WO2008057161A1 - Érythropoiétine dérivée des oiseaux - Google Patents

Érythropoiétine dérivée des oiseaux Download PDF

Info

Publication number
WO2008057161A1
WO2008057161A1 PCT/US2007/021643 US2007021643W WO2008057161A1 WO 2008057161 A1 WO2008057161 A1 WO 2008057161A1 US 2007021643 W US2007021643 W US 2007021643W WO 2008057161 A1 WO2008057161 A1 WO 2008057161A1
Authority
WO
WIPO (PCT)
Prior art keywords
epo
composition
isolated mixture
glycosylated
protein
Prior art date
Application number
PCT/US2007/021643
Other languages
English (en)
Inventor
Robert D. Ivarie
Guodong Liu
Jeffrey C. Rapp
Julie A. Morris
Alex J. Harvey
Original Assignee
Synageva Biopharma Corp
University Of Georgia Research Foumdation, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Synageva Biopharma Corp, University Of Georgia Research Foumdation, Inc. filed Critical Synageva Biopharma Corp
Priority to AU2007318209A priority Critical patent/AU2007318209A1/en
Priority to EP07839423A priority patent/EP2076530A4/fr
Priority to CA002668487A priority patent/CA2668487A1/fr
Priority to JP2009536230A priority patent/JP2010509327A/ja
Publication of WO2008057161A1 publication Critical patent/WO2008057161A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/465—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from birds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/505—Erythropoietin [EPO]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics

Definitions

  • the present invention relates to the introduction of exogenous genetic material into avian cells and the expression of the exogenous genetic material in the avian cells.
  • the invention particularly relates to transgenic avian species, including chicken, quail and turkey, and to avians which lay eggs containing exogenous proteins, for example pharmaceutical proteins.
  • the avian oviduct can also potentially serve as a bioreactor.
  • Successful methods of modifying avian genetic material such that high levels of exogenous proteins are secreted in the oviduct and packaged into eggs would allow inexpensive production of large amounts of protein.
  • Several advantages of such an approach would be: a) short generation times (24 weeks) and rapid establishment of transgenic flocks via artificial insemination; b) readily scaled production by increasing flock sizes to meet production needs; c) post- translational modification of expressed proteins; 4) automated feeding and egg collection; d) naturally sterile egg-whites; and e) reduced processing costs due to the high concentration of protein in the egg white.
  • the avian reproductive system including that of the chicken, is well described.
  • the egg of the hen consists of several layers which are secreted upon the yolk during its passage through the oviduct.
  • the production of an egg begins with formation of the large yolk in the ovary of the hen.
  • the unfertilized oocyte is then positioned on top of the yolk sac.
  • the oocyte passes into the infundibulum of the oviduct where it is fertilized if sperm are present. It then moves into the magnum of the oviduct which is lined with tubular gland cells.
  • ovalbumin secretes the egg-white proteins, including ovalbumin, lysozyme, ovomucoid, conalbumin, and ovomucin, into the lumen of the magnum where they are deposited onto the avian embryo and yolk.
  • the ovalbumin gene encodes a 45 kD protein that is specifically expressed in the tubular gland cells of the magnum of the oviduct (Beato Cell 56:335-344(1989)).
  • Ovalbumin is the most abundant egg white protein, comprising over 50 percent of the total protein produced by the tubular gland cells, or about 4 grams of protein per large Grade A egg (Gilbert, "Egg albumen and its formation” in Physiology and Biochemistry of the Domestic Fowl, Bell and Freeman, eds., Academic Press, London, N. Y., pp. 1291 -1329).
  • the ovalbumin gene and over 20 kb of each flanking region have been cloned and analyzed (Lai et al., Proc. Natl. Acad. Sci.
  • ovalbumin gene responds to steroid hormones such as estrogen, glucocorticoids, and progesterone, which induce the accumulation of about 70,000 ovalbumin mRNA transcripts per tubular gland cell in immature chicks and 100,000 ovalbumin mRNA transcripts per tubular gland cell in the mature laying hen (Palmiter, J. Biol. Chem. 248:8260-8270 (1973); Palmiter, Cell 4:189-197 (1975)).
  • DNAse hypersensitivity analysis and promoter-reporter gene assays in transfected tubular gland cells defined a 7.4 kb region as containing sequences required for ovalbumin gene expression.
  • This 5' flanking region contains four DNAse 1-hypersensitive sites centered at -0.25, -0.8, -3.2, and -6.0 kb from the transcription start site. These sites are called HS-I, -II, -III, and -IV, respectively. These regions reflect alterations in the chromatin structure and are specifically correlated with ovalbumin gene expression in oviduct cells (Kaye et al., EMBO 3:1137-1 144 (1984)). Hypersensitivity of HS-II and -III are estrogen-induced, supporting a role for these regions in hormone-induction of ovalbumin gene expression.
  • HS-I and HS-II are both required for steroid induction of ovalbumin gene transcription, and a 1.4 kb portion of the 5' region that includes these elements is sufficient to drive steroid-dependent ovalbumin expression in explanted tubular gland cells (Sanders and McKnight, Biochemistry 27: 6550-6557 (1988)).
  • HS-I is termed the negative-response element ("NRE") because it contains several negative regulatory elements which repress ovalbumin expression in the absence of hormones (Haekers et al., MoI. Endo. 9:1113-1126 (1995)). Protein factors bind these elements, including some factors only found in oviduct nuclei suggesting a role in tissue-specific expression.
  • HS-II is termed the steroid-dependent response element ("SDRE") because it is required to promote steroid induction of transcription. It binds a protein or protein complex known as Chirp-I. Chirp-I is induced by estrogen and turns over rapidly in the presence of cyclohexamide (Dean et al., MoI. Cell. Biol. 16:2015-2024 (1996)).
  • SDRE steroid-dependent response element
  • HS-III contains a functional estrogen response element, and confers estrogen inducibility to either the ovalbumin proximal promoter or a heterologous promoter when co-transfected into HeLa cells with an estrogen receptor cDNA. These data imply that HS-III may play a functional role in the overall regulation of the ovalbumin gene. Little is known about the function of HS-IV, except that it does not contain a functional estrogen-response element (Kato et al., Cell 68: 731-742 (1992)).
  • Transgenesis has been accomplished in mammals by several different methods.
  • mammals including the mouse, pig, goat, sheep and cow
  • a transgene is microinjected into the pronucleus of a fertilized egg, which is then placed in the uterus of a foster mother where it gives rise to a founder animal carrying the transgene in its germline.
  • the transgene is engineered to carry a promoter with specific regulatory sequences directing the expression of the foreign protein to a particular cell type. Since the transgene inserts randomly into the genome, position effects at the site of the transgene's insertion into the genome may variably cause decreased levels of transgene expression.
  • a second method for effecting animal transgenesis is targeted gene disruption, in which a targeting vector containing sequences of the target gene flanking a selectable marker gene is introduced into embryonic stem (“ES") cells. By homologous recombination, the targeting vector replaces the target gene sequences at the chromosomal locus or inserts into interior sequences preventing expression of the target gene product.
  • ES embryonic stem
  • Clones of ES cells having the appropriately disrupted gene are selected and then injected into early stage blastocysts generating chimeric founder animals, some of which have the transgene in the germ line.
  • the transgene deletes the target locus, it replaces the target locus with foreign DNA borne in the transgene vector, which consists of DNA encoding a selectable marker useful for detecting transfected ES cells in culture and may additionally contain DNA sequences encoding a foreign protein which is then inserted in place of the deleted gene such that the target gene promoter drives expression of the foreign gene (U.S. Pat. Nos. 5,464,764 and 5,487,992 (M. P. Capecchi and K. R. Thomas)).
  • This approach suffers from the limitation that ES cells are unavailable in many mammals, including goats, cows, sheep and pigs. Furthermore, this method is not useful when the deleted gene is required for survival or proper development of the organism or cell type.
  • Germ-line transgenic chickens may be produced by injecting replication-defective retrovirus into the subgerminal cavity of chick blastoderms in freshly laid eggs (U.S. Pat. No. 5,162,215; Bosselman et al., Science 243:533-534 (1989); Thoraval et al., Transgenic Research 4:369-36 (1995)).
  • the retroviral nucleic acid carrying a foreign gene randomly inserts into a chromosome of the embryonic cells, generating transgenic animals, some of which have the transgene in their germ line.
  • Use of insulator elements inserted at the 5' or 3' region of the fused gene construct to overcome position effects at the site of insertion has been described (Chim et al., Cell 74:504-514 (1993)).
  • a transgene has been microinjected into the germinal disc of a fertilized egg to produce a stable transgenic founder avian that may pass the gene to the Fl generation (Love et al., Bio/Technology 12:60-63 (1994)).
  • this method has several disadvantages. Hens must be sacrificed in order to collect the fertilized egg, the fraction of transgenic founders is low, and injected eggs require labor intensive in vitro culture in surrogate shells.
  • blastodermal cells containing presumptive primordial germ cells are excised from donor eggs, transfected with a transgene and introduced into the subgerminal cavity of recipient embryos.
  • the transfected donor cells are incorporated into the recipient embryos generating transgenic embryos, some of which are expected to have the transgene in the germ line.
  • the transgene inserts in random chromosomal sites by nonhomologous recombination. However, no transgenic founder avians have yet been generated by this method.
  • Lui Poult. Sci. 68:999-1010 (1995), used a targeting vector containing flanking DNA sequences of the vitellogenin gene to delete part of the resident gene in chicken blastodermal cells in culture.
  • these cells can contribute to the germ line and thus produce a transgenic embryo.
  • this method is not useful when the deleted gene is required for survival or proper development of the organism or cell type.
  • the abnormal genes that cause cancer comprise at least three types: firstly, there are the oncogenes, which, when altered, encourage the abnormal growth and division that characterize cancer. Secondly, there are the tumor suppressor genes, which, when altered, fail to control this abnormal growth and division. Thirdly, there are the DNA repair genes, which, when altered, fail to repair mutations that can lead to cancer. researchers speculate that there are about 30 to 40 tumor suppressor genes in the body, each of which produces a protein. These proteins may be controlled by "master" tumor suppressor proteins such as Rb (for retinoblastoma, with which it was first associated) and p53 (associated with many different tumors).
  • Rb for retinoblastoma, with which it was first associated
  • p53 associated with many different tumors.
  • Intercellular communication is dependent on the proper functioning of all the structural components of the tissue through which the messages are conveyed: the matrix, the cell membrane, the cytoskeleton, and the cell itself.
  • the communication network between cells is disrupted. If the cytoskeLeton is disrupted, the messages don't get through to the nucleus and the nucleus begins to function abnormally. Since the nucleus is the site where the oncogenes or tumor suppressor genes get switched on or off, this abnormal functioning can lead to malignancy. When this happens, the cells start growing irregularly and do not differentiate. They may also start to move and disrupt other cells.
  • Interferon probably in concert with other extracellular and cellular substances, restores the balance and homeostasis, making sure the messages get through properly. Interferon stops growth, stops motility, and enhances the ability of the cell, through adhesion molecules, to respond to its environment. It also corrects defects and injuries in the cytoskeleton. Interferon has been found to block angiogenesis, the initial step in the formation of new blood vessels that is essential to the growth of malignancies. Moreover, it blocks fibrosis, a response to injury that stimulates many different kinds of cells and promotes cell growth (Kathryn L. Hale, Oncolog, Interferon: The Evolution of a Biological Therapy, Talcing a New Look at Cytokine Biology).
  • Interferon is produced by animal cells when they are invaded by viruses and is released into the bloodstream or intercellular fluid to induce healthy cells to manufacture an enzyme that counters the infection. For many years the supply of human interferon for research was limited by costly extraction techniques. In 1980, however, the protein became available in greater quantities through genetic engineering (i.e., recombinant forms of the protein). Scientists also determined that the body makes three distinct types of interferon, referred to as ⁇ -(alpha), ⁇ -(beta), and ⁇ -(gamma) interferon. Interferons were first thought to be highly species-specific, but it is now known that individual interferons may have different ranges of activity in other species.
  • Alpha interferon has been approved for therapeutic use against hairy-cell leukemia and hepatitis C.
  • ⁇ -IFN has also been found effective against chronic hepatitis B, a major cause of liver cancer and cirrhosis, as well as for treatment of genital warts and some rarer cancers of blood and bone marrow.
  • Nasal sprays containing ⁇ -IFN provide some protection against colds caused by rhinoviruses.
  • Human ⁇ -IFN belongs to a family of extra-cellular signaling proteins with antiviral, antiproliferating and immunomodulatory activities. IFN- ⁇ proteins are encoded by a multigene family which includes 13 genes clustered on the human chromosome 9.
  • IFN- ⁇ genes are expressed at the mRNA level in leukocytes induced by Sendai virus. Further, it has been shown that at least nine different sub-types are also produced at the protein level. The biological significance of the expression of several similar IFN- ⁇ proteins is not known, however, it is believed that they have quantitatively distinct patterns of antiviral, growth inhibitory and killer-cell-stimulatory activities.
  • IFN- ⁇ 2a and IFN- ⁇ 2b are mass produced in Escherichia coli by recombinant technology and marketed as drugs.
  • IFN- ⁇ Unlike natural IFN- ⁇ , these recombinant IFN- ⁇ products have been shown to be immunogenic in some patients, which could be due to unnatural forms of IFN- ⁇ proteins. Thus, for the development of IFN- ⁇ drugs it is necessary to not only identify the IFN- ⁇ subtypes and variants expressed in normal human leukocytes, but also to characterize their possible post-translational modifications (Nyman et al. (1998) Eur. J. Biochem. 253:485-493).
  • Nyman et al. studied the glycosylation of natural human IFN- ⁇ . They found that two out of nine of the subtypes produced by leukocytes after a Sendai-virus induction were found to be glycosylated, namely IFN- ⁇ 14c and IFN- ⁇ 2b, which is consistent with earlier studies. IFN- ⁇ 14 is the only IFN- ⁇ subtype with potential " N- glycosylation sites, Asn2 and Asn72, but only Asn72 is actually glycosylated. IFN- ⁇ 2 is O-glycosylated at Threonine 106 (ThrlO ⁇ ). Interestingly, no other IFN- ⁇ subtype contains Thr at this position. In this study, Nyman et al.
  • IFN- ⁇ 2b and IFN- ⁇ 14c resolved into three peaks in reversed-phase high performance liquid chromatography (RP-HPLC).
  • Electrospray ionization mass spectrometry (ESI-MS) analysis of IFN- ⁇ 2b fractions from RP-HPLC revealed differences in their molecular masses, suggesting that these represent different glycoforms. This was confirmed by masspectrometric analysis of the liberated O- glycans of each fraction.
  • IFN- ⁇ 2b was estimated to contain about 20% of the core type-2 pentasaccharide, and about 50% of disialylated and 30% of monosialylated core type-1 glycans.
  • Nyman et al.'s data agrees with previous partial characterization of IFN- ⁇ 2b glycosylation (Adolf et al. (1991) Biochem. J. 276:511-518).
  • the role of glycosylation in IFN- ⁇ 14c and IFN- ⁇ 2b is not clearly established. According to Nyman et al. (supra), the carbohydrate chains are not essential for the biological activity, but glycosylation may have an effect on the pharmacokinetics and stability of the proteins.
  • IFN- ⁇ proteins contain 166 amino acids (with the exception of IFN- ⁇ 2, which has 165 amino acids) and characteristically contain four conserved cysteine residues which form two disulfide bridges.
  • IFN- ⁇ species are slightly acidic in character and lack a recognition site for asparagine-linked glycosylation (with the exception of IFN- ⁇ 14 which does contain a recognition site for asparagine-linked glycosylation).
  • IFN- ⁇ 2a Three variants of IFN- ⁇ 2, differing in their amino acids at positions 23 and 34, are known: IFN- ⁇ 2a (Lys-23, His-34); IFN- ⁇ 2b (Arg-23, His-34); and IFN- ⁇ 2c (Arg-23, Arg-34). It is believed that IFN- ⁇ 2a and IFN- ⁇ 2c are allelic variants of IFN- ⁇ 2b. See, Gewert et al (1993) J. Interferon Res. vol 13, p 227-231. The minor differences in amino acid content of the IFN- ⁇ 2 species is not expected to effect glycosylation of the interferons.
  • glycosyation patterns are expected to be essentially the same for each of IFN- ⁇ 2a, 2b and 2c.
  • Two other human IFN species namely IFN-oo 1 and IFN- ⁇ are N-glycosylated and are more distantly related to IFN- ⁇ .
  • IFN- ⁇ , - ⁇ and - ⁇ collectively referred to as class I IFNs, bind to the same high affinity cell membrane receptor (Adolf et al. (1991) Biochem. J. 276:511-518).
  • Adolf et al. used the specificity of a monoclonal antibody for the isolation of natural IFN- ⁇ 2 from human leukocyte IFN.
  • Adolf et al. also speculated that natural IFN- ⁇ 2 carries O-linked carbohydrate residues. Their hypothesis was confirmed by cleavage of the putative peptide-carbohydrate bond with alkali; the resulting protein was homogeneous and showed the same molecular mass as the recombinant protein. Further comparison of natural and recombinant proteins after proteolytic cleavage, followed by separation and analysis of the resulting fragments, allowed them to define a candidate glycopeptide. Sequence analysis of this peptide identified Thr-106 as the O-glycosylation site. A comparison of the amino acid sequences of all published IFN- ⁇ 2 species revealed that this threonine residue is unique to IFN- ⁇ 2. Glycine, isoleucine or glutamic acid are present at the corresponding position (107) in all other proteins.
  • IFN- ⁇ 2 produced in E. coli are devoid of O-glycosylation and have been registered as drugs in many countries.
  • the immunogenicity of therapeutically applied E. coli-derived IFN- ⁇ 2 might be affected by the lack of glycosylation.
  • This invention provides vectors and methods for the stable introduction of exogenous nucleic acid sequences into the genome of avians in order to express the exogenous sequences to alter the phenotype of the avians or to produce desired proteins.
  • transgenic avians are produced which express exogenous sequences in their oviducts and which deposit exogenous proteins, such as pharmaceutical proteins, into their eggs.
  • Avian eggs that contain such exogenous proteins are encompassed by this invention.
  • the present invention further provides novel forms of therapeutic proteins (e.g., human cytokines) including interferons, G- CSF, G-MCSF and erythropoietin which are efficiently expressed in the oviduct of transgenic avians and deposited into avian eggs.
  • the invention is drawn to proteins (e.g., human proteins) such as cytokines produced in avians.
  • the invention is drawn to human erythropoietin with a glycosylation pattern (e.g., poultry derived erythropoietin) wherein the erythropoietin is obtained from avian cells of a transgenic chicken, transgenic quail or transgenic turkey.
  • human proteins including cytokines such as erythropoietin produced in avians in isolated or purified form and present in pharmaceutical compositions.
  • the isolation of the recombinant proteins of the invention including erythropoietin can be accomplished by methodologies readily apparent to a practitioner skilled in the art of protein purification.
  • the make-up of formulations useful for producing pharmaceutical compositions are also well known in the art.
  • the proteins of the invention including erythropoietin have a glycosylation pattern that is obtained from poultry or avian oviduct cells, for example, tubular gland cells (e.g., tubular gland cells of a chicken).
  • One aspect of the present invention provides methods for producing exogenous proteins in specific tissues of avians. Exogenous proteins may be expressed in the oviduct, blood and/or other cells and tissues of the avian.
  • transgenes are introduced into embryonic blastodermal cells, for example, near stage X, to produce a transgenic avian, such that the protein of interest is expressed in the tubular gland cells of the magnum of the oviduct, secreted into the lumen, and deposited into the egg white of a hard shell egg.
  • a transgenic avian so produced can carry the transgene in its germ line.
  • the exogenous genes can therefore be transmitted to avians by both artificial introduction of the exogenous gene into avian embryonic cells, and by the transmission of the exogenous gene to the avian's offspring stably in a Mendelian fashion.
  • the present invention encompasses methods of producing exogenous protein in an avian oviduct.
  • the methods may include a first step of providing a vector that contains a coding sequence and a promoter operably linked to the coding sequence, so that the promoter can effect expression of the nucleic acid in the avian oviduct.
  • transgenic cells and/or tissues can be produced, wherein the vector is introduced into avian embryonic blastodermal cells, either freshly isolated, in culture, or in an embryo, so that the vector sequence is inserted, for example, randomly inserted into the avian genome.
  • a mature transgenic avian which expresses the exogenous protein in its oviduct can be derived from the transgenic cells and/or tissue.
  • This method can also be used to produce an avian egg which contains exogenous protein such as a pharmaceutical protein (e.g., a cytokine) when the exogenous protein that is expressed in the oviduct is also secreted into the oviduct lumen and deposited into the egg, for example, in the egg white of a hard shell egg.
  • exogenous protein such as a pharmaceutical protein (e.g., a cytokine)
  • a pharmaceutical protein e.g., a cytokine
  • the production of a transgenic bird by chromosomal insertion of a vector into its avian genome may optionally involve DNA transfection of embryonic blastodermal cells which are then injected into the subgerminal cavity beneath a recipient blastoderm.
  • the vector used in such a method may have a promoter which is fused to an exogenous coding sequence and directs expression of the coding sequence in the tubular gland cells of the oviduct.
  • a random chromosomal insertion and the production of a transgenic avian is accomplished by transduction of embryonic blastodermal cells with replication-defective or replication-competent retroviral particles carrying the transgene genetic code between the 5 1 and 3' LTRs of the retroviral rector.
  • retroviral particles carrying the transgene genetic code between the 5 1 and 3' LTRs of the retroviral rector.
  • an avian leukosis virus (ALV) retroviral vector or a murine leukemia virus (MLV) retroviral vector may be used which comprises a modified pNLB plasmid containing an exogenous gene that is inserted downstream of a segment of a promoter region.
  • RNA copy of the modified retroviral vector, packaged into viral particles can be used to infect embryonic blastoderms which develop into transgenic avians.
  • helper cells which produce the retroviral transducing particles are delivered to the embryonic blastoderm.
  • Another aspect of the invention provides a vector which includes a coding sequence and a promoter in operational and positional relationship such that the coding sequence is expressed in an avian oviduct.
  • Such vectors include, but are not limited to, an avian leukosis virus (ALV) retroviral vector, a murine leukemia virus (MLV) retroviral vector, and a lentivirus vector.
  • the vector may be a nucleic acid sequence which includes an LTR of an avian leukosis virus (ALV) retroviral vector, a murine leukemia virus (MLV) retroviral vector, or a lentivirus vector.
  • ABV avian leukosis virus
  • MLV murine leukemia virus
  • lentivirus vector a nucleic acid sequence which includes an LTR of an avian leukosis virus (ALV) retroviral vector, a murine leukemia virus (MLV) retroviral vector, or a lentivirus vector.
  • the promoter is sufficient for effecting expression of the coding sequence in the avian oviduct.
  • the coding sequence codes for an exogenous protein which is deposited into the egg white of a hard shell egg.
  • the coding sequence codes for exogenous proteins such as transgenic poultry derived proteins such as interferon- ⁇ 2b (TPD IFN- ⁇ 2b) and transgenic poultry derived erythropoietin (TPD EPO) and transgenic poultry derived granulocyte colony stimulating factor (TPD G-CSF).
  • vectors used in the methods of the invention contain a promoter which is particularly suited for expression of exogenous proteins in avians and their eggs.
  • expression of the exogenous coding sequence may occur in the oviduct and blood of the transgenic avian and in the egg white of its avian egg.
  • the promoters include, but are not limited to, a cytomegalovirus (CMV) promoter, a MDOT promoter, a rous-sarcoma virus (RSV) promoter, a ⁇ -actin promoter (e.g., a chicken ⁇ -actin promoter) a murine leukemia virus (MLV) promoter, a mouse mammary tumor virus (MMTV) promoter, an ovalbumin promoter, a lysozyme promoter, a conalbumin promoter, an ovomucoid promoter, an ovomucin promoter, and an ovotransferrin promoter.
  • CMV cytomegalovirus
  • MDOT rous-sarcoma virus
  • RSV rous-sarcoma virus
  • ⁇ -actin promoter e.g., a chicken ⁇ -actin promoter
  • MMV murine leukemia virus
  • MMTV mouse mammary tumor virus
  • the promoter may be a segment of at least one promoter region, such as a segment of the ovalbumin-, lysozyme-, conalbumin-, ovomucoid-, ovomucin-, and ovotransferrin promoter region.
  • the promoter is a combination or a fusion of one or more promoters or a fusion of a portion of one or more promoters such as ovalbumin-, lysozyme-, conalbumin-, ovomucoid-, ovomucin-, and ovotransferrin promoters.
  • One aspect of the invention involves truncating the ovalbumin promoter and/or condensing the critical regulatory elements of the ovalbumin promoter so that it retains sequences required for expression in the tubular gland cells of the magnum of the oviduct, while being small enough that it can be readily incorporated into vectors.
  • a segment of the ovalbumin promoter region may be used. This segment comprises the 5'-flanking region of the ovalbumin gene.
  • the total length of the ovalbumin promoter segment may be from about 0.88 kb to about 7.4 kb in length, and is preferably from about 0.88 kb to about 1.4 kb in length.
  • the segment preferably includes both the steroid-dependent regulatory element and the negative regulatory element of the ovalbumin gene.
  • the segment optionally also includes residues from the 5 'untranslated region (5 1 UTR) of the ovalbumin gene.
  • the promoter may be a segment of the promoter region of the lysozyme-, conalbumin-, ovomucin-, ovomucoid- and ovotransferrin genes.
  • An example of such a promoter is the synthetic MDOT promoter which is comprised of elements from the ovomucoid (MD) and ovotransferrin (OT) promoter.
  • the vectors integrated into the avian genome contain constitutive promoters which are operably linked to the exogenous coding sequence (e.g., cytomegalovirus (CMV) promoter, rous-sarcoma virus (RSV) promoter, and a murine leukemia virus (MLV) promoter.
  • constitutive promoters e.g., cytomegalovirus (CMV) promoter, rous-sarcoma virus (RSV) promoter, and a murine leukemia virus (MLV) promoter.
  • a non- constitutive promoter such as a mouse mammary tumor virus (MMTV) promoter may be used.
  • transgenic avians which carry a transgene in the genetic material of their germ-line tissue. More specifically, the transgene includes an exogenous gene and a promoter in operational and positional relationship to express the exogenous gene.
  • the exogenous gene may be expressed in the avian oviduct and in the blood of the transgenic avian.
  • the exogenous gene codes for exogenous proteins such as pharmaceutical proteins including cytokines such as TPD IFN- ⁇ (e.g., IFN- ⁇ 2) and TPD EPO and TPD G-CSF.
  • TPD IFN- ⁇ e.g., IFN- ⁇ 2
  • TPD EPO and TPD G-CSF TPD G-CSF.
  • the exogenous protein is deposited into the egg white of a hard shell egg.
  • Another aspect of the invention provides for an avian egg which contains protein exogenous to the avian species.
  • exogenous proteins in oviduct cells with secretion of the proteins into the lumen of the oviduct magnum and deposition into the egg white of the avian egg.
  • Proteins packaged into eggs may be present in quantities of up to one gram or more per egg.
  • the exogenous protein includes, but is not limited to, TPD IFN- ⁇ 2 and TPD EPO and TPD G-CSF.
  • Still another aspect of the invention provides an isolated polynucleotide sequence comprising the optimized coding sequence of human interferon- ⁇ 2b (IFN- ⁇
  • transgenic poultry derived interferon- ⁇ 2b i.e., recombinant transgenic poultry derived interferon- ⁇ 2b coding sequence which codes for transgenic poultry derived interferon- ⁇ 2b (TPD IFN- ⁇ 2b).
  • the invention also encompasses an isolated protein comprising the polypeptide sequence of TPD IFN - ⁇ 2b, wherein the protein is O-glycosylated at Thr-106 with N-Acetyl- Galactosamine, Galactose, N-Acetyl-Glucosamine, Sialic acid, and combinations thereof.
  • the invention further contemplates a pharmaceutical composition comprising the polypeptide sequence of TPD IFN- ⁇ 2b, wherein the protein is O-glycosylated at Thr-106 with N-Acetyl-Galactosamine, Galactose, N-Acetyl-Glucosamine, Sialic acid, and combinations thereof.
  • Codon optimization may be determined from the codon usage of at least one, and preferably more than one, protein expressed in an avian cell (e.g., a chicken cell).
  • the codon usage may be determined from the nucleic acid sequences encoding the proteins ovalbumin, lysozyme, ovomucin and ovotransferrin of chicken.
  • the DNA coding sequence for the exogenous protein may be codon optimized using the BACKTRANSLATE® program of the Wisconsin Package, version 9.1 (Genetics Computer Group, Inc., Madison, WI) with a codon usage table compiled from the chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and ovotransferrin proteins.
  • One aspect of the invention provides an isolated polynucleotide sequence comprising the optimized coding sequence of human erythropoietin (EPO), i.e., recombinant transgenic poultry derived erythropoietin coding sequence which codes for transgenic poultry derived erythropoietin (TPD EPO).
  • EPO human erythropoietin
  • TPD EPO transgenic poultry derived erythropoietin
  • Another aspect of the invention provides for a vector comprising a first and second coding sequence and a promoter in operational and positional relationship to the first and second coding sequence to express the first and second coding sequence in an avian oviduct.
  • the vector may include an internal ribosome entry site
  • protein X may be a light chain (LC) of a monoclonal antibody and protein Y may be a heavy chain (HC) of a monoclonal antibody.
  • the protein encoded by the second coding sequence e.g., enzyme
  • the protein encoded by the second coding sequence may be capable of providing post-translational modification of the protein encoded by the first coding sequence.
  • the vector optionally includes additional coding sequences and additional IRES elements, such that each coding sequence in the vector is separated from another coding sequence by an IRES element.
  • additional coding sequences and additional IRES elements such that each coding sequence in the vector is separated from another coding sequence by an IRES element.
  • the invention also contemplates methods of producing an avian egg which contains proteins such as pharmaceutical proteins including monoclonal antibodies, enzymes and other proteins.
  • Such methods may include providing a vector with a promoter, coding sequences, and at least one IRES element; creating transgenic cells or tissue by introducing the vector into avian embryonic blastodermal cells, wherein the vector sequence is randomly inserted into the avian genome; and deriving a mature transgenic avian from the transgenic cells or tissue.
  • the transgenic avian so derived may express the coding sequences in its oviduct, and the resulting protein secreted into the oviduct lumen, so that the protein is deposited into the egg white of a hard shell egg.
  • the invention includes progeny of the transgenic avians which produce eggs containing the recombinant protein.
  • the progeny will either contain the transgene in essentially all the cells of the bird or none of the cells of the progeny bird will contain the transgene.
  • avian hard shell eggs e.g., chicken hard shell eggs
  • an exogenous peptide or protein including, but not limited to, a pharmaceutical protein.
  • the exogenous peptide or protein may be encoded by a transgene of a transgenic avian.
  • the exogenous peptide or protein e.g., pharmaceutical protein
  • the protein may be present in any useful amount. In one embodiment, the protein is present in an amount in a range of between about 0.01 ⁇ g per hard-shell egg and about 1 gram per hard-shell egg.
  • the protein is present in an amount in a range of between about 1 ⁇ g per hard-shell egg and about 1 gram per hard-shell egg.
  • the protein may be present in an amount in a range of between about 10 ⁇ g per hard-shell egg and about 1 gram per hard-shell egg (e.g., a range of between about 10 ⁇ g per hard-shell egg and about 400 milligrams per hard-shell egg).
  • the exogenous protein of the invention for example, the exogenous pharmaceutical protein, is present in the egg white of the egg.
  • the protein is present in an amount in a range of between about 1 ng per milliliter of egg white and about 0.2 gram per milliliter of egg white.
  • the protein may be present in an amount in a range of between about 0.1 ⁇ g per milliliter of egg white and about 0.2 gram per milliliter of egg white (e.g., the protein may be present in an amount in a range of between about 1 ⁇ g per milliliter of egg white and about 100 milligrams per milliliter of egg white. In one embodiment, the protein is present in an amount in a range of between about 1 ⁇ g per milliliter of egg white and about 50 milligrams per milliliter of egg white.
  • the protein may be present in an amount in a range of about 1 ⁇ g per milliliter of egg white and about 10 milligrams per milliliter of egg white (e.g., the protein may be present in an amount in a range of between about 1 ⁇ g per milliliter of egg white and about 1 milligrams per milliliter of egg white). In one embodiment, the protein is present in an amount of more than 0.1 ⁇ g per milliliter of egg white. In one embodiment, the protein is present in an amount of more than 0.5 ⁇ g per milliliter of egg white. In one embodiment, the protein is present in an amount of more than 1 ⁇ g per milliliter of egg white. In one embodiment, the protein is present in an amount of more than 1.5 ⁇ g per milliliter of egg white.
  • the invention contemplates the production of hard shell eggs containing any useful protein including one or more pharmaceutical proteins.
  • useful protein include, but are not limited to, hormones, immunoglobulins or portions of immunoglobulins, cytokines (e.g., GM-CSF, G-CSF, erythropoietin and interferon) and CTLA4.
  • the invention also includes the production of hard shell eggs containing fusion proteins including, but not limited to, imunoglobulins or portions of immunoglobulins fused to certain useful peptide sequences.
  • the invention provides for the production of hard shell eggs containing an antibody Fc fragment.
  • the eggs may contain an Fc-CTLA4 fusion protein in accordance with the invention.
  • the avians developed from the blastodermal cells into which the vector has been introduced are the GO generation and can be referred to as "founders". Founder birds are typically chimeric for each inserted transgene. That is, only some of the cells of the GO transgenic bird contain the transgene(s).
  • the GO generation typically is also hemizygous for the transgene(s).
  • the GO generation may be bred to non-transgenic animals to give rise to Gl transgenic offspring which are also hemizygous for the transgene and contain the transgene(s) in essentially all of the bird's cells.
  • the Gl hemizygous offspring may be bred to non-transgenic animals giving rise to G2 hemizygous offspring or may be bred together to give rise to G2 offspring homozygous for the transgene. Substantially all of the cells of birds which are positive for the transgene that are derived from Gl offspring will contain the transgene(s).
  • hemizygotic G2 offspring from the same line can be bred to produce G3 offspring homozygous for the transgene.
  • hemizygous GO animals are bred together to give rise to homozygous Gl offspring containing two copies of the transgene(s) in each cell of the animal.
  • compositions which contain proteins produced in accordance with the invention that have a poultry derived glycosylation pattern such as a chicken derived glycosylation pattern.
  • compositions which contain proteins produced in accordance with the invention that have an avian derived glycosylation pattern such as a chicken derived glycosylation pattern.
  • the invention includes pharmaceutical proteins having a poultry derived glycosylation pattern such as one or more of the glycosylation patterns disclosed herein.
  • the invention also includes human proteins having a poultry derived glycosylation pattern such as one or more of the glycosylation patterns disclosed herein.
  • the invention includes G-CSF wherein the G-CSF has a poultry derived glycosylation pattern, i.e., a transgenic poultry derived G-CSF or TPD G-CSF.
  • the invention includes G-CSF wherein the G-CSF has a transgenic avian derived glycosylation pattern, i.e., a transgenic avian derived G-CSF.
  • the glycosylation pattern is other than that of G-CSF produced in a human cell and/or in a CHO cell.
  • compositions have a G-CSF molecule with a poultry or avian derived carbohydrate chain (i.e., glycosylation structure) and that carbohydrate chain or glycosylation structure is not found on G-CSF obtained from human cells and/or CHO cells.
  • the composition may also include G- CSF molecules that have glycosylation structures that are the same as that found on G- CSF obtained from CHO cells and/or human cells. Glycosylation of human G-CSF produced in CHO cells is disclosed in Holloway, C.J., European J. of Cancer (1994) vol 3OA, pS2-S6, the disclosure of which is incorporated in its entirety herein by reference; in Oheda et al (1988) J.
  • the glycosylation pattern of the G-CSF produced in accordance with the invention is other than that of G-CSF produced in mammalian cell.
  • the invention provides for the G-CSF to be isolated. That is, the G-CSF contained in the composition may be an isolated G-CSF.
  • the G-CSF may be isolated from egg white.
  • the isolated G-CSF may be G-CSF molecules having differing glycosylation structures among the G-CSF molecules or the isolated G-CSF may be an isolated individual species of G-CSF molecules having only one particular glycosylation structure among the species of G-CSF molecules.
  • the G-CSF of a composition of the invention is present in a hard shell egg.
  • the G-CSF may be present in the egg white of a hard shell egg laid by a transgenic avian of the invention.
  • the invention is directed to avian (e.g., chicken) egg white containing G ⁇ CSF of the invention.
  • the G-CSF is present in the egg white in an amount in excess of about 1 microgram per ml of egg white.
  • the G-CSF can be present in an amount greater that about 2 micrograms per ml of egg white (e.g., present in an amount of about 2 micrograms to about 200 micrograms per ml of egg white).
  • the G-CSF is glycosylated in an oviduct cell of the avian, e.g., glycosylated in an oviduct cell of a chicken.
  • the G-CSF can be produced and glycosylated in an oviduct cell.
  • the G-CSF is glycosylated in a tubular gland cell (e.g., the G-CSF is produced and glycosylated in a tubular gland cell).
  • the G-CSF is believed to be glycosylated at threonine 133.
  • the invention is not limited to glycosylation at any particular site on a G-CSF molecule.
  • the G-CSF of the invention is human G-CSF.
  • the mature G-CSF has the amino acid sequence of FIG. 18 C.
  • compositions of the invention include G-CSF molecules glycosylated with:
  • compositions containing G-CSF molecules that have one of these particular glycosyation structures.
  • Such compositions may also include one or more G-CSF molecules having one or more other glycosylation structures. That is, in one embodiment, the invention is specifically directed to compositions containing G-CSF molecules that have: GaI-NAcGIu-NAcGaI-;
  • compositions containing G-CSF molecules that have:
  • compositions containing G-CSF molecules that have:
  • compositions containing G-CSF molecules that have:
  • compositions containing G-CSF molecules that have:
  • compositions containing G-CSF molecules that have:
  • compositions containing G-CSF molecules that have:
  • the invention is also directed to methods of increasing white blood cell count in a patient which include administering to a patient a therapeutically effective amount of G-CSF produced in accordance with the invention.
  • the therapeutically effective amount is an amount of G-CSF that increases the white blood cell count in a patient by a desired amount.
  • One aspect of the invention relates to compositions containing EPO, i.e., EPO molecules produced in accordance with the invention.
  • the EPO is purified or isolated.
  • the EPO has been removed from the contents of a hard shell egg laid by a transgenic avian.
  • the EPO is human EPO.
  • the EPO of the invention has a glycosylation pattern resulting from the EPO being produced in an oviduct cell of an avian.
  • Another aspect of the invention relates to compositions containing EPO that has a glycosylation pattern wherein the glycosylation pattern is other than that of EPO produced in a human cell or a CHO cell and the EPO is produced in an oviduct cell of a chicken.
  • the invention provides for compositions that contain isolated EPO (e.g., human EPO) having an avian or poultry derived glycosylation pattern.
  • the compositions can contain a mixture of EPO molecules produced in avians, for example, chickens, in accordance with the invention and isolated from egg white.
  • the EPO containing compositions are pharmaceutical formulations.
  • the oligosaccharides present on the EPO of the invention do not contain fucose.
  • about 90% or more of the N-Iinked oligosaccharides present on the EPO of the invention do not contain fucose.
  • about 80% or more of the N-linked oligosaccharides present on the EPO of the invention do not contain fucose.
  • about 70% or more of the N-linked oligosaccharides present on the EPO of the invention do not contain fucose.
  • about 60% or more of the N-linked oligosaccharides present on the EPO of the invention do not contain fucose.
  • about 50% or more of the N-linked oligosaccharides present on the EPO of the invention do not contain fucose.
  • about 95% or more of the N-linked oligosaccharides present on the EPO of the invention do not contain sialic acid. In another embodiment, about 90% or more of the N-linked oligosaccharides present on the EPO of the invention do not contain sialic acid. In another embodiment, about 80% or more of the N-linked oligosaccharides present on the EPO of the invention do not contain sialic acid. In another embodiment, more than about 70% or more of the N-linked oligosaccharides present on the EPO of the invention do not contain sialic acid. In another embodiment, about 60% or more of the N-linked oligosaccharides present on the EPO of the invention do not contain sialic acid. In another embodiment, about 50% or more of the N-linked oligosaccharides present on the EPO of the invention do not contain sialic acid.
  • N-linked oligosaccharides present on the EPO of the invention contain a terminal N-Acetyl Glucosamine. In another embodiment, about 90% or more of the N-linked oligosaccharides present on the EPO of the invention contain a terminal N-Acetyl Glucosamine. In another embodiment, about 80% or more of the N-linked oligosaccharides present on the EPO of the invention contain a terminal N-Acetyl Glucosamine. In another embodiment, about 70% or more of the N-linked oligosaccharides present on the EPO of the invention contain a terminal N-Acetyl Glucosamine.
  • N-linked oligosaccharides present on the EPO of the invention contain a terminal N-Acetyl Glucosamine. In another embodiment, about 50% or more of the N-linked oligosaccharides present on the EPO of the invention contain a terminal N-Acetyl Glucosamine.
  • essentially none of the N-linked oligosaccharides structure types present on the EPO molecules of the invention contain fucose.
  • about 90% or more of the N-linked oligosaccharides structure types present on the EPO molecules of the invention do not contain fucose.
  • about 80% or more of the N-linked oligosaccharides structure types present on the EPO molecules of the invention do not contain fucose.
  • about 70% or more of the N-Iinked oligosaccharides structure types present on the EPO molecules of the invention do not contain fucose.
  • N-I inked oligosaccharides structure types present on the EPO molecules of the invention do not contain fucose.
  • about 50% or more of the N-linked oligosaccharides structure types present on the EPO molecules of the invention do not contain fucose.
  • essentially none of the N-linked oligosaccharides structure types present on the EPO molecules of the invention contain sialic acid.
  • about 90% or more of the N-Iinked oligosaccharides structure types present on the EPO molecules of the invention do not contain sialic acid.
  • 18 or more of the structure types will not contain sialic acid.
  • about 80% or more of the N- linked oligosaccharides structure types present on the EPO molecules of the invention do not contain sialic acid.
  • about 70% or more of the N-linked oligosaccharides structure types present on the EPO molecules of the invention do not contain sialic acid.
  • N-linked oligosaccharides structure types present on the EPO molecules of the invention do not contain sialic acid. In another embodiment, about 50% or more of the N-linked oligosaccharides structure types present on the EPO molecules of the invention do not contain sialic acid.
  • all of the N-linked oligosaccharides structure types present on the EPO molecules of the invention contain a terminal N-Acetyl Glucosamine.
  • about 90% or more of the N-Iinked oligosaccharides structure types present on the EPO molecules of the invention contain a terminal N-Acetyl Glucosamine.
  • 18 or more of the structure types will contain a terminal N-Acetyl Glucosamine.
  • about 80% or more of the N-linked oligosaccharides structure types present on the EPO molecules of the invention contain a terminal N-Acetyl Glucosamine.
  • N-linked oligosaccharides structure types present on the EPO molecules of the invention contain a terminal N-Acetyl Glucosamine.
  • about 60% or more of the N-linked oligosaccharides structure types present on the EPO molecules of the invention contain a terminal N-Acetyl Glucosamine.
  • about 50% or more of the N-linked oligosaccharides structure types present on the EPO molecules of the invention contain a terminal N-Acetyl Glucosamine.
  • the invention is directed to EPO obtained from a transgenic avian, for example, a transgenic chicken, which contains a transgene encoding the EPO.
  • the EPO is produced in an avian oviduct cell, for example, a tubular gland cell.
  • the EPO is contained in a hard shell egg, for example, a hard shell egg laid by an avian, e.g., a chicken.
  • the EPO may be present in the contents of an intact hard shell egg.
  • the EPO of the invention is human EPO.
  • the invention is drawn to compositions containing isolated EPO molecules, for example, human EPO molecules, wherein the EPO is produced in an avian which contains a transgene encoding the EPO.
  • the EPO is produced in an oviduct cell (e.g., a tubular gland cell) of a transgenic avian (e.g., transgenic chicken) and the EPO is isolated from egg white of the transgenic avian.
  • the EPO of the invention has the amino acid sequence of FlG. 19A. It is contemplated that the EPO is N-glycosylated and/or O-glycosylated.
  • the EPO is glycosylated in the oviduct cell (e.g., tubular gland cell) of the bird, for example, a chicken.
  • the invention relates to a composition, for example, a pharmaceutical formulation, containing isolated EPO, for example, human EPO, having an avian derived glycosylation pattern.
  • the invention relates to a composition, for example, a pharmaceutical formulation, containing isolated EPO, for example, human EPO, having a poultry derived glycosylation pattern.
  • the invention relates to a composition, for example, a pharmaceutical formulation, containing isolated EPO, for example, human EPO, produced in accordance with the invention.
  • EPO in compositions of the invention contains a glycosylation pattern other than that of EPO produced in a mammalian cell.
  • EPO in compositions of the invention contains a glycosylation pattern other than that of EPO produced in a CHO cell and a human cell.
  • EPO of the invention is attached to one or more TNI-linked oligosaccharide structures disclosed herein (e.g., those shown in FIG. 21).
  • EPO of the invention is attached to one or more O-Iinked oligosaccharide structures disclosed herein (e.g., those shown in FIG. 20).
  • One aspect of the invention is drawn to methods of treating a patient comprising administering to a patient a therapeutically effective amount of EPO obtained from a transgenic avian.
  • the therapeutically effective amount is an amount that increases the red blood cell count in a patient by a desired amount. It is contemplated that EPO produced in accordance with the invention can be used to treat chronic kidney disease, for example, where tissues fail to sustain production of erythropoietin.
  • compositions containing isolated glycosylated human protein molecules produced in the oviduct of a transgenic avian wherein the transgenic avian (e.g., transgenic chicken) contains a transgene encoding the human protein and wherein the human protein contains a chicken derived oligosaccharide which is not normally present on the human protein.
  • the human protein is attached to one or more N-linked oligosaccharide structures disclosed herein (e.g., those shown in FIG. 21).
  • the human protein is attached to one or more O-linked oligosaccharide structures disclosed herein (e.g., those shown in FIG. 20).
  • the invention is directed to isolated protein molecules produced in the oviduct of a transgenic chicken, for example, as disclosed herein, wherein the transgenic chicken contains a transgene encoding the protein molecule and wherein the protein molecule contains a chicken derived oligosaccharide.
  • the protein molecule can be a glycosylated form of GM-CSF, interferon ⁇ , fusion protein, CTLA4-Fc fusion protein, growth hormones, cytokines, structural, interferon, lysozyme, ⁇ -casein, albumin, ⁇ -1 antitrypsin, antithrombin III, collagen, factors VIII, IX, X (and the like), fibrinogen, lactoferrin, protein C, tissue-type plasminogen activator (tPA), somatotropin, and chymotrypsin, immunoglobulins, antibodies, immunotoxins, factor VIII, b-domain deleted factor VIII, factor Vila, factor IX, anticoagulants; hirudin, alteplase, tpa, reteplase, tpa, tpa - 3 of 5 domains deleted, insulin, insulin lispro, insulin aspart, insulin glargine, long-acting insulin analogs, glucagons, ts
  • Proteins not normally glycosylated can be engineered to contain a glycosylation site which will be glycosylated in the avian system, as is understood by a practitioner of skill in the art.
  • the isolated protein has attached one or more N-linked oligosaccharide structures disclosed herein (e.g., those shown in FIG. 21).
  • the isolated protein is attached to one or more O-linked oligosaccharide structures disclosed herein (e.g., those shown in FIG. 20).
  • compositions, glycosylation structures specifically contemplated for certain proteins disclosed herein such as EPO are also contemplated for other specific proteins disclosed herein, which can be produced in accordance with the invention.
  • the invention also includes, methods of making glycosylated proteins disclosed herein such as erythropoietin comprising producing a transgenic avian which contains a transgene encoding protein (e.g., erythropoietin) wherein the protein is packaged into a hard shell egg laid by the avian. Also included are the eggs laid by the avians which contain the protein (e.g., erythropoietin).
  • the invention also provides for compositions which contain isolated mixtures of an individual type of useful protein molecule, such as those proteins disclosed herein, where one or more of the protein molecules contained in the mixture has a specific oligosaccharide structure attached, in particular an oligosaccharide structure disclosed herein which may be produced by a transgenic avian.
  • the invention provides for isolated mixtures of EPO molecules, for example, human EPO molecules (e.g., EPO of SEQ ID NO: 50) which contain an EPO molecule glycosylated with one or more of:
  • FIGS. IA and IB illustrate ovalbumin promoter expression vectors comprising ovalbumin promoter segments and a coding sequence, gene X, which encodes an exogenous protein X.
  • X represents any exogenous gene or exogenous protein of interest.
  • FIGS. 2A, 2B, 2C and 2D illustrate retroviral vectors of the invention comprising an ovalbumin promoter and a coding sequence, gene X, encoding an exogenous protein X.
  • X represents any exogenous gene or exogenous protein of interest.
  • FIG. 2E illustrates a method of amplifying an exogenous gene for insertion into the vectors of 2 A and 2B.
  • FIG. 2F illustrates a retroviral vector comprising an ovalbumin promoter controlling expression of a coding sequence, gene X, and an internal ribosome entry site (IRES) element enabling expression of a second coding sequence, gene Y.
  • IRS internal ribosome entry site
  • FIGS. 3A and 3B show schematic representations of the ALV-derived vectors pNLB and pNLB-CMV-BL, respectively. Because NLB has not been sequenced in its entirety, measurements in bp (base pair) are estimated from published data (Cosset et al., 1991 ; Thoraval et al., 1995) and data discussed herein. The vectors are both shown as they would appear while integrated into the chicken genome.
  • FIGS. 4A and 4B show the amount of ⁇ -lactamase (lactamase) in the blood serum of chimeric and transgenic chickens.
  • concentration of bioactive lactamase in the serum of GO chickens transduced with the NLB-CMV-BL transgene was measured at 8 month post-hatch. The generation, sex and wing band numbers are indicated. Lactamase serum concentrations were measured for Gl transgenic chickens at 6 to 7 months post-hatch. Arrows indicate Gl chickens bred from rooster 2395.
  • FIG. 4B the lactamase serum concentration was measured for Gl and G2 transgenic chickens.
  • FIG. 5 shows the pedigree of chickens containing the transgenic loci harbored by hen 5657 (FIG. 5A) or rooster 4133 (FIG. 5B). 2395 was a rooster that carried multiple transgenic loci.
  • transgenic progeny for which expression data were not shown as well as non-transgenic progeny were omitted from the pedigree.
  • Band numbers are indicated by the following symbols: o hen; D rooster; • hen carrying the NLB-CMV-BL transgene; ⁇ rooster carrying the NLB-CMV-BL transgene.
  • FlG. 6 shows ⁇ -lactamase (lactamase) in the egg white of hen 5657 and her offspring.
  • FIG. 6A egg white from hen 5657 and her transgenic offspring were assayed for active lactamase. The control is from untreated hens and clutchmate is a non-transgenic G2 bred from hen 5657. Eggs were collected in March 2000. Arrows indicate G2s bred from hen 5657.
  • FIG. 6B egg white samples from G2 transgenic hens carrying one copy of the transgene (hemizygous) were compared with that of G3 hen 6978 which harbored two copies (homozygous). Eggs were collected in February 2001. The generation and wing band numbers are indicated to the left.
  • FlG. 7 shows ⁇ -lactamase (lactamase) in the eggs of G2 and G3 hens bred from rooster 4133.
  • ⁇ -lactamase lactamase
  • FIG. 7A egg whites from four representative hemizygous transgenic hens bred from rooster 4133 were assayed for active lactamase. Eggs were collected in October 1999, March 2000 and February 2001 and a minimum of 4 eggs per hen were assayed one month after each set was collected. The control represents egg white from untreated hens. Band numbers are indicated to the left. The average of the 4 hens for each period is calculated.
  • FIG. 7A egg whites from four representative hemizygous transgenic hens bred from rooster 4133 were assayed for active lactamase. Eggs were collected in October 1999, March 2000 and February 2001 and a minimum of 4 eggs per hen were assayed one month after each set was collected. The
  • FIGS. 8A and 8B show the pNLB-CMV-IFN vector for expressing IFN- ⁇ 2b in chickens; and the pNLB-MDOT-EPO vector used for expressing erythropoietin (EPO) in chickens, respectively.
  • FIG. 9 depicts the novel glycosylation pattern of transgenic poultry derived interferon- ⁇ 2b (TPD IFN- ⁇ 2b), including all 6 bands.
  • FIG. 10 shows the comparison of human peripheral blood leukocyte derived interferon- ⁇ 2b (PBL IFN- ⁇ 2b or natural MFN) and transgenic poultry derived interferon- ⁇ 2b (TPD IFN- ⁇ 2b or egg white hlFN).
  • PBL IFN- ⁇ 2b or natural MFN human peripheral blood leukocyte derived interferon- ⁇ 2b
  • TPD IFN- ⁇ 2b or egg white hlFN transgenic poultry derived interferon- ⁇ 2b
  • FIG. HA depicts the synthetic nucleic acid sequence (cDNA, residues 1-498) of optimized human interferon- ⁇ 2b (IFN- ⁇ 2b), i.e., recombinant TPD IFN- ⁇ 2b (SEQ ID NO: 1).
  • FIG. HB depicts the synthetic amino acid sequence (residues 1-165) of transgenic poultry derived interferon- ⁇ 2b (TPD IFN- ⁇ 2b) (SEQ ID NO: 2).
  • FIG. 12A depicts the synthetic nucleic acid sequence (cDNA, residues 1-579) of optimized human erythropoietin (EPO) i.e., recombinant TPD EPO (SEQ ID NO: 3).
  • EPO erythropoietin
  • FIG. 12B depicts the synthetic amino acid sequence (residues 1-193) of transgenic poultry derived erythropoietin (TPD EPO) (SEQ ID NO: 4). (For natural human EPO see also NCBI Accession Number NP 000790).
  • FIG. 13 shows the synthetic MDOT promoter linked to the IFN-MM CDS.
  • MDOT promoter contains elements from the chicken ovomucoid gene (ovomucoid promoter) ranging from -435 to -166 bp (see NCBI Accession Number J00894) and the chicken conalbumin gene (ovotransferrin promoter) ranging from -251 to +29 bp (see NCBI Accession Numbers Y00497, Ml 1862 and X01205).
  • FIG. 14 provides a summary of the major egg white proteins.
  • FIGS. 15A and 15D show the pCMV-LC-emcvIRES-HC vector, wherein the light chain (LC) and heavy chain (HC) of a human monoclonal antibody were expressed from this single vector by placement of an IRES from the encephalomyocarditis virus (EMCV) in order to test for expression of monoclonal antibodies.
  • FIGS. 15B and 15C show the separate vectors pCMV-HC and pCMV-LC, respectively, wherein these vectors were also used to test for expression of monoclonal antibodies.
  • FIG. 16 shows a silver stained SDS PAGE of Neupogen® (lane A) and TPD G- CSF (lane B).
  • FIG. 17 depicts the increase in Absolute Neutrophil Count (ANC) of TPD G-
  • FIG. 18A shows the nucleotide sequence encoding the amino acid sequence of FIG. 18B.
  • FIG. 18 B shows the amino acid sequence of G-CSF including the natural signal sequence which is cleaved away to form the mature G-CSF during cellular secretion.
  • FIG. 18C shows the amino acid sequence of the mature G-CSF protein produced in accordance with the present invention.
  • FIG. 19A shows the nucleotide coding sequence used to produce the 165 amino acid form of human erythropoietin in transgenic avians.
  • FIG. 19B shows the amino acid sequence of the 165 amino acid form of human erythropoietin produced in transgenic avians.
  • FIG. 20 shows representative O-linked glycosylation structures determined for the erythropoietin produced in accordance with the invention.
  • FIG. 21A and FIG. 21B shows representative N-linked glycosylation structures determined for the erythropoietin produced in accordance with the invention.
  • the bracket in front of a group of sugar residues means that the indicated sugar(s) can be attached to any of the bracketed sugars.
  • the indicated galactose molecule attached to a sialic acid can be attached to any one of the five terminal n-acetyl glucosamines.
  • Postulated linkages are also shown for the structures, as is understood in the art.
  • the two terminal NAcGIu residues linked to a single mannose may be 2,6-linked to mannose instead of 2,4 linked to the mannose.
  • FIG. 22 shows the in vitro activity of the purified transgenic chicken derived EPO.
  • ED50 0.44 ng/ml.
  • nucleic acid or polynucleotide sequence includes, but is not limited to, eukaryotic mRNA, cDNA, genomic DNA, and synthetic DNA and RNA sequences, comprising the natural nucleoside bases adenine, guanine, cytosine, thymidine, and uracil. The term also encompasses sequences having one or more modified bases.
  • avian refers to any species, subspecies or race of organism of the taxonomic class ava, such as, but not limited to chicken, turkey, duck, goose, quail, pheasants, parrots, finches, hawks, crows and ratites including ostrich, emu and cassowary.
  • the term includes the various known strains of Gallus gallus, or chickens, (for example, White Leghorn, Brown Leghorn, Barred-Rock, Wales, New Hampshire, Rhode Island, Australorp, Minorca, Amrox, California Gray), as well as strains of turkeys, pheasants, quails, duck, ostriches and other poultry commonly bred in commercial quantities. It also includes an individual avian organism in all stages of development, including embryonic and fetal stages. "Therapeutic proteins” or “pharmaceutical proteins” include an amino acid sequence which in whole or in part makes up a drug.
  • a “coding sequence” or “open reading frame” refers to a polynucleotide or nucleic acid sequence which can be transcribed and translated (in the case of DNA) or translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
  • the boundaries of the coding sequence are determined by a translation start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • a transcription termination sequence will usually be located 3' to the coding sequence.
  • a coding sequence may be flanked on the 5' and/or 3' ends by untranslated regions. "Exon” refers to that part of a gene which, when transcribed into a nuclear transcript, is “expressed” in the cytoplasmic mRNA after removal of the introns or intervening sequences by nuclear splicing.
  • control sequences or “regulatory sequences” refer to promoter sequences, translational start and stop codons, ribosome binding sites, polyadenylation signals, transcription termination sequences, upstream regulatory domains, enhancers, and the like, as necessary and sufficient for the transcription and translation of a given coding sequence in a defined host cell.
  • control sequences suitable for eukaryotic cells are promoters, polyadenylation signals, and enhancers. All of these control sequences need not be present in a recombinant vector so long as those necessary and sufficient for the transcription and translation of the desired gene are present.
  • “Operably or operatively linked” refers to the configuration of the coding and control sequences so as to perform the desired function.
  • control sequences operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
  • a coding sequence is operably linked to or under the control of transcriptional regulatory regions in a cell when DNA polymerase will bind the promoter sequence and transcribe the coding sequence into mRNA that can be translated into the encoded protein.
  • the control sequences need not be contiguous with the coding sequence, so long as they function to direct the expression thereof.
  • intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.
  • nucleic acid sequences such as coding sequences and control sequences
  • an "exogenous" region of a nucleic acid construct is an identifiable segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature.
  • an exogenous region of a construct could include a coding sequence flanked by sequences not found in association with the coding sequence in nature.
  • exogenous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene).
  • a host cell transformed with a construct or nucleic acid which is not normally present in the host cell would be considered exogenous for purposes of this invention.
  • oligosaccharide oligosaccharide structure
  • glycosylation pattern and “glycosylation structure” have essentially the same meaning and each refer to one or more structures which are formed from sugar residues and are attached to glycosylated proteins.
  • Exogenous protein refers to a protein not naturally present in a particular tissue or cell, a protein that is the expression product of an exogenous expression construct or transgene, or a protein not naturally present in a given quantity in a particular tissue or cell.
  • a protein that is exogenous to an egg is a protein that is not normally found in the egg.
  • a protein exogenous to an egg may be a protein that is present in the egg as a result of the expression of a coding sequence present in a transgene of the animal laying the egg.
  • Endogenous gene refers to a naturally occurring gene or fragment thereof normally associated with a particular cell.
  • EPO erythropoietin
  • the expression products described herein may consist of proteinaceous material having a defined chemical structure. However, the precise structure depends on a number of factors, particularly chemical modifications common to proteins. For example, since all proteins contain ionizable amino and carboxyl groups, the protein may be obtained in acidic or basic salt form, or in neutral form.
  • the primary amino acid sequence may be derivatized using sugar molecules (glycosylation) or by other chemical derivatizations involving covalent or ionic attachment with, for example, lipids, phosphate, acetyl groups and the like, often occurring through association with saccharides.
  • sugar molecules glycos
  • lipids, phosphate, acetyl groups and the like often occurring through association with saccharides.
  • modifications may occur in vitro or in vivo, the latter being performed by a host cell through post-translational processing systems. Such modifications may increase or decrease the biological activity of the molecule, and such chemically modified molecules are also intended to come within the scope of the invention.
  • Vector means a polynucleotide comprised of single strand, double strand, circular, or supercoiled DNA or RNA.
  • a typical vector may be comprised of the following elements operatively linked at appropriate distances for allowing functional gene expression: replication origin, promoter, enhancer, 5' mRNA leader sequence, ribosomal binding site, nucleic acid cassette, termination and polyadenylation sites, and selectable marker sequences. One or more of these elements may be omitted in specific applications.
  • the nucleic acid cassette can include a restriction site for insertion of the nucleic acid sequence to be expressed. In a functional vector the nucleic acid cassette contains the nucleic acid sequence to be expressed including translation initiation and termination sites.
  • An intron optionally may be included in the construct, for example, 5' to the coding sequence.
  • a vector is constructed so that the particular coding sequence is located in the vector with the appropriate regulatory sequences, the positioning and orientation of the coding sequence with respect to the control sequences being such that the coding sequence is transcribed under the "control" of the control or regulatory sequences. Modification of the sequences encoding the particular protein of interest may be desirable to achieve this end. For example, in some cases it may be necessary to modify the sequence so that it may be attached to the control sequences with the appropriate orientation; or to maintain the reading frame.
  • the control sequences and other regulatory sequences may be ligated to the coding sequence prior to insertion into a vector.
  • the coding sequence can be cloned directly into an expression vector which already contains the control sequences and an appropriate restriction site which is in reading frame with and under regulatory control of the control sequences.
  • a “promoter” is a site on the DNA to which RNA polymerase binds to initiate transcription of a gene.
  • the promoter will be modified by the addition or deletion of sequences, or replaced with alternative sequences, including natural and synthetic sequences as well as sequences which may be a combination of synthetic and natural sequences.
  • Many eukaryotic promoters contain two types of recognition sequences: the TATA box and the upstream promoter elements. The former, located upstream of the transcription initiation site, is involved in directing RNA polymerase to initiate transcription at the correct site, while the latter appears to determine the rate of transcription and is upstream of the TATA box.
  • Enhancer elements can also stimulate transcription from linked promoters, but many function exclusively in a particular cell type.
  • enhancer/promoter elements derived from viruses, e.g., the SV40 promoter, the cytomegalovirus (CMV) promoter, the rous- sarcoma virus (RSV) promoter, and the murine leukemia virus (MLV) promoter are all active in a wide array of cell types, and are termed "ubiquitous".
  • non- constitutive promoters such as the mouse mammary tumor virus (MMTV) promoter may also be used in the present invention.
  • the nucleic acid sequence inserted in the cloning site may have any open reading frame encoding a polypeptide of interest, with the proviso that where the coding sequence encodes a polypeptide of interest, it should lack cryptic splice sites which can block production of appropriate mRNA molecules and/or produce aberrantly spliced or abnormal mRNA molecules.
  • poultry derived refers to a composition or substance produced by or obtained from poultry.
  • poultry refers to birds that can be kept as livestock, including but not limited to, chickens, duck, turkey, quail and ratites.
  • poultry derived may refer to chicken derived, turkey derived and/or quail derived.
  • a “marker gene” is a gene which encodes a protein that allows for identification and isolation of correctly transfected cells. Suitable marker sequences include, but are not limited to green, yellow, and blue fluorescent protein genes (GFP, YFP, and BFP, respectively). Other suitable markers include thymidine kinase (tk), dihydrofolate reductase (DHFR), and aminoglycoside phosphotransferase (APH) genes. The latter imparts resistance to the aminoglycoside antibiotics, such as kanamycin, neomycin, and geneticin.
  • tk thymidine kinase
  • DHFR dihydrofolate reductase
  • APH aminoglycoside phosphotransferase
  • marker genes such as those encoding chloramphenicol acetyltransferase (CAT), ⁇ -lactamase, ⁇ -galactosidase ( ⁇ -gal), may be incorporated into the primary nucleic acid cassette along with the gene expressing the desired protein, or the selection markers may be contained on separate vectors and cotransfected.
  • CAT chloramphenicol acetyltransferase
  • ⁇ -lactamase ⁇ -galactosidase
  • a “reporter gene” is a marker gene that "reports” its activity in a cell by the presence of the protein that it encodes.
  • a “retroviral particle”, “transducing particle”, or “transduction particle” refers to a replication-defective or replication-competent virus capable of transducing non- viral DNA or RNA into a cell.
  • MDOT ovomucoid
  • TO ovotransferrin
  • optimal is used in the context of "optimized coding sequence", wherein the most frequently used codons for each particular amino acid found in the egg white proteins ovalbumin, lysozyme, ovomucoid, and ovotransferrin are used in the design of the optimized human interferon- ⁇ 2b (IFN - ⁇ 2b) polynucleotide sequence that is inserted into vectors of the present invention.
  • IFN - ⁇ 2b optimized human interferon- ⁇ 2b
  • the DNA sequence for optimized human IFN- ⁇ 2b is based on the hen oviduct optimized codon usage and is created using the BACKTRANSLATE program of the Wisconsin Package, Version 9.1 (Genetics Computer Group Inc., Madison, Wis.) with a codon usage table compiled from the chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and ovotransferrin proteins.
  • the percent usage for the four codons of the amino acid alanine in the four egg white proteins is 34% for GCU, 31% for GCC, 26% for GCA, and 8% for GCG.
  • GCU is used as the codon for the majority of alanines in the optimized human IFN- ⁇ 2b coding sequence.
  • the vectors containing the gene for optimized human IFN- ⁇ 2b are used to produce transgenic avians that express transgenic poultry derived IFN- ⁇ 2b (TPD IFN- ⁇ 2b) in their tissues and eggs.
  • TPD IFN- ⁇ 2b transgenic poultry derived IFN- ⁇ 2b
  • the above method is employed for the design of other coding sequences proteins such as human erythropoietin (EPO) or other proteins which may be produced in accordance with the invention.
  • transgenes can be introduced into avian embryonic blastodermal cells to produce a transgenic chicken, transgenic turkey, transgenic quail and other avian species, that carry the transgene in the genetic material of its germ-line tissue.
  • the blastodermal cells are typically stage VII-XII cells, or the equivalent thereof, and in one embodiment are near stage X.
  • the cells useful in the present invention include embryonic germ (EG) cells, embryonic stem (ES) cells & primordial germ cells (PGCs).
  • the embryonic blastodermal cells may be isolated freshly, maintained in culture, or reside within an embryo.
  • the vectors useful in carrying out the methods of the present invention are described herein. These vectors may be used for stable introduction of an exogenous coding sequence into the genome of an avian. Alternatively, the vectors may be used to produce exogenous proteins in specific tissues of an avian, for example, in the oviduct tissue of an avian. The vectors may also be used in methods to produce avian eggs which contain exogenous protein.
  • the coding sequence and the promoter are both positioned between 5' and 3' LTRs before introduction into blastodermal cells.
  • the vector is retroviral and the coding sequence and the promoter are both positioned between the 5' and 3' LTRs of the retroviral vector.
  • the LTRs or retroviral vector is derived from the avian leukosis virus (ALV), murine leukemia virus (MLV), or lentivirus.
  • the vector includes a signal peptide coding sequence which is operably linked to the coding sequence, so that upon translation in a cell, the signal peptide will direct secretion of the exogenous protein expressed by the vector into the egg white of a hard shell egg.
  • the vector may include a marker gene, wherein the marker gene is operably linked to a promoter.
  • introduction of a vector of the present invention into the embryonic blastodermal cells is performed with embryonic blastodermal cells that are either freshly isolated or in culture.
  • the transgenic cells are then typically injected into the subgerminal cavity beneath a recipient blastoderm in an egg.
  • the vector is delivered directly to the cells of a blastodermal embryo.
  • vectors used for transfecting blastodermal cells and generating stable integration into the avian genome contain a coding sequence and a promoter in operational and positional relationship to express the coding sequence in the tubular gland ceil of the magnum of the avian oviduct, wherein the coding sequence codes for an exogenous protein which is deposited in the egg white of a hard shell egg.
  • the promoter may optionally be a segment of the ovalbumin promoter region which is sufficiently large to direct expression of the coding sequence in the tubular gland cells.
  • the invention involves truncating the ovalbumin promoter and/or condensing the critical regulatory elements of the ovalbumin promoter so that it retains sequences required for expression in the tubular gland cells of the magnum of the oviduct, while being small enough that it can be readily incorporated into vectors.
  • a segment of the ovalbumin promoter region may be used. This segment comprises the 5'-flanking region of the ovalbumin gene.
  • the total length of the ovalbumin promoter segment may be from about 0.88 kb to about 7.4 kb in length, and is preferably from about 0.88 kb to about 1.4 kb in length.
  • the segment preferably includes both the steroid-dependent regulatory element and the negative regulatory element of the ovalbumin gene.
  • the segment optionally also includes residues from the 5' untranslated region (5' UTR) of the ovalbumin gene.
  • the promoter may be derived from the promoter regions of the ovalbumin-, lysozyme-, conalbumin-, ovomucoid-, ovotransferrin- or ovomucin genes (FIG. 14).
  • An example of such a promoter is the synthetic MDOT promoter which is comprised of elements from the ovomucoid and ovotransferrin promoter (FIG. 13).
  • the promoter may also be a promoter that is largely, but not entirely, specific to the magnum, such as the lysozyme promoter.
  • the promoter may also be a mouse mammary tumor virus (MMTV) promoter.
  • the promoter may be a constitutive promoter (e.g., a cytomegalovirus (CMV) promoter, a rous-sarcoma virus (RSV) promoter, a murine leukemia virus (MLV) promoter, etc.).
  • CMV cytomegalovirus
  • RSV rous-sarcoma virus
  • MMV murine leukemia virus
  • the promoter is a cytomegalovirus (CMV) promoter, a MDOT promoter, a rous-sarcoma virus (RSV) promoter, a murine leukemia virus (MLV) promoter, a mouse mammary tumor virus (MMTV) promoter, an ovalbumin promoter, a lysozyme promoter, a conalbumin promoter, an ovomucoid promoter, an ovomucin promoter, and an ovotransferrin promoter.
  • CMV cytomegalovirus
  • MDOT rous-sarcoma virus
  • MLV murine leukemia virus
  • MMTV mouse mammary tumor virus
  • ovalbumin promoter an ovalbumin promoter
  • a lysozyme promoter a conalbumin promoter
  • an ovomucoid promoter an ovomucin promoter
  • an ovotransferrin promoter an cytomegalovirus
  • the promoter may be at least one segment of a promoter region, such as a segment of the ovalbumin-, lysozyme-, conalbumin-, ovomucoid-, ovomucin-, and ovotransferrin promoter region.
  • the promoter is a CMV promoter.
  • FIGS. IA and IB illustrate examples of ovalbumin promoter expression vectors.
  • Gene X is a coding sequence which encodes an exogenous protein. Bent arrows indicate the transcriptional start sites.
  • the vector contains 1.4 kb of the 5' flanking region of the ovalbumin gene (FTG. IA).
  • the sequence of the "- 1.4 kb promoter" of FIG. IA corresponds to the sequence starting from approximately 1.4 kb upstream (1.4 kb) of the ovalbumin transcription start site and extending approximately 9 residues into the 5' untranslated region of the ovalbumin gene.
  • the approximately 1.4 kb-long segment harbors two critical regulatory elements, the steroid-dependent regulatory element (SDRE) and the negative regulatory element (NRE).
  • SDRE steroid-dependent regulatory element
  • NRE negative regulatory element
  • the NRE is so named because it contains several negative regulatory elements which block the gene's expression in the absence of hormones (e.g., estrogen).
  • a shorter 0.88 kb segment also contains both elements.
  • the vector contains approximately 7.4 kb of the 5' flanking region of the ovalbumin gene and harbors two additional elements (HS-III and HS-IV), one of which is known to contain a functional region enabling induction of the gene by estrogen (FIG. IB).
  • a shorter 6 kb segment also contains all four elements and could optionally be used in the present invention.
  • Each vector used for random integration preferably comprises at least one 1.2 kb element from the chicken ⁇ -globin locus which insulates the gene within from both activation and inactivation at the site of insertion into the genome.
  • two insulator elements are added to one end of the ovalbumin gene construct.
  • the insulator elements serve to prevent the distal locus control region (LCR) from activating genes upstream from the globin gene domain, and have been shown to overcome position effects in transgenic flies, indicating that they can protect against both positive and negative effects at the insertion site.
  • LCR distal locus control region
  • the insulator element(s) are only needed at either the 5' or 3' end of the gene because the transgenes are integrated in multiple, tandem copies effectively creating a series of genes flanked by the insulator of the neighboring transgene.
  • the insulator element is not linked to the vector but is cotransfected with the vector. In this case, the vector and the element are joined in tandem in the cell by the process of random integration into the genome.
  • Each vector may optionally also comprise a marker gene to allow identification and enrichment of cell clones which have stably integrated the expression vector.
  • the expression of the marker gene is driven by a ubiquitous promoter that drives high levels of expression in a variety of cell types.
  • the marker gene is human interferon driven by a lysozyme promoter.
  • the green fluorescent protein (GFP) reporter gene (Zolotukhin et al., J. Virol 70:4646-4654 (1995)) is driven by the Xenopus elongation factor 1- ⁇ (ef-l- ⁇ ) promoter (Johnson and Krieg, Gene 147:223-26 (1994)).
  • the Xenopus ef-l- ⁇ promoter is a strong promoter expressed in a variety of cell types.
  • the GFP contains mutations that enhance its fluorescence and is humanized, or modified such that the codons match the codon usage profile of human genes. Since avian codon usage is virtually the same as human codon usage, the humanized form of the gene is also highly expressed in avian blastodermal cells.
  • the marker gene is operably linked to one of the ubiquitous promoters of HSV tk, CMV, ⁇ -actin, or RSV.
  • the nonvertebrate gene sequence may be modified to change the appropriate codons such that codon usage is similar to that of humans and avians.
  • Transfection of the blastodermal cells may be mediated by any number of methods known to those of ordinary skill in the art.
  • the introduction of the vector to the cell may be aided by first mixing the nucleic acid with polylysine or cationic lipids which help facilitate passage across the cell membrane.
  • introduction of the vector into a cell is preferably achieved through the use of a delivery vehicle such as a liposome or a virus.
  • Viruses which may be used to introduce the vectors of the present invention into a blastodermal cell include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes simplex viruses, and vaccinia viruses.
  • a packaged retroviral-based vector is used to deliver the vector into embryonic blastodermal cells so that the vector is integrated into the avian genome.
  • helper cells which produce the retrovirus can be delivered to the blastoderm.
  • Useful retrovirus for randomly introducing a transgene into the avian genome is the replication-deficient avian leucosis virus (ALV), the replication-deficient murine leukemia virus (MLV), or the lentivirus.
  • AAV replication-deficient avian leucosis virus
  • MLV replication-deficient murine leukemia virus
  • a pNLB vector is modified by inserting a region of the ovalbumin promoter and one or more exogenous genes between the 5 1 and 3' long terminal repeats (LTRs) of the retrovirus genome.
  • LTRs long terminal repeats
  • the ovalbumin promoter will be expressed in the tubular gland cells of the oviduct magnum because the ovalbumin promoter drives the expression of the ovalbumin protein and is active in the oviduct tubular gland cells. While a 7.4 kb ovalbumin promoter has been found to produce the most active construct when assayed in cultured oviduct tubular gland cells, the ovalbumin promoter is preferably shortened for use in the retroviral vector. In one embodiment, the retroviral vector comprises a 1.4 kb segment of the ovalbumin promoter; a 0.88 kb segment would also suffice.
  • any of the vectors of the present invention may also optionally include a coding sequence encoding a signal peptide that will direct secretion of the protein expressed by the vector's coding sequence from the tubular gland cells of the oviduct.
  • This aspect of the invention effectively broadens the spectrum of exogenous proteins that may be deposited in avian eggs using the methods of the invention.
  • the vector containing the coding sequence is modified to comprise a DNA sequence comprising about 60 bp encoding a signal peptide from the lysozyme gene.
  • the DNA sequence encoding the signal peptide is inserted in the vector such that it is located at the N-terminus of the protein encoded by the DNA.
  • FIGS. 2A-2D illustrate examples of suitable retroviral vector constructs.
  • the vector construct is inserted into the avian genome with 5' and 3' flanking LTRs.
  • Neo is the neomycin phosphotransferase gene. Bent arrows indicate transcription start sites.
  • FIGS. 2A and 2B illustrate LTR and oviduct transcripts with a sequence encoding the lysozyme signal peptide (LSP), whereas FIGS. 2C and 2D illustrate transcripts without such a sequence.
  • LSP lysozyme signal peptide
  • FIGS. 2C and 2D illustrate transcripts without such a sequence.
  • Any protein that contains a eukaryotic signal peptide may be cloned into the vectors depicted in FIGS. 2B and 2D. Any protein that is not ordinarily secreted may be cloned into the vectors illustrated in FIGS. 2A and 2B to allow for its secretion from the tubular gland cells.
  • FIG. 2E illustrates the strategy for cloning an exogenous gene into a lysozyme signal peptide vector.
  • the polymerase chain reaction is used to amplify a copy of a coding sequence, gene X, using a pair of oligonucleotide primers containing restriction enzyme sites that enable the insertion of the amplified gene into the plasmid after digestion with the two enzymes.
  • the 5' and 3' oligonucleotides contain the Bsu36I and Xbal restriction sites, respectively.
  • IRES internal ribosome entry site
  • the IRES units are fused to 5' ends of one or more additional coding sequences which are then inserted into the vectors at the end of the original coding sequence, so that the coding sequences are separated from one another by an IRES (FIGS. 2F, 15A and 15D).
  • IRES internal ribosome entry site
  • the first coding sequence may encode collagen which would be hydroxylated and made active by the enzyme encoded by the second coding sequence.
  • an internal ribosome entry site (IRES) element is positioned between two exogenous coding sequences (gene X and gene Y).
  • the IRES allows both protein X and protein Y to be translated from the same transcript the transcription of which is directed by a promoter such as the ovalbumin promoter. Bent arrows indicate transcription start sites.
  • the expression of the protein encoded by gene X is expected to be highest in tubular gland cells, where it is specifically expressed but not secreted.
  • the protein encoded by gene Y is also expressed specifically in tubular gland cells but because it is efficiently secreted, protein Y is packaged into the eggs.
  • the light chain (LC) and heavy chain (HC) of a human monoclonal antibody are expressed from a single vector, pCMV-LC-emcvIRES-HC, by placement of an IRES from the encephalomyocarditis virus (EMCV). Transcription is driven by a CMV promoter.
  • EMCV encephalomyocarditis virus
  • the coding sequences of vectors used in any of the methods of the present invention are provided with a 3' untranslated region (3' UTR) to confer stability to the RNA produced.
  • the orientation of the promoter, gene X and the 3' UTR must be reversed in the construct, so that the addition of the 3' UTR will not interfere with transcription of the full-length genomic RNA.
  • the 3' UTR may be that of the ovalbumin or lysozyme genes, or any 3' UTR that is functional in a magnum cell, i.e., the SV40 late region.
  • a constitutive promoter e.g., CMV
  • CMV constitutive promoter
  • expression is not limited to the magnum; expression also occurs in other tissues within the avian (e.g., blood).
  • the use of such a transgene, which includes a constitutive promoter and a coding sequence, is particularly suitable for effecting or driving the expression of a protein in the oviduct and the subsequent secretion of the protein into the egg white (see FIG. 8A for an example of a CMV driven construct, such as the pNLB-CMV-IFN vector for expressing IFN- ⁇ 2b in chickens).
  • FlG. 3 A shows a schematic of the replication-deficient avian leukosis virus
  • ALV-based vector pNLB a vector which is suitable for use in the invention.
  • ALV ALV-based vector pNLB
  • most of the ALV genome is replaced by the neomycin resistance gene
  • FIG. 3B shows the vector pNLB-CMV-BL, in which lacZ has been replaced by the CMV promoter and the ⁇ - lactamase coding sequence ( ⁇ -La or BL). Construction of the vector is reported in the specific examples (Example 1, vide infra), ⁇ -lactamase is expressed from the CMV promoter and utilizes a polyadenylatio ⁇ signal (pA) in the 3 1 long terminal repeat
  • the ⁇ -Lactamase protein has a natural signal peptide; thus, it is found in blood and in egg white.
  • FIGS. 8A and 8B illustrates the pNLB-CMV-IFN vector used for expressing interferon- ⁇ 2b (IFN- ⁇ 2b) and the pNLB-MDOT-EPO vector used for expressing erythropoietin (EPO), respectively.
  • EPO exogenous proteins
  • IFN exogenous proteins
  • the pNLB-MDOT-EPO vector is created by substituting an EPO encoding sequence for the BL encoding sequence (Example 10, vide infra).
  • a synthetic promoter called MDOT is employed to drive expression of EPO.
  • MDOT contains elements from both the ovomucoid and ovotransferrin promoter.
  • the DNA sequence for human EPO is based on hen oviduct optimized codon usage as created using the BACKTRANSLATE program of the Wisconsin Package, version 9.1 (Genetics Computer Group, Inc., Madison, W is.) with a codon usage table compiled from the chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and ovotransferrin proteins.
  • the EPO DNA sequence is synthesized and cloned into the vector and the resulting plasmid is pNLB-MDOT-EPO (a.k.a. pAVIJCR-A145.27.2.2).
  • transducing particles i.e., transduction particles
  • these transducing particles are titered to determine the appropriate concentration that can be used to inject embryos. Eggs are then injected with transducing particles after which they hatch about 21 days later.
  • the exogenous protein levels such as the EPO levels can then be measured by an ELISA assay from serum samples collected from chicks one week after hatch.
  • Male birds are selected for breeding, wherein birds are screened for GO roosters which contain the EPO transgene in their sperm.
  • roosters with the highest levels of the transgene in their sperm samples are bred to nontransgenic hens by artificial insemination.
  • Blood DNA samples are screened for the presence of the transgene.
  • a number of chicks are usually found to be transgenic (Gl avians).
  • Chick serum is tested for the presence of human EPO (e.g., ELISA assay).
  • the egg white in eggs from Gl hens is also tested for the presence of human EPO.
  • the EPO i.e., derived from the optimized coding sequence of human EPO
  • the EPO present in eggs of the present invention is biologically active (Example 11).
  • the pNLB-CMV-IFN vector (FIG. 8A) is created by substituting an
  • IFN encoding sequence for the BL encoding sequence (Example 12, vide infra).
  • a constitutive cytomegalovirus (CMV) promoter is employed to drive expression of IFN. More specifically, the IFN coding sequence is controlled by the cytomegalovirus (CMV) immediate early promoter/enhancer and SV40 polyA site.
  • FIG. 8A illustrates pNLB-CMV-IFN used for expressing IFN in avians, for example, chicken and turkey.
  • An optimized coding sequence is created for human IFN- ⁇ 2b, wherein the most frequently used codons for each particular amino acid found in the egg white proteins ovalbumin, lysozyme, ovomucoid, and ovotransferrin are used in the design of the human IFN- ⁇ 2b sequence that is inserted into vectors of the present invention. More specifically, the DNA sequence for the optimized human IFN- ⁇ 2b (FIG.
  • the vectors containing the gene for the optimized human IFN- ⁇ 2b sequence are used to create transgenic avians that express TPD IFN- ⁇ 2b in their tissues and eggs.
  • Transducing particles i.e., transduction particles
  • Transduction particles are produced for the vector and titered to determine the appropriate concentration that can be used to inject embryos (Example 2, vide infra).
  • chimeric avians are produced (see also Example 13, vide infra).
  • Avian eggs are windowed according to the Speksnijder procedure (U.S. Pat. No. 5,897,998), and eggs are injected with transducing particles Eggs hatch about 21 days after injection.
  • hIFN levels are measured (e.g., ELISA assay) from serum samples collected from chicks one week after hatch.
  • EPO serpra
  • DNA is extracted from rooster sperm samples.
  • the GO roosters with the highest levels of the transgene in their sperm samples are bred to nontransgenic hens by artificial insemination.
  • Blood DNA samples are screened for the presence of the transgene.
  • the serum of transgenic roosters is tested for the presence of hIFN (e.g., ELISA assay). If the exogenous protein is confirmed the sperm of the transgenic roosters is used for artificial insemination of nontransgenic hens. A certain percent of the offspring will then contain the transgene (e.g., more than 50%).
  • IFN i.e., derived from the optimized coding sequence of human IFN
  • the IFN may be tested for biological activity.
  • such eggs usually contain biologically active IFN, such as TPD IFN- ⁇ 2b (FIG. 1 IB).
  • the methods of the invention which provide for the production of exogenous protein in the avian oviduct and the production of eggs which contain exogenous protein involve an additional step subsequent to providing a suitable vector and introducing the vector into embryonic blastodermal cells so that the vector is integrated into the avian genome.
  • the . subsequent step involves deriving a mature transgenic avian from the transgenic blastodermal cells produced in the previous steps. Deriving a mature transgenic avian from the blastodermal cells optionally involves transferring the transgenic blastodermal cells to an embryo and allowing that embryo to develop fully, so that the cells become incorporated into the avian as the embryo is allowed to develop. The resulting chick is then grown to maturity.
  • the cells of a blastodermal embryo are transfected or transduced with the vector directly within the embryo (Example 2).
  • the resulting embryo is allowed to develop and the chick allowed to mature.
  • the transgenic avian so produced from the transgenic blastodermal cells is known as a founder.
  • Some founders will carry the transgene in the tubular gland cells in the magnum of their oviducts.
  • These avians will express the exogenous protein encoded by the transgene in their oviducts.
  • the exogenous protein may also be expressed in other tissues (e.g., blood) in addition to the oviduct.
  • the exogenous protein contains the appropriate signal sequence(s), it will be secreted into the lumen of the oviduct and into the egg white of the egg.
  • Some founders are germ- line founders (Examples 8 and 9).
  • a germ-line founder is a founder that carries the transgene in genetic material of its germ-line tissue, and may also carry the transgene in oviduct magnum tubular gland cells that express the exogenous protein. Therefore, in accordance with the invention, the transgenic avian will have tubular gland cells expressing the exogenous protein, and the offspring of the transgenic avian will also have oviduct magnum tubular gland cells that express the exogenous protein.
  • the offspring express a phenotype determined by expression of the exogenous gene in specific tissue(s) of the avian (Example 6, Table 2).
  • the transgenic avian is a chicken or a turkey.
  • the invention can be used to express, in large yields and at low cost, desired proteins including those used as human and animal pharmaceuticals, diagnostics, and livestock feed additives.
  • the invention includes transgenic avians that produce such proteins and eggs laid by the transgenic avians which contain the protein, for example, in the egg white.
  • the present invention is contemplated for use in the production of any desired protein including pharmaceutical proteins with the requisite that the coding sequence of the protein can be introduced into an oviduct cell in accordance with the present invention.
  • human proteins as disclosed herein is of particular interest.
  • the human form of each of the proteins disclosed herein for which there is a human form, is contemplated for production in accordance with the invention.
  • Proteins contemplated for production as disclosed herein include, but are not limited to, fusion proteins, growth hormones, cytokines, structural proteins and enzymes including human growth hormone, interferon, Iysozyme, and ⁇ -casein, albumin, ⁇ -1 antitrypsin, antithrombin III, collagen, factors VIII, IX, X (and the like), fibrinogen, insulin, lactoferrin, protein C, erythropoietin (EPO), granulocyte colony- stimulating factor (G-CSF), granulocyte macrophage colony-stimulating factor (GM- CSF), tissue-type plasminogen activator (tPA), somatotropin, and chymotrypsin.
  • Modified immunoglobulins and antibodies including immunotoxins which bind to surface antigens on human tumor cells and destroy them, can also be produced as disclosed herein.
  • therapeutic proteins which may be produced as disclosed herein include, without limitation, factor VIII, b-domain deleted factor VIII, factor Vila, factor IX, anticoagulants; hirudin, alteplase, tpa, reteplase, tpa, tpa - 3 of 5 domains deleted, insulin, insulin lispro, insulin aspart, insulin glargine, long-acting insulin analogs, hgh, glucagons, tsh, follitropin-beta, fsh, gm-csf, pdgh, ifn alpha2, ifn alpha2a, ifn alpha2b, inf-apha, inf-beta Ib, ifn-beta Ia, ifn-gammalb, il-2, il-11, hbsag, ospa, murine mab directed against t-lymphocyte antigen, murine mab directed against tag-72, tumor-associated
  • the invention includes methods for producing multimeric proteins including immunoglobulins, such as antibodies, and antigen binding fragments thereof.
  • the multimeric protein is an immunoglobulin, wherein the first and second heterologous polypeptides are immunoglobulin heavy and light chains respectively.
  • an immunoglobulin polypeptide encoded by the transcriptional unit of at least one expression vector may be an immunoglobulin heavy chain polypeptide comprising a variable region or a variant thereof, and may further comprise a D region, a J region, a C region, or a combination thereof.
  • An immunoglobulin polypeptide encoded by an expression vector may also be an immunoglobulin light chain polypeptide comprising a variable region or a variant thereof, and may further comprise a J region and a C region.
  • the present invention also contemplates multiple immunoglobulin regions that are derived from the same animal species, or a mixture of species including, but not only, human, mouse, rat, rabbit and chicken. In certain embodiments, the antibodies are human or humanized.
  • the immunoglobulin polypeptide encoded by at least one expression vector comprises an immunoglobulin heavy chain variable region, an immunoglobulin light chain variable region, and a linker peptide thereby forming a single-chain antibody capable of selectively binding an antigen.
  • therapeutic antibodies examples include, but are not limited, to HERCEPTINTM (Trastuzumab) (Genentech, CA) which is a humanized anti-HER2 monoclonal antibody for the treatment of patients with metastatic breast cancer; REOPROTM (abciximab) (Centocor) which is an anti-glycoprotein Hb/IIIa receptor on the platelets for the prevention of clot formation; ZENAPAXTM (daclizumab) (Roche Pharmaceuticals, Switzerland) which is an immunosuppressive, humanized anti-CD25 monoclonal antibody for the prevention of acute renal allograft rejection; PANOREXTM which is a murine anti-17-IA cell surface antigen IgG2a antibody (Glaxo Wellcome/Centocor); BEC2 which is a murine antiidiotype (GD3 epitope) IgG antibody (ImClone System); IMC-C225 which is a chimeric anti-EGFR I
  • HERCEPTINTM Tras
  • the invention is drawn to G-CSF produced in poultry or avains.
  • the invention is drawn to G-CSF with a poultry derived glycosylation pattern (TPD G-CSF) wherein the G-CSF is obtained from avian cells, for example, avian cells of a chicken, quail or turkey.
  • TPD G-CSF poultry derived glycosylation pattern
  • the human proteins including cytokines such as G-CSF produced in poultry in isolated or purified form and human proteins including cytokines such as G-CSF produced in poultry present in pharmaceutical compositions.
  • the isolation of the proteins including G-CSF can be accomplished by methodologies readily apparent to a practitioner skilled in the art of protein purification.
  • the make-up of formulations useful for producing pharmaceutical compositions are also well known in the art.
  • the present invention encompasses transgenic poultry derived therapeutic or pharmaceutical proteins having a poultry derived glycoslyation pattern which are derived from avians.
  • the invention includes interferon- ⁇ 2 (TPD IFN- ⁇ 2) derived from avians.
  • TPD IFN- ⁇ 2 e.g., species type b
  • TPD IFN- ⁇ 2b also contains O-l inked carbohydrate structures that are similar to human PBL IFN- ⁇ 2b and is more efficiently produced in chickens than the human form.
  • the present invention contemplates an isolated polynucleotide comprising the optimized polynucleotide sequence of proteins produced as disclosed herein.
  • the invention includes avian optimized coding sequence for human IFN- ⁇ 2b, i.e., recombinant transgenic poultry derived interferon- ⁇ 2b (TPD IFN- ⁇ 2b) (SEQ ID NO: 1).
  • the coding sequence for optimized human IFN- ⁇ 2b includes 498 nucleic acids and 165 amino acids (see SEQ ID NO: 1 and FIG. 1 IA).
  • the coding sequence for natural human IFN- ⁇ 2b includes 498 nucleotides (NCBl Accession Number AF405539 and GI:15487989) and 165 amino acids (NCBI Accession Number AALOl 040 and GI: 15487990).
  • NCBI Accession Number AALOl 040 and GI: 15487990 The most frequently used codons for each particular amino acid found in the egg white proteins ovalbumin, lysozyme, ovomucoid, and ovotransferrin are used in the design of the optimized human IFN- ⁇ 2b coding sequence which is inserted into vectors of the present invention.
  • the DNA sequence for the optimized human IFN- ⁇ 2b is based on the hen oviduct optimized codon usage and is created using the BACKTRANSLATE program of the Wisconsin Package, Version 9.1 (Genetics Computer Group Inc., Madison, Wis.) with a codon usage table compiled from the chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and ovotransferrin proteins.
  • the percent usage for the four codons of the amino acid alanine in the four egg white proteins is 34% for GCLJ, 31% for GCC, 26% for GCA, and 8% for GCG.
  • GCU is used as the codon for the majority of alanines in the optimized human IFN- ⁇ 2b coding sequence.
  • the vectors containing the gene for optimized human IFN- ⁇ 2b are used to create transgenic avians that express TPD IFN- ⁇ 2b in their tissues and eggs. . As discussed in Example 13 (vide infra), TPD IFN- ⁇ 2b is produced in chicken.
  • TPD IFN- ⁇ 2b may also be produced in turkey and other avian species such as quail.
  • TPD IFN- ⁇ 2b is expressed in chicken and turkey and their hard shell eggs.
  • a carbohydrate analysis (Example 14, vide infra), including a monosaccharide analysis and FACE analysis, reveals the sugar make-up or novel glycosylation pattern of the protein.
  • TPD IFN- ⁇ 2b shows the following monosaccharide residues: N-Acetyl-Galactosamine (NAcGaI), Galactose (Gal), N-Acetyl-Glucosamine (NAcGIu), and Sialic acid (SA).
  • TPD IFN- ⁇ 2b is O-glycosylated at Thr-106.
  • This type of glycosylation is similar to human IFN- ⁇ 2, wherein the Thr residue at position 106 is unique to IFN- ⁇ 2.
  • TPD IFN- ⁇ 2b does not have mannose residues.
  • a FACE analysis reveals 6 bands (FlG. 9) that represent various sugar residues, wherein bands 1, 2 and 3 are un-sialylated, mono- sialylated, and di-sialylated, respectively (FIG. 10).
  • the sialic acid (SA) linkage is alpha 2-3 to Galactose (Gal) and alpha 2-6 to N-Acetyl-Galactosamine (NAcGaI).
  • Band 6 represents an un-sialylated tetrasaccharide.
  • Bands 4 and 5 are alpha-Galactose (alpha-Gal) extended disaccharides that are not seen in human PBL IFN- ⁇ 2b or natural human IFN (natural hlFN).
  • FIG. 10 shows the comparison of TPD IFN- ⁇ 2b (egg white hlFN) and human PBL IFN- ⁇ 2b (natural hlFN). Minor bands are present between bands 3 and 4 and between bands 4 and 5 in TPD IFN- ⁇ 2b (vide infra).
  • the present invention contemplates an isolated polypeptide sequence (SEQ ID NO: N-Acetyl-Galactosamine
  • TPD IFN- ⁇ 2b see also FIG. HB
  • a pharmaceutical composition thereof wherein the protein is O-glycosylated at Thr-106 with one or more of the carbohydrate structures disclosed herein as follows:
  • GaI GaI (v) GaI-GaI-NAcGaI- (vi) GaI-GaI-NAcGaI-
  • Gal-Gal-NAcGal- is about 12%
  • the invention is directed to human proteins having a poultry derived glycosylation pattern.
  • the poultry derived glycosylation pattern is obtained from avian oviduct cells, for example, tubular gland cells.
  • glycosylation patterns are disclosed herein which have been demonstrated to be present on human proteins produced in oviduct cells of a chicken in accordance with the present invention.
  • the invention is directed to human G-CSF produced in avians (e.g., avian oviduct cells) such as chickens, turkey and quail having a poultry derived glycosylation pattern.
  • avians e.g., avian oviduct cells
  • the mature hG-CSF amino acid sequence is shown in
  • FIG 18 C Nucleotide sequence used herein to produce G-CSF is shown in FIG 18 A and in NCBI Accession NM 172219. Nucleotide sequences optimized for avian (e.g., chicken) codon usage are also contemplated for use to produce G-CSF and other proteins such as human proteins produced in accordance with the invention.
  • avian e.g., chicken
  • the invention includes the eggs and the avians (e.g., chicken, turkey and quail) that lay the eggs containing G-CSF molecules of the invention comprising one or more of the glycosylation structures shown below:
  • avians e.g., chicken, turkey and quail
  • Gal Galactose
  • N AcGaI N -Acetyl-Galactosamine
  • NAcGlu N-Acetyl-Glucosamine
  • SA Sialic Acid
  • the invention includes a mixture of G-CSF molecules wherein the mixture contains G-CSF molecules having a glycosylation structure selected from one or more of Structure A, Structure B, Structure C, Structure D, Structure E, Structure F and Structure G.
  • the invention also includes a mixture of G- CSF molecules wherein the mixture contains G-CSF molecules having a glycosylation structure selected from one or more of Structure A, Structure B, Structure C, Structure D, Structure E, Structure F and Structure G wherein the mixture is isolated or purified, for example, purified from an egg or from egg white produced in accordance with the invention.
  • G-CSF molecules wherein the mixture contains G-CSF molecules having two, three, four, five or six of the structures: Structure A, Structure B, Structure C, Structure D, Structure E, Structure F and/or Structure G. Also included is a mixture of G-CSF molecules wherein the mixture contains G-CSF molecules having two, three, four, five or six of the structures: Structure A, Structure B, Structure C, Structure D, Structure E, Structure F and/or Structure G, that has been isolated or purified, for example, purified from an egg or from egg white produced in accordance with the invention.
  • the invention also includes an individual G-CSF molecule comprising a Structure A.
  • the invention also includes an individual G-CSF molecule comprising a Structure B.
  • the invention also includes an individual G-CSF molecule comprising a Structure C.
  • the invention also includes an individual G-CSF molecule comprising a Structure D.
  • the invention also includes an individual G-CSF molecule comprising a Structure E.
  • the invention also includes an individual G-CSF molecule comprising a Structure F.
  • the invention also includes an individual G-CSF molecule comprising a Structure G.
  • the individual G-CSF molecule is present in a mixture of G-CSF molecules that may be an isolated or purified mixture of G-CSF molecules, for example, the mixture being purified from an egg or from egg white produced in accordance with the invention.
  • the individual G-CSF molecule is isolated or purified, for example, purified as disclosed herein (e.g., by HPLC as disclosed in Example 20).
  • G-CSF for example, mixtures of G-CSF molecules and individual G-CSF molecules (in the preceding two paragraphs), are also applicable in general for each of the other proteins produced in accordance with the invention and their corresponding poultry derived glycosylation structures.
  • Transgenic chickens which lay eggs containing EPO were produced as disclosed in Examples 22 and 23.
  • a second line of EPO producing chickens was produced essentially as described in examples 22 and 23 except that a different producer cell line was used, as described in US patent publication No. 2007/0077650, published May 5, 2007, the disclosure of which is incorporated in its entirety herein by reference.
  • This second line of EPO producing chickens appeared to have a deletion in the CMV promoter and in an LTR providing for an enhanced level of production of EPO in the egg white of the resulting transgenic chickens as disclosed in US patent application No. 11/880,838, filed July 24, 2007, the disclosure of which is incorporated in its entirety herein by reference.
  • Proteins produced in transgenic avians in accordance with the invention can be purified from egg white by any useful procedure such as those apparent to a practitioner of ordinary skill in the art of protein purification.
  • the EPO produced in transgenic avians in accordance with the invention can be purified from egg white by methods apparent to practitioners of ordinary skill in the art of protein purification.
  • An example of a purification protocol for EPO present in egg white is described in Example 24.
  • the human erythropoietin (hEPO) produced in chickens has been shown to contain an O-linked carbohydrate chain and three N-linked carbohydrate chains.
  • the O-linked glycosylation has been shown to be at Ser-126 of the EPO and the N-Iinked glycosylations have been shown to be at Asn-24, Asn-38 and Asn-83.
  • the mature erythropoietin amino acid sequence produced in accordance with the invention is shown in FIG. 19B.
  • the human nucleotide sequence encoding the EPO is shown in FIG. 19A.
  • Nucleotide sequences optimized for avian (e.g., chicken) codon usage are also contemplated for use to produce EPO and other proteins in accordance with the invention.
  • glycosylation structures have been determined for the erythropoietin of the invention and are shown in Example 25 and in FIGS. 20 and 21.
  • B-n, D-n, F-n, H-n, J-n, L-n, N-n, O-n, P-n, and Q-n have been identified as being present on the avian derived EPO.
  • evidence shows that one or more of oligosaccharide structures A-n, C-n, E-n, G-n, I-n, K-n and M-n may also be present on the EPO.
  • data has indicated that there may be a second form of Q-n in which only four of the five terminal NAcGIu residues are present. This second form of Q-n may be a precursor form of Q-n.
  • the invention includes the eggs and egg white and the avians (e.g., chicken turkey and quail) that lay the eggs and produce the egg white containing erythropoietin molecules of the invention comprising one or more of the glycosylation structures disclosed herein.
  • avians e.g., chicken turkey and quail
  • the invention includes a mixture of erythropoietin molecules wherein the mixture contains erythropoietin molecules (e.g., one or more erythropoietin molecules) having an O-linked glycosylation structure selected from Structure A-o, Structure B-o and Structure C-o.
  • erythropoietin molecules e.g., one or more erythropoietin molecules
  • O-linked glycosylation analysis to date have confirmed the presence of A-o, B-o and C-o; Structure D-o, Structure E-o, Structure F-o and Structure G-o are also contemplated as being present on the poultry derived human EPO. It has been determined that the primary O-Iinked oligosaccharide present on the avian derived EPO appears to be C-o.
  • the invention also includes EPO having N-linked glycosylation structures at three sites wherein the structures at each of the three sites are selected from one of A-n, B-n, C-n, D-n, E-n, F-n, G-n, H-n, I-n, J-n, K-n, L-n, M-n, N-n, O-n, P-n and Q-n.
  • the invention also includes a mixture of erythropoietin molecules (e.g., more than one erythropoietin molecule) wherein some or all of the erythropoietin molecules have one or more glycosylation structures selected from Structure A-o, Structure B-o, Structure C-o, Structure A-n, Structure B-n, Structure C-n, Structure D-n, Structure E- n, Structure F-n, Structure G-n, Structure H-n, Structure I-n, Structure J-n, Structure K- n, Structure L-n, Structure M-n, Structure N-n, Structure O-n, Structure P-n, Structure Q-n.
  • the mixture of erythropoietin molecules is purified or isolated, for example, isolated from an egg or purified or isolated from egg white produced in a transgenic avian.
  • the invention also includes an individual erythropoietin molecule comprising a Structure A-o.
  • the invention also includes an individual erythropoietin molecule comprising a Structure B-o.
  • the invention also includes an individual erythropoietin molecule comprising a Structure C-o.
  • the invention also includes an individual erythropoietin molecule comprising a Structure A-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure B-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure C-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure D-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure E-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure F-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure G-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure H-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure I-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure J-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure K-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure L-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure M-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure N-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure O-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure P-n.
  • the invention also includes an individual erythropoietin molecule comprising a Structure Q-n.
  • the individual erythropoietin molecule is present in a mixture of erythropoietin molecules which has been produced in a transgenic avian, e.g., a transgenic chicken. In one embodiment, the individual erythropoietin molecule is present in a mixture of erythropoietin molecules which has been isolated or purified, for example, the mixture is isolated or purified from an egg or from egg white produced by a transgenic avian. In one embodiment, the individual erythropoietin molecule is isolated or purified.
  • the invention includes exemplary EPO molecules where each of the Asn-24,
  • Asn-38 and Asn-83 glycosylation sites are glycosylated with one of the A-n, B-n, C-n, D-n, E-n, F-n, G-n, H-n, I-n, J-n, K-n, L-n, M-n, N-n, O-n, P-n and Q-n Structures and where and the Ser-126 is glycosylated with A-o, B-o or C-o.
  • MALDI-TOF-MS analysis of peptide products yielded from proteolytic digests of the avian derived EPO of the invention have shown that essentially the same oligosaccharide structures are present at each of the three N-linked glycosylation sites. That is, it appears that about the same ratio of each of the N-Iinked oligosaccharides is present at each of the three N-linked glycosylation sites on the EPO molecules. This indicates that other N-glycosylated exogenous proteins produced in accordance with the invention may have similar N-linked glycosylation patterns.
  • each of the three N-linked sites is extensively glycosylated, each site being glycosylated greater than 95% of the time and possibly greater than 98% of the time, for example, greater than 99% of the time.
  • the erythropoietin analyzed was produced in a transgenic chicken which contained a transgene encoding the amino acid sequence of the human 165 amino acid protein, after cleavage of the signal peptide.
  • EPO produced in a transgenic chicken using a nucleotide sequence encoding the 166 amino acid form of EPO would result in the same complement of oligosaccharides on the 166 amino acid protein as is found on the 165 amino acid protein.
  • N-linked oligosaccharides attached to human EPO produced in transgenic chickens have a paucity of terminal sialic acid moieties. That is, only minor amounts of the N-linked oligosaccharide structures are terminally sialylated. This is in contrast to EPO produced in human cells and human EPO produced in CHO cells where the N- linked oligosaccharide structures are extensively terminally sialylated.
  • terminal N-Acetyl Glucosamine NAcGIu
  • NAcGIu N-Acetyl Glucosamine
  • fucose is not present on the N-linked oligosaccharide structures of the EPO produced in transgenic chickens. However, fucose appears to be present on all or most
  • N-linked oligosaccharide structures of EPO produced in human cells and human EPO produced in CHO cells are N-linked oligosaccharide structures of EPO produced in human cells and human EPO produced in CHO cells.
  • a human erythropoietin molecule may be glycosylated with, A-o, A-n, B-n and C-n, or A-o, B-n, C-n and D-n, or A-o, D-n, E-n and F-n, or A- o, E-n, F-n and G-n, or B-o, A-n, D-n and H-n, or B-o, E-n, F-n and G-n, or B-o, A-n, A-n and A-n, or C-o, D-n, D-n and C-n, or C-o, F-n, G-n and H-n, or C-o, A-n, B-n and C-n, or C-o, A-n, B-n and C-n, or C-o, A-n, B-n and H-n, or C-o, A-n, B-n and E-n
  • compositions of the invention are not limited thereto.
  • certain of the glycosylated protein molecules of the invention may be produced in other organisms such as transgenic fish, transgenic mammals, for example, transgenic goats or in transgenic plants, such as tobacco and duck weed (Lemna minor).
  • glycosylation structures demonstrated to be present on one protein of the invention may be present on another protein of the invention.
  • glycosylation structures shown to be present on TPD G-CSF may also be present on TPD GM-CSF, TPD IFN and/or other TPD proteins.
  • the glycosylation structures determined to be present on TPD IFN ⁇ 2 may be present on TPD G-CSF, TPD GM-CSF and/or other transgenic poultry derived (TPD) proteins.
  • TPD transgenic poultry derived
  • pegylating proteins produced as disclosed herein may be advantageous as discussed, for example, in US patent application No. 11/584,832, filed October 23, 2006, the disclosure of which is incorporated it its entirety herein by reference. While it is possible that, for use in therapy, therapeutic proteins produced in accordance with this invention may be administered in raw form, it is preferable to administer the therapeutic proteins as part of a pharmaceutical formulation.
  • the invention thus further provides pharmaceutical formulations comprising poultry derived glycosylated therapeutic proteins or a pharmaceutically acceptable derivative thereof together with one or more pharmaceutically acceptable carriers thereof and, optionally, other therapeutic and/or prophylactic ingredients and methods of administering such pharmaceutical formulations.
  • the carrier(s) must be "acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
  • compositions include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral.
  • the pharmaceutical formulations include those suitable for administration by injection including intramuscular, sub-cutaneous and intravenous administration.
  • the pharmaceutical formulations also include those for administration by inhalation or insufflation.
  • the formulations may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy.
  • the methods of producing the pharmaceutical formulations typically include the step of bringing the therapeutic proteins into association with liquid carriers or finely divided solid carriers or both and then, if necessary, shaping the product into the desired formulation.
  • compositions suitable for oral administration may conveniently be presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution; as a suspension; or as an emulsion.
  • the active ingredient may also be presented as a bolus, electuary or paste.
  • Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrants, or wetting agents.
  • the tablets may be coated according to methods well known in the art.
  • Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils) or preservatives.
  • Therapeutic proteins of the invention may also be formulated for parenteral administration (e.g., by injection, for example bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-f ⁇ lled syringes, small volume infusion or in multi-dose containers with an added preservative.
  • the therapeutic proteins may be injected by, for example, subcutaneous injections, intramuscular injections, and intravenous infusions or injections.
  • the therapeutic proteins may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. It is also contemplated that the therapeutic proteins may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use.
  • a suitable vehicle e.g., sterile, pyrogen-free water
  • the therapeutic proteins produced according to the invention may be formulated as ointments, creams or lotions, or as a transdermal patch.
  • Ointments and creams may, for example, be formulated with an aqueous or oily base with the addition of suitable thickening and/or gelling agents.
  • Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents or coloring agents.
  • Formulations suitable for topical administration in the mouth include lozenges comprising active ingredient in a flavored base, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert base such as gelatin and glycerin or sucrose and acacia; and mouthwashes comprising the active ingredient in a suitable liquid carrier.
  • compositions suitable for rectal administration wherein the carrier is a solid are most preferably represented as unit dose suppositories.
  • Suitable carriers include cocoa butter and other materials commonly used in the art, and the suppositories may be conveniently formed by a mixture of the active compound with the softened or melted carrier(s) followed by chilling and shaping in molds.
  • Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or sprays containing in addition to the active ingredient, such carriers as are known in the art to be appropriate.
  • the therapeutic proteins of the invention may be used as a liquid spray or dispersible powder or in the form of drops.
  • Drops may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents. Liquid sprays are conveniently delivered from pressurized packs.
  • therapeutic proteins according to the invention may be conveniently delivered from an insufflator, nebulizer or a pressurized pack or other convenient means of delivering an aerosol spray.
  • Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • the therapeutic proteins according to the invention may take the form of a dry powder composition, for example a powder mix of the compound and a suitable powder base such as lactose or starch.
  • the powder composition may be presented in unit dosage form in, for example, capsules or cartridges or, e.g., gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflator.
  • compositions according to the invention may also contain other active ingredients such as antimicrobial agents, or preservatives.
  • human EPO produced as disclosed herein, and which may be pegylated is employed in a pharmaceutical formulation wherein each 1 mL contains 0.05 rag polysorbate 80, and is formulated at pH 6.2 + 0.2 with 2.12 mg sodium phosphate monobasic monohydrate, 0.66 mg sodium phosphate dibasic anhydrous, and 8.18 mg sodium chloride in water for injection.
  • human interferon alpha produced as disclosed herein is employed in a pharmaceutical formulation containing 7.5 mg/ml sodium chloride, 1.8 mg/ml sodium phosphate dibasic, 1.3 mg/ml sodium phosphate monobasic, 0.1 mg/ml edetate disodium dihydrate, 0.7 mg/ml Tween® 80 and 1.5 mg/ml m-cresol.
  • human G-CSF produced as disclosed herein is employed in a pharmaceutical formulation containing 0.82 mg/ml sodium acetate, 2.8 ⁇ l/ml glacial acetic acid, 50 mg/ml mannitol and 0.04 mg/ml Tween® 80.
  • the therapeutic proteins of the invention may be used in combination with other therapeutic agents.
  • compositions or compounds of the invention can be used to treat a variety of conditions.
  • treatment therapies are known to practitioners of skill in the art in which therapeutic proteins obtained from cell culture (e.g., CHO cells) are employed.
  • cell culture e.g., CHO cells
  • the present invention contemplates that the therapeutic proteins produced in an avian system containing a poultry derived glycosyation pattern can be employed to treat such conditions. That is, the invention contemplates the treatment of conditions known to be treatable by conventionally produced therapeutic proteins by using therapeutic proteins produced in accordance with the invention.
  • erythropoietin produced in accordance with the invention can be used to treat human conditions such as anemia and kidney disease, e.g., chronic renal failure (or other conditions which may be treatable by administering EPO of the invention) and G-CSF produced in accordance with the invention can be used to treat cancer patients, as understood in the art.
  • human conditions such as anemia and kidney disease, e.g., chronic renal failure (or other conditions which may be treatable by administering EPO of the invention)
  • G-CSF produced in accordance with the invention can be used to treat cancer patients, as understood in the art.
  • the dosage administered will vary depending upon known factors such as age, health and weight of the recipient, type of concurrent treatment, frequency of treatment, and the like. Usually, a dosage of active ingredient can be between about 0.0001 and about 10 milligrams per kilogram of body weight. Precise dosage, frequency of administration and time span of treatment can be determined by a physician skilled in the art of administration of the respective therapeutic protein. The following specific examples are intended to illustrate the invention and should not be construed as limiting the scope of the claims.
  • the lacZ gene of pNLB a replication-deficient avian leukosis virus (ALV)- based vector (Cosset et al., 1991), was replaced with an expression cassette consisting of a cytomegalovirus (CMV) promoter and the reporter gene, ⁇ -lactamase.
  • CMV cytomegalovirus
  • the pNLB and pNLB-CMV-BL vector constructs are diagrammed in FIG. 3A and 3B, respectively.
  • an intermediate adaptor plasmid was first created, pNLB-Adapter.
  • pNLB-Adapter was created by inserting the chewed back Apal/Apal fragment of pNLB (Cosset et al., J. Virol. 65:3388-94 (1991)) (in pNLB, the 5 1 Apal resides 289 bp upstream of lacZ and the 3'ApaI resides 3 r of the 3' LTR and Gag segments) into the chewed-back Kpnl/Sacl sites of pBluescri ⁇ tKS(-).
  • the filled-in Mlul/Xbal fragment of pCMV-BL (Moore et al., Anal. Biochem.
  • Sentas and Isoldes were cultured in FlO (Gibco), 5% newborn calf serum (Gibco), 1% chicken serum (Gibco), 50 ⁇ g/ml phleomycin (Cayla Laboratories) and 50 ⁇ g/ml hygromycin (Sigma). Transduction particles were produced as described in Cosset et al., 1993, herein incorporated by reference, with the following exceptions. Two days after transfection of the retroviral vector pNLB-CMV-BL (from Example I, above) into 9xlO 5 Sentas, virus was harvested in fresh media for 6-16 hours and filtered.
  • All of the media was used to transduce 3x10 6 Isoldes in 3 100 mm plates with polybrene added to a final concentration of 4 ⁇ g/ml. The following day the media was replaced with media containing 50 ⁇ g/ml phleomycin, 50 ⁇ g/ml hygromycin and 200 ⁇ g/ml G418 (Sigma). After 10-12 days, single G418 resistant colonies were isolated and transferred to 24-well plates. After 7-10 days, titers from each colony were determined by transduction of Sentas followed by G418 selection. Typically 2 out of 60 colonies gave titers at 1-3x10 5 .
  • the transduction vector, pNLB-CMV-BL was injected into the subgerminal cavity of 546 unincubated SPF White Leghorn embryos, of which 126 chicks hatched and were assayed for secretion of ⁇ -lactamase (lactamase) into blood.
  • a kinetic colorimetric assay was employed in which PADAC, a purple substrate, is converted to a yellow compound specifically by lactamase. Lactamase activity was quantitated by monitoring the decrease in ODs 7O nm during a standard reaction time and compared to a standard curve with varying levels of purified lactamase (referred to as the "lactamase assay").
  • lactamase assay The presence or absence of lactamase in a sample could also be determined by visually scoring for the conversion of purple to yellow in a test sample overnight or for several days (the "overnight lactamase assay"). The latter method was suitable for detection of very low levels of lactamase or for screening a large number of samples.
  • chick serum samples were tested for the presence of lactamase. Twenty-seven chicks had very low levels of lactamase in their serum that was detectable only after the overnight lactamase assay and, as these birds matured, lactamase was no longer detectable.
  • Table 1 below and FIG. 4A 9 additional birds (3 males and 6 females) had serum levels of lactamase that ranged from 1 1.9 to 173.4 ng/ml at six to seven months post-hatch.
  • Lactamase was detected in the egg white of all six hens by a western blot assay with an anti- ⁇ -lactamase antibody.
  • the egg white lactamase was the same size as the bacterially produced, purified lactamase that was used as a standard.
  • the amount detected in egg white by Western analysis was consistent with that determined by the enzymatic assay, indicating that a significant proportion of the egg white lactamase was biologically active.
  • Hen-produced lactamase in egg white stored at 4°C lost no activity and showed no change in molecular weight even after several months of storage. This observation allowed storage of lactamase-containing eggs for extended periods prior to analysis.
  • the serum of the Gl transgenic chicks, 5308, 5657 and 4133, at 6 to 11 weeks post-hatch contained 0.03, 2.0 and 6.0 ⁇ g/ml of lactamase, respectively.
  • Hen 5657 and rooster 4133 were bred to non-transgenic chickens to obtain offspring hemizygous for the transgene.
  • the pedigrees of transgenic chickens bred from rooster 4133 or hen 5657 and the subsequent generations are shown in FIG. 5.
  • Transgenic rooster 5308 was also bred but this bird's progeny exhibited lactamase concentrations that were either very low or not detectable in serum and egg white. Active lactamase concentrations in the serum of randomly selected G2 transgenic chicks were measured at 3 to 90 days post-hatch.
  • Eggs from Gl hen 5657 contained 130 ng of active ⁇ -lactamase (lactamase) per ml of egg white (FIG. 6A). Lactamase concentrations were higher in the first few eggs laid and then reached a plateau that was stable for at least nine months. Eggs from transgenic hens bred from hen 5657 and a non-transgenic rooster had ' lactamase concentrations that were similar to their parent (FIG. 6A). Hen 6978 was bred from G2 hen 8617 and sibling G2 rooster 8839 and was homozygous for the transgene as determined by quantitative PCR and Southern analysis.
  • Rooster 4133 was bred to non-transgenic hens to obtain hemizygous G2 hens. Of the 15 transgenic hens analyzed, all had lactamase in the egg white at concentrations ranging from 0.47 to 1.34 ⁇ g/ml. Four representative hens are shown in FIG. 7A. When assayed 6 months later, the average expression level had dropped from approximately 1.0 ⁇ g/ml to 0.8 ⁇ g/ml (FIG. 7A). Expression levels were high in the initial eggs and leveled out over several months. After that, the concentrations of lactamase in the eggs remained constant.
  • G2 hen 8150 and sibling G2 rooster 8191 were crossed to yield hemizygous and homozygous G3 hens.
  • All transgenic G3 hens expressed lactamase in the white of their eggs at concentrations ranging from 0.52 to 1.65 ⁇ g/ml (FIG. 7B).
  • the average expression for the G3 hens that were homozygous was 47% higher than those G2 hens and G3 hens that were hemizygous.
  • the amount of lactamase in the eggs from G2 and G3 hens bred from rooster 4133 and his offspring varied significantly (FIGS. 7A and 7B), although the levels in the eggs from any given hen in that group were relatively constant.
  • Taqman detection of the neo resistance gene in sperm DNA was used to identify candidate GO males for breeding. Three GO males were identified, wherein each had the NLB-CMV-BL transgene in their sperm DNA at levels that were above background. All GO males positive for the transgene in their sperm were bred to non- transgenic hens to identify fully transgenic Gl offspring.
  • G2 hemizygous birds having NLB-CMV-BL integrated at the same site were crossbred.
  • Two groups were bred: the first was a hen and rooster arising from the Gl 4133 male and the second from the Gl 5657 hen.
  • the Taqman assay was used to quantitatively detect the neo resistance transgene in G3 progeny using a standard curve.
  • the standard curve was constructed using known amounts of genomic DNA from the Gl transgenic 4133 male hemizygous for the transgene as determined by Southern analysis.
  • the standard curve ranged from 10 3 to 1.6xlO 4 total copies of the transgene or 0.2 to 3.1 transgene copies per diploid genome. Because reaction components were not limited during the exponential phase, amplification was very efficient and gave reproducible values for a given copy number. There was a reproducible, one-cycle difference between each standard curve differing two-fold in copy number.
  • DNA of selected birds was analyzed by Southern blotting using Pstl-digested DNA and a probe complementary to the neo resistance gene to detect a 0.9 kb fragment. Detection of a small fragment was chosen since transfer of smaller DNAs from gel to membrane is more quantitative. The signal intensity of the 0.9 kb band corresponded well to the copy number of G3 transgenic birds as determined by the Taqman assay. The copy numbers of an additional eighteen G3 transgenic birds analyzed by Southern blotting were also consistent with that determined by Taqman.
  • Progeny of the 5657 lineage did not have the expected distribution but this could have been due to the low number of progeny tested (Harvey et al., "Consistent production of transgenic chickens using replication deficient retroviral vectors and high-throughput screening procedures” (February 2002) Poultry Science 81 :202-212).
  • an pNLB-MDOT-EPO vector was created, substituting an EPO encoding sequence for the BL encoding sequence (FIG. 8B).
  • MDOT is a synthetic promoter which contains elements from both the ovomucoid (MD) and ovotransferrin (TO) promoter.
  • MD ovomucoid
  • TO ovotransferrin
  • the DNA sequence for human EPO based on hen oviduct optimized codon usage was created using the BACKTRANSLATE program of the Wisconsin Package, version 9.1 (Genetics Computer Group, Inc., Madison, Wis.) with a codon usage table compiled from the chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and ovotransferrin proteins.
  • the DNA sequence was synthesized and cloned into the 3' overhang T's of pCRII-TOPO (Invitrogen) by Integrated DNA Technologies, Coralville, Iowa, on a contractual basis.
  • the EPO coding sequence was then removed from pEpoMM with Hind III and Fse I, purified from a 0.8% agarose-TAE GeI, and ligated to Hind III and Fse I digested, alkaline phosphatase-treated pCMV-IFNMM.
  • the resulting plasmid was pA VIJCR-A 137.43.2.2 which contained the EPO coding sequence controlled by the cytomegalovirus immediate early promoter/enhancer and SV40 polyA site.
  • the plasmid pAVIJCR-Al 37.43.2.2 was digested with Nco I and Fse I and the appropriate fragment ligated to an Nco 1 and Fse I-digested fragment of pMDOTIFN to obtain pA VIJCR-Al 37.87.2.1 which contained EPO driven by the MDOT promoter.
  • the plasmids pALVMDOTIFN and pA VIJCR-Al 37.87.2.1 were digested with Kpn I and Fse I.
  • NLB-MDOT-EPO transduction particles were performed as described for NLB-CMV-BL (see Example 2). Approximately 300 White Leghorn eggs were windowed according to the Speksnijder procedure (U.S. Pat. No. 5,897,998), then injected with about 7x10 4 transducing particles per egg. Eggs hatched 21 days after injection, and human EPO levels were measured by EPO ELISA from serum samples collected from chicks one week after hatch. In order to screen for GO roosters which contained the EPO transgene in their sperm, DNA was extracted from rooster sperm samples by Chelex-100 extraction (Walsh et al., 1991).
  • DNA samples were then subjected to Taqman® analysis on a 7700 Sequence Detector (Perkin Elmer) using the "neo for-1" (5'- TGGATTGCACGCAGGTTCT-3'; SEQ ID NO: 5) and “neo rev-1 " (5 1 - TGCCCAGTCATAGCCGAAT-S 1 ; SEQ ID NO: 6) primers and FAM labeled NEO- PROBEl (5 I -CCTCTCCACCCAAGCGGCCG-3 I ; SEQ ID NO: 7) to detect the transgene.
  • Eight GO roosters with the highest levels of the transgene in their sperm samples were bred to nontransgenic SPAFAS (White Leghorn) hens by artificial insemination. Blood DNA samples were screened for the presence of the transgene by Taqman® analysis as described above.
  • Chick serum was tested for the presence of human EPO by EPO ELISA, and EPO was present at about 70 nanogram/ml (ng/ml).
  • Egg white in eggs from Gl hens was also tested for the presence of human EPO by EPO ELISA and found to contain human EPO at about 70 ng/ml.
  • the EPO present in eggs i.e., derived from the optimized coding sequence of human EPO was found to be biologically active when tested on a human EPO responsive cell line (HCD57 murine erythroid cells) in a cell culture assay.
  • Example 1 Following the teachings of Example 1, a pNLB-CMV-IFN vector; was created (FIG. 8A), substituting an IFN encoding sequence for the BL encoding sequence of Example 1.
  • the DNA sequence for optimized human IFN- ⁇ 2b is based on the hen oviduct optimized codon usage and was created using the BACKTRANSLATE program of the Wisconsin Package, Version 9.1 (Genetics Computer Group Inc., Madison, Wis.) with a codon usage table compiled from the chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and ovotransferrin proteins.
  • the percent usage for the four codons of the amino acid alanine in the four egg white proteins is 34% for GCU, 31% for GCC, 26% for GCA, and 8% for GCG.
  • GCU was used as the codon for the majority of alanines in the optimized human IFN- ⁇ 2b coding sequence.
  • the vectors containing the gene for optimized human IFN- ⁇ 2b were used to create transgenic avians ;that express transgenic poultry derived interferon- ⁇ 2b (TPD IFN- ⁇ 2b) in their tissues and eggs.
  • the template and primer oligonucleotides listed in Table 4 below were amplified by PCR with Pfu polymerase (Stratagene, La Jolla, Calif.) using 20 cycles of 94°C for 1 min.; 50 0 C. for 30 sec; and 72°C. for 1 min. and 10 sec. PCR products were purified from a 12% polyacrylamide-TBE gel by the "crush and soak" method (Maniatis et al. 1982), then combined as templates in an amplification reaction using only IFN-I and IFN-8 as primers (see Table 4).
  • the resulting PCR product was digested with Hind III and Xba I and gel purified from a 2% agarose-TAE gel, then ligated into Hind III and Xba I digested, alkaline phosphatase-treated pBluescript KS (Stratagene), resulting in the plasmid pBluKSP-IFNMagMax. Both strands were sequenced by cycle sequencing on an ABI PRISM 377 DNA Sequencer (Perkin-Elmer, Foster City, Calif.) using universal T7 or T3 primers.
  • Mutations in pBluKSP-IFN derived from the original oligonucleotide templates were corrected by site-directed mutagenesis with the Transformer Site-Directed Mutagenesis Kit (Clontech, Palo Alto, Calif.).
  • the IFN coding sequence was then removed from the corrected pBluKSP-IFN with Hind III and Xba 1, purified from a 0.8% agarose-TAE Gel, and ligated to Hind III and Xba I digested, alkaline phosphatase-treated pCMV-BetaLa-3B-dH.
  • the resulting plasmid was pCMV-IFN which contained an IFN coding sequence controlled by the cytomegalovirus immediate early promoter/enhancer and SV40 polyA site.
  • pCMV-IFN was first digested with CIaI and Xbal, then both ends were filled in with Klenow fragment of DNA polymerase (New England BioLabs, Beverly, Mass.).
  • pNLB-adapter was digested with Ndel and Kpnl, and both ends were made blunt by T4 DNA polymerase (New England BioLabs).
  • DNA fragments were purified on a 0.8% agarose-TAE gel, then ligated and transformed into DH5 ⁇ cells.
  • the resulting plasmid was pNLB-adapter-CMV-IFN. This plasmid was then digested with MIuI and partially digested with BIpI and the appropriate fragment was gel purified.
  • pNLB-CMV-EGFP was digested with MIuI and BIpI, then alkaline-phosphatase treated and gel purified.
  • the Mlul/Blpl partial fragment of pNLB-adapter-CMV-IFN was ligated to the large fragment derived from the Mlul/Blpl digest of pNLB-CMV-EGFP creating pNLB-CMV-IFN.
  • Transduction particles of pNLB-CMV-IFN were produced following the procedures of Example 2. Approximately 300 White Leghorn (strain Line 0) eggs were windowed according to the Speksnijder procedure (U.S. Pat. No. 5,897,998), then injected with about 7x10 4 transducing particles per egg. Eggs hatched 21 days after injection, and human IFN levels were measured by IFN ELISA from serum samples collected from chicks one week after hatch.
  • Alphie's sperm was used for artificial insemination of nontransgenic SPAFAS (White Leghorn) hens. 106 out of 202 (about 52%) offspring contained the transgene as detected by Taqman® analysis. These breeding results followed a Mendelian inheritance pattern and indicated that Alphie is transgenic.
  • TPD IFN- ⁇ 2b Transgenic Poultry Derived Interferon- ⁇ 2b
  • TPD IFN- ⁇ 2b interferon- ⁇ 2b derived from avians
  • TPD IFN- ⁇ 2b was found to contain two new glyco forms (bands 4 and 5 are ⁇ -Gal extended disaccharides; see FIG. 9) not normally seen in human peripheral blood leukocyte derived interferon- ⁇ 2b (PBL IFN- ⁇ 2b) or natural human interferon- ⁇ 2b (natural hIFN).
  • PBL IFN- ⁇ 2b human peripheral blood leukocyte derived interferon- ⁇ 2b
  • natural human interferon- ⁇ 2b naturally hIFN
  • TPD IFN- ⁇ 2b The coding sequence for human IFN- ⁇ 2b was optimized (Example 12, supra) resulting in a recombinant IFN- ⁇ 2b coding sequence. TPD IFN- ⁇ 2b was then produced in chickens (Example 13, supra). A carbohydrate analysis, including a monosaccharide analysis and FACE analysis, revealed the sugar make-up or novel glycosylation pattern of the protein. As such, TPD IFN- ⁇ 2b showed the following monosaccharide residues: N-Acetyl-Galactosamine (NAcGaI), Galactose (Gal), N- Acetyl-Glucosamine (NAcGIu), and Sialic acid (SA).
  • NAcGaI N-Acetyl-Galactosamine
  • Gal Galactose
  • NAcGIu N- Acetyl-Glucosamine
  • SA Sialic acid
  • TPD IFN- ⁇ 2b No N-linked glycosylation was found in TPD IFN- ⁇ 2b. Instead, TPD IFN- ⁇ 2b was found to be O-glycosylated at Thr-106. This type of glycosylation is similar to human IFN- ⁇ 2, wherein the Thr residue at position 106 is unique to IFN- ⁇ 2. In addition, TPD IFN- ⁇ 2b was found to have no mannose residues.
  • a FACE analysis revealed 6 bands (FIG. 9) that represent various sugar residues, wherein bands 1, 2 and 3 are un-sialylated, mono-sialylated, and di-sialylated, respectively (FlG. 10).
  • SA linkage is alpha 2-3 to Galactose (Gal) and alpha 2-6 to N-Acetyl-Galactosamine (NAcGaI).
  • Band 6 represents an un-sialylated tetrasaccharide.
  • Bands 4 and 5 were found to be alpha- Galactose (alpha-Gal) extended disaccharides that are not seen in human PBL IFN- ⁇ 2b.
  • FIG. 10 shows the comparison of TPD IFN- ⁇ 2b (egg white hlFN) and human PBL IFN- ⁇ 2b (natural hlFN). Minor bands were present between bands 3 and 4 and between bands 4 and 5 in TPD IFN- ⁇ 2b (vide infra).
  • the protein was found to be O-glycosylated at Thr-106 with specific residues, such as:
  • Gal Galactose
  • NAcGal N-Acetyl-Galactosamine
  • NAcGlu N-Acetyl-Glucosamine
  • SA Sialic Acid
  • Gal-NAcGal- is about 20%
  • SA-GaI-NAcGaI- is about 29%
  • SA-GaI-NAcGaI- is about 9%
  • Gal (v) Gal-Gal-NAcGal- is about 7%
  • Gal-Gal-N AcGaI- is about 12%
  • the light chain (LC) and heavy chain (HC) of a human monoclonal antibody were expressed from a single vector, pCMV-LC-emcvIRES-HC, by placement of an IRES from the encephalomyocarditis virus (EMCV) (see also Jang et al. (1988) "A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation" J. Virol. 62:2636-2643) between the LC and HC coding sequences. Transcription was driven by the CMV promoter.
  • EMCV encephalomyocarditis virus
  • the LC or HC linked to the CMV promoter were cotransfected into LMH/2a cells, an estrogen-responsive, chicken hepatocyte cell line (see also Binder et al. (1990) "Expression of endogenous and transfected apolipoprotein II and vitellogenin II genes in an estrogen responsive chicken liver cell line" MoI. Endocrinol. 4:201 -208).
  • the CMV-LC-emcv-HC cassette was inserted in a retroviral vector based on the Moloney murine leukemia virus (MLV), creating pL-CMV-LC-emcvIRES-HC-
  • MMV Moloney murine leukemia virus
  • LMH cells were transduced with the L-CMV-LC-emcvIRES- HC-RN-BG retroviral vector and selected with neomycin and passaged for several weeks. LMH cells were separately transduced and neomycin selected with the parent
  • a pNLB-CMV-LC-emcv-HC vector is produced by substituting the CMV-LC- emcv-HC cassette of Example 15 for the CMV-BL cassette of pNLB-CMV-BL of Example 1.
  • Transduction particles of pNLB-CMV-LC-emcv-HC are produced following the procedures of Example 2. Approximately 300 White Leghorn (strain Line 0) eggs are windowed according to the Speksnijder procedure (U.S. Pat. No. 5,897,998) and are then injected with about 7x10 4 transducing particles per egg. Eggs hatch 21 days after injection, and human MAb levels are measured by ELISA from serum samples collected from chicks one week after hatch.
  • GO roster which contain the transgene in their sperm are identified by Taqman® analysis. Three GO roosters with the highest levels of the transgene in their sperm samples are bred to nontransgenic SPAFAS (White Leghorn) hens by artificial insemination. Over 1000 offspring are screened and more than 10 chicks are found to be transgenic (Gl avians). Chick serum is tested for the presence of the MAb by ELlSA.
  • the MAb is found to be present in an amount greater than 10 ⁇ g/ml of serum.
  • Egg white in eggs from Gl hens is also tested for the presence of the MAb by ELISA and is found to be present in an amount greater than 10 ⁇ g/ml of egg white.
  • This vector construction effectively replaces the IFN coding region of the pNLB-CMV-IFN vector of Example 12 with the coding sequence of G-CSF.
  • the hG- CSF ORF human granulocyte colony stimulating factor open reading frame
  • pORF9-hG-CSFb cat. no. porf-hgcsfb, Invivogen, San Diego, CA
  • 5'GCSF ggggggaagctttcaccatggctggacctgcca; SEQ ID NO: 32
  • 3'GCSF actagacttttcagggctgggcaaggtggcg; SEQ ID NO: 33
  • an 86 bp fragment of pNLB -CMV-IFN alpha-2b, which is present adjacent to the 3' end of the INF coding sequence was amplified by PCR using the primers 5'GCSF-NLB (ccagccctgaaaagtctagtatggggattggtg; SEQ ID NO: 34) and 3"GCSF-NLB (gggggggctcagctggaattccgcc; SEQ ID NO: 35).
  • the two PCR products (642 bp and 86 bp) were mixed and fused by PCR amplification with primers 5'GCSF and 3'GCSF- NLB.
  • the PCR product was cloned into pCR®4Blunt-TOPO® plasmid vector (Invitrogen) according to the manufacturer's instructions and electroporated into DH5 ⁇ -E cells, producing pFusion-hG-CSF-NLB.
  • pFusion-hG-CSF-NLB was digested with Hmd III and BIp I and the 690 bp G-CSF fragment was gel purified.
  • the IFN alpha-2b coding sequence was removed from pNLB-CMV-IFN alpha-2b by digesting with BIp I. The vector was then religated and clones were selected which lacked the IFN coding insert, creating pNLB-CMV-delta hIFN alpha-2b.
  • pNLB-CMV-delta IFN alpha-2b was digested with BIp I and partially digested with Hind III and the 8732 bp BIp I- Hmd III vector fragment was gel purified. The 8732 bp fragment was ligated to the 690 bp Hind III /BIp I G-CSF fragment to create pNLB-CMV-G-CSF.
  • the G-CSF ORF was verified by sequencing.
  • NLB-CMV-hG-CSF transduction particles were produced as described for NLB-CMV-BL in Example 2.
  • the embryos of 277 stage X eggs were injected with 7 ⁇ l of NLB-CMV-hG-CSF transduction particles (titers were 2.IxIO 7 - 6.9x10 7 ).
  • 86 chicks hatched and were raised to sexual maturity.
  • Egg white from 21 hens was assayed by ELISA for the presence of hG-CSF.
  • SJ-G-CSF probe (agcaagtgaggaagatccagggcg; SEQ ID NO: 38), to detect the transgene.
  • the rooster with the highest levels of the transgene in his sperm samples was bred to nontransgenic SPAFAS (White Leghorn) hens by artificial insemination.
  • XGF498 (therefore having the identical transgene inserted into identical position in the genome) were crossed with nontransgenic hens, to produce female offspring that lay eggs containing poultry derived G-CSF.
  • Milligram quantities of the G-CSF were purified from egg white collected from eggs of QGF910 and DD9027 offspring. Patterns of representative glycosylation structures of the poultry derived G-CSF were determined from the G-CSF obtained as disclosed in Example 20.
  • TPD G-CSF oligosaccharide structures were determined by employing the following analysis techniques as are well known to practitioners of skill in the art.
  • MALDI-TOF-MS Microx assisted laser desorption ionization time-of-flight mass spectrometry
  • ESI MS/MS electrospray ionization tandem mass spectrometry
  • Structure C and Structure D may be precursor forms of Structure E shown below. It has been estimated, the invention not being limited thereto, that structure A is present on the poultry derived glycosylated G-CSF about 20% to about 40% of the time and that structure B is present on the poultry derived glycosylated G-CSF about 5% to about 25% of the time and that structure C is present on the poultry derived glycosylated G- CSF about 10% to about 20% of the time and that structure D is present on the poultry derived glycosylated G-CSF about 5% to about 15% of the time and that structure E is present on the poultry derived glycosylated G-CSF about 1% to about 5% of the time and that structure F is present on the poultry derived glycosylated G-CSF about 10% to about 25% of the time and that structure G is present on the poultry derived glycosylated G-CSF about 20% to about 30% of the time.
  • Monosaccharide analysis was performed by GC/MS (gas chromatography- mass spectrometry) on poultry derived G-CSF that had been spiked with Arabitol (internal standard), hydrolyzed, N-acetylated and TMS derivatized using methods readily available to those skilled in the art.
  • the derivatized sample was compared to a standard mixture of sugars similarly derivatized.
  • Sialic acid analysis of the poultry derived G-CSF was performed after spiking with ketodeoxynonulosonic acid, lyophilized then hydrolyzed, desalted and re-Iyoph ⁇ lized.. Analysis of the sample was performed on a Dionex BioLC system using appropriate standards.
  • Linkage analysis was performed on a permethylated glycan sample of the poultry derived G-CSF that was hydrolyzed in TFA and reduced in sodium borodeuteride.
  • the borate was removed by three additions of methanol :glacial acetic acid (9:1) followed by lyophilization and then acetylation by acetic anhydride. After purification by extraction with chloroform, the sample was examined by GC/MS. A mixture of standards was also run under the same conditions.
  • the linkages were determined as follows: i.
  • the sialic acid linkage is 2-3 to galactose and 2-6 to N-acetylgalactosamine ii.
  • the galactose linkage is 2-3 to N-acetylgalactosamine and 2-4 to N- acetylglucosamine iii.
  • the N-acetylglucosamine linkage is 2-6 to N-acetylgalactosamine
  • TPD G-CSF Poultry Derived G-CSF
  • TPD G-CSF The in vitro biological activity of TPD G-CSF was demonstrated using the NFS- 60 cell proliferation assay. Briefly, NFS-60 cells were maintained in growth media containing GM-CSF. Confluent cultures were harvested, washed and plated at a cell density of 10 5 cells per well with growth media alone. TPD G-CSF and bacterial derived human G-CSF (i.e., Neupogen®) were serial diluted in growth media and added to separate wells in triplicate. Cell proliferation was determined by metabolic reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and was quantified spectrophotometrically.
  • MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
  • the specific activity of the avian derived G- CSF was determined by comparing the EDso of Neupogen® with that of the purified avian derived G-CSF.
  • the specific activity of TPD G-CSF over a 14 day period was determined to be well in excess of that of the bacterial derived G-CSF Neupogen® (non-glycosylated G-CSF). See FIG. 17.
  • pNLB-CMV-Des-Argl 66-EPO pNLB-CMV-IFN described in Example 12 was digested with Hind III and EcoRI in order to replace the hIFN ⁇ 2 coding sequence and signal peptide coding sequence with an EPO coding sequence plus signal peptide (SEQ ID NO: 42) shown below. Because multiple EcoRI and Hind HI sites exist in the vector, RecA-assisted restriction endonuclease (RARE) cleavage method was used to cut the desired sites.
  • RARE restriction endonuclease
  • oligonucleotides were used in the RARE procedure: pnlbEcoRI3805rare (5'-GAC TCC TGG AGC CCG TCA GTA TCG GCG GAA TTC CAG CTG AGC GCC GGT CGC TAC CAT TAC-3') (SEQ ID NO: 43) and pnlbHinD III3172rare (5'-TAA TAC GAC TCA CTA TAG GGA GAC CGG AAG CTT TCA CCA TGG CTT TGA CCT TTG CCT TAC-3') (SEQ ID NO: 44).
  • a linearized vector of 8740 bp was obtained and was gel purified.
  • the EPO insert was prepared by overlap PCR as follows.
  • the first PCR product was produced by amplification of a synthetic EPO sequence cloned into a standard cloning vector with Pfu polymerase and the following primers: 5'pNLB/Epo (5'-GGGGGGAAGCTTTCACCATGGGCGTGCACGAG-S') (SEQ ID NO: 45) and pNLB/3'Epo (5'-TCCCCATACTAGACTTTTTACCTATCGCCGGTC-S ') (SEQ ID NO: 46).
  • the second PCR product was produced by amplification of a region of pNLB-CMV-hIFN alpha-2b with Pfu polymerase and the following primers: 3'Epo/pNLB (5'-ACCGGCGATAGGTAAAAAGTCTAGTATGGG-S ') (SEQ ID NO: 47) and pNLB/SapI (5'-GGGGGGGCTCTTCTCAGCTGGAATTCCGCCGATAC-S ') (SEQ ID NO: 48).
  • the two PCR products were mixed and reamplified with the following primers: 5'pNLB/Epo (5'-
  • the fusion PCR product was digested with Hind III and Eco RI and a 633 bp fragment gel purified.
  • the 8740 bp and 633 bp fragments were Iigated to create pNLB-CMV- EPO.
  • EPO coding sequence is produced which codes for a 165 amino acid form of EPO with the terminal codon (coding for arginine at position 166) removed.
  • Transduction particles were prepared from the pNLB-CMV-Des-Argl 66-EPO essentially as described in Example 2.
  • Egg white from eggs of transgenic chickens which produce EPO in their oviduct was diluted with three volumes of 50 mM sodium acetate, pH 4.6, mixed and then filtered and loaded on to a Sepharose cation exchange column. Following a wash of the column with 50 mM sodium acetate, pH 5.0, containing 100 mM NaCl, the EPO was eluted with the same acetate buffer containing 500 mM NaCl together with 0.05% Tween 20. The EPO eluted from the Sepharose column was loaded on to a Phenyl Sepharose hydrophobic interaction chromatography column.
  • the column was equilibrated with 2 M NaCl, 50 mM Tris-HCl, pH 7.2, 0.05% Tween 20. The same buffer was used to wash the column after loading of the preparation. This is followed by a water wash. EPO was subsequently eluted with 30% IPA. The EPO preparation was then applied to a reversed-phase HPLC column and the EPO eluted with an increasing concentration of ethanol in 0.1% trifluoroacetic acid. The peak of EPO elution occurs at an ethanol concentration of about 53%. Diafiltration was used to concentrate the final EPO preparation and to replace the solvent with 0.1 M sodium phosphate buffer, pH 7.0.
  • oligosaccharide structures were determined for avian derived human EPO by employing the following analysis techniques as are well known to practitioners of ordinary skill in the art.
  • the O-linked oligosaccharides were chemically released from the protein and the N-linked oligosaccharides were enzymatically released from the protein. After release, the O-linked and the N-linked oligosaccharides were permethylated using the NaOH method involving reaction with methyl iodide under anhydrous DMSO and were then extracted into chloroform prior to analysis. The structures were separated using HPLC.
  • MALDl-TOF-MS Microx assisted laser desorption ionization time-of-flight mass spectrometry
  • ESI MS/MS electrospray ionization tandem mass spectrometry
  • N-linked EPO structures are shown below.
  • NAcGal N-Acetyl-GaIactosamine
  • NAcGlu N-Acetyl-Glucosamine
  • SA Sialic Acid
  • Monosaccharide analysis of EPO obtained from a transgenic chicken was performed by GC/MS (gas chromatography-mass spectrometry).
  • the sample was spiked with Arabitol (internal standard), hydrolyzed, N-acetylated and TMS derivat ⁇ zed using methods readily available to those skilled in the art.
  • the derivatized sample was compared to a standard mixture of sugars similarly derivatized.
  • Sialic acid analysis of the EPO was performed after spiking with ketodeoxynonulosonic acid, lyophilizing then hydrolyzing, desalting and re-lyophilizing. Analysis of the sample was performed on a Dionex BioLC system using appropriate standards.
  • Table 6 shows the quantification of monosaccharides detected for the EPO. Trace amounts of contaminating xylose, fucose and glucose were also detected in the monosaccharide analysis. The data in Table 6 supersedes preliminary data generated by HPAEC-PAD analysis.
  • TF-I cell proliferation v assay The in vitro biological activity of the poultry derived human EPO was demonstrated using the TF-I cell proliferation v assay. Two separate samples representing two fractions (SPl column: 130 mM NaCl and 250 mM NaCl) recovered from an initial ion exchange purification step were tested. Each of the two fractions showed essentially the same cell proliferation activity and it was also subsequently shown that the glycosylated erythropoietin contained in the two fractions was essentially the same. Briefly, TF-I cells were maintained in growth media containing GM-CSF (2 ng/ml).
  • Confluent cultures were harvested, washed and plated in wells of a standard 96 well plate (each well 0.32 cm 2 ) at a cell density of 10 4 cells per well in growth media not containing GM-CSF.
  • Avian derived EPO was serial diluted in growth media and added to separate wells in triplicate.
  • Cell proliferation after 5 days was determined by metabolic reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) and was quantified spectrophotometrically.
  • the in vitro activity of the purified EPO is shown in FIG. 22.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Urology & Nephrology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne l'érythropoïétine obtenue à partir d'œufs pondus par des oiseaux transgéniques ayant des motifs de glycosylation liée -N ou liée -O aviaires.
PCT/US2007/021643 2006-11-09 2007-10-10 Érythropoiétine dérivée des oiseaux WO2008057161A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU2007318209A AU2007318209A1 (en) 2006-11-09 2007-10-10 Avian derived erythropoietin
EP07839423A EP2076530A4 (fr) 2006-11-09 2007-10-10 ERYTHROPOïÉTINE DÉRIVÉE DES OISEAUX
CA002668487A CA2668487A1 (fr) 2006-11-09 2007-10-10 Erythropoietine derivee des oiseaux
JP2009536230A JP2010509327A (ja) 2006-11-09 2007-10-10 トリ由来エリスロポエチン

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US85789606P 2006-11-09 2006-11-09
US60/857,896 2006-11-09
US87760106P 2006-12-28 2006-12-28
US60/877,601 2006-12-28
US91850407P 2007-03-16 2007-03-16
US60/918,504 2007-03-16

Publications (1)

Publication Number Publication Date
WO2008057161A1 true WO2008057161A1 (fr) 2008-05-15

Family

ID=39364811

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/021643 WO2008057161A1 (fr) 2006-11-09 2007-10-10 Érythropoiétine dérivée des oiseaux

Country Status (6)

Country Link
EP (1) EP2076530A4 (fr)
JP (1) JP2010509327A (fr)
KR (1) KR20090090328A (fr)
AU (1) AU2007318209A1 (fr)
CA (1) CA2668487A1 (fr)
WO (1) WO2008057161A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2230900A4 (fr) * 2008-01-07 2013-01-09 Synageva Biopharma Corp Glycosylation chez l'oiseau
JP2013505276A (ja) * 2009-09-23 2013-02-14 バイオジェネリックス ゲーエムベーハー 組換えヒトエリスロポエチン（ｅｐｏ）を精製するためのプロセス、このようにして精製されたｅｐｏおよびこれを含む医薬組成物

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW201408695A (zh) * 2012-08-30 2014-03-01 Body Organ Biomedical Corp 重組載體及應用其而產生之轉基因魚卵與生物材料
WO2017169978A1 (fr) * 2016-03-31 2017-10-05 株式会社カネカ Procédé de production d'érythropoïétine féline purifiée
WO2018039163A1 (fr) * 2016-08-23 2018-03-01 Alexion Pharmaceuticals, Inc. Procédé de purification d'une protéine hétérologue à partir d'un blanc d'œuf

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020155998A1 (en) * 1998-06-15 2002-10-24 Genzyme Transgenics Corporation, A Massachusetts Corporation Erythropoietin analog-human serum albumin fusion
US20030126629A1 (en) * 2001-09-18 2003-07-03 Rapp Jeffrey C. Production of a transgenic avian by cytoplasmic injection
US20040019923A1 (en) * 1997-10-16 2004-01-29 Ivarie Robert D. Exogenous proteins expressed in avians and their eggs
US20040019922A1 (en) * 1997-10-16 2004-01-29 Avigenics, Inc. Exogenous proteins expressed in avians and their eggs
US6730822B1 (en) * 1997-10-16 2004-05-04 Avigenics, Inc. Vectors in avian transgenesis

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006112147A1 (fr) * 2005-03-30 2006-10-26 Kaneka Corporation Oiseau transgenique produisant de l’erythropoietine et procede pour l’obtenir

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040019923A1 (en) * 1997-10-16 2004-01-29 Ivarie Robert D. Exogenous proteins expressed in avians and their eggs
US20040019922A1 (en) * 1997-10-16 2004-01-29 Avigenics, Inc. Exogenous proteins expressed in avians and their eggs
US6730822B1 (en) * 1997-10-16 2004-05-04 Avigenics, Inc. Vectors in avian transgenesis
US20060171921A1 (en) * 1997-10-16 2006-08-03 Avigenics, Inc. Glycosylated interferon
US7129390B2 (en) * 1997-10-16 2006-10-31 Avigenics, Inc Poultry Derived Glycosylated Interferon Alpha 2b
US20020155998A1 (en) * 1998-06-15 2002-10-24 Genzyme Transgenics Corporation, A Massachusetts Corporation Erythropoietin analog-human serum albumin fusion
US20030126629A1 (en) * 2001-09-18 2003-07-03 Rapp Jeffrey C. Production of a transgenic avian by cytoplasmic injection

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP2076530A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2230900A4 (fr) * 2008-01-07 2013-01-09 Synageva Biopharma Corp Glycosylation chez l'oiseau
JP2013505276A (ja) * 2009-09-23 2013-02-14 バイオジェネリックス ゲーエムベーハー 組換えヒトエリスロポエチン（ｅｐｏ）を精製するためのプロセス、このようにして精製されたｅｐｏおよびこれを含む医薬組成物

Also Published As

Publication number Publication date
AU2007318209A1 (en) 2008-05-15
EP2076530A4 (fr) 2010-04-07
KR20090090328A (ko) 2009-08-25
JP2010509327A (ja) 2010-03-25
EP2076530A1 (fr) 2009-07-08
CA2668487A1 (fr) 2008-05-15

Similar Documents

Publication Publication Date Title
US7511120B2 (en) Glycosylated G-CSF obtained from a transgenic chicken
US7534929B2 (en) Avians expressing heterologous protein
US7338654B2 (en) Glycosylated interferon alpha obtained from a transgenic chicken
US8563803B2 (en) Method of making protein in an egg of a transgenic chicken
US20140336362A1 (en) Avian Derived Antibodies
US8124732B2 (en) Composition comprising isolated human CTLA4-Fc fusion protein produced in a transgenic chicken
WO2008057161A1 (fr) Érythropoiétine dérivée des oiseaux
US20090074718A1 (en) Avian derived erythropoietin
US7812127B2 (en) Glycosylated human G-CSF
AU2007227723B2 (en) Glycosylated G-CSF
US20090105462A1 (en) Glycosylated erythropoietin
US7803362B2 (en) Glycosylated interferon alpha
CN101595125A (zh) 禽类衍生的红细胞生成素
CN101405299A (zh) 糖基化的g-csf

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200780039130.4

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07839423

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2007839423

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2007318209

Country of ref document: AU

Ref document number: 576148

Country of ref document: NZ

Ref document number: 1355/KOLNP/2009

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2668487

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2009536230

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2007318209

Country of ref document: AU

Date of ref document: 20071010

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020097011831

Country of ref document: KR