WO2008058239A2 - Spink1 as a prostate cancer marker and uses thereof - Google Patents

Spink1 as a prostate cancer marker and uses thereof Download PDF

Info

Publication number
WO2008058239A2
WO2008058239A2 PCT/US2007/084090 US2007084090W WO2008058239A2 WO 2008058239 A2 WO2008058239 A2 WO 2008058239A2 US 2007084090 W US2007084090 W US 2007084090W WO 2008058239 A2 WO2008058239 A2 WO 2008058239A2
Authority
WO
WIPO (PCT)
Prior art keywords
spinkl
overexpression
erg
rna
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2007/084090
Other languages
English (en)
French (fr)
Other versions
WO2008058239A9 (en
WO2008058239A3 (en
Inventor
Arul M. Chinnaiyan
Scott A. Tomlins
Daniel R. Rhodes
Rohit Mehra
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Michigan System
University of Michigan Ann Arbor
Original Assignee
University of Michigan System
University of Michigan Ann Arbor
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US12/513,637 priority Critical patent/US20100129804A1/en
Priority to CA 2668961 priority patent/CA2668961A1/en
Priority to EP20070864115 priority patent/EP2079851B1/en
Priority to CN2007800495248A priority patent/CN101652484B/zh
Priority to JP2009536481A priority patent/JP2010508855A/ja
Priority to AU2007317306A priority patent/AU2007317306B2/en
Application filed by University of Michigan System, University of Michigan Ann Arbor filed Critical University of Michigan System
Publication of WO2008058239A2 publication Critical patent/WO2008058239A2/en
Publication of WO2008058239A3 publication Critical patent/WO2008058239A3/en
Priority to IL198526A priority patent/IL198526A/en
Anticipated expiration legal-status Critical
Publication of WO2008058239A9 publication Critical patent/WO2008058239A9/en
Priority to IL21537311A priority patent/IL215373A/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/57434Specifically defined cancers of prostate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/81Protease inhibitors
    • G01N2333/8107Endopeptidase (E.C. 3.4.21-99) inhibitors
    • G01N2333/811Serine protease (E.C. 3.4.21) inhibitors
    • G01N2333/8135Kazal type inhibitors, e.g. pancreatic secretory inhibitor or ovomucoid

Definitions

  • compositions and methods for cancer research, diagnosis, and treatment including but not limited to, cancer markers are provided.
  • cancer markers including but not limited to, SPINKl and other markers for prostate cancer are provided.
  • Prostate cancer is the most common nondermatologic cancer and the second most common cause of cancer-related deaths in American men.
  • the number of prostate cancers recorded in cancer registries in the United States and the United Kingdom has increased markedly in the past 15 years. This change predominantly represents an increase in the number of cancers diagnosed rather than a real increase in the number of cancers in the population.
  • 234,460 new cases and 27,350 deaths were estimated to occur. It was determined that approximately 91% of these new cases would be diagnosed at local or regional stages.
  • Prostate cancer is typically diagnosed with a digital rectal exam and/or prostate specific antigen (PSA) screening.
  • PSA prostate specific antigen
  • An elevated serum PSA level can indicate the presence of PCa.
  • PSA is used as a marker for prostate cancer because it is secreted only by prostate cells.
  • a healthy prostate will produce a stable amount — typically below 4 nanograms per milliliter, or a PSA reading of "4" or less — whereas cancer cells produce escalating amounts that correspond with the severity of the cancer.
  • a level between 4 and 10 may raise a doctor's suspicion that a patient has prostate cancer, while amounts above 50 may show that the tumor has spread elsewhere in the body.
  • a transrectal ultrasound is used to map the prostate and show any suspicious areas.
  • Biopsies of various sectors of the prostate are used to determine if prostate cancer is present.
  • Treatment options depend on the stage of the cancer. Men with a 10-year life expectancy or less who have a low Gleason number and whose tumor has not spread beyond the prostate are often treated with watchful waiting (no treatment).
  • Treatment options for more aggressive cancers include surgical treatments, such as radical prostatectomy (RP) in which the prostate is completely removed (with or without nerve sparing techniques), and radiation, applied through an external beam that directs the dose to the prostate from outside the body or via low-dose radioactive seeds that are implanted within the prostate to kill cancer cells locally.
  • RP radical prostatectomy
  • radiation applied through an external beam that directs the dose to the prostate from outside the body or via low-dose radioactive seeds that are implanted within the prostate to kill cancer cells locally.
  • Anti-androgen hormone therapy is also used, alone or in conjunction with surgery or radiation.
  • Hormone therapy uses luteinizing hormone-releasing hormones (LH-RH) analogs, which block the pituitary from producing hormones that stimulate testosterone production. Patients must have injections of LH-RH analogs for the rest of their lives. While surgical and hormonal treatments are often effective for localized PCa, advanced disease remains essentially incurable. Androgen ablation is the most common therapy for advanced PCa, leading to massive apoptosis of androgen- dependent malignant cells and temporary tumor regression. In most cases, however, the tumor reemerges with a vengeance and can proliferate independent of androgen signals.
  • PSA screening is currently the single best test for prostate cancer and is widely used in the diagnosis of prostate cancer, but it does not help in determining whether the detected cancer will cause clinically significant disease.
  • PSA is an excellent marker for the follow-up of patients with established prostate cancer
  • some men with prostate cancer may have normal PSA levels.
  • a moderate elevation of the PSA level (4-10 ng/mL) has a low specificity for prostate cancer, and an elevated PSA level is not specific for prostate cancer. Elevated serum PSA levels may also be associated with prostatitis, prostate infarction, PIN, prostate biopsy, transurethral resection of the prostate, and urethral catheterization.
  • the free-to-total PSA ratio measures both bound and free PSA as a percentage of total PSA and is a useful additional discriminator between cancer and benign pathology, especially in patients with moderately elevated serum PSA levels (4-10 ng/mL). This ratio is also useful in determining whether a repeat biopsy is appropriate in a patient with a moderately elevated PSA level whose initial systematic biopsy results are negative. The lower the percentage of free PSA, the higher the likelihood of cancer.
  • a method for identifying prostate cancer in a patient comprising: providing a sample containing prostate cells from the patient; detecting in the sample containing prostate cells overexpression of SPINKl compared to normal expression of SPINKl; and, detecting in the sample containing prostate cells normal expression of ERG and/or ETVl, wherein detecting in the sample containing prostate cells mutually exclusive overexpression of SPINKl compared to normal expression of ERG and/or ETVl identifies prostate cancer in the patient.
  • the detecting step comprises detecting overexpression of SPINKl RNA.
  • the detecting step comprises detecting overexpression of SPINKl protein.
  • the sample containing prostate cells is prostate tissue, blood, urine, semen, prostatic secretions or isolated prostate cells. In some embodiments, detecting in the sample containing prostate cells overexpression of SPINKl identifies invasive prostate cancer in the patient. In some embodiments, the sample containing prostate cells is from a patient following radical prostatectomy and overexpression of SPINKl identifies recurrence of prostate cancer in the patient following radical prostatectomy.
  • a method for identifying prostate cancer in a patient comprising: providing a sample containing prostate cells from the patient; and, detecting in the sample containing prostate cells: (a) overexpression of SPINKl compared to normal expression of SPINKl and overexpression of PCA3 compared to normal expression of PCA3; (b) overexpression of SPINKl compared to normal expression of SPINKl and overexpression of GOLPH2 compared to normal expression of GOLPH2; (c) overexpresssion of SPINKl compared to normal expression of SPINKl and presence of TMPRSS2:ERG; (d) overexpression of SPINKl compared to normal expression of SPINKl, overexpression of PCA3 compared to normal expression of PC A3 and overexpression of GOLPH2 compared to normal expression of GOLPH2; (e) overexpression of SPINKl compared to normal expression of SPINKl, overexpression of PCA3 compared to normal expression of PCA3 and presence of TMPRS S2:ERG; (
  • the detecting step comprises detecting overexpression of SPINKl RNA. In other embodiments, the detecting step comprises detecting overexpression of SPINKl protein.
  • the sample containing prostate cells is prostate tissue, blood, urine, semen, prostatic secretions or isolated prostate cells.
  • a composition comprising at least one of the following: (a) a first oligonucleotide probe comprising a sequence that hybridizes specifically to SPINKl RNA or cDNA, a second oligonucleotide probe comprising a sequence that hybridizes specifically to ERG RNA or cDNA, and a third oligonucleotide probe comprising a sequence that hybridizes specifically to ETVl RNA or cDNA; (b) a first pair of amplification oligonucleotides wherein each amplification oligonucleotide in the first pair comprises a sequence that hybridizes specifically to SPINKl RNA or cDNA, a second pair of amplification oligonucleotides wherein each amplification oligonucleotide in the second pair comprises a sequence that hybridizes specifically to ERG RNA or cDNA, and a third pair of amplification oligonucleotides wherein each amplification oligonugonu
  • a composition comprising at least one of the following: (a) at least two oligonucleotide probes comprising: (i) an oligonucleotide probe comprising a sequence that hybridizes specifically to SPINKl RNA or cDNA; and (ii) at least one other oligonucleotide probe comprising a sequence that hybridizes specifically to PCA3 RNA or cDNA, GOLPH2 RNA or cDNA, or a junction of a chimeric RNA or cDNA in which a 5' portion of the chimeric RNA is transcribed from a TMPRS S2 gene and a 3' portion of the chimeric RNA is from transcribed from an ERG gene; (b) at least two pairs of amplification oligonucleotides comprising: (i) a pair of amplification oligonucleotides wherein each amplification oligonucleotide comprises a sequence that hybridizes specifically to SPINKl RNA
  • Figure 1 shows that meta COPA identified SPINKl as a mutually exclusive outlier with ERG and ETVl in prostate cancer, a. Genes were ranked by the number of studies in which they scored in the top 100 outliers (ranked by COPA) at any of the three pre-defined percentile cutoffs (75th, 90th, 95th). Genes were further ranked by their average COPA rank (Avg. Rank) in studies where they ranked in the top 100. b. The expression of SPINKl and scatter plots of ERG vs. SPINKl and ETVl vs. SPINKl expression are shown from two studies where SPINKl ranked as a top 100 COPA outlier. Scatter plots are shown for ERG vs. SPINKl (middle panels) and ETVl vs. SPINKl (lower panels) for all samples in both studies.
  • Figure 2 shows that SPINKl over-expression identifies an aggressive subset of ETS negative prostate cancers and can be detected non-invasively.
  • a-b SPINKl expression was evaluated in two cohorts (University of Michigan (UM) and Swedish Watchful Waiting (SWW)) using immunohistochemistry (IHC) on tissue microarrays that have previously been evaluated for TMRPSS2:ERG status by fluorescence in situ hybridization (FISH), a. Representative SPINKl positive and negative cores are shown, along with cells from the same cores negative and positive for TMRPSS2:ERG rearrangement by FISH.
  • UM Universality of Michigan
  • SWW Swedish Watchful Waiting
  • IHC immunohistochemistry
  • Contingency tables for SPINKl expression and TMRPSS2:ERG status and p-values for Fisher's exact tests for both cohorts are indicated, c-e. Relationship between SPINKl outlier expression and biochemical recurrence after surgical resection. Kaplan-Meier analyses of outlier SPINKl expression from the (c) Glinsky et al. DNA microarray dataset and SPINKl IHC from the (d) UM and (e) Memorial Sloan Kettering Cancer Center (MSKCC) cohorts and biochemical recurrence after surgical resection are shown, f. Noninvasive detection of SPINKl outlier-expression in men with TMRPSS2:ERG negative prostate cancer. Contingency table for SPINKl outlier expression and TMPRSS2:ERG status and the Fisher's exact test p-value is shown.
  • Figure 3 shows that knockdown of SPINKl in 22RV 1 prostate cancer cells attenuates invasiveness, a-b.
  • the benign immortalized prostate cell line RWPE was infected with SPINKl or LACZ adenovirus as indicated and assayed for (a) proliferation or (b) invasion through a modified basement membrane, c. qPCR for SPINKl, ERG and ETVl outlier expression, d-f.
  • SPINKl mediates invasiveness in 22RV 1 cells. Cells were assayed for (d) proliferation and (e) invasion. Photomicrographs of invaded cells treated with the indicated siRNA are shown in f. g.
  • VCaP TMPRSS2:ERG positive
  • LNCaP ETVl rearrangement positive prostate cancer cell lines were treated with transfection reagent alone (untreated), or transfected with non-targeting nucleic acid or siRNA against SPINKl, ETVl or ERG as indicated and assayed for invasion.
  • Figure 4 shows meta-outlier genes showing over-expression in benign prostate tissue and ETS positive prostate cancers, a.
  • the expression of meta-outlier genes ORM (ranked 4th) and NEB (ranked 7th) in normalized expression units are shown from the indicated studies, according to the sample classes described in Figure 1, revealing outlier expression in multiple benign samples, b.
  • Figure 5 shows over-expression of SPINKl in prostate cancer compared to benign prostate tissue and mutually exclusive over-expression with ERG and ETVl in DNA microarray studies.
  • the expression of SPINKl and scatter plots of SPINKl vs. ERG and SPINKl vs. ETVl (if measured) for five studies profiling distinct classes of prostate tissue (a) and two studies profiling prostate cancers as part of multi-cancer studies (b) are shown as in Figure 1.
  • Figure 6 shows over-expression of SPINKl in prostate cancer compared to benign prostate tissue and mutually exclusive over-expression with ERG and ETVl.
  • a Scatter plots of ERG vs. SPINKl (left panel) and ETVl vs. SPINKl (right panel) by qPCR in 10 benign prostate samples, 54 localized prostate cancers (PCa) and 7 metastatic (Met) PCa samples.
  • Figure 7 shows qPCR confirmation of genes differentially expressed upon SPINKl knockdown in 22RV 1 cells. Selected a) over- and b) under-expressed genes in 22RV 1 siSPINKl cells were assessed by quantitative PCR as shown.
  • Figure 8 shows identification of genes showing co-expression with SPINKl across multiple prostate cancer profiling studies.
  • Figure 9 shows characterization of candidate urine-based biomarkers of prostate cancer.
  • A-C Quantitative PCR (qPCR) of whole transcriptome amplified (WTA) cDNA from urine obtained from patients presenting for needle biopsy or prostatectomy. Biomarker expression in patients with negative needle biopsies or patients with prostate cancer are shown. The - ⁇ Ct values of genes that were not significant predictors of prostate cancer by univariate analysis (see Table 5) are shown in A, and the expression of those that were significant predictors are shown in B and C D. Receiver operator characteristic (ROC) curves for individual variables for the diagnosis of prostate cancer.
  • ROC Receiver operator characteristic
  • Figure 10 shows a multiplexed set of urine biomarkers out performs PC A3 alone in the detection of prostate cancer.
  • A Multivariate regression analysis resulted in a multiplexed model including SPINKl, PCA3, GOLPH2 and TMPRSS2:ERG as significant predictors of prostate cancer (see Table 5). The point on the ROC curve with the maximum sum of sensitivity (Sens) and specificity (Spec) is indicated by the dashed line, and the positive and negative predictive values (PPV and NPV, respectively) are given.
  • B As in A, except a leave-one-out cross validation (LOOCV) strategy was used to generate unbiased area under curves.
  • LOOCV leave-one-out cross validation
  • COPA Cancer Outlier Profile Analysis
  • COPA nominated ETS family genes as candidate oncogenes in prostate cancer prompting the discovery of recurrent chromosomal rearrangements involving ERG or ETVl and the androgen-regulated gene TMPRSS2 (Tomlins et al., [2005], supra).
  • TMPRSS2:ETS gene fusions experiments were conducted to identify additional candidate oncogenes in prostate cancers.
  • Experiments conducted used a meta-analysis of COPA applied to 7 prostate cancer profiling studies and analyzed candidates for outlier expression in prostate cancer and mutually exclusive over-expression with ERG and ETVl .
  • SPINKl which was identified as the 2nd ranked meta-outlier, met both criteria across 8 data sets.
  • SPINKl showed marked overexpression in 50 of 325 (15.4%) profiled prostate cancers, but only 1 of 56 (1.8%) benign prostate tissue samples. In all 325 profiled prostate cancer samples, SPINKl, ERG and ETVl showed mutually exclusive outlier expression. The over-expression of SPINKl in a fraction of cancer samples compared to benign prostate tissue and the mutually exclusive over-expression of SPINKl, ERG and ETVl was confirmed by quantitative PCR. Fluorescence in situ hybridization from tissue from one of the localized prostate cancers over-expressing SPINKl did not reveal gene rearrangements or amplification, indicating that SPINKl is up-regulated through increased transcription.
  • the term "outlier expression of SPINKl” refers to an altered level of expression of SPINKl nucleic acid (e.g., mRNA) or protein relative to the level normally found (e.g., the level in a subject not diagnosed with cancer).
  • normal levels are the average level in a population of one or more individuals not diagnosed with cancer.
  • normal levels are determined within other tissues of the individual to be diagnosed.
  • expression is altered by at least 10%, preferably at least 20%, even more preferably at least 50%, yet more preferably at least 75%, still more preferably at least 90%, and most preferably at least 100% relative to the level of expression normally found (e.g., in non-cancerous tissue).
  • Expression levels may be determined using any suitable method, including, but not limited to, those disclosed herein (e.g., Example 1 below).
  • samples positive for outlier expression of SPINKl are those whose expression differs by greater than about 0.1, preferably greater than 0.2, and even more preferably greater than 0.5 normalized expression units.
  • Normalized expression units may be calculated using any suitable method, including, but not limited to, those described the experimental section below.
  • the term "overexpression of SPINKl” refers to a higher level of expression of SPINKl nucleic acid (e.g., mRNA) or protein relative to the level normally found.
  • expression is increased at least 10%, preferably at least 20%, even more preferably at least 50%, yet more preferably at least 75%, still more preferably at least 90%, and most preferably at least 100% relative to the level of expression normally found.
  • the level of expression normally found may be determined using any number of suitable parameters.
  • Examples include, but are not limited to, the level in non-cancerous prostate (e.g., an average of the level of SPINKl expression in prostate tissues from multiple subjects not diagnosed with prostate cancer), the level in non-cancerous tissues (e.g., an average of the level of SPINKl expression in non-prostate tissues from multiple subjects not diagnosed with cancer), the level in non-cancerous prostate cell lines, or a relative level of expression (e.g., the level over time in the same individual).
  • Expression levels may be determined using any suitable method, including, but not limited to, those disclosed herein.
  • expression levels are compared to the level of expression of a known gene (e.g., the level of expression or the relative expression).
  • the known gene is PSA.
  • gene expression associated with prostate cancer recurrence refers to a gene expression profile (e.g., outlier expression of SPINKl) associated with prostate cancer recurrence (e.g., in the prostate or metastatic) following treatment (e.g., surgery) for a primary tumor.
  • prostate cancer recurrence is increased at least 10%, preferably at least 20%, even more preferably at least 50%, yet more preferably at least 75%, still more preferably at least 90%, and most preferably at least 100% relative to the level of recurrence in representative subject population (e.g., average of a large population (e.g., one or more, preferably 100 or more, even more preferably 1000 or more and still more preferably 10,000 or more subjects) of subjects lacking "outlier expression of SPINKl").
  • representative subject population e.g., average of a large population (e.g., one or more, preferably 100 or more, even more preferably 1000 or more and still more preferably 10,000 or more subjects) of subjects lacking "outlier expression of SPINKl").
  • epitope refers to that portion of an antigen that makes contact with a particular antibody.
  • an antigenic determinant may compete with the intact antigen (i.e., the "immunogen" used to elicit the immune response) for binding to an antibody.
  • telomere binding when used in reference to the interaction of an antibody and a protein or peptide means that the interaction is dependent upon the presence of a particular structure (i.e., the antigenic determinant or epitope) on the protein; in other words the antibody is recognizing and binding to a specific protein structure rather than to proteins in general. For example, if an antibody is specific for epitope "A,” the presence of a protein containing epitope A (or free, unlabelled A) in a reaction containing labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.
  • non-specific binding and background binding when used in reference to the interaction of an antibody and a protein or peptide refer to an interaction that is not dependent on the presence of a particular structure (i.e., the antibody is binding to proteins in general rather that a particular structure such as an epitope).
  • the term “subject” refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, rodents, and the like, which is to be the recipient of a particular treatment.
  • the terms “subject” and “patient” are used interchangeably herein in reference to a human subject.
  • the term "subject suspected of having cancer” refers to a subject that presents one or more symptoms indicative of a cancer (e.g., a noticeable lump or mass) or is being screened for a cancer (e.g., during a routine physical).
  • a subject suspected of having cancer may also have one or more risk factors.
  • a subject suspected of having cancer has generally not been tested for cancer. However, a
  • subject suspected of having cancer encompasses an individual who has received an initial diagnosis (e.g., a CT scan showing a mass or increased PSA level) but for whom the stage of cancer is not known. The term further includes people who once had cancer (e.g., an individual in remission).
  • characteristic cancer in subject refers to the identification of one or more properties of a cancer sample in a subject, including but not limited to, the presence of benign, pre-cancerous or cancerous tissue, the stage of the cancer, and the subject's prognosis. Cancers may be characterized by the identification of the expression of one or more cancer marker genes, including but not limited to, the cancer markers disclosed herein.
  • tissue is characterized by the identification of the expression of one or more cancer marker genes, including but not limited to, the cancer markers disclosed herein.
  • cancer marker genes refers to a gene whose expression level, alone or in combination with other genes, is correlated with cancer or prognosis of cancer.
  • the correlation may relate to either an increased or decreased expression of the gene.
  • the expression of the gene may be indicative of cancer, or lack of expression of the gene may be correlated with poor prognosis in a cancer patient.
  • a reagent that specifically detects the presence or absence of a cancer marker refers to reagents used to detect the expression of one or more cancer markers (e.g., including but not limited to, the cancer markers described herein).
  • suitable reagents include but are not limited to, nucleic acid probes capable of specifically hybridizing to the gene of interest, PCR primers capable of specifically amplifying the gene of interest, and antibodies capable of specifically binding to proteins expressed by the gene of interest. Other non-limiting examples can be found in the description and examples below.
  • the term "instructions for using said kit for detecting cancer in said subject” includes instructions for using the reagents contained in the kit for the detection and characterization of cancer in a sample from a subject.
  • the instructions further comprise the statement of intended use required by the U.S. Food and Drug Administration (FDA) in labeling in vitro diagnostic products.
  • FDA U.S. Food and Drug Administration
  • stage of cancer refers to a qualitative or quantitative assessment of the level of advancement of a cancer. Criteria used to determine the stage of a cancer include, but are not limited to, the size of the tumor, whether the tumor has spread to other parts of the body and where the cancer has spread ⁇ e.g., within the same organ or region of the body or to another organ).
  • the term "providing a prognosis” refers to providing information regarding the impact of the presence of cancer ⁇ e.g., as determined by the diagnostic methods described herein) on a subject's future health ⁇ e.g., expected morbidity or mortality, the likelihood of getting cancer, and the risk of metastasis).
  • initial diagnosis refers to results of initial cancer diagnosis ⁇ e.g. the presence or absence of cancerous cells). An initial diagnosis does not include information about the stage of the cancer of the risk of prostate specific antigen failure.
  • biopsy tissue refers to a sample of tissue ⁇ e.g., prostate tissue) that is removed from a subject for the purpose of determining if the sample contains cancerous tissue.
  • biopsy tissue is obtained because a subject is suspected of having cancer. The biopsy tissue is then examined ⁇ e.g. , by microscopy) for the presence or absence of cancer.
  • non-human animals refers to all non-human animals including, but are not limited to, vertebrates such as rodents, non-human primates, ovines, bovines, ruminants, lagomorphs, porcines, caprines, equines, canines, felines, aves, etc.
  • gene refers to a nucleic acid ⁇ e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA ⁇ e.g., rRNA, tRNA).
  • the polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length or fragment are retained.
  • the term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full-length mRNA.
  • Sequences located 5' of the coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences.
  • the term "gene” encompasses both cDNA and genomic forms of a gene.
  • a genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed "introns" or "intervening regions” or “intervening sequences.”
  • Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers.
  • Introns are removed or "spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript.
  • mRNA messenger RNA
  • the mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
  • heterologous gene refers to a gene that is not in its natural environment.
  • a heterologous gene includes a gene from one species introduced into another species.
  • a heterologous gene also includes a gene native to an organism that has been altered in some way (e.g. , mutated, added in multiple copies, linked to non-native regulatory sequences, etc).
  • Heterologous genes are distinguished from endogenous genes in that the heterologous gene sequences are typically joined to DNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
  • RNA expression refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through "transcription" of the gene (i.e., via the enzymatic action of an RNA polymerase), and for protein encoding genes, into protein through “translation” of mRNA.
  • Gene expression can be regulated at many stages in the process.
  • Up- regulation” or “activation” refers to regulation that increases the production of gene expression products (i.e., RNA or protein), while “down-regulation” or “repression” refers to regulation that decrease production.
  • Molecules e.g., transcription factors
  • activators e.g., transcription factors
  • genomic forms of a gene may also include sequences located on both the 5' and 3' end of the sequences that are present on the RNA transcript. These sequences are referred to as "flanking" sequences or regions (these flanking sequences are located 5' or 3' to the non-translated sequences present on the mRNA transcript).
  • the 5' flanking region may contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene.
  • the 3' flanking region may contain sequences that direct the termination of transcription, post-transcriptional cleavage and polyadenylation.
  • oligonucleotide refers to a short length of single- stranded polynucleotide chain. Oligonucleotides are typically less than 200 residues long (e.g., between 15 and 100), however, as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are often referred to by their length. For example a 24 residue oligonucleotide is referred to as a "24-mer”. Oligonucleotides can form secondary and tertiary structures by self-hybridizing or by hybridizing to other polynucleotides. Such structures can include, but are not limited to, duplexes, hairpins, cruciforms, bends, and triplexes.
  • the terms “complementary” or “complementarity” are used in reference to polynucleotides (i. e. , a sequence of nucleotides) related by the base- pairing rules.
  • sequence “5'-A-G-T-3', M is complementary to the sequence "3'-T-C-A-5 ⁇ "
  • Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids.
  • the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.
  • a partially complementary sequence is a nucleic acid molecule that at least partially inhibits a completely complementary nucleic acid molecule from hybridizing to a target nucleic acid is "substantially homologous.”
  • the inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency.
  • a substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous nucleic acid molecule to a target under conditions of low stringency.
  • low stringency conditions are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction.
  • the absence of non-specific binding may be tested by the use of a second target that is substantially non- complementary (e.g., less than about 30% identity); in the absence of non-specific binding the probe will not hybridize to the second non-complementary target.
  • substantially homologous refers to any probe that can hybridize to either or both strands of the double-stranded nucleic acid sequence under conditions of low stringency as described above.
  • the term “substantially homologous” refers to any probe that can hybridize to either or both strands of the double-stranded nucleic acid sequence under conditions of low stringency as described above.
  • substantially homologous refers to any probe that can hybridize (i.e., it is the complement of) the single-stranded nucleic acid sequence under conditions of low stringency as described above.
  • hybridization is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the T m of the formed hybrid, and the G:C ratio within the nucleic acids. A single molecule that contains pairing of complementary nucleic acids within its structure is said to be “self-hybridized.”
  • T m is used in reference to the "melting temperature.”
  • the melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands.
  • stringency is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted.
  • low stringency conditions a nucleic acid sequence of interest will hybridize to its exact complement, sequences with single base mismatches, closely related sequences (e.g., sequences with 90% or greater homology), and sequences having only partial homology (e.g., sequences with 50-90% homology).
  • 'medium stringency conditions a nucleic acid sequence of interest will hybridize only to its exact complement, sequences with single base mismatches, and closely relation sequences (e.g., 90% or greater homology).
  • a nucleic acid sequence of interest will hybridize only to its exact complement, and (depending on conditions such a temperature) sequences with single base mismatches. In other words, under conditions of high stringency the temperature can be raised so as to exclude hybridization to sequences with single base mismatches.
  • High stringency conditions when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE, 1.0% SDS at 42°C when a probe of about 500 nucleotides in length is employed.
  • 5X SSPE 43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH
  • SDS 5X Denhardt's reagent
  • 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE, 1.0% SDS at 42°C
  • “Medium stringency conditions” when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1
  • EDTA pH adjusted to 7.4 with NaOH
  • 0.5% SDS 0.5% SDS
  • 5X Denhardt's reagent 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0X SSPE, 1.0% SDS at 42°C when a probe of about 500 nucleotides in length is employed.
  • Low stringency conditions comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5X Denhardt's reagent [5OX Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)] and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 5X SSPE, 0.1% SDS at 42°C when a probe of about 500 nucleotides in length is employed.
  • 5X SSPE 43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH
  • 5X Denhardt's reagent [5OX Denhardt's contains
  • low stringency conditions factors such as the length and nature (DNA, RNA, base composition) of the probe and nature of the target (DNA, RNA, base composition, present in solution or immobilized, etc.) and the concentration of the salts and other components (e.g., the presence or absence of formamide, dextran sulfate, polyethylene glycol) are considered and the hybridization solution may be varied to generate conditions of low stringency hybridization different from, but equivalent to, the above listed conditions.
  • conditions that promote hybridization under conditions of high stringency e.g., increasing the temperature of the hybridization and/or wash steps, the use of formamide in the hybridization solution, etc.
  • probe refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly or by PCR amplification, that is capable of hybridizing to at least a portion of another oligonucleotide of interest.
  • a probe may be single-stranded or double-stranded. Probes are useful in the detection, identification and isolation of particular gene sequences. It is contemplated that any probe used herein will be labeled with any "reporter molecule,” so that is detectable in any detection system, including, but not limited to enzyme (e.g. , ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the described methods be limited to any particular detection system or label.
  • portion when in reference to a nucleotide sequence (as in “a portion of a given nucleotide sequence”) refers to fragments of that sequence.
  • the fragments may range in size from four nucleotides to the entire nucleotide sequence minus one nucleotide (10 nucleotides, 20, 30, 40, 50, 100, 200, etc.).
  • amino acid sequence and terms such as “polypeptide” or “protein” are not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
  • native protein as used herein to indicate that a protein does not contain amino acid residues encoded by vector sequences; that is, the native protein contains only those amino acids found in the protein as it occurs in nature.
  • a native protein may be produced by recombinant means or may be isolated from a naturally occurring source.
  • portion when in reference to a protein (as in “a portion of a given protein”) refers to fragments of that protein. The fragments may range in size from four amino acid residues to the entire amino acid sequence minus one amino acid.
  • overexpression and “overexpressing” and grammatical equivalents, are used in reference to levels of mRNA to indicate a level of expression approximately 3 -fold higher (or greater) than that observed in a given tissue in a control or non-transgenic animal. Levels of mRNA are measured using any of a number of techniques known to those skilled in the art including, but not limited to Northern blot analysis.
  • RNA loaded from each tissue analyzed e.g., the amount of 28S rRNA, an abundant RNA transcript present at essentially the same amount in all tissues, present in each sample can be used as a means of normalizing or standardizing the mRNA-specific signal observed on Northern blots.
  • the amount of mRNA present in the band corresponding in size to the correctly spliced transgene RNA is quantified; other minor species of RNA which hybridize to the transgene probe are not considered in the quantification of the expression of the transgenic mRNA.
  • in vitro refers to an artificial environment and to processes or reactions that occur within an artificial environment.
  • in vitro environments can consist of, but are not limited to, test tubes and cell culture.
  • in vivo refers to the natural environment (e.g., an animal or a cell) and to processes or reaction that occur within a natural environment.
  • test compound and “candidate compound” refer to any chemical entity, pharmaceutical, drug, and the like that is a candidate for use to treat or prevent a disease, illness, sickness, or disorder of bodily function (e.g., cancer).
  • Test compounds comprise both known and potential therapeutic compounds.
  • a test compound can be determined to be therapeutic by screening using the screening methods described herein.
  • test compounds include antisense compounds.
  • sample is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum and the like. Environmental samples include environmental material such as surface matter, soil, water, crystals and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the described compositions and methods.
  • prostate sample refers to any sample containing prostate cells or secretions.
  • Example of prostate samples include, but are not limited to, a prostate tissue sample (e.g., a biopsy sample) or a urine sample.
  • the terms “detect”, “detecting”, or “detection” may describe either the general act of discovering or discerning or the specific observation of a detectably labeled composition.
  • siRNAs refers to small interfering RNAs.
  • siRNAs comprise a duplex, or double-stranded region, of about 18-25 nucleotides long; often siRNAs contain from about two to four unpaired nucleotides at the 3' end of each strand.
  • At least one strand of the duplex or double-stranded region of a siRNA is substantially homologous to, or substantially complementary to, a target RNA molecule.
  • the strand complementary to a target RNA molecule is the "antisense strand;" the strand homologous to the target RNA molecule is the "sense strand,” and is also complementary to the siRNA antisense strand.
  • siRNAs may also contain additional sequences; non-limiting examples of such sequences include linking sequences, or loops, as well as stem and other folded structures. siRNAs appear to function as key intermediaries in triggering RNA interference in invertebrates and in vertebrates, and in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants.
  • RNA interference refers to the silencing or decreasing of gene expression by siRNAs. It is the process of sequence-specific, posttranscriptional gene silencing in animals and plants, initiated by siRNA that is homologous in its duplex region to the sequence of the silenced gene.
  • the gene may be endogenous or exogenous to the organism, present integrated into a chromosome or present in a trans fection vector that is not integrated into the genome.
  • the expression of the gene is either completely or partially inhibited.
  • RNAi may also be considered to inhibit the function of a target RNA; the function of the target RNA may be complete or partial.
  • compositions and methods for cancer research, diagnosis, and treatment including but not limited to, cancer markers are described.
  • SPINKl and other markers for prostate cancer are provided. Accordingly, methods and kits for the detection of markers, as well as drug screening and therapeutic applications are provided.
  • Prostate Cancer Markers are described.
  • markers whose expression is specifically altered in cancerous prostate tissues are provided. Such markers find use in the diagnosis and characterization of prostate cancer. For example, experiments described herein identified SPINKl as being overexpressed in prostate cancer. In addition, SPINKl, ERG and ETVl showed mutually exclusive outlier expression. Further experiments identified a multiplex panel assay for detection of gene expression related to prostate cancer including SPINKl, PCA3, GOLPH2 and TMPRSS2:ERG fusions. A. SPINKl
  • SPINKl serine peptidase inhibitor, Kazal type 1
  • Genbank accession number NM 003122.2 accession number NM 003122.2.
  • SPINKl mRNA and protein have been detected in a variety of benign and cancerous tissues, however its expression in prostate has not been described (reviewed in Paju and Stenman, Crit Rev Clin Lab Sci 43, 103-42 (2006), Stenman, Clin Chem 48, 1206-9 (2002)).
  • SPINKl encodes a 79 amino acid peptide with a 23 amino acid signal peptide and is detectable in the urine and serum of healthy individuals (Paju and Stenman, supra).
  • serum levels of SPINKl may be dysregulated in numerous cancers, including pancreatic, gastric, liver, lung, breast, bladder, renal, head and neck, colorectal, kidney and ovarian cancer (reviewed in Paju and Stenman, supra, Stenman, supra).
  • this study identified marked over-expression of SPINKl in a subset of TMPRSS2:ETS negative prostate cancers, and confirmed these results using qPCR. Together, these results indicate that SPINKl over-expression plays a role in prostate cancer development as well as serving as a biomarker for a molecular subtype of prostate cancer.
  • ERG ERG (NM 004449), has been demonstrated to be highly expressed in prostate epithelium relative to other normal human tissues.
  • the ERG gene is located on chromosome 21. The gene is located at 38,675,671- 38,955,488 base pairs from the pter. The ERG gene is 279,817 total bp; minus strand orientation.
  • the ETVl gene is located on chromosome 7 (GenBank accession nos. NC 000007.i l; NC 086703.i l; and NT_007819.15). The gene is located at 13,708330 - 13,803,555 base pairs from the pter. The ETVl gene is 95,225 bp total, minus strand orientation. The corresponding ETVl cDNA and protein sequences are given at GenBank accession nos. NM 004956 and NP 004947 (Swiss protein ace. no. P50549), respectively.
  • PCA3 also known as DD3 (Bussemakers, PCT Publication No. WO 98/45420, Schalken, Eur. Urol. 34(suppl. 3):3-6 (1998), Bussemakers et al,
  • PCA3 dd3 is highly expressed in the vast majority of prostate cancer examined (47 out of 50) whereas no or very low expression is detected in BPH or normal prostate cells from the same patients. There is at least a 20-fold over- expression of PCA3 dd3 in prostate carcinoma in comparison to normal or BPH tissues. PCA3 dd3 expression seems to increase with tumor grade and is detected in metastatic lesions.
  • PCA3 is a gene wherein significant alternative splicing (as well as alternative poly-adenylation) occurs, as evidenced by the differently sized transcripts observed on Northern blots and the different types of clones identified. Virtually every combination of exons is possible.
  • the first cDNA species is found in approximately 5% of the cDNA clones and contains exons 1, 2, 3, 4a and 4b (poly-adenylation after 4b is preceeded by a real consensus poly-A-addition signal)
  • the second cDNA species found in approximately 15% of the cDNA cloned, contains exons 1, 3, 4a, 4b and 4c, arises by alternative splicing of the second exon (not present in this cDNA) and terminates at a different (real consensus) poly-A- addition signal.
  • the third cDNA species contains exons 1, 3, 4a, and 4b and is the most common one found (approximately 65% of 80 clones) (FIG. 1). This cDNA is most likely responsible for the most prominent transcript seen by Northern blot analysis.
  • the fourth cDNA species detected contains exons 1, 3, and 4a representing about 15% of clones, and terminates after 4a, which is the original DD3 clone stop site.
  • the poly-A-addition signal present here is close to the consensus sequence.
  • GOLPH2 is a glycoprotein marker of hepatitis B associated with liver cancer (Block et al., (2005) Proc. Natl. Acad. Sci. USA, 102, 779-784).
  • GP73 is a type II Golgi transmembrane protein that is expressed at high level in the hepatocytes of patients with viral hepatitis (Kladney, et al., 2000, Gene 249, 53-65).
  • GP73 is constitutively expressed in biliary epithelial cells, and minimally expressed in normal hepatocytes.
  • livers of patients with giant-cell hepatitis display strong immunoreactivity to GP73 in multinucleated hepatocytes.
  • GP73 mRNA and protein are expressed in highly differentiated HepG2 hepatoma cells after infection with viruses, including adenoviruses. Because GP73 is a Golgi transmembrane protein, it is not expected to exist in significant amounts in the serum, even in subjects with damaged or diseased livers.
  • GP73 Significant increases in whole-organ levels of GP73 have been found in liver disease due to viral causes (HBV, HCV) or nonviral causes (alcohol-induced liver disease, autoimmune hepatitis) (Kladney, et al., 2002, Hepatology 35(6): 1431-40). Hepatocyte expression of GP73 is unregulated in diseased livers, regardless of etiology, whereas biliary epithelial cell expression does not change appreciably.
  • HBV viral causes
  • nonviral causes alcohol-induced liver disease, autoimmune hepatitis
  • TMPRSS2 ERG TMPRS S2: ERG and other gene fusion markers of prostate cancer are described in US Publication No. US 20070212702 Al, herein incorporated by reference in its entirety.
  • TMPRSS2 (NM 005656), has been demonstrated to be highly expressed in prostate epithelium relative to other normal human tissues (Lin et al., Cancer Research 59: 4180 (1999)). The TMPRSS2 gene is located on chromosome 21.
  • This gene is located at 41,750,797 - 41,801,948 bp from the pter (51,151 total bp; minus strand orientation).
  • the human TMPRSS2 protein sequence may be found at GenBank accession no. AAC51784 (Swiss Protein accession no. 015393) and the corresponding cDNA at GenBank accession no. U75329 (see also, Paoloni-Giacobino, et al., Genomics 44: 309 (1997)).
  • Antibodies SPINKl or other cancer marker polypeptides, which include fragments, derivatives and analogs thereof may be used as immunogens to produce antibodies useful for diagnostic and therapeutic applications.
  • Such antibodies may be polyclonal or monoclonal, chimeric, humanized, single chain or Fab fragments, which may be labeled or unlabeled, all of which may be produced by using well known procedures and standard laboratory practices. See, e.g., Burns, ed., Immunochemical Protocols, 3 rd ed., Humana Press (2005); Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988); Kozbor et al., Immunology Today 4: 72 (1983); K ⁇ hler and Milstein, Nature 256: 495 (1975). In some embodiments, compositions and methods utilize commercially available antibodies.
  • Antibodies to SPINKl are available, for example, from GeneTex, San Antonio, Tx; Novus Biologicals, Littleton, CO; Santa Cruz Biotechnology, Santa Cruz, California; and Abnova Corporation, Taipei City, Taiwan.
  • Antibodies to SLC22A3 are available, for example, from Abnova Corporation, Taipei City, Taiwan. III. Diagnostic Applications
  • methods for detection of expression of cancer markers are provided.
  • detection methods measure the level of cancer marker detected (e.g., in comparison to the level of the cancer marker in normal prostate tissue).
  • expression is measured directly (e.g., at the RNA or protein level).
  • expression is detected in tissue samples (e.g., biopsy tissue).
  • expression is detected in bodily fluids (e.g., including but not limited to, plasma, serum, whole blood, mucus, and urine).
  • the presence of a cancer marker is used to provide a prognosis to a subject.
  • the detection of overexpression of SPINKl is indicative of gene expression associated with prostate cancer
  • outlier expression of SPINKl is associated with prostate cancer recurrence in a subject.
  • the information provided is also used to select a treatment course of action.
  • additional therapies e.g., hormonal or radiation therapies
  • additional therapies can be started at an earlier point when they are more likely to be effective (e.g., before metastasis).
  • additional therapies e.g., hormonal or radiation therapies
  • the expense and inconvenience of such therapies can be avoided.
  • the cancer markers may be detected along with other markers in a multiplex or panel format. Markers are selected for their predictive value alone or in combination with SPINKl . In one exemplary embodiment, two or more of SPINKl, PCA3, GOLPH2 and TMPRSS2:ERG are detected in a multiplex assay.
  • Other exemplary prostate cancer markers include, but are not limited to: AMACR/P504S (U.S. Pat. No. 6,262,245); PCA3 (U.S. Pat. No. 7,008,765); PCGEMl (U.S. Pat. No.
  • the diagnostic methods described herein may also be modified with reference to data correlating particular cancer marker(s) with the stage, aggressiveness or progression of the disease or the presence or risk of metastasis. Ultimately, the information provided by the methods described herein will assist a physician in choosing the best course of treatment for a particular patient.
  • sample Any patient sample suspected of containing the cancer marker may be tested according to the methods described herein.
  • the sample may be tissue (e.g., a prostate biopsy sample or a tissue sample obtained by prostatectomy), blood, urine, semen, prostatic secretions or a fraction thereof (e.g., plasma, serum, urine supernatant, urine cell pellet or prostate cells).
  • a urine sample is preferably collected immediately following an attentive digital rectal examination (DRE), which causes prostate cells from the prostate gland to shed into the urinary tract.
  • DRE attentive digital rectal examination
  • the patient sample typically requires preliminary processing designed to isolate or enrich the sample for the gene fusions or cells that contain the gene fusions.
  • a variety of techniques known to those of ordinary skill in the art may be used for this purpose, including but not limited: centrifugation; immunocapture; cell lysis; and, nucleic acid target capture (See, e.g., EP Pat. No. 1 409 727, herein incorporated by reference in its entirety).
  • RNA and DNA Detection The cancer markers described herein may be detected as RNA using a variety of nucleic acid techniques known to those of ordinary skill in the art, including but not limited to: nucleic acid sequencing; nucleic acid hybridization; and, nucleic acid amplification.
  • nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing. Those of ordinary skill in the art will recognize that because RNA is less stable in the cell and more prone to nuclease attack experimentally RNA is usually reverse transcribed to DNA before sequencing. Chain terminator sequencing uses sequence-specific termination of a DNA synthesis reaction using modified nucleotide substrates. Extension is initiated at a specific site on the template DNA by using a short radioactive, or other labeled, oligonucleotide primer complementary to the template at that region.
  • chain terminator sequencing uses sequence-specific termination of a DNA synthesis reaction using modified nucleotide substrates. Extension is initiated at a specific site on the template DNA by using a short radioactive, or other labeled, oligonucleotide primer complementary to the template at that region.
  • the oligonucleotide primer is extended using a DNA polymerase, standard four deoxynucleotide bases, and a low concentration of one chain terminating nucleotide, most commonly a di-deoxynucleotide. This reaction is repeated in four separate tubes with each of the bases taking turns as the di-deoxynucleotide. Limited incorporation of the chain terminating nucleotide by the DNA polymerase results in a series of related DNA fragments that are terminated only at positions where that particular di- deoxynucleotide is used. For each reaction tube, the fragments are size-separated by electrophoresis in a slab polyacrylamide gel or a capillary tube filled with a viscous polymer.
  • sequence is determined by reading which lane produces a visualized mark from the labeled primer as you scan from the top of the gel to the bottom.
  • Dye terminator sequencing alternatively labels the terminators. Complete sequencing can be performed in a single reaction by labeling each of the di- deoxynucleotide chain-terminators with a separate fluorescent dye, which fluoresces at a different wavelength.
  • Hybridization Illustrative non- limiting examples of nucleic acid hybridization techniques include, but are not limited to, in situ hybridization (ISH), microarray, and Southern or Northern blot.
  • ISH in situ hybridization
  • microarray microarray
  • Southern or Northern blot Southern or Northern blot
  • ISH In situ hybridization
  • DNA ISH can be used to determine the structure of chromosomes.
  • RNA ISH is used to measure and localize mRNAs and other transcripts within tissue sections or whole mounts. Sample cells and tissues are usually treated to fix the target transcripts in place and to increase access of the probe. The probe hybridizes to the target sequence at elevated temperature, and then the excess probe is washed away.
  • ISH can also use two or more probes, labeled with radioactivity or the other non-radioactive labels, to simultaneously detect two or more transcripts.
  • cancer marker sequences are detected using fluorescence in situ hybridization (FISH).
  • FISH fluorescence in situ hybridization
  • the preferred FISH assays utilize bacterial artificial chromosomes (BACs). These have been used extensively in the human genome sequencing project (see Nature 409: 953-958 (2001)) and clones containing specific BACs are available through distributors that can be located through many sources, e.g., NCBI. Each BAC clone from the human genome has been given a reference name that unambiguously identifies it. These names can be used to find a corresponding GenBank sequence and to order copies of the clone from a distributor.
  • BACs bacterial artificial chromosomes
  • a method of performing a FISH assay on human prostate cells, human prostate tissue or on the fluid surrounding said human prostate cells or human prostate tissue is further provided.
  • Specific protocols are well known in the art and can be readily adapted for use.
  • Guidance regarding methodology may be obtained from many references including: In situ Hybridization: Medical Applications (eds. G. R. Coulton and J. de Belleroche), Kluwer Academic Publishers, Boston (1992); In situ Hybridization: In Neurobiology; Advances in Methodology (eds. J. H. Eberwine, K. L. Valentino, and J. D. Barchas), Oxford University Press Inc., England (1994); In situ Hybridization: A Practical Approach (ed. D. G.
  • kits that are commercially available and that provide protocols for performing FISH assays (available from e.g., Oncor, Inc., Gaithersburg, MD).
  • Patents providing guidance on methodology include U.S. Pat. Nos. 5,225,326; 5,545,524; 6,121,489 and 6,573,043. All of these references are hereby incorporated by reference in their entirety and may be used along with similar references in the art and with the information provided in the Examples section herein to establish procedural steps convenient for a particular laboratory.
  • DNA microarrays including, but not limited to: DNA microarrays ⁇ e.g., cDNA microarrays and oligonucleotide microarrays); protein microarrays; tissue microarrays; transfection or cell microarrays; chemical compound microarrays; and, antibody microarrays.
  • a DNA microarray commonly known as gene chip, DNA chip, or biochip, is a collection of microscopic DNA spots attached to a solid surface (e.g., glass, plastic or silicon chip) forming an array for the purpose of expression profiling or monitoring expression levels for thousands of genes simultaneously.
  • the affixed DNA segments are known as probes, thousands of which can be used in a single DNA microarray.
  • Microarrays can be used to identify disease genes by comparing gene expression in disease and normal cells.
  • Microarrays can be fabricated using a variety of technologies, including but not limiting: printing with fine-pointed pins onto glass slides; photolithography using pre-made masks; photolithography using dynamic micromirror devices; ink-jet printing; or, electrochemistry on microelectrode arrays.
  • Southern and Northern blotting is used to detect specific DNA or RNA sequences, respectively.
  • DNA or RNA extracted from a sample is fragmented, electrophoretically separated on a matrix gel, and transferred to a membrane filter.
  • the filter bound DNA or RNA is subject to hybridization with a labeled probe complementary to the sequence of interest. Hybridized probe bound to the filter is detected.
  • a variant of the procedure is the reverse Northern blot, in which the substrate nucleic acid that is affixed to the membrane is a collection of isolated DNA fragments and the probe is RNA extracted from a tissue and labeled. 3.
  • Amplification is used to detect specific DNA or RNA sequences, respectively.
  • Cancer marker genomic DNA and mRNA may be amplified prior to or simultaneous with detection.
  • nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription- mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA).
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription polymerase chain reaction
  • TMA transcription- mediated amplification
  • LCR ligase chain reaction
  • SDA strand displacement amplification
  • NASBA nucleic acid sequence based amplification
  • PCR The polymerase chain reaction (U.S. Pat. Nos. 4,683,195, 4,683,202, 4,800,159 and 4,965,188, each of which is herein incorporated by reference in its entirety), commonly referred to as PCR, uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of a target nucleic acid sequence.
  • RT- PCR reverse transcriptase (RT) is used to make a complementary DNA (cDNA) from mRNA, and the cDNA is then amplified by PCR to produce multiple copies of DNA.
  • cDNA complementary DNA
  • TMA Transcription mediated amplification
  • a target nucleic acid sequence autocatalytically under conditions of substantially constant temperature, ionic strength, and pH in which multiple RNA copies of the target sequence autocatalytically generate additional copies.
  • TMA optionally incorporates the use of blocking moieties, terminating moieties, and other modifying moieties to improve TMA process sensitivity and accuracy.
  • the ligase chain reaction (Weiss, R., Science 254: 1292 (1991), herein incorporated by reference in its entirety), commonly referred to as LCR, uses two sets of complementary DNA oligonucleotides that hybridize to adjacent regions of the target nucleic acid.
  • the DNA oligonucleotides are covalently linked by a DNA ligase in repeated cycles of thermal denaturation, hybridization and ligation to produce a detectable double-stranded ligated oligonucleotide product.
  • Strand displacement amplification (Walker, G. et al., Proc. Natl. Acad. Sci. USA 89: 392-396 (1992); U.S. Pat. Nos. 5,270,184 and 5,455,166, each of which is herein incorporated by reference in its entirety), commonly referred to as SDA, uses cycles of annealing pairs of primer sequences to opposite strands of a target sequence, primer extension in the presence of a dNTP ⁇ S to produce a duplex hemiphosphorothioated primer extension product, endonuclease-mediated nicking of a hemimodified restriction endonuclease recognition site, and polymerase-mediated primer extension from the 3' end of the nick to displace an existing strand and produce a strand for the next round of primer annealing, nicking and strand displacement, resulting in geometric amplification of product.
  • Thermophilic SDA (tSDA) uses thermophilic endonucleases and polymer
  • amplification methods include, for example: nucleic acid sequence based amplification (U.S. Pat. No. 5,130,238, herein incorporated by reference in its entirety), commonly referred to as NASBA; one that uses an RNA replicase to amplify the probe molecule itself (Lizardi et al., BioTechnol. 6: 1197 (1988), herein incorporated by reference in its entirety), commonly referred to as Q ⁇ replicase; a transcription based amplification method (Kwoh et al., Proc. Natl. Acad. Sci. USA 86:1173 (1989)); and, self-sustained sequence replication (Guatelli et al., Proc. Natl. Acad. Sci.
  • Non-amplified or amplified nucleic acids can be detected by any conventional means.
  • the cancer marker nucleic acid can be detected by hybridization with a detectably labeled probe and measurement of the resulting hybrids.
  • Illustrative non-limiting examples of detection methods are described below.
  • One illustrative detection method, the Hybridization Protection Assay (HPA) involves hybridizing a chemiluminescent oligonucleotide probe ⁇ e.g., an acridinium ester-labeled (AE) probe) to the target sequence, selectively hydrolyzing the chemiluminescent label present on unhybridized probe, and measuring the chemiluminescence produced from the remaining probe in a luminometer.
  • HPA Hybridization Protection Assay
  • Another illustrative detection method provides for quantitative evaluation of the amplification process in real-time.
  • Evaluation of an amplification process in "real-time” involves determining the amount of amplicon in the reaction mixture either continuously or periodically during the amplification reaction, and using the determined values to calculate the amount of target sequence initially present in the sample.
  • a variety of methods for determining the amount of initial target sequence present in a sample based on real-time amplification are well known in the art. These include methods disclosed in U.S. Pat. Nos. 6,303,305 and 6,541,205, each of which is herein incorporated by reference in its entirety.
  • Another method for determining the quantity of target sequence initially present in a sample, but which is not based on a real-time amplification is disclosed in U.S. Pat. No. 5,710,029, herein incorporated by reference in its entirety.
  • Amplification products may be detected in real-time through the use of various self-hybridizing probes, most of which have a stem-loop structure.
  • Such self- hybridizing probes are labeled so that they emit differently detectable signals, depending on whether the probes are in a self-hybridized state or an altered state through hybridization to a target sequence.
  • self-hybridizing probes are labeled so that they emit differently detectable signals, depending on whether the probes are in a self-hybridized state or an altered state through hybridization to a target sequence.
  • molecular torches are a type of self-hybridizing probe that includes distinct regions of self-complementarity (referred to as “the target binding domain” and “the target closing domain”) which are connected by a joining region (e.g., non-nucleotide linker) and which hybridize to each other under predetermined hybridization assay conditions.
  • the target binding domain and “the target closing domain”
  • a joining region e.g., non-nucleotide linker
  • molecular torches contain single-stranded base regions in the target binding domain that are from 1 to about 20 bases in length and are accessible for hybridization to a target sequence present in an amplification reaction under strand displacement conditions.
  • the target binding domain and the target closing domain of a molecular torch include a detectable label or a pair of interacting labels (e.g., luminescent/quencher) positioned so that a different signal is produced when the molecular torch is self-hybridized than when the molecular torch is hybridized to the target sequence, thereby permitting detection of probe:target duplexes in a test sample in the presence of unhybridized molecular torches.
  • a detectable label or a pair of interacting labels e.g., luminescent/quencher
  • Molecular beacons include nucleic acid molecules having a target complementary sequence, an affinity pair (or nucleic acid arms) holding the probe in a closed conformation in the absence of a target sequence present in an amplification reaction, and a label pair that interacts when the probe is in a closed conformation. Hybridization of the target sequence and the target complementary sequence separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable due to reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS). Molecular beacons are disclosed in U.S. Pat. Nos. 5,925,517 and 6,150,097, herein incorporated by reference in its entirety.
  • probe binding pairs having interacting labels such as those disclosed in U.S. Pat. No. 5,928,862 (herein incorporated by reference in its entirety) might be adapted for use.
  • Probe systems used to detect single nucleotide polymorphisms (SNPs) might also be utilized in. Additional detection systems include "molecular switches," as disclosed in U.S. Publ. No. 20050042638, herein incorporated by reference in its entirety.
  • Other probes such as those comprising intercalating dyes and/or fluorochromes, are also useful for detection of amplification products. See, e.g., U.S. Pat. No. 5,814,447 (herein incorporated by reference in its entirety).
  • the cancer markers may be detected as proteins using a variety of protein techniques known to those of ordinary skill in the art, including but not limited to: protein sequencing; and, immunoassays.
  • Illustrative non-limiting examples of protein sequencing techniques include, but are not limited to, mass spectrometry and Edman degradation.
  • Mass spectrometry can, in principle, sequence any size protein but becomes computationally more difficult as size increases.
  • a protein is digested by an endoprotease, and the resulting solution is passed through a high pressure liquid chromatography column. At the end of this column, the solution is sprayed out of a narrow nozzle charged to a high positive potential into the mass spectrometer. The charge on the droplets causes them to fragment until only single ions remain. The peptides are then fragmented and the mass-charge ratios of the fragments measured.
  • the mass spectrum is analyzed by computer and often compared against a database of previously sequenced proteins in order to determine the sequences of the fragments.
  • the process is then repeated with a different digestion enzyme, and the overlaps in sequences are used to construct a sequence for the protein.
  • the peptide to be sequenced is adsorbed onto a solid surface (e.g., a glass fiber coated with polybrene).
  • the Edman reagent, phenylisothiocyanate (PTC) is added to the adsorbed peptide, together with a mildly basic buffer solution of 12% trimethylamine, and reacts with the amine group of the N-terminal amino acid.
  • the terminal amino acid derivative can then be selectively detached by the addition of anhydrous acid.
  • the derivative isomerizes to give a substituted phenylthiohydantoin, which can be washed off and identified by chromatography, and the cycle can be repeated.
  • the efficiency of each step is about 98%, which allows about 50 amino acids to be reliably determined.
  • immunoassays include, but are not limited to: immunoprecipitation; Western blot; ELISA; immunohistochemistry; immunocytochemistry; flow cytometry; and, immuno-PCR.
  • Polyclonal or monoclonal antibodies detectably labeled using various techniques known to those of ordinary skill in the art (e.g., colorimetric, fluorescent, chemiluminescent or radioactive) are suitable for use in the immunoassays.
  • Immunoprecipitation is the technique of precipitating an antigen out of solution using an antibody specific to that antigen.
  • the process can be used to identify protein complexes present in cell extracts by targeting a protein believed to be in the complex.
  • the complexes are brought out of solution by insoluble antibody- binding proteins isolated initially from bacteria, such as Protein A and Protein G.
  • the antibodies can also be coupled to sepharose beads that can easily be isolated out of solution. After washing, the precipitate can be analyzed using mass spectrometry, Western blotting, or any number of other methods for identifying constituents in the complex.
  • a Western blot, or immunoblot is a method to detect protein in a given sample of tissue homogenate or extract. It uses gel electrophoresis to separate denatured proteins by mass. The proteins are then transferred out of the gel and onto a membrane, typically polyvinyldiflroride or nitrocellulose, where they are probed using antibodies specific to the protein of interest. As a result, researchers can examine the amount of protein in a given sample and compare levels between several groups.
  • An ELISA short for Enzyme-Linked Immunosorbent Assay, is a biochemical technique to detect the presence of an antibody or an antigen in a sample. It utilizes a minimum of two antibodies, one of which is specific to the antigen and the other of which is coupled to an enzyme. The second antibody will cause a chromogenic or fluorogenic substrate to produce a signal. Variations of ELISA include sandwich ELISA, competitive ELISA, and ELISPOT. Because the ELISA can be performed to evaluate either the presence of antigen or the presence of antibody in a sample, it is a useful tool both for determining serum antibody concentrations and also for detecting the presence of antigen.
  • Immunohistochemistry and immunocytochemistry refer to the process of localizing proteins in a tissue section or cell, respectively, via the principle of antigens in tissue or cells binding to their respective antibodies. Visualization is enabled by tagging the antibody with color producing or fluorescent tags. Typical examples of color tags include, but are not limited to, horseradish peroxidase and alkaline phosphatase. Typical examples of fluorophore tags include, but are not limited to, fluorescein isothiocyanate (FITC) or phycoerythrin (PE). Flow cytometry is a technique for counting, examining and sorting microscopic particles suspended in a stream of fluid.
  • FITC fluorescein isothiocyanate
  • PE phycoerythrin
  • a beam of light (e.g., a laser) of a single frequency or color is directed onto a hydrodynamically focused stream of fluid.
  • a number of detectors are aimed at the point where the stream passes through the light beam; one in line with the light beam (Forward Scatter or FSC) and several perpendicular to it (Side Scatter (SSC) and one or more fluorescent detectors).
  • FSC Forward Scatter
  • SSC Segment Scatter
  • Each suspended particle passing through the beam scatters the light in some way, and fluorescent chemicals in the particle may be excited into emitting light at a lower frequency than the light source.
  • FSC correlates with the cell volume and SSC correlates with the density or inner complexity of the particle (e.g., shape of the nucleus, the amount and type of cytoplasmic granules or the membrane roughness).
  • Immuno-polymerase chain reaction utilizes nucleic acid amplification techniques to increase signal generation in antibody-based immunoassays. Because no protein equivalence of PCR exists, that is, proteins cannot be replicated in the same manner that nucleic acid is replicated during PCR, the only way to increase detection sensitivity is by signal amplification.
  • the target proteins are bound to antibodies which are directly or indirectly conjugated to oligonucleotides. Unbound antibodies are washed away and the remaining bound antibodies have their oligonucleotides amplified. Protein detection occurs via detection of amplified oligonucleotides using standard nucleic acid detection methods, including real-time methods. D. Data Analysis
  • a computer-based analysis program is used to translate the raw data generated by the detection assay (e.g., the presence, absence, or amount of a given marker or markers) into data of predictive value for a clinician.
  • the clinician can access the predictive data using any suitable means.
  • the clinician who is not likely to be trained in genetics or molecular biology, need not understand the raw data.
  • the data is presented directly to the clinician in its most useful form. The clinician is then able to immediately utilize the information in order to optimize the care of the subject.
  • a sample e.g., a biopsy or a serum or urine sample
  • a profiling service e.g., clinical lab at a medical facility, genomic profiling business, etc.
  • the subject may visit a medical center to have the sample obtained and sent to the profiling center, or subjects may collect the sample themselves (e.g., a urine sample) and directly send it to a profiling center.
  • the sample comprises previously determined biological information
  • the information may be directly sent to the profiling service by the subject (e.g., an information card containing the information may be scanned by a computer and the data transmitted to a computer of the profiling center using an electronic communication systems).
  • the profiling service Once received by the profiling service, the sample is processed and a profile is produced (i.e., expression data), specific for the diagnostic or prognostic information desired for the subject.
  • the profile data is then prepared in a format suitable for interpretation by a treating clinician.
  • the prepared format may represent a diagnosis or risk assessment (e.g., likelihood of cancer being present or the subtype of cancer) for the subject, along with recommendations for particular treatment options.
  • the data may be displayed to the clinician by any suitable method.
  • the profiling service generates a report that can be printed for the clinician (e.g., at the point of care) or displayed to the clinician on a computer monitor.
  • the information is first analyzed at the point of care or at a regional facility.
  • the raw data is then sent to a central processing facility for further analysis and/or to convert the raw data to information useful for a clinician or patient.
  • the central processing facility provides the advantage of privacy (all data is stored in a central facility with uniform security protocols), speed, and uniformity of data analysis.
  • the central processing facility can then control the fate of the data following treatment of the subject. For example, using an electronic communication system, the central facility can provide data to the clinician, the subject, or researchers.
  • the subject is able to directly access the data using the electronic communication system.
  • the subject may chose further intervention or counseling based on the results.
  • the data is used for research use.
  • the data may be used to further optimize the inclusion or elimination of markers as useful indicators of a particular condition or stage of disease.
  • the results are used in a clinical setting to determine a further diagnostic (e.g., the additional of further screening (e.g., PSA or other markers) or diagnostic (e.g., biopsy) course of action.
  • a further diagnostic e.g., the additional of further screening (e.g., PSA or other markers) or diagnostic (e.g., biopsy) course of action.
  • the results are used to determine a treatment course of action (e.g., choice of therapies or watchful waiting).
  • in vivo imaging techniques are used to visualize the expression of cancer markers in an animal ⁇ e.g., a human or non-human mammal).
  • cancer marker mRNA or protein is labeled using a labeled antibody specific for the cancer marker.
  • a specifically bound and labeled antibody can be detected in an individual using an in vivo imaging method, including, but not limited to, radionuclide imaging, positron emission tomography, computerized axial tomography, X-ray or magnetic resonance imaging method, fluorescence detection, and chemiluminescent detection. Methods for generating antibodies to the cancer markers of are described above.
  • In vivo imaging methods are useful in the diagnosis of cancers that express the cancer markers described herein ⁇ e.g., SPINKl). In vivo imaging is used to visualize the presence of a marker indicative of the cancer. Such techniques allow for diagnosis without the use of an unpleasant biopsy. The in vivo imaging methods are also useful for providing prognoses to cancer patients. For example, the presence of a marker indicative of cancers likely to metastasize can be detected. The in vivo imaging methods can further be used to detect metastatic cancers in other parts of the body.
  • reagents ⁇ e.g., antibodies
  • specific for the cancer markers are fiuorescently labeled.
  • the labeled antibodies are introduced into a subject ⁇ e.g., orally or parenterally).
  • Fiuorescently labeled antibodies are detected using any suitable method ⁇ e.g., using the apparatus described in U.S. Patent 6,198,107, herein incorporated by reference).
  • antibodies are radioactively labeled.
  • the use of antibodies for in vivo diagnosis is well known in the art. Sumerdon et ah, (Nucl. Med. Biol 17:247-254 [1990] have described an optimized antibody-chelator for the radioimmunoscintographic imaging of tumors using Indium- 111 as the label. Griffin et ah, (J Clin One 9:631-640 [1991]) have described the use of this agent in detecting tumors in patients suspected of having recurrent colorectal cancer. The use of similar agents with paramagnetic ions as labels for magnetic resonance imaging is known in the art (Lauffer, Magnetic Resonance in Medicine 22:339-342 [1991]).
  • Radioactive labels such as Indium- 111, Technetium-99m, or Iodine- 131 can be used for planar scans or single photon emission computed tomography (SPECT).
  • Positron emitting labels such as Fluorine- 19 can also be used for positron emission tomography (PET).
  • PET positron emission tomography
  • paramagnetic ions such as Gadolinium (III) or Manganese (II) can be used.
  • Radioactive metals with half-lives ranging from 1 hour to 3.5 days are available for conjugation to antibodies, such as scandium-47 (3.5 days) gallium-67 (2.8 days), gallium-68 (68 minutes), technetiium-99m (6 hours), and indium- 111 (3.2 days), of which gallium-67, technetium-99m, and indium- 111 are preferable for gamma camera imaging, gallium-68 is preferable for positron emission tomography.
  • a useful method of labeling antibodies with such radiometals is by means of a bifunctional chelating agent, such as diethylenetriaminepentaacetic acid (DTPA), as described, for example, by Khaw et al (Science 209:295 [1980]) for In-111 and Tc- 99m, and by Scheinberg et al (Science 215:1511 [1982]).
  • DTPA diethylenetriaminepentaacetic acid
  • Other chelating agents may also be used, but the l-(p-carboxymethoxybenzyl)EDTA and the carboxycarbonic anhydride of DTPA are advantageous because their use permits conjugation without affecting the antibody's immunoreactivity substantially.
  • Another method for coupling DPTA to proteins is by use of the cyclic anhydride of DTPA, as described by Hnatowich et al. (Int. J. Appl. Radiat. Isot. 33 :327 [ 1982]) for labeling of albumin with In- 111 , but which can be adapted for labeling of antibodies.
  • a suitable method of labeling antibodies with Tc-99m which does not use chelation with DPTA is the pretinning method of Crockford et al, (U.S. Pat. No. 4,323,546, herein incorporated by reference).
  • a preferred method of labeling immunoglobulins with Tc-99m is that described by Wong et al (Int. J. Appl. Radiat. Isot., 29:251 [1978]) for plasma protein, and recently applied successfully by Wong et al (J. Nucl. Med., 23:229 [1981]) for labeling antibodies.
  • a further improvement may be achieved by effecting radiolabeling in the presence of the specific cancer marker, to insure that the antigen binding site on the antibody will be protected.
  • the antigen is separated after labeling.
  • in vivo biophotonic imaging (Xenogen, Almeda, CA) is utilized for in vivo imaging.
  • This real-time in vivo imaging utilizes luciferase.
  • the luciferase gene is incorporated into cells, microorganisms, and animals ⁇ e.g., as a fusion protein with a cancer marker). When active, it leads to a reaction that emits light.
  • a CCD camera and software is used to capture the image and analyze it.
  • kits for the detection and characterization of prostate cancer contain antibodies specific for a cancer marker (e.g., SPINKl), in addition to detection reagents and buffers.
  • the kits contain reagents specific for the detection of the level of mRNA or cDNA or the presence or absence of chromosomal deletions (e.g., oligonucleotide probes or primers).
  • the kits contain all of the components necessary or sufficient to perform a detection assay, including all controls, directions for performing assays, and any necessary software for analysis and presentation of results. IV. Drug Screening
  • drug screening assays e.g., to screen for anticancer drugs
  • the screening methods utilize cancer markers identified herein (e.g., including but not limited to, SPINKl).
  • cancer markers identified herein e.g., including but not limited to, SPINKl.
  • candidate compounds are antisense agents (e.g., oligonucleotides) directed against cancer markers. See Section IV below for a discussion of antisense therapy.
  • candidate compounds are antibodies or small molecules that specifically bind to a cancer marker and inhibit its biological function.
  • candidate compounds are evaluated for their ability to alter cancer marker expression by contacting a compound with a cell expressing a cancer marker and then assaying for the effect of the candidate compounds on expression.
  • the effect of candidate compounds on expression of a cancer marker gene is assayed for by detecting the level of cancer marker mRNA expressed by the cell. mRNA expression can be detected by any suitable method.
  • the effect of candidate compounds on expression of cancer marker genes is assayed by measuring the level of polypeptide encoded by the cancer markers. The level of polypeptide expressed can be measured using any suitable method, including but not limited to, those disclosed herein.
  • screening methods for identifying modulators i.e., candidate or test compounds or agents (e.g., proteins, peptides, peptidomimetics, peptoids, small molecules or other drugs) which bind to cancer markers described herein, have an inhibitory (or stimulatory) effect on, for example, cancer marker expression or cancer marker activity, or have a stimulatory or inhibitory effect on, for example, the expression or activity of a cancer marker substrate are provided.
  • Compounds thus identified can be used to modulate the activity of target gene products (e.g., cancer marker genes) either directly or indirectly in a therapeutic protocol, to elaborate the biological function of the target gene product, or to identify compounds that disrupt normal target gene interactions.
  • Target gene products e.g., cancer marker genes
  • Compounds that inhibit the activity or expression of cancer markers are useful in the treatment of proliferative disorders, e.g., cancer, particularly prostate cancer.
  • the assays for screening candidate or test compounds that are substrates of a cancer marker protein or polypeptide or a biologically active portion thereof are provided. In another embodiment, the assays for screening candidate or test compounds that bind to or modulate the activity of a cancer marker protein or polypeptide or a biologically active portion thereof are provided.
  • test compounds can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone, which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckennann et ah, J. Med. Chem. 37: 2678- 85 [1994]); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection.
  • the biological library and peptoid library approaches are preferred for use with peptide libraries, while the other four approaches are applicable to peptide, non- peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12:145).
  • therapies for cancer are provided.
  • therapies target cancer markers e.g., including but not limited to, SPINKl.
  • antisense or RNAi therapies that target the expression of SPINKl are utilized. Additional therapeutic agents are identified, for example, using the drug screening methods described herein.
  • This Example describes the characterization of SPINKl expression in prostate cancer.
  • COPA Materials and Methods Cancer Outlier Profile Analysis
  • gene expression values are median-centered, setting each gene's median expression value to zero.
  • the median absolute deviation (MAD) is calculated and scaled to 1 by dividing each gene expression value by its MAD.
  • MAD median absolute deviation
  • the 75th, 90th, and 95th percentiles of the transformed expression values are tabulated for each gene and then genes are rank-ordered by their percentile scores, providing a prioritized list of outlier profiles. Genes scoring in the top 100 outliers at any of the three percentile cutoffs were called outliers.
  • Tissues used for quantitative PCR were from the radical prostatectomy series at the University of Michigan and from the Rapid Autopsy Program, which are both part of University of Michigan Prostate Cancer Specialized Program of Research Excellence (S.P.O.R.E.) Tissue Core.
  • FISH fluorescence in situ hybridization
  • IHC immunohistochemistry
  • the Swedish Watchful Waiting (SWW) cohort consisted of samples from a Swedish population-based cohort of men with localized prostate cancer diagnosed incidentally by trans-urethral resection of the prostate for symptomatic benign prostatic hyperplasia as described (Andren et al, J Urol 175, 1337-40 (2006); Johansson et al, JAMA 291, 2713-9 (2004)).
  • the Memorial Sloan Kettering Cancer Center (MSKCC) cohort consisted of patients with localized or locally advanced prostate cancer that were treated by radical prostatectomy at MSKCC between 1985 and 2003. All samples were obtained with IRB approval from the respective institution.
  • the prostate cancer cell line 22RV 1 was provided by Jill Macoska (University of Michigan). Quantitative PCR (qPCR) from tissue samples
  • qPCR Quantitative PCR
  • Trizol Invitrogen, Carlsbad, CA
  • RNA was quantified using a ND- 1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE) and 3-5 ⁇ g of total RNA was reverse transcribed into cDNA using Superscript III (Invitrogen) in the presence of random primers.
  • oligonucleotide primers were synthesized by Integrated DNA Technologies (Coralville, IA). GAPDH and HMBS, and ERG (exon5_6) and ETVl (exon6_7) primers were as described (Tomlins et al., 2005, supra). Sequences for SPINKl are as follows: SPINKI f- CAAAAATCTGGGCCTTGCTGAGAAC (SEQ ID NO: 1) SPINKI r- AGGCCTCGCGGTGACCTGAT (SEQ ID NO:2)
  • IHC for the MSKCC cohort was performed using an in-house mouse monoclonal antibody against SPINKl (code 6E832) on tissue microarrays containing triplicate cores from 817 evaluable cases of localized prostate cancer.
  • the percentage of positive tumor cells in each core was estimated and assigned values of 0%, 5%, or multiples of 10%.
  • the intensity of the expression was assigned a value of 0, 1, 2, or 3.
  • Triplicate cores from each specimen were scored separately and the presence of tumorous tissue in at least two interpretable cores was required to include a case for analysis. Cases were marked as SPINKl positive if any of the three cores showed >80% of cancerous cells showing positive SPINKl immunoreactivity (intensity 1-3).
  • biochemical recurrence was defined as a 0.2 ng/ml increase in PSA or recurrence of disease after prostatectomy, such as development of metastatic cancer, if biochemical recurrence information was not available.
  • biochemical recurrence defined as PSA > 0.2 ng/ml after surgical resection with a second confirmatory PSA- measurement > 0.2 ng/ml, was considered, as all patients with a clinical failure had previously had a biochemical recurrence.
  • samples positive for outlier expression of SPINKl were defined as those with greater than 0.5 normalized expression units (as shown in Figure IA).
  • IHC analysis of the UM and MSKCC cohorts positive cases were defined as described above.
  • Kaplan-Meier analysis and multivariate Cox proportional-hazards regression were then used to examine the association of SPINKl with biochemical PSA recurrence.
  • TMRPSS2:ERG RNA amplification and qPCR for TMRPSS2:ERG from men with prostate cancer was as described (Laxman, B. et al. Noninvasive detection of TMPRSS2:ERG fusion transcripts in the urine of men with prostate cancer. Neoplasia 8, 885-8 (2006)). Briefly, 25 ng of isolated RNA was amplified using TransPlex Whole Transcriptome Amplification (WTA) kit (Rubicon Genomics, Ann Arbor, MI) according to the manufacturer's instructions. For each qPCR reaction, 10 ng of WTA amplified cDNA was used as template.
  • WTA TransPlex Whole Transcriptome Amplification
  • the amount of SPINKl relative to PSA was determined for each sample using the comparative C t method and the relative amount in each sample was normalized to the median of all samples.
  • the top 11% of SPINKl over-expressing samples (the average percentage of SPINKl positive samples across the other five cohorts evaluated in this study (See Table 3)) were identified as SPINKl positive.
  • a one-sided Fisher's exact test was used to evaluate the relationship between SPINKl and TMPRSS2:ERG status, as this study was performed with the prior hypothesis that there was an inverse correlation between SPINKl expression and fusion status.
  • SPINKl_full-f ACCACCATGAAGGTAACAGGCATCTTTCTT (SEQ ID NO:3)
  • SPINKl_full-r TCAGCAAGGCCCAGATTTTTGA (SEQ ID NO:4)
  • the cDNA product was TOPO cloned into the Gateway entry vector pCR8/GW/TOPO (Invitrogen), yielding pCR8-SPINKl.
  • pCR8-SPINKl was recombined with pAD/CMV/V5 (Invitrogen) using LR Clonase II (Invitrogen). Control pAD/CMV/LACZ clones were obtained from Invitrogen.
  • Adenoviruses were generated by the University of Michigan Vector Core.
  • the benign immortalized prostate cell line RWPE was infected with SPINKl or LACZ adenoviruses, generating RWPE-SPINK1 and RWPE-LACZ for transient over-expression.
  • RWPE-SPINKl and RWPE-LACZ cells 48 hours after infection with adenoviruses
  • 22RV 1 cells 22RV 1 cells
  • Equal numbers of the indicated cells were seeded onto the basement membrane matrix (EC matrix, Chemicon, Temecula, CA) present in the insert of a 24 well culture plate, with fetal bovine serum added to the lower chamber as a chemoattractant.
  • EC matrix EC matrix
  • fetal bovine serum added to the lower chamber as a chemoattractant.
  • non- invading cells and EC matrix were removed by a cotton swab.
  • Invaded cells were stained with crystal violet and photographed.
  • the inserts were treated with 10% acetic acid and absorbance was measured at 560nm. SPINKl knockdown
  • siRNA knockdown of SPINKl in 22RV 1 cells the individual siRNAs composing the Dharmacon SMARTpool against SPINKl (LQ-019724-00, Chicago, IL) were tested for SPINKl knockdown by qPCR, and the most effective single siRNA (J-019724-07) was used for further experiments.
  • siCONTROL Non-Targeting siRNA #1 (D-OO 1210-01) or siRNA against SPINKl was transfected into 22RV 1 cells using Oligofectamine (Invitrogen). After 24 hours a second identical transfection was carried out and cells were harvested 24 hours later for RNA isolation, invasion assays or proliferation assays as described above.
  • RNA isolation profiling was performed using the Agilent Whole Human Genome Oligo Microarray (Santa Clara, CA).
  • Total RNA isolated using Trizol was purified using the Qiagen RN Aeasy Micro kit (Valencia, CA).
  • One ⁇ g of total RNA was converted to cRNA and labeled according to the manufacturer's protocol (Agilent).
  • Hybridizations were performed for 16 hrs at 65°C, and arrays were scanned on an Agilent DNA microarray scanner. Images were analyzed and data extracted using Agilent Feature Extraction Software 9.1.3.1, with linear and lowess normalization performed for each array.
  • 22RVl-siSPINKl hybridizations the reference was 22RV 1 cells infected with non-targeting siRNA.
  • SPINKl serine peptidase inhibitor, Kazal type 1
  • the 2nd ranked meta-outlier was identified as showing over-expression in prostate cancer compared to benign prostate tissue and mutually exclusive over-expression with ERG and ETVl across multiple studies.
  • IHC for SPINKl status was performed on an independent cohort of 817 evaluable prostate cancers (200 recurrences) from the Memorial Sloan Kettering Cancer Center (MSKCC).
  • MSKCC Memorial Sloan Kettering Cancer Center
  • 297 of the 817 cases (36%) of cases showed positive SPINKl immunoreactivity in at least one of three triplicate cores.
  • staining intensity was more variable than that observed in the UM and SWW cohorts.
  • SPINKl positive cases in the MSKCC cohort were defined as those with at least one core showing greater than 80% of cells showing positive SPINKl immunoreactivity, resulting in 75 SPINKl positive cases (9%), consistent with the other studies.
  • nomograms are commonly used to predict the likelihood of biochemical recurrence after surgical resection by optimally incorporating clinical and pathological parameters.
  • adenoviruses expressing SPINKl were generated and benign immortalized prostate epithelial cell line RWPE was infected with the adenovirus to generate RWPE-SPINK1 cells.
  • Over-expression of SPINKl had no significant effect on the proliferation or invasion of RWPE cells ( Figure 3a-b).
  • SPINKl over-expression had no effect on benign prostate cells, we hypothesized that SPINKl over-expression may occur later in prostate cancer progression in the presence of co-existing genetic lesions, consistent with its association with aggressive prostate cancer.
  • a panel of prostate cancer cell lines was analyzed for SPINKl outlier-expression.
  • SPINKl may be activated by a unique molecular event, similar to TMPRSS2:ETS positive prostate cancers.
  • FISH studies using locus/control and 573' split probes demonstrated no evidence of amplification or gross rearrangements, respectively, in samples with SPINKl over-expression.
  • sequencing of the SPINKl coding region identified no mutations in samples with SPINKl outlier- expression.
  • the present disclosure is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to understand the invention. Nonetheless, it is contemplated that SPINKl is activated by increased transcription, for example through promoter mutations affecting regulatory elements. Alternatively, SPINKl may be activated by a unique upstream genetic event.
  • the six cohorts evaluated in this study are: the in silico microarray data, quantitative PCR (qPCR) on tissue samples, University of Michigan (UM) immunohistochemistry (IHC) /fluorescence in situ hybridization (FISH), Swedish Watchful Waiting (SWW) IHC/FISH, Memorial Sloan Kettering Cancer Center (MSKCC) IHC and qPCR on urine samples.
  • This example describes a multiplex urine assay for use in the assessment of samples for markers associated with prostate cancer.
  • Urine was voided into urine collection cups containing DNA/RNA preservative (Sierra Diagnostics LLC, Sonora, CA). Isolation of RNA from urine and whole transcriptome amplification (WTA) were as described in (Laxman et al., Neoplasia 2006;8:885-8.).
  • Quantitative PCR was used to detect seven prostate cancer biomarkers (AMACR, ERG, GOLPH2, PCA3, SPINKl, TFF3, and TMPRSS2:ERG fusions) and the control transcripts PSA and GAPDH from WTA amplified cDNA essentially as described (Laxman et al., 2006, supra; Tomlins et al., Neoplasia 2006;8: 153-62).
  • ERG exon5_6
  • GAPDH Vandesompele et al., Genome Biol 2002; 3:RESEARCH0034
  • AMACR Kumar-Sinha et al., Am J Pathol 2004;164:787-93
  • PSA Seht et al., Am J Pathol 2001; 158:419-29
  • GOLPH2-f CTGGTGGCCTGCATCATCGTCTTG (SEQ ID NO:5)
  • GOLPH2-r GCTGCTCCCGCTGCTTCTCCA (SEQ ID NO:6)
  • PCA3-f CATGGTGGGAAGGACCTGATGATAC
  • PCA3-r GATGTGTGGCCTCAGATGGTAAAGTC
  • SPINKl-f CAAAAATCTGGGCCTTGCTGAGAAC
  • SPINKl -r AGGCCTCGCGGTGACCTGAT (SEQ ID NO: 10)
  • TFF3-f AACCGGGGCTGCTGCTTTGACTC (SEQ ID NO: 11)
  • TFF3-r TCCTGCAGGGGCTTGAAACACCA (SEQ ID NO:12).
  • TMPRSS2:ERG fusions were detected using Taqman primers/probe, with the following sequences:
  • TM-ERGa3-f CTGGAGCGCGGCAGGAA (SEQ ID NO: 13), TM-ERGa3 -r: CCGTAGGCACACTCAAACAACGA (SEQ ID NO: 14),
  • TM-ERGa3_MGB-probe 5 '-MGB-TTATCAGTTGTGAGTGAGGAC-S ' (SEQ ID NO:
  • Threshold levels were set during the exponential phase of the qPCR reaction using
  • TMPRSS2:ERG was dichotomized as a binary variable to reflect the fusion positive or negative status observed in tissue samples (Tomlins et al., 2005, supra, Perner et al, Am J Surg Pathol 2007;31:882-8), with positive samples defined as those with C t values less than 37.
  • PCA3 has been reported to be a prostate tissue-specific marker (de Kok et al., Cancer Res 2002;62:2695-8), it was normalized against urine PSA (CtpsA-QpcAs)- All other testing variables were adjusted against their mean urine PSA and GAPDH values ((C t psA+C t GAPDH)/ 2-Ctvanabie)- Twenty two samples showing outlier values were excluded, as at least one testing variable in those samples showed an adjusted value below 3 standard deviations from its sample mean, indicating qPCR failure. This resulted in a final data set of samples from 138 patients with prostate cancer (86 positive needle biopsy and 52 radical prostatectomy patients) and 96 biopsy-negative patients.
  • Risk Stratification Clinical information was identified from the medical record to determine association with clinical factors such as clinical stage, Gleason score, and risk categories based on biopsy results and pathologic data (D'Amico et al., JAMA 1998;280:969-74). Clinical nomograms were used to calculate risk of progression free survival and pathologic staging (Kattan et al., J Natl Cancer Inst 1998;90:766-71; Kattan et al.,
  • a novel risk stratification grouping (High risk vs. low risk) was also evaluated by grouping all Gleason 6 tumors, any Gleason 7 tumors with clinical Tie stage or Gleason 3 +4 tumors as a low risk tumors and Gleason 8+, stage T2 Gleason 7 tumors or tumors with Gleason 4 +3 grading as high risk tumors. All variables were tested for univariate association with each clinical risk group.
  • P 0.450 and 0.189, respectively.
  • the lack of specificity of AMACR and TFF3 in urine may be due to expression of these transcripts in urothelial or kidney derived cellular material which can also be shed in the urine.
  • TMPRSS2:ERG status showing association with risk groups was observed. Similar to the previously described PCR based test for breast cancer recurrence risk, a prostate cancer risk test can be used to drive high risk patients to therapies more suited for their disease course (van Gils et al, supra). In summary, this example describes a multiplexed qPCR based assay on sedimented urine collected from patients presenting for prostate biopsy or prostatectomy that exhibits superior performance relative to serum PSA or PCA3 alone.
  • the multiplex urine test which is a combination of PCA3, SPINKl, GOLPH2 and TMPRSS2:ERG status achieves a specificity and positive predictive value of >75%, making it a useful test to complement serum PSA, which has poor specificity in detecting prostate cancer.
  • Table 5 The multiplex urine test, which is a combination of PCA3, SPINKl, GOLPH2 and TMPRSS2:ERG status achieves a specificity and positive predictive value of >75%, making it a useful test to complement serum PSA, which has poor specificity in detecting prostate cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US2007/084090 2006-11-08 2007-11-08 Spink1 as a prostate cancer marker and uses thereof Ceased WO2008058239A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CA 2668961 CA2668961A1 (en) 2006-11-08 2007-11-08 Spink1 as a prostate cancer marker and uses thereof
EP20070864115 EP2079851B1 (en) 2006-11-08 2007-11-08 Method using spink1 as a prostate cancer marker
CN2007800495248A CN101652484B (zh) 2006-11-08 2007-11-08 前列腺癌标志物spink1及其应用
JP2009536481A JP2010508855A (ja) 2006-11-08 2007-11-08 前立腺癌マーカーとしてのspink1およびその使用
AU2007317306A AU2007317306B2 (en) 2006-11-08 2007-11-08 SPINK1 as a prostate cancer marker and uses thereof
US12/513,637 US20100129804A1 (en) 2006-11-08 2007-11-08 Spink1 as a prostate cancer marker and uses thereof
IL198526A IL198526A (en) 2006-11-08 2009-05-03 Spink1 as a prostate cancer marker and uses thereof
IL21537311A IL215373A (en) 2006-11-08 2011-09-25 Spink 1 as a prostate cancer marker and its use @

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US85775806P 2006-11-08 2006-11-08
US60/857,758 2006-11-08
US90687607P 2007-03-14 2007-03-14
US60/906,876 2007-03-14

Publications (3)

Publication Number Publication Date
WO2008058239A2 true WO2008058239A2 (en) 2008-05-15
WO2008058239A3 WO2008058239A3 (en) 2008-11-06
WO2008058239A9 WO2008058239A9 (en) 2009-12-23

Family

ID=39365376

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/084090 Ceased WO2008058239A2 (en) 2006-11-08 2007-11-08 Spink1 as a prostate cancer marker and uses thereof

Country Status (8)

Country Link
US (1) US20100129804A1 (enExample)
EP (1) EP2079851B1 (enExample)
JP (2) JP2010508855A (enExample)
CN (2) CN101652484B (enExample)
AU (1) AU2007317306B2 (enExample)
CA (1) CA2668961A1 (enExample)
IL (2) IL198526A (enExample)
WO (1) WO2008058239A2 (enExample)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011102999A3 (en) * 2010-02-19 2011-12-08 The Regents Of The University Of Michigan Spink1 targeted therapy
EP2748335A4 (en) * 2011-08-22 2015-05-06 Exosome Diagnostics Inc URINBIOMARKER
KR20180026023A (ko) * 2016-09-01 2018-03-12 충북대학교 산학협력단 전립선암 예후 분석용 신규 바이오마커 및 그의 용도
EP4310198A3 (en) * 2011-05-12 2024-04-24 MDxHealth Research B.V. Molecular markers in prostate cancer

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2795242C (en) * 2010-04-02 2019-08-13 Veridex, Llc Gene-based prediction of psa recurrence for clinically localized prostate cancer patients
WO2012078752A2 (en) * 2010-12-09 2012-06-14 Philadelphia Health & Education Corporation D/B/A Serine protease inhibitor kazal antibodies
WO2013036755A1 (en) * 2011-09-09 2013-03-14 Sloan-Kettering Institute For Cancer Research Etv1 antibodies and uses thereof
EP2786151B1 (en) * 2011-11-29 2019-07-03 F.Hoffmann-La Roche Ag Methods for prostate cancer analysis
CN103436594A (zh) * 2012-10-16 2013-12-11 科蒂亚(新乡)生物技术有限公司 一种bdna在尿液中检测pca3的应用
CN102968558B (zh) * 2012-11-14 2015-11-18 叶定伟 一种预测初诊前列腺癌骨转移风险的装置
WO2016087430A1 (en) * 2014-12-01 2016-06-09 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Novel RNA-biomarker signature for diagnosis of prostate cancer
CN104531878B (zh) * 2015-01-04 2017-11-10 上海市同济医院 一种联合lncRNA和AR3检测试剂盒及应用
CN105717082A (zh) * 2016-02-02 2016-06-29 管晓翔 一种用于检测三阴性乳腺癌瘤内异质性的方法
CN109521457B (zh) * 2018-09-25 2022-10-21 中国辐射防护研究院 一种基于信息准则的γ辐射源项划分方法及系统
CN111110849B (zh) * 2018-10-11 2021-09-10 中国科学院上海营养与健康研究所 丝氨酸蛋白酶抑制因子Kazal 1型在制备细胞衰老及肿瘤诊断或调控制剂中的应用
CN109678950B (zh) * 2019-01-08 2022-05-10 灏灵赛奥(天津)生物科技有限公司 spink1抗原、能够特异性结合spink1的抗体及其功能片段及其应用和产品
CN109776679B (zh) * 2019-01-08 2022-06-17 灏灵赛奥(天津)生物科技有限公司 一种丝氨酸蛋白酶抑制因子spink1的抗体、其制备方法和应用
US11788091B2 (en) 2019-08-21 2023-10-17 University Of Virginia Patent Foundation Methods and compositions for diagnosing and treating prostate cancer based on long noncoding RNA overlapping the LCK gene that regulates prostate cancer cell growth
US12319967B2 (en) 2019-08-21 2025-06-03 University Of Virginia Patent Foundation Methods and compositions for diagnosing and treating prostate cancer based on long noncoding RNA overlapping the LCK gene that regulates prostate cancer cell growth
CN111308095A (zh) * 2020-03-04 2020-06-19 北京师范大学 用于诊断前列腺癌的尿液蛋白标记物
EP4232605A4 (en) * 2020-11-11 2024-09-25 University of Virginia Patent Foundation METHODS AND COMPOSITIONS FOR DIAGNOSING AND TREATING PROSTATE CANCER BASED ON LONG NON-CODING RNA OVERLAPPING THE LCK GENE REGULATING PROSTATE CANCER CELL GROWTH
JPWO2023276768A1 (enExample) * 2021-06-29 2023-01-05
CN115181801A (zh) * 2022-07-11 2022-10-14 中山大学附属第一医院 Bhlhe22在前列腺癌骨转移免疫治疗中的应用

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4323546A (en) * 1978-05-22 1982-04-06 Nuc Med Inc. Method and composition for cancer detection in humans
JP3448090B2 (ja) * 1994-02-16 2003-09-16 浜松ホトニクス株式会社 エネルギー移動検出法およびその装置
US20050214309A1 (en) * 1994-03-18 2005-09-29 Hinrichs Steven H Methods and compositions for modulating transcription factor activity
US5854206A (en) * 1995-08-25 1998-12-29 Corixa Corporation Compounds and methods for treatment and diagnosis of prostate cancer
EP0914335A2 (en) * 1996-03-15 1999-05-12 Corixa Corporation Compounds and methods for immunotherapy and immunodiagnosis of prostate cancer
EP1005546A2 (en) * 1997-02-25 2000-06-07 Corixa Corporation Compounds for immunotherapy of prostate cancer and methods for their use
US20030185830A1 (en) * 1997-02-25 2003-10-02 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
ES2324503T3 (es) * 1997-04-10 2009-08-07 Stichting Katholieke Universiteit University Medical Centre Nijmegen Pca3, genes pca3 y metodos de uso.
US6187799B1 (en) * 1997-05-23 2001-02-13 Onyx Pharmaceuticals Inhibition of raf kinase activity using aryl ureas
US6828429B1 (en) * 1999-03-26 2004-12-07 Henry M. Jackson Foundation For The Advancement Of Military Medicine Prostate-specific gene, PCGEM1, and the methods of using PCGEM1 to detect, treat, and prevent prostate cancer
CA2423154A1 (en) * 2000-09-21 2002-03-28 David Kenneth Dean Imidazole derivatives as raf kinase inhibitors
US6897024B2 (en) * 2001-05-31 2005-05-24 Stichting Katholieke Universiteit More Particularly The University Medical Centre Nijmegen Nucleic acid molecules comprising the promoter for PCA3, and uses thereof
US7229774B2 (en) * 2001-08-02 2007-06-12 Regents Of The University Of Michigan Expression profile of prostate cancer
US7217807B2 (en) * 2002-11-26 2007-05-15 Rosetta Genomics Ltd Bioinformatically detectable group of novel HIV regulatory genes and uses thereof
KR20060031809A (ko) * 2003-06-09 2006-04-13 더 리젠츠 오브 더 유니버시티 오브 미시간 암 치료 및 진단용 조성물 및 방법
WO2005026687A2 (en) * 2003-09-05 2005-03-24 Thomas Jefferson University Diagnosis and monitoring of hepatocellular carcinoma
CN101018874A (zh) * 2004-08-13 2007-08-15 千年药品公司 用于鉴定、评估、预防和治疗前列腺癌的基因、组合物、试剂盒和方法
US20060275794A1 (en) * 2005-03-07 2006-12-07 Invitrogen Corporation Collections of matched biological reagents and methods for identifying matched reagents
US7718369B2 (en) * 2005-09-12 2010-05-18 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
EP2074225B1 (en) * 2006-10-10 2014-12-03 The Henry M. Jackson Foundation for the Advancement of Military Medicine, Inc. Prostate cancer-specific alterations in erg gene expression and detection and treatment methods based on those alterations
WO2009044899A1 (ja) * 2007-10-03 2009-04-09 Kyowa Hakko Kirin Co., Ltd. 細胞の増殖を制御する核酸

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
BHARATHI ET AL., NEOPLASIA, vol. 8, no. 10, 1 October 2006 (2006-10-01)
BLOCK ET AL., PROC. NATL. ACAD. SCI. USA, vol. 102, 2005, pages 779 - 784
CANCER LETTERS, vol. 237, 2006, pages 298 - 304
CARELL ET AL., ANGEW. CHEM. INT. ED. ENGL., vol. 33, 1994, pages 2061
CARRELL ET AL., ANGEW. CHEM. INT. ED. ENGL., vol. 33, 1994, pages 2059
CHO ET AL., SCIENCE, vol. 261, 1993, pages 1303
DEWITT ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 90, 1993, pages 6909
ERB ET AL., PROC. NAD. ACAD. SCI. USA, vol. 91, 1994, pages 11422
EUROPEAN UROLOGY SUPPLEMENTS, vol. 5, no. 14, 1 September 2006 (2006-09-01)
FRADET ET AL., EUROPEAN UROLOGY SUPPLEMENTS, vol. 5, no. 2, 1 April 2006 (2006-04-01)
GALLOP ET AL., J. MED. CHEM., vol. 37, 1994, pages 1233
GRIFFIN ET AL., J CLIN ONE, vol. 9, 1991, pages 631 - 640
KLADNEY ET AL., GENE, vol. 249, 2000, pages 53 - 65
LAPOINTE ET AL., PNAS, vol. 101, no. 3, 2004, pages 811 - 816
LAUFFER, MAGNETIC RESONANCE IN MEDICINE, vol. 22, 1991, pages 339 - 342
NATURE, vol. 409, 2001, pages 953 - 958
See also references of EP2079851A4
SINGH ET AL.: "PROCEEDINGS OF THE ANNUAL MEETING OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH", vol. 47, 1 April 2006, AMERICAN ASSOCIATION FOR CANCER RESEARCH
SUMERDON ET AL., NUCL. MED. BIOL, vol. 17, 1990, pages 247 - 254
ZUCKENNANN ET AL., J. MED. CHEM., vol. 37, 1994, pages 2678 - 85
ZUCKERMANN ET AL., J. MED. CHEM., vol. 37, 1994, pages 2678

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011102999A3 (en) * 2010-02-19 2011-12-08 The Regents Of The University Of Michigan Spink1 targeted therapy
EP4310198A3 (en) * 2011-05-12 2024-04-24 MDxHealth Research B.V. Molecular markers in prostate cancer
EP2748335A4 (en) * 2011-08-22 2015-05-06 Exosome Diagnostics Inc URINBIOMARKER
KR20180026023A (ko) * 2016-09-01 2018-03-12 충북대학교 산학협력단 전립선암 예후 분석용 신규 바이오마커 및 그의 용도
KR101948385B1 (ko) * 2016-09-01 2019-05-13 충북대학교 산학협력단 전립선암 예후 분석용 신규 바이오마커 및 그의 용도

Also Published As

Publication number Publication date
CN101652484B (zh) 2013-03-20
CN103233063A (zh) 2013-08-07
AU2007317306B2 (en) 2012-06-14
WO2008058239A9 (en) 2009-12-23
IL215373A (en) 2013-07-31
CA2668961A1 (en) 2008-05-15
EP2079851A2 (en) 2009-07-22
US20100129804A1 (en) 2010-05-27
CN101652484A (zh) 2010-02-17
EP2079851B1 (en) 2015-01-07
JP2010508855A (ja) 2010-03-25
JP2014087335A (ja) 2014-05-15
IL215373A0 (en) 2011-11-30
IL198526A0 (en) 2010-02-17
EP2079851A4 (en) 2010-09-01
AU2007317306A1 (en) 2008-05-15
JP5850898B2 (ja) 2016-02-03
WO2008058239A3 (en) 2008-11-06
IL198526A (en) 2012-10-31

Similar Documents

Publication Publication Date Title
EP2079851B1 (en) Method using spink1 as a prostate cancer marker
EP3018216B1 (en) Recurrent gene fusions in prostate cancer
US10190173B2 (en) Recurrent gene fusions in prostate cancer
EP2430191B1 (en) Phosphodiesterase 4d7 as prostate cancer marker
US9957569B2 (en) Recurrent gene fusions in prostate cancer
AU2010295689B2 (en) Recurrent gene fusions in prostate cancer
JP2009508493A (ja) すい臓がんを診断するための方法
US8945556B2 (en) RAF gene fusions
US20120184452A1 (en) Methods for diagnosing follicular thyroid cancer
US7713693B1 (en) Human cancer cell specific gene transcript
HK1187055A (en) Recurrent gene fusions in prostate cancer

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200780049524.8

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07864115

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 198526

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2009536481

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2668961

Country of ref document: CA

Ref document number: 2007864115

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007317306

Country of ref document: AU

Ref document number: 3078/DELNP/2009

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2007317306

Country of ref document: AU

Date of ref document: 20071108

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12513637

Country of ref document: US