WO2008036838A2 - Complexes isolés d'endotoxine et de md-2 modifié à réticulation covalente - Google Patents

Complexes isolés d'endotoxine et de md-2 modifié à réticulation covalente Download PDF

Info

Publication number
WO2008036838A2
WO2008036838A2 PCT/US2007/079071 US2007079071W WO2008036838A2 WO 2008036838 A2 WO2008036838 A2 WO 2008036838A2 US 2007079071 W US2007079071 W US 2007079071W WO 2008036838 A2 WO2008036838 A2 WO 2008036838A2
Authority
WO
WIPO (PCT)
Prior art keywords
endotoxin
complex
los
tlr4
cells
Prior art date
Application number
PCT/US2007/079071
Other languages
English (en)
Other versions
WO2008036838A3 (fr
Inventor
Jerrold P. Weiss
Theresa L. Gioannini
Original Assignee
University Of Iowa Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Iowa Research Foundation filed Critical University Of Iowa Research Foundation
Publication of WO2008036838A2 publication Critical patent/WO2008036838A2/fr
Publication of WO2008036838A3 publication Critical patent/WO2008036838A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/6415—Toxins or lectins, e.g. clostridial toxins or Pseudomonas exotoxins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/6425—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a receptor, e.g. CD4, a cell surface antigen, i.e. not a peptide ligand targeting the antigen, or a cell surface determinant, i.e. a part of the surface of a cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin

Definitions

  • the ability of an organism to withstand bacterial invasion depends upon sensitive and specific molecular systems.
  • the molecules involved in these systems are designed to recognize specific bacterial products and trigger rapid responses to small numbers of invading bacteria.
  • Innate recognition systems include highly conserved "pattern recognition" host molecules that detect and respond to highly conserved and structurally unique microbial molecules.
  • pattern recognition The best-studied example of such an innate system is the machinery engaged in recognition of endotoxins, which are unique surface glycolipids of gram -negative bacteria.
  • TLR4 Toll-like receptor 4
  • Beutler et al., 2003; Means et al., 2000; and Ulevitch et al., 1999 An important feature of TLR4-dependent cell activation by endotoxin is its extraordinary sensitivity, permitting timely host responses to small numbers of invading gram-negative bacteria, essential for efficient host defense (Beutler et al., 2003; Means et al., 2000; and Ulevitch et al., 1999).
  • TLR4 contains a leucine-rich extracellular domain involved in ligand recognition, a transmembrane region, and an intracellular domain responsible for triggering signalling pathways that result in activation of genes of the innate immune defense system (Beutler et al., 2001; and Medzhitov et al., 1998). Maximal potency of TLR4-dependent cell activation by endotoxin requires four different extracellular and cell surface host proteins: lipopolysaccharide (LPS) binding protein (LBP), CD 14, MD- 2 and TLR4 (Beutler et al., 2003; Miyake et al., 2003; and Ulevitch, 2000).
  • LPS lipopolysaccharide
  • LBP lipopolysaccharide
  • CD 14 CD 14
  • MD- 2 and TLR4 Beutler et al., 2003; Miyake et al., 2003; and Ulevitch, 2000.
  • TLR4 requires MD-2 for CD14-dependent cellular response to low concentrations of endotoxin, but neither the precise nature of the ligand that binds to TLR4 nor the role of MD-2 has been fully defined.
  • MD-2 either endogenously expressed or exogenously added, associates with TLR4 on the cell surface (Viriyakosol et al., 2001; Schramm et al., 2001; Visintin et al., 2001; Re et al., 2002; Akashi et al., 2003; Visintin et al., 2003; and Re et al., 2003) and its endogenous expression is needed for optimal surface expression of TLR4.
  • TLR4 responsiveness to endotoxin is disrupted by point mutations of MD-2 (Schramm et al., 2001; Kawasaki et al., 2003; Ohnishi et al., 2001; and Mullen et al., 2003) (e. g., C95Y, Lysl28 and Lysl32) despite surface expression of TLR4/MD-2 complexes.
  • the present invention provides a complex including endotoxin covalently bound to MD-2 by means of a cross-linker molecule.
  • these complexes when devoid of any other host or microbial molecules, are potent and water soluble and do not require additional lipid carrier molecules (e.g., serum albumin) for water solubility.
  • the cross-linker molecule can be tris-succinimidyl aminotriacetate (TSAT); bis(sulfosuccinimidyl) suberate (BS 3 ); disuccinimidyl suberate (DSS); bis(2- [sulfosuccinimidyooxycarbonloxyjethylsulfone) (BOSCOES); bis(2- [succinimidyooxycarbonloxyjethylsulfone) (Sulfo-BOSCOES); ethylene glycol bis- (succinimidylsuccinate) (EGS); ethylene glycol bis-(sulfosuccinimidylsuccinate) (SULFO-EBS); and Dimethyl 3,3'-dithiobis-propionimidate (DTBP).
  • TSAT tris-succinimidyl aminotriacetate
  • BS 3 bis(sulfosuccinimidyl) suberate
  • DSS disuccinimidyl
  • the cross-linker molecule is trivalent (such as TSAT).
  • the cross-linker molecule is bivalent (such as BS 3 , Sulfo-Boscoes, EGS, Sulfo-EBS, or DTBP).
  • bivalent is used to mean that the molecule has a valence of two, or binds together two separate molecules.
  • trivalent is used to mean that the molecule has a valence of three, or binds together three separate molecules, or three parts of a molecule (or two parts of one molecule to one part of another molecule).
  • the complex consists essentially of one cross-linker molecule bound to one molecule of endotoxin and to one molecule of MD-2. In certain embodiments, the complex is soluble in water. In certain embodiments, the complex has a molecular weight of about 25,000.
  • the endotoxin is a wild-type endotoxin.
  • the endotoxin is a gram-negative bacterial endotoxin, such as Neisseria, Escherichia, Pseudomonas, Haemophilus, Salmonella, or Francisella bacterial endotoxin (e.g., endotoxin from Neisseria meningitidis, Escherichia coli, Pseudomonas aeruginosa, Haemophilus influenzae, Salmonella typhimurium, or Francisella tularensis).
  • Neisseria, Escherichia, Pseudomonas, Haemophilus, Salmonella, or Francisella bacterial endotoxin e.g., endotoxin from Neisseria meningitidis, Escherichia coli, Pseudomonas aeruginosa, Haemophilus influenzae, Salmonella typhim
  • the endotoxin is a hepta-acylated endotoxin, a hexa-acylated endotoxin, a penta-acylated endotoxin or a tetra-acylated endotoxin.
  • the endotoxin is under-acylated (e.g., a tetra-acylated endotoxin or a penta-acylated endotoxin).
  • the present invention provides a complex including endotoxin covalently bound to either wild-type or variant MD-2 by means of a cross-linker molecule.
  • the variant MD-2 varies from wild-type MD-2 at one or more of amino acid residues 25, 37, 51, 55, 58, 68, 69, 90, 91, 95, 99, 102, 103, 105, 114, 121, 122, 125, 126, 127, 128, 129, 130, 131, 132, 133, and/or 148.
  • the reference numbering scheme is that used in Kawasaki et al., J. Immun 170:413-20 (2003).
  • the variation may be an amino acid substitution, such as a conserved substitution.
  • the wild-type amino acid may be substituted with an alanine.
  • the variant MD-2 varies as compared to a wild-type MD-2, wherein the modification is an amino acid substitution of one or two of amino acid residues 68, 69, 126, 127, 128, 129, 130, and/or 131.
  • the present invention also provides a method for making the complexes of the invention.
  • the present invention also provides compositions containing the complex including endotoxin covalently bound to MD-2 by means of a cross-linker molecule, which may contain a pharmaceutically acceptable carrier.
  • endotoxin :MD-2 complexes containing wild-type endotoxin produce TLR4-dependent cell stimulation, while complexes containing mutant forms of endotoxin (for example, under-acylated forms of endotoxin) inhibit TLR4-dependent cell stimulation.
  • MD-2 can have inhibitory as well as stimulatory effects on TLR4-dependent cell activation by endotoxin.
  • the complex binds to TLR4.
  • the complex inhibits TLR4-dependent activation of cells.
  • the complex may inhibit TLR4-dependent activation of cells at a concentration of less than about 500 nM of the complex, or any value between 500 nM and 300 pM.
  • the complex may inhibit TLR4-dependent activation of cells at a concentration of less than about 200 nM of the complex, less than 100 nM of the complex, less than 10 nM of the complex, less than 1 nM of the complex, or even less than 300 pM of the complex. In certain embodiments the complex inhibits TLR4- dependent activation of cells when the complex is present at a concentration between about 300 pM-100 nM.
  • the present invention also provides methods of using the complexes of the invention, e.g., methods to inhibit TLR4-dependent activation of cells by endotoxin in vitro or in vivo. Methods using complexes with mutant endotoxin are useful, e.g., to decrease undesirable endotoxin-mediated inflammation.
  • the cells are those that express TLR4 but not MD-2 such as mucosal epithelial cells derived from the gasterointestinal or respiratory tracts.
  • the cell is an airway epithelial cell derived from the trachea or bronchi.
  • the present invention further provides a pharmaceutical composition comprising a complex described hereinabove and a pharmaceutically acceptable carrier.
  • the present invention further provides a complex as described hereinabove for use in medical treatment or diagnosis.
  • the present invention further provides a use of a complex as described hereinabove to prepare a medicament useful for treating a condition associated with endotoxin-mediated cell activation in an animal.
  • Figure 1 depicts the expression and bioactivity of recombinant MD-2-His6 (6x
  • SDS/PAGE immunoblots were performed of control culture medium or medium from HiFive cells infected with recombinant baculovirus encoding wild-type (wt) or C95Y MD-2. MD-2 was detected using anti- (His) 4 (4x His tag disclosed as SEQ ID NO: 18) antibody.
  • HEK/TLR4 cells were incubated in HEPES-buffered HBSS + /0.1% albumin with 14 C-LOS agg (3 ng/ml) with or without LBP (30 ng/ml) and/or 60 ⁇ l of culture medium containing wt MD-2 ("MD-2") (open bars); LOS agg plus LBP and sCD14 (250 ng/ml) with or without wt (closed bars) or C95Y "MD-2” (striped bars), or 14 C-LOS:sCD14 (2 ng LOS/ml) with or without wt or C95Y "MD-2” (filled bars). After overnight incubation, extracellular IL-8 was assayed by ELISA.
  • 14 C-LOS is formed by incubation of 14 C-LOS:sCD14 with wt, but not C95Y, MD-2.
  • dialyzed control insect cell medium (o) or medium containing wt ( ⁇ ) or C95Y (*) MD- 2 was incubated for 30 minutes, 37°C with 14 C-LOS:sCD14 (1:1 vol/vol) in HBSS+/10 mM HEPES and chromatographed on Sephacryl SlOO. Column fractions were analyzed for 14 C-LOS. Identical results were obtained in analytical (5 ng 14 C-LOS per ml + 200 ⁇ l culture medium) or more preparative runs (reagents concentrated 2Ox).
  • Peak fractions of the purified complex (Figure 2B; 10 ng 14 C-LOS) were dialyzed against PBS and incubated with HisBind resin (0.125 ml) for one hour at 25 0 C and processed as described in the Methods for Example 1.
  • Non- adsorbed and adsorbed material eluted with 200 mM imidazole was precipitated with trichloroacetic acid to concentrate sample for SDS-P AGE/immunoblot analysis.
  • absorbed material was eluted with 2% SDS and counted by liquid scintillation spectroscopy.
  • adsorption of 14 C-LOS:sCD14 was tested as a negative control. Overall recovery of 14 C-LOS was greater than 90%. Results shown are the mean or representative of two closely similar experiments.
  • Figure 3 depicts delivery of 3 H-LOS:MD-2 but not 3 H-LOS agg or 3 H-LOS:sCD14 to HEK/TLR4.
  • HEK (D) or HEK/TLR4 ( ⁇ ) cells were incubated with 3 H-LOS (0.75 ng/ml) in the form of LOS agg , LOS:sCD14, or LOS:MD-2. After overnight incubation at 37°C, cells were washed and lysed as described in the Methods for Example 1. The amount Of 3 H-LOS associated with the cells was measured by liquid scintillation spectroscopy. Results are from one experiment in duplicate, representative of three similar experiments.
  • Figure 4 depicts the effects of added MD-2 on activation of HEK/TLR4 by 3 H- LOS:MD-2 and delivery of 3 H-LOS :MD-2 to HEK/TLR4.
  • FIG 4A cells were incubated in HBSS+, 10 mM HEPES/0.1% albumin with 14 C-LOS:MD-2 (0.3 ng/ml) and increasing amounts of wt ( ⁇ ), C95Y (*) MD-2 or negative control medium (D) as well as with wt MD-2 but no 14 C-LOS:MD-2 (o). After overnight incubation, extracellular accumulation of IL-8 was measured.
  • the concentrated and dialyzed conditioned media contained about 10 ng (wt or C95Y) MD-2 ⁇ l.
  • Results are from one experiment in duplicate, which are representative of three similar experiments.
  • purified 14 C-LOS:MD-2 (1 ng/ml) was pre-incubated with (•) or without (o) an amount of MD-2 that completely inhibited activation (40 ⁇ l of 20-fold concentrated and dialyzed conditioned media) for 30 minutes, 37°C in HBSS+/10 mM HEPES before chromatography on Sephacryl S200.
  • Column fractions were analyzed for 14 C-LOS by liquid scintillation spectroscopy.
  • FIG 4C 3 H-LOS:MD-2 (0.75 ng/ml; about 3000 cpm) with or without excess MD-2 as indicated in Figure 4B was incubated with HEK/TLR4 cells overnight at 37°C as described in the Methods for Example 1. After supernatants were removed, cells were washed and then lysed as described in the Methods for Example 1. The amount of radioactivity associated with the cells was determined by liquid scintillation spectroscopy. No radioactivity was associated with parental cells.
  • Figure 5 depicts a possible mechanism of action of MD-2 in endotoxin- dependent activation of TLR4. TLR4 activation may involve either conformational changes in MD- 2 that follow the interaction of MD-2 with endotoxin and TLR4 (A) or transfer of endotoxin from MD-2 to TLR4 (B).
  • Figure 6 depicts endotoxin responsiveness of well-differentiated primary cultures of human airway epithelia.
  • FIG. 6B shows the polarity of epithelial responses to IL- l ⁇ and NTHi LOS. Reagents were applied to the apical, basolateral or both surfaces as indicted in the same concentrations as in Figure 6 A. IL-I ⁇ induced HBD-2 expression from either surface, while NTHi LOS failed to induce responses from either side. Results represent replicate data from two different specimens, (four epithelialcondition) ; *P ⁇ 0.05.
  • Figure 7 depicts results indicating the generation of a functional adenoviral vector expressing human MD-2.
  • a replication incompetent adenoviral vector expressing MD-2 was used.
  • HEK293 cells were transduced with a multiplicity of infection of 50 (MOI 50). Twenty-four hours later, the HEK293 cell culture supernatants were harvested and, in dilutions as indicated, applied to HEK cells with or without TLR4 in the presence of LOS:sCD14 (2 ng LOS/ml). TLR4-dependent cell activation was manifested as extracellular accumulation of IL-8, monitored by ELISA.
  • the x-axis indicates the concentration (dilution) of cell culture supernatant applied. Results demonstrate that the adenoviral vector directs production of MD-2 that is secreted and functional. TLR4- cells showed no significant response to LOS-sCD14 medium containing MD-2.
  • Figure 8 depicts the effects of MD-2 on endotoxin responsiveness in human airway epithelia. Effect of transduction of well-differentiated, polarized human airway epithelia with Ad-MD-2 on cellular responsiveness to NTHi LOS as measured by HBD- 2 mRNA expression ( Figures 8A and 8C) and by NF- ⁇ B-luciferase activity ( Figure 8B). In the latter, cells were pretreated with an adenoviral vector expressing MD-2 48 hours before stimulation with LOS as described in the Materials of Example 2 below. Cells were treated with N.
  • meningitidis LOS aggregates prepared as described in the Materials of Example 2 below
  • LBP and sCD14 Figure 8A and 8B
  • purified LOS:sCD14 Figure 8C
  • results represent means ⁇ SE for four different human specimens ; *P ⁇ 0.05.
  • Figure 8D shows the effect of soluble, recombinant MD-2 (rMD-2) on cellular responsiveness to LOS:sCD14.
  • Well-differentiated human airway epithelia were treated with N. meningitidis LOS:sCD14 (5 ng LOS/ml), with or without the addition of cell culture supernatants containing rMD-2 as indicated on the x-axis. Twenty-four hours after endotoxin treatment, HBD-2 expression was quantified by real time PCR. Results shown represent findings from four different human airway specimens. *P ⁇ 0.05.
  • Figure 9 shows the responsiveness of airway epithelia to purified LOS:MD-2 complex.
  • Hatched bar represents results from cells pretreated with Ad-MD-2 twenty-four hours before application of LOS:MD-2 complex.
  • Each bar represents means ⁇ SE for results from four different human epithelial specimens; *P ⁇ 0.05 compared with LOS:CD14 condition.
  • Figure 1OA shows that MD-2 mR ⁇ A expression in human airway epithelia is induced by several stimuli.
  • MD-2 mR ⁇ A level form Mac is shown.
  • Figure 1OB shows the effect of pretreatment of airway epithelia with heat-killed ⁇ THi on LOS responsiveness.
  • Epithelia were exposed to ⁇ THi for 24 hours as described in Figure 1OA above, and were then treated with apically applied LOS:CD14 complex (hatched bar). Control cells were treated with LOS:CD14 alone (open bar) or ⁇ THi alone (filled bar). Twenty-four hours later, HBD-2 expression was assayed using real-time PCR. Results shown are mean ⁇ SE for epithelia from five different specimens.
  • Figures 1 IA-I ID shows proposed mechanisms by which expression of MD-2 in the airway can regulate the responsiveness of the airway epithelial cells to endotoxin.
  • Endogenous and exogenous expression of MD-2 refers to airway epithelial cells.
  • E(agg ⁇ memb), purified endotoxin (LPS or LOS) aggregates or gram-negative bacterial outer membrane to which LBP first binds.
  • LPS purified endotoxin
  • LOS purified endotoxin
  • Complexes of endotoxin (E) with sCD14 and soluble MD-2 (sMD-2) are, by contrast, monomeric.
  • Figure 12 depicts SephacrylTM S200 chromatography of u C-msbB LOS aggregates (1 ⁇ g) pre-incubated with 100 ng LBP and 24 ⁇ g sCD14 for 15 minutes at 37°C.
  • the arrow indicates elution of wt LOS-sCD14 complex.
  • Figure 13 depicts sephacryl S200 chromatography of u C-msbB LOS-sCD14 (160 ng) pre-incubated with ⁇ 5 ⁇ g MD-2 for 15 minutes at 37°C.
  • the arrow indicates elution of wt LOS-MD-2 complex.
  • Figure 14 depicts cell activation as measured by accumulation of extracellular IL-8, monitored by ELISA.
  • HEK/TLR4 cells were incubated overnight at 37°C with increasing amounts of wt or mutant (msbB) LOS-MD-2, as indicated.
  • Figure 15 depicts cell activation as measured by accumulation of extracellular IL-8, monitored by ELISA.
  • IL-8 monitored by ELISA.
  • HEK/TLR4 cells were incubated overnight at 37°C with 0.1 ng/ml of wt LOS-MD-2 increasing amounts of mutant msbB LOS-MD-2, as indicated.
  • Mutant MD-2 forms LOS:MD-2 complex ( Figure 16A) that acts as weak agonist ( Figure 16B) and inhibits activation of HEK/TLR4 cells by wt LOS:MD-2 ( Figure 16C).
  • FIG. 17A shows dose-dependent activation of HEK/TLR4 cells by wt and mutant LOS:MD-2 complexes. Purified LOS:MD-2 complexes were incubated with HEK293/TLR4 cells in HBSS+, HEPES, 0.1% human serum albumin for 16 h. Extracellular IL-8 recovered in harvested culture medium was measured by ELISA.
  • Figure 17B shows inhibition of wt LOS:MD-2 activity by LOS:MD-2 (F 126A).
  • HEK293/TLR4 cells were incubated for 16 h with increasing amounts of LOS:MD-2 (F126A) ⁇ 20 pM wt LOS:MD-2 before assay of extracellular IL-8 by ELISA. Results shown are representative of 3 closely similar experiments.
  • Figure 18 Molecular model of MD-2 molecule (Gangloff et al. 2004), and effects of site-specific mutations of murine or human MD-2 (Kawasaki et al. 2003).
  • Figures 20A-20E Chemical cross (X)-linking of [ 14 C]LOS:MD-2.
  • Molecular models of endotoxin (Fig. 20A) and MD-2 (Fig. 20B), highlighting sites that contain reactive amino groups, -NH 2 and ethanolamine (EtN) in the lipid A backbone and inner core sugar backbone of endotoxin (LOS) and lysines (K122, K125, K128, Kl 30, Kl 32) in MD-2, if fatty acyl chains of lipid A are buried in the predicted hydrophobic cavity of MD-2.
  • FIGs 21A-21C Flow chart of purification of cross (X)-linked [ 14 C]LOSiMD- 2 (Fig. 21A). SephacrylTM S200 chromatography of native and cross-linked reaction mixtures of [ 14 C]LOS:MD-2 (Fig. 21B).
  • FIG. 21C shows SDS-PAGE/image analysis of [ 14 C]LOS recovered in fraction 53 (void volume) and fraction 75 (M r -25,000). Results shown are representative of two closely similar experiments.
  • Figures 22 A and 22B Comparison of dose-dependent effects of native and cross-linked [ 14 C]LOS:MD-2 on HEK/TLR4 cells. Assay of TLR4 agonist activity: cells were incubated for 20 h at 37 0 C with increasing concentrations of native or cross- linked endotoxin (E):MD-2 (wild-type (wt; hexaacylated) meningococcal LOS :wt MD- 2) (Fig. 22A).
  • FIGS. 24A-24C Saturable, high affinity binding of [ 3 H]LOS:MD-2 to TLRE CD ⁇ Competition by native and cross-linked LOS:MD-2.
  • Concentrated conditioned medium containing TLR4 E C D (TLR4ECD) CHI was diluted in PBS to -75 pM TLR4 ECD and incubated at 37 0 C for 30 min with increasing concentrations of [ 3 H]LOS:MD-2. Formation of the M r -190,000 complex was monitored by SephacrylTM S200 chromatography in PBS, pH 7.4. Elution profiles from selected doses of [ 3 H]LOS:MD-2 are shown in Fig.
  • endotoxin bound to MD-2 rather than endotoxin itself, is a ligand for triggering TLR4 receptor activation or inhibition.
  • the present invention provides a complex including endotoxin covalently bound to MD-2 by means of a cross-linker molecule.
  • these complexes when devoid of any other host or microbial molecules, are potent and water soluble and do not require additional lipid carrier molecules (e.g., serum albumin) for water solubility.
  • the MD-2 and/or E:MD-2 complex may be purified.
  • an "isolated” or “purified” molecule or complex is a molecule or complex that exists apart from its native environment and is therefore not a product of nature.
  • An isolated molecule or complex may exist in a purified form or may exist in a non-native environment such as, for example, a transgenic host cell.
  • an "isolated" or “purified” protein, or biologically active portion thereof is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • MD-2 Complexes and Compositions Disclosed herein is the formation and isolation of a novel, bioactive, monomeric endotoxin:MD-2 complex.
  • the complex can be generated with about physiologic (pM) concentrations of endotoxin and soluble MD-2.
  • This complex at pg/ml concentrations, activates cells in a TLR4-dependent fashion without the inclusion of other host or bacterial factors.
  • pM physiologic
  • endotoxin molecules in purified aggregates (or membranes) containing thousands to millions of endotoxin molecules/particle are extracted and transferred to first CD 14 and then MD-2 provides a unique physico-chemical mechanism to attain the potency that is needed for response.
  • the ability to generate a homogeneous protein-endotoxin complex that, alone, triggers TLR4-dependent cell activation, interacts with host cells in an almost exclusively TLR4- dependent fashion and that can be metabolically labeled to sufficient specific radioactivity to monitor interactions at pM concentrations makes it possible for the first time to measure host cell-endotoxin interactions that are directly relevant to TLR4- dependent cell activation.
  • Many endotoxin-responsive cells contain membrane-associated CD 14 and MD-2
  • TLR4 associated with TLR4 (Means et al., 2000; Miyake et al., 2003; Takeda et al., 2003).
  • resting airway epithelial cells like HEK/TLR4 cells, express TLR4 without MD-2 and respond to endotoxin only if LBP, sCD14 and soluble MD-2 are added.
  • Each of these proteins are likely to be present in biological fluids at the concentrations needed to drive endotoxin-dependent TLR4 activation, especially in view of the very low extracellular MD-2 concentrations demonstrated in this study to be sufficient.
  • reaction pathway defined is relevant at the cell surface when TLR4/MD-2 complexes are endogenously present and also when only TLR4 is present at the cell surface and MD-2, which has been produced and secreted by neighboring cells, is present in the extracellular medium.
  • FIG. 5 depicts mechanisms of action of MD-2 in endotoxin-dependent activation of TLR4.
  • TLR4 activation may involve (A) conformational changes in MD-2 that follow the interaction of MD-2 with endotoxin and TLR4 and/or (B) transfer of endotoxin from MD-2 to TLR4.
  • the association of endotoxin with MD-2 forms the complexes of the invention.
  • the endotoxin molecules and the MD-2 molecules may be wild-type (wt) molecules, or they may be mutant molecules.
  • the complex may have a molecular weight of about 25,000.
  • the complex may consist essentially of one molecule of endotoxin bound to one molecule of MD-2.
  • the complex may be soluble in water.
  • the complexes may be soluble in water to a greater extent than is an endotoxin molecule not bound to MD-2.
  • the complex may bind to TLR4 and may produce TLR4-dependent activation of cells, e.g., at a concentration of about 1 nM or less of the complex the complex may produce a half maximal activation of cells, e.g., at a concentration of about 30 pM or less of the complex the complex may produce a half maximal activation of cells.
  • the present invention also provides a composition including a complex of the invention, optionally including a pharmaceutically acceptable carrier.
  • the composition can be used, e.g., to promote innate immune responses and as an immunological adjuvants.
  • the endotoxin molecules are wildtype (wt) endotoxin molecules, e.g., endotoxin derived from gram-negative bacteria.
  • the endotoxin may be a wild-type endotoxin derived from any of a broad array of gram- negative bacterial species.
  • the list of possible gram-negative bacteria includes many species of clinical importance such as Neisseria meningitidis, Escherichia coli, Pseudomonas aeruginosa, Haemophilus influenzae, Salmonella typhimurium, and Francisella tularensis.
  • the endotoxin may be a wild-type endotoxin, i.e., the form of endotoxin naturally found in the wildtype gram-negative bacteria.
  • the endotoxin may be a variant endotoxin, i.e., the endotoxin varies from the wildtype form in some way.
  • the endotoxin molecules are mutant endotoxin molecules.
  • the mutant endotoxin molecules are endotoxin molecules that are capable of binding to MD-2 and these complexes to TLR4 without producing the same level of TLR4-dependent cell activation (i.e., the mutant endotoxin complexes produce less activation) as produced by TLR4 dependent cell activation by complexes containing wild-type endotoxin molecules.
  • These mutant endotoxin molecules may be under-acylated (i.e., the endotoxin lacks at least one acyl group as compared to the wildtype form of the molecule).
  • under-acylated endotoxins examples include PCT Publication No. WO 97/19688.
  • These under-acylated endotoxin molecules may be produced via enzymatic release of non-hydroxylated fatty acids from endotoxin, or they may be produced using bacteria having genes disrupted that encode an acyltransferase (e.g., htrB, msbB) needed for biosynthetic incorporation of non-hydroxylated fatty acids into endotoxin.
  • the complex containing the under-acylated endotoxin may be capable of producing less TLR4-dependent activation of cells as compared to a complex including an endotoxin that is hexa-acylated.
  • the endotoxin molecules may be hepta-acylated, hexa-acylated, penta-acylated or tetra-acylated, or a combination thereof.
  • Cross-linking Molecules The endotoxin and MD-2 molecules are covalently linked using a chemical cross-linking agent. Many different cross-linking agents can be used. In certain embodiments the cross-linking agent is about 400-1000 daltons or about 3-12 angstroms in length.
  • the cross-linkers useful in the present invention must be at least bivalent so that they can covalently join two molecules, the endotoxin molecule to the MD-2 molecule.
  • the cross-linker can be tris-succinimidyl aminotriacetate (TSAT); bis(sulfosuccinimidyl) suberate (BS 3 ); disuccinimidyl suberate (DSS); bis (2-[sulfosuccinimidyooxycarbonloxy] ethylsulfone) (BOSCOES); bis(2- [succinimidyooxycarbonloxy]ethylsulfone) (Sulfo-BOSCOES); ethylene glycol bis- (succinimidylsuccinate) (EGS); ethylene glycol bis-(sulfosuccinimidylsuccinate) (Sulfo- EBS); or Dimethyl 3,3'-dithiobis-propionimidate (DTBP).
  • TSAT tris-succinimidyl aminotriacetate
  • BS 3 bis(sulfosuccinimidyl) suberate
  • DSS disuccinimid
  • the cross-liner is trivalent (such as TSAT).
  • the cross-linker is bivalent such as BS 3 , Sulfo-Boscoes, EGS, Sulfo-EBS, or DTBP.
  • a single molecule of endotoxin is covalently bound to a single MD-2 molecule by means of a single cross-linker molecule.
  • the single cross-linker molecule can be, for example, bivalent or trivalent.
  • the MD-2 molecule may also be a wild-type MD-2 or a variant MD-2 molecule.
  • the MD-2 may be a recombinant MD-2.
  • the MD-2 proteins include variants or biologically active fragments of the protein.
  • a "variant" of the protein is a protein that is not completely identical to a native protein.
  • a variant protein can be obtained by altering the amino acid sequence by insertion, deletion or substitution of one or more amino acid.
  • the amino acid sequence of the protein is modified, for example by substitution, to create a polypeptide having substantially the same or improved qualities as compared to the native polypeptide.
  • the substitution may be a conserved substitution.
  • a "conserved substitution” is a substitution of an amino acid with another amino acid having a similar side chain.
  • a conserved substitution would be a substitution with an amino acid that makes the smallest change possible in the charge of the amino acid or size of the side chain of the amino acid (alternatively, in the size, charge or kind of chemical group within the side chain) such that the overall polypeptide retains its spatial conformation but has altered biological activity.
  • common conserved changes might be Asp to GIu, Asn or GIn; His to Lys or Arg or Phe; Asn to GIn, Asp or GIu and Ser to Cys, Thr or GIy.
  • Alanine is commonly used to substitute for other amino acids in mutagenesis studies.
  • the 20 essential amino acids can be grouped as follows: alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan and methionine having nonpolar side chains; glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine having uncharged polar side chains; aspartate and glutamate having acidic side chains; and lysine, arginine, and histidine having basic side chains (Stryer (1981) ; Lehninger (1975)). It is known that variant polypeptides can be obtained based on substituting certain amino acids for other amino acids in the polypeptide structure in order to modify or improve biological activity.
  • amino acid sequence of the variant MD-2 protein corresponds essentially to the native protein amino acid sequence.
  • amino acid sequence corresponds essentially to refers to a polypeptide sequence that will elicit a biological response substantially the same as the response generated by native protein.
  • Such a response may be at least 60% of the level generated by native protein, and may be any integer between 60% to 200% (e.g., 61%, 62%, 63%, ... 198%, 199% or 200%).
  • the level is at least 80%, 85%, 90% or 95% of the level generated by wildtype (native) protein.
  • variants of the wildtype endotoxin will elicit a biological response (i.e., TLR4- dependent cell activation) substantially the same as the response generated by the native endotoxin.
  • a variant of the invention may include amino acid residues not present in the corresponding native protein, or may include deletions relative to the corresponding native protein.
  • a variant may also be a truncated fragment as compared to the corresponding native protein, i.e., only a portion of a full-length protein.
  • Protein variants also include peptides having at least one D-amino acid.
  • the MD-2 of the present invention may be expressed from isolated nucleic acid (DNA or RNA) sequences encoding the protein.
  • Amino acid changes from the native to the variant protein may be achieved by changing the codons of the corresponding nucleic acid sequence.
  • Recombinant is defined as a peptide or nucleic acid produced by the processes of genetic engineering. It should be noted that it is well- known in the art that, due to the redundancy in the genetic code, individual nucleotides can be readily exchanged in a codon, and still result in an identical amino acid sequence.
  • the starting material (such as an MD-2 gene) used to make the complexes of the present invention may be substantially identical to wild-type genes, or may be variants of the wild-type gene. Further, the polypeptide encoded by the starting material may be substantially identical to that encoded by the wild-type gene, or may be a variant of the wild-type gene.
  • reference sequence is a defined sequence used as a basis for sequence comparison.
  • a reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full length cDNA or gene sequence, or the complete cDNA or gene sequence.
  • comparison window makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) compared to the reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences.
  • the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30,40, 50,100, or longer.
  • a gap penalty is typically introduced and is subtracted from the number of matches.
  • the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm.
  • Preferred, non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller (1988); the local homology algorithm of Smith et al. (1981) ; the homology alignment algorithm of Needleman and Wunsch (1970); the search-for-similarity-method of Pearson and
  • HSPs high scoring sequence pairs
  • a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.
  • the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences.
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P (N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P (N) the smallest sum probability
  • a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, less than about 0.01, or even less than about 0.001.
  • Gapped BLAST in
  • BLAST 2.0 can be utilized as described in Altschul et al. (1997).
  • PSI- BLAST in BLAST 2.0
  • PSI-BLAST can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al., supra.
  • the default parameters of the respective programs e.g., BLASTN for nucleotide sequences, BLASTX for proteins
  • the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. Alignment may also be performed manually by inspection.
  • comparison of nucleotide sequences for determination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default parameters or any equivalent program.
  • equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.
  • sequence identity or “identity” in the context of two nucleic acid or polypeptide sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection.
  • percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule.
  • sequences differ in conservative substitutions the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.
  • Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity.” Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).
  • percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
  • polynucleotide sequences means that a polynucleotide includes a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, or 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters.
  • nucleotide sequences are substantially identical if two molecules hybridize to each other under stringent conditions (see below).
  • stringent conditions are selected to be about 5 0 C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
  • T m thermal melting point
  • stringent conditions encompass temperatures in the range of about 1°C to about 20 0 C, depending upon the desired degree of stringency as otherwise qualified herein.
  • Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
  • One indication that two nucleic acid sequences are substantially identical is when the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.
  • substantially identical in the context of a peptide indicates that a peptide includes a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, or 94%, or even 95%, 96%, 97%, 98% or 99%, sequence identity to the reference sequence over a specified comparison window.
  • Optimal alignment may be conducted using the homology alignment algorithm of Needleman and Wunsch (1970).
  • a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution.
  • sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e. g., total cellular) DNA or RNA.
  • Bod(s) substantially refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
  • T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution.
  • T m can be approximated from the equation of Meinkoth and Wahl ( 1984); T m 81.5 0 C + 16.6
  • T m is reduced by about I 0 C for each 1 % of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10 0 C.
  • stringent conditions are selected to be about 5 0 C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
  • severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the thermal melting point (T m )
  • moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C lower than the thermal melting point (T m )
  • low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point (T m ).
  • An example of highly stringent wash conditions is 0.15 M NaCl at 72°C for about 15 minutes.
  • An example of stringent wash conditions is a 0.2X SSC wash at 65 0 C for 15 minutes (see Sambrook et al. (2001) for a description of SSC buffer).
  • a high stringency wash is preceded by a low stringency wash to remove background probe signal.
  • An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides is IX SSC at 45°C for 15 minutes.
  • An example low stringency wash for a duplex of, e. g., more than 100 nucleotides is 4-6X SSC at 40°C for 15 minutes.
  • stringent conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8. 3, and the temperature is typically at least about 30 0 C and at least about 6O 0 C for long probes (e.g., >50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • destabilizing agents such as formamide.
  • a signal to noise ratio of 2X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.
  • Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
  • Very stringent conditions are selected to be equal to the Tm for a particular probe.
  • An example of stringent conditions for hybridization of complementary nucleic acids that have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37 0 C, and a wash in 0.5X to IX SSC at 55 to 60 0 C.
  • TLR4-dependent cell activation refers to the cascade of events produced when
  • TLR4 is activated, e.g., by endotoxin, to produce responses, e. g., pro-inflammatory responses.
  • the art worker can measure TLR4-dependent cell activation, e.g., by assaying the level of IL-8 produced by the cells.
  • the present invention also provides a method for modulating TLR4-mediated cell activation by endotoxin, including administering to the cell MD-2. Because the complexes are both potent and water soluble, they are useful in the treatment of conditions associated with TLR4-dependent cell activation.
  • the MD-2 can be administered prior to exposure of the cell to endotoxin.
  • the MD-2 can be administered while the cell is exposed to endotoxin.
  • administration of a stoichiometric excess of MD-2 relative to TLR4 inhibits the endotoxin-mediated cell activation.
  • the MD-2 is administered to achieve a concentration of about 10-100 ng/ml.
  • administration of MD-2 to cells increases endotoxin-mediated cell activation.
  • cells e.g., cells having a constitutive Iy low level of MD-2 expression
  • endotoxin-mediated cell activation increases endotoxin-mediated cell activation.
  • These cells may be, for example, airway epithelial cells or pulmonary macrophages.
  • the present invention also provides methods for treating conditions associated with endotoxin-mediated cell activation.
  • the conditions include sepsis, trauma, liver disease, inflammatory bowel disease, cystic fibrosis, asthma, complications in renal dialysis, autoimmune diseases, cancer chemotherapy sequelae, and intracellular gram- negative bacterial infections, e.g., infection caused by Francisella tularensis.
  • the conditions can be treated by administration of a complex of the invention.
  • Treatment, as used herein, includes both prophylactic treatments and therapeutic treatments.
  • Endotoxin Responsiveness of Human Airway Epithelia The surfaces of the conducting airways and alveoli of the lung are a large interface between the host and the environment.
  • Inducible antimicrobial peptides including the cationic ⁇ -defensins, represent an important component of the innate immune system (Zasloff, 2002; Schutte et al., 2002; and Ganz, 2002).
  • the expression of four ⁇ -defensins has been reported in pulmonary epithelia (McCray et al., 1997; Schroder et al., 1999; BaIs et al., 1998; Jia et al., 2001; Harder et al., 2001; and Garcia et al., 2001), and a recent genome-wide search uncovered evidence of a much larger family of ⁇ -defensin genes encoded in five chromosomal clusters (Schutte et al., 2002).
  • TLR Toll-like receptor
  • HBD-2 Human ⁇ -defensins-2
  • HBD-2 is an inducible cationic antimicrobial peptide expressed at many muscosal surfaces, including the skin, cornea, gut, gingiva and airway epithelium (BaIs et al., 1998; Harder et al., 1997; Mathews et al., 1999; O'Neil et al., 1999 ; Liu et al., 1998; and McNamara et al., 1999).
  • HBD-2 mRNA is expressed at low levels in resting cells but is markedly induced by pro-inflammatory stimuli including IL-l ⁇ , TNF- ⁇ , and Pseudomonas aeruginosa (Singh et al., 1998; and Harder et al., 2000). Furthermore, the 5' flanking sequence of the HBD-2 gene contains several cis-acting elements that may mediate transcription in response to inflammatory stimuli, including NF- ⁇ B, IFN-gamma, AP-I, and NF-IL-6 response elements (Liu et al., 1998 ; Harder et al., 2000; and Tsutsumi-Ishii et al., 2003).
  • Sensitive cellular response to many endotoxins requires the concerted action of at least four host extracellular and cellular proteins: LPS binding protein (LBP), CD 14, MD-2 and TLR-4.
  • LBP LPS binding protein
  • CD 14 CD 14
  • MD-2 MD-2
  • TLR-4 TLR-4
  • inducible antimicrobial peptides such as human defensin- ⁇ (HBD-2) by epithelia is a component of the innate pulmonary defense.
  • TLR4 In well-differentiated primary cultures of human airway epithelia, TLR4 but little or no MD-2 is expressed, and these cells are relatively unresponsive to added endotoxin, even in the presence of LBP and CD14.
  • hypo-responsiveness to endotoxin is a common characteristic of epithelial cells lining mucosal surfaces that are repeatedly exposed to gram-negative bacteria or cell- free (sterile) forms of endotoxin.
  • the molecular basis of endotoxin hypo-responsiveness is unknown.
  • hypo-responsiveness likely represents the functional deficiency of one or more elements of pathway(s) leading to and resulting from TLR4 activation.
  • TLR4 is a membrane protein containing repeats of a leucine rich motif in the extracellular portion of the protein and a cytoplasmic domain homologous to the intracellular domain of the human IL-I receptor (Medzhitov et al., 1997).
  • the IL-I responsiveness of airway epithelia indicates that the overlapping intracellular signaling pathways for activated TLR and IL-I receptors (Hoffmann et al., 1999; Janeway et al., 2002; and Beutler et al., 2003) are present and functionally intact in human airway epithelia, including those important in NF- ⁇ B-regulated HBD-2 expression.
  • TLR4 Even though airway epithelia express TLR4, the cells responded poorly to LOS:sCD14. Therefore it is likely that there is a defect in TLR4 -dependent recognition and/or response to endotoxin.
  • MD-2 also termed lymphocyte antigen 96 (LY96)
  • LY96 lymphocyte antigen 96
  • TLRs 1-6 and CD 14 were expressed in differentiated human airway epithelia. Although it was reported that P. aeruginosa LPS activated CD14-dependent NF- ⁇ B signaling, the increase in HBD-2 mRNA that was observed in response to P. aeruginosa LPS was no greater ( ⁇ 3-fold) than what the present inventors found with added LOS in the absence of MD-2 complementation; i.e., very modest when contrasted to the induction of HBD-2 expression caused by IL-I (3 or by endotoxin in the presence of MD-2.
  • TLR4 alone has no apparent ability to engage the endotoxin:(s) CD14 complex.
  • the ability of soluble, extracellular MD-2 plus endotoxin :sCD 14 and preformed endotoxin:MD-2 complex to activate resting human airway epithelia implies that sufficient TLR4 is produced by these cells to respond sensitively to endotoxin when endotoxin is presented as a complex with MD-2. No mechanism for TLR-independent interaction of endotoxin: MD-2 complex has been described.
  • results presented herein indicate that MD-2 plays a direct role in endotoxin recognition by TLR4. Endotoxin is transferred from an endotoxin:(s)CD14 complex to MD-2 to form an endotoxin:MD-2 complex that appears to be the ligand for endotoxin- dependent TLR4 activation. TLR4 alone has no apparent ability to productively engage the endotoxin:(s)CD14 complex. In addition, endogenous expression of MD-2 can increase surface expression of TLR4, as a TLR4/MD-2 complex, indicating a chaperone- like function for MD-2 as well.
  • MD-2 expression is a key determinant of airway epithelial responses to endotoxin.
  • low MD-2 expression in airway epithelia renders cells poorly responsive to endotoxin, whereas up-regulation of MD-2 alone can greatly enhance cellular responses to endotoxin.
  • a variety of stimuli can induce MD-2 mRNA expression in airway epithelia, perhaps by more than one receptor-mediated pathway.
  • MD-2 can be secreted by epithelia or mononuclear cells and the application of secreted MD-2 enhances TLR4 signaling in MD- 2 deficient cells.
  • cytokines e.g., cytokines, bacterial products
  • cytokine signals including TNF- ⁇ and interferon- (Abreu et al., 2001; and Visintin et al., 2001).
  • Stimulated pulmonary macrophages might also secrete sufficient MD-2 to enhance TLR4 signaling in epithelia. In either case, production of MD-2 by epithelia or exogenous provision of MD-2 from neighboring cells would complement the airway cells for enhanced TLR4 signaling in response to endotoxin.
  • TLR4-dependent cell activation by endotoxin requires simultaneous interaction of MD-2 with endotoxin and TLR4 ( Figure 11)
  • excessive production of MD-2 could blunt cellular responsiveness to endotoxin by promoting conversion of extracellular endotoxin:sCD14 complex to endotoxin:MD-2 while presaturating TLR4 with MD-2, leaving no cellular targets (i.e., free TLR4) for the extracellular endotoxin:MD-2 complex.
  • the regulation of MD-2 expression in the airways e.g., airway epithelia and/or pulmonary macrophages
  • One advantage of such a hierarchy of responses is that it would help to minimize the frequency of epithelial-induced inflammatory signals from endotoxin.
  • Ambient air contains bacteria and endotoxin (Mueller-Anneling et al., 2004) and the aerosolized concentrations of endotoxin can increase dramatically in some agricultural and industrial environments from ⁇ 10 EU/m 3 to >l,000 EU/m 3 (Douwes et al., 2003).
  • the low expression of MD-2 in epithelia can serve to dampen endotoxin responsiveness to common environmental exposures and thereby avoid unwanted states of chronic inflammation in the face of frequent encounters with environmental endotoxin and other bacterial cell wall components.
  • MD-2 expression can be important to enhance host defense responses to invading gram-negative bacteria.
  • enhanced expression of MD-2 could lead to exaggerated endotoxin responsiveness with pathologic consequences.
  • Complexes containing wild-type endotoxin produce TLR4-dependent cell stimulation, while complexes containing mutant forms of endotoxin inhibit TLR4- dependent cell stimulation.
  • Methods of using the complexes e.g., methods to increase or inhibit TLR4-dependent activation of cells by endotoxin in vitro or in vivo are provided.
  • Methods using complexes with mutant endotoxin are useful, e.g., to decrease undesirable endotoxin-mediated inflammation.
  • Methods using complexes with wild- type endotoxin are useful, e.g., to promote innate immune responses and to serve as an immunological adjuvant.
  • Complexes of the invention, or MD-2 alone, including their salts, can be administered to a patient.
  • Administration in accordance with the present invention may be in a single dose, in multiple doses, and/or in a continuous or intermittent manner, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners.
  • the administration may be essentially continuous over a preselected period of time or may be in a series of spaced doses.
  • the amount administered will vary depending on various factors including, but not limited to, the condition to be treated and the weight, physical condition, health, and age of the patient. A clinician employing animal models or other test systems that are available in the art can determine such factors.
  • the complexes are produced as described herein or otherwise obtained and purified as necessary or desired.
  • One or more suitable unit dosage forms including the complex can be administered by a variety of routes including topical, oral, parenteral (including subcutaneous, intravenous, intramuscular and intraperitoneal), rectal, dermal, transdermal, intrathoracic, intrapulmonary and intranasal (respiratory) routes.
  • routes including topical, oral, parenteral (including subcutaneous, intravenous, intramuscular and intraperitoneal), rectal, dermal, transdermal, intrathoracic, intrapulmonary and intranasal (respiratory) routes.
  • the formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any of the methods known to the pharmaceutical arts. Such methods include the step of mixing the complex with liquid carriers, solid matrices, semi-solid carriers, finely divided solid carriers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system.
  • pharmaceutically acceptable it is meant a carrier, diluent, excipient, and/or salt that is compatible with the other ingredients of the formulation, and not deleterious or unsuitably harmful to the recipient thereof.
  • the therapeutic compounds may also be formulated for sustained release, for example, using microencapsulation (see WO 94/07529, and U. S. Patent No. 4,962, 091).
  • the complex may be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, and small volume infusion containers, or in multi- dose containers. Preservatives can be added to help maintain the shelve life of the dosage form.
  • the complex and other ingredients may form suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the complex and other ingredients may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use.
  • formulations can contain pharmaceutically acceptable carriers and vehicles that are available in the art. It is possible, for example, to prepare solutions using one or more organic solvent(s) that is/are acceptable from the physiological standpoint, chosen, in addition to water, from solvents such as acetone, ethanol, isopropyl alcohol, glycol ethers such as the products sold under the name "Dowanol,” polyglycols and polyethylene glycols, C 1 -C 4 alkyl esters of short-chain acids, ethyl or isopropyl lactate, fatty acid triglycerides such as the products marketed under the name "Miglyol,” isopropyl myristate, animal, mineral and vegetable oils and polysiloxanes.
  • solvents such as acetone, ethanol, isopropyl alcohol, glycol ethers such as the products sold under the name "Dowanol,” polyglycols and polyethylene glycols, C 1 -C 4 alkyl esters of short-chain acids, e
  • antioxidants such as antioxidants, surfactants, preservatives, film-forming, keratolytic or comedolytic agents, perfumes, flavorings and colorings.
  • Antioxidants such as t-butylhydroquinone, butylated hydroxyanisole, butylated hydroxytoluene and a-tocopherol and its derivatives can be added.
  • the pharmaceutical formulations of the present invention may include, as optional ingredients, pharmaceutically acceptable carriers, diluents, solubilizing or emulsifying agents, and salts of the type that are available in the art.
  • pharmaceutically acceptable carriers such as physiologically buffered saline solutions and water.
  • physiologically acceptable buffered saline solutions such as phosphate buffered saline solutions at a pH of about 7.0-8. 0.
  • the complex can also be administered via the respiratory tract.
  • the present invention also provides aerosol pharmaceutical formulations and dosage forms for use in the methods of the invention.
  • dosage forms include an amount of complex effective to treat or prevent the clinical symptoms of a specific condition. Any attenuation, for example a statistically significant attenuation, of one or more symptoms of a condition that has been treated pursuant to the methods of the present invention is considered to be a treatment of such condition and is within the scope of the invention.
  • the composition may take the form of a dry powder, for example, a powder mix of the complex and a suitable powder base such as lactose or starch.
  • the powder composition may be presented in unit dosage form in, for example, capsules or cartridges, or, e.g., gelatin or blister packs from which the powder may be administered with the aid of an inhalator, insufflator, or a metered-dose inhaler (see, for example, the pressurized metered dose inhaler (MDI) and the dry powder inhaler disclosed in Newman (1984).
  • Intranasal formulations may include vehicles that neither cause irritation to the nasal mucosa nor significantly disturb ciliary function.
  • Diluents such as water, aqueous saline or other known substances can be employed with the subject invention.
  • the nasal formulations may also contain preservatives such as, but not limited to, chlorobutanol and bcnzalkonium chloride.
  • a surfactant may be present to enhance absorption of the subject proteins by the nasal mucosa.
  • the complex may also be administered in an aqueous solution, for example, when administered in an aerosol or inhaled form.
  • other aerosol pharmaceutical formulations may include, for example, a physiologically acceptable buffered saline solution.
  • Dry aerosol in the form of finely divided solid compound that is not dissolved or suspended in a liquid is also useful in the practice of the present invention.
  • the complex can be conveniently delivered from a nebulizer or a pressurized pack or other convenient means of delivering an aerosol spray.
  • Pressurized packs may include a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Nebulizers include, but are not limited to, those described in U.S. Patent Nos. 4,624,251; 3,703,173; 3,561,444; and 4,635,627. Aerosol delivery systems of the type disclosed herein are available from numerous commercial sources including Fisons Corporation (Bedford, Mass.), Schering Corp. (Kenilworth, NJ) and American Pharmoseal Co., (Valencia,
  • the therapeutic agent may also be administered via nose drops, a liquid spray, such as via a plastic bottle atomizer or metered-dose inhaler. Typical of atomizers are the Mistometer (Wintrop) and the Medihaler (Riker).
  • the complex may also be delivered via an ultrasonic delivery system. In some embodiments of the invention, the complex may be delivered via an endotracheal tube. In some embodiments of the invention, the complex may be delivered via a face mask.
  • the complex may also be used in combination with other therapeutic agents, for example, pain relievers, anti-inflammatory agents, antihistamines, and the like, whether for the conditions described or some other condition.
  • the present invention further pertains to a packaged pharmaceutical composition such as a kit or other container.
  • a packaged pharmaceutical composition such as a kit or other container.
  • the kit or container holds a therapeutically effective amount of a pharmaceutical composition of the complex and instructions for using the pharmaceutical composition for treating a condition.
  • TLR4-dependent delivery of endotoxin to human embryonic kidney (HEK) cells and cell activation at pM concentrations of endotoxin occurred with purified endotoxin :MD-2 complex, but not purified endotoxin aggregates LBP and/or sCD14.
  • the presence of excess MD-2 inhibited delivery of endotoxin:MD-2 to HEK/TLR4 cells and cell activation.
  • Recombinant MD-2 secreted by infected insect cells To further define the mechanism by which 14 C-LOS:sCD14 promotes cell activation and the role of MD-2, the inventors generated conditioned insect cell culture medium containing soluble, polyhistidine-tagged recombinant wild-type (wt) or C95Y mutant MD-2 according to the method of Viriyakosol et al. (2001).
  • HEK/TLR4 cells were not activated by 14 C-LOS aggregates with or without LBP and sCD14 or by the isolated 14 C-LOS:sCD14 complex ( Figure IA).
  • 14 C-LOS:sCD14 could activate HEK/TLR4 cells by first transferring 14 C-LOS:sCD14 to MD-2 indicated that it was this step that was facilitated by presentation of endotoxin as a monomeric complex with CD 14.
  • Various presentations of 14 C-LOS:sCD14 i.e., 14 C-LOS agg with or without LBP, with or without sCD14 were compared for their ability to react with MD-2 to form the LOS:MD-2 complex (assessed by gel filtration chromatography) and subsequently activate HEK/TLR4 cells.
  • Table 1 also indicates that endotoxin must be presented in the form of a monomeric endotoxin-MD-2 complex to activate HEK/TLR4 cells. This could reflect a unique ability of MD-2 to deliver endotoxin to TLR4. To test this hypothesis, cell association of purified LOS agg , LOS-sCD14 or LOS-MD-2 complexes to parental and HEK/TLR4 cells were compared. Initial experiments with [ 14 C]-LOS did not reveal significant cell association of radiolabeled LOS under any condition. These negative results could simply reflect the limited amount of surface TLR4 available and needed to engage LOS-MD-2 for cell activation.
  • LBP and sCD14 were provided by Xoma (US) LLC. (Berkeley, CA). Both parental HEK293 and cells stably transfected with TLR4 (HEK/TLR4) were provided by Dr. Jesse Chow, Eisai Research Institute, (Andover, MA). Chromatography matrices and electrophoresis supplies were purchased from Amersham Biosciences (Piscataway, NJ). Human serum albumin was obtained as an endotoxin-free, 25% stock solution
  • [ 14 C]-LOS or [ 3 H]-LOS was isolated from an acetate auxotroph of Neisseria meningitidis Serogroup B after metabolic labeling and isolated as previously described (28).
  • [ 14 C or 3 H]-LOS agg (apparent M r > 20 million) and [ 14 C or 3 H]-LOS-CD14 (M r ⁇ 60,000) were purified as previously described (Thomas et al. 2002).
  • [ 3 H]-LPS from E. coli LCD25 was purchased from List
  • MD-2 cDNA was isolated, linearized, and inserted, using Ncol and Xhol- sensitive restriction sites, into the baculovirus transfection vector pBACl 1 (Novagen) that provides a six residue polyhistidine tag at the carboxyl terminal end of MD-2 and 5' flanking signal sequence (gp64) to promote secretion of the expressed protein.
  • DNA encoding each desired product was sequenced in both directions to confirm fidelity of the product. Production and amplification of recombinant viruses were undertaken in collaboration with the Diabetes and Endocrinology Research Center at the Veterans' Administration Medical Center, Iowa City, IA.
  • Sf9 cells were transfected with linear baculovirus DNA and the pBACl 1 vector using Bacfectin, according to a procedure described by Clontech.
  • HiFive cells For production of recombinant protein, HiFive cells (Invitrogen) were incubated in serum-free medium and inoculated at an appropriate virus titer. Supernatants were collected and dialyzed either against HEPES-buffered (10 mM, pH 7.4) Hanks' balanced salts solution with divalent cations (HBSS + ), pH 7.4 or 50 mM phosphate, 150 mM NaCl, pH 7.4 (PBS). To absorb the expressed polyhistidine tagged protein, nickel charged agarose resin (HisBind, Novagen, Madison, WI) was incubated batchwise with culture medium pre-dialyzed against PBS containing 5 mM imidazole.
  • HEK cells +/- TLR4 have been extensively characterized and were cultured as has been described (Yang et ah, 2000).
  • cells were grown to confluency in 48 well plates. Cell monolayers were washed with warm PBS 2x and incubated overnight at 37°C, 5% CO 2 , and 95% humidity in HBSS + , 0.1% HSA with the supplements indicated in the legends to Figures 1-3 and Table 1.
  • Activation of HEK cells was assessed by measuring accumulation of extracellular IL-8 by ELISA as previously described (Denning et al, 1998).
  • Fractions (ImI) were collected (flow rate: 0.5 ml/min) at room temperature using an Amersham Biosciences AKTA FPLC.
  • Samples for chromatography contained from 2 ng to 200 ng [ 14 C]- LOS agg , [ 14 C]-LOS-SCD 14 or [ 14 C]-LOS-MD-2 in 1 ml of column buffer +/- 0.1% HSA.
  • Aliquots of the collected fractions were analyzed by liquid scintillation spectroscopy using a Beckman LS liquid scintillation counter to detect [ 14 C]-LOS.
  • Recoveries of [ 14 C]-LOS were > 70% +/- albumin. All solutions used were pyrogen- free and sterile-filtered.
  • HEK or HEK/TLR4 cells were grown to confluency in 6 well plates, washed twice with warm PBS, and [ 3 H]-LOS aggregates or [ 3 H]-LOS-protein complexes +/- indicated supplements were incubated overnight at 37°C, 5% CO 2 , and 95% humidity in DMEM, 0.1% HSA with the supplements indicated in the legends to Figures 3 and 4. After the incubation, supernatants (extracellular media) were collected, cells were washed twice with cold PBS, and cells were lysed and solubilized using RNeasy lysis buffer (Qiagen). The amount of radioactivity associated with the cells was determined by liquid scintillation spectroscopy. Total recovery of radioactivity was >90%.
  • results presented herein demonstrate that in well-differentiated primary cultures of human airway epithelia TLR4, but little or no MD-2, is expressed. These cells are relatively unresponsive to added endotoxin even in the presence of LBP and CD14. However, the responsiveness of these cells to endotoxin is markedly amplified by either the endogenous expression or the exogenous addition of MD-2, indicating that the constitutively low levels of MD-2 expression in these cells at "rest” is important in maintaining their hypo-responsiveness to endotoxin. Changes in MD-2 expression in the airway epithelium and/or neighboring cells can be achieved by exposure of these cells to specific bacterial and host products and can thereby regulate airway responsiveness to endotoxin.
  • Nontypeable Haemophilus influenza (NTHi) is a common commensal, and sometimes a pathogen, of the respiratory tract (Lerman et al, 1979; Smith et al, 1989; Bandi et al, 2001). The experiments described herein explored whether endotoxin
  • TLR4 Toll-like receptors
  • bacterial products including endotoxin from gram- negative bacteria
  • TLR4 is a key receptor for recognition and signaling in response to endotoxin (Medzhitov et al, 1997) and optimal responses require presentation of the bacterial product in the presence of LBP, CD14, and MD-2 (Shimazu et al, 1999; Gioannini et al, 2003; and Abreu et al, 2001).
  • Human airway epithelia were screened for the expression of TLR4, CD 14 and MD-2 mRNAs using RT-PCR.
  • Alveolar macrophages served as a positive control.
  • Figure 7 demonstrates that airway epithelia express the mRNAs for TLR4 and CD14.
  • macrophages demonstrated an MD-2 signal, no significant MD-2 transcripts were detected in airway epithelia following 35 cycles of PCR.
  • Conditioned medium recovered from the transduced cells were then assayed for the presence of active MD-2 by measuring activation of HEK293 cells ⁇ TLR4 by added LOS-sCD14 (the bioactive product of LBP/sCD14 treatment of LOS; (Giardina et al, 2001; Gioannini et al, 2002; and Gioannini et al, 2003)).
  • conditioned medium from Ad-MD-2 transduced cells produced a dose- dependent augmentation of IL-8 release by HEK/TLR4 + cells but not the parental (TLR4 ) cells, consistent with the functional expression of MD-2 by the vector.
  • Extracellular complementation with recombinant MD-2 protein enhances endotoxin signaling in human airway epithelia
  • HEK/TLR4 + cells have been used to show that endogenous (co-) expression of MD-2 or addition of secreted MD-2 to TLR4 + /MD-2 " cells confers increased endotoxin responsiveness.
  • the primary cultures of human airway epithelia provide a more natural setting to test the effect of exogenous addition of recombinant MD-2 (rMD-2) on cellular responsiveness to endotoxin (i.e., LOS-sCD14).
  • rMD-2 recombinant MD-2
  • LOS-sCD14 endotoxin
  • addition of conditioned insect cell culture medium containing rMD-2 increased the response of the human airway epithelial cultures to LOS-sCD14 by > 100-fold. Control conditioned medium, by contrast, had no effect.
  • MD-2 expression is the principal limiting factor for responsiveness of human airway epithelia to endotoxin.
  • the need for MD-2 could reflect its role either in TLR-4 trafficking, posttranslational modifications and surface expression, and/or in endotoxin recognition and delivery to TLR-4.
  • the inventors examined the responsiveness of airway epithelia to purified LOS: MD-2 complex.
  • Figure 9 show that the apical application of 2 ng/ml (400 pM) of LOS: MD-2 produced significant activation of resting epithelia, but not of cells induced by adenoviral transduction, to express MD-2 along with TLR-4.
  • the levels of MD-2 mRNA attained under these conditions were similar to that induced by phorbol myristate acetate but still significantly less than MD-2 mRNA levels in human alveolar macrophages. These findings demonstrate that, in response to specific stimuli, levels of MD-2 transcript can be up-regulated in human airway epithelia.
  • Figure 10 depicts results indicating that MD-2 mRNA expression in human airway epithelia is inducible in response to several stimuli. Fold increase in MD-2 mRNA expression was quantified using real time PCR. Figure 10 represents the results from three independent experiments on three different epithelial preparations. * indicates p ⁇ 0.05.
  • Phorbol myristate acetate (PMA), human recombinant IL- l ⁇ , TNF- ⁇ and INF- ⁇ were obtained from Sigma (St Louis, MO). Soluble CD14 (sCD14) and LPS binding protein (LBP) were provided by Xoma (US) LLC (Berkeley, CA). Lipooligosaccharide (LOS) from non-typeable Haemophilus influenzae was isolated by a mini-phenol-water extraction procedure, as previously described (Inzana et ah, 1997).
  • LOS was also isolated from Neisseria meningitidis and used as purified aggregates (LOS agg) and as monomeric LOS-sCD14 complexes as previously described (Giardina et al, 2001; and Gioannini et al, 2002).
  • P6 from non-typeable Haemophilus influenzae was a generous gift from Dr. Timothy F. Murphy, SUNY, Buffalo.
  • NTHi strain 12 (Frick et al, 2000) was a kind gift of Dr. Dwight Look.
  • BALF Bronchoalveolar lavage fluid
  • NF- ⁇ B-Luc plasmid (Clontech Laboratories Inc., Palo Alto,CA) was used as a template to generate a recombinant adenovirus vector (Ad-NF- ⁇ B-Luc).
  • Ad-NF- ⁇ B-Luc a recombinant adenovirus vector
  • the fragment was inserted into a promoterless adenoviral shuttle plasmid (pAd5mcspA) and Ad-NF- ⁇ B-Luc virus was generated by homologous recombination as previously described and stored in 10 mM Tris with 20% glycerol at -80 °C (Anderson et al, 2000).
  • the particle titer of adenoviral stock was determined by A260 reading.
  • the functional titer of the adenoviral stock was determined by plaque titering on 293 cells and expression assays for the encoded protein.
  • An adenoviral vector expressing human MD-2 was generated.
  • the MD-2 cDNA was digested by Sail at the 5' end and EcoRI at the 3' end and then inserted into an adenoviral shuttle plasmid (pAd5cmcpA), containing the CMV promoter and Ad-MD2 virus was generated by homologous recombination.
  • the titering and storage of the Ad-MD2 virus were identical to those described above for Ad-NF- ⁇ B-Luc.
  • An adenoviral vector expressing the human TLR-4 cDNA was also used in these studies. The methods for the construction of this vector were published previously (Arbour et al, 2000).
  • RNA Analysis Semiquantitative RT-PCR RT-PCR was used to detect expression of TLR4, CD 14 and MD-2 mRNA in human airway epithelia and alveolar macrophages. 1 ⁇ g of total RNA from each sample was reverse transcribed using random hexamer primers with Superscript (GibcoBRL). First strand cDNA was amplified by PCR.
  • the primer set for TLR4 consisted of forward- 5'-TGAGCAGTCGTGCTGGTATC-S' (SEQ ID NO:3); reverse- 5'-
  • CAGGGCTTTTCTGAGTCGTC-3' (SEQ ID NO:4) and amplified a product of 166 bp.
  • the primer set for CD14 consisted of forward- 5'-CTGCAACTTCTCCGAACCTC-S ' (SEQ ID NO:5) and reverse- 5'-CCAGTAGCTGAGCAGGAACC-S ' (SEQ ID NO:6) and produced a cDNA fragment of 215 bp.
  • the primer set for MD-2 included forward- 5 '-TGTAAAGCTTTGGAGATATTGAA- 3' (SEQ ID NO:7) and reverse- 5'-
  • TTTGAATTAGGTTGGTGTAGGA-3' (SEQ ID NO:8) and amplified a product of 508 bp.
  • GAPDH was amplified in each reaction using the following primers- forward- 5'-GTCAGTGGTGGACCTGACC-S' (SEQ ID NO:9); reverse- 5'-AGGGGTCTACATGGCAACTG-S' (SEQ ID NO: 10).
  • Each reaction contained approximately 1.25 pM of the primers, 3 mM Mg ⁇ + .
  • Real-time PCR was employed to detect human ⁇ -defensin-2 and MD-2 and to quantify changes in expression.
  • Real-time quantitative PCR was performed using a sequence detector (ABI PRISM 7700, Applied Biosystems, Foster City, CA) and Taqman technology (Roche Molecular Diagnostic Systems) following the manufacturer's protocols (Bustin, 2000).
  • the primers and probes were designed using the Primer Express program (Applied Biosystems).
  • the primers were- forward 5'-CAACAATATCATTCTCCTTCAAGGG -3' (SEQ ID NO:11), reverse 5'- GCATTTCTTCTGGGCTCCC-3' (SEQ ID NO: 12), and probe 5'- AAAATTTTCTAAGGGAAAATACAAATGTGTTGTTGAAGC-S ' (SEQ ID NO: 13).
  • the forward primer was- 5 '-CCTGTTACCTGCCTTAAGAGTGGA-3 '
  • CCATATGTCATCCAGTCTTTTGCCCTAGAAGG -3' (SEQ ID NO: 16). Both probes contain a fluorescent reporter (6-Carboxyfluorescein [FAM]) at the 5' end and a fluorescent quencher (6-Carboxytetramethylrhodamine [TAMRA]) at the 3' end.
  • FAM fluorescent reporter
  • TAMRA fluorescent quencher
  • human GAPDH real-time quantitative PCR was conducted in every reaction.
  • the primers and probes were purchased from Roche Molecular Diagnostic Systems. The PCR fragments were amplified for 40 cycles (15 sec at 95 0 C and 1 min at 60 0 C).
  • LOS ⁇ specific endotoxin-binding proteins as indicated in the individual figure legends were applied in 50 ⁇ l to the apical or basolateral side of the cells as noted.
  • Control groups received PBS (negative control) or IL-l ⁇ (100 ng/ml, applied apically and basolaterally as positive control).
  • the cells were disrupted in the IX lysis buffer provided with the luciferase assay kit (Promega) to measure luciferase activity.
  • some samples were prepared to isolate total RNA.
  • HEK cells +/- TLR4 were obtained from Dr. Jesse Chow (Eisai Research Institute, Andover, MA) and were cultured as described (Yang et al, 2000; and Gioannini et al, 2003).
  • cells were grown to confluency in 48 well plates. Epithelia were washed with warm PBS 2X and incubated overnight at
  • Recombinant MD-2 protein (rMD-2) was produced in baculovirus for application to airway epithelia.
  • the human MD-2 cDNA was first sub-cloned into pGEM-T easy vector for transformation of E. coli JM 109 and amplification.
  • the DNA was then isolated, linearized, and inserted into pBACl 1 (using Ncol and Xhol-sensitive restriction sites) for transfection into insect cells.
  • a vector encoding a six-histidine (6x His tag disclosed as SEQ ID NO: 17) (“poly-HIS”) extension of the C-terminus was used.
  • the DNA encoding MD-2 was sequenced in both directions to confirm the fidelity of the product.
  • Sf9 cells were used for production and multiplication of virus containing pBACl 1 plasmids.
  • High Five (Invitrogen) cells were inoculated with recombinant virus in serum-free medium, incubated 24-48 hr and culture medium then collected for analysis.
  • the presence of recombinant MD-2-(HIS)6 (6x His tag disclosed as SEQ ID NO: 17) was determined by SDS-PAGE and immuno-blots of the culture medium, using an anti-His4 (4x His tag disclosed as SEQ ID NO: 18) mAb (Qiagen).
  • the culture medium was dialyzed against sterile Hanks' balanced salts solution buffered with 10 mM HEPES, pH 7.4 and supplemented with 0.1% human serum albumin before use in bioassays. Stimulation of airway epithelia with pro-inflammatory products Several agents were applied to human airway epithelia to investigate the regulation of MD-2 expression.
  • PMA, TNF- ⁇ , and INF- ⁇ were applied to the apical and basolateral surfaces at 100 ng/ml.
  • Bacterial products including the NTHi membrane protein P6 (5 ⁇ g/ml) and heat killed NTHi (Strain 12, -100 bacteria per epithelial cell, Frick et al, 2000) were applied to the apical surface. Following an 18 - 24 hr stimulation, the cells were lysed and total RNA was extracted. Real-time PCR was conducted as described herein.
  • Endotoxin species with potent pro-inflammatory activity are typically hexa- acylated. That is, the lipid A region contains 6 covalently linked fatty acids, including 4 mol/mol of 3-OH fatty acids linked directly to the di-N-acetylglucosamine backbone of lipid A and 2 mol/mol non-hydroxylated fatty acids (NFA) that are linked to two of the four 3-OH fatty acids via an ester bond with the 3-OH group.
  • NFA non-hydroxylated fatty acids
  • Under-acylated endotoxin reacts normally with LBP, CD 14 and MD-2 to produce an endotoxin-MD-2 complex that engages TLR4 without producing the changes in TLR4 needed for receptor and cell activation.
  • the presence of an excess of under-acylated endotoxin-MD-2 complex e.g., terra- or penta-acylated endotoxin
  • NMB Neisseria meningitidis serogroup B
  • the activities of the endotoxin:MD-2 complexes differ markedly between the complex containing wt (hexa-acylated) LOS and that containing the mutant msbB (penta-acylated) LOS, with the complex containing the mutant LOS causing less cell activation.
  • addition of increasing amounts of the mutant msbB LOS:MD-2 complex significantly reduced cell activation by the wt LOS:MD-2 complex.
  • Limited cell activation seen at higher doses of the msbB LOS:MD-2 complex closely resembles levels of cell activation produced by addition of these amounts of the msbB LOS:MD-2 complex alone (compare Figs. 14 and 15) indicating that the mutant endotoxin: MD-2 complexes can efficiently compete with the wt endotoxin: MD-2 complex for interaction with cellular TLR4, and thus blunt endotoxin-induced cell activation.
  • the present inventors identified and characterized an MD-2 mutant that forms a monomeric complex with endotoxin (E) that acts as a TLR4 antagonist.
  • E endotoxin
  • Potent TLR4- dependent cell activation by E depends on transfer of E from LBP to CD 14 to MD-2.
  • MD-2 has the dual function of binding to the extracellular domain of TLR4 and to E. By site-directed mutagenesis, structural requirements of MD-2 for TLR4 binding and cellular E responsiveness have been determined but not, directly, those for E binding.
  • the inventors have also constructed the single site-specific mutants F126A and K 125 A mutants to determine whether K 125 and/or F 126 are functionally important. Each of these mutants reacted normally with E:sCD14 to form a monomeric E:MD-2 complex (data not shown).
  • E:MD-2 (K125A) was at least as active as E:MD-2 (wt) in activation of HEK/TLR4 cells, as judged by induced synthesis and secretion of IL-8 (data not shown).
  • E:MD-2 (F126A) produced virtually no activation of HEK/TLR4 (Fig. 17A).
  • the inventors used two different procedures for preparative production and purification of endotoxin:MD-2 complex.
  • the first procedure used recombinant MD-2 expressed in insect cells, where culture conditions are somewhat more favorable for retention of secreted MD-2 in functional form before exposure to monomeric endotoxin :sCD 14 complex.
  • the second procedure used, more analytical procedures, MD-2 expressed from mammalian cells. In the mammalian cells, formation and recovery of monomeric endotoxin :MD-2 complex is greatly enhanced by addition of endotoxin:sCD14 complex to culture medium to react with MD-2 as it is being secreted.
  • the harvested insect cell culture medium containing secreted soluble MD-2-His 6 (6x His tag disclosed as SEQ ID NO: 17) was incubated with preformed monomeric E:sCD14 for 30 min at 37 0 C.
  • Albumin >0.3% (wt/vol) was added to maintain the solubility of E as it is being transferred from CD 14 to MD-2.
  • This incubation can be carried out in small ( ⁇ 1 ml) to very large volumes (at least 1 Liter), producing in the latter case up to 1 mg monomeric E:MD-2 complex.
  • the complex is purified from the culture medium by gel sieving chromatography and, if necessary, metal chelation (e.g., HisLink) chromatography after concentration of the culture medium containing the monomeric E:MD-2 complex by ultrafiltration.
  • cultured mammalian cells e.g., HEK293T cells
  • an expression plasmid e.g., pEFBOS
  • 3 H-LOS:sCD14 5-10 ng LOS/ml
  • albumin 0.03% albumin
  • E/MD-2 complex take advantage of the much more favorable physico-chemical properties of the complex as compared to that of either endotoxin or MD-2 alone.
  • the expression and secretion of MD-2 in insect cells is advantageous because culturing is done at lower temperature (e.g., 27°C) than that used for mammalian cell cultures (37°C). Consequently, the secreted MD-2 suffers less temperature-dependent loss of activity.
  • This problem has been bypassed by spiking monomeric endotoxin: sCD 14 into the culture medium at the time of peak MD-2 secretion, taking advantage of the very fast transfer of E from sCD14 to MD-2 and the much greater stability of E:MD-2 in comparison to MD-2 alone.
  • the inventors have recovered the E:MD-2 complex from the culture medium after 24 to 48 h at 37 0 C and it still has full bioactivity.
  • Agonist versus antagonist properties of endotoxin variants e.g., differing in degree of acylation
  • the present inventors have also performed in vivo testing showing potent proinflammatory activity of nasally instilled E:MD-2.
  • the inventors performed experiments in mice to assess the ability of nasally administered purified wt E:MD-2 complex as compared to the same E added as purified endotoxin aggregates to induce airway inflammation.
  • the monomeric E:MD-2 complex was at least ten times more potent than the E aggregates (without MD-2), as judged by induction of airway accumulation of neutrophils. This supports the observation that E:MD-2 complex has special properties not associated with E or MD-2 alone.
  • TLR4 activation by endotoxin the role of MD-2, like that of LBP and CD 14 before it, could be to facilitate delivery of endotoxin to TLR4 by virtue of its capacity to bind to endotoxin and to TLR4 simultaneously.
  • endotoxin:MD-2 rather than endotoxin transferred from MD-2, may be the ligand for TLR4 that specifies receptor activation. If so, covalent tethering of bound endotoxin to MD-2 by chemical cross- linking should yield an even more stable endotoxin:MD-2 complex that is still a potent TLR4 agonist.
  • the inventors treated monomeric complex of 14 C-LOS:MD-2 with the amine reactive cross-linkers TSAT or BS 3 ( Figures 2OD and 20E).
  • SDS-PAGE analysis of LOS:MD-2 with or without cross-linker indicated that in the absence of TSAT or BS 3 , LOS migrated near the dye front, whereas cross-linked 14 C-LOS traveled with M r ⁇ 25,000, consistent with a product in which LOS was covalently attached to MD-2 ( Figure 20C). Approximately 30-50% Of 14 C-LOS was cross-linked to MD-2.
  • Remaining non-cross-linked 14 C-LOS was removed by treatment of the cross-linked reaction mixture with 0.3% deoxycholate to release non-covalently bound LOS from MD-2, followed by gel filtration (in phosphate-buffered saline, pH7.4, without deoxycholate) to separate cross-linked I4 C-LOS:MD-2 (cross-linked (XL)- 14 C- LOS:MD-2) from LOS that re-aggregates ( Figures 21A and 21B) and free MD-2.
  • the isolated XL- 14 C-LOS:MD-2 was unable to activate TLR4 and, instead, acted as an antagonist, inhibiting activation of HEK293/TLR4 cells by native LOS:MD- 2 ( Figures 22A and 22B).
  • TLR4E CD can also be used for screening and identification of novel (natural or synthetic) TLR4 agonists or antagonists, by measuring the ability of the test compounds to compete with the XL-LOS :MD-2 for binding to
  • Example 8 Structural Properties of E:MD-2 Determine Agonist or Antagonist
  • Expression vectors containing DNA of interest for production of FLAG-TLR4E CD , amino acids 24-634, (pFLAG-CMV-TLR4) and MD-2-FLAG-His (pEF-BOS) as well as MD-2 containing the indicated mutations have been previously described and characterized (Re et al. 2002) or have been generated according to that protocol.
  • Preparative amounts of wt and F 126 A MD-2 were generated from infections of High FiveTM (BTI-Tn-4) insect cells with baculovirus containing the gene for human MD-2 F126A inserted into pBACl 1.
  • Wt human MD-2-His 6 (6x His tag disclosed as SEQ ID NO: 17) was generated in insect cells as described previously (Gioannini et al. 2004).
  • pEF-BOS-MD-2 F126A -FLAG-His DNA was linearized, and inserted, using Ncol and ⁇ TzoZ-sensitive restriction sites, into the baculovirus transfection vector pBACl 1 (Novagen) that contains a 5' flanking signal sequence to promote secretion of the expressed protein.
  • DNA encoding MD-2 F126 ⁇ was sequenced in both directions to confirm fidelity of the product.
  • Monomeric [ 3 H]LOS:CD14 complexes (M r , - 60,000) were prepared by incubating [ 3 H]LOS agg for 30 min at 37 0 C with sub- stoichiometric LBP (molar ratio 100:1 LOS:LBP) and 1-1.5 x molar excess of sCD14 to LOS followed by gel exclusion chromatography (SephacrylTM S200, 1.6 cm x 70 cm column) in PBS, pH 7.4, 0.03% HSA to isolate monomeric [ 3 H]LOS:sCD14 complex.
  • sub- stoichiometric LBP molar ratio 100:1 LOS:LBP
  • 1-1.5 x molar excess of sCD14 to LOS followed by gel exclusion chromatography (SephacrylTM S200, 1.6 cm x 70 cm column) in PBS, pH 7.4, 0.03% HSA to isolate monomeric [ 3 H]LOS:sCD14 complex.
  • [ 3 H]LOS:MD-2-His 6 (6x His tag disclosed as SEQ ID NO: 17) (M r -25,000) was generated by treatment of [ 3 H]LOS:sCD14 (10 ⁇ g preparative or 10 ng analytical) by incubation for 30 min at 37 0 C with High FiveTM insect cell medium containing MD-2- His 6 (6x His tag disclosed as SEQ ID NO: 17) (25 ml preparative or 0.025 ml analytical). Preparative samples were concentrated to 2 ml before application to 1.6 cm x 70 cm SephacrylTM S200 column for isolation of [ 3 H]LOS:MD-2.
  • Radiochemical purity of [ 3 H]LOS agg was confirmed by SephacrylTM S500 (Gioannini et al. 2002) and that of [ 3 H]LOS:sCD14, and [ 3 H]LOS:MD-2 by SephacrylTM S200 chromatography (Gioannini et al. 2004, Gioannini et al. 2001). Reaction of secreted MD-2, TLR4 ECD and MD-2/TLR4 ECD with [ 3 H]LOS:protein complexes— Conditioned serum-free medium of transfected HEK293T cells was harvested after 24 h in culture and used for subsequent incubation with [ 3 H]LOS:sCD14.
  • the culture medium was "spiked" with [ 3 H]LOS:sCD14 (1 nM) at the time of addition of the medium to the transfected cells to permit reaction of MD-2 with [ 3 H]LOS : sCD 14 upon secretion.
  • [ 3 H]LOS:sCD14 are denoted as HEK/(secreted recombinant protein)cM, whereas media spiked with [ 3 H]LOS:sCD14 during cell culture are represented as (HEK/recombinant protein(s) secreted + [ 3 H]LOS:SCD14) C M- Media harvested without [ 3 H]LOS:sCD14 were incubated with 1 nM [ 3 H]LOS:sCD14 for 30 min (or 24 h) at 37°C and then analyzed by gel sieving chromatography. Media spiked with [ 3 H]LOS :sCD 14 during cell culture were analyzed directly after harvesting the medium by gel sieving chromatography.
  • [ 3 H]LOS :MD-2 F126A was incubated with concentrated (8-1Ox) conditioned medium containing TLR4 EC D in a final volume of 0.5 or 1 ml in PBS, pH 7.4, for 30 min at 37°C.
  • the same conditioned medium (containing secreted TLR4 EC D) was used with all concentrations of [ 3 H]LOS:MD-2 F126A tested for Scatchard analysis. Scatchard analysis was done using GraphPad Prism 4.
  • TBSTT for 1 hr at 25°C, and incubated with the anti-His 4 antibody in TBSTT overnight. After washing with TBSTT, the blot was incubated with donkey anti-mouse IgG conjugated to horseradish peroxidase (BioRad) for 1 hr at 25°C in TBS containing 3% goat serum and washed with TBSTT exhaustively. Blots were developed using the Pierce SuperSignal substrate system.
  • HEK293 cell activation assay ⁇ E ⁇ 3.93 /TLR4 cell lines have been extensively characterized and were cultured as has been previously described (Yang et al. 2000) or according to recommendations of Invivogen, Inc.
  • LOS:sCD14 cells were grown to confluency in a 6-well plate and then transfected with vector (4 ⁇ g DNA) containing wt or mutant MD-2 as described above. After transfection, serum-free medium was added for 24 h at 37°C in 5% CO 2 , and 95% humidity. The supernatants were removed; cells were dislodged and seeded in a 96-well plate (1 x 10 5 cells/well) in triplicate.
  • the cells were then stimulated with 200 pM LOS:sCD14 for 3 h in DMEM, 0.1% HSA.
  • the short incubation time (3 h) was used to preclude significant secretion of MD-2 that would compete with cell surface MD- 2/TLR4 for reaction with LOS:sCD14.
  • Supernatants were removed and evaluated for extracellular accumulation of IL-8 by ELISA.
  • HEK293 cells +/- TLR4 were seeded in a 96-well plate in triplicate (1 x 10 5 cells/well) and stimulated with increasing concentrations of LOS:MD-2 complex in DMEM, 0.1% HSA for 20 h. Activation of HEK293 cells was assessed by measuring accumulation of extracellular IL-8 by ELISA (BD Clontech, Inc., Palo Alto, CA).
  • MD-2 mutants that bind TLR4 but do not support TLR4-dependent cell activation by endotoxin Comparison of reactivity with [ 3 H] LOS :sCDl 4. —The same experimental design was used to re-examine the functional properties of three human MD-2 double mutants (F121A.K122A, K125A.F126A, and Y131A.K132A). These mutants interact with TLR4, as judged by co-precipitation and/or FACS-based analyses, but did not support robust cellular endotoxin responsiveness. These results suggest either a defect in LPS binding (i.e., reactivity with endotoxin:CD14) and/or activation of TLR4 by bound endotoxin :MD-2.
  • Reaction of human MD-2 F121 ⁇ ⁇ mA andMD-2 Y131 ⁇ K132A mutants with LOS:sCD14 depends on co-expression ofTLR4 ectodomain.— In many cells expressing MD-2, TLR4 is also expressed resulting in formation of MD-2/TLR4 heterodimer complex that reacts with monomeric E:CD14 to trigger cell activation.
  • the functional stability (i.e., reactivity with E:CD14) of wild-type human MD-2 in serum-free medium at 37 0 C is markedly enhanced by co-expression of the predicted ectodomain of TLR4 (residues 24-634), raising the possibility that for certain mutant MD-2 species co- expression of the TLR4 ectodomain might be necessary to maintain MD-2 in a form reactive with E:sCD14.
  • the mutants of MD-2 that did not react with [ 3 H]LOS:sCD14 i.e., MD-2 F121A K122A and MD-2 Y131A K132A
  • wild-type MD-2 were co-expressed and secreted with the TLR4 ectodomain into a culture medium "spiked" with [ 3 H]LOS:sCD14. After 24 h, the culture medium was harvested and analyzed by gel filtration chromatography.
  • TLR4 EC D expressed without MD-2 does not react with [ 3 H]LOS:sCD14.
  • the region encompassing residues 121-132 in MD-2 forms a rim surrounding the opening to a deep hydrophobic cavity in which the acyl chains of endotoxin are buried when bound to MD-2.
  • This region in human MD-2 contains several lysines (K122, K125, K128, K130 and K132) that have been implicated in E-MD-2 interactions.
  • lysines K122, K125, K128, K130 and K132
  • both MD- 2 K122A and MD-2 K132A retained the ability to react with [ 3 H]LOS :sCD 14 in a TLR4-independent manner as manifest by the generation of [ 3 H]LOS :MD-2 when these mutants were expressed and secreted into culture medium containing [ 3 H]LOS:sCD14 with or without TLR4 ECD -
  • LOS:sCD14 is the substrate for both MD-2 and MD-2/TLR4 EC D
  • differences in TLR4-independent reactivity of different MD-2 species could affect the yield of ([ 3 H]LOS:MD-2/TLR4 ECD ) 2 by differentially affecting the availability of LOS:sCD14 to react with MD-2/TLR4 E C D - TO eliminate the potentially complicating factor of formation of LOS:MD-2, co-expression of the various wt and mutant MD-2 species was repeated with TLR4 ECD in the absence of [ 3 H]LOS:sCD14.
  • the conditioned media (containing secreted MD-2 and MD-2/TLR4 ECD ) were harvested after 24 h and then incubated for 30 min at 37 0 C with freshly added [ 3 H]LOS:sCD14.
  • MD- 2/TLR4 ECD but not MD-2 alone, retained reactivity with [ 3 H]LOS :sCD 14 under these conditions and thus ([ 3 H]LOS:MD-2/TLR4 ECD ) 2 but not [ 3 H]LOS:MD-2 was formed.
  • Each of the mutant MD-2 species tested reacted with [ 3 H]LOS :sCD 14 to form ([ 3 H]LOS :MD-2/TLR4 ECD ) 2 , though the yield was reduced -50% in the double vs. the single mutants.
  • Monomeric complex ofLOS:MD-2 FI26 ⁇ is a potent TLR4 antagonist.-- The ability of a mutant MD-2 to bind both TLR4 and endotoxin without conferring TLR4 activation suggests that a complex of endotoxin with this MD-2 mutant acts as an effective TLR4 antagonist. Unfortunately, the inability of MD-2 F121A K122A and MD-2 Y131AK132A to react with LOS:sCD14 unless these MD-2 mutants were pre-associated with TLR4 precluded testing this prediction with these mutants.
  • LOS:MD-2 K125A F126A produced much more limited activation of HEK/TLR4 cells and, in molar excess, reduced cell activation triggered by wild-type LOS:MD-2 to levels closely similar to that produced by the mutant complex alone.
  • LOS:MD-2 K125A was as potent as wild-type LOS:MD-2 in activation of HEK/TLR4 cells, but LOS:MD-2 F126A produced essentially no activation of HEK/TLR4 cells. Instead, in molar excess, LOS:MD-2 F126A produced virtually complete dose-dependent inhibition of cell activation by wild-type LOS:MD-2.
  • the single amino acid alteration, F126A, in human MD-2 was sufficient to convert a potent TLR4 agonist (wild type LOS:MD-2) to a potent TLR4 antagonist.
  • the ratio of the products [ 3 H]LOSrMD- 2/([ 3 H]LOS :MD-2/TLR4 ECD ) 2 ) formed roughly corresponded to the ratio of expression and secretion of MD-2 and TLR4 ECD - i.e., ratio of MD-2 to MD-2/TLR4 ECD - as determined by immunoblot, suggesting that for these secreted MD-2 species the reactivity of MD-2 with LOS:sCD14 is not significantly altered by prior engagement of MD-2 with TLR4E CD .
  • MD-2 F121A K122A MD-2 F121A K122A
  • MD-2 Y131A K132A and MD-2 K132A interaction with TLR4 ECD was apparently crucial for reactivity of these MD-2 species with LOS:sCD14.
  • MD-2 when secreted in molar excess of TLR4, can form an array of oligomers as well as persist as a monomer. It is generally believed that the functionally reactive form of MD-2, both with respect to endotoxin and TLR4 binding, is monomeric MD-2 and that the state of the resting MD-2/TLR4 heterodimer (i.e., before binding of endotoxin) may also be monomeric (Visintin et al. 2003).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Oncology (AREA)
  • Pulmonology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des complexes isolés d'endotoxine et de MD-2 modifié réticulés chimiquement, ainsi que des procédés d'utilisation de ces complexes.
PCT/US2007/079071 2006-09-20 2007-09-20 Complexes isolés d'endotoxine et de md-2 modifié à réticulation covalente WO2008036838A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US82631006P 2006-09-20 2006-09-20
US60/826,310 2006-09-20

Publications (2)

Publication Number Publication Date
WO2008036838A2 true WO2008036838A2 (fr) 2008-03-27
WO2008036838A3 WO2008036838A3 (fr) 2008-07-03

Family

ID=39048788

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/079071 WO2008036838A2 (fr) 2006-09-20 2007-09-20 Complexes isolés d'endotoxine et de md-2 modifié à réticulation covalente

Country Status (2)

Country Link
US (1) US8137682B2 (fr)
WO (1) WO2008036838A2 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8088396B2 (en) * 2006-03-01 2012-01-03 University Of Iowa Research Foundation Isolated complexes of endotoxin and modified MD-2

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005049067A1 (fr) * 2003-11-17 2005-06-02 University Of Iowa Research Foundation Complexes isoles d'endotoxine et de md-2

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3561444A (en) 1968-05-22 1971-02-09 Bio Logics Inc Ultrasonic drug nebulizer
US3703173A (en) 1970-12-31 1972-11-21 Ted A Dixon Nebulizer and tent assembly
US4635627A (en) 1984-09-13 1987-01-13 Riker Laboratories, Inc. Apparatus and method
US4624251A (en) 1984-09-13 1986-11-25 Riker Laboratories, Inc. Apparatus for administering a nebulized substance
US4962091A (en) 1986-05-23 1990-10-09 Syntex (U.S.A.) Inc. Controlled release of macromolecular polypeptides
WO1994007529A1 (fr) 1992-09-25 1994-04-14 Neorx Corporation Inhibiteur therapeutique de cellules des muscles vasculaires lisses
US6887483B2 (en) 1995-12-01 2005-05-03 University Of Iowa Research Foundation Non-toxic mutants of pathogenic gram-negative bacteria
WO2007106072A2 (fr) 2006-03-01 2007-09-20 University Of Iowa Research Foundation Complexes isolés d'endotoxine et de md-2 modifiée
US8088396B2 (en) 2006-03-01 2012-01-03 University Of Iowa Research Foundation Isolated complexes of endotoxin and modified MD-2

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005049067A1 (fr) * 2003-11-17 2005-06-02 University Of Iowa Research Foundation Complexes isoles d'endotoxine et de md-2

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BEUTLER BRUCE ET AL: "Innate immune sensing and its roots: The story of endotoxin." NATURE REVIEWS IMMUNOLOGY, vol. 3, no. 2, February 2003 (2003-02), pages 169-176, XP002469987 ISSN: 1474-1733 *
BOSSHART HERBERT ET AL: "Targeting bacterial endotoxin: two sides of a coin." ANNALS OF THE NEW YORK ACADEMY OF SCIENCES JAN 2007, vol. 1096, January 2007 (2007-01), pages 1-17, XP009096337 ISSN: 0077-8923 *
BUTCHAR JONATHAN P ET AL: "Negative regulators of toll-like receptor 4-mediated macrophage inflammatory response" CURRENT PHARMACEUTICAL DESIGN, vol. 12, no. 32, 2006, pages 4143-4153, XP002469985 ISSN: 1381-6128 *
GIOANNINI T L ET AL: "Isolation of an endotoxin-MD-2 complex that produces Toll-like receptor 4-dependent cell activation at picomolar concentrations" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC, US, vol. 101, no. 12, 23 March 2004 (2004-03-23), pages 4186-4191, XP002323010 ISSN: 0027-8424 *
KENNEDY M N ET AL: "A complex of soluble MD-2 and lipopolysaccharide serves as an activating ligand for Toll-like receptor 4" JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM,, US, vol. 279, no. 33, 13 August 2004 (2004-08-13), pages 34698-34704, XP002323011 ISSN: 0021-9258 *
LIEW FOO Y ET AL: "Negative regulation of Toll-like receptor-mediated immune responses" NATURE REVIEWS IMMUNOLOGY, vol. 5, no. 6, June 2005 (2005-06), pages 446-458, XP002469986 ISSN: 1474-1733 *
STOLL LYNN L ET AL: "Endotoxin, TLR4 signaling and vascular inflammation: Potential therapeutic targets in cardiovascular disease" CURRENT PHARMACEUTICAL DESIGN, vol. 12, no. 32, 2006, pages 4229-4245, XP002469984 ISSN: 1381-6128 *
ULEVITCH R J: "Endotoxin opens the Tollgates to innate immunity." NATURE MEDICINE FEB 1999, vol. 5, no. 2, February 1999 (1999-02), pages 144-145, XP002469988 ISSN: 1078-8956 *

Also Published As

Publication number Publication date
WO2008036838A3 (fr) 2008-07-03
US20080125365A1 (en) 2008-05-29
US8137682B2 (en) 2012-03-20

Similar Documents

Publication Publication Date Title
Rustici et al. Molecular mapping and detoxification of the lipid A binding site by synthetic peptides
KR101737464B1 (ko) 표면 노출된 헤모필루스 인플루엔자 단백질 （단백질 Ｅ ― ｐＥ）
JP3797490B2 (ja) 単離されたＦｒｐＢ核酸分子およびワクチン
CA2392756A1 (fr) Vaccin a adn contre staphylococcus aureus
AU2009217425B2 (en) Vaccine
US8088396B2 (en) Isolated complexes of endotoxin and modified MD-2
US8137682B2 (en) Isolated complexes of covalently cross-linked endotoxin and modified MD-2
JP6776254B2 (ja) Ｂ７リガンド二量体界面に由来する単離されたペプチドおよびそれらの使用
US7164008B2 (en) Isolated complexes of endotoxin and MD-2
CN111533792A (zh) 一种定点突变的载体蛋白及其在制备疫苗中的用途
KR100509712B1 (ko) 나이세리아 락토페린 결합 단백질
JP2007511233A (ja) ボルデテラ（Ｂｏｒｄｅｔｅｌｌａ）の組換えアデニル酸シクラーゼ毒素は腫瘍抗原に対するＴ細胞応答を誘発する
WO2007106072A2 (fr) Complexes isolés d'endotoxine et de md-2 modifiée
JP2005532789A (ja) 減少した酵素活性を有する型別不能なインフルエンザ菌（Ｈａｅｍｏｐｈｉｌｕｓｉｎｆｌｕｅｎｚａ）のＰ４タンパク質の変異体
US20140286977A1 (en) Protein F - A Novel Haemophilus Influenzae Adhesin with Laminin and Vitronectin binding Properties
AU2014225330B2 (en) Transcutaneous dosage formulation
JPH10327882A (ja) 新規ＬｉｃＢ
JP2003506044A (ja) モラクセラ・カタラーリス（Ｍｏｒａｘｅｌｌａｃａｔａｒｒｈａｌｉｓ）由来のＢＡＳＢ１１８ポリペプチドおよびポリヌクレオチド
JPH11123088A (ja) 新規化合物
JP2003506027A (ja) モラクセラ・カタラーリス（Ｍｏｒａｘｅｌｌａｃａｔａｒｒｈａｌｉｓ）のＢＡＳＢ１１４抗原およびその使用
JP2003506043A (ja) 新規化合物
JP2003506045A (ja) モラクセラ・カタラーリス（Ｍｏｒａｘｅｌｌａｃａｔａｒｒｈａｌｉｓ）由来のＢＡＳＢ１１９ポリペプチドおよびポリヌクレオチド
Faggioni et al. Molecular and detoxification of lipid A binding site by synthetic peptides
CN109414481A (zh) 用于治疗病理性肌肉损失和虚弱的nope
JPH10327883A (ja) ｌｉｃＤ１

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07842904

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07842904

Country of ref document: EP

Kind code of ref document: A2