WO2007093975A2 - Uso del factor pedf para inducir la renovación de células - Google Patents

Uso del factor pedf para inducir la renovación de células Download PDF

Info

Publication number
WO2007093975A2
WO2007093975A2 PCT/IB2007/051115 IB2007051115W WO2007093975A2 WO 2007093975 A2 WO2007093975 A2 WO 2007093975A2 IB 2007051115 W IB2007051115 W IB 2007051115W WO 2007093975 A2 WO2007093975 A2 WO 2007093975A2
Authority
WO
WIPO (PCT)
Prior art keywords
pedf
factor
cells
pharmaceutical composition
pedf factor
Prior art date
Application number
PCT/IB2007/051115
Other languages
English (en)
French (fr)
Other versions
WO2007093975A3 (es
Inventor
Isabel FARIÑAS GÓMEZ
Celia ANDREU AGULLÓ
Sacramento RODRÍGUEZ FERRÓN
Carmen RAMÍREZ CASTILLEJO
Pilar SÁNCHEZ GÓMEZ
Helena Mira Aparicio
Julio ESCRIBANO MARTÍNEZ
Francisco SÁNCHEZ SÁNCHEZ
José Daniel AROCA AGUILAR
Original Assignee
Universitat De Valencia, Estudi General
Universidad De Castilla-La Mancha
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universitat De Valencia, Estudi General, Universidad De Castilla-La Mancha filed Critical Universitat De Valencia, Estudi General
Priority to AT07735311T priority Critical patent/ATE533501T1/de
Priority to EP07735311A priority patent/EP2044952B1/en
Priority to US12/278,166 priority patent/US20100047212A1/en
Publication of WO2007093975A2 publication Critical patent/WO2007093975A2/es
Publication of WO2007093975A3 publication Critical patent/WO2007093975A3/es

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/55—Protease inhibitors
    • A61K38/57—Protease inhibitors from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • This invention is within the field of Biochemistry and Cellular Biology.
  • the invention relates to the specific use of the PEDF molecule (Factor Derived from the Pigmented Epithelium) in the induction and / or enhancement of the self-renewal of stem cells in culture.
  • the present invention also relates to the use of this molecule for the activation of stem cells in different tissues by means of exogenous administration of PEDF to said tissues.
  • the use of pharmaceutical compositions for cell self-renewal characterized by containing at least a pharmaceutically effective amount of PEDF factor and at least one pharmaceutically acceptable excipient is also contemplated.
  • the PEDF factor (Factor Derived from the Pigmented Epithelium) is a member of the serpine superfamiiia (serine protease inhibitors), although it lacks the protease inhibitory activity.
  • Human PEDF consists of 418 amino acids, a signal peptide for secretion and is N-glucosylated in Asn285. AND! Secreted product has an apparent molecular weight of 50 kDa. Two regions have been described in the PEDF molecule:
  • the PEDF factor is a multifunctional protein and previously in the state of the art its efficacy has been demonstrated as: a) Neuron differentiation stimulator !, in neuroblastoma cells. b) Factor that causes a decrease in malignant phenotype in prostate tumor cells. c) Stimulator of neuritic growth, in motor neurons. d) Neuroprotective against stimuli that induce apoptotic neuronal death, in neurons of the retina, cerebellar granules, hippocampal, and motor neurons. e) Proliferation blocking factor, in mlcroglia cells. f) Apoptosls inducing factor, in tumor cells. g) Apoptosis inducing factor, in endothelial cells. h) Cellular migration blocking factor, in endothelial cells, i) Anti-angiogenic and anti-vasculogenic factor, in endoelial cells.
  • the PEDF factor in relation to the use of the PEDF factor, previously in the state of the art it has been proposed as a potentiating factor useful in the development, maintenance, and function of the retina and for the treatment of retinal degeneration, especially of ia macula, induced by light, age, diabetes, glaucoma or genetic diseases such as retinitis pigmentosa, in which neovascularization is an aggravating factor [WO0224234; WO02058730; WO04028635; WO04027019; WO0181551; US020194639; US030087859; US010049369; Ima ⁇ D, Yoneya S, Gehlbach PL, Wei LL, Mori K (2005) tntraocular gene transf ⁇ r of pigment epithelium-derived factor rescues photoreceptors from lighNnduced cell death.
  • the PEDF factor is a potentially useful factor for the neuroprotection of neurons in neurodegenerative or neuronal damage processes [WO0224234; WO02058730; WO04028635; WO04027019; WO0181551; US020194639; US030087859; US010049369; Cao W, Tombran-Tink J 1 Chen W, Mrazek D, Elias R, McGinnis JF. (1999) Pigment epithel ⁇ m-derived factor protects cultured retinal neurons against hydrogen peroxide-induced cell death. J Neurosci Res., 57 (6): 789-800.
  • Pigment epithelium-derived factor is a survival factor for cerebellar granule cells in culture. J Neurochem, 1995 Jun; 64 (6): 2509-17. Steele FR, Chader GJ, Johnson LV, Tombran-Tink J. (1993) Pigment epithelium-derived factor: neurotrophic activity and identification as a member of th ⁇ s ⁇ r ⁇ ne prot ⁇ ase inhibitor gene family. Proc Nati Acad Sci US A. 1993 Feb 15; 90 (4): 1526-30].
  • the PEDF factor has also been described as an anti-tumor factor because of its differentiating effect on tumor cells and for its effect of inhibiting angiogenesis [US030082183; US040234505; WO050118136; US050222031; Cai J, Jiang WG 1 Grant MB, Boulton M. (2006) Pigment Epitheii ⁇ m-derived Factor Inhibits Angiogenesis via Regulated Intracellular Proteolysis of Vascular Endothelial Growth Factor Receptor 1. J Biol Ch ⁇ m., 281 (6): 3604-13. Streck CJ 1 Zhang Y, Zhou J 1 Ng C, Nathwani AC, Davidoff AM.
  • Pigment epithelium-deriv ⁇ d factor regulates the vasculature and mass of the prostate and pancreas. Nat Med., 9 (6) .774-80. Guan M, Yam HF, Su B, Chan KP 1 Pang CP, Uu WW, Zhang WZ, Lu Y. (2003) Loss of pigment epithelium derived factor expression in glioma progr ⁇ ssion. J Clin Pathol., 56 (4): 277-82. Dawson DW, Volpert OV, GiIHs P, Crawford SE, Xu H, Benedict W, Bouck NP. Pigment epithelium-derived factor: a potent inhibitor of angiogenesis. Science, 285 (5425): 245 ⁇
  • the PEDF factor has never been described in previous literature as a factor related to the behavior of stem cells of any kind and, therefore, its use as an inducer of the self-renewal of stem cells is a novel aspect and therefore , object of the present invention. It is necessary to point out that, the effect that in the present invention is claimed of the PEDF factor as an inducing factor of the auto-renewal of stem cells, does not bear any relation to the effects previously described in the state of the art for the PEDF in other cell types, such as cell differentiation , Cell survival or apoptosis. Therefore, the present invention provides a new use or application of the PEDF factor as an inducing factor of the self-renewal of stem cells.
  • the present invention offers a method of promoting the self-renewal of stem cells in culture by exogenously applying PEDF.
  • the addition of PEDF to defined media favors the maintenance in the culture of the stem cells by means of its stimulating action of the cell division of self-renewing type against the differential cell division, which entails the disappearance of the stem cells of the culture and its transformation in parents committed to specific cell phenotypes. This leads to the expansion of the stem cells accompanied by the maintenance of the potential of these cells.
  • the present invention includes the use of the molecule "factor derived from pigmentary epithelium” (PEDF) and / or any derivative thereof to promote the amplification of populations of stem cells, somatic or embryonic, of any species. This action consists in favoring the repucation of stem cells by means of renovating cell division as well as the induction of the expression of molecules that are usually increased in cells with undifferentiated and multipotent phenotype.
  • PEDF pigmentary epithelium
  • the invention includes the use of PEDF in natural stem cells as well as in genetically or eptgenically modified stem cells.
  • the invention also provides a method of stimulating the activation of endogenous somatic stem cells, for the production of differentiated progeny, through the use of pharmaceutical compositions containing a pharmaceutically effective amount of PEDF factor.
  • the homogeneous expansion of a population of stem cells in defined media ex vivo is not efficient because it is observed that the propagation of these cells is accompanied by their derivation to cells that have proliferative capacity expansive but lacking the properties of unlimited self-renewal and multipotence, properties inherent in the concept of stem cell.
  • the fact that the propagation of stem cells when they are in culture is invariably accompanied by differentiation has been interpreted as a natural tendency of these cells towards the division of the differential type instead of the division of the self-renewing type. Since in the natural niches in which the specific tissue stem cells are found, they persist throughout the life of the individual, the progressive differentiation of these cells during their ex vivo expansion may be a reflection that the culture conditions do not reproduce adequately the situation of the natural endogenous microenvironment.
  • PEDF is a factor found in neurogenic niches. It is also a secreted and soluble molecule, which can be added to culture media. For this reason, the PEDF factor is capable of inducing self-renewal in stem cell populations obtained from adult mouse brains, for example, since it promotes the non-differential division of said stem cells and the expression of molecules that are associated with the most undifferentiated and multipotent state of these cells, such as the Sox2 transcription factor and effectors of the Notch signaling pathway.
  • the invention also provides an assay method in which to measure self-renewal of neural stem cells with the exogenous addition of PEDF and in which to test inhibitors of this process and / or antagonists of the PEDF factor and therefore, the present
  • the invention provides a new use of the PEDF factor as a product capable of stimulating the self-renewal of stem cells allowing the identification and / or testing of different compounds that inhibit self-renewal and / or antagonists of the PEDF factor.
  • the PEDF factor administered directly in the brain of mice causes the activation of endogenous neural stem cells, which leads to activation. to a greater neurogenic activity, of production of new neurons, in the subventricular area of the adult brain. Therefore, the PEDF can be a facilitating factor in the production of new cells from stem cells present in the tissues. Therefore, the present invention also refers to the use of the pEDF molecule in the preparation of pharmaceutical compositions for auto-renewal of endogenous stem cells.
  • PEDF factor to induce the self-renewal of stem cells of any type, without specifying the origin of the PEDF factor, since this could be generated from any synthesis or obtaining procedure or natural PEDF factor can be used. That is, in the present invention the use of the PEDF factor, whether natural or synthetic, is claimed as an inducer of the self-renewal of stem cells.
  • the present invention refers to the use of the PEDF factor in its complete or fragmented version in the preparation of a composition that induces the self-renewal of stem cells of any origin.
  • the present invention refers to the use of the PEDF factor in the preparation of a composition that induces the self-renewal of stem cells that is additionally combined with molecules selected from the group consisting of amino acids, lipids, carbohydrates and metals
  • the present invention relates to! use of the PEDF factor in the preparation of a composition that induces the self-renewal of stem cells in prokaryotic or eukaryotic expression systems and that induces the self-renewal of somatic stem cells.
  • the present invention refers to the use of the PEDF factor in the preparation of a composition that induces the self-renewal of endogenous or exogenous stem cells.
  • the present invention refers to the use of the PEDF factor in the preparation of a composition that induces the self-renewal of stem cells wherein the composition is in a selected form of powder, granules, tablets, capsules, troches, solution, suspension, emulsion and syrup.
  • the present invention refers to the use of the PEDF factor for the manufacture of a medicament to activate processes selected from the group formed by tissue regeneration processes of the skin, healing processes, neural regeneration processes in cases of stroke. .
  • the present invention refers to the use of the pEDF factor for the manufacture of a medicament for cell therapy, preferably for cardiac, neural and / or hematopoietic regeneration.
  • the present invention provides a pharmaceutical composition for inducing the self-renewal of stem cells comprising in a pharmaceutically acceptable medium a pharmaceutically effective amount of:
  • the present invention relates to a pharmaceutical composition containing at least a pharmaceutically effective amount of the total or partial sequence of the PEDF factor and at least one pharmaceutically acceptable excipient.
  • the present invention relates to a pharmaceutical composition containing at least a pharmaceutically effective amount of a natural biogenic variant of PEDF factor and at least one pharmaceutically acceptable excipient.
  • the present invention relates to a pharmaceutical composition containing at least a pharmaceutically effective amount of a functional equivalent of PEDF factor and at least one pharmaceutically acceptable excipient.
  • the present invention relates to a pharmaceutical composition containing at least a pharmaceutically effective amount of an active fragment of PEDF factor and at least one pharmaceutically acceptable excipient.
  • the present invention relates to a pharmaceutical composition containing at least a pharmaceutically effective amount of a protein fused from PEDF factor and at least one pharmaceutically acceptable excipient.
  • the present invention refers to a pharmaceutical composition containing at least a pharmaceutically effective amount of a PEDF factor derivative and at least one pharmaceutically acceptable excipient.
  • the present invention refers to a pharmaceutical composition containing a! at least a pharmaceutically effective amount of at least one analog structure! of PEDF factor and at least one pharmaceutically acceptable excipient.
  • the present invention refers to a pharmaceutical composition containing at least a pharmaceutically effective amount of al less a homologue of PEDF factor and at least one pharmaceutically acceptable excipient.
  • the present invention relates to a pharmaceutical composition in ia that the amount of factor PEDP e s of at the least 20 ng / ml.
  • cell therapy is based on the ex vivo expansion of stem cell populations and their differentiation directed towards specific cell phenotypes that will then be transplanted in order to recover a specific tissue deficiency.
  • Targeted differentiation requires starting from populations of stem cells that have maintained their full plastic potential in vitro, that is, that they have been divided in a self-renewing manner so that the cell line of these stem cells maintains the multipotence characteristic of these populations.
  • a partial sequence is understood as any portion of the molecule consisting of a smaller number of amino acids than the complete sequence and which also includes small peptides containing a PEDF sequence and produced by chemical synthesis.
  • PEDF molecules that come from different species or that are modified by natural mutations, or those that are produced in different species in recombinant form and that are modified differently
  • those total or partial sequences of PEDF that have been modified by directed mutagenesis or to which chemical groups have been added that modify their stability, diffusion or permeability, as well as their biological action.
  • Ta! and as cited in the present invention is understood as a fused protein comprising the PEDF factor fused to a peptide or another protein, a PEDF molecule that can additionally contain at one of its ends a series of amino acids that encode a sequence which serves to purify the molecule, trace its trajectory, or use it for interaction tests with other molecules
  • a homologue of PEDF is understood as a molecule of similar but not identical sequence with similar activity.
  • FIG. 1 This figure shows the simple scheme of the human PEDF polypeptide (A) and a truncated form that contains the anti-angiogenic domain but not the neurotrophic one and that comprises amino acid 195 to 400 (which we call C-ter PEDF ) (B).
  • Fig. 2 Effect of human PEDF and C-ter PEDF produced in Pichia pastoris on the neurosphere cultures that form the neural stem cells obtained from the subventricular area of the adult mouse brain.
  • the Y axis corresponds to the number of neurospheres formed
  • A corresponds to Control
  • B corresponds to PEDF
  • C corresponds to C-ter PEDF.
  • 1 corresponds to phase contrast optics and the numerical values indicate the average diameter of the neurospheres (mean ⁇ standard error)
  • 2 corresponds to immunocytochemical detection of the BdrU proliferation marker and the numbers indicate the percentage of cells that incorporate the BrdU relative to the total cells (mean ⁇ error standard).
  • A corresponds to Control
  • B corresponds to PEDF.
  • the asterisk indicates the level of statistical significance of the difference in an analysis of Student's t (* p ⁇ 0.05).
  • Fig. 3 Test in which clones / spheres that have been grown with PEDF (truncated form of PEDF, C-ter PEDF, is, again, control without effect) are dissociated and re-seeded in the absence of PEDF, in different mitogenic combinations.
  • A is defined by the control (usual growth in EGF and FGF)
  • B is defined by the pretreatment test with PEDF
  • C is defined by the assay with the C-ter PEDF treatment.
  • 1 corresponds to EGF + FGF
  • 2 corresponds to EGF
  • 3 corresponds to FGF
  • X axis corresponds to number of formed neurospheres.
  • the asterisks indicate the level of statistical significance of the difference in an analysis of Student's t (* indicates a p ⁇ 0.05; ** indicates a p ⁇ 0.01).
  • Fig. 4 It shows how treatment with PEDF increases the number of cells in the neurospheres that express a surface antigen (LeX) that co-segregates with the most muitipotent population of neural stem cells.
  • A is defined by the control
  • B is defined by the test with PEDF treatment
  • C is defined by the test with the C-ter PEDF treatment.
  • the asterisks indicate the level of statistical significance of the difference in an analysis of Student's t (** p ⁇ 0.01).
  • Fig. 5 The changes in the levels of undifferentiation markers induced by PEDF in determinations by RT-PCR are shown.
  • A corresponds to PEDF
  • (-) indicates not treated with PEDF and (+) indicates treated with PEDF
  • 1 corresponds to Hes1
  • 2 corresponds to Hes5
  • 3 corresponds to Mash1 / Asc! 1
  • 4 corresponds to beta-actin
  • 5 corresponds to SoX2
  • 6 corresponds to beta-actin.
  • PEDF increases the expression of the cell cycle regulator p21, determined by western blot analysis with specific anti-p21 antibodies. This increase in p21 levels is necessary for the effect of PEDF since in cells obtained from the subventricular zone of null mutant mice for p21 e! PEDF does not induce an increase in the number of spheres.
  • A corresponds to PEDF
  • (-) indicates not treated with PEDF and (+) indicates treated with PEDF
  • 1 corresponds to p21
  • 2 corresponds to beta-actin.
  • 1 + / + corresponds to neurospheres obtained from wild-type mice and 1 - / - to those obtained from null-deficient animals for p21.
  • the Y axis represents the increase in the number of spheres induced by PEDF relative to the growth obtained only with EGF and FGF and to which a control value of 1 is given.
  • PEDF treatment increases the number of cells that express indifferentiation markers (nestin) in the cultures, without affecting their proliferation.
  • the detection of the nestin (cytopiasmatic) and BrdU (nuclear) antigen is shown in the photo panels.
  • the Y axis corresponds to the percentages of cells marked for BrdU (left bars) and nestin (right bars) over the total number of cells in the culture plate.
  • 1 corresponds to control
  • 2 corresponds to PEDF.
  • the asterisks indicate the level of statistical significance of the difference in an analysis of Student's t after transformation of the data by means of the arch (relative value 1 ' 2 ) (** p ⁇ 0.01).
  • Fig. 8. The PEDF improves the neurogenic capacity of neurosphere cultures.
  • histogram 1 corresponds to the control and 2 corresponds to PEDF.
  • the Y axis shows the percentage of cells that have differentiated to neurons relative to the total number of cells present in the culture plate.
  • the asterisks indicate the level of statistical significance of the difference in an analysis of Student's t ( *** p ⁇ 0.001).
  • 1 corresponds to the control and 2 corresponds to PEDF.
  • Fig. 9 The truncated form containing the C-terminal half of the PEDF polypeptide antagonizes the action of the entire PEDF in the self-renewal assay.
  • the line dotted with the symbol m represents the control test (A) and the part of the graph dotted with the symbol • represents the test with 0.4 nM PEDF and with increasing concentrations of C-ter PEDF (B ) corresponding (in nM) to the numbers represented on the X axis.
  • the Y axis represents the number of spheres formed in each condition.
  • COS cells transfected with a construct containing the sequence encoding the human PEDF express and secrete PEDF that is active in a self-renewal assay in neural stem cells and the effect is blockable by the C-ter fragment.
  • A corresponds to the detection by RT-PCR of Pedf mRNA (Serpinfl)
  • B corresponds to the same for beta-actin
  • C corresponds to detection by western blotting of PEDF in the culture medium of COS cells.
  • 7 1 corresponds to COS7 + pcDNA (empty vector)
  • 2 corresponds to COS7 + pcDNA-Pedf.
  • 3 corresponds to co-culture with COS-7 cells
  • 4 corresponds to the same conditions as in 3 but in the presence of C-ter PEDF blocking
  • F corresponds to COS7 + pcDNA (empty vector, controi)
  • G corresponds to COS7 + pcDNA-Pedf.
  • the Y axis corresponds to the relative increase in the number of neurospheres with respect to the growth obtained in control medium.
  • Endothelial and ependymal cells express and secrete PEDF naturally while other cell types can express mRNA for PEDF but do not secrete detectable amounts of the factor.
  • A corresponds to Pedf mRNA
  • B corresponds to beta-actin, measured by RT-PCR
  • C corresponds to the PEDF protein
  • D corresponds to beta-tubulin, measured by western blotting in cell lysates
  • E corresponds to the PEDF protein determined by western blot in medium conditioned by the different types of cells.
  • F corresponds to WB
  • G corresponds to RT-PCR.
  • the cell types tested include endothelial cells of venous origin (HUVEC) (1), endotential cells of arterial origin (HUAEC) (2), cells of the subventricular zone (3), astrocytes (4) and granular cerebellar neurons (5).
  • Endothelial and ependymal cells which express and secrete PEDF naturally, induce sphere formation and this inducing effect is blocked by 15 nM C-ter PEDF.
  • A corresponds to co-culture with the different types of cells
  • B corresponds to the same conditions as in A but in the presence of C-ter PEDF that blocks the effect of the PEDF.
  • the cell types tested include endothelial cells of venous origin (HUVEC) (1), endothelial cells of arterial origin (HUAEC) (2), epidendum cells of the subventricular zone (3), astrocytes (4) and cerebellar granular neurons (5).
  • Ef Y axis corresponds to the increase in the number of neurospheres formed relative to the number obtained under normal conditions with EGF and FGF.
  • the statistical significance of biochecking with C-ter is indicated.
  • the asterisks indicate the level of statistical significance of the difference in an analysis of Student's t after transformation of the data by means of the arcsen (relative value 172 ) (* indicates a p ⁇ 0.05; ** indicates a p ⁇ 0.01).
  • HUVEC cells in which the expression of PEDF has been partially silenced by a specific siRNA secretes less PEDF into the medium and induces the formation of a smaller number of neurospheres than the HUVEC treated with a control siRNA.
  • A corresponds to the detection by western blot of PEDF in used cell phones
  • B corresponds to the same for beta-actin.
  • 1 corresponds to HUVEC cells transduced with control siRNA
  • 2 corresponds to HUVEC cells transduced with specific siRNA for Pedf.
  • the Y axis of the histogram corresponds to the number of neurospheres formed.
  • the asterisks indicate the level of statistical significance of the difference in an analysis of Student's t (* p ⁇ 0.05).
  • Fig. 14 The intracerebrally administered PEDF leads to a greater number of neural stem cells but biochecking of the endogenous PEDF does not cause changes.
  • Photographic panels show immunostaining for retention of BrdU (nuclei marked with greater intensity) on stains for nuclei with DAPI (marked with less intensity) in sections of the subventricular area.
  • the insert shows that the cells that retain BrdU (nuclear tide) for long periods of time are GFAP-positive (cytoplasmic tide and cell prolongations), as corresponds to the neural stem cells of this area.
  • 1 corresponds to saline
  • 2 corresponds to PEDF
  • 3 corresponds to C-ter PEDF
  • 4 corresponds to BrdUL / GFAP.
  • the asterisks indicate the level of statistical significance of the difference in an analysis of Student's t after transformation of the data by means of the arch (relative value 172 ) (* p ⁇ 0.05).
  • Fig. 15 The PEDF administered to mice at the level of the subventricular zone activates the division of neural stem cells.
  • the photographic panels show immunostaining for BrdU (nuclear staining) incorporated at short times on stains for GFAP (cytoplasmic dizziness and cell prolongations).
  • 1 corresponds to saline
  • 2 corresponds to PEDF
  • 3 corresponds to C-ter PEDF.
  • the asterisks indicate the level of statistical significance of the difference in an analysis of Student's t after transformation of the data by means of the arch (relative value 1 ' 2 ) (* p ⁇ 0.05).
  • Fig. 16 The PEDF administered to mice at the level of the subventricular zone activates endogenous neurogenesis.
  • the photographic panels (A) show immunostaining for BrdU ⁇ nuclear staining) incorporated at short times on stains for PSA-NCAM (cytoplasm and cell extension). 1 corresponds to saline, 2 corresponds to PEDF 1 3 corresponds to C-ter PEDF. Jan! histogram, the Y axis corresponds to the relative increase in e! number of cells that retain BrdU (B) or that are labeled with anti-PSA-NCAM (C) antibodies in brains infused with PEDF (2) or C-ter PEDF (3) with respect to those infused with saline solution (value control ⁇ 1).
  • the asterisks indicate the level of statistical significance of the difference in an analysis of the Student t after transformation of the data using the arcsen (relative value 1 ' 2 ) (* p ⁇ 0.05; ** p ⁇ 0, 01).
  • PEDF administered exogenously to brains leads to increased production of neurospheres from the dissociated tissue of these brains.
  • Photographic panels show contrast photographs of phases of neurospheres. 1 corresponds to saline, 2 corresponds to PEDF, 3 corresponds to C-ter PEDF.
  • the Y axis corresponds to the number of primary neurospheres formed from the brains infused with saline (1), PEDF (2) or C-ter PEDF (3).
  • the Y axis corresponds to the number of secondary neurospheres formed from brains infused with saline (1), PEDF (2) or C-ter PEDF (3).
  • the asterisks indicate the level of statistical significance of the difference in an analysis of Student's t (* p ⁇ 0.05; ** p ⁇ 0.01; *** p ⁇ 0.001).
  • Fig. 18 Forms purified by complete PEDF chromatography and the C-terminal half of the human PEDF from! medium obtained from Pichia and separated in SDS-PAGE electrophoresis gel stained with Coomasie blue (A) and immunodetected with anti-PEDF antibodies (B). 1 corresponds to PEDF (47 kDa) and 2 corresponds to C-ter PEDF (26 kDa).
  • A Coomasie blue
  • B immunodetected with anti-PEDF antibodies
  • Example 1 Self-renewal assay in neural stem cells in culture.
  • PEDF The forms of PEDF that have been used for the embodiments are those shown in Figure 1.
  • This figure shows the scheme of the human pgpp polypeptide and a truncated form containing the anti-angiogenic domain but not the neurotrophic one and comprising from amino acid 195 to 400 (which we call C-ter PEDF).
  • the complete PEDF (here called PEDF) modulates the self-renewal of stem cells but the C-ter PEDF fragment does not do so because it has been used as a negative control in the experiments. Also, and as will be seen later, the C-ter PEDF has been used as a competitor of the entire PEDF.
  • the PEDF protein promotes the self-renewal of neural stem cells of the subventricular area of the brain of adult mice in vitro.
  • this factor increases the number of cells capable of forming new spheres / clones when the treated cells are seeded density of 2.5 cells / microliter (self-renewal assay) (see Figure 2).
  • Figure 2 shows how the administration of PEDF to a culture of neural stem cells of the subventricular zone involves the formation of more clones (neurospheres) in the presence of only the usual growth medium for these cells (complete medium).
  • the addition of PEDF does not increase the size of each clone (see average diameters of the spheres), nor the incorporation of the bromo-deoxyuridine proliferation marker (BrdU) (see percentages of incorporation), thus indicating that it is not a mitogenic
  • NSC nuclear neurae cell
  • Control medium DMEM / F12 supplemented with 0.6% glucose, 0.1% NaHCO 3 , 5 rnM HEPES, 2 mM L-glutamine (Invitrogen), 50 units / ml penicillin / streptomycin (Invitrogen) , 0.08 mg / ml of apo-t-transferrin (Sigma), 0.02 mg / ml of insulin (Sigma), 9 ⁇ g / ml of utrescina (Sigma), 16 nM of progesterone (Sigma) and 24 nM of Na 2 SeO 3 (SigmaJ.
  • Complete medium control medium supplemented with 4 mg / ml of BSA (bovine serum albumin, Sigma), 0.7 units / ml of heparin (Sigma), 20 ng / ml of EGF (factor of ⁇ recimiento epidermal; Invitrogen), and 10 ng / ml FGF2 (fibroblast growth factor, Sigma)] and grown at 37 0 C in a CO 2 atmosphere of 5% until the size of neurospheres was adequate, approximately after 6 days in vitro (IVD), at which time they are dissociated and reseeded (passed) as individual cells in the same complete medium to start the growth of new clones / neurospheres. Cultures made in this way can be expanded.
  • BSA bovine serum albumin, Sigma
  • heparin Sigma
  • EGF factor of ⁇ recimiento epidermal
  • FGF2 fibroblast growth factor
  • the cells from the neurosphere are passed and the sowing is carried out at a density of 2.5 cells / microliter.
  • PEDF or C-ter PEDF was added at a concentration of 20 ng / ml. After 4-6 DIV the number of spheres formed in each condition is determined and the diameters of the spheres are measured.
  • an assay is shown by which clones / spheres that have been treated with PEDF (truncated form of PEDF, C-ter PEDF, is, again, the control without effect) when they are dissociated and re -seeded in the absence of PEDF, in different mitogenic combinations.
  • PEDF truncated form of PEDF, C-ter PEDF, is, again, the control without effect
  • the formation of a greater number of new clones indicates that the PEDF treatment induced the self-renewal division of the stem cells when it was present. This indicates that the PEDF in the sphere promotes the generation of new clone-forming cells by self-renewing division.
  • Secondary spheres To determine that the increase in the capacity to form new spheres (secondary spheres) is related to the presence of more multipotential stem cells in cultures with PEDF, it has also been determined that in these cultures there are more cells that express a surface antigen (LeX ) that has been associated with the most multipotent fraction of neural stem cells (see Figure 4). In this Figure 4 it is shown how the treatment with PEDF increases the number of cells in the neurospheres that express a surface antigen (LeX) that co-secretes with the most multipotent population of the neural stem cells. To carry out this determination, the neurospheres were collected by centrifugation after 6 DlV, and mechanically disintegrated until they had a homogeneous cell suspension.
  • the increase in the number of new clone-forming cells promoted by PEDF is accompanied by molecular changes in the levels of factors that have been associated in neural stem cells, as well as in other cell populations, to a more undifferentiated state, property necessary for e ! maintenance of the multipotence.
  • Some of these molecules have been affected by treatment with PEDF.
  • treatment with PEDF induces the expression of effector molecules of the Notch pathway, which when increased, inhibit factors that promote cell differentiation, in this case the differentiation towards neurons.
  • These effectors of the Notch pathway that we find increased in the cultures treated with PEDF are Hes1 and Hes ⁇ . In the same way, a factor whose expression is associated with the most indifferentiated states of the neural progenitors is increased.
  • Figure 5 shows the changes in the levels of indifferentiation markers induced by PEDF.
  • total RNAs were extracted using the Rneasy Mini Kit (Qiagen) extraction kit following the manufacturer's recommendations. They collected approximately 1x10 6 cells grown in complete medium with or without PEDF and total RNA were stored at -80 0 C until use.
  • RT-PCR analyzes that were performed to evaluate the expression of different genes were started from 1 ⁇ g of RNA that was retrotranscribed in complementary DNA (cDNA) using random hexanucfeotides (3 ⁇ g / ⁇ L, Invitrogen Life Technologies, USA) and 200 U of the SuperScript IE RT reverse transcriptase (Invitrogen Life Technologies), in a reaction volume of 40 ⁇ L and in the presence of first strand buffer (50 mM Tris-HCI, 75 mM KCI, 3 mM Mg 2 CI), 5 mM DTT and 0.25 mM of each dNTPs (Amersham Pharmacia). PCR reactions were performed in an Eppendorf thermal cycler.
  • 1 ⁇ l of cDNA was used as a template in a reaction volume of 20 ⁇ l containing 4mM Tris-HCi, 20 mM KCI, 20 ⁇ M EDTA, 200 ⁇ M DTT, 0.25 mM dNTP s (Amersham Pharmacia), 0.25 ⁇ M of the primers (Sigma -Genosys) and 1 U of DNA Taq poümerasa (Eppendorf, Hamburg, Germany). After an initial denaturation at 94 0 C for 2 min, the amplification cycles corresponding to each pair of primers and a final extension of 10 min at 72 0 C were performed. The size of each amplification product was resolved by electrophoresis in a ge!
  • the invention also provides an assay method in which to measure self-renewal of neural stem cells with the exogenous addition of PEDF and in which to inhibit this process inhibitors.
  • Self-renewal in stem cells is associated with molecules that regulate e! cell cycle too.
  • the expression of the p21waf1 molecule belonging to the Cip / kip family of cyclin dependent kinase inhibitors, is necessary for the long-term persistence of somatic stem cells and for their unlimited self-renewal.
  • Figure 6 shows how PEDF increases the expression of p21, determined by western blot analysis with specific anti-p21 antibodies. This increase in p21 levels is necessary for the effect of PEDF since in cells obtained from the subventricular zone of null mutant mice for p21, the PEDF has no effect on the number of neurospheres, as shown in Figure 6.
  • the Null mutant mice for the p21 protein came from the laboratory of Philip Leder (Department of Genetics, Harvard Medical School, Boston, Massachusetts) and were generated in a strain with mixed genetic background C57BL6 / 129 and those of wild phenotype were obtained from the laboratories Jackson (Bar Harbor, ME). The mutant colony remained in homozygosis.
  • the genotype of the animals was determined by PCR analysis of the genomic DNA extracted from a co! A fragment. Tissues were digested in Iisis buffer (10OmM Tris, pH 8.0, 20OmM NaCI, 2% SDS, 5mM EDTA, 200 ⁇ g / ml proteinase K) for 12 hr at 55 0 C.
  • the samples were then centrifuged at 14,000 rpm for 10 min, and the generated DNA precipitates were washed with 70% ethanol (70 ° EtOH), allowed to dry and resuspended in 100 ⁇ l of H 2 OmQ overnight. 4 0 C.
  • the primers used for the amplifications were: p21 + 116F
  • amplification conditions were as follows: denaturation at 94 0 C for 50 sec, annealing at 55 0 C for 30 sec and extension at 72 0 C 2 min. After a 40-cycle reaction, the wild allele ran by 0.7 Kilobase electrophoresis and the 0.5 kilobase mutant allele.
  • Example 3 Induction test of differentiation in neural stem cells
  • PEDF promotes undifferentiation is found in the fact that when neural stem cells previously treated with PEDF are differentiated by sowing them on an adhesive substrate in the absence of mitogens they show a more undifferentiated phenotype, in case of neural stem cells the number increases of cells that express the nestin indifferentiation marker for a longer time ( Figure 7), Figure 7 shows how the treatment with PEDF increases the number of cells that express indifferentiation markers (nestin) in the cultures without affecting their proliferation.
  • indifferentiation markers for the induction of population differentiation, cells grown during 5 DIV were collected in the presence or absence of PEDF in the complete growth medium by centrifugation and washed several times in control medium, to eliminate the traces of mitogens and PEDF.
  • the sowing was done in plates pretreated for 2 hours with matrigel (15 mg / mL stock solution diluted 1: 100 in control medium; Becton Dick ⁇ nson, Bedford, MA), at a density of 1x10 4 cells / mL, in a medium of differentiation that contained control medium, supplemented with FGF (20ng / mL), growth factor that favored cell survival in the initial steps of differentiation.
  • matrigel 15 mg / mL stock solution diluted 1: 100 in control medium; Becton Dick ⁇ nson, Bedford, MA
  • FGF ng / mL
  • the cells were treated 5 min with Brdu (2 ⁇ M) and fixed with 4% paraformaldehyde (PFA) for 20 min.
  • PFA paraformaldehyde
  • nonspecific binding was blocked with a blocking buffer containing 10% goat serum (invitrogen), 10% (w / v) glycine, and 0.25% (v / v) Triton X-100 as detergent nonionic for the permeabilization of the cells.
  • Cells were incubated Ia all night at 4 0 C with a monoclonal anti-nestin the DSHB (University of owa, USA) and anti-BrdU antibody policlonai (Dakko) diluted in the same blocking buffer.
  • the cells were washed 3 times with 0.1 M PB and incubated with the fluorescent secondary antibodies: Alexa 350 goat anti-rabbit (1: 200), Cy3 goat anti-mouse (1: 2000) followed by a nuclear counterstain with bisbenzimide.
  • Example 4 Neuroagenesis induction assay in cultured neural stem cells
  • the cells were fixed with 4% PFA in 0.1 M PB, for 20 min at room temperature and examined by immunocytochemistry for the detection of specific markers of neurons and glial cells, determining the proportions of each phenotype.
  • Neural and glial differentiation was defined by a triple immunocytochemical marking using a primary antibody anti-Tuj1 (neurons), anti-GFAP (astrocytes) and anti-MBP (oligodendrocytes).
  • the cells were subsequently washed 3 times with 0.1 M PB and incubated with the following fluorescent secondary antibodies: Alexa 350 goat anti-rabbit (1: 200), Cy3 goat anthraton (1: 2000), Biotinylated goat anti-rat (1: 300), Cy2 conjugated to streptoavidin (1: 200) followed by a nuclear stain with bisbenzimide (DAPI).
  • Alexa 350 goat anti-rabbit (1: 200) Cy3 goat anthraton (1: 2000), Biotinylated goat anti-rat (1: 300), Cy2 conjugated to streptoavidin (1: 200) followed by a nuclear stain with bisbenzimide (DAPI).
  • DAPI bisbenzimide
  • the population differentiations were used to determine the neurogenic capacity of the different cultures, for which the glass covers were mounted on a slide with fluorescent protective permanent mounting liquid (Fluorsave, Calbiochem, La JoIIa, CA) and the number was determined of neurons, astrocytes and oligodendrocytes counting the number of neurons and astrocytes, or oligodendrocytes with respect to the total nuclei stained with DAPI in at least 25 random fields.
  • the fluorescence was visualized with a Nikon diaphon inverted microscope, or vertical (E400) and images were captured with a Nikon digital camera.
  • Example ⁇ Competition test of the effect of PEDF in the auto-renewal of neurate stem cells in culture with the C-ter PEDF fragment
  • the truncated form containing the C-terminal half of the PEDF polypeptide antagonizes the action of the complete PEDF in the self-renewal test of stem cells becoming a useful tool to determine the specificity of the action in the complete form (Figure 9). Therefore, the present invention also provides a method to analyze the specificity of the effects of the PEDF molecule on e! self-renewal process
  • NSCs dissociated in complete medium with 20 ng / ml PEDF (equivalent to a 0.4 nM concentration) and in the presence of increasing concentrations of the C-ter PEDF fragment were seeded. After 4 IVD, the number of neurospheres formed in each condition was determined.
  • a assay was conducted in which COS cells, which do not possess significant levels of PEDF, were transfected with a cDNA encoding human PEDF.
  • the Pedf cDNA (the name of the gene in the HUGO nomenclature is Serpinfi) was obtained by RT-PCR and was cloned into the vector pcDNA3.1 (Invitrogen).
  • the cells were co-transfected with said plasmid and one containing a construct for GFP as a transfection marker, by Lipofectamine, in DMEM. After 8 hr the cells were transferred to DMEM with 10% FBS for 12 hours.
  • Pedf expression and secretion in cells transfected with an empty vector or with pcDNA-hPedf was analyzed, respectively, by RT-PCR and by conditioned medium immunobiot as explained in the following paragraphs.
  • the transfected cells were changed to complete medium NSCs, an insert was placed (12 mm Millipore transwell and 0.4 ⁇ m pore diameter) 2 hours later and in it dissociated neural stem cells were seeded at low density. These cultures were performed in the presence or absence of CED ter PEDF at a concentration of 15 nM. At 4 DlV the number of neurospheres formed in each culture was counted.
  • FIG. 10 shows shows how COS cells transfected with a construct containing the sequence encoding the human PEDF express and secrete PEDF, This PEDF is active in a self-renewal assay in neural stem cells and the effect is blockable by the C-ter fragment.
  • the truncated C-ter PEDF form allows, therefore, to identify the participation of the PEDF from a cellular system that expresses it through its specific antagonism with the truncated form, as shown in the following experiment in which it antagonizes with C- ter PEDF the effect on self-renewal that have cell types that naturally produce and secrete PEDF.
  • Figure 11 shows cell types that express PEDF and, among them, those that secrete detectable amounts of PEDF protein. These cell types are natural producers of the factor, such as endothelial cells or ependymal cells. For these experiments different types of cells were analyzed:
  • Primary arterial endothelial cells from the human umbilical cord (HUAEC cells): obtained from AdvanceCell and maintained with the means suggested by the distributor.
  • primary venous endothelial cells of the human umbilical cord (HUVEC cells): obtained from AdvanceCell and maintained with the means suggested by the distributor, - ependymal cells obtained by extracting the ependymal layer of the lateral ventricles of brains of adult and maintained mice in the middle of neurospheres.
  • Astrocyte cells obtained by differentiating neural stem cells in differentiation assays or by astrocyte cultures from brains of neonatal mice granular neurons isolated from cerebellums of seven-day postnatal mice and seeded on pol sobre-D-iisin in DM EM -F 12, 10% FBS and 25 mM potassium chloride.
  • RNAs were extracted using the Rneasy Mini Kit (Qiagen) extraction kit following the manufacturer's recommendations. From 1 ⁇ g of RNA, a retro-transcription was performed using random hexanucleotides (3 ⁇ g / ⁇ l, Invitrogen Life Technologies, USA) and 200 U of the SuperScript Il RT reverse transcriptase (Invitrogen Life Technologies), in a reaction volume 40 ⁇ L and in the presence of first strand buffer (50 mM Tris-HC ⁇ , 75 mM KCI 1 3 mM Mg 2 CI) 1 5 mM DTT and 0.25 mM of each dNTPs (Amersham Pharmacia).
  • first strand buffer 50 mM Tris-HC ⁇ , 75 mM KCI 1 3 mM Mg 2 CI
  • PCR reactions were performed in an Eppendorf thermal cycler. 1 ⁇ l of cDNA was used as a template in a reaction volume of 20 ⁇ l containing 4mM Tris-HCI, 20 mM KCI, 20 ⁇ M EDTA, 200 ⁇ M DTT, 0.25 mM dNTPs (Amersham Pharmacia), 0.25 ⁇ M of the primers (Sigma- Genosys) and 1 U of Taq polymerase DNA (Eppendorf). After an initial denaturation at 94 0 C for 2 min, the amplification cycles corresponding to each pair of primers were performed and a final extension of 10 min at 72 0 C.
  • each amplification product was resolved by electrophoresis in a 2% agarose gei (w / v) prepared in TBE buffer (89 mM Tris, pH 8.0, 89 mM boric acid, 2mM EDTA) with 10 ⁇ g / ml ethidium bromide.
  • TBE buffer 89 mM Tris, pH 8.0, 89 mM boric acid, 2mM EDTA
  • 10 ⁇ g / ml ethidium bromide As a 6x loading buffer, 50% glyceri, 0.05% bromophen blue !, 0.05% xylene cyanol, 100 mM EDTA was used.
  • the quantification was carried out by densitometry comparing the intensity of each band with the product of the amplification of the gene from! To beta-actin.
  • the primers used were: hPEDF (forward: CTGAAGCTGAGTTATGAAGGCG; reverse:
  • the concentration of the extracted protein was determined by the modified Bradford method (DC Protein assay; Bio-Rad) using bovine serum aibumin (BSA) as standard.
  • BSA bovine serum aibumin
  • the same amount of protein (50-100 ⁇ g) was resuspended in a sample solvent buffer (625 mM Tris-HCI, pH 6.8, 10% (v / v) glyceri, 2% (p / v) SDS, 4% ( v / v) ⁇ -mercaptoethanol, 0.025% (w / v) bromophenol azui), boiled denatured for 5 minutes and resolved by SDS-PAGE electrophoresis in 10-13% gels.
  • the gels were electrotransferred (100 V, 1 hour) to a nitrocellulose membrane (Hybond-ECL, Amersham Biosciences), using transfer buffer (25mM Tris, pH 8.3, 20% (v / v) methanol, 192mM glycine) in a Mini Trans-blot system (Bio-Rad).
  • the membranes were blocked in 5% skimmed milk powder (w / v) in 0.1% (v / v) tris borate saline-Tween-20 (Sigma) (TBS-T) (0.1 M Tris-HCI pH 7.5, 0.9% (w / v) NaCl) for 1 hour at room temperature and under stirring.
  • the membranes were subsequently incubated with the primary anti-PEDF antibodies (Chemicon, 1: 1000) and anti-beta-actin (Sigma; 1: 5000) in JBS-T, overnight at 4 0 C and under agitation. Finally, the membranes were washed three times in TBS-T, incubated for 1 hour at room temperature with the appropriate secondary antibodies bound to peroxidase and revealed by chemiluminescence (Roche Lumi-light ECL kit), exposing the membranes on photographic paper ( Konica) until the optimal detection of the signal. The intensities of the individual bands were quantified using an image densitometer (Scion Image) The expression levels of the protein analyzed in our studies were normalized with respect to the ⁇ -actin of these same samples.
  • the C-ter fragment is capable of competing the inductive effect of endothelial and ependymal cells in the self-renewal test of neural stem cells, as shown in Figure 12, This block is in agreement with the observation that these types of cells secrete pEDF and proves that the PEDF produced naturally! by certain types of cells it can be antagonized by the C-ter fragment in the self-renewal process. This is shown in Figure 12.
  • Figure 12 shows how endothelial and ependymal cells, which express and secrete PEDF naturally (see figure 11), induce spheres formation and that this inducing effect is blocked by 15 nM C- ter PEDF.
  • Example 6 Self-renewal test of stem cells, neurals, the neurogenic niche of the subventricular area by means of intra-beta administration of the PEDF
  • the PEDF also activates the self-renewal division of neural stem cells present in the endogenous neurogenic niches increasing their number and their ability to give rise to progeny but maintaining their stem cell status (self-renewal), as demonstrated when PEDF is administered intracerebrally using mini-osmotic pumps in mouse brains ( Figures 14 and 15).
  • Figure 14 shows that when the PEDF factor is administered intracerebrally, it leads to a greater number of neural stem cells (which retain long periods of BrdU, an indication of their relative quiescence, and which are positive for the GFAP marker).
  • the blockage of the endogenous PEDF that occurs in the neurogenic niche of the subventricular zone under normal conditions does not cause changes, which suggests that the PEDF does not act as a survival factor for these cells.
  • Figure 15 shows that the effect of PEDF administered to mice at the level of the subventricular zone is to activate the division of neural stem cells, as observed in the fact that they incorporate more BrdU, indicating that they are proliferating in the presence of exogenous PEDF .
  • Alzet mini osmotic pumps (model 1007D) were implanted coupled to cannulas of 28 ⁇ m in diameter that were inserted intracerebrally in adult mice with stereotactic coordinates: 0.0 anteroposterior to Bregma, 0.7 mediolateral and 1.7 dorsoventral and were fixed to the skull with Histoacryl (B / Braun).
  • Brdu is a structural analogue of the thymidine nucleotide, and is incorporated into the DNA of cells that are in the S phase at the time of the pulse. Subsequently we can detect cells that have been marked by the use of a specific antibody in histological sections.
  • Brdu massages of proliferating cells in the adult brain the mice underwent two different types of administration regime depending on the cells that were to be labeled:
  • mice received on the last day of the intraventricular infusion period 7 intraperitoneal injections of Brdu (Sigma), (50 ⁇ g / g weight) every two hours (Nowakowski et al. t 1988), and were sacrificed one hour after Ia Last injection This strategy marks the cells that are proliferating on the last day of infusion.
  • mice received a month before the start of the infusion period, 6 injections of BrdU in a period of two days (3x2) and were sacrificed at the end of the infusion period.
  • This strategy marks the neural stem cells, relatively quiescent and, therefore, maintain the mark associated with the incorporation of the BrdU for a month, and which express GFAP.
  • mice All animals were anesthetized with sodium pentobarbital (13 mg / g of animal) and slaughtered by intracardiac perfusion with 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer, pH 7.4 After post-fixation overnight ( o / n), brains were removed and washed in PB for 2 hours. Next, the tissue was dehydrated and included in paraffin. Serial sections of 7 microns thick were incubated in 2N HCl at 37 0 C for 20 minutes and neutralized with 0.1 M pH 8.5 borate buffer.
  • PFA paraformaldehyde
  • the blocking of nonspecific junctions was carried out by incubating the cuts with a blocking solution (0.2% Triton X-100, 10% goat serum in 0.1 M PB) for 1 hour at room temperature. In that same blocking solution, the sections were incubated with a primary anti-Brdu antibody (DAKO, 1: 200) for 12 hours, followed by specific secondary antibodies labeled with fluorochromes.
  • DAKO primary anti-Brdu antibody
  • This immunocytochemical detection was combined with the immunocytochemical detection of specific markers of NSCs, such as GFAP (fibric acidic glial protein), and neuroblasts, such as the polysialized form of the neural adhesion molecule (PSA-NCAM). PEDF makes the niche more efficient in the production of neuronal progeny (Figure 16).
  • Figure 16 shows how the PEDF administered exogenously leads to a greater production of neurons in the subventricular zone (positive for the PSA-NCAM antigen) and to a greater pro ⁇ iferative activity of the area (incorporation of BrdU).
  • the administration of PEDF leads to the obtaining of cultures with greater capacity to generate neurospheres (Figure 17).
  • Figure 17 shows how when the PEDF is exogenously administered to brains, it leads to a greater production of neurospheres from the dissociated tissue. of these brains. This indicates that the activation of somatic stem cells by PEDF favors the production of cell progeny and, therefore, can contribute to regenerative processes and tissue repair.
  • PEDF production Four examples of PEDF production are included, to demonstrate that the object of the present invention is fundamentally focused on the new use of the PEDF factor as an inducer of the self-renewal of stem cells, regardless of the way in which the PEDF:
  • PEDF - From cells that express and secrete PEDF naturally, such as endothelial cells (for example, umbilical cord) or cells of an ependymal nature (see Figure 11). These cells are sufficient to grow them both in their usual culture medium and in the culture medium of neural stem cells so that they secrete PEDF. These cells can be from primary cultures or cell lines of endothelial or ependymal origin, transferred or acquired from companies. To use them as a source of PEDF for self-renewal, they can be co-quantitative with the stem cells through co-culture systems with porous membrane inserts that do not allow contact between the cells of the two sources, as explained for the tests contained in example 5.
  • endothelial cells for example, umbilical cord
  • ependymal nature see Figure 11
  • These cells are sufficient to grow them both in their usual culture medium and in the culture medium of neural stem cells so that they secrete PEDF.
  • These cells can be from primary cultures or cell lines of endothelial or ependy
  • PEDF can be expressed in any cell line that does not express or express low levels of PEDF by introducing a cDNA for Pedf using transfection, as explained for example in the tests included in the example of embodiment 5.
  • Produced in Pichia pastoris from the human sequence obtained by PCR and cloned into the pPICZ ⁇ A vector to which the sequence for the Saccharomyces cerevisiae signal peptide and a hysteridine tail is added. Once produced in Pichia, it is purified by chromatography and the obtaining and purity by electrophoresis in SDS-PAGE and western blot are checked with specific anti-PEDF antibodies (see Figure 18). These molecules were obtained from Julio Escribano's laboratory at the University of Castilla La Mancha, which yielded them for the analyzes shown in the examples of realization.
  • Figure 18 shows purified forms by complete PEDF chromatography and the C-terminal half of the human PEDF from the means obtained from Pichia genetically modified for the expression of these forms.
  • the SDS-PAGE electrophoresis shows the purity of the separation and the apparent molecular weight of the PEDF (47 kDa) and the C-ter PEDF (26 kDa) and the immunodetection with anti-PEDF antibodies shows the specificity of the two products.
  • the use of biologically active PEDF in the process of self-renewal of stem cells includes the PEDF and any PEDF derivative with action in cell renewal.
  • PEDF can be purified from natural sources, such as vitreous humor.
  • the invention is not restricted to the use of the entire PEDF molecule or its precise sequence or its origin from humans or other species.
  • a coding sequence for PEDF may include population air variations or point mutations, as well as variants by insertion, deletion or substitution, on PEDF polypeptides that are found in nature.
  • the PEDF polypeptide may contain other domains, such as special epitopes for purification (such as, for example, histidine tails, myc) or for monitoring (such as, for example, GFP), It may also be variants of post-translational modifications, as glycosuation or phosphorylation.
  • the PEDF can be used in its complete form or in the form of fragments that retain the activity on cell renewal. All of these forms can be supplied to stem cell cultures directly for activation and maintenance.
  • the use of pharmaceutical compositions for cell self-renewal characterized by containing at least a pharmaceutically effective amount of PEDF factor and at least one pharmaceutically acceptable excipient can also be applied systemically or locally. In this sense, the PEDF is not toxic and the effects on self-renewal, at least in mouse neural stem cells both in culture experiments and by administering it directly in the brain of mice, we have found them with concentrations of only 0.4 nM .
  • the PEDF can be used in the form of a construction containing a nucleic acid sequence encoding any of the PEDF forms contemplated in the preceding paragraph.
  • these sequences can be introduced into cellular systems using recombinant DNA technology.
  • PEDF can be introduced in this way into cellular systems (through transfection, infection, electroporation, microinjection, etc.), which can then be co-cultured with stem cells, or introduced into tissues in which it is necessary to activate stem cells. endogenous, or it can be introduced directly into tissues through infection with viral vectors used in gene therapy.
  • these sequences can be used for the mass expression of the active DF form in cell renewal in prokaryotic or eukaryotic expression systems. In all these cases, the constructions must contain promoters capable of directing the expression of the molecule in the cells of interest.
  • the PEDF can be supplied alone or in combination with other factors that induce self-renewal.
  • the PEDF polypeptide activates the self-renewing division of somatic stem cells, such as neural ones, in natural niches and with it, the production of differentiated progeny.
  • the present invention provides a method for activating stem cells present in tissues that require greater activity of their stem cells for tissue renewal and even regeneration, such as skin regeneration, hematopoietic, neural after stroke, heart, etc.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Dermatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Uso del factor PEDF para inducir la renovación de celular. La presente invención se refiere al uso de la molécula del PEDF para la fabricación de medicamentos para activar procesos incluidos en el grupo de los procesos de regeneración, tales como la regeneración de la piel, cicatrización, terapia celular para regeneración cardiaca, neural o hematopoyética. También se refiere a la fabricación/uso de composiciones farmacéuticas que contienen una. cantidad eficiente del factor PEDF para la auto- renovación de células madre.

Description

USO DEL FACTOR PEDF PARA INDUCIR LA RENOVACIÓN DE CELULAR
CAMPO DE LA INVENCIÓN:
Esta invención está dentro del campo de ia Bioquímica y Ia Biología Celular. En particular, Ia invención se refiere al uso específico de Ia molécula PEDF (Factor Derivado del Epitelio Pigmentado) en Ia inducción y/o potenciación de Ia auto- renovación de células madre en cultivo. La presente invención también se refiere al uso de esta molécula para Ia activación de células madre en distintos tejidos mediante Ia administración exógena de PEDF a dichos tejidos. Se contempla además el uso de composiciones farmacéuticas para auto-renovación celular caracterizadas por contener ai menos una cantidad farmacéuticamente eficaz de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
ANTECEDENTES DE LA INVENCIÓN:
El factor PEDF (Factor Derivado del Epitelio Pigmentado) es un miembro de Ia superfamiiia de las serpinas (inhibidores de Ia proteasa de serina), aunque carece de Ia actividad inhibidora de proteasas. El PEDF humano consta de 418 aminoácidos, un péptido señal para secreción y está N-gücosilado en Asn285. E! producto secretado tiene un peso molecular aparente de 50 kDa. Se han descrito en Ia molécula PEDF dos regiones:
1) Asp44-Asn77 (34 aminoácidos), con actividad anti-angiogénica,
2) Val78-Thr121 (44 aminoácidos), con actividad neurotrófica.
El factor PEDF es una proteína multifuncional y anteriormente en el estado de Ia técnica se ha demostrado su eficacia como: a) Estimulador de diferenciación neurona!, en células de neuroblastoma. b) Factor que produce disminución de fenotipo maligno, en células tumorales de próstata. c) Estimulador de crecimiento neurítico, en neuronas motoras. d) Neuroprotector frente a estímulos que inducen muerte neuronal apoptótica, en neuronas de Ia retina, granulares del cerebelo, hipocampales, y neuronas motoras. e) Factor bloqueante de proliferación, en células de mlcroglía. f) Factor inductor de apoptosls, en células tumoraies. g) Factor inductor de apoptosis, en células endoteliales. h) Factor bloqueante de migración celular, en células endoteliales, i) Factor anti-angiogénlco y anti-vasculogénico, en células endoíeliales.
Por Io tanto, en relación con el uso del factor PEDF, anteriormente en el estado de Ia técnica se ha propuesto como un factor potenciaimente útil en el desarrollo, mantenimiento, y función de Ia retina y para el tratamiento de degeneración retiniana, especialmente de ia mácula, inducida por íuz, edad, diabetes, glaucoma o enfermedades genéticas como Ia retinitis pigmentosa, en las que Ia neovascularizaciόn es un agravante [WO0224234; WO02058730; WO04028635; WO04027019; WO0181551; US020194639; US030087859; US010049369; Imaí D, Yoneya S, Gehlbach PL, Wei LL, Mori K (2005) tntraocular gene transfβr of pigment epithelium- derived factor rescues photoreceptors from lighNnduced cell death. J CeII Physiol., 202(2):570~8 ; Takita H1 Yoneya S1 Gehlbach PL, Duh EJ, Wei LL, Morí K. (2003) Retinal nβuroprotection against ischβmic injury mediated by infraocular gene transfer of pigment epithelium-derived factor. Invest Ophthalmol Vis Sci. 44(10):4497-504; Miyazaki M, lkeda Y, Yonemitsu Y, Goto Y, Sakamoto T, Tabata T1 Ueda Y, Hasegawa M1 Tobimatsu S, lshibashi T, Sueishi K. (2003) Simian Iβntiviral vβctor-mediated retinal gene transfer of pigment epitheliυm-deríved factor protects retinal degeneration and electrical defect in Roya! College of Surgeons rats. Gene Ther. 10(17):1503-11. Aυricchio A, Behling KC, Magυire AM, O'Connor EM1 Bennβtt J, Wilson JM, Tolentino MJ. (2002) Inhibition of retinal neovascularization by infraocular viral-mediated delivery of anti-angiogβnic agents. Mol Ther., 6(4): 490-4. 5. Mori K, Gehlbach P, Ando A, McVey D, Wei L, Campochiaro PA. (2002) Regression of ocular neovascularization in response to increased expression of pigment epithelium-deríved factor. Invest Ophthalmol Vis Sci., 43(7):2428-34. 6. Raisler BJ, Berns Kl, Grant MB, Beliaev D, Hauswirth WW. (2002) Adeno-associated virus type-2 expression of pigmented epithelium-derived factor or Kringles 1-3 of angiostatin reduce retinal neovascularízation. Proc Nati Acad Sci U S A., 25,99(13):8909-14. Ogata N, Wang L, Jo N, Tombran-Tink J, Takahashi K, Mrazek D, Matsumura M. (2001) Pigment epithelium deríved factor as a neuroprotective agent against ischemic retinal injury, Curr Eye Res. 22(4):245-52, Morí K, Duh E, Gehlbach P1 Ando A, Takahashi K, Pearlman J, Morí K, Yang HS, Zack DJ, Ettyreddy D, Brough DE, Wei LL, Campochiaro PA. Pigment epithelium-deríved factor inhibits retinal and choroidal neovascularízation. J CeII Physiol., 188(2):253-δ3. Cao W1 Tombran-Tink J, Elias R, Sezate S, Mrazek D, McGinnis JF. (2001) In vivo protection of photoreceptors from light damage by pigment epithelium-deríved factor. Invest Ophthalmoi Vis ScL 42(7):1646-52, Stellmach V, Crawford SE, Zhou W, Bouck N. (2001) Prevention of ischemia-índuced reftnopathy by the natural ocular antiangiogenic agent pigment epithelium-derived factor. Proc Nati Acad Sci U S A., 98(5):2593~7. Cayouette M, Smith SB, Becerra SP, Grave! C. (1999) Pigment epithelium-derived factor delays the death of photoreceptors in mouse models of inheríted retinal degenerations. Neurobiol Dis,, 6(6):523-32. Cao W, Tombran-Tink J, Chen W1 Mrazek D, Elias R, McGinnis JF, (1999) Pigment epithelium-deríved factor protβcts cultured retinal neurons against hydrogen peroxide-induced cell death. J Neurosci Res., 57 (6) :789-800}
Por otro lado, también es conocido que el factor PEDF es un factor potencialmente útil para Ia neuroprotección de neuronas en procesos neurodegenerativos o de daño neuronal [WO0224234; WO02058730; WO04028635; WO04027019; WO0181551; US020194639; US030087859; US010049369; Cao W, Tombran-Tink J1 Chen W, Mrazek D, Elias R, McGinnis JF. (1999) Pigment epithelíυm-derived factor protects cultured retinal neurons against hydrogen peroxide-induced cell death. J Neurosci Res., 57(6):789-800. Houenou LJ, D'Costa AP, Li L1 Turgeon VL1 Enyadike C, Alberdi E, Becerra SP. (1999) Pigment epithelium-deríved factor promotes the survival and differentiation of developing spinal motor neurons. J Comp Neurol., 412(3):506-14. Bilak MM, Corsé AM, Bilak SR, Lehar M, Tombran-Tink J, Kuncl RW. (1999) Pigment epithelium-derived factor (PEDF) protects motor neurons from chronic glutamate- mediated neurodegeneration. J Neuropathol Exp Neurol., 58(7)119-28. DeCoster MA, Schabelman E, Tombran-Tink J, Bazan NG, (1999) Neuroprotection by pigment epithelial-derived factor against glutamate toxicíty in developing primary hippocampal neurons. J Neurosci Res., 56(6):604-10. Taniwaki T, Hirashima N1 Becerra SP, Chader GJ, Etcheberrigaray R, Schwartz JP. (1997) Pigment epithelium-derivθd factor protects cultured cerebellar granule cells against glutamate-induced neurotoxicity. J Neuroohem., 6β(1):26-32. Taniwaki T, Becerra SP, Chader GJ, Schwartz JP. (1995) Pigment epithelium-derived factor is a survival factor for cerebellar granule cells in culture. J Neurochem, 1995 Jun;64(6):2509-17. Steele FR, Chader GJ, Johnson LV, Tombran-Tink J. (1993) Pigment epithelium-derived factor: neurotrophic activity and identifícation as a member of thβ sβríne protβase inhibitor gene family. Proc Nati Acad Sci U S A. 1993 Feb 15;90(4): 1526-30].
El factor PEDF también se ha descrito como un factor anti-tumoral por su efecto diferenciad o r en células tumorales y por su efecto de inhibición de Ia angiogénesis [US030082183; US040234505; WO050118136; US050222031; Cai J, Jiang WG1 Grant MB, Boulton M. (2006) Pigment Epitheiiυm-derived Factor Inhibits Angiogénesis vía Regulated Intracellular Proteolysis of Vascular Endothelial Growth Factor Receptor 1. J Biol Chβm., 281(6):3604-13. Streck CJ1 Zhang Y, Zhou J1 Ng C, Nathwani AC, Davidoff AM. Adeno-associated virus vector-mediated delivery of pigment epithelium- derived factor restrícts neuroblastoma angiogénesis and growth. J Pediatr Surg. 40(1):236-43. Wang L, Schmitz V, Perez-Mediavilla A, Izal I, Prieto J, Qian C. (2003) Suppression of angiogenesis and tumor growth by adenoviral-mediated gene transfer of pigment epithelium-derived factor. Mol Ther., 8(1)12-9, DoII JA, Stellmach VM, Bouck NP, Bergh AR, Lee C, Abramson LP, Comwell ML, Pins MR, Borensztajn J, Crawford SE. (2003) Pigment epithelium-derivθd factor regulates the vasculature and mass of the prostate and páncreas. Nat Med., 9(6) .774-80. Guan M, Yam HF, Su B, Chan KP1 Pang CP, Uu WW, Zhang WZ, Lu Y. (2003) Loss of pigment epithelium derived factor expression in glioma progrβssion. J Clin Pathol., 56(4):277-82. Dawson DW, Volpert OV, GiIHs P, Crawford SE, Xu H, Benedict W, Bouck NP. Pigment epithelium-derived factor: a potent inhibitor of angiogenesis. Science, 285(5425):245~
También se conoce su función diagnóstica de ciertas patologías neurodegenerativas, como Ia esclerosis lateral amiotrófica, por el aumento de sus niveles en el líquido cefalorraquídeo, y de prognosis tumoral por su disminución en tumores [US050222031; Sidle DM, Maddalozzo J, Meter JD, Cornwell M, Stellmach V1 Crawford SE. (2005) Altered pigment epithelium-derived factor and vascular endothelial growth factor levéis in lymphangioma pathogenesis and clinical recurrence. Arch Otolaryngol Head Neck Surg., 131(11):990-5. Matsumoto K, Ishikawa H, Nishimura D, Hamasaki K, Nakao K, Eguchi K. Antiangiogenic property of pigment epithelium-derived factor in hepatocellular carcinoma. Hepatology, 40(1):252-9. Uehara H, Miyamoto M, Kato K, Ebihara Y, Kaneko H1 Hashimoto H1 Murakami Y, Hase R, Takahashi R, Mega S, Shichinohe T, Kawarada Y, ltoh T1 Okushiba S, Kondo S, Katoh H. (2004) Expression of pigment epithelium-derived factor decreases liver metástasis and correlates with favorable prognosis for patients with ductat pancreatic adenocarcinoma. Cáncer Res,, 64(10):3533-7. Gυan M, Pang CP, Yam HF, Cheung KF, Liu WW, Lu Y. (2004) Inhibition of glioma invasión by overexpression of pigment epithelium-derivθd factor. Cáncer Gene Ther., 11(5):325-32. Abe R, Shimizu T1 Yamagishi S, Shibaki A, Amano S1 lnagaki Y1 Watanabe H1 Sugawara H, Nakamura H1 Takeuchi M, Imaizυmi T, Shimizu H. (2004) Overexpression of pigment epithelium-derived factor decreasβs angiogenesis and inhibits the growth of human malignant melanoma cells in vivo. Am J Pathol., 164(4):1225-32. Miyagishi D, Ohno-Matsui K, Amagasa T, Monta I. (2003) Regulation of the expression of pigment epithelium-derived factor, an anti-angiogenic factor in human oral squamous cell carcinoma cell Unes. Cáncer Lett., 196(1):77-85. Guan M, Yam HF, Su B, Chan KP1 Pang CP, Liu WW, Zhang WZ, Lu Y. Loss of pigment epithelium derived factor expression in glioma progression. J Clin Pathol. , 56(4):277-82. Abramson LP, Stellmach V, DoII JA1 Cornwell M, Arensman RM1 Crawford SE. (2003) Wilms' tumor growth is suppressed by antiangiogenic pigment epithelium-derived factor in a xenografí model. J Pediatr Surg., 38(3):336~42. Slavc I1 Rodríguez IR1 Mazuruk K, Chader GJ, Biegel JA. (1997) Mutatíon analysis and loss of heterozygosity of PEDF in central nervous system primitive neuroectodermal tumors. lnt J Cáncer. 72(2):277-82. Seigel GM1 Tombran-Tínk J1 Becerra SP, Chader GJ, Diloreto DA Jr, del Cerro C, Lazar ES, del Cerro M. (1994) Differentiation of Y79 retinoblastoma cells with pigment epithelial-derived factor and interphotoreceptor matrix wash: efíects on tumorigenicity. Growth Factors, 10(4):289-97. Tombran-Tink J, Chader GG, Johnson LV. (1991) PEDF: a pigment epitheiium-derived factor with potent neurona! differentiative activity. Exp Eye Res. 53(3):411-4. Kuncl RW1 Bilak MM, Bilak SR, Corsé AM1 Royal W, Becerra SP. (2002) Pigment epithelium-derived factor is elevated in CSF of patients with amyotrophic lateral sclerosis. J Neurochem., 81 (1):178-84].
Sin embargo, el factor PEDF nunca ha sido descrito en bibliografía anterior como un factor relacionado con el comportamiento de células madre de ningún tipo y, por tanto, su utilización como inductor de Ia auto-renovación de células madre es un aspecto novedoso y por tanto, objeto de Ia presente invención. Es necesario puntualizar que, el efecto que en Ia presente invención se reivindica del factor PEDF como factor inductor de la auto-renovación de células madre, no guarda ninguna relación con los efectos previamente descritos en el estado de técnica para el PEDF en otros tipos celulares, como son la diferenciación celular, Ia supervivencia celular o Ia apoptosis. Por Io tanto, Ia presente invención proporciona un uso nuevo o aplicación del factor PEDF como un factor inductor de Ia auto-renovación de células madre.
DESCRIPCIÓN DE LA INVENCIÓN:
La presente invención ofrece un método de potenciar Ia auto-renovación de células madre en cultivo aplicando exógenamente PEDF. La adición de PEDF a medios definidos favorece el mantenimiento en el cultivo de las células madre mediante su acción estimuladora de la división celular de tipo auto-renovante frente a Ia división celular diferenciativa, que conlleva Ia desaparición de las céluías madre del cultivo y su transformación en progenitores comprometidos a fenotipos celulares específicos. Esto conduce a Ia expansión de las células madre acompañada del mantenimiento del potencial de estas células.
La presente invención incluye el uso de ía molécula "factor derivado de epitelio pigmentario" (PEDF) y/o cualquier derivado suyo para promover Ia amplificación de poblaciones de células madre, somáticas o embrionarias, de cualquier especie. Esta acción consiste en favorecer Ia repücación de células madre mediante división celular renovadora así como de Ia inducción de Ia expresión de moléculas que suelen estar aumentadas en células con fenotipo indiferenciado y multipotente. La invención incluye el uso de PEDF en células madre naturales así como en células madre modificadas genética o eptgenéticamente. La invención también proporciona un método de estimular Ia activación de células madre somáticas endógenas, para producción de progenie diferenciada, mediante el uso de composiciones farmacéuticas que contienen una cantidad farmacéuticamente eficaz de factor PEDF.
La expansión homogénea de una población de células madre en medios definidos ex vivo no es eficiente porque se observa que Ia propagación de estas células va acompañada de su derivación hacia células que tienen capacidad proliferativa expansiva pero que carecen de las propiedades de auto-renovación ilimitada y de multipotencia, propiedades inherentes al concepto de célula madre. El hecho de que Ia propagación de células madre cuando están en cultivo invariablemente se acompañe de diferenciación ha sido interpretado como una tendencia natural de estas células hacia la división de tipo diferenciativo en lugar de Ia división de tipo auto-renovante. Dado que en los nichos naturales en los que las células madre específicas de tejido se encuentran, éstas persisten durante toda Ia vida del individuo, Ia progresiva diferenciación de estas células durante su expansión ex vivo puede ser un reflejo de que las condiciones del cultivo no reproducen adecuadamente Ia situación del microambiente endógeno natural.
EI PEDF, es un factor que se encuentra en nichos neurogénicos. Es, además, una molécula secretada y soluble, que puede ser adicionada a medios de cultivo. Por esta razón, ei factor PEDF es capaz de inducir auto-renovación en poblaciones de células madre obtenidas de cerebros adultos de ratón, por ejemplo, ya que promueve Ia división no diferenciativa de dichas células madre y Ia expresión de moléculas que se asocian con el estado más indiferenciado y multipotente de estas células, como es el factor de transcripción Sox2 y efectores de Ia vía de señalización de Notch. Es por ello que, cuando se administra PEDF a cultivos de neuroesferas, que son ¡os agregados clónales en forma de esfera formados por Ia progenie de cada célula madre neura!, éste factor aumenta el número de células capaces de formar nuevas esferas cuando se resiembran las células tratadas a una densidad de 2,5 células/microlitro (ensayo de auto-renovación). Además, en las células tratadas con PEDF aumenta Ia expresión de! factor de transcripción Sox2, relacionado con indiferenciación. Por tanto, Ia invención proporciona también un método de ensayo en el que medir auto-renovación de células madre neurales con Ia adición exógena de PEDF y en el que ensayar inhibidores de este proceso y/o antagonistas del factor PEDF y por tanto, Ia presente invención proporciona un uso nuevo del factor PEDF como producto capaz de estimular la auto- renovación de células madre permitiendo identificar y/o ensayar diferentes compuestos inhibidores de Ia auto-renovación y/o antagonistas del factor PEDF.
Aparte de poder proporcionar condiciones de cultivo para Ia expansión más adecuada de estas células, el factor PEDF administrado directamente en el cerebro de ratones causa Ia activación de las células madre neurales endógenas, activación que conduce a una mayor actividad neurogénica, de producción de nuevas neuronas, en Ia zona subventricular de cerebro adulto. Por ello, el PEDF puede ser un factor facilitador de procesos de producción de nuevas células a partir de células madre presentes en los tejidos. Por tanto, Ia presente invención se refiere también al uso de Ia molécula pEDF en Ia preparación de composiciones farmacéuticas para auto-renovación de células madre endógenas.
En Ia presente invención, se reivindica el uso de! factor PEDF para inducir Ia auto- renovación de células madre de cualquier tipo, sin especificar el origen del factor PEDF, ya que éste podría generarse a partir de cualquier procedimiento de síntesis u obtención o bien utilizarse factor PEDF natural. Es decir, en Ia presente invención se reivindica ei uso del factor PEDF, ya sea natural o sintético, como inductor de Ia auto- renovación de células madre.
Según un primer aspecto importante Ia presente invención se refiere al uso del factor PEDF en su versión completa o fragmentado en Ia preparación de una composición que induce ía auto-renovación de células madre de cualquier origen.
Según otro aspecto importante Ia presente invención se refiere al uso del factor PEDF en Ia preparación de una composición que induce la auto-renovación de células madre que está combinado de forma adicional con moléculas seleccionadas del grupo formado por aminoácidos, lípidos, hidratos de carbono y metales.
Según otro aspecto importante Ia presente invención se refiere a! uso del factor PEDF en Ia preparación de una composición que induce Ia auto-renovación de células madre en sistemas de expresión procariotas o eucariotas y que induce Ia auto-renovación de céluias madre somáticas.
Según otro aspecto importante ia presente invención se refiere al uso del factor PEDF en Ia preparación de una composición que induce Ia auto-renovación de células madre endógenas o exógenas.
Según otro aspecto importante Ia presente invención se refiere al uso del factor PEDF en la preparación de una composición que induce Ia auto-renovación de céluias madre en el que Ia composición está en una forma seleccionada de polvo, granulos, comprimidos, cápsulas, trociscos, solución, suspensión, emulsión y jarabe.
Según otro aspecto importante Ia presente invención se refiere al uso del factor PEDF para Ia fabricación de un medicamento para activar procesos seleccionados del grupo formado por procesos de regeneración tisular de Ia piel, procesos de cicatrización, procesos de regeneración neural en casos de accidente cerebro vascular.
Según otro aspecto importante Ia presente invención se refiere al uso del factor pEDF para Ia fabricación de un medicamento para terapia celular, preferentemente para regeneración cardíaca, neural y/o hematopoyética.
Según un segundo aspecto importante la presente invención proporciona una composición farmacéutica para inducir Ia auto-renovación de células madre que comprende en un medio farmacéuticamente aceptable una cantidad farmacéuticamente eficaz de:
a) Ia secuencia total o parcial del factor PEDF,
b) una variante biológica natural, como una variante alélica, del factor
PEDF,
c) un equivalente funcional del factor PEDF que contenga sustitución(es), adición(es), inserción(es) y/o deleción(es) únicas o múltiples en Ia secuencia de Ia proteína tipo salvaje y/o sustituciones de aminoácidos modificados químicamente que no afecten Ia función biológica autorenovadora de células madre,
d) un fragmento activo del factor PEDF en el que "fragmento activo" designa a un secuencia de PEDF que mantiene Ia función biológica de auto-renovación de células madre,
e) una proteína fusionada que comprende el factor PEDF fusionado a un péptido o a otra proteína,
f) Un derivado de PEDF,
g) Un análogo estructural de PEDF h) y/o un homólogo de PEDF.
Según otro aspecto importante Ia presente invención se refiere a una composición farmacéutica que contiene al menos una cantidad farmacéuticamente eficaz de !a secuencia total o parcial del factor PEDF y al menos un excipiente farmacéuticamente aceptable.
Según otro aspecto importante Ia presente invención se refiere a una composición farmacéutica que contiene al menos una cantidad farmacéuticamente eficaz de una variante bioiógica natural de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
Según otro aspecto importante Ia presente invención se refiere a una composición farmacéutica que contiene ai menos una cantidad farmacéuticamente eficaz de un equivalente funcional de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
Según otro aspecto importante Ia presente invención se refiere a una composición farmacéutica que contiene al menos una cantidad farmacéuticamente eficaz de un fragmento activo de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
Según otro aspecto importante Ia presente invención se refiere a una composición farmacéutica que contiene al menos una cantidad farmacéuticamente eficaz de una proteína fusionada de factor PEDF y ai menos un excipiente farmacéuticamente aceptable.
Según otro aspecto importante Ia presente invención se refiere a una composición farmacéutica que contiene al menos una cantidad farmacéuticamente eficaz de un derivado de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
Según otro aspecto importante Ia presente invención se refiere a una composición farmacéutica que contiene a! menos una cantidad farmacéuticamente eficaz de al menos un análogo estructura! de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
Según otro aspecto importante ía presente invención se refiere a una composición farmacéutica que contiene al menos una cantidad farmacéuticamente eficaz de al menos un homóiogo de factor PEDF y ai menos un excipiente farmacéuticamente aceptable.
Según otro aspecto importante Ia presente invención se refiere a una composición farmacéutica en ia que Ia cantidad de factor PEDP es de al menos 20 ng/ml.
En procesos de regeneración celular tras lesión {cardíaca, regeneración de Ia piel, neural, por ejemplo, tras accidente cerebrovascular o en enfermedades neurodegenerativas), en situaciones patológicas (hematopoyética, por ejemplo, tras transplante de médula ósea; neural, por ejemplo, en enfermedades neurodegenerativas) es necesario que se produzca un aporte de nuevas células que recuperen el tejido dañado. Esto puede suceder si es posible inducir Ia producción de progenie celular diferenciada a partir de células madre endógenas, propias de los tejidos adultos, mediante Ia aceleración del proceso de recambio celular homeostático por una adecuada activación de células madre endógenas. Esta activación adecuada debería promover que estas células endógenas fueran capaces de producir Ia progenie celular demandada sin agotar el complemento de células madre presentes en ese tejido, es decir, de promover Ia división auto-renovante de las células madre. Por otro lado, Ia terapia celular se fundamenta en Ia expansión ex vivo de poblaciones de células madre y su diferenciación dirigida hacia fenotipos celulares específicos que serán luego transplantados a fin de recuperar una deficiencia tisular concreta. La diferenciación dirigida requiere partir de poblaciones de células madre que hayan mantenido in vitro todo su potencial plástico, es decir, que se hayan dividido de forma auto-renovante de forma que Ia progenie celular de estas células madre mantenga Ia multipotencia característica de estas poblaciones.
Tai y como se cita en Ia presente invención, se entiende como secuencia parcial cualquier porción de la molécula consistente en un número de aminoácidos menor al de Ia secuencia completa y que incluye también péptidos pequeños conteniendo una secuencia de PEDF y producidos por síntesis química.
Tal y como se cita en Ia presente invención, se entiende como variante biológica natural todas aquellas moléculas de PEDF que procedan de distintas especies o que estén modificadas por mutaciones naturales, o bien aquellas que se producen en distintas especies en forma recombinante y que están modificadas de forma distinta. Tal y como se cita en Ia presente invención, se entiende como equivalente funciona! aquellas secuencias totales o parciales de PEDF que hayan sido modificadas mediante mutagénesis dirigida o a las que se hayan añadido grupos químicos que modifiquen su estabilidad, difusión o permeabilidad, así como su acción biológica.
Tal y como se cita en Ia presente invención, se entiende como fragmento activo cualquier secuencia peptídica, por corta que sea, que mantenga las funciones del factor PEDF.
Ta! y como se cita en Ia presente invención se entiende por proteína fusionada que comprende el factor PEDF fusionado a un péptido o a otra proteína, una molécula de PEDF que pueda contener de forma adicional en uno de sus extremos una serie de aminoácidos que codifican para una secuencia que sirve para purificar Ia molécula, trazar su trayectoria, o utilizarla para ensayos de interacción con otras moléculas
Tal y como se cita en Ia presente invención se entiende por análogo estructural de PEDF, una molécula de estructura similar pero no idéntica con actividad semejante.
Tal y como se cita en Ia presente invención se entiende por homólogo de PEDF, una molécula de secuencia similar pero no idéntica con actividad semejante.
DESCRIPCIÓN DE LAS FIGURAS
Fig. 1. En esta figura se muestra el esquema simple del poltpéptido PEDF humano (A) y una forma truncada que contiene el dominio anti-angiogénico pero no el neurotrófico y que comprende desde el aminoácido 195 al 400 (que denominamos C-ter PEDF) (B).
Fϊg. 2. Efecto del PEDF y el C-ter PEDF humanos producidos en Pichia pastoris sobre los cultivos de neuroesferas que forman las células madre neurales obtenidas de Ia zona subventricular del cerebro de ratón adulto. En el htstograma, el eje de las Y corresponde al número de neuroesferas formadas, A corresponde a Control, B corresponde a PEDF, C corresponde a C-ter PEDF. En el panel de las fotografías, 1 corresponde a óptica de contraste de fases y los valores numéricos indican el diámetro promedio de las neuroesferas (media ± error estándar), 2 corresponde a detección inmunocitoquímica del marcador de proliferación BdrU y los números indican el porcentaje de células que incorporan Ia BrdU relativo al total de células (media ± error estándar). A corresponde a Control, B corresponde a PEDF. EI asterisco indica el nivel de significación estadística de Ia diferencia en un análisis de Ia t de Student (*p < 0,05).
Fig. 3. Ensayo en el que clones/esferas que han sido crecidos con PEDF (forma truncada de PEDF, C-ter PEDF, es, de nuevo, el control sin efecto) son disociados y re-sembrados en ausencia de PEDF, en distintas combinaciones mitogénicas. En esta figura A está definido por el control (crecimiento habitual en EGF y FGF), B está definido por el ensayo con pretratamiento con PEDF y C está definido por ei ensayo con el tratamiento con C-ter PEDF. En e! histograma, 1 corresponde a EGF + FGF, 2 corresponde a EGF, 3 corresponde a FGF, Eje de las X corresponde a número de neuroesferas formadas. Los asteriscos indican el nivel de significación estadística de Ia diferencia en un análisis de Ia t de Student (* indica una p < 0,05; ** indica una p < 0,01).
Fig. 4. Muestra como el tratamiento con PEDF aumenta el número de células en las neuroesferas que expresan un antígeno de superficie (LeX) que co-segrega con Ia población más muitipotente de las células madre neurales. A está definido por el control, B está definido por el ensayo con tratamiento con PEDF y C está definido por el ensayo con el tratamiento con C-ter PEDF. Eje de las X corresponde al incremento en el número de células LeX-positivas, medido en un citómetro, relativo a Ia condición control A (= 1). Los asteriscos indican el nivel de significación estadística de Ia diferencia en un análisis de Ia t de Student ( ** p < 0,01).
Fig. 5. Se muestran los cambios en los niveles de marcadores de indiferenciación inducidos por PEDF, en determinaciones mediante RT-PCR. A corresponde a PEDF, (-) indica no tratado con PEDF y (+) indica tratado con PEDF, 1 corresponde a Hes1 , 2 corresponde a Hes5, 3 corresponde a Mash1/Asc!1 , 4 corresponde a beta-actina, 5 corresponde a SoX2, 6 corresponde a beta-actina.
Fig. 6. PEDF aumenta Ia expresión del regulador de ciclo celular p21 , determinada mediante análisis por western blot con anticuerpos específicos anti-p21. Este aumento en los niveles de p21 es necesario para el efecto de PEDF ya que en células obtenidas de Ia zona subventricular de ratones mutantes nulos para p21 e! PEDF no induce un aumento en el número de esferas. A corresponde a PEDF, (-) indica no tratado con PEDF y (+) indica tratado con PEDF, 1 corresponde a p21 , 2 corresponde a beta-actina. En el histograma, 1+/+ corresponde a neurosferas obtenidas a partir de ratones de genotipo salvaje y 1-/- a las obtenidas a partir de animales deficientes nulos para p21. El eje Y representa el incremento en el número de esferas inducido por PEDF relativo al crecimiento que se obtiene sólo con EGF y FGF y al que se Ie da un valor control de 1.
Fig, 7. El tratamiento con PEDF aumenta el número de células que expresan marcadores de indiferenciación (nestina) en los cultivos, sin afectar a su proliferación. En los paneles de fotografías se muestra Ia detección del antígeno nestina (citopiasmático) y BrdU (nuclear). En el histograma, el eje Y corresponde a los porcentajes de células marcadas para BrdU (barras de Ia izquierda) y nestina (barras de Ia derecha) sobre el número total de células en Ia placa de cultivo. 1 corresponde a control, 2 corresponde a PEDF. LOS asteriscos indican el nivel de significación estadística de Ia diferencia en un análisis de Ia t de Student tras transformación de los datos mediante el arcsen(valor relativo1'2) (** p < 0,01).
Fig. 8. El PEDF mejora ia capacidad neurogénica de los cultivos de neuroesferas. En el histograma 1 corresponde al control y 2 corresponde a PEDF. El eje Y muestra el porcentaje de céiulas que se han diferenciado a neuronas relativo al número total de céiuias presentes en Ia placa de cultivo. Los asteriscos indican ei nivel de significación estadística de Ia diferencia en un análisis de Ia t de Student ( *** p < 0,001). En los paneles de fotografías que muestran Ia inmunodetección del antígeno neuronal beta- Ill-tubulina, 1 corresponde al control y 2 corresponde a PEDF.
Fig. 9. La forma truncada conteniendo Ia mitad C-terminal del poíipéptido PEDF antagoniza Ia acción del PEDF completo en el ensayo de auto-renovación. En Ia gráfica, Ia línea punteada con el símbolo m representa Ia prueba control (A) y Ia parte de Ia gráfica punteada con el símbolo • representa el ensayo con 0,4 nM de PEDF y con concentraciones crecientes de C-ter PEDF (B) correspondientes (en nM) a los números representados en el eje X. El eje Y representa en número de esferas formado en cada condición. Fig. 10. Células COS transfectadas con una construcción conteniendo Ia secuencia que codifica para el PEDF humano expresan y secretan PEDF que es activo en un ensayo de auto-renovación en células madre neurales y el efecto es bloqueable por el fragmento C-ter. En el pane! de Ia izquierda A corresponde a Ia detección por RT-PCR dei mRNA de Pedf (Serpinfl), B corresponde a Io mismo para beta-actina, C corresponde a ia detección por western blot de PEDF en el medio de cultivo de las células COS-7, 1 corresponde a COS7+pcDNA (vector vacío), 2 corresponde a COS7+pcDNA-Pedf. En el histograma, 3 corresponde a co-cultívo con las células COS-7, 4 corresponde a las mismas condiciones que en 3 pero en presencia de C-ter PEDF que bloquea, F corresponde a COS7+pcDNA (vector vacío, controi), G corresponde a COS7+pcDNA-Pedf. El eje Y corresponde al aumento relativo en el número de neuroesferas con respecto al crecimiento obtenido en medio control.
Fig, 11. Células endoteliales y ependimarias expresan y secretan PEDF de forma natural mientras que otros tipos celulares pueden expresar el mRNA para PEDF pero no secretan cantidades detectables del factor. A corresponde al mRNA de Pedf, B corresponde a beta-actina, medidos por RT-PCR; C corresponde a Ia proteína PEDF, D corresponde a beta-tubulin, medidos mediante western blot en los lisados celulares; E corresponde a Ia proteína PEDF determinada por western blot en medio condicionado por los distintos tipos de células. F corresponde a WB, G corresponde a RT-PCR. Los tipos celulares ensayados incluyen a células endoteliales de origen venoso (HUVEC) (1), células endoteüales de origen arterial (HUAEC) (2), células de epéndimo de Ia zona subventricular (3), astrocitos (4) y neuronas granulares de cerebelo (5).
Fig. 12. Células endoteliales y ependimarias, que expresan y secretan PEDF de forma natural, inducen formación de esferas y este efecto inductor es bloqueado por 15 nM C-ter PEDF. En esta figura, A corresponde a co-cultivo con los distintos tipos de células, B corresponde a las mismas condiciones que en A pero en presencia de C-ter PEDF que bloquea el efecto del PEDF. Los tipos celulares ensayados incluyen a células endoteliales de origen venoso (HUVEC) (1), células endoteliales de origen arterial (HUAEC) (2), células de epéndimo de Ia zona subventricular (3), astrocitos (4) y neuronas granulares de cerebelo (5). Ef eje Y corresponde al aumento en ei número de neuroesferas formado relativo al número que se obtiene en condiciones normales con EGF y FGF. Se indica !a significación estadística del bioqueo con C-ter. Los asteriscos indican el nivel de significación estadística de Ia diferencia en un análisis de la t de Student tras transformación de los datos mediante el arcsen(va!or relativo172) (* indica una p < 0,05; ** indica una p < 0,01).
Fϊg. 13. Células HUVEC en las que se ha silenciado parcialmente Ia expresión de PEDF mediante un siRNA específico secretan menos PEDF al medio e inducen Ia formación de un número menor de neuroesferas que las HUVEC tratadas con un siRNA control. En el pane! izquierdo, A corresponde a Ia detección por western blot de PEDF en usados celulares, B corresponde a Io mismo para Ia beta-actin. 1 corresponde a células HUVEC transducidas con siRNA control, 2 corresponde a células HUVEC transducidas con siRNA específico para Pedf. EI eje Y del histograma corresponde al número de neuroesferas formadas. Los asteriscos indican el nivel de significación estadística de Ia diferencia en un análisis de Ia t de Student (* p < 0,05).
Fϊg. 14. El PEDF administrado intracerebralmente conduce a un mayor número de células madre neurales pero el bioqueo del PEDF endógeno no causa cambios. Los paneles fotográficos muestran inmunotinciones para retención de BrdU (núcleos marcados con mayor intensidad) sobre tinciones para núcleos con DAPI (marcados con menor intensidad) en cortes de ia zona subventricular. El inserto muestra que las células que retienen BrdU (mareaje nuclear) por largos periodos de tiempo son GFAP- positivas (mareaje de citoplasma y prolongaciones celulares), como corresponde a las células madre neurales de esta zona. 1 corresponde a salino, 2 corresponde a PEDF, 3 corresponde a C-ter PEDF, 4 corresponde a BrdUL/GFAP. En el histograma, el eje Y corresponde al aumento relativo en el número de células que retienen BrdU (A) en los cerebros infundidos con PEDF (2) o C-ter PEDF (3) con respecto a los infundidos con solución salina (vaior contra! = 1). Los asteriscos indican el nivel de significación estadística de Ia diferencia en un análisis de Ia t de Student tras transformación de los datos mediante el arcsen(valor relativo172) (* p < 0,05).
Fig. 15. El PEDF administrado a ratones a nivel de ia zona subventricular activa Ia división de las células madre neurales. Los paneles fotográficos muestran inmunotinciones para BrdU (tinción nuclear) incorporada a tiempos cortos sobre tinciones para GFAP (mareaje de citoplasma y prolongaciones celulares). 1 corresponde a salino, 2 corresponde a PEDF, 3 corresponde a C-ter PEDF. En el histograma, el eje Y corresponde al aumento relativo en el número de células que retienen BrcíU (A) en los cerebros infundidos con PEDF (2) o C-ter PEDF (3) con respecto a los infundldos con solución salina {valor control = 1). Los asteriscos indican el nivel de significación estadística de Ia diferencia en un análisis de Ia t de Student tras transformación de los datos mediante el arcsen(valor relativo1'2) (* p < 0,05).
Fig. 16. El PEDF administrado a ratones a nivel de Ia zona subventricular activa Ia neurogénesis endógena. Los paneles fotográficos (A) muestran inmunotinciones para BrdU {tinción nuclear) incorporada a tiempos cortos sobre tinciones para PSA-NCAM (mareaje de citoplasma y prolongaciones celulares). 1 corresponde a salino, 2 corresponde a PEDF1 3 corresponde a C-ter PEDF. En e! histograma, el eje Y corresponde al aumento relativo en e! número de células que retienen BrdU (B) o que se marcan con anticuerpos anti-PSA-NCAM (C) en los cerebros infundidos con PEDF (2) o C-ter PEDF (3) con respecto a los infundidos con solución salina (valor control ~ 1). Los asteriscos indican el nivel de significación estadística de ia diferencia en un análisis de Ia t de Student tras transformación de los datos mediante el arcsen(va!or relativo1'2) (* p < 0,05; ** p < 0,01).
Fig. 17. El PEDF administrado exógenamente a cerebros conduce a una mayor producción de neuroesferas a partir del tejido disociado de estos cerebros. Los paneles fotográficos muestran fotografías de contraste de fases de neuroesferas. 1 corresponde a salino, 2 corresponde a PEDF, 3 corresponde a C-ter PEDF. En el histograma de Ia izquierda, el eje Y corresponde al número de neuroesferas primarias formadas a partir de los cerebros infundidos con solución salina (1), PEDF (2) o C-ter PEDF (3). En el histograma de !a derecha, el eje Y corresponde ai número de neuroesferas secundarias formadas a partir de los cerebros infundidos con solución salina (1), PEDF (2) o C-ter PEDF (3). Los asteriscos indican el nivel de significación estadística de Ia diferencia en un análisis de Ia t de Student (* p < 0,05; ** p < 0,01 ; *** p < 0,001).
Fig. 18. Formas purificadas por cromatografía de PEDF completo y Ia mitad C-terminal del PEDF humano a partir de! medio obtenido de Pichia y separadas en gel de electroforesís SDS-PAGE teñido con azul Coomasie (A) e inmunodetectadas con anticuerpos anti-PEDF (B). 1 corresponde a PEDF (47 kDa) y 2 corresponde a C-ter PEDF (26 kDa). EJEMPLOS PE REALIZACIÓN:
Los siguientes ejemplos específicos que se proporcionan aquf sirven para ilustrar la naturaleza de Ia presente invención. Estos ejemplos se incluyen solamente con fines ilustrativos y no han de ser interpretados como limitaciones a Ia invención que aquí se reivindica.
Ejemplo 1: Ensayo de auto-renovación en células madre neurales en cultivo.
Las formas de PEDF que se han utilizado para las realizaciones son las que se muestran en Ia Figura 1. En esta figura se muestra el esquema del polipéptido pgpp humano y una forma truncada que contiene el dominio anti-angiogénico pero no el neurotrófico y que comprende desde el aminoácido 195 al 400 (que denominamos C- ter PEDF). El PEDF completo (aquí denominado PEDF) modula Ia auto-renovación de células madre pero el fragmento C-ter PEDF no Io hace por io que se ha utilizado como control negativo en los experimentos. También, y como se verá más adelante, el C-ter PEDF se ha utilizado como competidor dei PEDF completo.
Hemos demostrado mediante este ensayo de realización que Ia proteína PEDF promueve Ia auto-renovación de células madre neurales de la zona subventricuiar del cerebro de ratones adultos in vitro. Cuando se administra PEDF a cultivos de neuroesferas, que son los agregados clónales en forma de esfera formados por Ia progenie de cada célula madre neural, éste factor aumenta el número de células capaces de formar nuevas esferas/clones cuando se resiembran las células tratadas a una densidad de 2,5 células/microlitro (ensayo de auto-renovación) (ver Figura 2). En
Ia Figura 2 se muestra como Ia administración de PEDF a un cultivo de células madre neurales de Ia zona subventricuiar conlleva Ia formación de más clones (neuroesferas) en presencia solamente de medio de crecimiento habitual para estas células (medio completo). Sin embargo, la adición de PEDF no aumenta el tamaño de cada clon (ver diámetros medios de las esferas), ni la incorporación del marcador de proliferación bromo-desoxiuridina (BrdU) (ver porcentajes de incorporación), indicando por tanto que no es un mitógeno. Para realizar los cultivos de células miadre neuraies adultas (NSC) se sacrificaron por dislocación cervical animales de 2 a 4 meses de edad, se extrajeron los cerebros y se
, pusieron en PBS estéril y frío. Se realizaron los cortes coronales necesarios para Ia disección de Ia zona subventricular (SVZ) excluyendo restos de estriado y plexos coroideos. Las piezas de tejido diseccionadas se incubaron en Ia solución enzimática durante 30 minutos a 37 0C y se disgregaron cuidadosamente con una pipeta de vidrio pulida. Una vez conseguida una suspensión celular homogénea se sembraron en medio completo (medio de cultivo definido con 20 ng/mL EGF y 20 ng/mL FGFb)
\Medio control: DMEM/F12 suplementado con 0,6% de glucosa, 0,1% de NaHCO3, 5 rnM de HEPES, 2 mM de L-gíutamina (Invitrogen), 50 unidades/ml de penicilina/estreptomicina (Invitrogen), 0,08 mg/ml de apo-t-transferrina (Sigma), 0,02 mg/ml de insulina (Sigma), 9 μg/ml de utrescina (Sigma), 16 nM de progesterona (Sigma) y 24 nM de Na2SeO3 (SigmaJ. Medio completo: medio control suplementado con 4 mg/ml de BSA (albúmina de suero bovino, Sigma), 0,7 unidades/ml de heparina (Sigma), 20 ng/ml de EGF (factor de αrecimiento epidérmico; Invitrogen), y 10 ng/ml de FGF2 (factor de crecimiento fibroblástico, Sigma)] y se crecieron a 37 0C en una atmósfera de CO2 del 5%, hasta que el tamaño de las neuroesferas fue adecuado, aproximadamente tras 6 días in vitro (DIV), momento en el cual se las disocia y resiembra (pase) como células individuales en el mismo medio completo para iniciar el crecimiento de nuevos clones/neuroesferas. Los cultivos realizados de esta forma pueden expandirse realizando sucesivos pases durante un tiempo prácticamente ilimitado. Para el análisis del ensayo de auto-renovación las células procedentes de neuroesfera se pasan y la siembra se realiza a una densidad de 2,5 céiulas/microlitro. En algunos de estos cultivos a baja densidad (dilución límite) se añadió PEDF o C-ter PEDF a una concentración de 20 ng/ml. Tras 4-6 DIV se determina el número de esferas formadas en cada condición y se miden los diámetros de las esferas. Para los ensayos de incorporación de bromo-desoxi-uridina (BrdU), las esferas formadas tras 48 hr se trataron 5 min con Brdu (2 μM), se engancharon sobre cubreobjetos tratados con poly-D-lisine (10 μg/ml; Sigma) y se fijaron con paraformaldehido (PFA) al 4% durante 20 min. Tras varios lavados en PB 0.1 M, se procedió a Ia detección immunocitoquímica de Ia BrdU incorporada mediante anticuerpos específicos. Las esferas tratadas con PEDF contienen un mayor número de células capaces de dar lugar a más neuroesferas/clones a baja densidad, una propiedad asociada con las céíuías madre neurales con más potencial (Figura 3). Como se observa en Ia Figura 3 se muestra un ensayo por el cual clones/esferas que han sido tratados con PEDF (forma truncada de PEDF,C-ter PEDF, es, de nuevo, e! control sin efecto) cuando son disociados y re-sembrados en ausencia de PEDF, en distintas combinaciones mitogénicas. La formación de un mayor número de nuevos clones (capacidad formadora de esferas incrementada) indica que el tratamiento con PEDF indujo Ia división auto-renovante de las células madre cuando estaba presente. Esto indica que el PEDF en Ia esfera promueve Ia generación de nuevas células formadoras de clones mediante división auto-renovante.
Para determinar que el aumento en Ia capacidad formadora de nuevas esferas (esferas secundarias) se relaciona con Ia presencia de más células madre multipotenciales en los cultivos con PEDF también se ha determinado que en dichos cultivos existen más células que expresan un antígeno de superficie (LeX) que ha sido asociado a Ia fracción más multipotente de las células madre neurales (ver Figura 4). En esta Figura 4 se muestra como el tratamiento con PEDF aumenta el número de células en ias neuroesferas que expresan un antígeno de superficie (LeX) que co- segrega con Ia población más multipotente de las céiuias madre neurales. Para realizar esta determinación se recogieron por centrifugación las neuroesferas tras 6 DlV, y se disgregaron mecánicamente hasta tener una suspensión celuiar homogénea. A continuación se resuspendieron en medio control (sin mitógenos) conteniendo una dilución 1:20 de anticuerpo monoclonal anti-LeX/SSEA-1 procedente del Developmentai Studies Hybridoma Bank (University of lowa, USA) durante 15 min a 37 0C. Postreiormente, las células fueron fijadas con 4% PFA durante 10 min a 4 0C, lavadas, e incubadas con anti-lgM de ratón biotiniiadas (1 :200) seguido de estreptoavidina marcada con Cy3 (1:1000; Jackson Laboratories). Se analizaron por citometría al menos 20.000 células por cultivo y se determinó el porcentaje de céiuias inmunopositivas para LeX. Los análisis se hicieron con un analizador BECKMAN COULTER EPICS dotado con un láser de argón a 488nm como fuente de luz. Ejemplo 2: Ensayo de inducción_de Ia multipotencia a nivel molecular en células madre neurales en cultivo
El aumento del número de células formadoras de nuevos clones promovido por PEDF va acompañado de cambios moleculares en los niveles de factores que han sido asociados en las células madre neurales, así como en otras poblaciones celulares, a un estado más indiferenciado, propiedad necesaria para e! mantenimiento de Ia multipotencia. Algunas de estas moléculas se han visto afectadas por el tratamiento con PEDF. Así, por ejemplo, el tratamiento con PEDF induce Ia expresión de moléculas efectoras de Ia vía de Notch, que cuando se encuentran aumentadas inhiben a factores que promueven Ia diferenciación celular, en este caso Ia diferenciación hacia neuronas. Estos efectores de Ia vía de Notch que encontramos aumentados en los cultivos tratados con PEDF son Hes1 y Hesδ. De Ia misma manera, se encuentra aumentado un factor cuya expresión va asociada a los estados más indiferencíados de ios progenitores neurales. Esto se muestra en la figura 5. En Ia Figura 5 se muestran los cambios en los niveles de marcadores de indiferenciación inducidos por PEDF. Para estos experimentos se extrajeron los RNA totales mediante el Kit de extracción Rneasy Mini Kit (Qiagen) siguiendo las recomendaciones del fabricante. Se recolectaron aproximadamente 1x106 de células crecidas en medio completo con o sin PEDF y los RNA totales se guardaron a -80 0C hasta su uso. Los análisis por RT-PCR que se realizaron para evaluar Ia expresión de distintos genes se iniciaron a partir de 1 μg de RNA que fue retrotranscrito en DNA complementario (cDNA) usando hexanucfeótidos al azar (3 μg/μL, Invitrogen Life Technologies, USA) y 200 U de Ia transcriptasa reversa SuperScript IE RT (Invitrogen Life Technologies), en un volumen de reacción de 40 μL y en presencia de tampón first strand (50 mM Tris-HCI, 75 mM KCI, 3 mM Mg2CI), 5 mM DTT y 0.25 mM de cada dNTPs (Amersham Pharmacia). Las reacciones de PCR se realizaron en un termociclador Eppendorf. Se usó como molde 1 μl de cDNA en un volumen de reacción de 20 μl conteniendo 4mM Tris-HCí, 20 mM KCI, 20 μM EDTA, 200 μM DTT, 0.25 mM dNTPs (Amersham Pharmacia), 0.25 μM de los cebadores (Sigma-Genosys) y 1 U de ADN Taq poümerasa (Eppendorf, Hamburg, Alemania). Después de una desnaturalización inicial a 940C durante 2 min, se efectuaron los ciclos de amplificación correspondientes a cada pareja de cebadores y una extensión final de 10 min a 72 0C. El tamaño de cada producto de amplificación se resolvió mediante electroforesis en un ge! de agarosa al 2% (p/v) preparado en tampón TBE (89 mM Tris, pH 8.0, 89 mM ácido bórico, 2mM EDTA) con 10μg/ml de bromuro de etidio. Como tampón de carga 6x, se utilizó 50% de gücerol, 0,05% azul de bromofenol, 0.05% cianol de xiieno, 100 mM EDTA. La cuantificación se realizó por densitometría comparando Ia intensidad de cada banda con Ia del producto de Ia ampiificación del gen de Ia beta- actina. Los cebadores utifizados fueron: [mHesi {CGGTCTACACCAGCAACAGT;CACATGGAGTCCGAAGTGAG),mHes5(GCAGCATA GAGCAGCTGAAG;GAAGGCTTTGCTGTGTTCA),mSox2(ATGCACAACTCGGAGATC AG;TATAATCCGGGTGCTCCTTC), mβ-actin (CCGGGACCTGACAGACTACCT; GCCATCTCCTGCTCGAAGTCTA). Tal y como se muestra en Ia figura 5, dado que en las células tratadas con PEDF aumenta Ia expresión del factor de transcripción Sox2, relacionado con indiferenciación, Ia invención proporciona también un método de ensayo en el que medir auto-renovación de células madre neurales con Ia adición exógena de PEDF y en el que ensayar inhibidores de este proceso.
La auto-renovación en células madre está asociada a moléculas que regulan e! ciclo celular también. En particular Ia expresión de Ia molécula p21waf1, perteneciente a la familia Cip/kip de inhibidores de quinasas dependiente de ciclinas, es necesaria para Ia persistencia a largo plazo de las células madre somáticas y para su auto-renovación ilimitada. En Ia figura 6 se muestra como PEDF aumenta Ia expresión de p21 , determinada mediante análisis por western blot con anticuerpos específicos anti-p21. Este aumento en los niveles de p21 es necesario para el efecto de PEDF ya que en células obtenidas de Ia zona subventricular de ratones mutantes nulos para p21 , el PEDF no tiene efecto en el número de neuroesferas, como se muestra en Ia figura 6. Los ratones mutantes nulos para Ia proteína p21 procedieron del laboratorio de Philip Leder (Department of Genetics, Harvard Medica! School, Boston, Massachusetts) y se generaron en una cepa con fondo genético mixto C57BL6/129 y los de fenotipo salvaje se obtuvieron de ios laboratorios Jackson (Bar Harbor, ME). La colonia muíante se mantuvo en homocigosis. El genotipo de los animales se determinó mediante el análisis por PCR del DNA genómico extraído de una fragmento de co!a. Los tejidos se digirieron en tampón de Iisis (10OmM Tris, pH 8.0, 20OmM NaCI, 2% SDS, 5mM EDTA, 200 μg/ml proteinasa K) durante 12 hr a 550C. Tras la digestión se centrifugaron los usados celulares a 14.000 rpm, 10 minutos, y los sobrenadantes se transfirieron a eppendorfs limpios. A continuación se añadieron 200 μl de cloroformo (Sigma) y 0,2 volúmenes de acetato potásico (Panreac) 8 M, se agitaron y se incubaron a -800C durante 1 hora. Transcurrido ese tiempo se dejó descongelar a temperatura ambiente y se centrifugó a 14.000 rpm durante 15 min, para facilitar Ia separación entre las fases acuosa y orgánica. Se transfirieron 200 μl de Ia fase acuosa a un eppendorf limpio y se precipitó el DNA genómico con 1 mi de eíanol absoluto (EtOH 100°). A continuación se centrifugaron las muestras a 14.000 rpm durante 10 min, y los precipitados de ADN generados se lavaron con etanol al 70% (EtOH 70°), se dejaron secar y se resuspendieron en 100 μl de H2OmQ durante toda Ia noche a 40C. Los cebadores utilizados para las amplificaciones fueron: p21+116F
(AAGCCTTGATTCTGATGTGGGC), p21-135(TGACGAAGTCAAAGTTCCACCG) y p21-Neo19+(GCTATCAGGACATAGCGTTGGC) este último correspondiente a Ia secuencisa neo. Las condiciones de amplificación fueron las siguientes: desnaturalización a 940C durante 50 sec, annealing at 550C for 30 sec y extensión a 720C 2 min. Después de una reacción de 40 ciclos el alelo salvaje corrió mediante eíectroforesis a 0,7 Kilobase y el alelo mutante a 0,5 kilobases.
Ejemplo 3: Ensayo de inducción de Ia ¡ndiferenciación en células madre neurales
Que el PEDF promueve indiferenciación se comprueba en el hecho de que cuando células madre neurales previamente tratadas con PEDF se ponen a diferenciar sembrándolas en un sustrato adhesivo en ausencia de mitógenos muestran un fenotipo más indiferenciado, en ef caso de ias células madre neurales aumenta el número de células que expresan el marcador de indiferenciación nestina durante más tiempo (Figura 7), En Ia Figura 7 se muestra como el tratamiento con PEDF aumenta el número de células que expresan marcadores de indiferenciación (nestina) en los cultivos sin afectar a su proliferación. Para Ia inducción de Ia diferenciación pobiacional se recogieron células crecidas durante 5 DIV en presencia o ausencia de PEDF en el medio de crecimeinto completo por centrifugación y se lavaron varias veces en medio control, para eliminar las trazas de mitógenos y de PEDF. A continuación se realizó Ia siembra en placas pretratadas durante 2 horas con matrigel (15 mg/mL solución stock diluida 1:100 en medio control; Becton Dickínson, Bedford, MA), a una densidad de 1x104 células/mL, en un medio de diferenciación que contenía medio controi, suplementado con FGF (20ng/mL), factor de crecimiento que favorecía Ia supervivencia celular en los pasos iniciales de Ia diferenciación. A los 2 DiV las células se trataron 5 min con Brdu (2 μM) y se fijaron con paraformaldehido (PFA) al 4% durante 20 min. Tras varios lavados en PB 0.1 M, se procedió a ia detección immunocitoquímica de Ia BrdU incorporada y del marcador de progenitores neurales nestiπa mediante anticuerpos específicos. Para ello, se procedió al bloqueo de uniones inespecíficas con un tampón bloqueo que contenía 10% suero de cabra (invitrogen), 10% (p/v) glicina, y 0,25% (v/v) Tritón X-100 como detergente no iónico para Ia permeabilización de las células. Las células se incubaron toda Ia noche a 4 0C con un anticuerpo monoclonal anti-nestina del DSHB (University of ¡owa, USA) y un anticuerpo policlonai anti-BrdU (Dakko) diluidos en el mismo tampón de bloqueo. Posteriormente las células se lavaron 3 veces con PB 0.1 M y se incubaron con los anticuerpos secundarios fluorescentes: Alexa 350 cabra anti-conejo (1 :200), Cy3 cabra anti-ratón(1 :2000) seguido de una contratinción nuclear con bisbencimida.
Ejemplo 4: Ensayo de inducción de neuroαénesis en células madre neurales en cultivo
Aun así, el tratamiento con PEDF durante Ia fase de expansión no impide Ia diferenciación terminal de estas células a neuronas. De hecho, como se muestra en Ia Figura 8 se potencia Ia neurogénesis en los cultivos tratados con PEDF. En la Figura 8 se muestra como eí aumento de marcadores de indiferenciación no impide Ia diferenciación terminal de los cultivos, pasado el tiempo habitual al que se culmina Ia diferenciación final del cultivo. Más aun, se observa como el tratamiento previo con PEDF mejora Ia capacidad neurogénica, favoreciendo la diferenciación de un número mayor de neuronas (Tuj1 -positivas). A los 2 DIV después de sembrar las NSCs en sustrato adherente como se comenta en el párrafo anterior se sustituyó e! medio por medio control suplementado con 2% suero bovino fetal (Invitrogen) durante 5 DiV más, Io que favorece Ia maduración de las neuronas y de Ia glía. A los 7 DIV las células se fijaron con PFA al 4% en PB 0.1 M, durante 20 min a temperatura ambiente y se examinaron por immunocitoquímica para Ia detcción de marcadores específicos de neuronas y células gliaíes, determinándose las proporciones de cada fenotipo. La diferenciación neuronal y glial se definió por un mareaje immunocitoquímico triple usando un anticuerpo primario anti-Tuj1 (neuronas), anti-GFAP (astrocitos) y anti-MBP (oligodendrocitos). Tras Ia fijación de las células se realizaron varios lavados en PB 0.1 M y se procedió al bloqueo de uniones inespecíficas con un tampón bloqueo que contenía 10% suero de cabra (Invitrogen), 10% (p/v) glicina, y 0,25% (v/v) Tritón X-100 como detergente no iónico para Ia permeabilización de las células. Las células se incubaron toda Ia noche a 40C con los siguientes anticuerpos primarios diluidos en el mismo tampón de bloqueo: anti-βill-Tubulina (Tuj1) monoclonal de ratón (IgG) (1:300; Covance); anti-proteina fibrilar acídica giiai (GFAP) policlonai de conejo (IgG) (1:300; Dako); anti-proteína básica de la mieüna (MBP) monoclonal de rata (IgG) (1 :300, Chemicon). Posteriormente las células se lavaron 3 veces con PB 0.1 M y se incubaron con los siguientes anticuerpos secundarios fluorescentes: Alexa 350 cabra anti-conejo (1:200), Cy3 cabra anthratón( 1:2000), Biotinilado goat anti-rata (1:300), Cy2 conjugado con estreptoavidina (1 :200) seguido de una tinción nuclear con bisbencimida (DAPI). Las diferenciaciones poblacionales se utilizaron para determinar Ia capacidad neurogénica de los diferentes cultivos, para Io cual se montaron los cubres de vidrio sobre un portaobjetos con líquido de montaje permanente protector de fluorescencia (Fluorsave, Calbiochem, La JoIIa, CA) y se determinó el número de neuronas, astrocitos y oligodendrocitos contando ei número de neuronas y astrocitos, o de oligodendrocitos con respecto al total de núcleos teñidos con DAPI en al menos 25 campos aleatorios. La fluorescencia fue visualizada con un microscopio invertido Nikon diaphon, o vertical (E400) y se capturaron imágenes con una cámara digital Nikon.
Ejemplo δ: Ensayo de competición del efecto del PEDF en Ia auto-renovación de células madre neurates en cultivo con el fragmento C-ter PEDF
La forma truncada conteniendo Ia mitad C-terminal del polipéptido PEDF antagoniza Ia acción del PEDF completo en el ensayo de auto-renovación de células madre constituyéndose en una herramienta útil para determinar Ia especificidad de Ia acción de Ia forma completa (Figura 9). Por tanto, Ia presente invención también proporciona un método para analizar la especificidad de los efectos de ia molécula PEDF sobre e! proceso de auto-renovación. Para la realización de el ensayo que se muestra en la figura 9 se sembraron NSCs disociadas en medio completo con 20 ng/ml PEDF (equivalente a una concentración 0.4 nM) y en presencia de concentraciones crecientes del fragmento C-ter PEDF. Al cabo de 4 DIV, el número de neuroesferas formado en cada condición fue determinado. Como se muestra en Ia figura concentraciones crecientes de C-ter PEDF antagonizan ei efecto del PEDF proporcionando un ensayo de especificidad. El receptor del PEDF es todavía desconocido pero se ha descrito Ia interacción del PEDF con una molécula de membrana de unos 80 kDa. (Alberdi, E., Aymerich, M, S., Becerra, S. P. (1999) Binding of pigment epithelium-derived factor (PEDF) to retinoblastoma cells and cerebellar granule neurons. Evidence for a PEDF receptor. J. Biol. Chem. 274, 31605-31612). Este tipo de ensayo sugiere que las formas completa y truncada podrían estar compitiendo a nivel de su unión al receptor de membrana.
Para determinar si la forma truncada era capaz de antagonlzar el efecto de un PEDF producido por células de mamífero se realizó un ensayo en el que se transfectaron células COS, que no poseen niveles significativos de PEDF, con un cDNA que codifica para PEDF humano. Para ello, se obtuvo el cDNA del Pedf (el nombre de! gen en Ia nomenclatura HUGO es Serpinfi) humano mediante RT-PCR y fue clonado en el vector pcDNA3.1 (Invitrogen). Las células fueron co-transfectadas con dicho plásmido y uno conteniendo una construcción para GFP como marcador de transfección, mediante Lipofectamine, en DMEM. Tras 8 hr ías células fueron transferidas a DMEM con FBS al 10% durante 12 horas. La expresión y secreción de Pedf en las células transfectadas con vector vacío o con pcDNA-hPedf se analizó, respectivamente, mediante RT-PCR y por inmunobiot de medio condicionado como se explica en los párrafos siguientes. Las células trasfectadas fueron cambiadas a medio completo de NSCs, se colocó se colocó un inserto (transwell de Millipore de 12 mm y 0.4 μm diámetro de poro) 2 horas más tarde y en él se sembraron células madre neurales disociadas a baja densidad. Estos cultivos se realizaron en presencia o ausencia de C- ter PEDF a una concentración de 15 nM. A los 4 DlV se contó el número de neuroesferas formadas en cada cultivo. En el caso de los co~cultivos de NSCs con células COS transfectadas con Pedf, se observó un aumento en el número de neuroesferas que era antagonizado por el fragmento C-ter, tai como se observa en la figura 10. En Ia figura 10 se muestra como células COS transfectadas con una construcción conteniendo Ia secuencia que codifica para el PEDF humano expresan y secretan PEDF, Este PEDF es activo en un ensayo de auto-renovación en células madre neurales y el efecto es bloqueable por el fragmento C-ter.
La forma truncada C-ter PEDF permite, por tanto, identificar la participación del PEDF a partir de un sistema celular que Io exprese mediante su antagonismo específico con Ia forma truncada, como se muestra en el experimento siguiente en el cual se antagoniza con C-ter PEDF el efecto sobre auto-renovación que tienen tipos celulares que, de forma natural, producen y secretan PEDF. Así, por ejemplo, en Ia figura 11 se muestran tipos celulares que expresan PEDF y, de entre ellos, aquellos que secretan cantidades detectables de proteína PEDF. Estos tipos celulares son productores naturales del factor, como ias células endoteliales o las células ependimarias. Para estos experimentos se analizaron distintos tipos de células:
células endoteliales primarias de tipo arterial procedentes de cordón umbilical humano (células HUAEC): obtenidas de AdvanceCell y mantenidas con los medios que sugiere el distribuidor. céluias endoteliales primarias de tipo venoso procedentes de cordón umbilical humano (células HUVEC): obtenidas de AdvanceCell y mantenidas con los medios que sugiere el distribuidor, - células ependimarias obtenidas mediante extracción de Ia capa ependimaria de los ventrículos laterales de cerebros de ratones adultos y mantenidas en medio completo de neuroesferas. células astrocitarías obtenidas mediante Ia diferenciación de células madre neurales en ensayos de diferenciación o mediante cultivos de astrocitos a partir de cerebros de ratones neonatales neuronas granulares aisladas a partir de cerebelos de ratones de siete días postnatales y sembradas sobre polϊ-D-iisina en DM EM-F 12, 10% FBS y 25 mM de cloruro potásico.
Estos tipos celulares fueron cultivados o en sus medios correspondientes o en medio completo de neuroesferas. Para analizar Ia expresión a nivel de RNAm se extrajeron los RNA totales mediante el Kit de extracción Rneasy Mini Kit (Qiagen) siguiendo las recomendaciones del fabricante. A partir de 1 μg de RNA se realizó una retro- transcripción usando hexanucleótidos al azar (3 μg/μl, Invitrogen Life Technologies, USA) y 200 U de Ia transcriptasa reversa SuperScript Il RT (Invitrogen Life Technologies), en un volumen de reacción de 40 μL y en presencia de tampón first strand (50 mM Tris-HCÍ, 75 mM KCI1 3 mM Mg2CI)1 5 mM DTT y 0.25 mM de cada dNTPs (Amersham Pharmacia). Las reacciones de PCR se realizaron en un termociclador Eppendorf. Se usó como molde 1 μl de cDNA en un volumen de reacción de 20 μl conteniendo 4mM Tris-HCI, 20 mM KCI, 20 μM EDTA, 200 μM DTT, 0.25 mM dNTPs (Amersham Pharmacia), 0.25 μM de los cebadores (Sigma-Genosys) y 1 U de ADN Taq polimerasa (Eppendorf). Después de una desnaturalización inicial a 940C durante 2 min, se efectuaron los ciclos de amplificación correspondientes a cada pareja de cebadores y una extensión final de 10 min a 72 0C. EI tamaño de cada producto de amplificación se resolvió mediante electroforesis en un gei de agarosa al 2% (p/v) preparado en tampón TBE (89 mM Tris, pH 8.0, 89 mM ácido bórico, 2mM EDTA) con 10μg/ml de bromuro de etidio. Como tampón de carga 6x, se utilizó 50% de gliceroí, 0.05% azul de bromofeno!, 0.05% cianol de xileno, 100 mM EDTA. La cuantificación se realizó por densitometría comparando Ia intensidad de cada banda con Ia del producto de Ia amplificación del gen de !a beta-actina. Los cebadores utilizados fueron: hPEDF (forward: CTGAAGCTGAGTTATGAAGGCG; reverse:
GGTTAAGGTGATAGTCCAGCGC), hβ-actin (GCATGGAGTCCTGTGGCATCCACG; GGGTGTAACGCAACTAAGTCATAG), mPEDF
(GAGCTACATCTTCTTCCTGCC;CCAGTAATCπGCTGAAGTCGG)(mβ-actin (CCGGGACCTGACAGACTACCTiGCCATCTCCTGCTCGAAGTCTA). Para las determinaciones proteicas se recogieron o bien las células o bien el medio condicionado por ellas. Las células se homogeneizaron en tampón de lisis RIPA (20 mM Tampón fosfato sódico, 150 mM NaCI, 5 mM EDTA, 1% Tritón X-100) suplementado con inhibidores de fosfatasas y proteasas {1 mM ortovanadato sódico, 1 mM fluoruro sódico, 1 mM PMSF, 10 μg/ml aprotinina y 10 μg/ml leupeptina). La concentración de Ia proteína extraída se determinó por el método de Bradford modificado (DC Protein assay; Bio-Rad) usando Ia aibúmina bovina del suero (BSA) como estándar. La misma cantidad de proteína (50-100 μg) fue resuspendida en un tampón disolvente de muestras (625 mM Tris-HCI, pH 6.8, 10 %(v/v) gliceroí, 2% (p/v) SDS, 4% (v/v) β-mercaptoetanol, 0.025% (p/v) azui de bromofenol), desnaturalizada por ebullición durante 5 minutos y resuelta mediante eíectroforesis de SDS-PAGE en geles de 10-13%. Los geles se electrotransfirieron (100 V, 1 hora) a una membrana de nitrocelulosa (Hybond-ECL, Amersham Biosciences), utilizando tampón de transferencia (25mM Tris, pH 8.3, 20% (v/v) metanol, 192 mM glicina) en un sistema Mini Trans-blot (Bio-Rad). Las membranas fueron bloqueadas en leche desnatada en polvo al 5% (p/v) en tris borato salino-Tween-20 (Sigma) al 0.1%(v/v) (TBS-T) (0.1 M Tris-HCI pH 7.5, 0.9% (p/v) NaCI) durante 1 hora a temperatura ambiente y en agitación. Posteriormente se incubaron las membranas con Io anticuerpos primarios anti-PEDF (Chemicon, 1:1000) y anti-beta-actina (Sigma; 1 :5000) en JBS-T, durante toda Ia noche a 4 0C y en agitación. Finalmente, las membranas se lavaron tres veces en TBS-T, se incubaron durante 1 hora a temperatura ambiente con los anticuerpos secundarios adecuados unidos a peroxidasa y se revelaron mediante quimioluminiscencia (Roche Lumi-light ECL kit), exponiendo las membranas en papel fotográfico (Konica) hasta Ia detección óptima de Ia señal. Las intensidades de las bandas individuales se cuantificaron mediante un densitómetro de imágenes (Scion Image). Los niveles de expresión de Ia proteína analizada en nuestros estudios se normalizaron con respecto a Ia β-actina de estas mismas muestras.
El fragmento C-ter es capaz de competir el efecto inductor de las células endoteliales y ependimarias en el ensayo de auto-renovación de células madre neurales, como se muestra en Ia figura 12, Este bloqueo está de acuerdo con Ia observación de que estos tipos de células secretan pEDF y demuestra que el PEDF producido de forma natura! por ciertos tipos de células puede ser antagonizado por el fragmento C-ter en el proceso de auto-renovación. Esto se muestra en Ia figura 12. En Ia figura 12 se muestra cómo células endoteliales y ependimarias, que expresan y secretan PEDF de forma natural (ver figura 11), inducen formación de esferas y que este efecto inductor es bloqueado por 15 nM C-ter PEDF. Para ía realización de estos experimentos, se sembraron los distintos tipos de células en placas de 24 pocilios en medio completo de NSCs, se colocó un inserto (transwell de Miiüpore de 12 mm y 0.4 μm diámetro de poro) 2 hr más tarde y en él se sembraron células madre neurales disociadas a baja densidad. Estos cultivos se realizaron en presencia o ausencia de C-ter PEDF a una concentración de 15 nM. A los 4 DIV se contó el número de neuroesferas formadas en cada cultivo. En el caso de los co-culttvos de NSCs con células endoteüales y ependimarias, se observó un aumento en el número de neuroesferas que era antagonizado por el fragmento C-ter. En el caso de los astrocitos, habia un efecto inductor en la formación de esferas no mediado por PEDF ya que no era antagonizado por el fragmento (de acuerdo con Ia falta de secreción de PEDF) y en el caso de las neuronas no había ningún efecto. Todo esto indica que fuentes celulares naturales de PEDF pueden activar Ia auto-renovación y que el fragmento C-ter puede ser utilizado para demostrar Ia especificidad del efecto.
Para demostrar de forma paralela que las células endoteliales favorecían Ia auto- renovación de células madre neurales porque producen PEDF, silenciamos Ia expresión de PEDF endógena en estas células mediante técnicas de RNA interferentes, observando que el efecto inductor de las células HUVEC sobre Ia formación de esferas se veía reducido cuando Ia expresión y secreción del PEDF endógeno disminuía. Esto se muestra en Ia figura 13. En Ia figura 13 por tanto se muestra como células HUVEC en las que se ha silenciado parciaimente Ia expresión de PEDF mediante un siRNA específico secretan menos PEDF al medio e inducen Ia formación de un número menor de neuroesferas que las HUVEC tratadas con un siRNA control. Para realizar este experimento, obtuvimos de PROLIGO 21 -bp siRNAs específicos (siPedf S'-CGAGUUCAUUCAUGACAUAGA-S'. sicontrol (luciferasa) 5'- AACGUACGCGGAAUACAACGA-3') que fueron introducidos en las células mediante dos rondas de transfección con Lipofectamine (Invitrogen). La determinación de los niveles de PEDF en el medio de cultivo se realizó mediante inmunoblot y ía determinación del número de esferas se hizo mediante co-cultivo, tal como se ha contado anteriormente.
Ejemplo 6: Ensayo de auto-renovación de células madre, neurales el nicho neurogénico de Ia zona subventricular mediante administración intracerβbral del PEDF
El PEDF también activa Ia división auto-renovante de células madre neurales presentes en los nichos neurogénicos endógenos aumentando su número y su capacidad de dar lugar a progenie pero manteniendo su estado de célula madre (auto- renovación), como se demuestra cuando se administra PEDF intracerebralmente mediante bombas mini-osmóticas en cerebros de ratón (Figuras 14 y 15). En Ia figura 14 se muestra que cuando el factor PEDF es administrado intracerebralmente conduce a un mayor número de células madre neuraies (que retienen BrdU largos periodos, una indicación de su relativa quiescencia, y que son positivas para el marcador GFAP). El bloqueo del PEDF endógeno que se produce en el nicho neurogénico de ía zona subventricular en condiciones normales no causa cambios, Io que sugiere que el PEDF no actúa como factor de supervivencia para estas células.
La Figura 15 muestra que el efecto del PEDF administrado a ratones a nivel de Ia zona subventricuiar es activar Ia división de las células madre neurales, como se observa en el hecho de que incorporan más BrdU, indicación de que están proliferando en presencia de PEDF exógeno. Para Ia realización de estos experimentos se implantaron mini-bombas osmóticas Alzet (modelo 1007D) acopladas a cánulas de 28 μm de diámetro que se insertaron intracerebralmente en ratones adultas con coordenadas estereotáxicas: 0.0 anteroposterior a Bregma, 0.7 mediolateral y 1.7 dorsoventral y fueron fijadas al cráneo con Histoacryl (B/Braun). Se infundió solución salina (vehículo), PEDF (20 ng/ml) o C-ter pEDF (100 ng/ml) durante 7 días a una tasa de flujo de 0.5 μl/h. Para analizar las distintas poblaciones de células con capacidad proliferativa en Ia zona subventricuiar, incluyendo las células madre, se utilizó la técnica de incorporación de BrdU. La Brdu es un análogo estructural del nucleótido timidina, y se incorpora al ADN de las células que se encuentran en fase S en el momento del pulso. Posteriormente podemos detectar las células que han quedado marcadas mediante el uso de un anticuerpo específico en cortes histológicos. Para los mareajes con Brdu de las células proliferantes en el cerebro adulto, los ratones se sometieron a dos tipos de régimen de administración distinto en función de las células que se deseaba marcar:
una tanda de ratones recibieron el último día del periodo de infusión intraventricular 7 inyecciones intraperitoneales de Brdu (Sigma), (50 μg/g de peso) cada dos horas (Nowakowski et al.t 1988), y fueron sacrificados una hora después de Ia úítima inyección. Esta estrategia marca las células que en el último día de infusión están proliferando.
Otra tanda de ratones recibieron un mes antes del inicio del periodo de infusión, 6 inyecciones de BrdU en un periodo de dos días (3x2) y fueron sacrificados al final del periodo de infusión. Esta estrategia marca las células madre neurales, relativamente quiescentes y que, por tanto, mantienen Ia marca asociada a Ia incorporación de Ia BrdU durante un mes, y que expresan GFAP.
Todos los animales fueron anestesiados con pentobarbital sódico (13 mg/g de animal) y sacrificados mediante perfusión intracardíaca con paraformaldehído (PFA) al 4% (p/v) en tampón fosfato 0.1 M, pH 7.4 Tras Ia postfijación durante toda Ia noche (o/n), se extrajeron los cerebros y se lavaron en PB durante 2 horas. A continuación, se procedió a ia deshidratacíón del tejido, e inclusión en parafina. Cortes seriados de 7 μm de grosor fueron incubados en HCI 2N a 37 0C durante 20 minutos y neutralizados con tampón borato 0,1 M pH 8,5. EI bloqueo de uniones inespecíficas se llevó a cabo incubando ios cortes con una solución de bloqueo (0,2% Tritón X-100, 10% suero de cabra en PB 0,1 M) durante 1 hora a temperatura ambiente. En esa misma solución de bloqueo se incubaron los cortes con un anticuerpo primario anti-Brdu (DAKO, 1:200) durante 12 horas, seguido de anticuerpos secundarios específicos marcados con fluorocromos. Esta detección inmunocitoquímica se combinó con Ia detección inmunocitoquímica de marcadores específicos de NSCs, como es Ia GFAP (proteína glial acídica fíbrilar), y de neuroblastos, como es Ia forma polisializada de Ia molécula de adhesión neural (PSA-NCAM). Ei PEDF hace que el nicho sea más eficiente em la producción de progenie neuronal (Figura 16). En Ia Figura 16 se observa que cuando el factor PEDF es administrado exógenamente conduce a una mayor producción de neuronas en Ia zona subventricular (positivas para el antígeno PSA-NCAM) y a una mayor actividad proliferativa de Ia zona (incorporación de BrdU). Lo contrario se obtiene cuando se bloquea el PEDF endógeno mediante el fragmento no activo C-ter PEDF. Por tanto Ia figura 16 muestra cómo el PEDF administrado exógenamente conduce a una mayor producción de neuronas en Ia zona subventricular (positivas para el antígeno PSA- NCAM) y a una mayor actividad proíiferativa de Ia zona (incorporación de BrdU). Además, Ia administración de PEDF conduce a Ia obtención de cultivos con mayor capacidad de generar neuroesferas (Figura 17), En Ia Figura 17 se muestra cómo cuando el PEDF es administrado exógenamente a cerebros conduce a una mayor producción de neuroesferas a partir del tejido disociado de estos cerebros. Esto indica que Ia activación de células madre somáticas por PEDF favorece Ia producción de progenie celular y, por tanto, puede contribuir a procesos regenerativos y de reparación tisular.
Ejemplo 7: Ensayos relacionados con las fuentes de PEDF
Se incluyen cuatro ejemplos de producción de PEDF, para demostrar que el objeto de Ia presente invención se centra fundamentalmente en el nuevo uso del factor PEDF como inductor de la auto-renovación de células madre, independientemente de Ia forma en Ia que haya sido obtenido el PEDF:
- A partir de células que expresan y secretan PEDF de forma natural, como por ejemplo, células endoteliales (por ejemp o, de cordón umbilical) o células de naturaleza ependimaria (ver Figura 11). Estas células basta con cultivarlas tanto en su medio de cultivo habitual como en medio de cultivo de células madre neurales para que secreten PEDF Estas células pueden ser de cultivos primarios o bien ¡íneas celulares de origen endotelial o ependimario, cedidas o adquiridas a empresas. Para usarlas como fuente de PEDF para Ia auto- renovación pueden ser co-cu!tivas con las- células madre mediante sistemas de co-cultivo con insertos de membranas porosas que no permiten el contacto entre las células de las dos procedencias, tal y como se explica para los ensayos contenidos en el ejemplo 5.
- A partir de células en las que se expresa de forma heteróloga Ia secuencia de PEDF, como por ejemplo células COS. Para eílo, se puede expresar PEDF en cualquier línea celular que no exprese o que exprese niveles bajos de PEDF mediante Ia introducción de un cDNA para Pedf utilizando transfección, como se explica por ejemplo en los ensayos que se incluyen en el ejemplo de realización 5.
- Como recombinante en bacterias (E colí). Hemos comprobado que producido en bacterias también tiene efecto en Ia auto-renovación de células madre neurales: 41 + 1 % más neuroesferas en cultivos tratados con PEDF1 n = 3; P < 0.01 , Student's t-test. Este PEDF fue obtenido de Ia compañía Bioproducts MD.
Producido en Pichia pastoris: a partir de Ia secuencia humana obtenida por PCR y clonada en el vector pPICZαA a la que se añade Ia secuencia para el péptido señal de Saccharomyces cerevisiae y una cola de hístidínas. Una vez producida en Pichia, se purifica mediante cromatografía y se comprueba Ia obtención y pureza por electroforesis en SDS-PAGE y western blot con anticuerpos específicos anti-PEDF (ver Figura 18). Estas moléculas fueron obtenidas del laboratorio de Julio Escribano en Ia Universidad de Castilla La Mancha, que las cedió para los análisis mostrados en los ejemplos de realización. En Ia figura 18 se muestra formas purificadas por cromatografía de PEDF completo y Ia mitad C-terminal del PEDF humano a partir del medio obtenido de Pichia modificadas genéticamente para Ia expresión de estas formas. La electroforesis en SDS-PAGE muestra Ia pureza de ia separación y el peso molecular aparente del PEDF (47 kDa) y del C-ter PEDF (26 kDa) y la inmunodetección con anticuerpos anti-PEDF muestra Ia especificidad de ios dos productos.
En el contexto de Ia presente invención, el uso de PEDF biológicamente activo en el proceso de auto-renovación de células madre incluye al PEDF y a cualquier derivado de PEDF con acción en renovación celular. Ei PEDF puede ser purificado a partir de fuentes naturales, como el humor vitreo. La invención no se restringe al uso de ia molécula completa de PEDF ni a Ia de su secuencia precisa ni en su procedencia de humanos ni de otras especies. Una secuencia codificadora para PEDF puede incluir variaciones aiélicas poblacionales o mutaciones puntuales, así como variantes por inserción, deleción o sustitución, sobre polipéptidos de PEDF que se encuentran en Ia naturaleza. El polipéptido PEDF puede contener otros dominios, como epítopos especiales para Ia purificación (como, por ejemplo, colas de histidinas, myc) o para el seguimiento (como, por ejemplo, GFP), Puede tratarse además de variantes de modificaciones post-traduccionales, como glicosüación o fosforilación. El PEDF puede ser utilizado en su forma completa o en forma de fragmentos que retengan Ia actividad sobre renovación celular. Todas estas formas pueden ser suministradas a cultivos de células madre directamente para su activación y mantenimiento. También pueden ser aplicadas sistémica o localmente medíante el uso de composiciones farmacéuticas para auto-renovación celular caracterizadas por contener al menos una cantidad farmacéuticamente eficaz de factor PEDF y al menos un excipiente farmacéuticamente aceptable. En este sentido, el PEDF no es tóxico y los efectos sobre auto-renovación, al menos en células madre neurales de ratón tanto en experimentos en cultivo como administrándolo directamente en el cerebro de ios ratones, los hemos encontrado con concentraciones de tan sólo 0.4 nM.
El PEDF puede ser utilizado en forma de construcción conteniendo una secuencia de ácido nucleico que codifica para cualquiera de las formas de PEDF contempladas en el párrafo anterior. En este caso, estas secuencias pueden ser introducidas en sistemas celulares usando tecnología de DNA recombinante. E! PEDF puede ser introducido de esta forma en sistemas celulares (mediante transfección, infección, electroporación, microinyección, etc.), que luego puedan ser puestos en co-cultivo con células madre, o bien introducidos en tejidos en los que sea necesario activar células madre endógenas, o puede ser introducido directamente en los tejidos medíante infección con vectores virales utilizados en terapia génica. También, estas secuencias pueden ser utilizadas para Ia expresión masiva de Ia forma de p£DF activo en renovación celular en sistemas de expresión procariotas o eucariotas. En todos estos casos, las construcciones deberán contener promotores capaces de dirigir la expresión de Ia molécula en las células de interés.
En todos los casos anteriores, el PEDF puede ser suministrado sólo o en combinación con otros factores inductores de Ia auto-renovación. En el contexto de Ia presente invención también proponemos el uso de fragmentos C-terminales de Ia molécula de PEDF como estrategia para e! bloqueo de los efectos de PEDF completo sobre Ia auto-renovación celular.
El polipéptido PEDF activa Ia división auto-renovante de células madre somáticas, como las neurales, en nichos naturales y con ello, Ia producción de progenie diferenciada. La presente invención proporciona un método para activar céiulas madre presentes en los tejidos que requieren una mayor actividad de sus células madre para renovación tisular e, incluso, regeneración, como por ejemplo, regeneración de piel, hematopoyética, neural tras accidente cerebrovascular, cardiaca, etc

Claims

RElVlNDiCACiONES
1. Uso del factor PEDF en su versión completa o fragmentado para Ia fabricación de un medicamento para activar procesos seleccionados deí grupo formado por procesos de regeneración tisular de Ia piel, procesos de cicatrización, procesos de terapia celuiar, procesos de regeneración cardiaca y/o hematopoyética.
2, Uso del factor PEDF según Ia reivindicación 1 en Ia preparación de un medicamento que comprende de forma adicional moléculas seleccionadas del grupo formado por aminoácidos, lípidos, hidratos de carbono y metales.
3. Uso del factor PEDF según cualquiera de las reivindicaciones 1 a 2 en Ia preparación de un medicamento en una forma seleccionada entre polvo, granulos, comprimidos, cápsulas, trociscos, solución, suspensión, emulsión y jarabe.
4, Composición farmacéutica caracterizada porque comprende en un medio farmacéuticamente aceptable una cantidad farmacéuticamente eficaz de:
a) Ia secuencia tota! o parcial del factor PEDF,
b) una variante biológica natural, como una variante alélica, del factor PEDF,
c) un equivalente funcional del factor PEDF que contenga sustitución(es), adición(es), inserción(es) y/o deleción(es) únicas o múltiples en Ia secuencia de Ia proteína tipo salvaje y/o sustituciones de aminoácidos modificados químicamente que no afecten a su función biológica,
d) un fragmento activo del factor PEDF que comprende una secuencia parcial de PEDF que mantiene su función biológica,
e) una proteína fusionada que comprende el factor PEDF fusionado a un pé piído o a otra proteína,
f) Un análogo estructural de PEDF,
g) y/o un homólogo de PEDF.
5. Composición farmacéutica según Ia reivindicación 4 caracterizada porque contiene al menos una cantidad farmacéuticamente eficaz de Ia secuencia total o parcial del factor PEDF y al menos un excipiente farmacéuticamente aceptable.
6. Composición farmacéutica según Ia reivindicación 4 caracterizada porque contiene al menos una cantidad farmacéuticamente eficaz de una variante biológica natural de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
7. Composición farmacéutica según Ia reivindicación 4 caracterizada porque contiene ai menos una cantidad farmacéuticamente eficaz de un equivalente funcional de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
8. Composición farmacéutica según Ia reivindicación 4 caracterizada porque contiene ai menos una cantidad farmacéuticamente eficaz de un fragmento activo de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
9. Composición farmacéutica según Ia reivindicación 4 caracterizada porque contiene ai menos una cantidad farmacéuticamente eficaz de una proteína fusionada de factor PEDF y ai menos un excipiente farmacéuticamente aceptable.
10. Composición farmacéutica según ia reivindicación 4 caracterizada porque contiene al menos una cantidad farmacéuticamente eficaz de un derivado de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
11. Composición farmacéutica según Ia reivindicación 4 caracterizada porque contiene al menos una cantidad farmacéuticamente eficaz de al menos un análogo estructural de factor PEDF y al menos un excipiente farmacéuticamente aceptable,
12. Composición farmacéutica según Ia reivindicación 4 caracterizada porque contiene al menos una cantidad farmacéuticamente eficaz al menos un homólogo de factor PEDF y al menos un excipiente farmacéuticamente aceptable.
13. Composición farmacéutica según Ia reivindicación 4 caracterizada porque la cantidad de factor PEDF es de al menos 20 ng/ml.
PCT/IB2007/051115 2006-02-17 2007-02-16 Uso del factor pedf para inducir la renovación de células WO2007093975A2 (es)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AT07735311T ATE533501T1 (de) 2006-02-17 2007-02-16 Verwendung des ped-faktors zur induktion von zellregenerierung
EP07735311A EP2044952B1 (en) 2006-02-17 2007-02-16 Use of the pedf factor to induce cell regeneration
US12/278,166 US20100047212A1 (en) 2006-02-17 2007-02-16 Use of the pedf factor to induce cell regeneration

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES200600386 2006-02-17
ES200600386A ES2329636B2 (es) 2006-02-17 2006-02-17 Uso del factor pedf para inducir la auto-renovacion de celulas madre.

Publications (2)

Publication Number Publication Date
WO2007093975A2 true WO2007093975A2 (es) 2007-08-23
WO2007093975A3 WO2007093975A3 (es) 2008-05-02

Family

ID=38371888

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2007/051115 WO2007093975A2 (es) 2006-02-17 2007-02-16 Uso del factor pedf para inducir la renovación de células

Country Status (5)

Country Link
US (1) US20100047212A1 (es)
EP (1) EP2044952B1 (es)
AT (1) ATE533501T1 (es)
ES (1) ES2329636B2 (es)
WO (1) WO2007093975A2 (es)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2508196B1 (en) * 2011-03-23 2018-09-26 Mackay Memorial Hospital Use of PEDF-derived polypeptides for promoting stem cells proliferation and wound healing
TWI491616B (zh) * 2012-08-09 2015-07-11 Mackay Memorial Hospital 色素上皮衍生因子衍生之多胜肽於促進肌肉或肌腱再生或動脈血管生成之用途
EP3342781B1 (en) * 2012-08-09 2019-07-24 MacKay Memorial Hospital Use of pedf-derived polypeptides for promoting arteriogenesis
AU2012390200B2 (en) 2012-09-19 2017-06-29 Mackay Memorial Hospital Use of pedf-derived polypeptides for preventing and/or ameliorating skin aging
US10724005B2 (en) 2012-09-28 2020-07-28 Scripps Health Methods of differentiating stem cells into chondrocytes
KR101540698B1 (ko) * 2012-10-05 2015-07-30 사회복지법인 삼성생명공익재단 허혈혈청을 포함하는 줄기세포 활성화 촉진용 조성물 및 줄기세포의 활성화 촉진 방법
JP6324395B2 (ja) 2012-10-29 2018-05-16 スクリップス ヘルス 軟骨細胞を移植する方法
WO2014070797A1 (en) * 2012-10-29 2014-05-08 Scripps Health Methods of producing pluripotent stem cells from chondrocytes
JP2017165745A (ja) * 2017-04-19 2017-09-21 マクカイ メモリアル ホスピタル 筋肉若しくは腱再生又は動脈形成を促進するためのｐｅｄｆ由来のポリペプチドの使用
EA202092368A1 (ru) * 2018-04-08 2021-01-18 Брим Байотекнолоджи, Инк. Применение происходящих из pedf коротких пептидов при заживлении сухожилий

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001081551A2 (en) 2000-04-27 2001-11-01 Neurotech S.A. Retinal pigment epithelial cell lines with extended life-span and their applications
US20010049369A1 (en) 2000-02-10 2001-12-06 Jablonski Monica M. Brimonidine compositions and methods for retinal degeneration
WO2002024234A2 (en) 2000-09-20 2002-03-28 The Regents Of The University Of California Use of recombinant gene delivery vectors for treating or preventing diseases of the eye
WO2002058730A2 (en) 2000-11-01 2002-08-01 Allergan, Inc. Compositions for treatment of ocular neovascularization
US20020194630A1 (en) 1999-03-15 2002-12-19 Manning William C. Use of recombinant gene delivery vectors for treating or preventing diseases of the eye
US20030082183A1 (en) 2000-11-01 2003-05-01 Wheeler Larry A. Methods and compositions for treatment of ocular neovascularization and neural injury
US20030087859A1 (en) 2001-02-21 2003-05-08 Stefan Kochanek Pigment epithelial cell of the eye, its production and use in therapy of an eye or CNS disease
WO2004027079A2 (en) 2002-09-19 2004-04-01 Tanox, Inc. Nuclear factor of activated t cells receptor
WO2004027019A2 (en) 2002-05-01 2004-04-01 University Of Florida Research Foundation, Inc. Improved raav expression systems for genetic modification of specific capsid proteins
WO2004028635A1 (en) 2002-09-27 2004-04-08 Novartis Ag Ocular gene therapy
US20040234505A1 (en) 1998-09-23 2004-11-25 Stuart Naylor Polynucleotide constructs and uses thereof
WO2005011813A2 (en) 2003-07-30 2005-02-10 Minu, L.L.C. Treatment of ocular disease
US20050222031A1 (en) 2004-03-19 2005-10-06 Yamagishi Sho-Ichi Method for preventing or treating malignant melanoma

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6451763B1 (en) * 1992-06-04 2002-09-17 The United States Of America As Represented By The Department Of Health And Human Services Retinal pigmented epithelium derived neurotrophic factor and methods of use
US6797691B1 (en) * 1997-07-23 2004-09-28 Northwestern University Methods and compositions for inhibiting angiogenesis
DE60136444D1 (de) * 2000-02-23 2008-12-18 Univ Northwestern Pharmazeutische zusammensetzung zur angiogenese-hemmung mittels eines pedf-fragmentes
WO2004028559A1 (en) * 2002-09-26 2004-04-08 The Board Of Trustees Of The University Of Illinois Anti-angiogenic fragments of pigment epithelium-derived factor (pedf)
KR100875112B1 (ko) * 2002-11-16 2008-12-22 삼성에스디아이 주식회사 비수계 전해액 및 이를 채용한 리튬 전지
EP1684692A2 (en) * 2003-10-29 2006-08-02 The Johns Hopkins University Pigment epithelium-derived factor, novel biological activity and methods of use

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040234505A1 (en) 1998-09-23 2004-11-25 Stuart Naylor Polynucleotide constructs and uses thereof
US20020194630A1 (en) 1999-03-15 2002-12-19 Manning William C. Use of recombinant gene delivery vectors for treating or preventing diseases of the eye
US20010049369A1 (en) 2000-02-10 2001-12-06 Jablonski Monica M. Brimonidine compositions and methods for retinal degeneration
WO2001081551A2 (en) 2000-04-27 2001-11-01 Neurotech S.A. Retinal pigment epithelial cell lines with extended life-span and their applications
WO2002024234A2 (en) 2000-09-20 2002-03-28 The Regents Of The University Of California Use of recombinant gene delivery vectors for treating or preventing diseases of the eye
WO2002058730A2 (en) 2000-11-01 2002-08-01 Allergan, Inc. Compositions for treatment of ocular neovascularization
US20030082183A1 (en) 2000-11-01 2003-05-01 Wheeler Larry A. Methods and compositions for treatment of ocular neovascularization and neural injury
US20030087859A1 (en) 2001-02-21 2003-05-08 Stefan Kochanek Pigment epithelial cell of the eye, its production and use in therapy of an eye or CNS disease
WO2004027019A2 (en) 2002-05-01 2004-04-01 University Of Florida Research Foundation, Inc. Improved raav expression systems for genetic modification of specific capsid proteins
WO2004027079A2 (en) 2002-09-19 2004-04-01 Tanox, Inc. Nuclear factor of activated t cells receptor
WO2004028635A1 (en) 2002-09-27 2004-04-08 Novartis Ag Ocular gene therapy
WO2005011813A2 (en) 2003-07-30 2005-02-10 Minu, L.L.C. Treatment of ocular disease
US20050222031A1 (en) 2004-03-19 2005-10-06 Yamagishi Sho-Ichi Method for preventing or treating malignant melanoma

Non-Patent Citations (37)

* Cited by examiner, † Cited by third party
Title
ABE R ET AL.: "Overexpression of pigment epithelium-derived factor decreases angiogenesis and inhibits the growth of human malignant melanoma cells in vivo", AM J PATHOL., vol. 164, no. 4, 2004, pages 1225 - 32
ABRAMSON LP ET AL.: "Wilms' tumor growth is suppressed by antiangiogenic pigment epithelium-derived factor in a xenograft model", J PEDIATR SURG., vol. 38, no. 3, 2003, pages 336 - 42
ALBERDI, E.; AYMERICH, M.S.; BECERRA, S.P.: "Binding of pigment epithelium-derived factor (PEOF) to retinoblastoma cells and cerebellar granule neurons", EVIDENCE FOR A PEDF RECEPTOR. J. BIOL. CHEM., vol. 274, 1999, pages 31605 - 31612
AURICCHIO A ET AL.: "Inhibition of retinal neovascularization by intraocular viral-mediated delivery of anti-angiogenic agents", MOL THER., vol. 6, no. 4, 2002, pages 490 - 4
BILAK MM ET AL.: "Pigment epithelium-derived factor (PEDF) protects motor neurons from chronic glutamate-mediated neurodegeneration", J NEUROPATHOL EXP NEUROL., vol. 58, no. 7, 1999, pages 719 - 28
CAI J ET AL.: "Pigment Epithelium-derived Factor Inhibits Angiogenesis via Regulated lntracellular Proteolysis of Vascular Endothelial Growth Factor Receptor 1", J BIOL CHEM., vol. 281, no. 6, 2006, pages 3604 - 13
CAO W ET AL.: "In vivo protection of photoreceptors from light damage by pigment epithelium-derived factor", INVEST OPHTHALMOL VIS SCI., vol. 42, no. 7, 2001, pages 1646 - 52
CAO W ET AL.: "Pigment epithelium-derived factor protects cultured retinal neurons against hydrogen peroxide-induced cell death", J NEUROSCI RES., vol. 57, no. 6, 1999, pages 789 - 800
CAYOUETTE M ET AL.: "Pigment epithelium-derived factor delays the death of photoreceptors in mouse models of inherited retinal degenerations", NEUROBIOL DIS., vol. 6, no. 6, 1999, pages 523 - 32
DAWSON DW ET AL.: "Pigment epithelium-derived factor: a potent inhibitor of angiogenesis", SCIENCE, vol. 285, no. 5425, pages 245 - 8
DECOSTER MA ET AL.: "Neuroprotection by pigment epithelial-derived factor against glutamate toxicity in developing primary hippocampal neurons", J NEUROSCI RES., vol. 56, no. 6, 1999, pages 604 - 10
DOLL JA ET AL.: "Pigment epithelium-derived factor regulates the vasculature and mass of the prostate and pancreas", NAT MED., vol. 9, no. 6, 2003, pages 774 - 80
GUAN M ET AL.: "Inhibition of glioma invasion by overexpression of pigment epithelium-derived factor", CANCER GENE THER., vol. 11, no. 5, 2004, pages 325 - 32
GUAN M ET AL.: "Loss of pigment epithelium derived factor expression in glioma progression", J CLIN PATHOL., vol. 56, no. 4, 2003, pages 277 - 82
GUAN M ET AL.: "Loss of pigment epithelium derived factor expression in glioma progression", J CLIN PATHOL., vol. 56, no. 4, pages 277 - 82
HOUENOU LJ ET AL.: "Pigment epithelium-derived factor promotes the survival and differentiation of developing spinal motor neurons", J COMP NEUROL., vol. 412, no. 3, 1999, pages 506 - 14
KUNCL RW ET AL.: "Pigment epithelium-derived factor is elevated in CSF of patients with amyotrophic lateral sclerosis", J NEUROCHEM., vol. 81, no. 1, 2002, pages 178 - 84
LMAI D ET AL.: "Intraocular gene transfer of pigment epithelium-derived factor rescues photoreceptors from light- induced cell death", J CELL PHYSIOL., vol. 202, no. 2, 2005, pages 570 - 8
MATSUMOTO K ET AL.: "Antiangiogenic property of pigment epithelium-derived factor in hepatocellular carcinoma", HEPATOLOGY, vol. 40, no. 1, pages 252 - 9
MIYAGISHI D ET AL.: "Regulation of the expression of pigment epithelium-derived factor, an anti-angiogenic factor in human oral squamous cell carcinoma cell lines", CANCER LETT., vol. 196, no. 1, 2003, pages 77 - 85
MIYAZAKI M ET AL.: "Simian lentiviral vector-mediated retinal gene transfer of pigment epithelium-derived factor protects retinal degeneration and electrical defect in Royal College of Surgeons rats", GENE THER., vol. 10, no. 17, 2003, pages 1503 - 11
MORI K ET AL.: "Pigment epithelium-derived factor inhibits retinal and choroidal neovascularization", J CELL PHYSIOL., vol. 188, no. 2, pages 253 - 63
MORI K ET AL.: "Regression of ocular neovascularization in response to increased expression of pigment epithelium-derived factor", INVEST OPHTHALMOL VIS SCI., vol. 43, no. 7, 2002, pages 2428 - 34
OGATA N ET AL.: "Pigment epithelium derived factor as a neuroprotective agent against ischemic retinal injury", CURR EYE RES., vol. 22, no. 4, 2001, pages 245 - 52
RAISLER BJ ET AL.: "Adeno-associated virus type-2 expression of pigmented epithelium-derived factor or Kringles 1-3 of angiostatin reduce retinal neovascularization", PROC NATL ACAD SCI USA, vol. 99, no. 13, 2002, pages 8909 - 14
SEIGEL GM ET AL.: "Differentiation of Y79 retinoblastoma cells with pigment epithelial-derived factor and interphotoreceptor matrix wash: effects on tumorigenicity", GROWTH FACTORS, vol. 10, no. 4, 1994, pages 289 - 97
SIDLE DM ET AL.: "Altered pigment epithelium-derived factor and vascular endothelial growth factor levels in lymphangioma pathogenesis and clinical recurrence", ARCH OTOLARYNGOL HEAD NECK SURG., vol. 131, no. 11, 2005, pages 990 - 5
SLAVC I ET AL.: "Mutation analysis and loss of heterozygosity of PEDF in central nervous system primitive neuroectodermal tumors", INT J CANCER., vol. 72, no. 2, 1997, pages 277 - 82
STEELE FR ET AL.: "Pigment epithelium-derived factor neurotrophic activity and identification as a member of the serine protease inhibitor gene family", PROC NATL ACAD SCI USA., vol. 90, no. 4, 15 February 1993 (1993-02-15), pages 1526 - 30
STELLMACH V ET AL.: "Prevention of ischemia-induced retinopathy by the natural ocular antiangiogenic agent pigment epithelium-derived factor", PROC NATL ACAD SCI U S A., vol. 98, no. 5, 2001, pages 2593 - 7
STRECK CJ ET AL.: "Adeno-associated virus vector-mediated delivery of pigment epithelium-derived factor restricts neuroblastoma angiogenesis and growth", J PEDIATR SURG., vol. 40, no. 1, pages 236 - 43
TAKITA H ET AL.: "Retinal neuroprotection against ischemic injury mediated by intraocular gene transfer of pigment epithelium-derived factor", INVEST OPHTHALMOL VIS SCI., vol. 44, no. 10, 2003, pages 4497 - 504
TANIWAKI T ET AL.: "Pigment epithelium-derived factor is a survival factor for cerebellar granule cells in culture", J NEUROCHEM., vol. 64, no. 6, June 1995 (1995-06-01), pages 2509 - 17
TANIWAKI T ET AL.: "Pigment epithelium-derived factor protects cultured cerebellar granule cells against glutamate-induced neurotoxicity", J NEUROCHEM., vol. 68, no. 1, 1997, pages 26 - 32
TOMBRAN-TINK J; CHADER GG; JOHNSON LV: "PEDF. a pigment epithelium-derived factor with potent neuronal differentiative activity", EXP EYE RES., vol. 53, no. 3, 1991, pages 411 - 4
UEHARA H ET AL.: "Expression of pigment epithelium-derived factor decreases liver metastasis and correlates with favorable prognosis for patients with ductal pancreatic adenocarcinoma", CANCER RES., vol. 64, no. 10, 2004, pages 3533 - 7
WANG L ET AL.: "Suppression of angiogenesis and tumor growth by adenoviral-mediated gene transfer of pigment epithelium-derived factor", MOL THER., vol. 8, no. 1, 2003, pages 72 - 9

Also Published As

Publication number Publication date
ATE533501T1 (de) 2011-12-15
ES2329636A1 (es) 2009-11-27
ES2329636B2 (es) 2010-07-26
WO2007093975A3 (es) 2008-05-02
US20100047212A1 (en) 2010-02-25
EP2044952B1 (en) 2011-11-16
EP2044952A2 (en) 2009-04-08

Similar Documents

Publication Publication Date Title
ES2329636B2 (es) Uso del factor pedf para inducir la auto-renovacion de celulas madre.
JP6063626B2 (ja) プロミニン−１ペプチド断片およびその使用
JP2019501210A (ja) 神経細胞の損失予防及び再生の効能を有するペプチド及びこれを含む組成物
US20220220173A1 (en) Tdp-43 mitochondrial localization inhibitor for the treatment of neurogenerative disease
EP2605790B1 (en) Intranasal delivery of cell permeant therapeutics
KR102100021B1 (ko) 성장 인자를 코딩하는 외인성 폴리뉴클레오티드를 포함하는 안정한 신경 줄기세포 및 그의 사용 방법
ES2656353T3 (es) Nuevas aplicaciones de HIP/PAP o derivados de la misma
WO2011072484A1 (zh) 脑损伤治疗的靶点和药物
Zheng et al. Tight junction proteins related to blood-brain barrier and their regulatory signaling pathways in ischemic Stroke
US20190002517A1 (en) Neuropeptide y-derived peptides
AU2005313020A1 (en) Materials and methods related to Dickkopfs (DKK) and Neurogenesis
ES2397300T3 (es) Utilización de péptidos de SCO-espondina para inhibir o prevenir la apoptosis neuronal mediada por los ligandos de receptores de la muerte celular
WO2019195717A1 (en) Compositions and methods of treatment of vision loss through generation of rod photoreceptors from müller glial cells
JP2000501416A (ja) ニューロン病を治療し予防するための、治療法および薬物のスクリーニング法
US20150133388A1 (en) Acetylated crystallin polypeptides and mimetics thereof as therapeutic agents
EP2522359A1 (en) Compounds with thioredoxin-like fold domain for the treatment of degenerative disorders
Yang et al. Targeted delivery of extracellular matrix protected against neurologic defects after focal ischemia reperfusion in rats
KR20200039621A (ko) 미엘린 장애의 치료를 위한 조성물 및 방법
KR101394538B1 (ko) Ｔｇｆｂｉ 유전자 변이 각막이상증의 예방 또는 치료용 약제학적 조성물 및 그의 스크리닝 방법
US20230257436A1 (en) Cell Lines Secreting Alpha-Synuclein Targeting Antibodies, Progranulin and Prosaposin and a Complex of Both, and GDNF
US10660934B2 (en) Neuroprotective peptide
JP2020511148A (ja) 血管新生阻害剤としてのｃ型レクチンであるレベセチン
Zheng The role of Coxsackie and Adenovirus receptor in the central nervous system
Anderton Defining the anti-apoptotic function of the survival of motor neuron (SMN) protein and assessment of a novel therapy for the treatment of spinal muscular atrophy (SMA)
Pradhan AAV2/8 mediated in vivo gene knockdown to characterize the role of neuronal Nogo-A in regulation of dendritic spine dynamics

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07735311

Country of ref document: EP

Kind code of ref document: A2

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007735311

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12278166

Country of ref document: US