WO2007141705A2 - Promoteurs végétaux - Google Patents

Promoteurs végétaux Download PDF

Info

Publication number
WO2007141705A2
WO2007141705A2 PCT/IB2007/052002 IB2007052002W WO2007141705A2 WO 2007141705 A2 WO2007141705 A2 WO 2007141705A2 IB 2007052002 W IB2007052002 W IB 2007052002W WO 2007141705 A2 WO2007141705 A2 WO 2007141705A2
Authority
WO
WIPO (PCT)
Prior art keywords
plant
promoter
polynucleotide molecule
promoters
gene
Prior art date
Application number
PCT/IB2007/052002
Other languages
English (en)
Other versions
WO2007141705A3 (fr
Inventor
Alexander Andrew Myburg
Martin Ranik
Nicole Marie Creux
Original Assignee
Mondi Business Paper: South Africa
University Of Pretoria
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mondi Business Paper: South Africa, University Of Pretoria filed Critical Mondi Business Paper: South Africa
Publication of WO2007141705A2 publication Critical patent/WO2007141705A2/fr
Publication of WO2007141705A3 publication Critical patent/WO2007141705A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C12N9/1059—Cellulose synthases (2.4.1.12; 2.4.1.29)

Definitions

  • THIS INVENTION relates to plant promoters. More particularly, this invention relates to plant promoters from Eucalyptus species, and their use in regulating tempero- spatial gene expression in plants.
  • Promoter sequences from tree species are potentially extremely valuable for applications in tree biotechnology due to their ability to drive the expression of diverse transgenes, at varying intensities, in a range of tissues and cell types at developmental time-points relevant to the life-time of a tree.
  • an isolated plant promoter including a polynucleotide molecule having 95%, preferably 90%, more preferably 85%, most preferably 80% sequence homology to a polynucleotide molecule selected from the group consisting of any one of SEQ ID NOs 1 to 7, the complement thereof, fragments thereof, cis-elements contained therein, or nucleotide sequences which hybridize under strict hybridization conditions thereto, capable of regulating transcription of an operably linked transcribable polynucleotide molecule.
  • a further aspect of the invention extends to a plasmid construct or vector containing at least one of the isolated promoters of the invention.
  • the construct or vector may include a transcribable polynucleotide molecule linked operably downstream of the promoter.
  • a plant cell transformed with a construct including a promoter that is functional in plants the promoter including a polynucleotide molecule substantially homologous to a polynucleotide sequence selected from the group consisting of any one of SEQ ID NOs 1 to 7, the complement thereof, fragments thereof, cis-elements contained therein, or nucleotide sequences which hybridize under strict hybridization conditions thereto, wherein said promoter is operably linked to a transcribable polynucleotide molecule, wherein said transcribable polynucleotide molecule is a gene or regulatory molecule of agronomic, pharmaceutical, or bio-energetics interest.
  • a transgenic plant stably transformed with a construct including a promoter that is functional in plants, the promoter including a polynucleotide molecule substantially homologous to a polynucleotide sequence selected from the group consisting of any one of SEQ ID NOs 1 to 7, the complement thereof, fragments thereof, cis-elements contained therein, or nucleotide sequences which hybridize under strict hybridization conditions thereto, wherein said promoter is operably linked to a transcribable polynucleotide molecule, wherein said transcribable polynucleotide molecule is a gene or regulatory molecule of agronomic interest.
  • a method of modifying an agronomic trait such as wood quality in a plant including the steps of: transforming a plant cell with a construct having included therein a promoter of the invention having at least one gene encoding a gene for said agronomic trait; and regenerating said plant cell to produce a plant with a modified agronomic trait, when compared to a non-transformed plant.
  • a method of altering the cellulose content or cell wall characteristics of a plant including the steps of: transforming a plant cell with a construct having included therein a promoter of the invention having a gene involved in cell wall formation operably linked thereto; and regenerating said plant cell to produce a plant with modified cellulose content, when compared to a non-transformed plant.
  • a method of targeting the expression of a desired transgene to xylogenic tissues in vascular plants including the steps of: transforming a plant cell with a construct having included therein a promoter of the invention having a desired transgene linked thereto; and regenerating said plant cell to produce a plant in which the expression of the transgene is targeted to the xylogenic tissues of the plant.
  • the invention extends to sense or antisense sequences of the plant promoter, or derivatives thereof.
  • the transchbable polynucleotide molecule may be a gene or regulatory molecule of agronomic, forestry, pharmaceutical, or bio-energetics interest.
  • the transcribable polynucleotide molecule may confer enhanced wood formation, fibre formation, biofermentation, cell wall deposition and/or increased cellulose content on a transformed plant.
  • the transcribable polynucleotide molecule may encode at least one gene involved in cell wall formation, more specifically a cellulose synthase gene of Eucalyptus species, most specifically a cellulose synthase gene of Eucalyptus grandis.
  • the transgenic plant may be an angiosperm or a gymnosperm, such as, for example, a monocotyledonous plant, a dicotyledonous plant, a woody species, or a herbaceous species.
  • the transgenic plant may be a plant selected from the group consisting of: Arabidopsis, rice, maize, Populus, Acacia, Salix, and Eucalyptus species. However, other suitable species are within the scope of the invention.
  • the method may include the step of introducing more than one of the promoters of the invention into a plant cell and expressing transgenes operably linked to such promoters at specific ratios relative to one another.
  • the ratios may mimic the ratio of CesA genes in Eucalyptus spp. Accordingly, it will be appreciated that the promoters of the invention may act as a suite of regulatory sequences.
  • the promoter sequences of SEQ ID NOs 1 to 7 may be linked together to form a combined synthetic promoter sequence having promoter activity.
  • a method of mimicking the native expression pattern of cellulose synthase genes in a plant including the step of co-expressing at least one desired polynucleotide sequence operably linked to the promoter sequences of any one or more of SEQ ID NOs 1 to 7 in the plant.
  • the method may include a method of mimicking either the spatial expression of CesA genes, the temporal expression of CesA genes, or the tempero-spatial expression of CesA genes under control of the plant promoters of the invention in vivo, by transforming any one or more of the isolated promoters of the invention into a plant.
  • the invention extends also to seed, seedlings, clones, cuttings, and somatic embryos of a transgenic plant of the invention.
  • the invention extends also to a promoter set including any two or more of the promoter sequences of the invention, inserted into a vector, plant cell, transgenic plant, seed, seedling, clone, cutting or somatic embryo, and being capable of regulating transcription of an operably linked transcribable polynucleotide molecule.
  • Figure 1 shows tissue-specific gene expression levels of EgCesAI through 5 and 7 relative to the expression level of EgArf (Eucalyptus grandis ADP ribosylation factor). Vertical axis represents units of fold expression level relative to the normalization gene EgArf. Error bars denote the standard deviations of three replicate experiments.
  • FIG. 2 shows a schematic representation of the EgCesAI promoter cloned into pMDC162 and pMDC107 in sense and antisense orientation, directly ahead of the GUS gene or modified green fluorescent protein (mgfp ⁇ ). Left and right borders of the T-DNA are indicated (LB, RB).
  • Figure 3 shows PCR screening of lines carrying the EgCesAI promoter upstream of either GUS (A) or GFP (B).
  • Numbered columns 1-7 denote the amplification of a region of GUS (A, 690 bp) or GFP (B, 289 bp) as well as the endogenous control amplification of a 720 bp region of the Arabidopsis actin 2 gene in seven different transgenic lines.
  • Lane “o” denotes amplification of either the GUS or GFP fragments from plasmid DNA used to transform the plants.
  • Lane “wt” depicts the amplification of the actin 2 fragment from CoI-O DNA. No amplification of the GUS or GFP fragments was observed when using DNA from untransformed plants as template (data not shown).
  • Figure 4 shows a top view of a rosette leaf of T1 plant expressing GUS under the control of the EgCesAI promoter. Arrows indicate the dark-staining leaf veins.
  • Figure 5 shows histochemical staining of transverse sections through rosette leaves. Arrows indicate GUS staining in the central vein.
  • Figure 6 shows a partial longitudinal section series at increasing magnification through a rosette leaf of a T1 line expressing GUS driven by the EgCesAI promoter.
  • Black arrows designate the presence of a strong GUS signal in vessel elements in the central vein.
  • Red arrows indicate cellulose microfibrils deposited at right angles to the axis of the vessel cells.
  • Figure 7 shows a free-hand section through GUS-stained inflorescence stem of a T1 plant expressing GUS under the control of the EgCesAI promoter.
  • Vascular bundles are indicated by black arrows with the phloem (P) and xylem (X) polarity indicated.
  • Tissues with cells lacking secondary cell walls are indicated by red (pith parenchyma), blue (cortex parenchyma) and yellow (epidermis) arrows.
  • Figure 8 shows a free-hand sections through GUS-expressing inflorescence stems. GUS signal evident in cells undergoing secondary cell wall deposition.
  • Figure 9 shows gel images of the full-length amplification of the 6 EgCesA promoters sequences.
  • Lane 1 of each gel image shows a 1 kb ladder except for EgCesA7 which is a 100 bp ladder.
  • the subsequent lanes in each image indicates the full-length promoter fragment amplified from genomic DNA.
  • Figure 10a-f shows a schematic representation of the CesA promoter structure, indicative of conservation among the promoters of CesA orthologs from different species (Arabidopsis, Poplar and Eucalyptus).
  • Figure 11 shows a representation of the determination of the transcription start site of EgCesAI.
  • Lanes L, P and X denote the primer extension products derived from RNA extracted from unfolding leaves, phloem and xylem respectively.
  • Lane labelled '-' contains a primer extension reaction performed without reverse transcriptase. Numbers indicate sizes in base pairs of the Li-COR 50-350 IRD700-labelled molecular weight standard.
  • the arrow indicates the 243 bp primer extension product observed in all the analysed tissues.
  • Figure 12 shows expression of GUS in stem and leaf tissues of T2 Arabidopsis lines.
  • C3, C5 two independent T2 lines expressing the GUS reporter gene under the control of the sense EgCesAI promoter.
  • D1 T2 line harbouring the GUS gene preceded by the antisense EgCesAI promoter.
  • Wt wild-type untransformed Arabidopsis thaliana ecotype CoI-O.
  • Figure 13 shows expression of the GUS reporter gene in plants harbouring the EgCesA3::GUS reporter construct.
  • the specific expression of GUS in cells undergoing secondary cell wall formation is shown in free hand sections of stem (A and B), apical inflorescence stem including developing flowers and siliques (C), leaf veins (D) and root (E).
  • Figure 14 shows expression of the GUS reporter gene in plants harbouring the EgCesA4::GUS reporter construct.
  • the ubiquitous expression of GUS in cells undergoing primary cell wall formation is shown in leaves (A and B), apical inflorescence stem including developing flowers and siliques (C), roots (D) and freehand stem sections (E).
  • Figure 15 shows expression of the GUS reporter gene in plants harbouring the EgCesA5::GUS reporter construct.
  • the ubiquitous expression of GUS in cells undergoing primary cell wall formation is shown in leaves (A, B and E), apical inflorescence stem including developing flowers (C), free-hand stem sections (D) root (F) and thchomes (G).
  • Figure 16 shows the results of quantitative assays of GUS activity in transgenic plants harbouring various promoter:: GUS constructs.
  • GUS activity is indicated on the y- axis.
  • the identity of Arabidopsis lines is indicated on the x-axis.
  • Line numbers followed by S indicate GUS activity in stem tissue, while L denotes GUS activity in leaf tissues of the same line.
  • Lines with sense or anti-sense versions of the promoters are indicated by grey and white bars, respectively, below the x-axis.
  • Wood is composed mostly of cellulose, the crystallinity of which contributes largely to wood and fibre quality. Despite this, the molecular biology of cellulose biosynthesis in trees is still incompletely understood.
  • the first cellulose synthase gene characterised was identified as part of the cellulose synthase operon of Acetobacter xylinum, a cellulose-producing bacterium.
  • plant cellulose synthases were assumed to be associated with rosette-shaped protein complexes embedded in the cell membranes of all plant cells. This would be consistent with the observation that cellulose is synthesized in a highly organised fashion in plant cells, especially in secondary cell walls where cellulose chains are not only organized into microfibrils, but the microfibrils are closely aligned to form crystalline cellulose domains.
  • lmmunogold labelling of rosettes has shown that they contain subunits encoded by cellulose synthase genes.
  • Cellulose synthase catalytic subunit genes abbreviated as CesA, have since been sequenced in a number of higher plant species including Arabidopsis, rice, maize, poplar (Populus) and Eucalyptus .
  • CesA mutants in Arabidopsis form two distinct groups: those affecting cellulose deposition in primary cell walls: rsw1, ixr1, ixr2, cev1, elH, prd, and those affecting the walls of cells undergoing secondary thickening: irx1, irx3, irx ⁇ .
  • the three secondary cell wall related irregular xylem (irx) CesA mutants irx1, irx3, and irx ⁇ are caused by mutations in AtCesA8, AtCesA7 and AtCesA4 respectively.
  • AtCesA8, 7 and 4 are expressed at similar levels in the same cell types at the same developmental stage.
  • the CesA proteins IRX1 , IRX3 and IRX5 tend to co-purify, presumably due to their association as components of the rosette in vivo.
  • AtCesAs thought to act in primary cell wall development. Mutations in two relatively divergent Arabidopsis cellulose synthase genes, AtCesA3 and AtCesA ⁇ , produce very similar phenotypes: ixr1 and ixr2. It has also been shown via complementation studies that AtCesAI and AtCesA3, two distinct Ces>As required for primary cell wall biosynthesis, are not functionally redundant.
  • polynucleotide molecule refers to single- or double-stranded DNA or RNA of genomic or synthetic origin, i.e., a polymer of deoxyhbonucleotide or ribonucleotide bases, respectively, read from the 5' (upstream) end to the 3' (downstream) end.
  • polynucleotide sequence refers to the sequence of nucleotides or base pairs in a polynucleotide molecule.
  • promoter refers to a polynucleotide molecule that, in its native state, is located upstream or 5' to a translational start codon of an open reading frame (or protein-coding region) and which is in the selectively recognized and bound by RNA polymerase Il and other proteins (frans-acting transcription factors) to initiate transcription.
  • a "plant promoter” is a native or non-native promoter that is functional in plant cells, i.e. which can be used as a regulatory element for modulating expression of a nucleotide sequence, gene, or genes operably associated therewith.
  • Plant promoters include promoters produced through the manipulation of known promoters to produce artificial, chimeric, or hybrid promoters by methods known to persons skilled in the art of the invention.
  • chimeric or hybrid promoters comprising a polynucleotide sequence substantially homologous to any one or more of SEQ ID NOs 1 to 7, the complement thereof, fragments thereof, cis-elements contained therein, or nucleotide sequences which hybridize under strict hybridization conditions thereto, having promoter activity for modulating the expression of operably linked polynucleotide sequences is included in the present invention.
  • substantially homologous refers to polynucleotide molecules that demonstrate a substantial percent sequence identity with the promoters provided herein, wherein the polynucleotide molecules function in plants to direct transcription and have at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least about 95% sequence identity, or even greater sequence identity, such as 99% sequence identity with the polynucleotide sequences of the promoters described herein.
  • Polynucleotide molecules that are capable of regulating transcription of operably linked transcribable polynucleotide molecules particularly during wood or fibre formation, or xylogenesis of a plant, and that are substantially homologous to the polynucleotide sequences of the promoters provided herein are encompassed within the scope of this invention.
  • percent sequence identity refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference polynucleotide molecule (or its complementary strand) as compared to a test polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the window of comparison).
  • homology refers to the level of similarity or percent identity between polynucleotide sequences in terms of percent nucleotide positional identity, i.e., sequence similarity or identity.
  • homology also refers to the concept of similar functional properties among different polynucleotide molecules.
  • stringent conditions is functionally defined with regard to the hybridization of a nucleic-acid probe to a target nucleic acid.
  • relatively high stringent conditions e.g., one will select relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCI at temperatures of about 50 0 C to about 70 0 C.
  • a high stringency condition for example, is to wash the hybridization filter at least twice with high-stringency wash buffer (0.2 x SSC, 0.1 % SDS, at 65°C).
  • Appropriate moderate stringency conditions that promote DNA hybridization may be, for example, 6x sodium chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2 x SSC at 50 0 C. Additionally, the salt concentration in the wash step can be selected from a low stringency of about 2 x SSC at 50°C to a high stringency of about 0.2 x SSC at 50 0 C.
  • SSC sodium chloride/sodium citrate
  • agronomic also includes applications of the various soil and plant sciences to soil management and crop production, including forestry applications.
  • the promoter of the invention can be modified.
  • Those skilled in the art of the invention will appreciate that it is possible to create promoters that have variations in the polynucleotide sequence yet remain functional.
  • the polynucleotide sequences of the promoter of the present invention may be modified or altered to enhance the control characteristics thereof. Sequences can be modified, for example by insertion, deletion, point mutation, or replacement of template sequences in a PCR-based DNA modification approach.
  • a "variant" is a promoter containing changes in which one or more nucleotides of an original promoter is deleted, added, and/or substituted, preferably while substantially maintaining promoter function.
  • variant promoters can include changes affecting the transcription of a minimal promoter to which it is operably linked.
  • a minimal or basal promoter is a polynucleotide molecule that is capable of recruiting and binding the basal transcription machinery.
  • basal transcription machinery in eukaryotic cells is the RNA polymerase Il complex and its accessory proteins.
  • Variant promoters can be produced, for example, by standard DNA mutagenesis techniques or by chemically synthesizing the variant promoter or a portion thereof.
  • Novel chimeric promoters can be designed or produced by a number of methods.
  • promoters can be constructed such that promoter fragments or elements are operably linked, for example, by placing such a fragment upstream of a transchbable gene, polynucleotide sequence, or a minimal promoter.
  • the elements and fragments of the promoter of the present invention can be used by persons skilled in the art of the invention for the construction of such chimeric promoters.
  • Methods for construction of chimeric and variant promoters of the present invention include, but are not limited to, combining control elements of different promoters or duplicating portions or regions of a promoter.
  • Genomic DNA was isolated from Eucalyptus grandis using the DNeasy Plant kit (Qiagen, Valencia, CA). Genome walking was performed using the Genome Walker kit (Clontech, Palo Alto, CA) according to the manufacturer's instructions and starting from gene-specific DNA sequences at the 5' end of the EgCesAI to 5 and EgCesA7 genes. Genome walking products were cloned using the InsT/A clone kit (Fermentas, Hanover, MD) and sequenced. Sequences were assembled using the ContigExpress module of the Vector NTI software (ver. 9.1 , Invitrogen).
  • GUS Spc R TCCGGTTCGTTGGCAATACT mGFP 36 CACTGGAGTTGTCCCAATTC mGFP mGFP 322C CGTCGTCCTTGAAGAAGATG
  • EgCesA1_2180_R CAATCTTCTCGCGACCCAAT
  • EgCesA2_1356_R GCGCAAAATCAGATCAACCTA
  • EgCesA3_MS1 prom_F GTT CCC AAC TCA CTC ACC TA
  • EgCesA_1552_R TCCTGGCTCGGATGCTAAGA
  • EgCesA_GW_405 GCCTCCATCGTCGTCCTCTTCCTTCCT
  • EgCesA7_F AAAGGAAAGACGCGACAGCCAGAA
  • EgCesA7_R ACCAGAACGAGAGGACCCGACTCA
  • Full-length promoter sequences were amplified from genomic DNA using a proof-reading Taq polymerase mix (Exsel, Supertherm) and cloned into the GATEWA Y- adapted pCR8/GW/TOPO vector (Invitrogen, Carlsbad, CA). At least three independent clones of each full-length promoter were completely sequenced on both DNA strands. In addition, the Applicants have cloned approx 1 kb of the AtCesA8 promoter, orthologous to the EgCesAI promoter, for use as an endogenous positive control.
  • RNA-phmer complex was incubated for 1 hr at 42 0 C in the presence of 1 ⁇ l lmpromll reverse transcriptase (Promega, Madison, Wl) according to the manufacturer's instructions.
  • the single- stranded reverse transcription products were separated on an 8% denaturing polyacrylamide gel using the LI-COR DNA analyser (Model 4200S, LI-COR, Lincoln, NE). Band location and sizing was then performed.
  • TSSP transcriptional start site
  • 5'UTR length 5'UTR length.
  • TSSP is a plant specific TSS prediction programme trained on the plant promoters in PlantpromDB (database) (Table 3).
  • NNPP Neuronal network promoter prediction
  • Table 3 is a more general eukaryotic promoter prediction tool.
  • Table 3 A list of the on-line tools and their addresses used for in silico promoter analysis and motif identification.
  • Binary vectors were introduced into Agrobacterium tumefaciens strain LBA4404 using standard methods known to those of ordinary skill in the field of the invention.
  • Arabidopsis thaliana ecotype CoI-O was transformed by the floral dip method. Selection of transgenic seedlings was performed using hygromycin B.
  • genomic DNA was extracted from 100 mg of putative T1 Arabidopsis leaf material using the Dneasy Plant kit (Qiagen). To confirm the integration of the T-DNA into the Arabidopsis genome, PCR was performed using GUS-specific (GUS Spc F and GUS Spc R, Table 1 ) or GFP- specific (mGFP36 and mGFP322C, see Table 1 ) primers as appropriate for either pMDC162 or pMDC107.
  • GUS-specific GUS Spc F and GUS Spc R, Table 1
  • GFP-specific mGFP36 and mGFP322C, see Table 1
  • Fresh stem segments from confirmed transgenic T1 lines, as well as wild- type CoI-O Arabidopsis were harvested and vacuum infiltrated for 10 min in staining buffer followed by overnight incubation at 37 0 C. Chlorophyll in tissue sections was removed by treatment in 100% ethanol prior to free-hand sectioning. Sections were mounted in 50% glycerol and examined by light microscopy.
  • GUS assays were performed on tissue extracts. GUS activity was calculated in pmol 4-MU/min/mg of tissue.
  • EgCesA ⁇ When full-length promoter amplification was performed, all of the promoters produced a single fragment, except for EgCesA ⁇ .
  • EgCesA ⁇ promoter When the EgCesA ⁇ promoter was amplified, it produced two fragments, the larger fragment (EgCesA ⁇ A) was of the expected size (1559 bp) but the second fragment (EgCesA ⁇ B) was approximately 200 bp smaller ( Figure 9). These fragments were cloned and sequenced separately. DNA sequencing revealed that the fragments had a high sequence similarity but that EgCesA ⁇ B contained a 196 bp deletion and that both were similar to the sequence obtained from the original genome walking product.
  • TSS and the 5'UTR of these seven promoter sequences and their homologs in Arabidopsis and Populus trichocarpa were predicted using two programs. The results for the two programs were compared (see Table 2). Table 2. Comparison of the predicted TSSs of the Eucalyptus CesA genes and Populus orthologs as predicted by TSSP and NNPP.
  • a Orthologous promoters are grouped together in groups listed A-F as in Figure 2.5.
  • b Names of the CesA genes from Populus and Eucalyptus whose promoter regions were analyzed using TSSP and NNPP.
  • c Transcriptional start sites predicted by NNPP represented as the number of bp upstream of the start codon. The dashes indicate were the program was unable to predict a promoter.
  • d Transcriptional start sites predicted by TSSP, represented as the number of bp upstream of the start codon. The dashes indicate were the program was unable to predict a promoter.
  • FIG. 10 The structure of the CesA promoters appeared to be conserved among species.
  • Figure 10 groups the different homologs (presumed orthologs) together and compares their structure.
  • the first set of the secondary cell wall- associated CesA homologs produced a similar result with the Poplar and Eucalyptus 5'UTRs having only an 8 bp difference in length (218 bp and 210 bp respectively) and again the Arabidopsis 5'UTR was shorter, being only 75 bp in length.
  • the third set of the secondary call wall-associated homologs also showed high conservation, where each gene had a very short 5'UTR. Arabidopsis and Eucalyptus had the same predicted length of 5' UTR (45 bp), while Poplar had a slightly smaller 5'UTR of 35 bp, but this promoter was predicted by a different program.
  • the other homolog groups did not show such apparent conservation, but this may be due to the fact that the in silico analysis is not highly accurate.
  • FIG. 3 illustrates the screening of plants by PCR using primers selective for the GUS or GFP reporter genes. It was found that the majority of plants which survived the hygromycin B selection also contained the reporter genes located downstream from the EgCesAI promoter (see Figure 3). No amplification of GUS or GFP products were observed when wild-type Arabidopsis DNA was used as template (not shown). The presence of the reporter gene constructs were similarly confirmed for the EgCesA3, 4, 5 and AtCesA8 promoters.
  • transgenic plants harbouring EgCesA4 and 5 promoter: :GUS constructs exhibited much more ubiquitous, but strong expression of GUS.
  • GUS expression was observed in the veins and in the non-vein tissues ( Figure 14A, 14B, 15A, B and E), while GUS expression driven by the two secondary cell wall specific promoters was confined to veins. This was also true of root expression where GUS activity was observed in all root tissues ( Figure 14D and 15F), while EgCesA3 driven expression of GUS was restricted to the central vascular column.
  • EgCesA ⁇ expression was also observed in cells with rapidly expanding primary walls such as trichomes ( Figure 15G).
  • the leaf expression of the primary cell wall associated CesA promoters was equivalent to the expression of the strong constitutive double 35S promoter in the same tissues.
  • Overall the anti-sense versions of both the primary and secondary cell wall associated promoters were expressed at much lower (20 to 100 fold) and variable levels, which could be attributed to positional effects.
  • the GUS activity levels conferred by the orthologous pair of promoters (EgCesAI and AtCesA8) were similar in stem and leaf tissues.
  • the EgCesA3 promoter conferred the strongest stem-specific GUS expression of all the promoters.
  • the isolated promoter regions of EgCesAI -5 and 7 contain well-defined core promoter architecture that can be detected both by in silico and in vitro techniques
  • the two software programs used to predict the transcriptional start sites included in the six promoters were able to detect core promoter sequences for all of the Eucalyptus promoters (Table 2).
  • Table 2 When compared to the Arabidopsis and poplar promoters, the length and structure of the 5'UTRs of the EgCesA genes showed a great deal of conservation with orthologs in the two species. Differences in estimates between the two software programs could be ascribed to the collection of promoter sequences on which each was modelled. The in silico results were further supported by the results of an in vitro assay of the EgCesAI promoter ( Figure 11 ).
  • EgCesA3, AtCesA7 and PtrCesA2 promoters also have a highly conserved structure, with the 5'UTR of the Eucalyptus and the Arabidopsis sequences each having a length of 45 bp as predicted by TSSP, while the 5'UTR of PtrCesA2 only differs by 13 bp being 32 bp in length, as predicted by NNPP.
  • CesA promoters may be linked to expression differences among species and individuals
  • EgCesA ⁇ B has a 200 bp deletion.
  • the EgCesAI and EgCesA3 promoters activate the expression of transgenes in cells which are actively undergoing secondary cell wall deposition
  • EgCesA3 promoter resulted in stronger GUS expression than the EgCesAI promoter predicts that it will be possible to use these promoters to express transgenes at predictably scaled levels, while maintaining the appropriate temporal and spatial expression profiles of the genes under the control of these promoters.
  • the EgCesA4 and EgCesA ⁇ promoters activate the expression of transgenes in cells which are actively undergoing cell wall deposition
  • the Applicant showed that when expressed in Arabidopsis, the EgCesA4 and 5 promoters result in the induction of GUS activity in cells that are undergoing active cell wall biosynthesis.
  • these promoters were expressed at much lower levels than the secondary cell wall associated CesA promoters, they were still expressed at high levels, comparable to that of the strong constitutive 35S plant promoter often used in plant biotechnology.
  • 35S expression is not targeted towards actively dividing and growing plant cells, which suggests another possible utility of the primary cell wall associated CesA promoters, i.e. a spatial targeting function.
  • the EgCesA promoters represent a suite of transcriptional activators that can be utilized to regulate the expression of transgenes at predictable and scalable levels in primary and secondary plant tissues
  • the Applicant has isolated and characterized full-length CesA cDNAs from Eucalyptus. It has also been shown that the cellulose synthase gene family of Eucalyptus is regulated similarly to other plants, i.e. two groups of co-regulated Ces/As exist - associated with either primary or secondary cell wall biosynthesis. Considering the necessity for three functional Ces>As for primary and secondary cell wall biosynthesis, as well as evidence of a specific expression ratio of the three Ces>As relative to each other, the promoters of the EgCesAs are excellent targets for further characterization.
  • the EgCesA promoter set offers regulatory sequences of varying strengths which also have the potential to direct tissue-specific expression of transgenes in the same ratios and with a similar tempero-spatial profile as in Eucalyptus spp.
  • these promoters are potentially extremely valuable for transgenic biotechnology applications in forest trees, especially Eucalyptus spp, and it is foreseen that, even in Eucalyptus spp., the various CesA genes may be operably linked to, or controlled by, non-corresponding CesA promoters.
  • the promoters as described herein can be used to express transgenes in a very specific ratio that mimics the ratio of the CesA genes and allow modular expression of such transgenes. This feature emphasizes the value of the promoters as a suite of regulatory sequences.
  • EgCesAI, 3, 4 and 5 promoters are active in a heterologous system (Arabidopsis thaliana) and confer strong transcriptional activity to the GUS reporter gene, specifically in cells actively laying down secondary or primary cell walls consistent with the expression pattern of the same genes in Eucalyptus.
  • This suite of promoters is thus useful for targeting the expression of transgenes to xylogenic and other tissues in vascular plants.
  • the promoters of the invention may be used to direct the tempero-spatial expression of certain peptides such as immunological peptides, sub-unit vaccines, and the like, in plants transformed with these promoters, and also to enhance the bio- fermentative, wood formation, and fibre formation characteristics of transformed plants or cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des promoteurs végétaux pleine-longueur, isolés et caractérisés, issus de l'eucalyptus. Les promoteurs régulent l'expression de la famille de gènes de la cellulose synthase (CesA), qui est impliquée dans la formation du bois et des fibres des arbres. L'ensemble de promoteurs de la CesA faisant l'objet de cette invention présente des séquences régulatrices de forces variées qui possèdent également le potentiel de diriger l'expression spécifique tissulaire de transgènes dans des rapports et avec un profil temporo-spatial similaires à ceux d'Eucalyptus spp. Les promoteurs décrits dans ce document peuvent être utilisés pour exprimer des transgènes dans un rapport très spécifique, analogue au rapport des gènes de la CesA, et permettent une expression modulaire de tels transgènes. L'invention concerne également des cassettes d'expression, des vecteurs et des plantes transgéniques contenant lesdits promoteurs, ainsi qu'un procédé de production desdites plantes et graines transgéniques.
PCT/IB2007/052002 2006-06-02 2007-05-28 Promoteurs végétaux WO2007141705A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ZA2006/04517 2006-06-02
ZA200604517 2006-06-02

Publications (2)

Publication Number Publication Date
WO2007141705A2 true WO2007141705A2 (fr) 2007-12-13
WO2007141705A3 WO2007141705A3 (fr) 2008-06-19

Family

ID=38792069

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2007/052002 WO2007141705A2 (fr) 2006-06-02 2007-05-28 Promoteurs végétaux

Country Status (2)

Country Link
WO (1) WO2007141705A2 (fr)
ZA (1) ZA200810878B (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019148193A1 (fr) * 2018-01-29 2019-08-01 Afingen, Inc. Compositions et procédés pour augmenter la croissance de plantes et améliorer de multiples traits liés au rendement

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000058474A1 (fr) * 1999-03-25 2000-10-05 Genesis Research & Development Corporation Limited Compositions et methodes de modification de l'expression genique
WO2004048595A2 (fr) * 2002-11-22 2004-06-10 Arborgen, Llc Promoteurs a preference vasculaire
WO2006109424A1 (fr) * 2005-03-31 2006-10-19 Oji Paper Co., Ltd. Adn codant pour une proteine ayant pour fonction de former et de reguler la paroi cellulaire de fibre cellulosique dans un tronc d'arbre et leurs and promoteurs

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000058474A1 (fr) * 1999-03-25 2000-10-05 Genesis Research & Development Corporation Limited Compositions et methodes de modification de l'expression genique
WO2004048595A2 (fr) * 2002-11-22 2004-06-10 Arborgen, Llc Promoteurs a preference vasculaire
WO2006109424A1 (fr) * 2005-03-31 2006-10-19 Oji Paper Co., Ltd. Adn codant pour une proteine ayant pour fonction de former et de reguler la paroi cellulaire de fibre cellulosique dans un tronc d'arbre et leurs and promoteurs

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [Online] 31 January 2006 (2006-01-31), "Eucalyptus grandis cellulose synthase 1 (CesA1) mRNA, complete cds." XP002464035 retrieved from EBI accession no. EMBL:DQ014505 Database accession no. DQ014505 -& RANIK MARTIN ET AL: "Six new cellulose synthase genes from Eucalyptus are associated with primary and secondary cell wall biosynthesis" TREE PHYSIOLOGY, vol. 26, no. 5, May 2006 (2006-05), pages 545-556, XP002464276 ISSN: 0829-318X *
WU L ET AL: "A XYLEM-SPECIFIC CELLULOSE SYNTHASE GENE FROM ASPEN (POPULUS TREMULOIDES) IS RESPONSIVE TO MECHANICAL STRESS" PLANT JOURNAL, BLACKWELL SCIENTIFIC PUBLICATIONS, OXFORD, GB, vol. 22, no. 6, June 2000 (2000-06), pages 495-502, XP001098902 ISSN: 0960-7412 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019148193A1 (fr) * 2018-01-29 2019-08-01 Afingen, Inc. Compositions et procédés pour augmenter la croissance de plantes et améliorer de multiples traits liés au rendement
US11613760B2 (en) 2018-01-29 2023-03-28 Afingen, Inc. Compositions and methods for increasing plant growth and improving multiple yield-related traits

Also Published As

Publication number Publication date
ZA200810878B (en) 2010-06-30
WO2007141705A3 (fr) 2008-06-19

Similar Documents

Publication Publication Date Title
AU2005252469B2 (en) Polynucleotides and polypeptides involved in plant fiber development and methods of using same
EP2096909A2 (fr) Polynucleotides et polypeptides impliques dans le developpement de fibres vegetales et procedes d'utilisation
CN111118030B (zh) 调控玉米叶夹角的dna序列及其突变体、分子标记、检测引物和应用
EP3601579A1 (fr) Éléments de modulation d'expression et leur utilisation
CN109311952B (zh) 用于控制棕榈壳表型的mads-box域的等位基因
US10036030B2 (en) Use of the soybean sucrose synthase promoter to increase plant seed lipid content
Gavazzi et al. Evolutionary characterization and transcript profiling of β-tubulin genes in flax (Linum usitatissimum L.) during plant development
CN110079534B (zh) 调控玉米开花期的基因、启动子及其应用
CN108291234A (zh) 倍数孢子体形成基因
CN110862993B (zh) 控制玉米株高和穗位高基因zkm89及其应用
US9133470B2 (en) Material and methods to increase plant growth and yield
US7205450B2 (en) DMI1 gene encodes a protein that is required for the early steps of bacterial and fungal symbioses
CN102690341A (zh) 一种与植物分蘖相关蛋白及其编码基因
Wise et al. Isolation and characterization of the cellulose synthase genes PpCesA6 and PpCesA7 in Physcomitrella patens
CN112521471B (zh) 一个控制玉米籽粒含水量的基因和分子标记及其应用
CN110862440A (zh) 控制玉米株高基因zkm465及其应用
WO2007141705A2 (fr) Promoteurs végétaux
WO2006102491A2 (fr) Modification de la taille de l'albumen ou d'un embryon vegetal pendant le developpement de la semence
CN110862994A (zh) 控制玉米株高和穗位高基因zkm76及其应用
CN116790599B (zh) 蔷薇属u6启动子及其应用
US20170233754A1 (en) Materials and methods to increase plant growth and yield
WO2018102131A1 (fr) Terminateurs transcriptionnels pour l'expression génique dans des plantes
CN114516908B (zh) 水稻粒形调控蛋白hos59及其编码基因和应用
BR112012024153B1 (pt) Seqüência de dna contendo a região promotora e elementos regulatórios do gene mec1, com expressão na raiz da mandioca, para uso em programas de melhoramento
AU2012216482B2 (en) Polynucleotides and Polypeptides Involved in Plant Fiber Development and Methods of Using Same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07736030

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 07736030

Country of ref document: EP

Kind code of ref document: A2