Classifications

• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
  • G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
  • A01K67/027—New or modified breeds of vertebrates
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
  • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
  • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
  • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P5/00—Drugs for disorders of the endocrine system
  • A61P5/48—Drugs for disorders of the endocrine system of the pancreatic hormones
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2227/00—Animals characterised by species
  • A01K2227/10—Mammal
  • A01K2227/105—Murine
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2267/00—Animals characterised by purpose
  • A01K2267/03—Animal model, e.g. for test or diseases
  • A01K2267/035—Animal model for multifactorial diseases
  • A01K2267/0362—Animal model for lipid/glucose metabolism, e.g. obesity, type-2 diabetes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/112—Disease subtyping, staging or classification
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/118—Prognosis of disease development
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/136—Screening for pharmacological compounds
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/156—Polymorphic or mutational markers
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/158—Expression markers
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/172—Haplotypes
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2800/00—Detection or diagnosis of diseases
  • G01N2800/04—Endocrine or metabolic disorders
  • G01N2800/042—Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism

Definitions

• the present application implicates the involvement of the HIF ⁇ - homologous ArntU gene in the control of type 1 (insulin-dependent) diabetes. Accordingly, the present invention provides a method of determining the susceptibility of a subject to developing insulin-dependent diabetes based on the expressing level of the Arntl2 gene.
• the present invention also provides a method for identifying compounds effective for treating or preventing having insulin-dependent diabetes in a subject in need thereof and a method of treating or preventing insulin-dependent diabetes by administering an effective amount of compound identified by the identification method.
• the present invention also provides a method of enhancing protection against insulitis progression or autoimmune diabetes development in a subject in need thereof comprising, enhancing expression of the ArntU gene.
• Type 1 or insulin dependent diabetes is an autoimmune disease characterized by the progressive destruction of insulin-producing ⁇ -cells of the islets of Langerhans by infiltrating lymphocytes (1, 2).
• the disease which affects about 0.3% of the Caucasian population, is both multifactorial and polygenic, with the MHC class II locus and the insulin locus being the two best studied genetic loci (3, 4).
• the non-obese diabetes (NOD) mouse (5, 6) is a well-characterized animal model of IDDM. More than twenty murine insulin dependent diabetes susceptibility loci (Idd) have been genetically identified (7), but little information has been obtained about the nature of these non-MHC Idd genes. Construction of congenic strains, differing from the NOD receiver strain by only a selected genetic region derived from a non-diabetes prone parental donor strain (8, 9), is a widely used approach allowing the definition of disease-related candidate regions. A promising strategy for candidate gene identification is to combine a variety of phenotypic studies of congenic mice with expression profiling, haplotype and mutational analysis (10-13).
• Idd loci have been identified on mouse chromosome 6. (14-16). Recently, the IDDM associated loci Idd6, Iddl9, and Idd20 on distal chromosome 6 have been further defined by the analysis of a series of congenic strains, carrying C3H/HeJ genomic material for distal chromosome 6 introgressed onto the NOD/Lt genetic background, with their candidate regions being refined respectively to 4.5, 7 and 4 cM (17).
• NOD/Lt alleles at the Idd6 locus on distal mouse chromosome 6 confer susceptibility to IDDM, whilst C57BL/6, C57BL/10 and C3H/HeJ alleles all confer resistance to diabetes (14, 17, 18).
• the NOD.C3H congenic strain described in this study carries NOD alleles at both the Natural Killer gene complex (18) and the candidate region for the islet-specific BDC-6.9 autoantigen gene (19), which excludes both these loci as responsible for the disease resistance.
• the Idd6 candidate region does however overlap with the candidate region for the resistance of immature T-cells to dexamethasone (20-22). Idd6 has also been suggested to control low rates of proliferation in immature NOD-thymocytes (23).
• the inventors describe the transcriptional profiling of all identified transcripts within the Idd6 interval of the murine model system. A total of six transcripts distributed throughout the interval were found to have strongly altered expression profiles when comparing splenic tissues of the disease protected congenic NOD.C3H 6.VIII and a NOD control strain. Analysis of newly created subcongenic strains showed the presence of at least three diabetes related sub-loci within the Idd6 locus. The recently identified control of disease protection mediated splenocytes was mapped to a 700 kb interval, which contains the Aryl hydrocarbon receptor nuclear translocator-like 2 (Arntl2, Bmal2) encoding gene.
• Aryl hydrocarbon receptor nuclear translocator-like 2 Arntl2, Bmal2
• Arntl2 upregulation correlated with the upregulation of the ARNT-binding site containing Pla2g4a gene that has recently been shown to be required for protection against insulitis progression and autoimmune diabetes development. Accordingly, the present invention targets Arntl2 and its downstream targets for controlling type 1 diabetes resistance.
• Another object of the present invention is to provide a method for identifying a compound effective for treating or preventing insulin-dependent diabetes in a subject in need thereof by: a) acquiring a control sample from a diabetes-sensitive NOD mouse; b) determining the expression level of the Arntl2 gene in the control sample; c) administering at least one candidate compound to the diabetes-sensitive NOD mouse; d) acquiring a test sample from the diabetes-sensitive NOD mouse; e) determining the expression level of the Arntl2 gene in the test sample; and e) comparing the expression level of the ArntU gene determined in (b) with that determined in (e), wherein an increase in the expression level of the ArntU gene in (e) as compared to (b) is correlated with an increase in insulin-dependent diabetes resistance.
• Another object of the present invention to provide a method of preventing insulin-dependent diabetes in a subject in need thereof by administering an effective amount of a composition containing the compound identified by the method above. It is still another object of the present invention to provide a method of enhancing protection against insulitis progression or autoimmune diabetes development in a subject in need thereof by enhancing expression of the Arntl2 gene in cells of the subject.
• the target genes may be one or more of ' Pla2g4a, Gpx, Chi313, and Mpo.
• Figure 1 shows genotyping using a large marker panel for distal chromosome 6, which permits estimation of the size of the C3H derived intervals.
• A Cumulative incidence of different mouse strains and
• B diabetes protection in splenocyte co- transfer. P-values are ⁇ 0.0001 for 6.VIII, ⁇ 0.0001 for 6.VIIIa, 0.01 for 6. VIII c, 0.026 for 6.VIIIc against CO in diabetes incidence; 0.012 for 6. VIII, 0.568 for 6.VIIIa, 0.339 for 6.VIIIb, and 0.048 for 6.VIIIc against CO, and ⁇ 0.0001 for CO against diabetogenic splenocytes (Db) in diabetes transfer assay.
• Figure 2 shows a map of the C3H derived intervals (grey bars) on distal chromosome 6 contained in the original NOD.C3H 6.VIII and new subcongenic mouse strains 6.VIIIa, 6.VIIIb, 6.VIIIc.
• the localization of the newly defined candidate region for the splenocyte subphenotype ⁇ Idd6.3) is indicated by dotted lines.
• Figure 3 shows the relative expression of Ar ntl 2 (Bmal2) gene in strain 6.
• RNA from spleen and thymus of four pre-diabetic female mice (A) and spleen at different ages and 15 weeks old diabetic mice (B) were analysed for the expression of Arntl2 by
• Figure 4 shows the transcription profile and architecture of Bmal2.
• A Transcript profiles of Bmal2 in 6.VIII and NOD mice were identical as shown by Northern blotting. 1 , thymus; 2, testis; 3, spleen; 4, skeletal muscle; 5, lung; 6, liver; 7, kidney; 8, heart; 9, brain.
• B Three isoforms Bmal2a, Bmal2b, and Bmal2c of 579, 199 and 355 amino acids length, were present in the spleen (bottom).
• C Partial sequences identified in spleen indicate the presence of strain-specific isoforms (top).
• Figure 5 shows C3H versus NOD polymorphisms within Bmal2.
• A Within the coding sequence of Bmal2, six codons at positions 71, 425, 426, 450, 455 and 483, and one synonymous mutation corresponding to codon 94 differed between the 6.VIII and NOD strains.
• B The alignment of partial 3'UTR of the Bmal2 gene, corresponding to Ensembl Chr.6 sequence positions 147,759,731 to 147,760,164, from strain 6.VIII (upper sequence) and NOD displays significant sequence variation. The length of this region in 6. VIII is 123 bases shorter than in NOD mice.
• Figure 6 shows circadian transcription profiles of Arntl2, Arntll, Perl, and PAI-I expression in spleens of single eight weeks old 6.VIII (white circles) and NOD (black triangles) mice housed under 14 hour light (blank bar) and 10 hour dark cycle (filled bar) which are shown as arbitrary units.
• ZT zeitgeber time
• Figure 7 shows relative expression in arbitrary units of Pla2g4a (A) in the spleens of different aged mice of 6.VIII (white bars) and NOD (black bars) strains. Data were pooled from four pre-diabetic female mice.
• ZT zeitgeber time.
• Figure 8 shows a graphic depiction of information relevant to mBmal2.
• Figure 9 shows the transcription profile of mBmal2.
• Figure 10 shows the gene structure of mBmal2.
• Figure 11 shows the SNPs and Indels of mBmal2.
• the sequence depicted as "Query” is SEQ ID NO: 35 and the sequence depicted as "Sbjct” is SEQ ID NO: 36.
• Figures 12A-B shows the Bmal2 coding region.
• NOD control is shown in SEQ ID NO: 33, while 6.VIII is shown in SEQ ID NO: 34.
• Figures 13A-C shows the designation of the intron and exon portions of the genomic sequence.
• Figure 13A 071-E1 (118F-668R) - 3 SNP (Ensembl Chr.6 147727278 to 147727780), Exon: underlined; NOD control is shown in SEQ ID NO: 37, while 6.VIII is shown in SEQ ID NO: 38.
• Figure 13B SNP35-38 (SNP35-38- 64F+SNP35-38-465R) - 1 SNP (Ensembl Chr.6 147746092-147746427); NOD control is shown in SEQ ID NO: 39, while 6.VIII is shown in SEQ ID NO: 40.
• Figure 13C 071-E5 (131F+465R) - 5 SNPs (Ensembl Chr.6 147751781 to 147752273) Exon : underlined ; NOD control is shown in SEQ ID NO: 41, while 6.VIII is shown in SEQ ID NO: 42.
• Figure 13D 071-SNP 75-80 (114F+440R) - 1 SNPs (Ensembl Chr.6 starting from the 3rd base 147758806 to 147759169); NOD control is shown in SEQ ID NO: 43, while 6.VIII is shown in SEQ ID NO: 44.
• FIG 14 shows the Bmal2 coding region which marked exons.
• Bmal2 coding region SEQ ID NO: 45
• exons marked by different colors CO as example
• Figures 15A-B shows the Sequencing files (071-43F to 071-2122R) corresponding to Bmal2c. More specifically, these figures show the sequencing data corresponding to Bmal2c by amplification using SEQ ID NO: 31 as the forward primer and the reverse complement of SEQ ID NO: 32 as the reverse primer. Bmal2c was cloned into a pGEM-T vector. The coding region is underlined. NOD control
• SEQ ID NO: 47 While 6.VIII (Fig. 15B) is shown in SEQ ID NO: 48 with the encoded polypeptide appearing as SEQ ID NO: 49.
• Figure 16 shows the 3' UTR (right after the stop codon), the first base corresponds to Ensembl v37 chr.6 147759660. NOD control is shown in SEQ ID NO: 50, while 6.VIII is shown in SEQ ID NO: 51.
• Figures 17A-D shows the upstream genomic sequence (primers: 071- 16798F+071-17695R).
• Fig. 17A Upstream genomic sequence (primers: 071 -
• NOD control is shown in SEQ ID NO: 52, while 6.VIII is shown in SEQ ID NO:
• Fig. 17B Upstream genomic sequence (primers: 071-17610F-18412R) - 5 SNPs (Ensembl Chr.6 147716616 to 147717298); NOD control is shown in SEQ ID NO: 54, while 6.VIII is shown in SEQ ID NO: 55.
• Fig. 17C Upstream genomic sequence
• the Idd6 murine type 1 diabetes locus has been shown to control diabetes by regulating the protective activity of the peripheral immune system as demonstrated by diabetes transfer assays using splenocytes.
• the analysis of three novel subcongenic NOD.C3H strains has confirmed the presence of at least two diabetes related genes within the 5.4 Mb Idd6 interval with the disease protection conferred by splenocyte co-transfer being located to a 700 kb subregion.
• This sub-interval contains the circadian rhythm related transcription factor Arntl2 (Bmal2), a homologue of the type 2 diabetes associated ARNT (HIF l ⁇ ) gene.
• Arntl2 exhibited a six-fold upregulation in spleens of the NOD.C3H 6.VIII congenic strain compared to the NOD control strain, strain-specific splice variants and a large number of polymorphisms in both coding and non-coding regions.
• ArntU upregulation was not associated with changes in the expression levels of other circadian genes in the spleen, but did correlate with the upregulation of the ARNT-binding motif containing Pla2g4a gene, that has recently been described as being protective for the progression of insulitis and autoimmune diabetes in the NOD mouse.
• the present application provides that the HIF ⁇ - homologous ArntU gene is involved in the control of type 1 diabetes.
• Non-obese diabetic (NOD) mice deficient in cPLA(2)alpha show severe insulitis and an increased incidence of diabetes.
• PGE(2) prostaglandin E(2)
• TNF tumour necrosis factor
• ARNT HIFl ⁇
• ARNT also known as the Hypoxia-Inducible Factor 1
• Arntl2 heterodimerizes with both BMALl and BMAL2 to regulate gene transcription.
• the present invention provides a method of diagnosing the susceptibility of a subject to developing insulin-dependent diabetes by: a) acquiring a sample from said subject; b) determining the expression level of the Arntl2 gene in said sample; c) comparing the expression level of the Arntl2 gene determined in (b) with that of the average expression level of the Arntl2 gene in samples of the corresponding type obtained from the population to which said subject belongs, wherein an expression level of the ArntU gene in said subject that is lower than that of the average expression level of the ArntU gene is correlated with an increased susceptibility in developing insulin-dependent diabetes.
• any mammal may be used as the subject.
• mammals suitable for use in the present invention include humans, rats, and mice.
• the Arntl2 gene is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 3.
• the Arntl2 gene encodes a protein that is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 4.
• the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
• the term "% homologous" includes "% similarity" and "% identity”.
• the ArntU gene is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 3.
• the ArntU gene encodes a protein that is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 4.
• the ArntU gene product possess aryl hydrocarbon receptor nuclear translocator activity.
• the sample may be obtained from one of several sources. These sources include many other body tissues and/or cells. Particular exemplary cell types include: mucosa, spleen, thymus, blood, and pancreas. The skilled artisan would know how to and would select the most appropriate source for the samples for use in the methods of the present invention.
• the sample contains at least one type of cells selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages.
• the sample is obtained from the spleen.
• the sample may be acquired by conventional techniques that are readily known to the skilled artisan.
• the sample may be obtained by tissue biopsy, a blood sample, or a mucosa sample.
• the determination method of the expression level of the Arntl2 gene may be achieved by any known method. For example, it is possible to quantitate the amount of ArntU transcripts by quantitative PCR techniques using primers designed based upon the known sequence of the Arntl2 gene. The artisan is referred to Current Protocols in Molecular Biology, Ausubel, et al., Eds., Greene Publishing and Wiley- Interscience, New York (2000), among other well known treatises for a discussion of standard PCR protocols. Other quantitation techniques that may be used to effectuate the expression level determination include ELISA and/or Western blot techniques.
• the expression level of the AnrtU gene of the candidate subject is compared to that of the average expression level of the ArntU gene in splenic samples of the corresponding type (i.e., where the sample from the subject is acquired from the spleen the comparative expression level would be from spleen, etc.) obtained from the population to which said subject belongs.
• the sample may be from a variable source (e.g., thymus, spleen, pancreas, blood, mucosa, etc.) while the comparative expression level is that for a known standard source (e.g., blood).
• the basal expression level for each individual member of the population may be obtained via the same procedure as that of the candidate subject. Following collection of a representative number of members in the population to which the candidate subject belongs an average expression level is determined to which the expression level of the candidate subject can be compared. Within this embodiment, it is preferred that the representatives of the population be clinically screened as to their type 1 diabetes status so as to ensure an unbiased population.
• the expression level of the ArntU gene is significantly higher than that found in diabetes-sensitive subjects.
• the expression level of the Arntl2 gene in the candidate subject is lower than that of the average expression level of the ArntU gene this decreased expression may be correlated to an increased susceptibility in developing insulin-dependent diabetes.
• In another embodiment of the present invention is a method for identifying a compound effective for treating or preventing insulin-dependent diabetes in a subject in need thereof by: a) acquiring a control sample from a diabetes-sensitive NOD mouse; b) determining the expression level of the ArntU gene in said control sample; c) administering at least one candidate compound to said diabetes-sensitive NOD mouse; d) acquiring a test sample from said diabetes-sensitive NOD mouse after said administering; e) determining the expression level of the Arntl2 gene in said test sample; and e) comparing the expression level of the ArntU gene determined in (b) with that determined in (e), wherein an increase in the expression level of the Arntl2 gene in (e) as compared to (b) is correlated with an increase in insulin-dependent diabetes resistance.
• the Arntl2 gene is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 1. Further, it is preferred that the Arntl2 gene encodes a protein that is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 2. Still further, it is preferred that the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
• the term "% homologous" includes "% similarity" and "% identity”.
• the ArntU gene is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 1.
• the Amtl2 gene encodes a protein that is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 2.
• the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
• the control sample is obtained from the spleen of the diabetes-sensitive NOD mouse.
• the control sample contains at least one type of splenic cells selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages.
• the foregoing control sample may be obtained from the thymus, pancreas, a blood sample, or a mucosa sample of the diabetes-sensitive NOD mouse.
• the test sample is obtained from the spleen of the diabetes-sensitive NOD mouse.
• the test sample contains at least one type of splenic cells selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages.
• the foregoing test sample may be obtained from the thymus of the of the diabetes- sensitive NOD mouse.
• the test sample may be obtained from other tissue and/or cell sources, such as the pancreas.
• the sample may also be acquired from a blood sample or a mucosa sample.
• the sample may be acquired by conventional techniques that are readily known to the skilled artisan.
• the sample may be obtained by tissue biopsy, a blood sample, or a mucosa sample.
• the determination method of the expression level of the Arntl2 gene may be achieved by any known method. For example, it is possible to quantitate the amount of Arntl2 transcripts by quantitative PCR techniques using primers designed based upon the known sequence of the Arntl2 gene.
• suitable PCR primers include the primer pairs represented by SEQ ID NO: 1 1 (071 -248F) and SEQ ID NO: 12 (071 -334R) or SEQ ID NO: 13 (AY-56F) and SEQ ID NO: 14 (AY- 136R).
• Additional primers suitable for use are the primer pair: 071-43F - GGGAGGATTGTTAGCACGTCTGTGA (SEQ ID NO: 31) and 071-2122R - the reverse and complementary sequence of 5'-CACTGTACTCTTGAGCACTGTATTG- 3' (SEQ ID NO: 32).
• the expression level of the ArntU gene is significantly higher than that found in diabetes-sensitive subjects.
• the expression level of the ArntU gene in the test sample as compared to the control sample has increased due to contact with the candidate compound(s)
• the increased expression level of the Arntl2 gene may be correlated with an increase in insulin-dependent diabetes resistance.
• a difference in expression level is considered to be "significant" when it is a reproducible and noticeable and/or measurable difference. More preferably, the term "significant" refers to a statistically significant difference. As the skilled artisan would appreciate, statistically significance can be determined by any conventional statistical analysis method. The difference is considered statistically significant when the p-value is 5%, more preferably 1%, and most preferably 0.1%.
• the candidate compound(s) is not particularly limited. It is envisioned that in the present invention the candidate compound(s) may be a drug, a polynucleotide, a polypeptide, immunogenic fragments of polypeptides, a hormone, etc. or a salt thereof. Further, within this embodiment there is no particular limitation on the number of compounds that may be simultaneously administered to the subject. In other words, a compound may be separately administered or multiple compounds may be administered sequentially or simultaneously. Further, the compounds may be administered as pharmaceutical compositions containing one or more pharmaceutically acceptable carriers, diluents, excipients, and adjuvants, or mixtures of the same.
• the present method is adaptable to determining the effect of a wide range of dosage forms and amounts. Therefore, it is envisioned that the compound(s) may be administered via any route including orally, parenterally, intravenously, intradermally, subcutaneously, or topically, in liquid or solid form.
• the time between the administration of the candidate compound(s) and the recovery of a test sample may range from instantaneous to minutes to hours to weeks. Further, the administration may be either a single administration or may include multiple repeated administration events prior to recovery of a test compound. For example, the present invention embraces repeated individual administration events of the same (or different compounds) once hourly, every four to six hours, twice daily, once daily, once weekly, etc.
• phrases "effective for treating a subject having insulin-dependent diabetes” or the term “treating” as used herein means that the administration of the compound(s) results in a reduction of symptoms associated with insulin-dependent diabetes or of at least one disorder induced, caused or mediated by insulin-induced diabetes by at least 10%, preferably at least 25%, more preferably at least 50%, still more preferably at least 75%, even more preferably at least 80%, yet more preferably at least 90%, and most preferably at least 95%.
• phrases "effective for preventing a subject having insulin-dependent diabetes” or the term “preventing” as used herein means that the administration of the compound(s) results in a reduction in the likelihood that a subject with a propensity of developing or believed to be at risk for developing insulin-dependent diabetes will indeed develop insulin-dependent diabetes.
• this phrase means that the administration of the compound(s) results in the elimination of the likelihood or probability that a subject with a propensity of developing or believed to be at risk for developing insulin-dependent diabetes will indeed develop insulin-dependent diabetes.
• in another embodiment of the present invention is a method of treating insulin- dependent diabetes in a subject in need thereof by administering an effective amount of a composition containing a compound(s) that was determined to be effective for treating a subject having insulin-dependent diabetes by the method of the foregoing embodiment.
• in another embodiment of the present invention is a method of preventing insulin-dependent diabetes in a subject in need thereof by administering an effective amount of a composition containing a compound(s) that was determined to be effective for preventing insulin-dependent diabetes in a subject in need thereof having by the method of the foregoing embodiment.
• the term "subject in need thereof is used to designate the subject as being one with a recognized need for prophylactic and/or therapeutic treatment of at least one disorder induced, caused or mediated by insulin- induced diabetes.
• the subject may be any mammal, including by not limited to: a human, a rat, and a mouse.
• a compound may be separately administered or multiple compounds may be administered sequentially or simultaneously.
• the compounds may be administered as pharmaceutical compositions containing one or more pharmaceutically acceptable carriers, diluents, excipients, and adjuvants, or mixtures of the same.
• the present method is adaptable to a wide range of dosage forms and amounts. Therefore, it is envisioned that the compound(s) may be administered via any route including orally, parenterally, intravenously, intradermally, subcutaneously, or topically, in liquid or solid form.
• the composition may be administered in single or repeated dosages.
• the composition may be administered once hourly, every four to six hours, twice daily, once daily, once weekly, etc.
• the term "effective amount" is any amount that results in the reduction of symptoms associated with insulin-dependent diabetes or of at least one disorder induced, caused or mediated by insulin-induced diabetes by at least 10%, preferably at least 25%, more preferably at least 50%, still more preferably at least 75%, even more preferably at least 80%, yet more preferably at least 90%, and most preferably at least 95%.
• the nature of the compound and the nature of the administration method and dosage be tailored to that determined to be effective by the above-described identification method.
• Yet another embodiment of the present invention is a method of enhancing protection against insulitis progression or autoimmune diabetes development in a subject in need thereof comprising modulating expression of a target gene of the Arntl2 gene in cells of said subject.
• Suitable targets within the scope of the present invention include Pla2g4a, Gpx, Chi313, and Mpo (see Example 8). Therefore, in still another embodiment of the present invention is a method of enhancing protection against insulitis progression and/or autoimmune diabetes development in a subject in need thereof by enhancing expression of the Arntl2 gene in the cells of said subject.
• the subject may be any mammal, including but not limited to: a human, a rat, and a mouse.
• the Arntl2 gene is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 1.
• the ArntU gene encodes a protein that is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 2.
• the ArntU gene product possess aryl hydrocarbon receptor nuclear translocator activity.
• the term "% homologous" includes "% similarity" and "% identity”.
• the ArntU gene is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 1.
• the ArntU gene encodes a protein that is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 2.
• the ArntU gene product possess aryl hydrocarbon receptor nuclear translocator activity.
• the ArntU gene is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 3. Further, it is preferred that the ArntU gene encodes a protein that is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 4. Still further, it is preferred that the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
• the term "% homologous” includes "% similarity" and "% identity”.
• the Arntl2 gene is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 3.
• the Arntl2 gene encodes a protein that is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 4.
• the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
• the sample may be obtained from one of several sources. These sources include many other body tissues and/or cells. Particular exemplary cell types include: spleen, thymus, blood, mucosa, and pancreas.
• the sample is obtained from the spleen.
• the sample contains at least one type of splenic cells selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages.
• the sample may be acquired by conventional techniques that are readily known to the skilled artisan.
• the sample may be obtained by tissue biopsy, a blood sample, or a mucosa sample.
• ArntU is used to designate the polynucleotide sequence of SEQ ID NO: 1 obtained from mice and SEQ ID NO: 3 obtained from humans and homologous sequences coding for polypeptides with the same function as the polypeptides shown by SEQ ID NO: 2 or 4.
• u Arntl2 is used to designate the open-reading frame, inclusive of exons and introns. However, it is to be recognized that the protein encoded by the Arntl2 gene would constitute only the exonic regions.
• the present application refers to the mouse Arntl2 gene as "mArntU” and the human ArntU gene as u hArntl2.”
• the present invention also includes polynucleotides that hybridize to the complement of the polynucleotide sequence o ⁇ ArntU, or homologs and/or fragments thereof, under stringent conditions.
• stringent conditions or “stringent hybridization conditions” includes reference to conditions under which a polynucleotide will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
• stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 3O 0 C for short probes (e.g., 10 to 50 nucleotides) and at least about 6O 0 C for long probes (e.g., greater than 50 nucleotides).
• Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
• Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 6O 0 C.
• Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1 X SSC at 60 to 65°C. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution.
• Tm can be approximated from the equation of Meinkoth and Wahl, Anal.
• Tm 81.5°C+16.6 (log M)+0.41 (%GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
• the Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe.
• Tm is reduced by about I 0 C for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with approximately 90% identity are sought, the Tm can be decreased 1O 0 C.
• stringent conditions are selected to be about 5 0 C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize hybridization and/or wash at 1, 2, 3, or 4 0 C.
• a polynucleotide sequence is "homologous" with the sequence according to the invention if at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% of its base composition and base sequence is identical to the sequence according to the invention (i.e., Arntll).
• Another object of the present invention are the polypeptide sequences encoded by ArntU, or a homolog thereof.
• the polypeptides of the present invention exhibit aryl hydrocarbon receptor nuclear translocator activity.
• a "homologous protein” or “homologous polypeptide” is to be understood to comprise proteins (polypeptides) which contain an amino acid sequence at least 70 % of which, preferably at least 80 % of which, more preferably at least 90%, most preferably at least 95% of which corresponds (i.e., is identical and/or similar) to the amino acid sequence encoded by ArntU. It is particularly preferred that the homologous protein retain at least 50%, preferably at least 70%, more preferably at least 80%, most preferably at least 90% of the residual activity of the wild-type hydrocarbon receptor nuclear translocator activity.
• the homologous proteins embrace homologous and non-homologous amino acid substitutions, as well as polymorphs and alternative spliced variants.
• homologous amino acids denotes those that have corresponding properties, particularly with regard to their charge, hydrophobic character, steric properties, etc.
• sequence similarity or sequence identity of nucleotide or amino acid sequences may be determined conventionally by using known software or computer programs such as the BestFit or Gap pairwise comparison programs (GCG Wisconsin Package, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin 5371 1). BestFit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of identity or similarity between two sequences. Gap performs global alignments: all of one sequence with all of another similar sequence using the method of Needleman and Wunsch, J. MoI. Biol. 48:443-453 (1970).
• sequence alignment program such as BestFit
• the default setting may be used, or an appropriate scoring matrix may be selected to optimize identity, similarity or homology scores.
• program such as BestFit to determine sequence identity, similarity or homology between two different amino acid sequences
• the default settings may be used, or an appropriate scoring matrix, such as blosum45 or blosum ⁇ O, may be selected to optimize identity, similarity or homology scores.
• Sequence alignments can also be performed using the Align.ppc program (Mac Molly TetraLite, Mologen) or ClustalW.
• polynucleotide refers in general to polyribonucleotides and polydeoxyribonucleotides, and can denote an unmodified RNA or DNA or a modified RNA or DNA. Further, this term embraces recombinant polynucleotides. Of course, this term also embraces salt forms thereof.
• polypeptides is to be understood to mean peptides or proteins that contain two or more amino acids that are bound via peptide bonds. Further, this term embraces recombinant polypeptides. Of course, this term also embraces salt forms thereof.
• the present inventors have sequenced the murine gene ArntH in the NOD/Lt and C3HHeJ strains and identified polymorphisms between the diabetes sensitive strain NOD/Lt and the diabetes resistant strain C3HHeJ (see Example 6 and Figures 8- 17). These polymorphs form a part of the present invention.
• the reference sequence NM l 72309 refers to the diabetes-resistant C57BL/6J strain. It should be noticed that the present inventors have also identified alteration of transcription levels of Arntl2, which is upregulated in the diabetes resistant congenic NOD.C3H strain 6.VIII.
• RNA preparation RNA preparation, cDNA synthesis and microarray analysis -
• RNA of various tissues from the 6.VIII and NOD control strains was separated in TBE on 1% agarose gels containing 1% formaldehyde and transferred on Hybond N+ membranes (Amersham).
• Northern blots were hybridized using a 3' NOD cDNA fragment amplified with the Arntl2 specific primers AY-555F 5'- AGGC AAC ACC AGAGCACTGA-3' (SEQ ID NO: 5) and AY334R 071-334R 5'- GCCAGGATTACAAAGTGTGCAC-3' (SEQ ID NO: 6).
• 5' and 3' RACE experiments were performed using both total spleen RNA extracted from NOD CO and 6. VIII strain and the GeneRacer Kit (Invitrogen).
• Quantitative PCR was performed on an ABIPRISM 7700 Sequence detector using the SYBR Green PCR Master Mix (PE Biosystems) according to the manufacturer's conditions. Primers were designed using PrimerExpress software and used at optimal concentration. Quantification of the amplification product was carried out using the Standard curve method. For the circadian rhythm analysis we used the ⁇ CT method and the Gapdh gene expression as reporter. Sequences of the oligonucleotides used were as follows:
• DNA fragments were amplified and sequenced from genomic DNA or cDNA of the NOD.C3H strain 6. VIII and the NOD control mice. Polymporphisms were identified by sequence alignment using Megalign (DNASTAR Inc.). Potential transcription factor binding sites were identified by using the Matlnspector program, which is available from Genomatix Software GmbH (Munich, Germany) (41).
• the subcongenic strains were constructed by intercrossing the Idd6 congenic NOD.C3H 6. VIII strain (6. VIII) and the NOD control congenic strain (CO), both originally derived from crosses between C3H/HeJ and NOD/Lt mice (17). Male mice heterozygous for the Idd ⁇ interval were then backcrossed to the CO strain. Recombinant offspring were selected using the polymorphic markers D6MzY14, D6 ⁇ //Y15, D6Mit294 and D6M/7304. The corresponding subcongenic intervals were fixed by intercrossing of the heterozygous offspring resulting from a backcross to the CO strain.
• Spontaneous diabetes incidence was monitored weekly from 10 to 30 weeks of age by assessment of glucosuria (Diabur test, Roche).
• Splenocyte co-transfer was performed by transferring 10 7 splenocytes from diabetic NOD mice together with 2x
• the original microsatellite based genotyping of the diabetes-resistant Idd ⁇ congenic strain NOD.C3H 6.VIII indicated that the C3H introgressed donor sequence was located at the end of chromosome 6, distal to the microsatellite marker D6MY113 (17, 25).
• Random sampling of potential SNPs listed in the genomic databases identified four polymorphisms located between bps 144,874,468 and 144,874,516 on mouse chromosome 6. These SNPs included a SNP at bp position 144,874,516 associated with a silent amino acid exchange in the Sox5 gene, located distal to D6Mz71 13 (Ensembl mouse database for Mus musculus) (Table 1).
• the mapping of these newly identified SNPs allowed the Idd ⁇ locus to be restrained from a 6.1 Mb to a 5.4 Mb interval lying in between the Sox5 locus and the telomere of mouse chromosome 6.
• Table 1 Genes that are significantly differentially expressed in the diabetes- resistance strain 6.VIII compared to the diabetes-sensitive NOD mice at 6-7 weeks old of age. Data were pooled from the analysis of three or four pre- diabetic animals showing no signs of insulitis progression. The sequence positions shown are according to the NCBI build m34.
• Idd6 modifies suppression of diabetes in co- transfer assays when using splenocytes.
• This splenocyte sub- phenotype segregates with one or other of the newly derived C3H derived sub- intervals.
• a total of 2 x 10 7 splenocytes from 7 week-old mice were injected into NOD/Scid recipient mice together with 10 7 total splenocytes from diabetic mice.
• injection of the diabetogenic cells alone resulted in the rapid induction of diabetes in the NOD/Scid recipient.
• Co-transfer of splenocytes inhibited significantly the diabetes transfer in all the groups tested ( Figure 2).
• strain 6.VIIIc differs from strain 6.VIIIa by only a 700 kb C3H derived interval (Idd6.3) lying between the markers D6M/Y294 (147.2 Mb, C3H allele in strain 6.VIIIc, NOD allele in 6.VIIIa) and D6MY373 (147.9 Mb, C3H allele in both 6.VIIIc and 6.VIIIa).
• Diabetes associated genes are expected to be either functional coding sequence variants or to show differential regulation between diabetes sensitive and a diabetes resistant strains. Detection of functional coding variants would require extensive sequencing efforts throughout the entire 5.4 Mb Idd6 candidate interval, which contains some hundred potential genes, which would likely through up a very large number of sequence variants for evaluation. We turned therefore first to expression analysis for the identification of potential candidate genes responsible for the susceptibility to IDDM. Potential mouse transcripts within Idd6 were identified from the Celera and public databases. Additional information was obtained by examination of the syntenic region to Idd6 in the human genome, which maps to the 12pl 1 -pi 2.2 chromosomal region (NCBI version 35.1, Figure 1).
• the 700 kb Idd6.3 interval contains a total of ten genes (Figure 1, Table 2) with seven transcripts, 4933424B01Rik, Tm7s ⁇ , Stk381, LOC232534, 1700023A16Rik, Ppfibl, and 2210417D09Rik, being unlikely candidates for IDDM because of their known role or inappropriate expression pattern. None of the genes showed however differential expression between the 6.VIII and CO strains except for the ArntU (Bmal2) (brain-muscle- ARNT-like protein 2) gene that was six-fold overexpressed in spleens of the 6. VIII strain. We turned therefore to a detailed analysis of Arntl2.
• the Arntl2 gene encodes a basic helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) transcription factor and has been functionally linked to circadian clock mediated activities and to the regulation of cell proliferation (26).
• the Arntl2 gene was expressed in significantly higher amounts in spleen samples obtained from either 4 weeks old or 6-7 weeks old diabetes-resistant strain 6.VIII animals than from diabetes-sensitive NOD mice (Figure 3A). Thymi obtained from the same groups of animals showed a similar tendency, although with only two-fold difference, between the strain 6. VIII and NOD mice ( Figure 3B).
• Lymphocyte subsets including B cells, CD4+ T cells, CD8+ T cells, CD4+CD25+ regulatory T cells showed similar expression differences to the whole tissue preparations. Further expression profiling of spleens showed that differential expression of Arntl2 was independent of the age of the animals and maintained from two to twelve weeks of age as well as in diabetic animals (Figure 3C). These results suggest that the differential expression of Arntl2 in the two mouse strains is independent of disease progression.
• Bmal2b (27) containing respectively 579 and 199 amino acids. While examining the transcripts expressed in spleen of strain 6. VIII and NOD CO mice, a third putative alternative spliced variant, Bmal2c, was identified in a 5' RACE experiment. This transcript initiated within an intron, 100 nucleotides upstream of the start of exon 7 in the consensus mRNA (AY005163, ArntUa mRNA). This transcript encoded a 355 amino acid protein containing only the C-terminal half of the full-length protein and was missing both the bHLH and PAS-A domains ( Figure 4B).
• transcripts were identical between 6.VIII and NOD spleen, but the analysis of partial cDNA sequences amplified from nested primers indicated the existence of transcripts specific for strains 6.VIII and NOD, generated by differential exon use ( Figure 4C).
• This leucine residue which is highly conserved in the bHLH family, serves as an important contact site by interacting with residues in helix II in the formation of the helix structure, and is also involved in protein dimerisation (28, 29).
• the other polymorphisms identified were all located between the PAS-B domain and C terminus.
• Three serine residues in the strain 6.VIII at amino acid position 425, 426 and 455 were all replaced by glycine residues in the NOD mice.
• the valine residue at position 450 in strain 6.VIII was replaced by isoleucine, and the glutamic acid at position 483 was deleted.
• the 3' UTR sequences of the ArntU gene also showed striking variation.
• Figure 8-17 shows a graphic depiction of information relevant to mBmal2.
• Figure 9 shows the transcription profile of mBmal2.
• Figure 10 shows the gene structure of mBmal2.
• Figure 11 shows the SNPs and Indels of mBmal2.
• the sequence depicted as "Query” is SEQ ID NO: 35 and the sequence depicted as "Sbjct” is SEQ ID NO: 36.
• Figures 12A-B shows the Bmal2 coding region. NOD control is shown in
• Figures 13 A-C shows the designation of the intron and exon portions of the genomic sequence.
• Figure 13A 071-E1 (1 18F-668R) - 3 SNP (Ensembl Chr.6 147727278 to 147727780), Exon: underlined; NOD control is shown in SEQ ID NO: 37, while 6.VIII is shown in SEQ ID NO: 38.
• Figure 13B SNP35-38 (SNP35-38- 64F+SNP35-38-465R) - 1 SNP (Ensembl Chr.6 147746092-147746427); NOD control is shown in SEQ ID NO: 39, while 6.VIII is shown in SEQ ID NO: 40.
• Figure 13C 071-E5 (131F+465R) - 5 SNPs (Ensembl Chr.6 147751781 to 147752273) Exon : underlined ; NOD control is shown in SEQ ID NO: 41, while 6.VIII is shown in SEQ ID NO: 42.
• Figure 13D 071-SNP 75-80 (114F+440R) - 1 SNPs (Ensembl Chr.6 starting from the 3rd base 147758806 to 147759169); NOD control is shown in SEQ ID NO: 43, while 6.VIII is shown in SEQ ID NO: 44.
• Figure 14 shows the Bmal2 coding region which marked exons.
• Bmal2 coding region SEQ ID NO: 45
• Bold the same exon but with splice forms (The part in bold and underlined is spliced out in mBmal2b sequence resulting in the early stop of translation.
• the present inventors found the same types of sequences in NOD and 6. VIII.
• Underline and and italics with underline the alternative exons of 6.VIII tioj'cs: the alternative exons of NOD control.
• Figures 15A-B shows the Sequencing files (071-43F to 071-2122R) corresponding to Bmal2c. More specifically, these figures show the sequencing data corresponding to Bmal2c by amplification using SEQ ID NO: 31 as the forward primer and the reverse complement of SEQ ID NO: 32 as the reverse primer. Bmal2c was cloned into a pGEM-T vector. The coding region is underlined. NOD control (Fig. 15A) is shown in SEQ ID NO: 46 with the encoded polypeptide appearing as SEQ ID NO: 47, while 6.VIII (Fig. 15B) is shown in SEQ ID NO: 48 with the encoded polypeptide appearing as SEQ ID NO: 49.
• Figure 16 shows the 3' UTR (right after the stop codon), the first base corresponds to Ensembl v37 chr.6 147759660. NOD control is shown in SEQ ID NO: 50, while 6.VIII is shown in SEQ ID NO: 51.
• Figures 17A-D shows the upstream genomic sequence (primers: 071- 16798F+071-17695R).
• Fig. 17A Upstream genomic sequence (primers: 071- 16798F+071-17695R) - 4 SNPs (6. VIII sequence blast to Ensembl Chr.6 : starting from the lOOst base to the end 147715903 to 147716583- did not see the result of 1- 99); NOD control is shown in SEQ ID NO: 52, while 6.VIII is shown in SEQ ID NO: 53.
• Fig. 17A Upstream genomic sequence (primers: 071- 16798F+071-17695R) - 4 SNPs (6. VIII sequence blast to Ensembl Chr.6 : starting from the lOOst base to the end 147715903 to 147716583- did not see the result of 1- 99); NOD control is shown in SEQ ID NO: 52, while 6.VIII is shown in SEQ ID NO: 53.
• FIG. 17B Upstream genomic sequence (primers: 071-17610F-18412R) - 5 SNPs (Ensembl Chr.6 147716616 to 147717298); NOD control is shown in SEQ ID NO: 54, while 6. VIII is shown in SEQ ID NO: 55.
• Example 8 Cytosolic phospholipase A2 is a potential downstream target of Arntl2 -
• the hypoxia-involved Pla2g4a gene (34, 35) showed a particular interesting expression as it was, like Arntl2, upregulated in strain 6.VIII at all ages ( Figure 7).
• a two-fold upregulation was also measured when spleen samples from strain 6.VIIIc were compared to 6.VIIIa samples, confirming that the upregulation was at least to some extent directly to factors lying within Idd6.3.
• a potential ARNT binding site (TGCGTG) was identified +101 to +106 of its transcription start site, which indicated that Pla2g4a might be a direct target of Arntl2.
• Pla2ga4a expression was upregulated in different splenic cell population, including CD4(+) T cells, CD8(+) T cell, B cells, and macrophages.
• CD4(+) T cells CD4(+) T cells
• CD8(+) T cell CD8(+) T cell
• B cells CD8(+) T cell
• macrophages we analysed its circadian profile and showed that whilst the expression of Pla2g4a oscillated mildly, the variation between strain 6.VIII and CO mice was maintained throughout the day ( Figure 7).
• the circadian profile of Pla2g4a whilst very similar to that of Arntll (Bmall) and Arntl2 ⁇ Bmal2), was clearly different from those of Perl and PAI-I. This suggests that Pla2g4a circadian expression correlates with that of the Bmall and Bmal2 and that it may be regulated by these transcription factors.
• Example 9 Establishment of cellular ex vivo systems for testing of the Arntl2 Rene -
• the present inventors were interested in exploring the adequacy of ex vivo systems in the characterization of the candidate gene.
• the present inventors have undertaken studies on the RAW264.7 cell macrophage line and several other currently used mouse cell lines.
• the present inventors have been able to show that these cell lines can be used for the systematic testing of RNAi constructs cloned into the pSUPER vector system (Oligogene) prior to their sub-cloning into lentiviral vectors.
• the RAW264.7 is of particular interest for some of these studies because it can also be used for functional studies of the mediated Arntl2 pathways.
• transient transfection using the lipofection method (jetPEITM transfection reagent, Polyplus) of the RAW264.7 cell line results in about a 60% reduction of gene expression, when tested on ArntU.
• Stable integrants can be expected to show about 90% reduction of expression.
• Arntl2 downregulation resulted in deregulation of other genes, known to be involved in diabetes development.
• HIF-I Hypoxia-inducible factor-] up-regulates adrenomedullin expression in human tumor cell lines during oxygen deprivation: a possible promotion mechanism of carcinogenesis.
• Endocrinol 14, 848-62 33. Makino, Y., Nakamura, H., Ikeda, E., Ohnuma, K., Yamauchi, K., Yabe, Y., Poellinger, L., Okada, Y., Morimoto, C. and Tanaka, H. (2003) Hypoxia-inducible factor regulates survival of antigen receptor-driven T cells. J Immunol, 171, 6534-40.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Immunology (AREA)
• Organic Chemistry (AREA)
• Hematology (AREA)
• General Health & Medical Sciences (AREA)
• Analytical Chemistry (AREA)
• Zoology (AREA)
• Molecular Biology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Animal Behavior & Ethology (AREA)
• Medicinal Chemistry (AREA)
• Urology & Nephrology (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Biotechnology (AREA)
• Physics & Mathematics (AREA)
• Diabetes (AREA)
• Biomedical Technology (AREA)
• Wood Science & Technology (AREA)
• Genetics & Genomics (AREA)
• Pathology (AREA)
• Environmental Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Public Health (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• General Engineering & Computer Science (AREA)
• Food Science & Technology (AREA)
• General Physics & Mathematics (AREA)
• Animal Husbandry (AREA)
• Biophysics (AREA)
• Biodiversity & Conservation Biology (AREA)
• Rehabilitation Therapy (AREA)
• Rheumatology (AREA)

Priority Applications (7)

Applications Claiming Priority (2)

Publications (2)

Family

ID=38442622

Family Applications (1)

Country Status (7)

Families Citing this family (2)

Family Cites Families (3)

• 2007
  • 2007-02-27 US US12/280,822 patent/US20090181915A1/en not_active Abandoned
  • 2007-02-27 US US11/679,492 patent/US7960107B2/en not_active Expired - Fee Related
  • 2007-02-27 WO PCT/IB2007/001649 patent/WO2007099461A2/en not_active Ceased
  • 2007-02-27 DE DE602007009944T patent/DE602007009944D1/de active Active
  • 2007-02-27 AT AT07734854T patent/ATE485399T1/de not_active IP Right Cessation
  • 2007-02-27 EP EP07734854A patent/EP1994174B1/en not_active Not-in-force
  • 2007-02-27 JP JP2008555900A patent/JP2009528030A/ja not_active Withdrawn
  • 2007-02-27 CA CA002638825A patent/CA2638825A1/en not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events