and into the pGEX-2T plasmid (Invitorgen) for expression of a N-terminal GST-tagged protein in E. coli. Protein expression was induced by IPTG induction and was extracted from E. coli by lysosome digestion, followed by centrifugation of the cell lysate at 131, OOOxgin a sucrose gradient (40-53%) prepared in 1OmM Tris-HCl, 0. ImM EDTA, pH 7.0. The pellet was re-suspended in the Tris buffer and after further centrifugation the pellet was re-suspended in ice cold 1.2% w/v sarkosyl in 1OmM Tris-HCl, 0. ImM EDTA, pH 7 and centrifuged. The supernatant containing his-tagged HH3 protein was then stored at -80°C or affinity purified using by Nickel resin chromatography under denaturing conditions (8M urea) using the Probond resin™ following the manufacturer's instructions ( Invitrogen) . The protein was re-natured by extensive dialysis into 1OmM Tris buffer containing 0.01% Triton-X detergent.
Gradient ion exchange chromatography (DEAE Cellulose 52 column) was used to purify the PNCl protein under native conditions and the protein was eluted with Tris buffer 0- 40OmM NaCl pH7.6.
Rabitts were immunized with 500ug of purified protein followed by two boosts of 500ug and 350ug. Antisera were obtained and affinity purified by adsorption to nitrocellulose immobilized PNCl protein followed by elution with 0.2M glycine buffer pH 2.15 and neutralisation with IM K2HPO4 buffer pH7 and extensive dialysis.
Immunofluoresence and microscopy
For immunofluoresence, cells on cover slips were rinsed with Ix PBS and placed in serum-free DMEM with 25nM mitoTracker (Molecular Probes, Hamburg, Germany) for 30 min. Cells were fixed in 3.7% formaldehyde in PHEM buffer (6OmM Pipes, 25mM Hepes, 1OmM EGTA, 2mM MgCl2) pH6.9 for 10 min and permeabilized with 0.1% Triton X-100 in PHEM for 5 minutes. For staining with the anti-Ha antibodies cells, were first pre-blocked with 2.5% normal goat serum in PHEM for 30 min, then incubated with primary antibody, washed with PHEM, and incubated with Cy2- or Cy3-conjugated secondary antibody (Jackson Labs). Cells were photographed using a confocal microscope or UV microscope. Assays for cell proliferation and cell size
Cells were cultured in CM at 3 x 104 cells per well in a 24- well plate. To monitor cell growth, cells were removed to Eppendorf tubes using trypsin-EDTA and centrifuged at 1000 rpm for 3 min. The cell pellets were then resuspended in lOOμl of medium and counted using trypan blue exclusion.
To determine relative cell size, cells in six-well plates were transfected with PNCl siRNA. After incubation for 24, 48, 72, or 96 h cells were trypsinized and re-seeded into 60 mm plates at -30% confluence in CM. Rapamycin (Calbiochem) (100 nM) was added to some cultures 24 h after re-seeding. Cells were removed from plates by trypisinization and resuspended in PBS for FACS analysis. In each sample 10,000 cells were analyzed by flow cytometry and cell quest software (Becton Dickinson) to obtain the mean forward scatter height (FSC-H) .
Cellular protein extracts and western blotting.
Cellular protein extracts were prepared by lysing in lysis buffer (Tris-HCl, pH 7.4, 15OmM NaCl, 1% Nonidet P-40) , plus the tyrosine phosphate inhibitor Na3VO4, (ImM) and the protease inhibitors phenylmethlysulfonyl fluoride (ImM), pepstatin (IDm), and aprotinin (1.5μg/ml). After incubation at 4°C for 20 min, nuclear and cellular debris were removed by micro-centrifugation at 14,000rpm for 15 min at 4°C. For western blot analysis proteins were resolved by SDS-PAGE on 4-15% gradient gels and transferred to nitrocellulose membranes. Blots were incubated for Ih at room temperature in TBS containing 0.05% Tween 20 (TBS-T) and either 5% milk (w/v) or 2% BSA. This was followed by primary antibody incubations overnight at 4°C. The anti-phospho S6K1 Thr 389 and Thr 421/424, anti-S6Kl, anti-phospho-4E-BPl, anti- phospho-Akt, anti-Akt polyclonal antibodies, anti-p-AMPK, anti-P-ACC, and the anti-phospho-p42/44 MAP kinase monoclonal antibody were all from Cell Signaling Technology
(Beverly, MA) . The anti-Ha antibody 12CA5 was from Roche Molecular Biochemicals (East Sussex, UK) . The anti-actin monoclonal antibody was from Sigma. Secondary antibodies conjugated with horse radish peroxidase were used for detection with enhanced chemiluminescence (ECL, Amersham Biosciences) .
SiRNA oligonucleotides, shRNA and transfection. Small interfering RNAs (siRNA) (Elbashir et al., 2001) oligonucleotides were obtained from MWG (Ebersberg, Germany) . An oligonucleotide complementary to both the human and mouse sequence of the pncl gene ( (aauuugguuggaguugcacca SEQUENCE ID NO: 6) corresponding to nucleotides 311-332 in human gene and nucleotides 304-325 in mouse gene after the start codon. Two other pre-designed oligonucleotides specific for the human gene were obtained from Ambion (siRNAl ID no. 123672 and siRNA3: ID No: 123672. A negative control siRNA (negative control nol) was also obtained from Ambion. Transfection was carried out using OligofectAMINE transfection reagent (Invitrogen) with concentrations of oligonucleotide ranging fromlOnM to 20OnM. All concentrations tested showed similar specific effects on suppressing protein expression and decreasing cell size. For most experiments 5OnM of oligonucleotide was used. Expression of the transfected Ha-PNCl protein was assessed by western blotting using the anti-Ha antibody. RNA levels were assessed using semi-quantitative or quantitative RT-PCR 48-96 h after transfection. Stable transfectants of HeLA cells expressing shRNA from the pSuper vector (Invitrogen) were generated after transfection with lipofectamine and selection in geneticin. Cells were cloned and a different clones with PNCl stably expressed by 50-70% of that in vector-transfected cells were isolated.
Semi quantitative and quantitative RT-PCR.
Total RNA was isolated from cells using the RNeasy kit (Qiagen, West Sussex, U.K.) and treated with DNase I. CDNA synthesis was carried out by reverse transcription with equal amounts of RNA (2 Dg) using a cDNA synthesis kit (Roche) . Equal amounts of cDNA were amplified. This was confirmed by amplification of gapdh or Igf-lr. The quantity of reverse transcription reaction used for amplification was non-saturating for the PCR product after the selected number of amplification cycles. For MCF-7, MCFlOA cells and Jurkat cells cultured in complete medium 36 cycles were used. For R- cells stimulated with insulin 39 cycles were used, and for MCF-7 cells stimulated with IGF-I 33 cycles were used.
For quantitative PCR RNA was later reverse transcribed by M-MLV reverse transcriptase with oligo dTi2-i8 (Invitrogen) priming and 37°C incubation for I hour. Quantitative PCR was carried out using the ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA) with QuantiTect SYBR Green technology (Qiagen) . Primers for the HH3 gene and for GAPDH as housekeeping gene are indicated (HH3: forward primer, 5 ' -GCTCTGCAGCTTTTATCACAAATTC-S ' (SEQUENCE ID NO: 9) and reverse primer, 5 ' -AACGTAACGAGCACACTGGAGTG-S ' (SEQUENCE ID NO: 10); GAPDH: forward primer, 51- CCCATGTTCGTCATGGGTGTGA-3 ' (SEQUENCE ID NO: 11) and reverse primer, 5 ' -TGGTCATGAGTCCTTCCACGATACC-3 ' (SEQUENCE ID NO: 12)). Plates were heated for 15 min at 95 0C, and forty PCR cycles consisting of 15 s at 95 0C, 30 s at 60 °C and 30 s at 72 0C were applied. Samples were subsequently heated to 95 0C. Results were expressed as DeltaDelta Cτ [ (Cτ HH3-CT GAPDH) siRNA- (Cτ HH3-CTGAPDH) neg] and as relative amounts to negative control. In these assays , PNCl siRNA 3 achieved a reduction in the HH3 transcript of between 75 and 80%.
Mitochondrial Isolation.
Cells were removed from plates by trypsinization followed by washing with PBS and centrifugation at 10Ox g to generate a pellet. A volume of mitochondrial extraction buffer (10 mM Tris-Cl, pH 7.5, 210 mM sucrose, 70 mM sorbitol, 10 mM NaCl, ImM EDTA, 1.5 mM MgCl2) equivalent to three times the volume of the pellet was added. Cells were homogenized by fine needle (26G) aspiration 10 times and the homogenates centrifuged at lOOOg for 15 minutes at 4°C. The supernatants were removed to fresh tubes and re-centrifuged at lOOOg to remove any residual cellular contaminants. The supernatants were again removed and centrifuged at 700Og for 15 minutes at 4°C. The pellet obtained is the mitochondrial fraction. This was then washed three times with PBS to remove any remaining cytosolic fraction contaminants.
Extraction and Analysis of nucleotides.
The cell or mitochondrial pellet was gently resuspended in an ice-cold 6% solution of trichloroacetic acid to precipitate protein. Samples were incubated on ice for 10 minutes, and centrifuged at 20,80Og for 10 minutes at 4°C. The protein pellet was discarded, and, to remove the acid, an equal volume of 7.0 % trioctylamine in Freon (1,1,2 trichlorotrifluoroethane) was added to the retained supernatant. The mixture was shaken vigorously, and then centrifuged at 20,800 g for 5 minutes at 4°C. The nucleotides were recovered in the upper aqueous phase. Chromatographic separation of the nucleotide pools was achieved using reverse phase, ion-pairing HPLC on a Vydac C18 column (250 x 4.6 mm, 5Dm particle size) fitted with a C18 guard column. The mobile phase consisted of buffer A (4.0 mM tetrabutylammonium bisulphate, 100 mM KH2PO4, pH 6.0) and Buffer B, which was prepared by adding 30% methanol to Buffer A. Buffers were filtered and degassed before use. Separation was achieved at 1 ml/minute using the following gradient: 0-20% buffer B over 8 minutes, 20-70% B over 12 minutes and then a decrease to 0% B over 5 minutes. Nucleotide standard solutions, prepared using a 5'- nucleotide and nucleoside kit from Sigma, were used to validate peak positions.
Measurement of Cellular ROS Mitochondria mass was assessed by first fixing cells in PBS containing 2% formaldehyde and 2% glutaraldehyde for 30 min at 37°C, followed by incubation in PBS containing 25nM MitoTracker dye (Molecular Probes) for 30 mins . Cells were washed and analyzed by flow cytometry. Cellular ROS were assessed by incubating cells in PBS containing lOuM H2DCFDA fluorescent probe (Molecular Probes) for 15 minutes in the dark at 20°C.
RESULTS Expression of a mitochondrial carrier is enhanced in IGF-IR- transformed fibroblasts.
Suppressive subtractive hybridization (SSH) was used to isolate cDNAs that were differentially expressed between the R- and R+ cell lines (Loughran, et al., 2005. Gene expression profiles in cells transformed by overexpression of the IGF-I receptor. Oncogene 24:6185-6193)). The mRNA for one of these was confirmed by northern blotting (Fig. IA) to be more abundantly expressed in R+ cells than in R- cells. This cDNA was used to probe a multiple tissue blot, which showed high expression of mRNA in liver and testis, lower levels in heart and brain but undetectable levels in spleen, lung, skeletal muscle, or kidney (Fig. IB) . A comparison of both the human and mouse sequences with those in the EMBL Nucleotide Sequence database showed that this cDNA encoded a member of the mitochondrial carrier family (Kunji, E. R.
(2004). The role and structure of mitochondrial carriers.
FEBS Lett 564, 239-244; Palmieri, F. et al.,. (2006).
Identification of mitochondrial carriers in Saccharomyces cerevisiae by transport assay of reconstituted recombinant proteins. Biochim Biophys Acta 1757, 1249-1262) .
This gene is located on human chromosome 1 (Ip36.22), and its product (Q9BSK2) has another isoform (Q96CQ1) with 60 % identity that is located on chromosome 3. The nucleic acid sequence of the gene is provided in SEQUENCE ID NO: and the amino acid sequence of the protein is provided in SEQUENCE ID NO:
PNCl expression in transformed cells and induction by IGF-I and insulin
Pncl mRNA was detected in the breast carcinoma cell line MCF-7, but not in the non-tumorigenic breast epithelial cell line MCFlOA (Fig. 3A) . Similarly pncl mRNA was detected in the Jurkat T lymphocytic leukemia cell line, but not in primary T lymphocytes. (Fig. 2A). This indicates that there is generally increased PNCl expression in transformed cells. To investiage whether pncl expression was regulated by IGF- I or insulin, R+ cells were starved of serum, then stimulated with IGF-I, and analyzed by northern blotting for pncl expression. In R+ cells pncl mRNA was low in starved cells but was rapidly induced after 2 hours of IGF-I stimulation (Fig. 2C) . In MCF-7 cells pncl mRNA expression was induced by 4 hours stimulation with IGF-I (Fig. 2C) with a further increase after 24 hours. R-cells were used to investigate whether pncl transcription was responsive to insulin. Pncl mRNA expression was not detectable in starved R- cells but was induced by insulin after 2 and 4 hours, and a further induction was observed after 8 and 12 hours (Fig. 2C) . A similar pattern of pncl induction was observed in the 3T3L1 pre-adipocyte cell line (not shown) . Induction of pncl mRNA by IGF-I in MCF-7 cells was found to be dependent on the activity of the PI-3 kinase and mTOR pathways, but not on the Erk mitogen activated protein kinase (MAPK) pathway. This was determined by pharmacological inhibition of each of these three pathways with LY29004 (PI3-kinase inhibitor), Rapamycin (mTOR inhibitor) and PD98059 (Mek inhibitor) before IGF-I stimulation (Fig. 2D) .
Taken together these data indicate that pncl expression is enhanced in transformed cell lines and primary tumours and is rapidly responsive to either insulin or IGF-I signalling through the PI3-kinase/mTOR pathway.
Over-expressed PNCl causes an increase in cell size. Plasmids encoding PNCl as either a GFP- or Ha-fusion protein were transiently transfected into MCF-7 or HeLa cells. Confocal microscopy showed that GFP-PNCl was co-localized with mitoTracker, which specifically labels mitochondria (Fig. 3A) . HeLa cells transiently expressing Ha-PNCl were co-stained with an anti-Ha antibody and a human anti-mito antibody, which labels mitochondrial membranes. This experiment demonstrated that Ha-PNCl became localized to mitochondrial membranes. Over-expression of PNCl had no discernible effect on mitochondrial membrane polarization as assessed with the JCl probe (data not shown) , which indicates that it does not alter the integrity of the mitochondrial membrane.
The effects of PNCl levels on cell size and growth were assessed in clones of MCF-7 cells that stably over-expressed PNCl. Cell size was determined by flow cytometry analysis of cells cultured in complete medium. MCF-7/Ha-PNCl cells consistently exhibited an increased light scatter compared with Neo cells, which is indicative of increased cell size (Figure 3B) . MCF-7 /Ha-PNCl cells cultured in either 10% FBS, IGF-I, or insulin showed very little difference in proliferation compared to the control cells (Neo) (not shown) . These data indicate that over-expressed PNCl promotes cell growth.
Suppression of PNCl by siRNA causes decreased cell size and decreased proliferation.
Several siRNA oligonucleotides directed against PNCl were used to suppress its expression in either MCF-7, MCF-7/Ha- PNCl, Dul45 prostate carcinoma, or HeLa cervival carcinoma cell lines. The Ha antibody was used to detect over- expressed PNCl protein, and RT-PCR was used to detect endogenous PNCl mRNA. In MCF-7 cells Ha-PNCl protein expression was reduced at 2, 3, and 4 days in MCF-7/HaPNCl cells transfected with PNCl siRNA compated with control
(Fig.4A). RT-PCR analysis demonstrated that endogenous PNCl mRNA was reduced in PNCl siRNA-treated MCF-7/Neo cells, but mRNAs for the folate and dicarboxylate mitochondrial carriers (Fiermonte et al., 1998; Titus and Moran, 2000) were not reduced (shown in Figure 4B at 72 hours after transfection) . Cell size was reduced in MCF-7/Neo, MCF-7/Ha- PNCl cultures at 48, 72, and 96 hours after transfection with PNCl siRNA. Data shown compare mock transfected cells with PNCl siRNA-transfected cells after 96 hours (Fig. 4C) . As a control, cells were treated with Rapamycin, which causes decreased cell size through inhibition of mTOR. Rapamycin caused a similar decrease in cell size as the PNCl siRNA in MCF-7/Neo cells and caused a smaller decrease in cell size than the PNCl siRNA in MCF-7/HaPNCl cells. Cell size was also reduced in MCF-7, DU145 cells and HeLa cells that had reduced PNCl expression due to siRNA transfection (Fig. 4D) . Proliferation of the PNCl siRNA-treated MCF-7 cell cultures was greatly decreased over 96 hours compared with control siRNA-transfected cells (Fig. 4E). These data indicate that that reduced PNCl expression retards cell growth and proliferation.
PNCl suppression decreases mitochondrial UTP levels. Total cellular nucleotides were extracted from PNCl siRNA- transfected MCF-7 cells and controls and were assessed by HPLC analysis using purified nucleotide as references. Due to a decrease in proliferation of MCF-7 cells transfected with PNCl siRNA the total amount of nucleotides extracted was always lower than in cells transfected with control siRNA. The GTP peak was thus used as an internal standard and the quantity of other nucleotides are expressed as a percentage of the quantity of GTP. As can be seen in Figure 6A the levels of total cellular UTP were lower in the PNCl siRNA-treated cells compared with the controls. However, ATP and ADP were not significantly different and the ratio of ADP:ATP appeared to be unaltered. The latter result was confirmed using a luminescence-based assay for cellular ATP (not shown) . Nucleotide levels in mitochondrial fractions that were isolated from cells by differential centrifugation were assessed. This demonstrated that UTP levels were significantly lower in PNCl siRNA-transfected MCF-7 cells compared with controls, while ADP, ATP and GTP were not altered signifcantly (Fig. 6B). It was also noted that the ADP:ATP ratio, which is higher in isolated mitochondria than in total cell extracts, was not altered by suppression of PNCl. Expression of the mitochondrial marker cytochome C and the cytoplasmic marker paxillin in the same amount of total protein demonstrated that the mitochondrial fraction was uncontaminated (Fig.6C).
•These data indicate that suppression of PNCl expression decreases total cellular UTP levels as well as accumulation of mitochondrial UTP. This suggests that the effects on cell growth are due its function as a UTP carrier.
Activation of mTOR is only moderately affected by PNCl expression .
IGF-I-mediated activation of Akt in MCF-7/Ha-PNCl cells was investigated. As can be seen in Figure 7A, IGF-I-mediated phosphorylation of Akt was similar in MCF-7/Ha-PNCl and MCF-
7/Neo cells. Phosphorylation of the mTOR target S6K1 was very slightly increased in MCF-7/Ha-PNCl cells at 2 min and 5 min after IGF-I stimulation (Fig. 7A). mTOR pathway activity was measured in cells where PNCl expression was suppressed using siRNA. In MCF-7/Ha-PNCl cells reduced PNCl expression was accompanied by a slight but reproducible reduction in S6K1 phosphorylation on both the Thr 421/424 and Thr 389 phosphorylation sites at 30 sec 2 min, 5 min, and 10 min IGF-I stimulation (Fig. 6B) Phosphorylation of 4E-BP1 was also reduced in the PNCl siRNA-treated cells, but Akt phosphorylation was similar in the control and siRNA-treated cells. A similar reduction in S6K1 phosphorylation was observed in MCF-7 cells using two different siRNAs (Fig. 6D) .
D-Galactosamine suppresses IGF-I-mediated activation of the mTOR pathway.
To test whether depletion of cellular UTP would affect IGF- I-mediated activation cells were MCF-7 cells were incubated with D-galactosamine for 2 hours in serum starved cultures, and then stimulated with IGF-I. As can be seen in Figure 7, IGF-I-mediated phosphorylation of Erk was similar whether cells were treated with D-GAL or not. However, in D-GAL treated cells phosphorylation of Akt was reduced slightly, and phosphorylation of S6K1 and 4EBPl was reduced to a large extent compared to untreated cells. Cellular UTP levels were reduced to 38% of those in untreated cells, whereas UMP was normal, and adenine nucleotides were also reduced (to 45- 65%) in D-GAL-treated cells, as assessed by HPLC analysis (not shown) . These data indicate that altered cellular nucleotide levels disrupt mTOR activation, which suggests that decreased PNCl expression could suppress mTOR activation . PNCl expression modulates AMPK activation in cells. MCF-7 cells over-expressing PNCl and HeLa cells with PNCl suppressed were assessed for AMPK activation in basal conditions or in response to IGF-I stimulation. Cell lysates were assessed for phosphorylation of AMPK on serine 172 using an anti phosphoserine AMPK antibody and western blotting. In MCF-7/Neo cells AMPK phosphorylation on threonine 172 was low in starved cells and induced by IGF-I at 5 and 10 minutes (Fig. 8A) . However, in two clones of MCF-7/PNC1 cells AMPK phosphorylation was not increased by IGF-I). This result indicates that over-expression of PNCl suppresses IGF-I-mediated activation of AMPK. In two clones of HeLA cells with stably suppressed PNCl due to expression of a short hairpin ShRNA targeted to PNCl, phosphorylation of AMPK was increased in basal culture conditions (10% FBS) compared with cells expressing a control shRNA (Fig. 8B). A similar result was observed with siRNA in MCF-7 cells, which demonstrated increased AMPK in response to PNCl suppression (data not shown) . These results indicate that suppression of PNCl is accompanied by an increase in AMPK activity regardless of IGF-I stimulation and in the absence of the upstream AMPK kinase LKBl (because HeLA cells do not express LKBl).
PNCl expression regulates cellular ROS levels: PNCl expression may elicit a mitochondrial retrograde or stress signaling response, which is associated with increased cellular ROS and has been proposed as an important mechanism of communication between mitochondria and nucleus in response to physiological and pathological stimuli . This retrograde signalling can influence cellular phenotype and cause epithelial mesenchymal transitions associated with development and tumour metastasis (Butow, R. A., and Avadhani, N. G. (2004). MoI Cell 14, 1-15). Amuthan, et al., . (2002).. Oncogene 21, 7839-7849)
. To test this cellular ROS levels were measured in cells with either increased or decreased PNCl expression. As can be seen in Figure 9A MCF-7 cells over-expressing PNCl had decreased basal cellular levels of ROS compared with Vector controls in normal culture conditions. MCF-7 cells with suppressed PNCl had increased cellular ROS compared with controls (Fig. 9B). HeLa cells with stably suppressed PNCl expression also had increased ROS levels (data not shown) . These data indicate that cellular ROS levels are strongly influenced by PNCl expression, and suggest that PNCl has a function in regulating mitochondrial retrograde signalling.
Screening Methods
In accordance with the invention, non-cell based assay systems may be used to identify compounds that interact with, i. e. bind to PNCl, and regulate the enzymatic activity of PNCl. Such compounds may act as antagonists or agonists of PNCl activity and may be used to regulate cell metabolism. PNCl peptides corresponding to different functional domains or subunit fusion proteins may be expressed and used in assays to identify compounds that interact with PNCl. To this end, soluble regions of PNCl may be recombinantly expressed and utilized in non-cell based assays to identify compounds that bind to PNCl. The PNCl may also be one which has been fully or partially isolated from cell membranes, or which may be present as part of a crude or semi- purified extract.
The basis of the assays used to identify compounds that bind to PNCl involves preparing a reaction mixture of the PNCl and the test compound under conditions and for time sufficient to allow the two components to interact and bind, thus forming a complex which can be removed and/or detected in the reaction mixture. The identity of the bound test compound is then determined. For example, one method to conduct such an assay involves anchoring the protein, polypeptide, peptide, fusion protein or the test substance onto a solid phase and detecting PNCl/test compound complexes anchored on the solid phase at the end of the reaction. In one embodiment of such a method, the PNCl reactant is anchored onto a solid surface, and the test compound, which is not anchored, may be labeled.
In practice, microtitre plates conveniently can be utilized as the solid phase. The anchored component is immobilized by non-covalent or covalent attachments. The surfaces may be prepared in advance and stored. In order to conduct the assay, the non-immobilized component is added to the coated surfaces containing the anchored component. After the reaction is completed, unreacted components are removed (e.g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously non- immobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously non-immobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the solid surface; e. g., using a labeled antibody specific for the previously non-immobilized component .
Alternatively, a reaction is conducted in a liquid phase, the reaction products separated from unreacted components using an immobilized antibody specific for PNCl protein, fusion protein or the test compound, and complexes detected using a labeled antibody specific for the other component of the possible complex to detect anchored complexes.
In accordance with the invention, a cell based assay system can be used to screen for compounds that modulate the activity of PNCl, the system employing cells that express PNCl. In one embodiment, a cell based assay system can be used to screen for compounds that modulate the expression of PNCl within a cell.
Assays may be designed to screen for compounds that regulate PNCl expression at either the transcriptional or translational level. In one embodiment, DNA encoding a reporter molecule can be linked to a regulatory element of the PNCl gene encoding PNCl and used in appropriate intact cells, cell extracts or lysates to identify compounds that modulate PNCl gene expression. Such reporter genes may include but are not limited to chloramphenicol acetyltransferase (CAT), luciferase, p-glucuronidase (GUS), growth hormone, or placental alkaline phosphatase (SEAP) .
Such constructs are introduced into cells thereby providing a recombinant cell useful for screening assays designed to identify modulators of PNCl gene expression. Following exposure of the cells to the test compound, the level of reporter gene expression may be quantitated to determine the test compound's ability to regulate PNCl expression. Alkaline phosphatase assays are particularly useful in the practice of the invention as the enzyme is secreted from the cell.
Therefore, tissue culture supernatant may be assayed for secreted alkaline phosphatase. In addition, alkaline phosphatase activity may be measured by calorimetric, bioluminescent or chemiluminescent assays such as those described in Bronstein, I . et al. (1994, Biotechniques 17: 172-177) . Such assays provide a simple, sensitive easily automatable detection system for pharmaceutical screening.
In an embodiment of the invention, the level of PNCl expression can be modulated using RNA interference, antisense or ribozyme approaches to inhibit or prevent translation of PNCl mRNA transcripts or triple helix approaches to inhibit transcription of the PNCl gene. Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to PNCl mRNA. The antisense oligonucleotides will bind to the complementary mRNA transcripts and prevent translation.
In yet another embodiment of the invention, ribozyme molecules designed to catalytically cleave PNCl mRNA transcripts can also be used to prevent translation and expression of PNCl. (See, e. g. , PCT International PublicationW090/11364, published October 4,1990 ; Sarver et al. , 1990, Science 247: 1222-1225). Cellular or mitochondrial UTP levels may be employed as a surrogate marker of PNCl protein activity, and hence as of identifying any modulation in the proteins activity in response to treatment with a candidate agent. Methods of extracting and quantifying cellular and mitochondrial UTP levels are described herein, and will also be well known to those skilled in the art. For example, HPLC analysis may be employed in the quantification employing purified nucleotides as references. Further, PNCl expressing MCF-7 cells may be employed as the source of PNCl-expressing cells .
PNCl is also useful as a marker of mitochondria integrity because suppression of PNCI and subsequent lack of accumulation of UTP in mitochondria results in a signal from the mitochondria to the cytoplasm that results in decreased cell growth and proliferation and possible autophagy
(shrinkage and redigestion of cellular components to survive) .
Therapeutic Compositions and Methods of Administration
The invention provides methods of, and compositions for, treatment and prevention by administration to a subject in need of such treatment of a therapeutically or prophylactically effective amount of a therapeutic of the invention. The subject may be an animal or a human, with or without an established disease.
Various delivery systems are known and can be used to administer a therapeutic of the invention, e.g • / encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the therapeutic, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), construction of a therapeutic nucleic acid as part of a retroviral or other vector, etc. Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compositions may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent .
It may be desirable to administer the compositions of the invention locally to the area in need of treatment; this may be achieved, for example and not by way of limitation, by topical application, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. Alternatively, the therapeutic can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327.)
In yet another embodiment, the therapeutic can be delivered in a controlled release system. In one embodiment, a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref.
Biomed., Eng. 14:201 (1987); Buchwald et al . , Surgery 88:75
(1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, FIa. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al . , J. Neurosurg. 71:105 (1989)). In yet another embodiment, a controlled release system can be placed in proximity of the therapeutic target, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)).
An antagonist of PNCl, such as a PNCl-specific antibody, may function as a therapeutic of the invention, and such antagonists may be produced using methods which are generally known in the art. In particular, purified PNCl may be used to produce antibodies or to screen libraries of pharmaceutical agents to identify those which specifically bind PNCl. Antibodies to PNCl may also be generated using methods that are well known in the art. Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, and single chain antibodies, Fab fragments, and fragments produced by a Fab expression library. Neutralizing antibodies (i.e., those which inhibit dimer formation) are generally preferred for therapeutic use. Single chain antibodies (e.g., from camels or llamas) may be potent enzyme inhibitors and may have advantages in the design of peptide mimetics, and in the development of immuno- adsorbents and biosensors (Muyldermans, S. (2001) J. Biotechnol. 74:277-302).
For the production of antibodies, various hosts including goats, rabbits, rats, mice, camels, dromedaries, llamas, humans, and others may be immunized by injection with PNCl or with any fragment or oligopeptide thereof which has immunogenic properties (especially the fragment specified above) . Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, KLH, and dinitrophenol . Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially preferable.
It is preferred that the oligopeptides, peptides, or fragments used to induce antibodies to PNCl have an amino acid sequence consisting of at least about 5 amino acids, and generally will consist of at least about 10 amino acids. It is also preferable that these oligopeptides, peptides, or fragments are identical to a portion of the amino acid sequence of the natural protein. Short stretches of PNCl amino acids may be fused with those of another protein, such as KLH, and antibodies to the chimeric molecule may be produced.
Monoclonal antibodies to PNCl may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique. (See, e.g., Kohler, G. et al. (1975) Nature 256:495-497; Kozbor, D. et al. (1985) J. Immunol. Methods 81:31-42; Cote, R. J. et al. (1983) Proc. Natl. Acad. Sci . USA 80:2026-2030; and Cole, S. P. et al . (1984) MoI. Cell Biol. 62:109-120.)
In addition, techniques developed for the production of "chimeric antibodies," such as the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used. (See, e.g., Morrison, S. L. et al. (1984) Proc. Natl. Acad. Sci. USA 81:6851-6855; Neuberger, M. S. et al. (1984) Nature 312:604-608; and Takeda, S. et al. (1985) Nature 314:452-454.) Alternatively, techniques described for the production of single chain antibodies may be adapted, using methods known in the art, to produce PNCl- specific single chain antibodies. Antibodies with related specificity, but of distinct idiotypic composition, may be generated by chain shuffling from random combinatorial immunoglobulin libraries. (See, e.g., Burton, D. R. (1991) Proc. Natl. Acad. Sci . USA 88:10134-10137.)
Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature. (See, e.g., Orlandi, R. et al. (1989) Proc. Natl. Acad. Sci. USA 86:3833-3837; Winter, G. et al . (1991) Nature 349:293-299.)
Antibody fragments which contain specific binding sites for PNCl may also be generated. For example, such fragments include, but are not limited to, F(ab').sub.2 fragments produced by pepsin digestion of the antibody molecule and Fab fragments generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity. (See, e.g., Huse, W. D. et al. (1989) Science 246:1275-1281. )
Various immunoassays may be used for screening to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art. Such immunoassays typically involve the measurement of complex formation between PNCl and its specific antibody. A two- site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering PNCl epitopes is generally used, but a competitive binding assay may also be employed (Pound, supra) .
Various methods such as Scatchard analysis in conjunction with radioimmunoassay techniques may be used to assess the affinity of antibodies for PNCl. Affinity is expressed as an association constant, Ka, which is defined as the molar concentration of PNCl-antibody complex divided by the molar concentrations of free antigen and free antibody under equilibrium conditions. The Ka determined for a preparation of polyclonal antibodies, which are heterogeneous in their affinities for multiple PNCl epitopes, represents the average affinity, or avidity, of the antibodies for PNCl. The Ka determined for a preparation of monoclonal antibodies, which are monospecific for a particular PNCl epitope, represents a true measure of affinity. High- affinity antibody preparations with Ka ranging from about 109 to 1012 L/mole are preferred for use in immunoassays in which the PNCl-antibody complex must withstand rigorous manipulations. Low-affinity antibody preparations with Ka ranging from about 106 to 107 L/mole are preferred for use in immunopurification and similar procedures which ultimately require dissociation of PNCl, preferably in active form, from the antibody (Catty, D. (1988) Antibodies, Volume I: A Practical Approach, IRL Press, Washington D. C; Liddell, J. E. and A. Cryer (1991) A Practical Guide to Monoclonal Antibodies, John Wiley & Sons, New York N.Y.).
The titer and avidity of polyclonal antibody preparations may be further evaluated to determine the quality and suitability of such preparations for certain downstream applications. For example, a polyclonal antibody preparation containing at least 1-2 mg specific antibody/ml, preferably 5-10 mg specific antibody/ml, is generally employed in procedures requiring precipitation of Cf5-antibody complexes. Procedures for evaluating antibody specificity, titer, and avidity, and guidelines for antibody quality and usage in various applications, are generally available.
The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of a therapeutic, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the Therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin. Such compositions will contain a therapeutically effective amount of the therapeutic, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration.
In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to, ease pain at the, site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
In the case of cancer, the amount of the therapeutic of the invention which will be effective in the treatment or prevention of cancer will depend on the type, stage and locus of the cancer, and, in cases where the subject does not have an established cancer, will depend on various other factors including the age, sex, weight, and clinical history of the subject. The amount of therapeutic may be determined by standard clinical techniques. In addition, in vivo and/or in vitro assays may optionally be employed to help predict optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the cancer, and should be decided according to the judgment of the practitioner and each patient's circumstances. Routes of administration of a therapeutic include, but are not limited to, intramuscularly, subcutaneously or intravenously. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the compositions of the invention. The invention is not limited to the embodiments hereinbefore described which may be varied in both construction and detail without departing from the spirit of the invention.

Claims

Claims
1. A method of preventing or treating a pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways in an individual in need thereof, the method comprising a step of modulating PNCl protein activity in the individual.
2. A method as claimed in Claim 1 in which the pathology characterised by dysregulated growth, proliferation, survival, migratory, and invasive signalling pathways is one that involves aberrant cell survival, migration, proliferation, invasion, or motility.
3. A method as claimed in Claim 2 in which the pathology is selected from the group comprising: cancer; high blood pressure; hypertension; metabolic disease; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis.
4. A method as claimed in Claim 1 in which the pathology is characterised by aberrant mTOR activity, and is selected from the group comprising: cancer; and neurodegenerative disease .
5. A method as claimed in Claim 1 in which the pathology is characterised by aberrant AMPK activity is selected from the group comprising: high blood pressure; and metabolic disease.
6. A method as claimed in Claim 3 in which the pathology is cancer, and in which the individual is treated with an agent capable of attenuating PNCl protein activity in a cancer cell.
7. A method as claimed in Claim 6 in which the cancer is selected from the group comprising: fibrosarcoma; myxosarcoma; liposarcoma; chondrosarcom; osteogenic sarcoma; chordoma; angiosarcoma; endotheliosarcoma; lymphangiosarcoma; lymphangioendotheliosarcoma; synovioma; mesothelioma; Ewing's tumor; leiomyosarcoma; rhabdomyosarcoma; colon carcinoma; pancreatic cancer; breast cancer; ovarian cancer; prostate cancer; squamous cell carcinoma; basal cell carcinoma; adenocarcinoma; sweat gland carcinoma; sebaceous gland carcinoma; papillary carcinoma; papillary adenocarcinomas; cystadenocarcinoma; medullary carcinoma; bronchogenic carcinoma; renal cell carcinoma; hepatoma; bile duct carcinoma; choriocarcinoma; seminoma; embryonal carcinoma; Wilms' tumor; cervical cancer; uterine cancer; testicular tumor; lung carcinoma; small cell lung carcinoma; bladder carcinoma; epithelial carcinoma; glioma; astrocytoma; medulloblastoma; craniopharyngioma; ependymoma; pinealoma; hemangioblastoma; acoustic neuroma; oligodendroglioma; meningioma; melanoma; retinoblastoma; and leukemias .
8. A method as claimed in Claim 7 in which the cancer is selected from the group comprising: breast; cervical; prostate; and leukemias.
9. A method as claimed in Claim 3 in which the pathology is metabolic disease or elevated blood pressure, and in which the individual is treated with an agent capable of attenuating cellular PNCl protein activity.
10. A method as claimed in Claim 9 in which the metabolic disease is selected from the group comprising: diabetes; metabolic syndrome; and obesity.
11. A method as claimed in Claim 10 in which the diabetes is type II diabetes.
12. A method of inhibiting mTOR function in a biological system comprising the step of treating the biological system with an agent capable of attenuating the PNCl protein activity of the biological system.
13. A method of increasing AMPK function in a biological system comprising the step of treating the biological system with an agent capable of attenuating the PNCl protein activity of the biological system.
14. A method as claimed in any of Claims 12 or 13 in which the biological system is selected from the group comprising: a cell; a cell line; a tissue; on organ; an organism.
15. A method as claimed in any of Claims 6 to 14 in which the agent attenuates PNCl protein activity by means selected from the group comprising: suppression of PNCl expression; and inhibiting PCNl activity.
16. A method as claimed in Claim 15 in which PNCl expression is suppressed by means of siRNA.
17. A method as claimed in Claim 16 in which siRNA molecules are designed to target a sequence in the PNCl mRNA corresponding to nucleotides 311 to 332 in the human pncl gene.
18. A method as claimed in Claims 16 or 17 in which the siRNA molecules are selected from the group comprising: SEQUENCE ID NO: 6; Ambion siRNAl ID. 123672; and dsiRNA3 ID. 123672.
19. A method as claimed in any of Claims 6 to 15 in which the agent inhibits PNCl activity, wherein the agent is a pyrimidine nucleotide analogue.
20. A method as claimed in Claim 3 in which the pathology is neurodegenerative disease, and in which the individual is treated with an agent capable of modulating or effecting an increase in PNCl activity in cells of the neuraxis .
21. A method as claimed in Claim 20 in which the agent is PNCl protein, or a biologically active fragment or variant thereof.
22. A method as claimed in Claim 20 in which the PNCl protein is human PNCl protein.
23. A method as claimed in Claim 20 in which the PNCl protein is recombinant human PCNl protein.
24. A method as claimed in Claim 20 in which the agent is capable of increasing expression of the PNCl gene.
25. A method as claimed in any of Claims 20 to 24 in which the agent is targeted to the cells of the neuraxis by means of a viral delivery vector.
26. A method as claimed in any of Claims 20 to 25 in which the neurodegenerataive disease is selected from the group comprising: amyotrophic lateral sclerosis (ALS) , or variants thereof including primary lateral sclerosis and spinal muscular atrophy; prion disease; Huntington' s disease; Parkinson's disease; Alzheimer's disease; Multiple sclerosis (MS) ; hereditary neuropathies; tauopathies; and diseases involving cerebellar degeneration.
27. Use of an agent capable of modulating PNCl activity as a medicament .
28. Use as claimed in Claim 27 in which the agent is selected from the group comprising: an agent capable of inhibiting PNCl protein; and an agent capable of attenuating PNCl expression.
29. Use as claimed in Claim 28 in which the agent is an siRNA molecule targeted to the PNCl mRNA.
30. Use of PNCl protein, or a biologically active fragment or variant thereof, as a medicament.
31. A pharmaceutical composition comprising an agent capable of modulating PNCl activity, optionally in combination with a suitable pharmaceutical excipient .
32. A method of identifying or monitoring insulin-like growth factor (IGF) signalling pathway activity in a biological system comprising the step of assaying the biological system for PNCl activity.
33. A method of identifying or monitoring AMPK activity in a biological system comprising the step of assaying the biological system for PNCl activity.
34. A method of assessing the transformation status of a cell comprising the step of assaying the cell for expression of PNCl, wherein an increased level of PNCl expression compared to a reference level is indicative of a transformed cell.
35. A method as claimed in Claim 34 in which the reference level of PNCl is obtained from a non-tumorigenic cell line.
36. A method of identifying highly metabolic cells comprising the step of assaying the cell for expression of
PNCl, wherein an elevated level of PNCl expression compared to a reference level is indicative of a highly metabolic cell.
37. A method of assessing the status of mitochondrial integrity or biogenesis in cells comprising the step of determining the PNCl activity of a cell relative to a reference cell having normal metabolism, wherein modulated PNCl activity compared to a reference level is indicative of modulated biogenesis or mitochondrial in the cell.
38. A method of identifying compounds useful in the treatment or prevention of pathologies associated dysregulated growth, proliferation, survival, migratory, and invasive signalling in an individual, comprising determining a reference level of activity of PNCl protein, contacting the PNCl protein with a candidate compound, and determining the level of activity of the contacted PNCl protein, wherein a decrease in the level of activity of the contacted PNCl protein relative to the reference level of PNCl activity is an indication that the candidate compound is useful in the treatment or prevention of .pathologies associated with aberrant mTOR activity or AMPK activity.
39. A method as claimed in Claim 38 in which the pathologies associated with dysregulated growth, proliferation, survival, migratory, and invasive signalling are selected from the group comprising: cancer; high blood pressure; hypertension; metabolic disease; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis.
40. A method as claimed in Claim 38 or 39 in which the PNCl protein is provided in the form of PNCl expressing cells, and in which the level of PNCl activity is correlated with a level of expression of PNCl protein in the cells, and wherein the reference level of PNCl activity is the level of PNCl expression in a non-tumorigenic cell.
41. A method as claimed in Claim 38 or 39 in which the PNCl protein is provided in the form of PNCl expressing cells, and in which the level of PNCl activity is correlated with cellular or mitochondrial UTP levels.
42. A method of identifying an agent that suppresses expression of PNCl protein comprising the steps of providing a source of PNCl expressing cells, treating the cells with a candidate agent, and assaying the cells for expression of PNCl, wherein a decrease in the level of expression of PNCl protein in the treated cells relative to untreated cells is an indication that the candidate agent is useful in suppressing expression of PNCl protein.
43. A method of identifying an agent that inhibits PNCl protein activity, comprising the steps of providing a source of PNCl expressing cells, treating the cells with a candidate agent, and assaying the cells (or an organelle from the cells) for UTP levels, wherein a decrease in the level of UTP in the treated cells (or in organelles from the treated cells ) relative to untreated cells is an indication that the candidate agent is useful in suppressing expression of PNCl protein.
44. Use of a method as claimed in Claims 42 or 43 in identifying agents suitable for treatment or prevention of pathologies associated with dysregulated growth, proliferation, survival, migratory, and invasive signalling.
45. Use as claimed in Claim 44 in which the pathologies are selected from the group comprising: cancer; high blood pressure; hypertension; metabolic disease; cardiovascular disease; neurodegenerative disease; ischemia (of thrombotic or haemorrhagic origin) ; pathologies associated with dysfunctional bone remodelling (i.e. osteoporosis); pathologies associated with dysfunctional tissue remodelling (i.e. wound healing, tissue grafting, corneal injury, tissue transplant and prostheses or other tissue implants.); inflammation and inflammatory disease; autoimmune disorders; infectious disease; renal disease; chronic and acute wounds; tissue damage; and restenosis.
46. An antibody raised against PNCl protein, an immunogenic fragment of PNCl protein, or an isoform of PNCl protein.
47. An antibody as claimed in Claim 46 in which the PNCl protein is of human or mouse origin.
48. An antibody as claimed in Claim 46 or 47 for use as a medicament .
49. A siRNA molecule capable of targeting the pncl gene.
50. A siRNA molecule as claimed in Claim 49 designed to target a sequence in human PNCl mRNA from nucleotides 311 to 332.
51. A siRNA molecule selected from the group comprising: SEQ ID NO: 6.
52. A pharmaceutical composition comprising an agent that attenuates the activity of PNCl and a suitable carrier or pharmaceutical excipient.
53. A pharmaceutical composition as claimed in Claim 52 in which the agent comprises a siRNA molecule of Claims 49 to
51.
54. A pharmaceutical composition as claimed in Claim 52 in which the agent comprises an antibody of any of Claims 46 to 48.
55. A pharmaceutical composition as claimed in Claim 52 in which the agent comprises a ligand which binds specifically to PNCl protein.
56. A pharmaceutical composition as claimed in any of Claims 52 to 55, and further including an effective amount of a cytotoxic agent.
PCT/IE2007/000118 2006-12-01 2007-11-30 Treatment of disease WO2008065637A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US87216606P 2006-12-01 2006-12-01
US60/872,166 2006-12-01

Publications (2)

Publication Number Publication Date
WO2008065637A1 true WO2008065637A1 (en) 2008-06-05
WO2008065637A9 WO2008065637A9 (en) 2009-02-05

Family

ID=39166356

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IE2007/000118 WO2008065637A1 (en) 2006-12-01 2007-11-30 Treatment of disease

Country Status (1)

Country Link
WO (1) WO2008065637A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002014500A2 (en) * 2000-08-16 2002-02-21 Chiron Corporation Human genes and gene expression products
WO2004039956A2 (en) * 2002-10-29 2004-05-13 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
WO2005016962A2 (en) * 2003-08-11 2005-02-24 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
US20050227917A1 (en) * 1997-12-23 2005-10-13 Williams Lewis T Gene products differentially expressed in cancerous cells and their methods of use II

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050227917A1 (en) * 1997-12-23 2005-10-13 Williams Lewis T Gene products differentially expressed in cancerous cells and their methods of use II
WO2002014500A2 (en) * 2000-08-16 2002-02-21 Chiron Corporation Human genes and gene expression products
WO2004039956A2 (en) * 2002-10-29 2004-05-13 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
WO2005016962A2 (en) * 2003-08-11 2005-02-24 Genentech, Inc. Compositions and methods for the treatment of immune related diseases

Also Published As

Publication number Publication date
WO2008065637A9 (en) 2009-02-05

Similar Documents

Publication Publication Date Title
Ooki et al. High-molecular-weight hyaluronan is a hippo pathway ligand directing cell density-dependent growth inhibition via PAR1b
Yi et al. Tumor-derived platelet-derived growth factor-BB plays a critical role in osteosclerotic bone metastasis in an animal model of human breast cancer
Li et al. Cornulin is induced in psoriasis lesions and promotes keratinocyte proliferation via phosphoinositide 3-kinase/Akt pathways
US9316654B2 (en) TAZ/WWTR1 for diagnosis and treatment of cancer
KR101048316B1 (en) Use of TRM72 as a target for muscle and heart enhancers
WO2008020596A2 (en) Treating or preventing cancers over-expressing reg4 or kiaa0101
EP2565275B1 (en) Method of treatment of vascular complications using modulators of TRX and TRXNIP
WO2006108023A2 (en) Methods and compositions for modulating necdin function
Kim et al. Estradiol-ERβ2 signaling axis confers growth and migration of CRPC cells through TMPRSS2-ETV5 gene fusion
US20170100313A1 (en) Methods of inhibiting, protecting against, or treating uvr-induced skin damage
Lou et al. MFAP3L activation promotes colorectal cancer cell invasion and metastasis
JP2009523409A (en) Compositions and methods for cancer treatment and diagnosis
Hishida et al. A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion
KR101343840B1 (en) Chaperoning Composition comprising RPS3a and composition for diagnosing HBV-associated Hepatocellular Carcinoma comprising RPS3a
US9492472B2 (en) Compositions and methods of treating cancer
Okabe-Kado et al. NM23 downregulation and lysophosphatidic acid receptor EDG2/lpa1 upregulation during myeloid differentiation of human leukemia cells
WO2008065637A1 (en) Treatment of disease
JP2014095643A (en) Screening method for inflammatory disease therapeutic agent, and treatment and inspection of inflammatory disease
US20130089538A1 (en) Treating cancer by modulating mammalian sterile 20-like kinase 3
Masilamani et al. Calpain-mediated cleavage generates a ZBTB18 N-terminal product that regulates HIF1A signaling and glioblastoma metabolism
KR102194536B1 (en) A Composition for Predicting Response to Tamoxifen
US20210052598A1 (en) Compositions and methods for treating cancer
EP4257146A1 (en) Cystic lymphangioma treatment drug
US20170258871A1 (en) Combined use of a trka inhibitor and an epha2 inhibitor for using in the treatment of solid cancers, and method for the prognosis of survival of a patient who has a solid cancer
EP2292266A1 (en) Treating cancer by modulating copine III

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07827131

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07827131

Country of ref document: EP

Kind code of ref document: A1