WO2008007031A1 - Genes codant pour la cis-labda-12,14-dien-8 alpha-ol (cis-abienol) synthase et la syn-copalyl-8-ol diphosphate synthase et leurs utilisations - Google Patents

Genes codant pour la cis-labda-12,14-dien-8 alpha-ol (cis-abienol) synthase et la syn-copalyl-8-ol diphosphate synthase et leurs utilisations Download PDF

Info

Publication number
WO2008007031A1
WO2008007031A1 PCT/FR2007/051654 FR2007051654W WO2008007031A1 WO 2008007031 A1 WO2008007031 A1 WO 2008007031A1 FR 2007051654 W FR2007051654 W FR 2007051654W WO 2008007031 A1 WO2008007031 A1 WO 2008007031A1
Authority
WO
WIPO (PCT)
Prior art keywords
syn
synthase
diphosphate
abienol
copalyl
Prior art date
Application number
PCT/FR2007/051654
Other languages
English (en)
Inventor
Christophe Sallaud
Denis Rontein
Alain Tissier
Original Assignee
Librophyt
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Librophyt filed Critical Librophyt
Publication of WO2008007031A1 publication Critical patent/WO2008007031A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)

Definitions

  • the present invention relates to genes involved in the synthesis of czs-abienol and their use for the preparation thereof in living organisms such as bacteria, yeasts, animal cells and plants.
  • Terpenes form a large class of natural molecules found in all living organisms (bacteria, fungi, animals, plants). In plants, they play various roles, particularly in the attraction of beneficial insects for the plant, and in defense against pathogens (bacteria, fungi, insects). Terpenes consist of multiple isoprenyl units with 5 carbons. The number of isoprenyl units makes it possible to classify them in particular as monoterpenes (compounds containing ten carbon atoms or ClO), sesquiterpenes (C 15), diterpenes (C20), triterpenes (C30), tetraterpenes (C40) and polyterpenes (> C45) .
  • monoterpenes compounds containing ten carbon atoms or ClO
  • sesquiterpenes C 15
  • diterpenes C20
  • triterpenes C30
  • tetraterpenes C40
  • polyterpenes > C45
  • the biosynthetic pathways of terpenes precursors have been widely described in the literature (see, for example, Eisenreich et al, 2004).
  • the universal precursors of all terpenes are isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP).
  • IPP isopentenyl diphosphate
  • DMAPP dimethylallyl diphosphate
  • One, the mevalonate pathway (MEV) is localized in the cytoplasm while the other, the methyl-erythritol pathway (MEP), exists only in certain bacteria and plants where it is localized in plastids. All the steps and genes encoding the enzymes of these two pathways are known.
  • the first step of the terpene biosynthesis is carried out by tr ⁇ ns-prenyltransferases which go through the condensation of the two precursors, IPP and DMAPP, to generate carbon chains consisting of isoprenyl units (C5) of length variable.
  • IPP isoprenyl units
  • DMAPP transgeryanyl diphosphate
  • prenyl diphosphate chains of variable length are the substrates of an enzyme class, the terpene synthases which allow the formation of the basic skeleton of cyclic or acyclic terpenes in ClO (monoterpene), C15 (sesquiterpene), C20 (diterpene) , C30 (triterpene) (Cane 1999, McMillan and Beale 1999, Wise and Croteau 1999).
  • the reaction diversity of these enzymes is responsible for the diversity of cyclic terpene skeletons found in nature.
  • Cultivated tobacco produces a secretion in its trichomes, or secretory hairs, of which more than half are composed of diterpenes belonging to two classes, the cembranes and the labdans.
  • czs-abienol is the compound predominantly produced by a large number of tobacco varieties (N. tabacum). In some varieties, the amount of czs-abienol may represent more than 1% of fresh leaf material.
  • the czs-abienol positively participates in the aromatic characteristics of tobacco leaves. It can also be used as a precursor in the synthesis of ambroxides, molecules used in the perfume industry.
  • GGPP ent- or syn-cyddyldiphosphate
  • ent- or syn-CPS ent- or syn-copalyldiphosphate synthase
  • AtGA1 genes (Sun et al., 1994) and KX.GA2 (Yamaguchi et al., 1998) are involved in gibberellin biosynthesis and encode ent-copalyldiphosphate synthase (ent-CPS) and ent-kaurene synthase, respectively.
  • ent-CPS ent-copalyldiphosphate synthase
  • OsCPS3 ent-copalyldiphosphate synthase
  • OsCPS3 two genes code for CPS-ent
  • OsCPS1 is responsible for the biosynthesis of the gibberellin precursor, ent-kaurene (Sakamoto et al., 2004).
  • OsCPS2 and OsCPS3 are involved in the biosynthesis of precursors of several phytoallexins of the labdane type (ent-cassa-15-diene; ent-sandaracopimaradiene;
  • labdanoid diterpenes are derived from copalyl-8-ol diphosphate, such as sclareol or (13E) -labdene-8,15-diol. Syn-CODP synthase, the sequence of which was unknown to date, would therefore be the first step in the biosynthesis of these molecules from GGPP.
  • the invention relates to enzymatic activities, the peptide sequences responsible for these activities and the corresponding nucleic acid sequences responsible for the biosynthesis of czs-abienol from GGPP.
  • the invention also relates to methods for producing cis-abienol or derivatives thereof using these enzymatic activities.
  • the present invention therefore relates to a method for producing cis-abienol or derivatives thereof from geranyl geranyl diphosphate (GGPP) in a cell having a source of GGPP, comprising: a) introducing into said cell of a construct carrying an expression cassette comprising a gene encoding a syn-copalyl-8-ol diphosphate synthase (syn-COPS), said synthase having at least 80% identity with the
  • the present invention also relates to an isolated or recombinant protein having a czs-abienol synthase activity and having a sequence having at least 95% identity with SEQ ID No. 24. It also relates to a nucleic acid comprising a nucleotide sequence coding for such protein, or a sequence capable of hybridizing thereto under stringent conditions and having a czs-abienol synthase activity.
  • the present invention further relates to an isolated or recombinant protein having syn-COVS activity and having a sequence having at least 80% identity with SEQ ID No. 22. It also relates to a nucleic acid comprising a nucleotide sequence coding for such protein, or a sequence capable of hybridizing thereto under stringent conditions and having syn-COVS activity.
  • the present invention relates to an expression cassette comprising a nucleic acid according to the present invention, a vector comprising an expression cassette or a nucleic acid according to the present invention, a host cell comprising a vector, an expression cassette or an acid nucleic acid according to the present invention, and a non-human transgenic organism comprising a cell, a vector, an expression cassette or a nucleic acid according to the present invention.
  • the present invention relates to the use of a protein, a nucleic acid, a host cell or a transgenic organism according to the present invention for the preparation of syn-CODV or cz 's-abiénol or derivatives of these.
  • the present invention finally relates to a non-human transgenic cell or organism, characterized in that the route of synthesis of the czs-abienol is blocked by inactivation of the gene coding for a syn-COVS according to the present invention or of the gene encoding a czs -abienol synthase according to the present invention or both genes.
  • Figure 1 Diagram of the biosynthesis of czs-abienol from geranylgeranyl diphosphate according to Carman and Duffield (1993).
  • syn-CODP syn-copalyl-8-ol diphosphate
  • czs-abienol czs-labda-12,14-dien-8 alpha-ol
  • A syn-copalyl-8-ol diphosphate synthase (syn-COPS)
  • B czs-abienol synthase (ABS)
  • C Phosphatase.
  • Figure 2 Tobacco gene fragment expression level coding for CPS and KS related proteins. Quantitative analysis of the expression was performed on cDNAs by quantitative PCR in real time with primers specific for each of the genes. The cDNAs were synthesized from total RNA isolated from leaves and trichomes of tobacco leaves.
  • Figure 2A Level of gene expression in trichomes relative to leaves. The y-axis represents the ratio of the value obtained in the trichomes to that obtained in the leaves.
  • Figure 2B Level of gene expression relative to the NtCBTS-02 gene whose expression is trichome-specific. The y-axis represents the ratio of the values obtained in trichomes on the value obtained for the CBTS gene in trichomes.
  • NtCBTS-02 CBT-ol synthase (NID: AF401234)
  • NtCYP71D16B CBT-ol hydroxylase similar to CYP71D16 (NID: AF166332).
  • FIG. 3 Schematic representation of T-DNAs carrying NtCPS2 and NtKSL3 transgenes.
  • km kanamycin resistance gene
  • e35S cauliflower mosaic virus 35S promoter enhancer.
  • CBTSter terminator of the CBTS gene
  • eCBTSl.O lkb promoter of the CBTS gene fused with the 35S promoter of cauliflower mosaic virus.
  • NtCPS2 coding phase of the gene encoding the Tobacco SPC (N. tabacum);
  • NtKSL3 coding phase of the gene coding for tobacco SPC
  • Figure 4 Analysis of plant exudates by gas chromatography.
  • the exudates from the plant leaves were extracted with a pentane solution and analyzed by gas chromatography coupled with mass spectrometry.
  • Figure 5 Mass spectrum of the peak corresponding to the czs-abienol obtained after gas chromatography performed from the exudates of the plant # 3513 bearing transgenes NtCPS2 and NtKSL3.
  • Figure 5A Mass spectrum of a cis-abienol standard.
  • Figure 5B Mass spectrum corresponding to the peak No. 1 of Figure No. 4.
  • Figure 6 Analysis of activity tests carried out in vitro with NtCPS2.
  • Figure 6A GC / MS of the compounds extracted from the reaction medium.
  • Figure 7 Mass spectrum of peak No. 3 of Figure 6 corresponding to 9-beta labda-13-en-8,15-diol
  • Figure 7A Exudates of N. tabacum.
  • Figure 7B Activity test performed with NtCPS2.
  • CBTS cembratrien-ol synthase czs-abienol: czs-labda-12,14-dien-8 alpha-ol syn-COOF: 9-beta labda-13-en-8-ol-15-yl trihydrogen diphosphate or syn-copalyl-8-ol diphosphate syn-COVS: syn-copalyl-8-ol diphosphate synthase or 9-beta labda-13-en-8-ol-15-yl trihydrogen diphosphate synthase or syn-CODP synthase
  • CPS copalyl diphosphate synthase GC: gas chromatography
  • GGPP geranyl geranyl diphosphate
  • KS kaurene synthase ihpRNAi: intron hairpin RNA interfere MS: mass spectrometry
  • RACE "rapid amplification of cDNA ends”
  • SSC sodium chloride-Sodium Citrate
  • the present invention thus describes for the first time the genes encoding the enzymes involved in the czs-abienol synthesis pathway.
  • the present invention relates to the characterization of tobacco czs-labda-12,14-dien-8 alpha-ol synthase (cz ' s-abienol synthase, ABS) which allows the production of czs-labda-12,14 -dien-8 alpha-ol (cis-abienol), a diterpene belonging to the labdane family, from 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate (syn-copalyl-8) -ol-diphosphate, syn-CODV).
  • tobacco syn-copalyl-8-ol diphosphate synthase (syn-COPS) which allows the production of 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate.
  • syn-copalyl-8-ol-diphosphate syn-CODP
  • These enzymes can be used for the production of czs-abienol or syn-COOF, in vitro or in vivo in transgenic organisms or recombinant cells or microorganisms.
  • Transgenic organisms, cells or micro-organisms such as bacteria, yeasts, animal, insect or plant cells and transgenic plants or animals are considered.
  • the present invention therefore relates to a method for producing cis-abienol or derivatives thereof from GGPP in a cell having a source of GGPP, comprising: a) introducing into said cell a construction carrying a cassette expression system comprising a gene encoding a syn-COPS, said synthase having at least 80% identity with SEQ ID No. 22 and a construct carrying an expression cassette comprising a gene encoding a czs-abienol synthase said synthase having at least 80% identity with SEQ ID No.
  • the produced czs-abienol is harvested in step c).
  • the cis-abienol product is the starting material to obtain another compound of interest such as Ambrox®.
  • syn-copalyl-8-ol diphosphate syn-CODP
  • syn-COPS an enzyme capable of producing 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate (syn -copalyl-8-ol-diphosphate, syn-CODV) from GGPP (geranyl geranyl diphosphate).
  • cz ' 5-labda-12,14-dien-8 alpha-ol synthase or czs-abienol synthase or ABS is meant an enzyme capable of producing czs-abienol or czs-labda-12,14-dien-8 alpha-ol from 9-beta-labda- 13-en-8-ol-15-yl trihydrogen diphosphate.
  • said cell produces GGPP.
  • the GGPP is provided to the cell.
  • the two expression cassettes are carried by the same construction. In another embodiment, the two expression cassettes are carried by two distinct constructions.
  • the present invention thus relates to a method for producing cis-abienol or derivatives thereof from GGPP in a recombinant cell having a source of GGPP and comprising a heterologous gene encoding a syn-copalyl-8-ol diphosphate ( syn-CODP) synthase having at least 80% identity with SEQ ID No. 22 and a heterologous gene encoding a czs-abienol synthase having at least 80% identity with SEQ ID No. 24.
  • syn-CODP syn-copalyl-8-ol diphosphate
  • the origin of the gene may be different from the cell into which it is introduced.
  • the gene is said to be heterologous because it is under the control of a promoter other than its natural promoter, it is introduced in a different place from where it is located naturally.
  • the host cell may contain a copy of the endogenous gene prior to the introduction of the heterologous gene or it may not contain an endogenous copy.
  • the present invention relates to an isolated or recombinant polypeptide having syn-copalyl-8-ol diphosphate (syn-CODP) synthase activity and having a sequence of at least 80%, 85%, 90%, 95% or 98% thereof. identity with SEQ ID No. 22.
  • the polypeptide has at least 90 or 95% identity with SEQ ID No. 22.
  • the polypeptide comprises or consists of the sequence SEQ ID No. 22.
  • This polypeptide probably has a plastid targeting sequence. It is located at the N-terminus of the protein and generally comprises about the first 50 amino acids. Such a truncated polypeptide of the plastid targeting sequence is also considered.
  • the present invention relates to a polypeptide according to the present invention having a deletion of the 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or 55 N-terminal amino acids.
  • This polypeptide may also comprise an additional sequence making it possible to facilitate the purification of the enzyme, for example a tag sequence comprising several consecutive histidine amino acids.
  • the present invention also relates to an isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having syn-copalyl-8-ol diphosphate (syn-CODP) synthase activity and having a sequence of at least 80%, 85%, 90%, 95% or 98% identity with SEQ ID No. 22.
  • An exemplary nucleic acid is nucleic acid comprising or consisting of a sequence having at least 80%, 85%, 90%, 95% or 98% d identity with SEQ ID No. 21 or a sequence complementary thereto this.
  • the present invention relates to an isolated nucleic acid capable of hybridizing under conditions of high stringency to a nucleic acid which encodes a polypeptide having syn-copalyl-8-ol diphosphate (syn-CODP) synthase activity and whose sequence is present. at least 80%, 85%, 90%, 95% or 98% identity with SEQ ID No. 22.
  • the nucleic acid comprises or consists of SEQ ID No. 21.
  • the invention also relates to an expression cassette, a vector, a host cell or a transgenic organism comprising a nucleic acid according to the present invention.
  • High stringency conditions include a wash step of about 0.1 x SSC at 65 ° C.
  • the nucleic acids can be genomic DNAs, complementary DNAs (cDNAs) or synthetic DNAs. They can be in simple chain or duplex form or a mixture of both.
  • the transcribed nucleic acids are preferably cDNAs devoid of introns.
  • the transcribed nucleic acids may be synthetic or semi-synthetic, recombinant, optionally amplified or cloned in vectors, chemically modified or comprising non-natural bases. These are typically isolated DNA molecules, synthesized by recombinant techniques well known to those skilled in the art.
  • the present invention relates to an isolated or recombinant polypeptide having czs-abienol synthase activity and whose sequence has at least 95% or 98% identity with SEQ ID No. 24.
  • the polypeptide comprises or consists of the sequence SEQ ID No. 24.
  • This polypeptide probably has a plastid targeting sequence. It is often located at the N-terminus of the protein and generally comprises about the first 50 amino acids. Such a truncated polypeptide of the plastid targeting sequence is also considered.
  • the present invention relates to a polypeptide according to the present invention having a deletion of the 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or 55 N-terminal amino acids.
  • the present invention relates to an isolated or recombinant polypeptide having czs-abienol synthase activity and whose sequence has at least 98% identity with SEQ ID No. 24.
  • This polypeptide may also include an additional sequence allowing facilitate the purification of the enzyme, for example a tag sequence comprising several consecutive histidine amino acids.
  • the present invention also relates to an isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having cz ' s-abenolol synthase activity and whose sequence has at least 95% or 98% identity with SEQ ID No. 24.
  • An example nucleic acid is the nucleic acid comprising or consisting of a sequence having at least 95% or 98% identity with SEQ ID No. 23 or a complementary sequence thereof.
  • the present invention relates to an isolated nucleic acid capable of hybridizing under high stringency conditions to a nucleic acid which encodes a polypeptide having cz ' s-abienol synthase activity and whose sequence has at least 95% or 98% d identity with SEQ ID No. 24.
  • the nucleic acid comprises or consists of the sequence SEQ ID No. 23.
  • the present invention also relates to an expression cassette, a vector, a host cell or a transgenic organism comprising a nucleic acid according to the present invention.
  • the present invention particularly relates to a vector, a host cell or a transgenic organism comprising a nucleic acid comprising a heterologous sequence encoding a polypeptide having a cz ' s-abienol synthase activity and having a sequence of at least 80%, 85%, 90%, 95% or 98% identity with SEQ ID No. 24 and a nucleic acid comprising a heterologous sequence encoding a polypeptide having syn-copalyl-8-ol diphosphate (syn-CODP) synthase activity and whose sequence has at least 80%, 85%, 90%, 95% or 98% identity with SEQ ID No. 22.
  • the transgenic organism is a plant, particularly a glandular trichome plant.
  • the present invention relates to a method for producing cis-abienol or derivatives thereof from GGPP comprising contacting GGPP with a syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least 80 % identity with SEQ ID No. 22 and a czs-abienol synthase having at least 80% identity with SEQ ID No. 24 under appropriate conditions and harvesting cz ' s-abienol or derivatives thereof obtained. It relates to the use of a syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least 80% identity with SEQ ID No.
  • the present invention relates to a method for producing syn-copalyl-8-ol diphosphate or derivatives thereof from GGPP comprising contacting the
  • GGPP with syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least
  • the method further comprises incubating the obtained syn-copalyl-8-ol diphosphate with a phosphatase and harvesting 9-beta-labda-13-en-8,15-diol.
  • the present invention relates to the use of a syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least
  • the present invention relates to a method for producing cis-abienol or derivatives thereof from syn-copalyl-8-ol diphosphate comprising contacting syn-copalyl-8-ol diphosphate with a czs-abienol synthase. having at least 80% identity with SEQ ID No. 24 under appropriate conditions and harvesting cis-abienol or derivatives thereof. It concerns the use of a czs-synthase abiénol having at least 80% identity with SEQ ID No. 24 for the preparation of cz 's-abiénol or derivatives thereof from syn-copalyl-8 -ol diphosphate.
  • an expression cassette comprises all the elements necessary for the transcription and translation of the gene into a protein.
  • it comprises a promoter, possibly an amplifier, a transcription terminator and the elements allowing the translation.
  • the promoter is adapted to the host cell.
  • the promoter can be selected from the following promoters: LacI, LacZ, pLacT, ptac, pARA, pBAD, T3 or T7 bacteriophage RNA polymerase promoters, polyhedrin promoter, PR or PL promoter of phage lambda.
  • the promoter can be selected from the following promoters: CMV early promoter, HSV thymidine kinase promoter, SV40 early or late promoter, mouse metallothionein-L promoter, and LTR regions of some retro viruses.
  • the vector may be a plasmid, a fold, a phagemid, a cosmid, a virus, a YAC, a BAC, a plasmid pTi ⁇ 'Agrobacterium, etc.
  • the vector may preferably comprise one or more elements selected from an origin of replication, a multiple cloning site and a marker.
  • the marker may be a reporter gene that generates a detectable signal.
  • the detectable signal may be a fluorescent signal, a color, a light emission.
  • the marker may therefore be GFP, EGFP, DsRed, beta-galactosidase, luciferase, etc.
  • the marker is preferably a selection marker providing the cell with resistance to an antibiotic.
  • the gene may be a resistance gene for kanamycin, neomycin, etc.
  • the vector is a plasmid.
  • prokaryotic vectors examples include pQE70, pQE60, pQE-9 (Qiagen), pbs, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene) ); ptrc99a, pKK223-3, pKK233-3, pDR540, pBR322, and pRIT5 (Pharmacia), pET (Novagen) and pQE-30 (QIAGEN).
  • eukaryotic vectors examples include pWLNEO, pSV2CAT, pPICZ, pcDNA3.1 (+) Hyg (Invitrogen), pOG44, pXT1, pSG (Stratagene); pSVK3, pBPV, pCI-neo (Stratagene), pMSG, pSVL (Pharmacia);
  • the viral vectors may be non-exhaustively adenoviruses, AAVs, HSVs, lentiviruses, etc.
  • the expression vector is a plasmid or a viral vector.
  • the host cell may be a prokaryote, for example Escherichia coli, Bacillus subtilis, Streptomyces sp, and Pseudomonas sp or a eukaryotic.
  • the eukaryote may be a lower eukaryote such as a yeast (eg, Saccharomyces cerevisiae) or a filamentous fungus (eg Aspergillus genus) or a higher eukaryote such as an insect, mammalian or plant cell.
  • the cell may be a mammalian cell, for example COS, CHO (US 4,889,803; US 5,047,335).
  • the cell is non-human and non-embryonic.
  • the cell can be isolated, for example in a culture medium.
  • the cells may also be included in organisms, for example transgenic non-human animals or transgenic plants.
  • the present invention thus relates to a method for producing 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate or derivatives thereof from GGPP in a cell having a source of GGPP, comprising a) introducing into said cell a construct carrying an expression cassette comprising a gene coding for a syn-copalyl-8-ol diphosphate
  • synthase (syn-CODP) synthase, said synthase having at least 80% identity with SEQ ID No. 22; b) culturing the transformed cell under conditions appropriate for the expression of the gene; and, c) optionally, harvesting the syn-copalyl-8-ol diphosphate or derivatives thereof contained in said cell and / or in the culture medium.
  • the syn-copalyl-8-ol diphosphate product is harvested in step c).
  • the syn-copalyl-8-ol diphosphate product is the starting material to obtain another compound of interest such as 9-betalabda-13-en-8,15-diol.
  • syn-copalyl-8-ol diphosphate can be converted to 9-beta-labda-13-en-8,15-diol by phosphatase.
  • the method may further comprise in step a) the introduction of a construct carrying an expression cassette comprising a gene coding for a phosphatase, thus allowing the harvesting of 9-beta-labda-13-en.
  • the present invention thus relates to a method for producing syn-copalyl-8-ol diphosphate or derivatives thereof from GGPP in a recombinant cell having a GGPP source and comprising a heterologous gene encoding a syn-copalyl- 8-ol diphosphate (syn-CODP) synthase having at least 80% identity with SEQ ID No. 22.
  • syn-CODP syn-copalyl- 8-ol diphosphate
  • the present invention thus relates to a method for producing cis-abienol or derivatives thereof from syn-copalyl-8-ol diphosphate in a cell having a syn-copalyl-8-ol diphosphate source, comprising: a) introducing into said cell a construct carrying an expression cassette comprising a gene coding for a czs-labda-12,14-dien-8 alpha-ol synthase having at least 80% identity with the SEQ ID No 24; b) culturing the transformed cell under conditions appropriate for gene expression; and, c) optionally, harvesting the cis-abienol or derivatives thereof contained in said cell and / or in the culture medium.
  • the produced czs-abienol is harvested in step c).
  • the cis-abienol product is the starting material to obtain another compound of interest such as Ambrox®.
  • the present invention thus relates to a method for producing cis-abienol or derivatives thereof from syn-copalyl-8-ol diphosphate in a recombinant cell having a source of syn-copalyl-8-ol diphosphate and comprising a heterologous gene encoding a czs-labda-12,14-dien-8 alpha-ol synthase having at least 80% identity with SEQ ID No. 24.
  • the cell may also be part of a multicellular organism, for example a non-human plant or animal.
  • the method comprises: a) introducing into a cell of the organism a construct carrying an expression cassette comprising a gene encoding a syn-copalyl-8-ol diphosphate (syn-CODP) synthase with at least 80% identity with the
  • SEQ ID No. 22 and a construct carrying an expression cassette comprising a gene coding for a czs-labda-12,14-dien-8 alpha-ol synthase having at least 80% identity with SEQ ID No. 24 ; b) reconstituting an organism from said cell and selecting the transgenic organisms expressing the two introduced genes; and c) harvesting the cz 's-abiénol product or derivatives thereof in said transgenic organisms.
  • the organism is a non-human animal.
  • the body can be a mouse, a rat, a guinea pig, a rabbit, etc.
  • the organism is a plant, preferably a glandular trichome plant. The method allows to produce czs-abiénol to organizations that do not produce this compound or increase the amount of cz 's-abiénol produced by organisms already occurring.
  • the present invention also relates to a method for producing 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate or derivatives thereof comprising: a) introducing into a cell of the organism of a construct carrying an expression cassette comprising a gene encoding a syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least 80% identity with the
  • the organism is a non-human animal.
  • the body can be a mouse, a rat, a guinea pig, a rabbit, etc.
  • the organism is a plant, preferably a glandular trichome plant. The method makes it possible to produce syn-copalyl-8-ol diphosphate in organisms which do not produce this compound or to increase the amount of syn-copalyl-8-ol diphosphate produced by organisms.
  • the present invention also relates to a method for producing cis-abienol or derivatives thereof comprising: a) introducing into a cell of the body a construct carrying an expression cassette comprising a gene coding for a czs-abienol synthase having at least 80% identity with SEQ ID No. 24; b) reconstituting an organism from said cell and selecting the transgenic organisms expressing the two introduced genes; and c) harvesting the cz 's-abiénol product or derivatives thereof in said transgenic organisms.
  • the organism is a non-human animal.
  • the body can be a mouse, a rat, a guinea pig, a rabbit, etc.
  • the organism is a plant, preferably a glandular trichome plant. The method allows to produce czs-abiénol to organisms that do not produce this compound or to increase the amount of cz 's-abiénol produced by organisms.
  • the invention is particularly applicable to all plants of families with glandular trichomes, for example the Asteraceae (sunflower, etc.), Solanaceae (tomato, tobacco, potato, pepper, eggplant, etc.), Cannabaceae (ex Cannabis sativa) and Lamiaceae (mint, basil, lavender, thyme, etc.). It is particularly adapted to plants of the family Solanaceae, such as for example genera Solanum, Capsicum, Petunia, Datura, Atropa, etc., and in particular of the Nicotiana genus, for example tobacco grown ⁇ Nicotiana tabacum), and more particularly wild tobacco Nicotiana syîvestris.
  • Solanaceae such as for example genera Solanum, Capsicum, Petunia, Datura, Atropa, etc.
  • Nicotiana genus for example tobacco grown ⁇ Nicotiana tabacum
  • wild tobacco Nicotiana syîvestris for example tobacco grown ⁇
  • the invention can be applied to plants of the following genera: Populus, Nicotiana, Cannabis, Pharbitis, Apteria, Psychotria, Mercurialis, Chrysanthemum, Polypodium, Pelargonium, Mimulus, Matricaria, Monarda, Solanum, Achillea, Valeriana, Ocimum, Medicago, Aesculus, Plumbago, Pityrogramma, Phacelia, Avicennia, Tamarix, Frankenia, Limonium, Foeniculum, Thymus, Salvia, Kadsura, Beyeria, Humulus, Mentha, Artemisia, Nepta, Geraea, Pogostemon, Majorana, Cleome, Cnicus, Parthenium, Ricinocarpos, Hymennaea, Larrea, Primula, Phacelia, Dryopteris, Plectranthus, Cypripedium, Petunia, Datura, Mucuna, Ricinus,
  • the plant is a plant of the family Asteraceae, Cannabaceae, Solanaceae or Lamiaceae.
  • the plant is of the genus Nicotiana, preferably Nicotiana sy ⁇ vestris or Nicotiana tabacum.
  • the genes are placed under the control of a promoter allowing expression, preferably specific, in the trichomes of the plant.
  • a promoter allowing expression, preferably specific, in the trichomes of the plant.
  • the term "specific" promoter is understood to mean a promoter mainly active in a given tissue or cell group. It is understood that a residual expression, generally lower, in other tissues or cells can not be entirely excluded.
  • a particular characteristic of the invention resides in the capacity to construct specific promoters of the secretory cells of the glandular trichomes, allowing a modification of the composition of the foliar secretions of the plant, and in particular to express the genes of the present invention making it possible to prepare cis-abienol.
  • syn-copalyl-8-ol diphosphate, czs-abienol or derivatives thereof can be harvested from the trichomes of these plants, particularly in the exudate of trichomes.
  • the promoter used in the cassette is derived from the Nicotiana sylvestris NsTPS-02a, 02b, 03, and 04 genes with strong sequence similarity to CYC-2 (CBT-1). ol cyclase, NID: AF401234). These promoter sequences are more fully described in the patent application WO2006040479.
  • Preferred terminator sequences include the NOS terminator (Bevan et al., 1983), and the histone gene terminator (EPO 633,317).
  • the expression cassette may comprise a sequence for increasing expression (“enhancer"), for example certain elements of the CaMV35S promoter and octopine synthase genes (US 5,290,924). .
  • the activating elements of the CaMV35S promoter are used.
  • constructs carrying one or both of the genes of the invention into a plant cell or tissue, including a seed or plant can be carried out by any technique known to those skilled in the art, including in episomal form or chromosome.
  • Plant transgenesis techniques are well known in the art, and include, for example, the use of the bacterium Agrobacterium tumefaciens, electroporation, biolistic techniques, transfection with a viral vector in particular, and any other technique known to those skilled in the art.
  • a commonly used technique relies on the use of the bacterium Agrobacterium tumefaciens, which consists essentially of introducing the construction of interest (acid nucleic acid, cassette, vector, etc.) in the bacterium A. tumefaciens, then to bring this transformed bacterium into contact with leaf disks of the chosen plant.
  • the introduction of the expression cassette into the bacterium is typically carried out using Ti (or T-DNA) plasmid as a vector, which can be transferred into the bacterium for example by thermal shock. Incubation of the transformed bacterium with the leaf disks makes it possible to obtain the transfer of the Ti plasmid into the genome of the cells of the disks.
  • transgenic plants may optionally be grown under conditions suitable for reconstituting a transgenic plant whose cells comprise the construction of the invention.
  • A. tumefaciens transformation technique reference may be made, for example, to Horsch et al. (1985) or Hooykaas and Schilperoort (1992).
  • the expression cassette thus formed is inserted between the left and right borders of the transfer DNA (T-DNA) of a disarmed Ti plasmid for transfer into plant cells by Agrobacterium. tumefaciens.
  • T-DNA also includes a gene whose expression confers resistance to an antibiotic or a herbicide and which allows the selection of transformants.
  • transgenic plants can be tested for the heterologous expression of genes of the present invention or the production of cz 's-abiénol or syn- copalyl-8-ol diphosphate in the trichomes. This can be accomplished by harvesting leaf exudate and testing for the presence of the product of interest in this exudate. This can also be done by analyzing the presence of one or more heterologous enzymes of the present invention in the leaves and, more particularly, in the trichome cells (for example by analyzing mRNA or genomic DNA using probes or specific primers). Plants can optionally be selected, crossed, processed, etc. to obtain plants with improved levels of expression.
  • Another subject of the invention also resides in a plant or seed comprising a nucleic acid, an expression cassette or a vector as defined above.
  • the present invention finally relates to a non-human transgenic cell or organism, characterized in that the route of synthesis of the czs-abienol is blocked by inactivation of the gene coding for a syn-copalyl-8-ol diphosphate (syn-CODP) synthase according to the present invention or the gene coding for czs-abienol synthase according to the present invention or both genes.
  • the expression of these genes can be blocked by many techniques available and known to those skilled in the art.
  • the genes can be deleted, mutated (for example by chemical mutagenesis by ethyl methane sulphonate or by ionizing radiation) or interrupted (insertional mutagenesis).
  • the blocking of the expression of these genes can also be achieved by gene silencing by expressing an inhibitory transcript.
  • the inhibitory transcript is an RNA which can be in the form of a double-stranded RNA, an antisense RNA, a ribozyme, an RNA capable of forming a triple helix, and which has a certain complementarity or specificity with the transcript of the gene to block.
  • the present invention also relates to a nucleic acid capable of decreasing or suppressing the expression of a gene encoding syn-copalyl-8-ol diphosphate (syn-CODV) synthase.
  • a nucleic acid capable of decreasing or suppressing the expression of a gene encoding syn-copalyl-8-ol diphosphate (syn-CODV) synthase.
  • an inhibitory RNA which can be in the form of a double-stranded RNA, an antisense RNA, a ribozyme, an RNA capable of forming a triple helix, and which has a certain complementarity or specificity with the gene encoding syn-copalyl-8-ol diphosphate (syn-CODP) synthase can be prepared on the basis of the teaching of the present invention.
  • the present invention relates to an inhibitory RNA of the gene encoding syn-copalyl-8-ol diphosphate (syn-CODP) synthase comprising at least 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of SEQ ID No. 21 or a complementary sequence thereof.
  • a polynucleotide comprising at least 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of SEQ ID No. 21 or a complementary sequence thereof to inhibit expression of the gene encoding syn-copalyl-8-ol diphosphate (syn-CODP) synthase.
  • the inhibition of this enzyme may be useful to stop or slow synthesis pathway cz 's- abiénol and make GGPP available for another synthetic pathway of interest requiring intake GGPP.
  • the inhibition of this enzyme may make it possible to increase the production rate of CBT-diol by the glandular cells of tobacco leaf trichomes.
  • the present invention thus relates to transgenic cells or organisms in which the gene encoding syn-copalyl-8-ol diphosphate (syn-CODP) synthase has been inactivated. Inactivation can be performed by interfering RNA, gene deletion, chemical mutation or homologous recombination inactivation techniques.
  • the present invention also relates to a nucleic acid capable of decreasing or suppressing the expression of a gene encoding a czs-abienol synthase.
  • an inhibitory RNA which can be in the form of a double-stranded RNA, an antisense RNA, a ribozyme, an RNA capable of forming a triple helix, and which has a certain complementarity or specificity with the gene encoding a cz 's- abiénol synthase can be prepared based on the teaching of the present invention.
  • the present invention relates to a gene encoding an inhibitory RNA cz 's- abiénol synthase comprising at least 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of SEQ ID NO 23.
  • a polynucleotide comprising at least 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of SEQ ID No. 23 for inhibiting the expression of the gene encoding a czs-abienol synthase.
  • Inhibition of this enzyme may be useful to stop the synthesis of cz channel 's-abiénol and make the syn-copalyl-8-ol diphosphate available for another synthetic pathway of interest requiring a contribution in this compound, for example, to prepare derivatives of syn-copalyl-8-ol diphosphate, for example, sclareol, or 9-beta labda-13-en-8,15-diol.
  • Sclareol is used industrially for the synthesis of ambroxides, such as Ambrox®, which are ingredients of the perfume industry.
  • the present invention thus relates to transgenic cells or organisms in which the gene encoding a czs-abienol synthase is inactivated. Inactivation can be performed by interfering RNA, gene deletion, chemical mutation or homologous recombination inactivation techniques. Thus the level of czs-abienol can be decreased in these cells or transgenic organisms.
  • KS kaurene synthase
  • CPS copalyl diphosphate synthase
  • FIG. 2A also shows that the NtKSL2 and NtKSL3 genes express themselves specifically in trichomes, whereas NtKSL1 is not specific for trichomes.
  • FIG. 2B indicates that the expression of the NtCPS2 gene in trichomes is comparable to that of the CBTS and CYP71D16B genes, since the expression ratio of the NtCPS2 gene on CBTS is close to 1, unlike the ratio NtCPS1 on CBTS which is very weak (10 ⁇ 4 ).
  • the same analysis concluded that the NtKSL3 gene expresses strongly and specifically in tobacco leaf trichome cells (Fig. 2A and 2B).
  • NtCPS2 and NtKSL3 genes were identified by standard 5 'RACE and 3' RACE PCR techniques using primers specific for each sequence (Table 2). CDNAs isolated from tobacco leaf trichomes (N. tabacum) were used as a template for PCR amplification. The 5 'and 3' fragments obtained for each of the different genes were assembled to form the NtCPS2 coding sequences of 2409 bases (SEQ ID No. 21) and NtKSL3 (SEQ ID No. 23) of 2379 bases respectively coding for proteins. of 802 AA (SEQ ID NO: 22) and 792 AA (SEQ ID NO: 24).
  • NtKSL3-like sequences were searched for in the SwissProt protein library using the BlastP program (Altschul et al., 1997). The highest percentage identity was obtained with pumpkin (45%) and crustacean (44%) entangaurene synthase (Table 3). It can also be noted that the NtKSL3 sequence has a very high degree of identity (90%) with a putative tobacco terpene cyclase (Wang and Wagner, 2005, PID AAS98912.1). Indeed, the segment 1-722 of this sequence of 759 residues corresponds to segment 46-766 of the sequence NtKSL3, the remaining segment 723-759 having no relation with the sequence NtKSL3. The function of this protein, however, has not been demonstrated. Table 2:
  • Ent-kaurene synthase A Pisum sativum 004408 Ent-copalyldiphosphate synthase 44 ent-kaurene synthase A, Arabidopsis thahana Q38802 Ent-copalyldiphosphate synthase 45 chloroplast precursor
  • NtCPS2-HisTAG a protein encoded by NtCPS2
  • the nucleic sequence coding for NtCPS2 was introduced into the pET-30b expression vector (Novagen).
  • the STOP codon of the sequence was removed to create a C-terminal histidine tail fusion protein.
  • the vector NtCPS2-pET30b was introduced by electroporation into expression E. coli cells (BL21-CodonPlus, Stratagene).
  • the production of the protein in these cells was induced by the addition of 1 mM IPTG at 160 ° C., starting from 500 ml of culture. After 18 hours of induction, the cells are collected by centrifugation and lysed by a depression shock ( ⁇ P: 19 bar).
  • the soluble proteins desalted on a PD10 column (Amersham) are applied to a nickel-nitrilotriacetic agarose affinity resin (Ni-NTA) according to the manufacturer's protocol (Qiagen).
  • the activity tests were carried out on the protein fraction enriched in NtCPS2-HisTag in a buffer containing 50 mM Hepes, 100 mM KCl, 7.5 mM MgCl 2 , 5% glycerol, and 5 mM DTT.
  • FPP, GGPP were tested separately at a concentration of 65 ⁇ M with 25 or 50 ⁇ g of proteins, incubated at 32 0 C for 2 hours.
  • the products of the reaction were then dephosphorylated by adding 20 units of calf intestinal alkaline phosphatase (New England Biolabs) for 1 hour at 37 ° C.
  • the products were extracted with a chloroform: methanol: water (5%) mixture. : 1: 4).
  • the aqueous and organic phases are separated by centrifugation, the organic phase is dried under a stream of nitrogen, taken up in pentane and analyzed by GC / MS.
  • NtCPS2-HisTAG The enzymatic function of NtCPS2 was studied by the production of the recombinant enzyme NtCPS2-HisTAG from E. coll. The soluble enzyme mixture obtained from the E. coli disruption was then loaded onto an affinity column. An enrichment factor of 15 to 20 is evaluated by SDS gel electrophoresis. To demonstrate its function, NtCPS2-HisTAG was incubated with 3 different substrates: GPP, FPP and GGPP. No new products were detected with GPP or FPP showing that NtCPS2-HisTAG does not use these substrates. On the other hand, when GGPP has been used, a new diterpen-diol appears.
  • NtKSL3 and NtCPS2 Identification of the function of proteins encoded by NtKSL3 and NtCPS2.
  • NtKSL3 and NtCPS2 genes their sequences were introduced by genetic transformation into N. sy ⁇ vestris, a wild tobacco that does not produce cz ' s-abienol and in a transgenic N. syîvestris line (ihpCBTS source line). whose expression of the CBTS gene was inhibited by RNA interference (Tissier et al., 2005). In this line, the amount of CBT-diol of the leaves is very small.
  • a specific trichome tobacco promoter (eCBTS1.0, Tissier et al., 2004) was put upstream of the coding sequences NtCPS2 and NtKSL3 to form the constructs eCBTS1.0-NtCPS2 [# 1] and eCBTS1.0-NtKSL3 [# 2]. These two constructions were introduced in the same binary vector containing a kanamycin resistance gene to give the pLIBRO-58 binary vector (Fig. 3A). Constructs # 1 and # 2 were also independently introduced into the same vector to form the binary vectors pLIBRO-68 (Fig. 3B) and pLIBRO-69 (Fig. 3C), respectively.
  • the vectors were introduced into the strain of Agrobacterium LBA4404 by electroporation.
  • the strains containing the different vectors were used to carry out the genetic transformation of N. sylvestris by the leaf disk method (Horsch et al., 1985).
  • About 25 kanamycin resistant plants were obtained for each construct.
  • the presence of transgenes in each plant was confirmed by PCR from genomic leaf DNA.
  • the expression level of the transgenes was verified by RT-PCR from tobacco leaf mRNA.
  • the plant exudates that express the transgenes were extracted by immersion in pentane solution for 1 min. The extracts were analyzed by gas chromatography coupled to a mass spectrum (GC / MS).
  • FIG. 4 An example of a chromatographic profile of the exudates of plants obtained by GC / MS is presented in FIG. 4. It shows that the exudate of a transgenic line containing the NtCPS2 and NtKSL3 genes contains an additional peak noted at # 40, 5 min. The exact superimposition of the retention times and peak mass spectra at 40.5 min with that of the czs-abienol naturally produced by N. tabacum (FIGS. 4A and 5A), demonstrates the authenticity of peak no. being the czs-abienol. Plants that express both NtCPS2 and NtKSL3 transgenes produce significant amounts of czs-abienol in the ihpCBTS line (Table 5).
  • Rates of czs-abienol and CBT-diol in the exudates of transgenic plants that integrated and expressed the NtCPS2 and NtKSL3 transgenes Quantification of czs-abienol was performed by GC / MS in comparison with a standard of czs-abienol purified from exudate of N. tabacum leaves.
  • N. sylvestris ihpCBTS Transgenic line whose expression of the CBTS gene was inhibited by RNA interference.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne les gènes impliqués dans la voie de biosynthèse du cis- abiéno l, une syn-copalyl-8-ol diphosphate (syn-CODP) synthase et une cis-labda-12,14-dien-8 alpha-ol synthase, et leurs utilisations pour la production de cis-abiénol.

Description

GENES CODANT POUR LA CIS-LABD A-12,14-DIEN-8 ALPHA-OL (CIS-
ABIÉNOL) SYNTHASE ET LA SKV-COPALYL-8-OL DIPHOSPHATE SYNTHASE ET LEURS UTILISATIONS
Domaine de l'Invention
La présente invention se rapporte à des gènes impliqués dans la synthèse du czs-abiénol et leur utilisation pour la préparation de celui-ci dans des organismes vivants tels que les bactéries, les levures, les cellules animales et les plantes.
Introduction
Les terpènes forment une classe nombreuse de molécules naturelles que l'on trouve dans tous les organismes vivants (bactéries, champignons, animaux, plantes). Chez les plantes, ils jouent des rôles variés, notamment dans l'attraction d'insectes bénéfiques pour la plante, et dans la défense vis-à-vis de pathogènes (bactéries, champignons, insectes). Les terpènes sont constitués de multiples d'unités isoprényles à 5 carbones. Le nombre d'unités isoprényles permet de les classer notamment en monoterpènes (composés à dix atomes de carbone ou ClO), sesquiterpènes (C 15), diterpènes (C20), triterpènes (C30), tetraterpènes (C40) et polyterpènes (>C45). Les voies de biosynthèse des précurseurs des terpènes ont largement été décrites dans la littérature (voir par exemple, Eisenreich et al, 2004). Les précurseurs universels de tous les terpènes sont l'isopentenyl diphosphate (IPP) et le diméthylallyl diphosphate (DMAPP). Deux voies distinctes conduisent à la formation de l'IPP et du DMAPP. L'une, la voie du mévalonate (MEV) est localisée dans le cytoplasme alors que l'autre, la voie du méthyl-erythritol (MEP), n'existe que chez certaines bactéries et les plantes où elle localisée dans les plastes. Toutes les étapes et les gènes codant les enzymes de ces deux voies sont connus. A partir des précurseurs, la première étape de la biosynthèse des terpènes est réalisée par des trαns-prényltransférases qui vont par condensation des deux précurseurs, l'IPP et le DMAPP, générer des chaînes de carbones constituées d'unités isoprényles (C5) de longueur variable. Ainsi, l'addition séquentielle d'une unité d'IPP à un DMAPP produit du trans- géranyl diphosphate (GPP, ClO), puis à partir du GPP du trαns, trαns- farnésyl diphosphate (FPP, C 15) et enfin à partir du FPP du trαns, trαns, trαns-géranyl géranyl diphosphate (GGPP, C20). Ces chaînes de prényl diphosphates de longueur variable sont les substrats d'une classe d'enzyme, les terpènes synthases qui permettent la formation du squelette de base des terpènes cycliques ou acycliques en ClO (monoterpène), C15 (sesquiterpène), C20 (diterpène), C30 (triterpène) (Cane, 1999; McMillan and Beale, 1999; Wise and Croteau, 1999). La diversité de réaction de ces enzymes est à l'origine de la diversité des squelettes terpéniques cycliques que l'on retrouve dans la nature.
Le tabac cultivé {Nicotiana tabacum) produit au niveau de ses trichomes, ou poils sécréteurs, une sécrétion dont plus de la moitié est composée de diterpènes appartenant à deux classes, les cembranes et les labdanes. Parmi les labdanes, le czs-abiénol est le composé majoritairement produit par un grand nombre de variétés de tabac (N. tabacum). Chez certaines variétés, la quantité de czs-abiénol peut représenter plus de 1% de la matière fraîche des feuilles. Le czs-abiénol participe positivement aux caractéristiques aromatiques des feuilles de tabac. Il peut également être utilisé comme précurseur dans la synthèse d'ambroxides, molécules utilisées dans l'industrie de la parfumerie.
Dans la famille des labdanes, d'autres molécules ont été caractérisées comme par exemple :
(i) le sclaréol qui est présent dans les tissus floraux de la sauge sclarée
(Salvia sclarea) mais également produit dans le tabac en réponse aux pathogènes ;
(ii) les oryzalexines et les phytocassanes produites chez le riz en réponse aux attaques de pathogènes ; et
(iii) les gibbérellines et leur précurseur, la ent-kaurene.
Il a été démontré que la biosynthèse du squelette labdanoïde à partir du GGPP nécessite deux étapes. Dans une première étape, le GGPP est transformé en ent- ou syn- copalyldiphosphate (ent- ou syn-CDP) par la ent- ou syn-copalyldiphosphate synthase (ent- ou syn-CPS), respectivement. Dans une seconde étape, le CDP est transformé en une oléfine labdanoïde par une labdane synthase. Les gènes codant pour ces deux types d'enzymes ont été clones chez de nombreuses plantes. Par exemple, chez Arabidopsis, les gènes AtGAl (Sun et al., 1994) et KX.GA2 (Yamaguchi et al., 1998) sont impliqués dans la biosynthèse des gibbérellines et codent pour la ent-copalyldiphosphate synthase (ent-CPS) et la ent-kaurene synthase, respectivement. Chez le riz, deux gènes codent pour la ent-CPS (OsCPSl et OsCPS2) et un gène pour la syn-CPS (OsCPS3). OsCPSl est responsable de la biosynthèse du précurseur des gibbérellines, la ent-kaurene (Sakamoto et al., 2004). OsCPS2 et OsCPS3 sont impliqués dans la biosynthèse des précurseurs de plusieurs phytoallexines de type labdane (ent-cassa-\2 ;15-diene ; ent-sandaracopimaradiene ;
Stemar-13-ene ; 9β-pimara-7,15-diene). Il existe dans le génome du riz neuf gènes homologues à la kaurene synthase d'Arabidopsis, notés OsKSl à 9 (Sakamoto et al, 2004). L'analyse de mutants déficients en acide gibbérellique a permis de démontrer que OsKSl code pour la ent-kaurene synthase (Sakamoto et al, 2004). Par ailleurs, la fonction de plusieurs OsKS a été déterminée in vitro après expression chez E. coli. Par exemple, OsKS7 et OsKSlO codent pour la ent-cassa-12,15-diene et la ent-sandaracopimaradiene, respectivement.
Chez le tabac, une activité de type czs-abiénol synthase a été détectée dans des cellules extraites à partir de trichomes. Cependant, les gènes codant pour la biosynthèse du cis- abiénol à partir du GGPP n'ont pas été identifiés. Comme pour l'ensemble des labdanoïdes, une molécule de type CDP est un intermédiaire probable dans la biosynthèse du czs-abiénol (Fig. 1). Plus particulièrement, la structure du czs-abiénol suggère que l'intermédiaire soit le syn-copalyl-8-ol diphosphate (syn-CODP) (Carman and Duffield, 1993, Guo et al, 1994). D'autres diterpènes labdanoïdes sont dérivés du copalyl-8-ol diphosphate, comme le sclaréol ou le (13E)-labdene-8,15-diol. La syn-CODP synthase, dont la séquence était inconnue à ce jour, constituerait donc la première étape de biosynthèse de ces molécules à partir du GGPP.
II existe une forte demande de procédés qui permettraient de produire à moindre coût des terpènes d'intérêt tels que l'abiénol ou le sclaréol qui sont difficilement accessibles à la synthèse. La caractérisation de la voie de synthèse du czs-abiénol permettrait de mettre au point des méthodes de production de cette molécule, très utile en parfumerie, ainsi que d'autres diterpènes labdanoïdes pouvant être préparés par cette voie de synthèse.
Résumé de l'Invention
L'invention concerne les activités enzymatiques, les séquences peptidiques responsables de ces activités et les séquences d'acide nucléique correspondantes, responsables de la biosynthèse du czs-abiénol à partir de GGPP. L'invention concerne également des méthodes de production du czs-abiénol ou de dérivés de celui-ci utilisant ces activités enzymatiques. La présente invention concerne donc une méthode de production du czs-abiénol ou de dérivés de celui-ci à partir de géranyl géranyl diphosphate (GGPP) dans une cellule ayant une source de GGPP, comprenant : a) l'introduction dans ladite cellule d'une construction portant une cassette d'expression comprenant un gène codant pour une syn-copalyl-8-ol diphosphate synthase (syn-COPS), ladite synthase présentant au moins 80 % d'identité avec la
SEQ ID No 22 et d'une construction portant une cassette d'expression comprenant un gène codant pour une czs-labda-12,14-dien-8 alpha-ol (= cz's-abiénol) synthase, ladite synthase présentant au moins 80 % d'identité avec la SEQ ID No 24 ; b) la culture de la cellule transformée dans des conditions appropriées pour l'expression des gènes ; et, c) facultativement, la récolte du czs-abiénol ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.
La présente invention concerne également une protéine isolée ou recombinante ayant une activité czs-abiénol synthase et ayant une séquence présentant au moins 95 % d'identité avec la SEQ ID No 24. Elle concerne aussi un acide nucléique comprenant une séquence nucléotidique codant pour une telle protéine, ou une séquence capable de s'hybrider à celui-ci dans des conditions stringentes et ayant une activité czs-abiénol synthase.
La présente invention concerne en outre une protéine isolée ou recombinante ayant une activité syn-COVS et ayant une séquence présentant au moins 80 % d'identité avec la SEQ ID No 22. Elle concerne aussi un acide nucléique comprenant une séquence nucléotidique codant pour une telle protéine, ou une séquence capable de s'hybrider à celui-ci dans des conditions stringentes et ayant une activité syn-COVS.
La présente invention concerne une cassette d'expression comprenant un acide nucléique selon la présente invention, un vecteur comprenant une cassette d'expression ou un acide nucléique selon la présente invention, une cellule hôte comprenant un vecteur, une cassette d'expression ou un acide nucléique selon la présente invention, et un organisme transgénique non- humain comprenant une cellule, un vecteur, une cassette d'expression ou un acide nucléique selon la présente invention. La présente invention concerne l'utilisation d'une protéine, d'un acide nucléique, d'une cellule hôte ou d'un organisme transgénique selon la présente invention pour la préparation de syn-CODV ou de cz's-abiénol ou de dérivés de ceux-ci.
La présente invention concerne enfin une cellule ou un organisme transgénique non- humain, caractérisé en ce que la voie de synthèse du czs-abiénol est bloquée par inactivation du gène codant pour une syn-COVS selon la présente invention ou du gène codant pour une czs-abiénol synthase selon la présente invention ou des deux gènes.
Brève Description des Figures
Figure 1 : Schéma de la biosynthèse du czs-abiénol à partir du géranylgéranyl diphosphate selon Carman and Duffield (1993). syn-CODP : syn-copalyl-8-ol diphosphate; czs-abiénol : czs-labda-12,14-dien-8 alpha-ol ; A : syn-copalyl-8-ol diphosphate synthase (syn-COPS) ; B : czs-abiénol synthase (ABS) C : Phosphatase.
Figure 2 : Niveau d'expression de fragment de gènes de tabac codant pour des protéines apparentées aux CPS et aux KS. L'analyse quantitative de l'expression a été réalisée sur des ADNc par PCR quantitative en temps réel avec des amorces spécifiques de chacun des gènes. Les ADNc ont été synthétisés à partir d'ARN totaux isolés de feuilles et de trichomes de feuilles de tabac. Figure 2A) Niveau d'expression des gènes dans les trichomes par rapport à celui des feuilles. L'axe des ordonnées représente le rapport de la valeur obtenue dans les trichomes sur celle obtenue dans les feuilles. Figure 2B) Niveau d'expression des gènes par rapport au gène NtCBTS-02 dont l'expression est trichome spécifique. L'axe des ordonnées représente le rapport des valeurs obtenues dans les trichomes sur la valeur obtenue pour le gène CBTS dans les trichomes. NtCBTS-02 : CBT- ol synthase (NID:AF401234) ; NtCYP71D16B : CBT-ol hydroxylase similaire à CYP71D16 (NID : AF166332).
Figure 3 : Représentation schématique des ADN-T portant les transgènes NtCPS2 et NtKSL3. km : gène de résistance à la kanamycine ; e35S : amplificateur du promoteur 35S du virus de la mosaïque du choux-fleur. CBTSter : terminateur du gène CBTS ; eCBTSl.O : promoteur de lkb du gène CBTS fusionné avec l'amplificateur du promoteur 35S du virus de la mosaïque du chou-fleur. NtCPS2 : phase codante du gène codant pour la CPS de tabac (N. tabacum) ; NtKSL3 : phase codante du gène codant pour la CPS de tabac
(N tabacum). Figure 3A) fragment ADN-T du vecteur binaire pLIBRO58 ; Figure 3B) fragment ADN-T du vecteur binaire pLIBRO68 ; Figure 3C) fragment ADN-T du vecteur binaire pLIBRO69.
Figure 4 : Analyse des exsudats de plantes par chromatographie en phase gazeuse. Les exsudats des feuilles de plantes ont été extraits avec une solution de pentane et analysés par chromatographie en phase gazeuse couplée à une spectrométrie de masse. Exemple de profils chromatographiques obtenus à partir d'extraits de feuilles de N. tabacum [Figure 4A], N. syîvestris [Figure 4B] et d'une lignée transgénique TO #3513 portant les transgènes NtCPS2 et NtKSL3 [Figure 4C]. La lignée transgénique #3513 a été obtenue à partir d'une lignée transgénique portant un transgène antisense de type ihpRNAi du gène CBTS. [1] czs-abiénol. Temps de rétention = 40.5 min ; [2] CBT-diol Temps de rétention = 43 min.
Figure 5 : Spectre de masse du pic correspondant au czs-abiénol obtenu après chromatographie en phase gazeuse réalisée à partir des exsudats de la plante #3513 portant les transgènes NtCPS2 et NtKSL3. Figure 5A) Spectre de masse d'un standard de cis- abiénol. Figure 5B) Spectre de masse correspondant au pic N° 1 de la figure N° 4.
Figure 6 : Analyse des tests d'activité réalisés in vitro avec NtCPS2. Figure 6A) GC/MS des composés extraits du milieu de réaction. Figure 6B) GC/MS des exsudats des feuilles de N. tabacum extraits avec une solution de pentane. [1] czs-abiénol, temps de rétention = 41 min ; [2] CBT-diol, temps de rétention = 43,4 min ; [3] 9-beta labda-13-en-8,15-diol, temps de rétention = 48,1 min.
Figure 7 : Spectre de masse du pic N°3 de la figure 6 correspondant au 9-beta labda-13-en- 8,15-diol Figure 7A) Exsudats de N. tabacum . Figure 7B) Test d'activité réalisé avec NtCPS2.
Abréviations
CBT-ol : cembratrien-ol
CBTS : cembratrien-ol synthase czs-abiénol : czs-labda-12,14-dien-8 alpha-ol syn-COOF : le 9-béta labda-13-en-8-ol-15-yl trihydrogen diphosphate ou le syn-copalyl-8- ol diphosphate syn-COVS : syn-copalyl-8-ol diphosphate synthase ou 9-béta labda-13-en-8-ol-15-yl trihydrogen diphosphate synthase ou syn-CODP synthase CPS : copalyl diphophosphate synthase GC : chromatographie gazeuse GGPP : géranyl géranyl diphosphate KS : kaurene synthase ihpRNAi : intron hairpin ARN interfèrent MS : spectrométrie de masse
RACE : « rapid amplification of cDNA ends » SSC : « Sodium chloride-Sodium Citrate »
Description Détaillée de l'Invention La présente invention décrit donc pour la première fois les gènes codant pour les enzymes impliquées dans la voie de synthèse du czs-abiénol. En particulier, la présente invention concerne la caractérisation de la czs-labda-12,14-dien-8 alpha-ol synthase (cz's-abiénol synthase, ABS) de tabac qui permet la production de czs-labda-12,14-dien-8 alpha-ol (cis- abiénol), un diterpène appartenant à la famille des labdanes, à partir du 9-beta-labda-13-en- 8-ol-15-yl trihydrogen diphosphate (syn-copalyl-8-ol-diphosphate, syn-CODV). En outre, elle concerne également la caractérisation de la syn-copalyl-8-ol diphosphate synthase (syn-COPS) de tabac qui permet la production de 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate (syn-copalyl-8-ol-diphosphate, syn-CODP) à partir de GGPP. Ces enzymes peuvent être utilisées pour la production de czs-abiénol ou de syn-COOF, in vitro ou in vivo dans des organismes transgéniques ou des cellules ou micro-organismes recombinants. Les organismes transgéniques, cellules ou micro -organismes tels que les bactéries, les levures, les cellules animales, d'insectes ou de plantes et les plantes ou animaux transgéniques sont considérés. Elles permettent également la production de composés dérivés du syn-CODV. Les procédés de la présente invention sont plus particulièrement applicables à la production de czs-abiénol dans les plantes possédant des trichomes glanduleux de type sécréteurs. La production de czs-abiénol peut également être diminuée ou supprimée dans des plantes, par exemple le tabac, par des techniques d'extinction de gènes. La présente invention concerne donc une méthode de production de czs-abiénol ou de dérivés de celui-ci à partir de GGPP dans une cellule ayant une source de GGPP, comprenant : a) l'introduction dans ladite cellule d'une construction portant une cassette d'expression comprenant un gène codant pour une syn-COPS, ladite synthase présentant au moins 80 % d'identité avec la SEQ ID No 22 et d'une construction portant une cassette d'expression comprenant un gène codant pour une czs-abiénol synthase, ladite synthase présentant au moins 80 % d'identité avec la SEQ ID No
24 ; b) la culture de la cellule transformée dans des conditions appropriées pour l'expression des gènes ; et, c) facultativement, la récolte du czs-abiénol ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.
Dans un mode de réalisation particulier, le czs-abiénol produit est récolté à l'étape c). Dans un autre mode de réalisation particulier, le czs-abiénol produit est le produit de départ pour obtenir un autre composé d'intérêt comme l'Ambrox®.
Par « syn-copalyl-8-ol diphosphate (syn-CODP) synthase » ou syn-COPS est entendue une enzyme capable de produire du 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate (syn-copalyl-8-ol-diphosphate, syn-CODV) à partit du GGPP (géranyl géranyl diphosphate).
Par « cz'5-labda-12,14-dien-8 alpha-ol synthase » ou czs-abiénol synthase ou ABS est entendue une enzyme capable de produire du czs-abiénol ou czs-labda-12,14-dien-8 alpha- ol à partir du 9-beta-labda- 13-en-8-ol- 15-yl trihydrogen diphosphate.
Dans un mode de réalisation préféré, ladite cellule produit du GGPP. Dans un autre mode de réalisation, le GGPP est fourni à la cellule.
Dans un mode de réalisation particulier, les deux cassettes d'expression sont portées par une même construction. Dans un autre mode de réalisation, les deux cassettes d'expression sont portées par deux constructions distinctes. La présente invention concerne donc une méthode de production de czs-abiénol ou de dérivés de celui-ci à partir de GGPP dans une cellule recombinante ayant une source de GGPP et comprenant un gène hétérologue codant pour une syn-copalyl-8-ol diphosphate (syn-CODP) synthase présentant au moins 80 % d'identité avec la SEQ ID No 22 et un gène hétérologue codant pour une czs-abiénol synthase présentant au moins 80 % d'identité avec la SEQ ID No 24. Par « hétérologue » est entendu que ce gène a été introduit par génie génétique dans la cellule. Il peut y être présent sous forme épisomale ou chromosomique. L'origine du gène peut être différente de la cellule dans laquelle il est introduit. Par exemple, le gène est dit hétérologue car il est sous le contrôle d'un promoteur autre que son promoteur naturel, il est introduit dans un endroit différent de celui-ci où il est situé naturellement. La cellule hôte peut contenir une copie du gène endogène au préalable de l'introduction du gène hétérologue ou elle peut ne pas contenir de copie endogène.
La présente invention concerne un polypeptide isolé ou recombinant ayant une activité de syn-copalyl-8-ol diphosphate (syn-CODP) synthase et dont la séquence présente au moins 80%, 85%, 90%, 95% ou 98% d'identité avec la SEQ ID No 22. De préférence, le polypeptide présente au moins 90 ou 95% d'identité avec la SEQ ID No 22. Dans un mode de réalisation particulier, le polypeptide comprend ou consiste en la séquence SEQ ID No 22. Ce polypeptide présente probablement une séquence d'adressage vers les plastes. Elle est située à l'extrémité N-terminale de la protéine et comprend généralement environ les 50 premiers acides aminés. Un tel polypeptide tronqué de la séquence d'adressage vers les plastes est également considéré. Ainsi, la présente invention concerne un polypeptide selon la présente invention présentant une délétion des 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 ou 55 acides aminés N-terminaux. Ce polypeptide peut également comprendre une séquence additionnelle permettant de faciliter la purification de l'enzyme, par exemple une séquence étiquette comprenant plusieurs acides aminés histidine consécutifs.
La présente invention concerne également un acide nucléique isolé comprenant une séquence nucléotidique codant un polypeptide ayant une activité de syn-copalyl-8-ol diphosphate (syn-CODP) synthase et dont la séquence présente au moins 80%, 85%, 90%, 95% ou 98% d'identité avec la SEQ ID No 22. Un exemple d'acide nucléique est l'acide nucléique comprenant ou consistant en une séquence présentant au moins 80%, 85%, 90%, 95% ou 98% d'identité avec la SEQ ID No 21 ou une séquence complémentaire de celle- ci. La présente invention concerne un acide nucléique isolé capable de s'hybrider dans des conditions de forte stringence à un acide nucléique qui code un polypeptide ayant une activité de syn-copalyl-8-ol diphosphate (syn-CODP) synthase et dont la séquence présente au moins 80%, 85%, 90%, 95% ou 98% d'identité avec la SEQ ID No 22. Dans un mode de réalisation particulier, l'acide nucléique comprend ou consiste en la séquence SEQ ID No 21. La présente invention concerne également une cassette d'expression, un vecteur, une cellule hôte ou un organisme transgénique comprenant un acide nucléique selon la présente invention. Les conditions de forte stringence incluent une étape de lavage d'environ 0,1 x SSC à 65°C.
Les acides nucléiques peuvent être des ADN génomiques, des ADN complémentaires (ADNc) ou des ADN synthétiques. Ils peuvent être sous forme simple chaîne ou en duplexe ou un mélange des deux. Dans le cadre de la présente invention, les acides nucléiques transcrits sont de préférence des ADNc dénués d'introns. Les acides nucléiques transcrits peuvent être des molécules synthétiques ou semi-synthétiques, recombinantes, éventuellement amplifiées ou clonées dans des vecteurs, modifiées chimiquement ou comprenant des bases non naturelles. Il s'agit typiquement de molécules dADN isolées, synthétisées par des techniques recombinantes bien connues en soi de l'homme du métier.
La présente invention concerne un polypeptide isolé ou recombinant ayant une activité de czs-abiénol synthase et dont la séquence présente au moins 95% ou 98% d'identité avec la SEQ ID No 24. Dans un mode de réalisation particulier, le polypeptide comprend ou consiste en la séquence SEQ ID No 24. Ce polypeptide présente probablement une séquence d'adressage vers les plastes. Elle est souvent située à l'extrémité N-terminale de la protéine et comprend généralement environ les 50 premiers acides aminés. Un tel polypeptide tronqué de la séquence d'adressage vers les plastes est également considéré. Ainsi, la présente invention concerne un polypeptide selon la présente invention présentant une délétion des 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 ou 55 acides aminés N-terminaux. Dans ce cas, la présente invention concerne un polypeptide isolé ou recombinant ayant une activité de czs-abiénol synthase et dont la séquence présente au moins 98% d'identité avec la SEQ ID No 24. Ce polypeptide peut également comprendre une séquence additionnelle permettant de faciliter la purification de l'enzyme, par exemple une séquence étiquette comprenant plusieurs acides aminés histidine consécutifs. La présente invention concerne également un acide nucléique isolé comprenant une séquence nucléotidique codant un polypeptide ayant une activité de cz's- abiénol synthase et dont la séquence présente au moins 95% ou 98% d'identité avec la SEQ ID No 24. Un exemple d'acide nucléique est l'acide nucléique comprenant ou consistant en une séquence présentant au moins 95% ou 98% d'identité avec la SEQ ID No 23 ou une séquence complémentaire de celle-ci. La présente invention concerne un acide nucléique isolé capable de s'hybrider dans des conditions de forte stringence à un acide nucléique qui code un polypeptide ayant une activité de cz's- abiénol synthase et dont la séquence présente au moins 95% ou 98% d'identité avec la SEQ ID No 24. Dans un mode de réalisation particulier, l'acide nucléique comprend ou consiste en la séquence SEQ ID No 23. La présente invention concerne également une cassette d'expression, un vecteur, une cellule hôte ou un organisme transgénique comprenant un acide nucléique selon la présente invention.
La présente invention concerne tout particulièrement un vecteur, une cellule hôte ou un organisme transgénique comprenant un acide nucléique comprenant une séquence hétérologue codant un polypeptide ayant une activité de cz's- abiénol synthase et dont la séquence présente au moins 80%, 85%, 90%, 95% ou 98% d'identité avec la SEQ ID No 24 et un acide nucléique comprenant une séquence hétérologue codant un polypeptide ayant une activité de syn-copalyl-8-ol diphosphate (syn-CODP) synthase et dont la séquence présente au moins 80%, 85%, 90%, 95% ou 98% d'identité avec la SEQ ID No 22. De préférence, l'organisme transgénique est une plante, en particulier une plante à trichomes glanduleux.
La présente invention concerne une méthode de production de czs-abiénol ou de dérivés de celui-ci à partir de GGPP comprenant la mise en contact du GGPP avec une syn-copalyl-8- ol diphosphate (syn-CODP) synthase présentant au moins 80 % d'identité avec la SEQ ID No 22 et une czs-abiénol synthase présentant au moins 80 % d'identité avec la SEQ ID No 24 dans des conditions appropriées et la récolte du cz's-abiénol ou de dérivés de celui-ci obtenus. Elle concerne l'utilisation d'une syn-copalyl-8-ol diphosphate (syn-CODP) synthase présentant au moins 80 % d'identité avec la SEQ ID No 22 et d'une czs-abiénol synthase présentant au moins 80 % d'identité avec la SEQ ID No 24 pour la préparation de czs-abiénol ou de dérivés de celui-ci à partir de GGPP. La présente invention concerne une méthode de production de syn-copalyl-8-ol diphosphate ou de dérivés de celui-ci à partir du GGPP comprenant la mise en contact du
GGPP avec une syn-copalyl-8-ol diphosphate (syn-CODP) synthase présentant au moins
80 % d'identité avec la SEQ ID No 22 dans des conditions appropriées et la récolte du syn- copalyl-8-ol diphosphate ou de dérivés de celui-ci obtenus. Facultativement, la méthode comprend en outre l'incubation du syn-copalyl-8-ol diphosphate obtenu avec une phosphatase et la récolte du 9-beta-labda-13-en-8,15-diol. La présente invention concerne l'utilisation d'une syn-copalyl-8-ol diphosphate (syn-CODP) synthase présentant au moins
80 % d'identité avec la SEQ ID No 22 pour la préparation de 9-beta-labda-13-en-8-ol-15- yl trihydrogen diphosphate ou de dérivés de celui-ci à partir de GGPP.
La présente invention concerne une méthode de production de czs-abiénol ou de dérivés de celui-ci à partir de syn-copalyl-8-ol diphosphate comprenant la mise en contact du syn- copalyl-8-ol diphosphate avec une czs-abiénol synthase présentant au moins 80 % d'identité avec la SEQ ID No 24 dans des conditions appropriées et la récolte du cis- abiénol ou de dérivés de celui-ci obtenus. Elle concerne l'utilisation d'une czs-abiénol synthase présentant au moins 80 % d'identité avec la SEQ ID No 24 pour la préparation de cz's-abiénol ou de dérivés de celui-ci à partir de syn-copalyl-8-ol diphosphate.
De manière générale, une cassette d'expression comprend tous les éléments nécessaires à la transcription et traduction du gène en une protéine. Notamment, elle comprend un promoteur, éventuellement un amplificateur, un terminateur de transcription et les éléments permettant la traduction.
Le promoteur est adapté à la cellule hôte. Par exemple, si la cellule est procaryote, le promoteur peut être sélectionné parmi les promoteurs suivants : Lacl, LacZ, pLacT, ptac, pARA, pBAD, les promoteurs d'ARN polymérase de bactériophage T3 or T7, le promoteur de la polyhèdrine, le promoteur PR ou PL du phage lambda. Si la cellule est eucaryote et animale, le promoteur peut être sélectionné parmi les promoteurs suivants : promoteur précoce du CMV, promoteur de la thymidine kinase de HSV, promoteur précoce ou tardif de SV40, le promoteur de la métallothionéine-L de souris, et les régions LTR de certains rétro virus. De manière générale, pour le choix d'un promoteur adapté, l'homme du métier pourra avantageusement se référer à l'ouvrage de Sambrook et Russell (2000) ou encore aux techniques décrites dans l'ouvrage d'Ausubel et al. (2006) Le vecteur peut être un plasmide, un pliage, un phagemide, un cosmide, un virus, un YAC, un BAC, un plasmide pTi ά' Agrobacterium, etc. Le vecteur peut comprendre de préférence un ou plusieurs éléments sélectionnés parmi une origine de réplication, un site de clonage multiple et un marqueur. Le marqueur peut être un gène rapporteur qui engendre un signal détectable. Le signal détectable peut être un signal fluorescent, une coloration, une émission de lumière. Le marqueur pourra donc être GFP, EGFP, DsRed, la béta- galactosidase, la luciférase, etc.. Le marqueur est de préférence un marqueur de sélection procurant à la cellule une résistance à un antibiotique. Par exemple, le gène peut être un gène de résistance à la kanamycine, néomycine, etc.. Dans un mode de réalisation préféré, le vecteur est un plasmide. Des exemples de vecteurs procaryotes figurent dans la liste suivante qui n'est pas exhaustive : pQE70, pQE60, pQE-9 (Qiagen), pbs, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pBR322, et pRIT5 (Pharmacia), pET (Novagen) et pQE-30 (QIAGEN). Des exemples de vecteurs eucaryotes figurent dans la liste suivante qui n'est pas exhaustive : pWLNEO, pSV2CAT, pPICZ, pcDNA3.1 (+) Hyg (Invitrogen), pOG44, pXTl, pSG (Stratagene); pSVK3, pBPV, pCI-neo (Stratagene), pMSG, pSVL (Pharmacia);. Les vecteurs viraux peuvent être de manière non-exhaustive des adénovirus, des AAV, des HSV, des lentivirus, etc. De préférence, le vecteur d'expression est un plasmide ou un vecteur viral.
La cellule hôte peut être un procaryote, par exemple Escherichia coli, Bacillus subtilis, Streptomyces sp, et Pseudomonas sp ou un eucaryote. L'eucaryote peut être un eucaryote inférieur comme une levure (par exemple, Saccharomyces cerevisiaé) ou un champignon filamenteux (par exemple du genre Aspergillus) ou un eucaryote supérieur comme une cellule d'insecte, de mammifère ou de plante. La cellule peut être une cellule mammifère, par exemple COS, CHO (US 4,889,803 ; US 5,047,335). Dans un mode de réalisation particulier, la cellule est non-humaine et non-embryonnaire. La cellule peut être isolée, par exemple dans un milieu de culture. Les cellules peuvent également être comprises dans des organismes, par exemple des animaux non-humains transgéniques ou des plantes transgéniques. La présente invention concerne donc une méthode de production de 9-beta-labda-13-en-8- ol-15-yl trihydrogen diphosphate ou de dérivés de celui-ci à partir du GGPP dans une cellule ayant une source de GGPP, comprenant : a) l'introduction dans ladite cellule d'une construction portant une cassette d'expression comprenant un gène codant pour une syn-copalyl-8-ol diphosphate
(syn-CODP) synthase, ladite synthase présentant au moins 80 % d'identité avec la SEQ ID No 22 ; b) la culture de la cellule transformée dans des conditions appropriées pour l'expression du gène ; et, c) facultativement, la récolte du syn-copalyl-8-ol diphosphate ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.
Dans un mode de réalisation particulier, le syn-copalyl-8-ol diphosphate produit est récolté à l'étape c). Dans un autre mode de réalisation particulier, le syn-copalyl-8-ol diphosphate produit est le produit de départ pour obtenir un autre composé d'intérêt comme le 9-beta- labda-13-en-8,15-diol. Par exemple, le syn-copalyl-8-ol diphosphate peut être transformé en 9-beta-labda-13-en-8,15-diol par une phosphatase. Ainsi, la méthode peut comprendre en outre à l'étape a) l'introduction d'une construction portant une cassette d'expression comprenant un gène codant pour une phosphatase, permettant ainsi la récolte de 9-beta- labda-13-en-8,15-diol à l'étape c). Parmi d'autres dérivés d'intérêt du syn-copalyl-8-ol diphosphate figure le sclaréol. La présente invention concerne donc une méthode de production de syn-copalyl-8-ol diphosphate ou de dérivés de celui-ci à partir de GGPP dans une cellule recombinante ayant une source de GGPP et comprenant un gène hétérologue codant pour une syn-copalyl-8-ol diphosphate (syn-CODP) synthase présentant au moins 80 % d'identité avec la SEQ ID No 22.
La présente invention concerne donc une méthode de production de czs-abiénol ou de dérivés de celui-ci à partir de syn-copalyl-8-ol diphosphate dans une cellule ayant une source de 9 syn-copalyl-8-ol diphosphate, comprenant : a) l'introduction dans ladite cellule d'une construction portant une cassette d'expression comprenant un gène codant pour une czs-labda-12,14-dien-8 alpha-ol synthase présentant au moins 80 % d'identité avec la SEQ ID No 24 ; b) la culture de la cellule transformée dans des conditions appropriées pour l'expression des gènes ; et, c) facultativement, la récolte du czs-abiénol ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.
Dans un mode de réalisation particulier, le czs-abiénol produit est récolté à l'étape c). Dans un autre mode de réalisation particulier, le czs-abiénol produit est le produit de départ pour obtenir un autre composé d'intérêt comme l'Ambrox®. La présente invention concerne donc une méthode de production de czs-abiénol ou de dérivés de celui-ci à partir de syn- copalyl-8-ol diphosphate dans une cellule recombinante ayant une source de syn-copalyl-8- ol diphosphate et comprenant un gène hétérologue codant pour une une czs-labda-12,14- dien-8 alpha-ol synthase présentant au moins 80 % d'identité avec la SEQ ID No 24.
La cellule peut également être partie d'un organisme multicellulaire, par exemple une plante ou un animal non-humain. Dans ce cas, la méthode comprend : a) l'introduction dans une cellule de l'organisme d'une construction portant une cassette d'expression comprenant un gène codant pour une syn-copalyl-8-ol diphosphate (syn-CODP) synthase présentant au moins 80 % d'identité avec la
SEQ ID No 22 et d'une construction portant une cassette d'expression comprenant un gène codant pour une czs-labda-12,14-dien-8 alpha-ol synthase présentant au moins 80 % d'identité avec la SEQ ID No 24 ; b) la reconstitution d'un organisme à partir de ladite cellule et la sélection des organismes transgéniques exprimant les deux gènes introduits ; et, c) la récolte du cz's-abiénol produit ou de dérivés de celui-ci dans lesdits organismes transgéniques.
Dans un mode de réalisation, l'organisme est un animal non- humain. Par exemple, l'organisme peut être une souris, un rat, un cobaye, un lapin, etc. Dans un autre mode de réalisation préféré, l'organisme est une plante, de préférence une plante à trichomes glanduleux. La méthode permet de faire produire du czs-abiénol à des organismes ne produisant pas ce composé ou d'augmenter la quantité de cz's-abiénol produit par des organismes le produisant déjà.
La présente invention concerne également une méthode de production de 9-beta-labda-13- en-8-ol-15-yl trihydrogen diphosphate ou de dérivés de celui-ci comprenant : a) l'introduction dans une cellule de l'organisme d'une construction portant une cassette d'expression comprenant un gène codant pour une syn-copalyl-8-ol diphosphate (syn-CODP) synthase présentant au moins 80 % d'identité avec la
SEQ ID No 22; b) la reconstitution d'un organisme à partir de ladite cellule et la sélection des organismes transgéniques exprimant les deux gènes introduits ; et, c) la récolte du syn-copalyl-8-ol diphosphate produit ou de dérivés de celui-ci dans lesdits organismes transgéniques.
Dans un mode de réalisation, l'organisme est un animal non- humain. Par exemple, l'organisme peut être une souris, un rat, un cobaye, un lapin, etc. Dans un autre mode de réalisation préféré, l'organisme est une plante, de préférence une plante à trichomes glanduleux. La méthode permet de faire produire du syn-copalyl-8-ol diphosphate à des organismes ne produisant pas ce composé ou d'augmenter la quantité de syn-copalyl-8-ol diphosphate produit par des organismes.
La présente invention concerne également une méthode de production de czs-abiénol ou de dérivés de celui-ci comprenant : a) l'introduction dans une cellule de l'organisme d'une construction portant une cassette d'expression comprenant un gène codant pour une czs-abiénol synthase présentant au moins 80 % d'identité avec la SEQ ID No 24 ; b) la reconstitution d'un organisme à partir de ladite cellule et la sélection des organismes transgéniques exprimant les deux gènes introduits ; et, c) la récolte du cz's-abiénol produit ou de dérivés de celui-ci dans lesdits organismes transgéniques.
Dans un mode de réalisation, l'organisme est un animal non- humain. Par exemple, l'organisme peut être une souris, un rat, un cobaye, un lapin, etc. Dans un autre mode de réalisation préféré, l'organisme est une plante, de préférence une plante à trichomes glanduleux. La méthode permet de faire produire du czs-abiénol à des organismes ne produisant pas ce composé ou d'augmenter la quantité de cz's-abiénol produit par des organismes.
L'invention est notamment applicable à toutes les plantes de familles possédant des trichomes glanduleux, par exemple les Astéracées (tournesol, etc.), Solanacées (tomate, tabac, pomme de terre, poivron, aubergine, etc.), Cannabacées (ex Cannabis sativa) et Lamiacées (menthe, basilic, lavande, thym, etc.). Elle est particulièrement adaptée aux plantes de la famille des Solanacées, telles que par exemple des genres Solanum, Capsicum, Pétunia, Datura, Atropa, etc., et en particulier du genre Nicotiana par exemple le tabac cultivé {Nicotiana tabacum), et plus particulièrement le tabac sauvage Nicotiana syîvestris. De manière non limitative, l'invention peut s'appliquer aux plantes des genres suivants : Populus, Nicotiana, Cannabis, Pharbitis, Apteria, Psychotria, Mercurialis, Chrysanthemum, Polypodium, Pelargonium, Mimulus, Matricaria, Monarda, Solanum, Achillea, Valeriana, Ocimum, Medicago, Aesculus, Plumbago, Pityrogramma, Phacelia, Avicennia, Tamarix, Frankenia, Limonium, Foeniculum, Thymus, Salvia, Kadsura, Beyeria, Humulus, Mentha, Artemisia, Nepta, Geraea, Pogostemon, Majorana, Cleome, Cnicus, Parthenium, Ricinocarpos, Hymennaea, Larrea, Primula, Phacelia, Dryopteris, Plectranthus, Cypripedium, Pétunia, Datura, Mucuna, Ricinus, Hypericum, Myoporum, Acacia, Diplopeltis, Dodonaea, Halgania, Cyanostegia, Prostanthera, Anthocercis, Olearia, Viscaria. De préférence, la plante est une plante de la famille des Asteracées, Cannabacées, Solanacées ou Lamiacées. Dans un mode de réalisation encore plus préféré, la plante est du genre Nicotiana, de préférence Nicotiana syîvestris ou Nicotiana tabacum.
Dans ce mode de réalisation, les gènes sont placés sous le contrôle d'un promoteur permettant une expression, de préférence spécifique, dans les trichomes de la plante. De tels promoteurs sont connus par l'homme du métier.
Au sens de l'invention, on entend par promoteur "spécifique" un promoteur principalement actif dans un tissu ou un groupe cellulaire donné. Il est entendu qu'une expression résiduelle, généralement plus faible, dans d'autres tissus ou cellules ne peut être entièrement exclue. Une caractéristique particulière de l'invention réside dans la capacité de construire des promoteurs spécifiques des cellules sécrétrices des trichomes glanduleux, permettant une modification de la composition des sécrétions foliaires de la plante, et notamment d'y exprimer les gènes de la présente invention permettant de préparer le cis- abiénol. Ainsi, le syn-copalyl-8-ol diphosphate, le czs-abiénol ou des dérivés de ceux-ci peuvent être récoltés au niveau des trichomes de ces plantes, en particulier dans l' exsudât des trichomes.
Par exemple, il a été montré qu'une séquence régulatrice de 1852 pb, située en amont de l'ATG du gène CYP71D16, permet de diriger l'expression du gène rapporteur uidA spécifiquement dans les cellules sécrétrices de trichomes de tabac (demande US2003/0100050 Al, Wagner et al, 2003). D'autre part, plusieurs séquences promotrices extraites de différentes espèces ont été identifiées comme étant capables de diriger l'expression d'un gène hétérologue dans les trichomes de tabac.
Figure imgf000019_0001
Dans un mode de réalisation préféré de la présente invention, le promoteur utilisé dans la cassette est dérivé des gènes NsTPS-02a, 02b, 03, et 04 de l'espèce Nicotiana sylvestris possédant une forte similarité de séquence avec CYC-2 (CBT-ol cyclase; NID : AF401234). Ces séquences promotrices sont plus amplement décrites dans la demande de brevet WO2006040479.
Parmi les séquences terminateurs préférées, on peut citer le terminateur NOS (Bevan et al, 1983), et le terminateur du gène d'histone (EPO 633 317).
Dans un mode de réalisation particulier, la cassette d'expression peut comprendre une séquence permettant d'augmenter l'expression (« amplificateur »), par exemple certains éléments du promoteur CaMV35S et de gènes de l'octopine synthase (US 5 290 924). De préférence, les éléments activateurs du promoteur CaMV35S sont utilisés.
L'introduction des constructions portant un ou les deux gènes de l'invention dans une cellule ou un tissu végétal, y compris une graine ou plante, peut être réalisée par toute technique connue de l'homme du métier, y compris sous forme épisomale ou chromosomique. Les techniques de transgenèse végétale sont bien connues dans le domaine, et comprennent par exemple l'utilisation de la bactérie Agrobacterium tumefaciens, Pélectroporation, des techniques biolistiques, transfection par un vecteur viral notamment, et toute autre technique connue de l'homme du métier.
Une technique communément utilisée repose sur l'utilisation de la bactérie Agrobacterium tumefaciens, qui consiste essentiellement à introduire la construction d'intérêt (acide nucléique, cassette, vecteur, etc.) dans la bactérie A. tumefaciens, puis à mettre en contact cette bactérie transformée avec des disques de feuilles de la plante choisie. L'introduction de la cassette d'expression dans la bactérie est typiquement réalisée en utilisant comme vecteur le plasmide Ti (ou T-DNA), qui peut être transféré dans la bactérie par exemple par choc thermique. L'incubation de la bactérie transformée avec les disques foliaires permet d'obtenir le transfert du plasmide Ti dans le génome des cellules des disques. Ceux-ci peuvent éventuellement être cultivés dans des conditions appropriées pour reconstituer une plante transgénique dont les cellules comprennent la construction de l'invention. Pour plus de détails ou des variantes de mise en œuvre de la technique de transformation par A. tumefaciens, on peut se référer par exemple à Horsch et al. (1985) ou Hooykaas and Schilperoort (1992).
Ainsi, dans un mode de réalisation particulier, la cassette d'expression ainsi constituée est insérée entre les bordures gauche et droite de l'ADN de transfert (T-DNA) d'un plasmide Ti désarmé pour le transfert dans des cellules végétales par Agrobacterium tumefaciens. Le T-DNA comprend également un gène dont l'expression confère une résistance à un antibiotique ou un herbicide et qui permet la sélection des transformants.
Une fois régénérées, les plantes transgéniques peuvent être testées pour l'expression hétérologue des gènes de la présente invention ou la production du cz's-abiénol ou du syn- copalyl-8-ol diphosphate dans les trichomes. Ceci peut être réalisé en récoltant l'exsudat des feuilles et en testant la présence du produit d'intérêt dans cet exsudât. Ceci peut également être fait en analysant la présence d'une ou des enzymes hétérologues de la présente invention dans les feuilles et, plus particulièrement, dans les cellules de trichome (par exemple en analysant les ARNm ou l'ADN génomique au moyen de sondes ou d'amorces spécifiques). Les plantes peuvent éventuellement être sélectionnées, croisées, traitées, etc. pour obtenir des plantes présentant des niveaux d'expression améliorés.
Un autre objet de l'invention réside également dans une plante ou graine comprenant un acide nucléique, une cassette d'expression ou un vecteur tels que définis précédemment.
La présente invention concerne enfin une cellule ou un organisme transgénique non- humain, caractérisé en ce que la voie de synthèse du czs-abiénol est bloquée par inactivation du gène codant pour une syn-copalyl-8-ol diphosphate (syn-CODP) synthase selon la présente invention ou du gène codant pour czs-abiénol synthase selon la présente invention ou des deux gènes. L'expression de ces gènes peut être bloquée par de nombreuses techniques disponibles et connues par l'homme du métier. Les gènes peuvent être délétés, mutés (par exemple par mutagenèse chimique par Ethyl Méthane Sulfonate ou par rayonnements ionisants) ou interrompus (mutagenèse insertionnelle). Par ailleurs, le blocage de l'expression de ces gènes peut également être réalisé par extinction de gènes en exprimant un transcrit inhibiteur. Le transcrit inhibiteur est un ARN qui peut se présenter sous la forme d'un ARN double brin, d'un ARN antisens, d'un ribozyme, d'un ARN capable de former une triple hélice, et qui a une certaine complémentarité ou spécificité avec le transcrit du gène à bloquer.
La présente invention concerne également un acide nucléique capable de diminuer ou de supprimer l'expression d'un gène codant une syn-copalyl-8-ol diphosphate (syn-CODV) synthase. En effet, un ARN inhibiteur qui peut se présenter sous la forme d'un ARN double brin, d'un ARN antisens, d'un ribozyme, d'un ARN capable de former une triple hélice, et qui a une certaine complémentarité ou spécificité avec le gène codant une syn-copalyl-8-ol diphosphate (syn-CODP) synthase peut être préparé sur la base de l'enseignement de la présente invention. Ainsi, la présente invention concerne un ARN inhibiteur du gène codant une syn-copalyl-8-ol diphosphate (syn-CODP) synthase comprenant au moins 30, 40, 50, 60, 70, 80, 90 ou 100 nucléotides consécutifs de la SEQ ID No 21 ou d'une séquence complémentaire de celle-ci. De même, elle concerne l'utilisation d'un polynucléotide comprenant au moins 30, 40, 50, 60, 70, 80, 90 ou 100 nucléotides consécutifs de la SEQ ID No 21 ou d'une séquence complémentaire de celle-ci pour inhiber l'expression du gène codant une syn-copalyl-8-ol diphosphate (syn-CODP) synthase. L'inhibition de cette enzyme peut être utile pour stopper ou ralentir la voie de synthèse du cz's- abiénol et rendre le GGPP disponible pour une autre voie de synthèse d'intérêt nécessitant un apport en GGPP. Par exemple, l'inhibition de cette enzyme peut permettre d'augmenter le taux de production du CBT-diol par les cellules glandulaires des trichomes de feuilles de tabac. La présente invention concerne donc des cellules ou des organismes transgéniques dans lesquels le gène codant une syn-copalyl-8-ol diphosphate (syn-CODP) synthase a été inactivé. L'inactivation peut être effectuée par des techniques d'ARN interfèrent, de délétion de gène, de mutation chimique ou d'inactivation par recombinaison homologue. Ainsi le taux de syn-copalyl-8-ol diphosphate ou de czs-abiénol peut être diminué dans ces cellules ou organismes transgéniques. En outre, la présente invention concerne également un acide nucléique capable de diminuer ou de supprimer l'expression d'un gène codant une czs-abiénol synthase. En effet, un ARN inhibiteur qui peut se présenter sous la forme d'un ARN double brin, d'un ARN antisens, d'un ribozyme, d'un ARN capable de former une triple hélice, et qui a une certaine complémentarité ou spécificité avec le gène codant une cz's- abiénol synthase peut être préparé sur la base de l'enseignement de la présente invention. Ainsi, la présente invention concerne un ARN inhibiteur du gène codant une cz's- abiénol synthase comprenant au moins 30, 40, 50, 60, 70, 80, 90 ou 100 nucléotides consécutifs de la SEQ ID No 23. De même, elle concerne l'utilisation d'un polynucléotide comprenant au moins 30, 40, 50, 60, 70, 80, 90 ou 100 nucléotides consécutifs de la SEQ ID No 23 pour inhiber l'expression du gène codant une czs-abiénol synthase. L'inhibition de cette enzyme peut être utile pour stopper la voie de synthèse du cz's-abiénol et rendre le syn-copalyl-8-ol diphosphate disponible pour une autre voie de synthèse d'intérêt nécessitant un apport en ce composé, par exemple pour préparer des dérivés du syn-copalyl-8-ol diphosphate, par exemple, du sclaréol, ou du 9- béta labda-13-en-8,15-diol. Le sclaréol est utilisé industriellement pour la synthèse d'ambroxides, comme l'Ambrox®, qui sont des ingrédients de l'industrie de la parfumerie. La présente invention concerne donc des cellules ou des organismes transgéniques dans lesquels le gène codant une czs-abiénol synthase est inactivé. L'inactivation peut être effectuée par des techniques d'ARN interfèrent, de délétion de gène, de mutation chimique ou d'inactivation par recombinaison homologue. Ainsi le taux de czs-abiénol peut être diminué dans ces cellules ou organismes transgéniques.
D'autres aspects et avantages de la présente invention apparaîtront à la lecture des exemples qui suivent, qui doivent être considérés comme illustratifs et non limitatifs.
Exemples
Identification de fragments de gènes candidats codant pour une CPS et une KS de tabac spécifiquement exprimés dans les cellules de trichomes de tabac.
Les séquences codant pour les enzymes apparentées aux kaurene-synthases (KS) et aux copalyl-diphosphate synthases (CPS) appartiennent à la même famille phylogénétique tout en constituant deux groupes distincts. Les séquences protéiques des membres représentatifs de ces deux familles ont été alignées avec le logiciel ClustalX (Thompson et al., 1997).
L'alignement a permis de définir un motif conservé, YDTAWV (motif A ; SEQ ID No 1), pour les deux familles et des motifs conservés pour chacune des deux familles, à savoir PWYASL (motif B ; SEQ ID No 2) pour la famille CPS et CAMAFR (motif C ; SEQ ID
No 3) pour la famille KS.
Des amorces dégénérées correspondant aux motifs conservés A, B, et C, respectivement, ont été conçues (Tableau 1). Une amplification d'ADN a été réalisée par PCR avec les couples d'amorces correspondant aux motifs A / B et A / C à partir d'ADNc de trichomes de feuilles de tabac (N tabacum) pour amplifier des fragments d'ADNc codant pour des séquences de type CPS et KS, respectivement. Deux et trois séquences ayant une forte homologie avec les séquences CPS et KS respectivement ont été identifiées et respectivement notées NtCPSl, NtCPS2, NtKSLl, NtKSL2, NtKSL3. Tableau 1 :
Séquences des amorces dégénérées correspondant aux motifs conservés des protéines codant pour des CPS et des KS.
Motif AA Motif # Famille Séquence amorce 5' --> 3' SEQ ID No
YDTAWV A CPS/KSL τÀ7GAYÀÏÏNGCNfGGGT 4
PWYASL B CPS AGNGANGCRTACCANGG 5
PWYASL B CPS YAANGANGCRTACCANGG 6 PWYASL B CPS AGRCTNGCRTACCANGG 7
PWYASL B CPS AARCJJNjGCRJACCANGG 8 CAMAFR ™~C KSL CGRAANGCCATNGCRCA 9
KSL
Des amorces spécifiques de chacun des gènes ont été définies pour déterminer le niveau d'expression des gènes dans les feuilles et les trichomes. L'analyse a été réalisée par PCR quantitative en temps réel à partir d'ADNc de feuilles et de trichomes de tabac (N tabacum). Les gènes codant pour la cembratriene-ol synthase (CBTS-02) (NID: AF401234), et la CBT-ol hydroxylase (CYP71D16B) (NID: AF166332), qui s'expriment fortement et spécifiquement dans les cellules glandulaires de trichomes de tabac, ont été utilisés comme témoins positifs. La figure 2A montre que le gène NtCPS2 s'exprime plus spécifiquement dans les trichomes de tabac que dans la feuille alors que le niveau d'expression du gène NtCPSl est pratiquement identique dans les deux tissus. La figure 2 A montre également que les gènes NtKSL2 et NtKSL3 s'expriment spécifiquement dans les trichomes, alors que NtKSLl n'est pas spécifique des trichomes. La figure 2B indique que l'expression du gène NtCPS2 dans les trichomes est comparable à celui des gènes CBTS et CYP71D16B étant donné que le rapport d'expression du gène NtCPS2 sur CBTS est proche de 1 à la différence du rapport NtCPSl sur CBTS qui est très faible (10~4). La même analyse a permit de conclure que le gène NtKSL3 s'exprime fortement et spécifiquement dans les cellules de trichomes de feuilles de tabac (Fig. 2A et 2B).
Identification des séquences nucléiques codantes complètes de NtCPS2 et NtKSL3.
Les séquences nucléiques codantes et complètes pour les deux gènes NtCPS2 et NtKSL3 ont été identifiées par les techniques classiques de 5' RACE et 3' RACE PCR en utilisant des amorces spécifiques de chaque séquence (Tableau 2). Des ADNc isolés à partir de trichomes de feuilles de tabac (N. tabacum) ont été utilisés comme matrice pour l'amplification PCR. Les fragments 5' et 3' obtenus pour chacun des différents gènes ont été assemblés pour former les séquences codantes NtCPS2 de 2409 bases (SEQ ID N°21) et de NtKSL3 (SEQ ID N°23) de 2379 bases codant respectivement pour des protéines de 802 AA (SEQ ID N°22) et 792 AA (SEQ ID N°24). Les séquences similaires à NtKSL3 ont été recherchées dans la banque de protéine SwissProt en utilisant le programme BlastP (Altschul et al., 1997). Le meilleur pourcentage d'identité a été obtenue avec la ent- kaurene synthase de citrouille (45%) et de l'arabette (44%) (Tableau 3). On peut noter également que la séquence NtKSL3 possède un très fort degré d'identité (90 %) avec une terpène cyclase putative de tabac (Wang and Wagner, 2005, PID AAS98912.1). En effet, le segment 1-722 de cette séquence de 759 résidus correspond au segment 46-766 de la séquence NtKSL3, le segment restant 723-759 n'ayant aucun rapport avec la séquence NtKSL3. La fonction de cette protéine n'a cependant pas été démontrée. Tableau 2 :
Séquence des amorces pour amplifier les régions 5' et 3' des phases codantes des gènes
NtCPS2 et NtKSL3.
Cible Nom Description Séquence amorce 5' --> 3' SEQ ID No
NtCPS2 8EΞ03 5' RACE AAGACAAGATGGA^CATAGGTCTTTGA 11 NtCPS2 8E04 5' RACE CTCCCCATGAACCATCAGAAAGTTGA 12 13 14 15
Figure imgf000025_0001
16
NtKSL.3 8G05 5' RACE AACATGGTTGGTTCATAGAATATCTTGA 17 NtKSL3 8G06 5' RACE iliiπiA£AAGCAATGGATGGCTAGGA 18
NtKSL3 8C05 3' RACE " œTGCÂTGÂTCÂAC^^ 19 NtKSL3 8C06 3' RACE CCTTGTAAATATGATGCTCTGCGAACGT 20
Tableau 3 :
Séquences présentant le meilleur pourcentage d'identité obtenu par recherche d'homologie avec le programme BlastP 2.2.13 (Altschul et al., 1997) contre la banque SwissProt avec la séquence NtKSL3.
Description urganisme ro accession fonction % α lαeπtiœ
CmKS entKaurene B Cucurbita maxima L AAB39482 ent-kaurene synthase 45
AtGA2 Arabidopsis thahana AAC39443 ent-kaurene synthase 44
AgE-a-bisabolene synthase Abies grandis AAC24191 E-alpha-bisabolene synthase 34
AgAbietadiene synthase Abies grandis AAB05407 Abietadiene synthase 27
TbTaxadiene synthase taxus baccata Q93YA3 Taxadiene synthase 26
Tableau 4 :
Séquences présentant le meilleur pourcentage d'identité obtenu par recherche d'homologie avec le programme BlastP 2.2.13 (Altschul et al., 1997) contre la banque SwissProt et
Genbank, respectivement, avec la séquence NtCPS2. Description Organisme N° Fonction % identité )
Ent-kaurene synthase A, Pisum sativum 004408 Ent-copalyldiphosphate synthase 44 ent-kaurene synthase A, Arabidopsis thahana Q38802 Ent-copalyldiphosphate synthase 45 chloroplast precursor
Abietadiene synthase, Àbies grandis 038710 Àbietadiene synthase 42 chloroplast precursor
Âipha-bisabofene synthase Àbies grandis Ô8ÎÔ86 (Ë)-alpha-bιsaboiene synthase 34
Description Organisme N° Fonction % identité accession avec copalyldiphosphate Lactuca sativa BAB12440.1 Putative copalyldiphosphate 48 synthase NoJ synthase copaiyi pyrophosphate Stevia rebaudiana ÂÂB8709Î .Î Putative copalyldiphosphate 48 synthase synthase copalyl diphosphate Croton subiyratus BÀÀ956Î2.Î Putative copaïyîdiphosphate 48 copalyl diphosphate Lycopersicon BAA84918.1 Putative copalyldiphosphate 47 putative copalyï Scopana duicis BÀD9Î 286.Î Ënt-copaïyîdiphosphate synthase 46
Identification de la fonction de la protéine codée par NtCPS2 Afin d'établir la fonction de la protéine NtCPS2, la production de l'enzyme recombinante NtCPS2-HisTAG par E. coli a été réalisée, pour identifier son (ses) activité(s) potentielle(s). La séquence nucléique codant pour NtCPS2 (séquence ID N° 21) a été introduite dans le vecteur d'expression pET-30b (Novagen). Pour faciliter la purification de la protéine, le codon STOP de la séquence a été éliminé pour créer une protéine de fusion avec une queue de 5 histidines en position C-terminale. Le vecteur NtCPS2-pET30b a été introduit par électroporation dans des cellules E. Coli d'expression (BL21- CodonPlus, Stratagene). La production de la protéine dans ces cellules a été induite par addition d'IPTG 1 mM, à 16 0C, à partir de 500 ml de culture. Après 18 heures d'induction, les cellules sont collectées par centrifugation, et lysées par un choc de dépression (ΔP: 19 bar). Les protéines solubles dessalées sur une colonne PDlO (Amersham), sont appliquées sur une résine d'affinité nickel-nitrilotriacetique d'agarose (Ni-NTA) selon le protocole du fabriquant (Qiagen). Les tests d'activité ont été réalisés sur la fraction protéique enrichie en NtCPS2-HisTag dans un tampon contenant 50 mM Hepes, 100 mM KCl, 7,5 mM MgCl2, 5% glycérol, et 5 mM DTT. Les substrats suivants GPP,
FPP, GGPP ont été testés séparément à une concentration de 65 μM avec 25 ou 50 μg de protéines, incubés à 32 0C pendant 2 heures. Les produits de la réaction ont ensuite été déphosphorylés par ajout de 20 unités de phosphatase alkaline d'intestin de veau (New England Biolabs) pendant 1 heure à 37 0C. Les produits ont été extraits par une mélange chloroforme:méthanol:eau (5:1:4). Les phases aqueuse et organique sont séparées par centrifugation, la phase organique est séchée sous courant d'azote, reprise dans du pentane et analysée par GC/MS.
La fonction enzymatique de NtCPS2 a été étudiée par la production de l'enzyme recombinante NtCPS2-HisTAG depuis E. coll. Le mélange d'enzyme soluble obtenu de la disruption de E. coli a ensuite été chargé sur colonne d'affinité. Un facteur d'enrichissement de 15 à 20 est évalué par électrophorèse sur gel SDS. Pour démontrer sa fonction, NtCPS2-HisTAG a été incubé avec 3 différents substrats : GPP, FPP et GGPP. Aucun nouveau produit n'a été détecté avec le GPP ou le FPP montrant que NtCPS2- HisTAG n'utilise pas ces substrats. En revanche, lorsque le GGPP a été utilisé, un nouveau diterpen-diol apparaît. L'ion moléculaire 308 est très minoritaire, mais l'ion 290 correspondant à la perte d'une fonction alcool par élimination d'une molécule d'eau (M- 18) est identifiable sur le spectre de masse (Figure 7). Le pic a été identifié comme étant le 9-beta labda-13-en-8,15-diol par comparaison avec le pic de 9-beta labda-13-en-8,15-diol naturellement produit dans l'exsudat des feuilles de N. tαbαcum (Figure 6). Le spectre de masse et le temps de rétention du nouveau composé sont identiques à celui présent chez N. tαbαcum (Fig. 7). Le produit obtenu correspond au produit de déphosphorylation du 9-beta labda-13-en-8-ol-15-yl trihydrogen diphosphate (syn-CODP).
Identification de la fonction des protéines codées par NtKSL3 et NtCPS2. Pour déterminer la fonction des gènes NtKSL3 et NtCPS2, leurs séquences ont été introduites par transformation génétique dans N. syîvestris, un tabac sauvage qui ne produit pas de cz's-abiénol et dans une lignée transgénique de N. syîvestris (lignée source ihpCBTS) dont l'expression du gène CBTS a été inhibée par ARN interférence (Tissier et αl, 2005). Dans cette lignée, la quantité de CBT-diol des feuilles est très réduite. Un promoteur de tabac trichome spécifique (eCBTSl.0, Tissier et αl., 2004) a été mis en amont des séquences codantes NtCPS2 et NtKSL3 pour former les constructions eCBTS1.0-NtCPS2 [#1] et eCBTS1.0-NtKSL3 [#2]. Ces deux constructions ont été introduites dans un même vecteur binaire contenant un gène de résistance à la kanamycine pour donner le vecteur binaire pLIBRO-58 (Fig. 3A). Les constructions #1 et #2 ont également été introduites de manière indépendante dans le même vecteur pour former les vecteurs binaires pLIBRO-68 (Fig. 3B) et pLIBRO-69 (Fig. 3C), respectivement. Les vecteurs ont été introduits dans la souche d' 'Agrobacterium LBA4404 par électroporation. Les souches contenant les différents vecteurs ont été utilisées pour réaliser la transformation génétique de N. sylvestris par la méthode des disques foliaires (Horsch et al., 1985). Environ 25 plantes résistantes à la kanamycine ont été obtenues pour chaque construction. La présence des transgènes dans chaque plante a été confirmée par PCR à partir d'ADN génomique de feuilles. Le niveau d'expression des transgènes a été vérifié par RT-PCR à partir d'ARNm de feuilles de tabac. Les exsudats des plantes qui expriment les transgènes ont été extraits par immersion dans une solution de pentane pendant 1 min. Les extraits ont été analysés par chromatographie en phase gazeuse couplée à un spectre de masse (GC/MS). Un exemple de profil chromatographique des exsudats de plantes obtenues par GC/MS est présenté sur la figure 4. Il montre que l'exsudat d'une lignée transgénique contenant les gènes NtCPS2 et NtKSL3 contient un pic supplémentaire noté n°l ' à 40,5 min. L'exacte superposition des temps de rétention et des spectres de masse du pic 1 à 40,5 min avec celui du czs-abiénol naturellement produit par N. tabacum (figures 4A et 5A), démontre l'authenticité du pic n°l comme étant le czs-abiénol. Les plantes qui expriment les deux transgènes NtCPS2 et NtKSL3 produisent des quantités importantes de czs-abiénol dans la lignée ihpCBTS (Tableau 5). Les lignées transgéniques ayant intégré le gène NtCPS2 seul ou le gène NtKSL3 seul ne produisent pas de czs-abiénol. Ces résultats indiquent que la présence des deux gènes est nécessaire à la synthèse de czs-abiénol. En conclusion, NtKSL3 et MCPS2 permettent la biosynthèse de cz's-abiénol à partir de GGPP.
Tableau 5 :
Taux de czs-abiénol et de CBT-diol dans les exsudats des plantes transgéniques ayant intégré et exprimant les transgènes NtCPS2 et NtKSL3. La quantification de czs-abiénol a été réalisée par GC/MS par comparaison avec un standard de czs-abiénol purifié à partir d'exsudat de feuilles de N. tabacum. N. sylvestris ihpCBTS : Lignée transgénique dont l'expression du gène CBTS a été inhibée par ARN interférence.
Figure imgf000029_0001
3398 N. sylvestris ihpCBTS 14 169 3403 N. sylvestris ihpCBTS 13 53
3388 N. sylvestris ihpCBTS 8 550
Références
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schâffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new génération of protein database search programs, Nucleic Acids Res. 25:3389-3402.
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. (2006) Current Protocols in Molecular Biology, John Wiley & Sons, Inc.
Bevan M, Barnes WM, Chilton MD. (1983) Structure and transcription of the nopaline synthase gène région of T-DNA. Nucleic Acids Res. 11: 369-385.
Cane DE. (1999) Sesquiterpene biosynthesis: Cyclization mechanisms. In "Comprehensive natural products chemistry, isoprenoids including carotenoids and steroids" Vol. 2, D. D. Cane, ed (Amsterdam, The Netherlands; Elsevier), pp.155-200
Carman RM, Duffield AR (1993) The Biosynthesis of Labdanoids - the Optical Purity of Naturally-Occurring Manool and Abiénol. Aust. J. Chem. 46 : 1105-1114 Eisenreich W, Bâcher A, Arigoni D, Rohdich F. (2004) Biosynthesis of isoprenoids via the non-mevalonate pathway. CeIl. Mol. Life Sci. 61 : 1401-1426.
Guo Z, Severson RF, Wagner GJ. (1994) Biosynthesis of the diterpene czs-abiénol in cell- free extracts of tobacco trichomes. Arch Biochem Biophys. 308(1): 103-8.
Hooykaas PJ, Schilperoort RA (1992) Agrobacterium and plant genetic engineering. Plant Mol Biol 20: 175
Horsch RB, Rogers SG, Fraley RT (1985) Transgenic plants. CoId Spring Harb Symp Quant Biol. 50: 433-7
McMillan J., and Beale M.H. (1999) Dipterpene biosynthesis. In comprehensive natural products chemistry, isoprenoids including carotenoids and steroids Vol. 2, D.D. Cane, ed (Amsterdam, The Netherlands;Elsever), pp.217-243
Sakamoto T, Miura K, Itoh H, Tatsumi T, Ueguchi-Tanaka M, Ishiyama K, Kobayashi M, Agrawal GK, Takeda S, Abe K, Miyao A, Hirochika H, Kitano H, Ashikari M, Matsuoka M. An overview of gibberellin metabolism enzyme gènes and their related mutants in rice. Plant Physiol. 2004 134(4): 1642-53
Sambrook J, Russell D. Molecular Cloning: a Laboratory Manual. CoId Spring Harbor Laboratory Press, third édition (1989).
Sun T, Kamiya Y The Arabidopsis GAl locus encodes the cyclase ent-kaurene synthetase A of gibberellin biosynthesis. Plant CeIl. 1994 6(10):1509-18.
ThompsonJ.D., Gibson,T.J., Plewniak,F., Jeanmougin,F. and Higgins,D.G. (1997) The ClustalX Windows interface: flexible stratégies for multiple séquence alignment aided by quality analysis tools. Nucleic Acids Research 24:4876-4882.
Tissier A, Sallaud C, Rontein D (2004) Promoteurs végétaux et utilisations PCT/FR 05/02530. Tissier A, Sallaud C, Rontein D (2005) Système de production de terpènes dans les plantes
Demande de brevet France FR 05 00855.
Wagner GJ, Wang E, Shepherd RW (2004) New approaches for studying and exploiting an old protubérance, the plant trichome. Annals ofBotany 93:3-11
Wise ML, Croteau RA (1999). Monoterpene biosynthesis. In "Comprehensive natural products chemistry, isoprenoids including carotenoids and steroids" Vol. 2, D.D. Cane, ed (Amsterdam, The Netherlands;Elsever), pp.97-153
Yamaguchi S, Sun T, Kawaide H, Kamiya Y. The GA2 locus of Arabidopsis thaliana encodes ent-kaurene synthase of gibberellin biosynthesis. Plant Physiol. 1998 116(4): 1271- 8.

Claims

Revendications
1- Méthode de production du cz's-abiénol ou de dérivés de celui-ci à partir de géranyl géranyl diphosphate (GGPP) dans une cellule ayant une source de GGPP, comprenant : a) l'introduction dans ladite cellule d'une construction portant une cassette d'expression comprenant un gène codant pour une syn-copalyl-8-ol diphosphate (syn-CODP) synthase présentant au moins 80 % d'identité avec la SEQ ID No 22 et d'une construction portant une cassette d'expression comprenant un gène codant pour une czs-labda-12,14-dien-8 alpha-ol synthase présentant au moins 80 % d'identité avec la SEQ ID No 24 ; b) la culture de la cellule transformée dans des conditions appropriées pour l'expression des gènes ; et, a) facultativement, la récolte du czs-abiénol ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.
2- Protéine isolée ou recombinante ayant une activité czs-labda-12,14-dien-8 alpha-ol synthase et ayant une séquence présentant au moins 95 % d'identité avec la SEQ ID No 24.
3- Protéine isolée ou recombinante ayant une activité syn-copalyl-8-ol diphosphate (syn- CODP) synthase et ayant une séquence présentant au moins 80 % d'identité avec la SEQ
ID No 22.
4- Acide nucléique comprenant une séquence nucléotidique codant pour une protéine selon la revendication 2, ou une séquence capable de s'hybrider à celui-ci dans des conditions stringentes et ayant une activité czs-labda-12,14-dien-8 alpha-ol synthase.
5- Acide nucléique comprenant une séquence nucléotidique codant pour une protéine selon la revendication 3, ou une séquence capable de s'hybrider à celui-ci dans des conditions stringentes et ayant une activité syn-copalyl-8-ol diphosphate (syn-CODP) synthase.
6- Cassette d'expression comprenant un acide nucléique selon la revendication 4 ou 5.
7- Vecteur comprenant un acide nucléique selon la revendication 4 ou 5 ou une cassette d'expression selon la revendication 6. 8- Cellule hôte comprenant un acide nucléique selon la revendication 4 ou 5, une cassette d'expression selon la revendication 6, ou un vecteur selon la revendication 7.
9- Organisme transgénique non-humain comprenant un acide nucléique selon la revendication 4 ou 5, une cassette d'expression selon la revendication 6, un vecteur selon la revendication 7, ou une cellule selon la revendication 8.
10- Organisme transgénique selon la revendication 9, caractérisé en ce que l'organisme est une plante à trichomes glanduleux, de préférence du genre Nicotiana.
11- Utilisation d'une protéine selon la revendication 2 ou 3, d'un acide nucléique selon la revendication 4 ou 5, d'une cellule hôte selon la revendication 8 ou d'un organisme transgénique selon la revendication 9 ou 10 pour la préparation de syn-copalyl-8-ol diphosphate ou de czs-abiénol ou de dérivés de ceux-ci.
12- Cellule ou organisme transgénique non-humain, caractérisé en ce que la voie de synthèse du czs-abiénol est bloquée par inactivation du gène codant pour une protéine selon la revendication 4 ou du gène codant pour une protéine selon la revendication 5 ou des deux gènes.
PCT/FR2007/051654 2006-07-13 2007-07-12 Genes codant pour la cis-labda-12,14-dien-8 alpha-ol (cis-abienol) synthase et la syn-copalyl-8-ol diphosphate synthase et leurs utilisations WO2008007031A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR06/06417 2006-07-13
FR0606417A FR2903703B1 (fr) 2006-07-13 2006-07-13 Genes codant pour la cis-labda-12,14-dien-8 alpha-ol (cis-abienol)synthase et la syn-copalyl-8-ol diphosphate synthase et leurs utilisations

Publications (1)

Publication Number Publication Date
WO2008007031A1 true WO2008007031A1 (fr) 2008-01-17

Family

ID=37649437

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2007/051654 WO2008007031A1 (fr) 2006-07-13 2007-07-12 Genes codant pour la cis-labda-12,14-dien-8 alpha-ol (cis-abienol) synthase et la syn-copalyl-8-ol diphosphate synthase et leurs utilisations

Country Status (2)

Country Link
FR (1) FR2903703B1 (fr)
WO (1) WO2008007031A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013075239A1 (fr) 2011-11-21 2013-05-30 The University Of British Columbia Diterpènes synthases et procédé de production de diterpénoïdes
US8586328B2 (en) 2008-02-15 2013-11-19 Firmenich Sa Method for producing sclareol
WO2014022434A1 (fr) * 2012-07-30 2014-02-06 Allylix, Inc. Polypeptides de sclaréol et de diphosphate de labdénediol synthase codant des molécules d'acide nucléique et leurs utilisations
CN106987625A (zh) * 2017-03-21 2017-07-28 三瑞农业科技股份有限公司 快速鉴定食用向日葵杂交种三瑞6号真实性和纯度的方法
CN107109393A (zh) * 2014-12-09 2017-08-29 帝斯曼知识产权资产管理有限公司 用于生产冷杉醇的方法
WO2023280677A1 (fr) 2021-07-06 2023-01-12 Isobionics B.V. Fabrication recombinante d'alcools terpénoïdes en c-20
US11999960B2 (en) 2018-02-06 2024-06-04 University Of Kentucky Research Foundation Method of producing tobacco plants with increased sucrose ester content

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040072323A1 (en) * 2001-01-05 2004-04-15 Matsuda Seiichi P.T. Diterpene-producing unicellular organism

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040072323A1 (en) * 2001-01-05 2004-04-15 Matsuda Seiichi P.T. Diterpene-producing unicellular organism

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL 1 February 2005 (2005-02-01), WANG E ET AL: "The cDNA of a Nicotiana tabacum terpenoid cyclase gene", XP002416765, Database accession no. AY528645 *
DATABASE GENESEQ 1 July 2004 (2004-07-01), MATSUDA S ET AL: "Diterpene synthase from Pisum sativum", XP002416767, Database accession no. ADM98974 *
DATABASE GENESEQ 1 July 2004 (2004-07-01), MATSUDA S ET AL: "Diterpene synthase from Stevia rebaudiana", XP002416768, Database accession no. ADM98965 *
DATABASE GENESEQ 1 July 2004 (2004-07-01), MATSUDA SPT ET AL: "Diterpene synthase DNA from Pisum sativum", XP002417004, Database accession no. ADM98960 *
DATABASE GENESEQ 1 July 2004 (2004-07-01), MATSUDA SPT: "Diterpene synthase DNA from Stevia rebaudiana", XP002417005, Database accession no. ADM98992 *
DATABASE UniProt 1 March 2005 (2005-03-01), WANG E ET AL: "Terpenoid cyclase of Nicotiana tabacum", XP002416766, Database accession no. Q5GIA8 *
GUO ZHENHUA ET AL: "Biosynthesis of the diterpene cis-abienol in cell-free extracts of tobacco trichomes", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, vol. 308, no. 1, 1994, pages 103 - 108, XP009077695, ISSN: 0003-9861 *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8586328B2 (en) 2008-02-15 2013-11-19 Firmenich Sa Method for producing sclareol
US9677091B2 (en) 2011-11-21 2017-06-13 The University Of British Columbia Diterpene synthases and method for producing diterpenoids
AU2012343263B2 (en) * 2011-11-21 2017-10-26 The University Of British Columbia Diterpene synthases and method for producing diterpenoids
US8889381B2 (en) 2011-11-21 2014-11-18 University Of British Columbia Diterpene synthases and method for producing diterpenoids
EP2783004A4 (fr) * 2011-11-21 2015-05-27 Univ British Columbia Diterpènes synthases et procédé de production de diterpénoïdes
WO2013075239A1 (fr) 2011-11-21 2013-05-30 The University Of British Columbia Diterpènes synthases et procédé de production de diterpénoïdes
US9725740B2 (en) 2012-07-30 2017-08-08 Evolva, Inc. Sclareol and labdenediol diphosphate synthase polypeptides, encoding nucleic acid molecules and uses thereof
US9353385B2 (en) 2012-07-30 2016-05-31 Evolva, Inc. Sclareol and labdenediol diphosphate synthase polypeptides, encoding nucleic acid molecules and uses thereof
WO2014022434A1 (fr) * 2012-07-30 2014-02-06 Allylix, Inc. Polypeptides de sclaréol et de diphosphate de labdénediol synthase codant des molécules d'acide nucléique et leurs utilisations
EP3929289A1 (fr) * 2012-07-30 2021-12-29 Evolva, Inc. Polypeptides de sclaréol et de diphosphate de labdénediol synthase codant des molécules d'acide nucléique et leurs utilisations
CN107109393A (zh) * 2014-12-09 2017-08-29 帝斯曼知识产权资产管理有限公司 用于生产冷杉醇的方法
EP3242937A4 (fr) * 2014-12-09 2018-07-25 DSM IP Assets B.V. Procédés de production d'abiénol
US10563190B2 (en) 2014-12-09 2020-02-18 Dsm Ip Assets B.V. Methods for producing abienol
CN107109393B (zh) * 2014-12-09 2021-08-03 帝斯曼知识产权资产管理有限公司 用于生产冷杉醇的方法
CN106987625A (zh) * 2017-03-21 2017-07-28 三瑞农业科技股份有限公司 快速鉴定食用向日葵杂交种三瑞6号真实性和纯度的方法
CN106987625B (zh) * 2017-03-21 2021-03-23 三瑞农业科技股份有限公司 快速鉴定食用向日葵杂交种三瑞6号真实性和纯度的方法
US11999960B2 (en) 2018-02-06 2024-06-04 University Of Kentucky Research Foundation Method of producing tobacco plants with increased sucrose ester content
WO2023280677A1 (fr) 2021-07-06 2023-01-12 Isobionics B.V. Fabrication recombinante d'alcools terpénoïdes en c-20

Also Published As

Publication number Publication date
FR2903703A1 (fr) 2008-01-18
FR2903703B1 (fr) 2012-09-28

Similar Documents

Publication Publication Date Title
EP2132305B1 (fr) Genes codant pour la z,z-farnesyl diphosphate synthase et une sesquiterpene synthase a produits multiples et leurs utilisations
EP1897951B1 (fr) Composition et procédés de production de stéviol et de glycosides de stéviol
Hemmerlin et al. Enzymes encoded by the farnesyl diphosphate synthase gene family in the big sagebrush Artemisia tridentata ssp. spiciformis
CA2595608C (fr) Systeme de production de terpenoides dans les plantes
US20150059018A1 (en) Methods and compositions for producing drimenol
US7199284B2 (en) Chlorophyllases
WO2008007031A1 (fr) Genes codant pour la cis-labda-12,14-dien-8 alpha-ol (cis-abienol) synthase et la syn-copalyl-8-ol diphosphate synthase et leurs utilisations
US11827915B2 (en) Method for production of novel diterpene scaffolds
US20170247713A1 (en) Trichome-specific transcription factor modulating terpene biosynthesis
Park et al. Differential expression of six novel peroxidase cDNAs from cell cultures of sweetpotato in response to stress
Curtis et al. Induction of dwarfism in transgenic Solanum dulcamara by over‐expression of a gibberellin 20‐oxidase cDNA from pumpkin
US11952582B2 (en) Herbicide-resistance gene and application thereof in plant breeding
Wang et al. Transcriptomic analysis reveals that reactive oxygen species and genes encoding lipid transfer protein are associated with tobacco hairy root growth and branch development
HU227706B1 (en) Methods and materials for making transgenic dicamba-degrading organisms
FR2734838A1 (fr) Fragment d'acide nucleique codant pour un enzyme implique dans la voie de biosynthese de l'acide abscisique (aba) chez les plantes
JPH09104698A (ja) カウレン合成酵素
CN114524868B (zh) 甘薯叶片发育及类黄酮强化相关蛋白IbBBX29及其编码基因与应用
WO2018015512A1 (fr) Biosynthèse de dérivés d'oxyde de 13r-manoyl
WO2021027771A1 (fr) Fonction et application de glyoxalase spg
EP3436573B1 (fr) Séquence nucléotidique codant la 9-lipoxygénase et constructions recombinantes la comprenant
US20040010822A1 (en) Hydroperoxyde lyases
EP2732039A1 (fr) Procédé d'amélioration de la résistance des plantes aux virus
FR2779737A1 (fr) Gene de reponse aux nematodes
CA2187170A1 (fr) Procede de selection de cellules eucaryotes transformees et cellules obtenues

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07823575

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 07823575

Country of ref document: EP

Kind code of ref document: A1