WO2007085837A1 - Binding molecules - Google Patents
Binding molecules Download PDFInfo
- Publication number
- WO2007085837A1 WO2007085837A1 PCT/GB2007/000258 GB2007000258W WO2007085837A1 WO 2007085837 A1 WO2007085837 A1 WO 2007085837A1 GB 2007000258 W GB2007000258 W GB 2007000258W WO 2007085837 A1 WO2007085837 A1 WO 2007085837A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- binding
- domains
- domain
- polypeptide binding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
- C07K16/241—Tumor Necrosis Factors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
- C07K16/461—Igs containing Ig-regions, -domains or -residues form different species
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
- C07K16/468—Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
- C07K2317/522—CH1 domain
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/64—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a combination of variable region and constant region components
Definitions
- the present invention relates to the generation of polypeptide binding complexes comprising VH binding domains (as defined herein) linked to both amino and carboxyl termini of dimerisation domains.
- VH binding domains and dimerisation domains generated using the methods of the present invention show inherent structural and functional stability relative to scFv derived polypeptide binding complexes described in the prior art, so providing advantages for product manufacture and product stability. The uses thereof are also described.
- Monoclonal antibodies or variants thereof will represent a high proportion of new medicines launched in the 21 st century.
- Monoclonal antibody therapy is already accepted as a preferred route for the treatment for rheumatoid arthritis and Crohn's disease and there is impressive progress in the treatment of cancer.
- Antibody-based products are also in development for the treatment of cardiovascular and infectious diseases.
- Most marketed monoclonal antibody products recognise and bind a single, well-defined epitope on the target ligand (eg TNF ⁇ ).
- TNF ⁇ target ligand
- the assembly of a complex consisting of two heavy chains and two light chains (the H 2 L 2 complex) and subsequent post-translational glycosylation processes require the use of mammalian production systems.
- a variety of transgenic organisms are capable of expressing fully functional antibodies. These include plants, insects, chickens, goats and cattle. Functional antibody fragments can be manufactured in E. coli but the product generally has low serum stability unless pegylated during the manufacturing process.
- Bi-specific antibody complexes are engineered Ig-based molecules capable of binding two different epitopes on either the same or different antigens.
- Bi-specific binding proteins incorporating antibodies alone or in combination with other binding agents show promise for treatment modalities where captured human immune functions elicit a therapeutic effect, for example the elimination of pathogens (Van Spriel et ah, (1999) J. Infect. Diseases, 179, 661-669; Tacken et al., ' (2004) J. Immunol, 172, 4934-4940; US 5,487,890), the treatment of cancer (Glennie and van der Winkel, (2003,) Drug Discovery Today, 8, 503-5100); and immunotherapy (Van Spriel et al, (2000) Immunol.
- BsIgG bi-speciflc IgG formats
- BsIgGs require engineered "knob and hole” heavy chains to prevent heterodimer formation and utilise identical L-chains to avoid L-chain mispairing (Carter, (2001) J. Immunol. Methods, 248, 7-15).
- BsAb diabodies or mini antibodies
- scFv V H and V L binding sites
- C H I and L-constant domains have been used as heterodimerisation domains for bi-specific mini-antibody formation (Muller et al, (1998)
- immunoglobulins The structure of immunoglobulins is well known in the art. Most natural immunoglobulins comprise two heavy chains and two light chains. The heavy chains are joined to each other via disulphide bonds between hinge domains located approximately half way along each heavy chain. A light chain is associated with each heavy chain on the N-terminal side of the hinge domain. Each light chain is normally bound to its respective heavy chain by a disulphide bond close to the hinge domain.
- Heavy chains have a single variable domain V H , adjacent the variable domain of the light chain, a first constant domain, a hinge domain and two or three further constant domains. Interaction of the heavy (V H ) and light (V L ) chain variable domains results in the formation of an antigen binding region (Fv). Generally, both V H and V L are required for optimal antigen binding, although heavy chain dimers and amino-terminal fragments have been shown to retain activity in the absence of light chain (Jaton et al, (1968) Biochemistry, 7, 4185-4195).
- camelids as a result of natural gene mutations, produce functional IgG2 and IgG3 heavy chain-only dimers which are unable to bind light chain due to the absence of the C H I light chain-binding region (Hamers- Casterman et ⁇ /.,.(1993) Nature, 363, 446-448) and that species such as shark produce a heavy chain-only-like binding protein family, probably related to the mammalian T-cell receptor or immunoglobulin light chain (Stanfield et al, (2004) Science, 305, 1770-1773).
- camelid heavy chain-only antibody is the camelid V H domain, which provides improved solubility and stability relative to the natural human V H domain.
- Human VH domains may be engineered for improved solubility characteristics (see Davies and Riechmann, (1996) Protein Eng., 9 (6), 531-537; Lutz and Muyldermans, (1999) J. Immuno. Methods, 231, 25-38) or solubility maybe be acquired by natural selection in vivo (see Tanha et al, (2001) J. Biol. Chem., 276, 24774-24780; Jespers L, Schon O, James LC, Veprintsev D, Winter G., J MoI Biol. 2004 Apr 2;337(4):893-903).
- V H binding domains have been derived from phage libraries, intrinsic affinities for antigen remain in the low micromolar to high nanomolar range, in spite of the application of affinity improvement strategies involving, for example, affinity hot spot randomisation (Yau et al, (2005) J. Immunol. Methods, 297, 213-224).
- scFvs have limitations due to inherent instability and folding inefficiency when produced and recovered from host cells, or when produced as intrabodies in a reducing intracellular environment (see der Maur et al., (2002) J.Biol.Chem 277, 45075-45085).
- V H domains typified by camelid V HH , show high thermodynamic stability relative to conventional antibody fragments (Dumoulin et al., (2002) Protein Science, 11, 500-515) and retain functional stability even in the presence of non-ionic and anionic surfactants, and harsh denaturing conditions such as urea (DoIk et al., (2005) Applied and Environmental Microbiology, 71, 442-450), important features for the recovery of functional antibody complexes in high yield from harsh manufacturing environments, and the maintenance of product structural and functional integrity both in vivo and in vitro.
- VH H and camelised or engineered VH antibody domains also show the potential for greater target penetration of infectious agents than larger conventional antibody fragments (Stijlemans et al., (2004) J.Biol.Chem. 279, 1256-1261) and, when used as an "intrabody", retain intracellular structural and functional stability, blocking the production of porcine retrovirus by PK15 cells in culture ( Dekker et al., (2003) J.Virol. 77, 12132-12139).
- Camelid V H antibodies are also characterised by a modified CDR3 loop.
- This CDR3 loop is, on average, longer than those found in non-camelid antibodies and is a feature considered to be a major influence on overall antigen affinity and specificity, which appear to compensate for the absence of a V L domain in the camelid heavy chain-only antibody species (Desmyter et al, (1996) Nat. Struct. Biol, 3, 803-811, Riechmann and Muyldermans, (1999) J. Immunol. Methods, 23, 25-28). Recently, methods for the production of heavy-chain-only antibodies in transgenic mammals have been developed (see WO02/085945 and WO02/085944).
- Functional heavy chain-only antibody of potentially any class (IgM, IgG, IgD, IgA or IgE) and derived from any mammal (including man) can be produced from transgenic mammals (preferably mice) as a result of antigen challenge.
- Heavy chain-only monoclonal antibodies can be recovered from B-cells of the spleen by standard cloning technology or recovered from B-cell mRNA by phage display technology (Ward et al, (1989) Nature, 341, 544-546).
- Heavy chain-only antibodies derived from camelids or transgenic animals are of high affinity.
- V H domains found in heavy chain-only antibodies such as camelid Vm heavy chain-only antibodies and camelised human V H heavy chain only antibodies
- each region binds as a monomer with no dependency on dimerisation with a V L region for optimal solubility and binding affinity.
- V H domains found in heavy chain-only antibodies have yet to be used to advantage in design of multimeric proteins as reagents, therapeutics and diagnostics, although two V H domains tethered by a natural antibody hinge region have been shown to retain binding characteristics within bi-specific or bivalent constructs (Conrath et al.,( 2001) J.Biol.Chem. 276, 7346-7352).
- the incorporation of multiple binding domains in combination with a dimerisation domain has clear advantage over parallel approaches using scFvs which must be engineered from VH and V L domains with the associated potential of loss of specificity and avidity, the increased risk of antigenicity due to the presence of linker peptides, and inherent lack of stability relative to V H binding domains.
- VH binding domains derived from antibody- related gene families such as T-cell receptors or the shark immunogloblin family also provide alternatives to scFv for the generation of bi- or multi-specific binding molecules.
- C H 2-C H 3 dimerisation domains have been used in the design of tetrameric monospecific homodimers or bivalent bi-speciftc homodimers carrying scFv binding domains at their amino and carboxyl termini (see Jendreyko et al. (2003) J.Biol.Chem. 278, 47812-47819) or combinations of scFv binding domains and receptor binding proteins (Biburger et al.(2005) J.Mol.Biol. 346,1299-1311).
- C H 2-C H 3 domains have also been used to construct bivalent bi-specific homodimers using ,camelised V H and llama V HH domains found in heavy chain-only antibodies (PCT/GB2005/002892).
- Dimerisation domains may comprise natural or engineered immunoglobulin C H 2-CH3 dimerisation domains lacking heavy chain effector function for example C H 2-C H 3 derived from IgG4 (see Bruggemann,M. et al. J.Ex. Med. (1987) 166, 1351-1361).
- dimerisation domains other than C H 2-C H 3 are incorporated.
- the resulting polypeptide binding complex is less than 12OkDa molecular weight so as to maximise tissue penetration when administered in vivo.
- the present invention provides a method to use VH binding domains (as defined herein) alone or in combination with other binding domains, but excluding scFVs, to produce a polypeptide binding complex.
- a polypeptide binding complex comprising a dimer of a first heavy chain and a second heavy chain, wherein each heavy chain comprises an amino terminal VH binding domain (as defined herein); a carboxy terminal VH binding domain (as defined herein); and a dimerisation domain preferably lacking CH2-CH3 dimerisation functionality.
- VH binding domain includes natural VH binding domains, for instance as expressed by a heavy chain locus alone as a result of recombination between single V, D and J gene segments followed subsequently by somatic mutation.
- VH binding domain encompasses any naturally occurring antigen-binding domain derived from a vertebrate, including shark, camelid and human. Where the VH binding domain is taken from a camelid or other natural heavy chain-only antibody, it is referred to as a V HH domain. Where the VH domain is taken or derived from an antibody other than a heavy chain-only antibody, it is referred to as a V H domain.
- VH binding domain includes VH or V HH domains which have been altered through selection or engineering to change their characteristics. For example, stability under certain conditions or solubility may have been altered.
- the VH domain may also have been altered through selection or engineering to more closely resemble a V H or V HH domain from another species.
- a V region of a human V H domain may have been altered to more closely resemble a V region found in a camelid V HH domain.
- VH binding domain also includes homologues, derivatives or protein fragments, which are capable of functioning as a VH domain, for example a VL binding domain. All such embodiments are included in the invention.
- the polypeptide binding complex may comprise a dimer of a first heavy chain and a second heavy chain, wherein each heavy chain comprises one or more additional amino terminal VH binding domains in tandem and separated by a hinge domain; and one or more additional carboxy terminal VH binding domains in tandem and separated by a hinge domain.
- the dimerisation domain is preferably of human origin, and may, depending on the application, comprise natural or engineered glycosylation sites to enhance plasma stability or alternatively may lack all post-translational modification sites to enhance plasma clearance or to reduce masking so as to enhance target recognition and binding. Where performance criteria in vivo, such as tissue penetration or plasma clearance, are required, the size of the overall polypeptide binding complex should preferably not be greater than 12OkDa.
- polypeptide binding complex comprising VH binding domains is to be used as an intrabody (see Dekker et al. (2003) J.Virol. 77, 12132-12139), additional, intracellular signalling features may be incorporated to determine, for example, intranuclear or membrane localisation (see, for example, Jendreyo et al., (2003) J. Biol. Chem. 278, 47812-47819).
- signal peptides may also be incorporated in vectors at the amino termini of polypeptide binding complexes so as to facilitate synthesis and secretion of the assembled polypeptide complex from production cells of choice (eg yeast, insect or mammalian cells).
- the dimerisation domain may comprise a homodimer or a heterodimer.
- the dimerisation domain of the first heavy chain is different to that of the second heavy chain, such that the polypeptide binding complex is a heterodimer comprising different polypeptides (heterodimers).
- the dimerisation domain of the first heavy chain is the same as that of the second heavy chain, such that the polypeptide binding complex is a homodimer comprising two identical polypeptides (homodimers).
- the VH domains of the invention may show the same specificity or they may show different specificity.
- the polypeptide binding complex comprises four VH domains, these may be tetravalent monospecific, bivalent bi-specific, trispecific or tetraspecific.
- polypeptide binding complexes are envisaged which show greater increasing levels of specificity in line with the number of additional VH domains. For example, a polypeptide complex with eight VH domains may show octaspecificity.
- the polypeptide binding complex is less than 12OkDA in size.
- one or more, but not all of the VH domains may be substituted by an alternative class of polypeptide binding domain.
- the alternative binding domain is a cytokine, a growth factor, a receptor antagonist or agonist or a ligand.
- the dimerisation domain and/or the amino or carboxy terminal binding domains of one or both of the heavy chains are separated by a flexible hinge domain.
- the invention also provides an isolated nucleic acid encoding the first heavy chain, second heavy chain or both heavy chains of the invention.
- the invention also provides a vector comprising the isolated nucleic acid.
- the invention further provides a cell transformed with the vector.
- the invention provides a method for the production of the polypeptide binding complex of the invention, comprising culturing a host cell transformed with a vector comprising a nucleic acid encoding the first heavy chain, second heavy chain or both heavy chains.
- VH binding domains, dimerisation domains or linker polypeptides of the invention may be produced by a synthetic route, such as peptide chemistry or chemical conjugation.
- the polypeptide binding complex may be pegylated to enhance stability in vivo.
- the invention also provides a pharmaceutical composition comprising a polypeptide binding complex according to the invention.
- the invention also provides a method of treating a patient by administering a pharmaceutical composition or a vector of the invention to the patient.
- the invention also provides the use of a polypeptide binding complex according to the invention in the preparation of a medicament for prophylaxis or treatment of disease.
- the invention also provides using a polypeptide binding complex of the invention as a diagnostic, a reagent, an abzyme, an inhibitory agent, a cytochemical reagent, an imaging agent or an intrabody.
- a polypeptide binding complex comprises a dimerisation domain configured with VH binding domains at both amino and carboxyl termini of the molecule.
- the dimerisation domain and the VH binding domain are separated by a flexible polypeptide linker.
- Preferred configurations comprise tetravalent monospecific polypeptide VH binding complexes and bivalent bi-specific polypeptide VH binding complexes (see Figs 1 to 5).
- the VH binding domain maybe derived from any vertebrate though is preferably of human origin. Such VH binding domains maybe derived from natural sources such as camelid, transgenic animals or shark or selected from synthetic library arrays such as phage or yeast VH display libraries.
- VH binding domains may be engineered to improve physical characteristics, such as solubility and stability, or humanised to avoid or reduce antigenicity.
- the definition of VH encompasses any natural polypeptide binding domain derived from immunoglobulin heavy chain, immunoglobulin light chain, T-cell receptor or similar molecule, but excludes engineered scFv molecules where the binding site is engineered from the V H and V L domains of a tetrameric antibody (H 2 L 2 ).
- the dimerisation domain comprises a homodimer or heterodimer derived from a natural source,- -preferably human, which is stable under physiological conditions.
- the dimerisation domain may naturally incorporate addition effector functions or may be engineered to incorporate additional effector functions. These may include but are not limited to sites for post translational modifications (phosphorylation and glycosylation), sites for pegylation, enzymic, cytotoxic and imaging, immune stimulatory and receptor binding functions.
- the present invention also provides a vector(s) comprising a nucleotide sequence encoding the VH polypeptide binding complex and dimerisation domain of the invention and a host cell transformed with such a vector(s).
- polypeptide binding complex in the preparation of a medicament.
- the polypeptide binding complexes of the invention may also be used as imaging agents, diagnostics, reagents, abzymes or inhibitory agents.
- a pharmaceutical composition comprising the polypeptide binding complex according to the invention, and a pharmacologically appropriate carrier.
- the polypeptide binding complex of the invention may also be used as an intrabody whether delivered to the target cell as a vector capable of directing the intracellular synthesis of the polypeptide binding complex in the target cell, or delivered as a proteinaceous complex for cellular uptake and subsequent intracellular function within the target cell.
- transgenic animals in particular mice, can be generated using "micro loci" to produce class-specific VH heavy chain-only antibodies, or a mixture of different classes of VH heavy chain-only antibodies which are secreted by plasma or B cells in response to antigen challenge.
- These can then be used either to generate a reliable supply of class-specific, heavy chain-only antibody using established hybridoma technology or as a source of functional camelid V HH binding domains or VH heavy chain- only binding domains, preferably soluble, V H heavy chain-only binding domains of human origin.
- VH binding domains of the required specificity can be sourced from phage, yeast or similarly constructed display libraries.
- VH domains can be cloned and expressed in bacterial systems to generate VH binding domains with retention of antigen binding, specificity and affinity. Moreover VH binding domains retain functionality whether present at the amino or carboxyl terminus of a dimerisation domain.
- Tetravalent mono-specific VH binding complexes, or bivalent bi-specific VH binding complexes can be assembled using homo- or hetero- dimerisation domains and can be expressed and assembled using cells in culture (e.g. bacterial, yeast, insect, plant or mammalian cells) or by transgenic organisms (e.g. mammal, insect, plant etc) without the need for extensive prior engineering of the binding domain (scFy), the need for chemical cross linking or the need to separate the product from heterologous mixtures of mismatched binding domains.
- cells in culture e.g. bacterial, yeast, insect, plant or mammalian cells
- transgenic organisms e.g. mammal, insect, plant etc
- VH domains are small (approx. 15kDa) relative to scFv (28kDa) or Fab (55kDa) binding domains. Size differential and the presence or otherwise of heavy chain effector function has marked effect on the pharmacokinetics and biodistribution of protein complexes in vivo.
- small soluble polypeptide binding complexes which show rapid tissue penetration and high target retention, lack some or all effector functions and are rapidly cleared from the blood stream are superior in some clinical circumstances to large IgG molecules with poor tissue penetration, associated effector functions, and long serum half- lives (see Holliger, P. & Hudson, P. J. (2005) Nature Biotechnology, 23, 1126-1136 for extensive review).
- CH2-C H 3 dimerisation domains adds heavy chain effector function to VH polypeptide binding complexes.
- CH2-CH3 domain derived from IgG4 or alternative homo- or hetero- dimerisation domains allows size constraints to be engineered in a controlled manner in the absence of heavy chain effector function, but with the incorporation of additional desired functional features as required.
- dimerisation domains are of human origin, preferably produced in specialised tissues so they are unlikely to be present as homologous contaminants during manufacture in diverse protein production systems.
- the dimerisation domain when present in the natural protein should have a nuclear or cytoplasmic location so endogenous protein can be segregated away from a dimerised polypeptide binding protein product destined for secretion via the secretory pathway using natural intracellular membrane bound processes.
- association/disassociation of the polypeptide dimer is not phosphorylation dependent.
- VH polypeptide binding complexes especially those of human origin, have wide ranging applications in the field of healthcare as medicines, imaging agents, diagnostics, abzymes and reagents, with parallel agricultural, environmental and industrial applications.
- the antigen-specific VH binding domain of the invention may be cloned from, e.g., mRNA isolated from an antibody-producing cell of an immunised transgenic animal as described above.
- Cloned VH binding domain sequences can also be isolated from phage arrays (Ward et ah, (1989) Nature, 341, 544-546) or similar array libraries, for example using yeast-based systems (Boder and Wittrup, (1997) Nat. Biotechnol., 15, 553-7).
- Antigen-specific VH binding domains can then be manufactured either alone or as fusion proteins in scalable bacterial, yeast or alternative expression systems.
- VH binding domains can also be cloned from characterised hybridomas derived by classical procedures from immunised transgenic mice. These can then be used for the production of antigen specific VH binding domains and derivatives thereof.
- VH domain-containing fragments can be generated from isolated immunoglobulin heavy chains, heavy chain-only antibodies derived from transgenic animals or natural sources (sharks and camelids) using enzymic or chemical cleavage technology and subsequent separation of the VH domain-containing fragment from the other cleavage products (Jaton et ah, (1968) Biochemistry, 7, 4185-4195).
- VH binding domain is isolated from a characterised hybridoma
- the VH binding domain sequence derived from mRNA can be directly cloned into an expression vector without recourse to additional selection steps necessary using phage and other display systems to characterise and optimise the affinity of the selected VH binding domain.
- Production systems for VH binding domains incorporating heavy chain dimerisation and effector regions include mammalian cells in culture (e.g. B-cell hybridomas, CHO cells), plants (e.g. maize), transgenic goats, rabbits, cattle, sheep and chickens and insect larvae suited to mass rearing technology.
- Other production systems including virus infection (eg baculovirus in insect larvae and cell-lines), are alternatives to cell culture and germline approaches.
- Other production methods will also be familiar to those skilled in the art. Suitable methods for the production of camelid heavy chain-only antibody or VH binding domains alone are known in the art.
- camelid VH binding domains have been produced in bacterial systems and camelid heavy chain-only homodimers have been produced in hybridomas and transfected mammalian cells (see Reichmann and Muyldermans, (1999) J. Immunol. Methods, 231, 25-38).
- Insect larvae from transgenic fly lines have been shown to produce functional heavy chain- only antibody fragments with characteristics indistinguishable from the same antibody produced by mammalian cells (PCT/GB2003/0003319).
- the present invention also provides a vector(s) comprising a polypeptide binding protein, or fragment thereof, encoding VH binding domains and the dimerisation domain(s) according to the present invention.
- the present invention also provides a host cell transformed with vectors according to the present invention.
- the present invention provides a polypeptide binding complex comprising an antigen-specific VH binding domains fused at carboxyl and amino terminal ends of a dimerisation domain lacking C H 2-C H 3 heavy chain effector function(s).
- These polypeptide binding complexes retain the physiological function conferred by the antigen-specific VH binding domain(s) in combination with additional targetting or-effector functions naturally present or engineered into the dimerisation domain.
- Such polypeptide binding complexes may be in the form of functional mono-specific tetrameric binding complexes, bivalent bi-specific binding complexes, or tetra-specif ⁇ c binding complexes.
- VH binding domains are present at the amino and carboxy termini of the binding molecule (see Figure 1 for example).
- Dimerisation domains may be homodimers or heterodimers dependent on the required design of the final functional polypeptide binding complex.
- VH domains acting in a co-operative manner provides a binding molecule of greater affinity and avidity than a single VH alone.
- a tetravalent monospecific polypeptide binding complex assembled as a protein homodimer can be produced from a single cloned gene sequence as a single product free of mismatched contaminating binding sequences.
- a bivalent bi-specific polypeptide binding complex can facilitate cross-linking of different targets whilst retaining the beneficial cooperative effect of two VH binding domains for each antigen.
- a bi-specific polypeptide complex may be utilised to enhance cell-cell interactions or cell/pathogen interactions.
- the polypeptide complexes of the invention can be utilised, for example, to bridge between two cell types such as an erythrocyte and a pathogen (see Taylor et al., (1991) PNAS 88, 3305-3309).
- Bifunctionality can be used to simultaneously inhibit two components of an enzyme pathway (Jendreyko et al (2003) J.Biol.Chem. 278, 47812-47819).
- Bifunctionality can be used to bring an effector moiety into close proximity with a target cell.
- the VH binding domain at the amino terminal end of the each domain are identical and those at the carboxyl terminal end are identical (but recognise a different antigen or epitope to that at the amino terminal end), facilitating co-operative binding of pairs of VH binding domains.
- effector moiety' as used herein includes any moiety that mediates a desired biological effect on a cell.
- the effector moiety is preferably soluble and may be a peptide, polypeptide or protein or may be a non-peptidic structure.
- the effector moiety may be an enzyme, hormone, cytokine, drug, pro-drug, toxin, in particular a protein toxin, a radionuclide in a chelating structure, an imaging agent, albumin or an inhibitory agent.
- the effector moiety may be a cell, for example a T-cell, a peptide, polypeptide or protein or may be a non-peptidic structure.
- the effector moiety associated with the VH binding domain maybe cellular, proteinaceous, organic or inorganic in nature, dependent on the desired effect.
- Albumin, immunoglobulins or other serum proteins may be utilised as an effector moiety to increase the stability or pharmacokinetic and/or pharmacodynamic properties of the antigen-specific VH binding domain (Sung et at, (2003) J. Interferon Cytokine Res., 23 (1): 25-36: Harmsen et al (2005) Vaccine, 23 (41) 4926-4934).
- the effector moiety may be a PEGylated structure or a naturally glycosylated structure so as to improve pharmacodynamic properties.
- the present inventors have also recognised the properties of any polypeptide binding complex are not just dependent on the VH binding domains incorporated in the final polypeptide binding complex.
- the size of the overall complex has significant influence on the pharmacokinetics of the complex in vivo and the ease of manufacture.
- the dimerisation domain dependent on the design of the polypeptide binding complex, may comprise additional effector activity.
- the polypeptide complex comprises a dimerisation domain which is limited in size so as to benefit tissue penetration.
- the second aspect of the present invention provides a dimerisation domain, wherein the dimerisation domain may comprise a homodimer, or a heterodimer.
- the dimerisation is through non-covalent interactions.
- Dimerisation domains are linked covalently to VH binding domains at the dimerisation domains' amino and carboxyl termini.
- the polypeptide binding complex includes natural or engineered flexible hinge-like domains linking the VH binding domains and the dimerisation domain. The presence of hinge regions facilitates the independent function of the VH binding domains in the resultant polypeptide binding complex.
- dimerisation domain may comprise other useful functions, or may be engineered to incorporate additional features such as recognition sequences for glycosylation, pegylation, cell surface receptor binding, or tags for antibody or binding protein recognition.
- Dimerisation domains maybe engineered to optimise association - .through the introduction or elimination for example of additional cysteine residues.
- Small dimerisation domains such as leucine zippers may be present as monomers or tandem pairs to enhance stability. Additional VH domains maybe used to link tandem dimerisation domains.
- the dimerisation domain has a size not greater than 6OkDa and the size of the polypeptide binding complex is approximately 12OkDA so as to enhance tissue penetration.
- Preferred dimerisation domains comprise small domains from natural (human) proteins. These include the small 30 amino acid leucine zipper motifs present in many gene regulatory proteins (Landschulz et al.(1988) Science, 240, 1759-1764). This approach has been used previously for the production of bispecif ⁇ c F(ab') 2 heterodimers (Kostelny et al.,(1992) J.Immunology 148, 1547-1553). Zippers may be engineered to increase the specificity of a given heterodimerisation event (Loriaux et al,. (1993) PNAS 90, 9046- 9050).
- a dimerisation domain according to the first and second aspect of the invention may be any protein, peptide fragment or consensus sequence capable of forming a homo or heterodimer protein-protein interaction, such as that seen between: C H 2-C H 3 region of the immunoglobulin heavy chain constant regions, the C H I domain of an immunoglobulin heavy chain and the constant region of an immunoglobulin light chain, or the homodimerisation of the 180 amino acid carboxyl terminal domain of the TATA binding protein (Colemen et al., (1995) J.Biol.Chem.
- VCAM and VLA-4 VCAM and VLA-4; integrins and extracellular matrix proteins; integrins and cell surface molecules such as CD54 or CD 102; ALCAMs; leucine zipper heterodimerisation domains; glutathione transfereases; and SRCR domains provide alternative examples.
- Exemplary polypeptide binding complexes according to the first and second aspects of the invention are useful for cytochemical labelling, targetting methods or therapy.
- cytochemical labelling for example:
- the carboxyl terminal VH may bind an effector moiety comprising a pro-drug converting enzyme.
- the amino terminal antigen-specific VH binding domain binds to the target and the carboxyl terminal VH brings the effector moiety into close proximity with the target such that the effector moiety can exert a biological effect on the target in the presence of the-pro-drug (e.g. nitroreductase or DT diaphorase with CB 1954);
- VH binding domains target a cytokine (e.g. TNF ⁇ ), all four binding domains acting co-operatively will act with greater avidity and affinity than a VH monomer or dimer alone.
- cytokine e.g. TNF ⁇
- VH binding domains may bind a cytokine and the carboxyl domains serum albumin so as to enhance the serum half-life of the active complex.
- binding domain as used herein in respect of all the above aspects of the present invention includes any polypeptide binding domain that has effector activity in a physiological medium. Such a polypeptide binding domain must also have the ability to bind to a target under physiological conditions.
- a VH binding domain may comprise a camelid VH domain or may comprise a VH domain obtained from a non-camelid.
- the VH binding domain is a human VH binding domain.
- VH binding domains are preferably of B-cell origin, derived from transgenic animals or camelids (as described above) as opposed to VH domains derived from synthetic phage libraries, since the former will be of higher affinity due to their generation in response to antigen challenge in vivo via VDJ rearrangement and somatic mutation.
- VH binding domains may be substituted by alternative protein binding domains.
- substitution occurs either at the amino or the carboxyl termini but not both.
- binding domains include domains that can mediate binding or adhesion to a cell surface.
- Suitable domains which may be used in the polypeptide complexes of the invention are mammalian, prokaryotic and viral cell adhesion molecules, cytokines, growth factors, receptor antagonists or agonists, ligands, cell surface receptors, regulatory factors, structural proteins and peptides, serum proteins, secreted proteins, plasmalemma- associated proteins, viral antigens, bacterial antigens, protozoal antigens, parasitic antigens, lipoproteins, glycoproteins, hormones, neurotransmitters, clotting factors and the like, but excluding engineered single chain Fvs.
- Polynucleotide sequences, vectors and host cells are mammalian, prokaryotic and viral cell adhesion molecules, cytokines, growth factors, receptor antagonists or agonists, ligands, cell surface receptors, regulatory factors, structural proteins and peptides, serum proteins, secreted proteins
- the present invention also provides a polynucleotide sequence encoding any one of the polypeptide binding complexes of the present invention, a vector comprising one or more of the polynucleotide sequences referred to above and a host cell transformed with a vector or vectors encoding the polypeptide binding complex of the present invention.
- the polynucleotides preferably include sequences which allow the expressed polypeptide binding complex to be secreted as either homo or heterodimers into the medium in which the host cell is growing.
- the host cell may include but is not limited to bacterial and yeast, insect, plant and mammalian host cells.
- the present invention provides a transgenic organism expressing at least one homo- or hetero- dimer polypeptide binding complex of the present invention.
- the transgenic organism maybe a non-human vertebrate or mammal, a plant or an insect.
- polypeptide binding complexes for healthcare applications requires large scale manufacturing systems, examples of which are discussed in detail above.
- Such systems include plants (e.g. maize), transgenic cattle and sheep, and chickens, also insect larvae suitable for mass rearing technology.
- Other production systems including virus infection (e.g. baculovirus in insect larvae and cell-lines) as an alternative to cell culture and germline approaches will also be familiar to those skilled in the art.
- polypeptide binding complexes of the invention have a great number of applications.
- the polypeptide binding complexes of the invention comprise mono- bi- and multi-specific polypeptide complexes. These complexes are particularly advantageous, e.g. as therapeutics for the treatment, prevention and diagnosis of diseases.
- the polypeptide binding complexes of the invention are useful for cytochemical labelling, targeting methods, therapy and diagnostics. In mono-antibody therapy, pathogen escape, for example due to a mutation leading to loss of a single binding site, will abolish the therapeutic effect of the antibody.
- the production of bivalent bi-specific polypeptide binding complexes recognising different antigens on the same pathogen can overcome this problem.
- the use of two VH binding domains having different specificities in the polypeptide binding complexes of the invention can also be utilised to enhance both cell-cell interactions and cell/pathogen interactions-.
- polypeptide complexes of the invention can be utilised, for example, to bridge polypeptide complexes between two cell types such as a pathogen and a macrophage, or a tumour cell and a T-cell.
- the polypeptide complex may recognise two or more epitopes on the same pathogen with effector function being provided by receptor recognition domain within or inserted between the dimerisation domain and the hinge sequence.
- bi-specific polypeptide binding complexes may be used to target cells and tissues in vivo, then subsequently to capture circulating effector molecules or imaging agents.
- bi-specific tumour targeting agents can be used to capture pro-drug converting complexes for the subsequent localised conversion of pro-drug to reactive agent.
- Bi- and multi- specific binding complexes in combination with effector agents may also be used to bind and destroy one or more pathogens dependent on the selection of binding domains.
- the presence of two or more binding domains which recognise different antigens on the same pathogen provide clinical advantages and reduce the likelihood of pathogen escape and drug redundancy as a result of mutation within the pathogen.
- the first aspect of the present invention provides VH binding domains or fragments thereof and dimerisation domains including natural or engineered C H 2-C H 3 dimerisation domains lacking some or all heavy chain effector functions.
- polypeptide binding complexes are not greater than 12OkDa in size so as to enhance tissue penetration of the polypeptide binding complex.
- amino or carboxyl terminal VH binding domains maybe replaced with alternative binding domains excepting scFv.
- Polypeptide binding complexes comprising predominantly human sequences are suitable for pharmaceutical use in humans, and so the invention provides a pharmaceutical composition of the polypeptide binding complex comprising VH binding domains linked to a dimerisation domain through an optional hinge region at the amino and carboxyl termini.
- the invention also provides the use of a polypeptide binding complex of the present invention in the preparation of a medicament for the prophylaxis and/or treatment of disease. Where appropriate polypeptide binding complexes and effector moieties maybe formulated separately or together.
- the polypeptide binding complexes may be mixed with stabilisers, particularly if they are to be lyophilised.
- Addition of sugars e.g. mannitol, sucrose, or trehalose
- a preferred stabiliser is mannitol.
- Human serum albumin preferably recombinant
- Mixtures of sugars can also be used, e.g. sucrose and mannitol, trehalose and mannitol, etc.
- Buffer may be added to the composition, e.g. a Tris buffer, a histidine buffer, a glycine buffer or, preferably, a phosphate buffer (e.g. containing sodium dihydrogen phosphate and disodium hydrogen phosphate). Addition of buffer to give a pH between 7.2 and 7.8 is preferred, and in particular a pH of about 7.5.
- a phosphate buffer e.g. containing sodium dihydrogen phosphate and disodium hydrogen phosphate.
- Addition of buffer to give a pH between 7.2 and 7.8 is preferred, and in particular a pH of about 7.5.
- sterile water for injection may be used for reconstitution after lyophilisation. It is also possible to reconstitute a lyophilised cake with an aqueous composition comprising human serum albumin (preferably recombinant).
- the polypeptide binding complexes will be utilised in purified form together with pharmacologically appropriate carriers.
- the invention thus provides a method for treating a patient, comprising administering a pharmaceutical composition of the invention to the patient.
- the patient is preferably a human, and may be a child (e.g. a toddler or infant), a teenager or an adult, but will generally be an adult.
- the invention also provides a polypeptide binding complex of the invention for use as a medicament.
- the invention also provides the use of the polypeptide binding complexes of the invention in the manufacture of a medicament for treating a patient.
- These uses, methods and medicaments are preferably for the treatment of one of the following diseases or disorders: wound healing, cell proliferative disorders, including neoplasm, melanoma, lung, colorectal, osteosarcoma, rectal, ovarian, sarcoma, cervical, oesophageal, breast, pancreas, .
- myeloproliferative disorders such as leukemia, non-Hodgkin lymphoma, leukopenia, thrombocytopenia, angiogenesis disorder, Kaposi's sarcoma
- myeloproliferative disorders such as leukemia, non-Hodgkin lymphoma, leukopenia, thrombocytopenia, angiogenesis disorder, Kaposi's sarcoma
- autoimmune/inflammatory disorders including allergy, inflammatory bowel disease, arthritis, psoriasis and respiratory tract inflammation, asthma, immunodisorders and organ transplant rejection
- cardiovascular and vascular disorders including hypertension, oedema, angina, atherosclerosis, thrombosis, sepsis, shock, reperfusion injury, and ischemia
- neurological disorders including central nervous system disease, Alzheimer's disease, brain injury, amyotrophic lateral sclerosis, and pain
- developmental disorders including metabolic disorders including diabetes mellitus, osteoporosis, and obesity, AIDS and renal disease
- the present invention provides the use of a polypeptide binding complex of the present invention as a diagnostic, prognostic, or therapeutic imaging agent.
- the present invention provides the use of a heavy chain-only antibody or a fragment thereof as herein described as an intracellular binding reagent, or an abzyme.
- Preferred heavy chain-only antibody fragments are soluble antigen-specific VH binding domains.
- the present invention also provides, the use of VH polypeptide binding complexes according to the present invention as enzyme inhibitors or receptor blockers.
- the present invention also provides the use of VH polypeptide binding complexes for use as a therapeutic, imaging agent, diagnostic, abzyme or reagent.
- the present invention also provides VH polypeptide binding complexes for use as an intracellular binding agent (intrabody), and provides vectors functional in target cells for the intracellular expression of intrabodies.comprising VH polypeptide binding complexes.
- Figure 1 shows a polypeptide binding complex comprising a VH polypeptide binding domain, homo dimerisation domains linked by hinge or linker sequences. VH polypeptide domains are positioned at the amino and carboxy terminal ends of the dimerization domains. A. Shows a tetravalent monospecific polypeptide binding domain
- Figure 3 shows a strategy for the generation of a tetravalent monospecific polypeptide binding complex
- Figure 4 shows a strategy for the generation of a bi-specif ⁇ c bivalent polypeptide binding complex with binding affinity for GAG and HSP
- Figure 5 shows an example of a bispecific tetravalent antibody comprising more than one amino and carboxy terminal VH domain.
- Figure 6 shows a scheme for generating heterodimerised bi-specific bi-valent binding molecules using ⁇ s and jun zipper domains.
- Figure 7 PCR results
- Any suitable recombinant DNA technique may be used in the production of the bi- and multi-valent polypeptide complexes, single heavy chain antibodies, and fragments thereof, of the present invention.
- Typical expression vectors such as plasmids, are constructed comprising DNA sequences coding for each of the chains of the polypeptide complex or antibody. Any suitable established techniques for enzymic and chemical fragmentation of immunoglobulins and separation of resultant fragments may be used. The identification, isolation and characterisation of antigen specific VH polypeptide binding domains from phage display libraries and hybridomas derived from camelids and transgenic mice use well established methodologies.
- the present invention also provides vectors including constructs for the construction and expression of polypeptide binding complexes of the present invention.
- a single vector may be constructed which contains the DNA sequences coding for more than polypeptide chain.
- the DNA sequences encoding two different polypeptide chains of a heterodimer with associated VH binding domains may be inserted at different positions on the same plasmid.
- the DNA sequence coding for each polypeptide chain may be inserted individually into a plasmid, thus producing a number of constructed plasmids, each coding for a particular polypeptide chain.
- the plasmids into which the sequences are inserted are compatible.
- Each plasmid is then used to transform a host cell so that each host cell contains DNA sequences coding for each of the polypeptide chains in the polypeptide binding complex.
- Suitable expression vectors which may be used for cloning in bacterial systems include plasmids, such as Col El, pcRl, pBR322, pACYC 184 and RP4, phage DNA or derivatives of any of these.
- suitable expression vectors include plasmids based on a 2 micron origin.
- Any plasmid containing an appropriate mammalian gene promoter sequence may be used in cloning in mammalian systems. Insect or bacculoviral promoter sequences may be used fir insect cell gene expression.
- Such vectors include plasmids derived from, for instance, pBR322, bovine papilloma virus, retroviruses, DNA viruses and vaccinia viruses.
- Suitable host cells which may be used for expression of the polypeptide complex or antibody include bacteria, yeasts and eukaryotic cells, such as insect or mammalian cell lines, transgenic plants, insects, mammalian and other invertebrate or vertebrate expression systems.
- polypeptide binding complex include homologous polypeptide and nucleic acid sequences obtained from any source, for example related cellular homologues, homologues from other species and variants or derivatives thereof.
- present invention encompasses variants, homologues or derivatives of the polypeptide binding -complexes , VH binding domains and dimerisation domains as herein described.
- a homologous sequence is taken to include an amino acid sequence which is at least 80, 85, 90, 95, 96, 97, 98, 99, 99.5, 99.6, 99.7, 99.8,
- homology can also be considered in terms of similarity (i. e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
- the present invention also includes constructed expression vectors and transformed host cells for use in producing the polypeptide binding complexes, dimerisation domains and VH binding domains of the present invention.
- the individual polypeptide binding complexes will be processed by the host cell to form the dimerised polypeptide binding complex which advantageously is secreted therefrom.
- polypeptide binding complexes including fragments thereof of the present invention may be employed in: in vivo therapeutic and prophylactic applications, in vitro and in vivo diagnostic applications, in vitro assay and reagent applications, and the like.
- Therapeutic and prophylactic uses of the polypeptide binding complexes of the invention involve the administration of the above to a recipient mammal, such as a human.
- Substantially pure polypeptide binding complexes including fragments thereof of at least
- polypeptide binding complexes as herein described may be used diagnostically or therapeutically (including extracorporeally) or in developing and performing assay procedures using methods known to those skilled in the art.
- polypeptide binding complexes of the present invention will be utilised in purified form together with pharmacologically appropriate carriers.
- these carriers include aqueous or alcoholic/aqueous solutions, emulsions or suspensions, which may include saline and/or buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride and lactated Ringer's.
- Suitable physiologically-acceptable adjuvants may be chosen from thickeners such as carboxymethylcellulose, polyvinylpyrrolidone, gelatin and alginates.
- Intravenous vehicles include fluid and nutrient replenishers and electrolyte replenishers, such as those based on Ringer's dextrose. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents and inert gases, may also be present (Mack (1982) Remington's Pharmaceutical Sciences, 16th Edition).
- polypeptide complexes and antibodies, including fragments thereof, of the present invention may be used as separately administered compositions or in conjunction with other agents.
- agents can include various immunotherapeutic drugs, such as cyclosporine, methotrexate, adriamycin, cisplatinum or an immunotoxin.
- the polypeptide binding complexes can be used in conjunction with enzymes for the conversion of prodrugs at their site of action.
- compositions can include "cocktails" of various cytotoxic or other agents in conjunction with the selected polypeptide binding complexes of the present invention or even combinations of the selected polypeptide binding complexes of the present invention.
- the route of administration of pharmaceutical compositions of the invention may be any of those commonly known to those of ordinary skill in the art.
- the polypeptide binding complexes of the invention can be administered to any patient in accordance with standard techniques.
- the administration can be by any appropriate mode, including parenterally, intravenously, intramuscularly, intraperitoneally, transdermally, via the pulmonary route, or also, appropriately, by direct infusion with a catheter.
- the dosage and frequency of administration will depend on the age, sex and condition of the patient, concurrent administration of other drugs, counter- indications and other parameters to-be taken into account by the clinician.
- polypeptide binding complexes and antibodies of this invention can be lyophilised for storage and reconstituted in a suitable carrier prior to use.
- Known lyophilisation and reconstitution techniques can be employed. It will be appreciated by those skilled in the art that lyophilisation and reconstitution can lead to varying degrees of functional activity loss and that use levels may have to be adjusted upward to compensate.
- polypeptide binding complex When used as an intrabody the polypeptide binding complex may be delivered using non- viral or viral based vectors, or maybe delivered as a liposomal or alternative formulation resulting in the uptake in the required target cell.
- polypeptide binding complexes of the present invention may be used for diagnostic purposes.
- VH binding domains as herein described may be generated or raised against antigens which are specifically expressed during disease states or whose levels change during a given disease state.
- polypeptide binding complexes can comprise VH domains binding one or more epitopes on the same antigen, alternatively one or more binding domains may act as capture domains either binding the polypeptide complex to a defined substrate or binding an assay component required for qualitative or quantitative aspects of the assay read out.
- labels may be added. Suitable labels include, but are not limited to, any of the following: radioactive labels, NMR spin labels and fluorescent labels. Means for the detection of the labels will be familiar to those skilled in the art.
- compositions containing the polypeptide binding complexes of the present invention or a cocktail thereof can be administered for prophylactic and/or therapeutic treatments.
- a composition containing one or more polypeptide binding complexes of the present invention may be utilised in prophylactic and therapeutic settings to aid in the alteration, inactivation, killing or removal of a select target cell population in a mammal.
- the selected repertoires of polypeptide binding complexes described herein may be used extracorporeally or in vitro selectively to kill, deplete or otherwise effectively remove a target cell population from a heterogeneous collection of cells. Examples Example 1
- Tetravalent monospecific anti- aTNF polypeptide binding protein Tetravalent monospecific anti- aTNF polypeptide binding protein.
- the construct was derived from a previously characterised monoclonal antibody producing a heavy chain only IgM in a transgenic mouse challenged with aTNF.
- the VH domain comprised a camelid V segment and human DJ and constant regions.
- the CH2CH3 backbone of the antibody was deleted and replaced by the CHl immunoglobulin heavy chain domain and by the immunoglobulin light chain constant region.
- the VH domain was then duplicated and cloned at the carboxyl terminal end of each construct using a modified hinge region.
- This hinge was similar to the existing IgG2 hinge sequence but was altered by replacing the cysteines with prolines to prevent crosslinking of the cysteines in the antibody dimer and providing extra flexibility via the prolines to prevent the second antibody being spatially constrained, which otherwise may have inhibited its function.
- formation of the sulphide bridges normally present in the human IgG2 hinge was prevented by replacing the cysteins (greyshade) with prolines (underlined).
- prolines add extra flexibility to the hinge to allow the proper functioning of the second antibody domain that becomes connected to COOH terminus of the dimerisation domain via the hinge.
- the normal IgG hinge sequence (cysteine codons in greyshade, proline codons underlined) GAGCGCAAATGl ⁇ iCGAG ⁇ BcCACCG ⁇ HcCA (SEQ ID NO:1) and its complement were replaced by
- AGCTTCTGAGCGCAAACCACCAGTCGAGCCACCACCGCCACCAC (SEQ ID NO: 2) and its complement 7 7 CG ⁇ GTGGTGGCGGTGGTGGCTCGACTGGTGGTTTGCGCTCAGA (SEQ ID NO:3).
- This also provided the fragment (white box hinge, Figure 2, center) with two single strand ends compatible with HindIII (bold) and Xhol (italic) sites for cloning purposes.
- the final construct was ligated into a bluescript (Pbluescriptl l sk+) expression plasmid that contains a chicken actin promoter and a CMV enhancer sequence ( Figure 22, expression plasmid) by standard recombinant DNA technology.
- the diabody expression plasmids were grown and cotransfected with the plasmid pGK- hygro (to allow the selection of transfected cells) by standard methods (Superfect) into CHO cells. Positive clones were selected in hygromycin containing medium and positively identified as expressing the diabody by performing a standard aTNF ELISA of the growth medium containing secreted diabody by the CHO cells.
- a bi-specific bi-valent polypeptide binding complex comprising VH binding domains and a CH2CH3 dimerisation domain lacking heavy chain effector functions derived from IgG4.
- the experiment was carried out using a camelised human VH domains raised against E.coli HSP70 protein at the amino terminus of the dimerisation domain, and a llama VHH domain raised against the PERV gag antigen (Dekker et al., (2003) J.Virol. 77, (22) 12132- 9) at the carboxyl terminus.
- Experimental detail is as described in Example 2 figs 22,23 and 24 of PCT/GB2005/002892) except that the IgG2 CH2-CH3 dimerisation domain was replaced by a human IgG4 CH2-CH3 dimerisation domain (Bruggemann,M.et al. (1987) J.Ex.Med.,166, 1351-1361.
- the vector comprising polypeptide binding complex was expressed in CHO cells, and the secreted polypeptide binding complex shown by western blotting to bind both HSP70 and gag antigens.
- dimerisation domains can be used to generate multivalent multispecific bonding molecules, for example the leucine zipper domains of the jun and fos genes in combination with different (human) VH domains.
- the jun zipper domain can heterodimerise with the fos zipper domain, but it can also homodimerise.
- the following two examples describe the hetero- and homodimerisation using these zipper domains.
- the last example describes the use of other domains.
- Example 3 Heterodimerised bi-specif ⁇ c bi-valent binding molecules using fos and jun zipper domains.
- VH developed against rTTA (Janssens et al., 2006) is amplified by PCR with primers that at the 5' side has an EcoRI site (primer 1) and is homologous to the leader sequence and at the 3' side is homologous to the hinge region plus a sequence homologous to the 5' end of the fos and jun sequences (primer 2 and 3 respectively).
- Standard PCR amplification results in a fragment A for fos (fig 6 solid line) or fos (fig 7 dotted line) of 600 basepairs.
- Primer 1 CTGGAATTCTCACCATGGAGCTGGGGCTGAGC (SEQ ID NO:4)
- Primer 2 CGCTTGGAGTGTATCAGTCAGTGGGCACCTTGGGCACGGGGG
- Primer 3 CAGCCGGGCGATTCTCTCCAGTGGGCACCTTGGGCACGGGGG
- the fos and jun leucine zipper regions are amplified from human cDNA coding for fos or jun.
- the primers at the 5' end contained a sequence homologous to the 3 'end of the hinge region of the rTTA VH (primers 4 and 5 respectively).
- the primers at the 3' end were homologous to the 3 'end of the zipper regions (primers 6 and 7) and contains at the 3 'end a sequence homologous to the 5' end of the hinge region (PCT/GB2005/002892 ) present at the 5' end of the A5 VH (Janssens et al., 2006).
- Primer 4 CCCCCGTGCCCAAGGTGCCCACTGACTGATACACTCCAAGCG (SEQ ID NO:7)
- Primer 5 CCCCCGTGCCCAAGGTGCCCACTGGAGAGAATCGCCCGGCTG
- Primer 6 TGGTGGTTTGCGCTCAGAAGCCAGGATGAACTCTAGTTTTTC (SEQ ID NO:9)
- Primer 7 TGGTGGTTTGCGCTCAGAAGCAACGTGGTTCATGACTTTCTG (SEQ ID NO: 10)
- a hinge sequence not containing any cysteine is first cloned (as specified in PCT/GB2005/002892, ERKPPVEPPPPP) onto the A5 VH region (Dekker et al.,
- the hinge and A5 VH are subsequently amplified using a primer that is homologous with the 5 'end of the hinge region and a primer homologous to the 3 'end of the A5 VH region including the stop codon (primer , resulting in a fragment D for fos (fig.6 solid line) or jun (fig.6 dotted line) of 400 basepairs.
- Primer 8 GAAAAACTAGAGTTCATCCTGGCTTCTGAGCGCAAACCACCA (SEQ ID NO: 11)
- Primer 9 CAGAAAGTCATGAACCACGTTGCTTCTGAGCGCAAACCACCA (SEQ ID NO: 12)
- Primer 10 GTCGAATTCTCATTCCGAGGAGACGGTGACCTGGGTC (SEQ ID NO: 12)
- Fragment A (fig. 6 solid line), B and D (fig. 6 solid line) are mixed in equimolar amounts and fragments A (fig.6 dotted line), C and D (Fig.6 dotted line) are mixed in equimolar amounts, denatured and PCR amplified using the primers 1 and 10, resulting in a fragment of 1200 basepairs (see figure 7, rTTA-fos-A5 below, containing a characteristic Xhol site at the 5' of the A5 sequence).
- rTTA -foszip-A5 and rTTA-junzip-A5 are cloned by standard means into a yeast (Pichia, Invitrogen) or standard CHO (between CAG promoter and polyA site) expression vector. These construct are introduced into yeast and CHO cells respectively.
- Example 4 This is to show homodimerisation by the same method as shown in Example 3 with the exception that only the jun zipper part of the experiment is - earned out.
- the rTTA-junzip-A5 is expressed in Pichia or CHO cells and shown to form rTTA and A5 binding homodimers by the same methods as in example 2.
- step 2 Similar methodology as described in examples 3 and 4 can be applied for other homo- or heterodimer forming domains.
- step 2 would be homologous to such other dimerising domains and the oligonucleotides used in steps 1 and 3 would have ends overlapping with these domains to enable step 4.
- VH or VL domains or other binding domains such as transcription factor DNA binding domains or ligand binding domains could be used.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2007209130A AU2007209130A1 (en) | 2006-01-25 | 2007-01-25 | Binding molecules |
| US12/161,986 US20090169548A1 (en) | 2006-01-25 | 2007-01-25 | Binding molecules |
| EP07705029A EP1989229A1 (en) | 2006-01-25 | 2007-01-25 | Binding molecules |
| JP2008551872A JP2009524422A (ja) | 2006-01-25 | 2007-01-25 | 結合分子3 |
| BRPI0706737-2A BRPI0706737A2 (pt) | 2006-01-20 | 2007-01-25 | moléculas ligantes |
| CA002637945A CA2637945A1 (en) | 2006-01-25 | 2007-01-25 | Binding molecules |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB0601513.5A GB0601513D0 (en) | 2006-01-25 | 2006-01-25 | Binding molecules 3 |
| GB0601513.5 | 2006-01-25 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2007085837A1 true WO2007085837A1 (en) | 2007-08-02 |
Family
ID=36060850
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2007/000258 Ceased WO2007085837A1 (en) | 2006-01-20 | 2007-01-25 | Binding molecules |
Country Status (13)
| Country | Link |
|---|---|
| US (1) | US20090169548A1 (enExample) |
| EP (1) | EP1989229A1 (enExample) |
| JP (1) | JP2009524422A (enExample) |
| KR (1) | KR20080106201A (enExample) |
| CN (1) | CN101472946A (enExample) |
| AU (1) | AU2007209130A1 (enExample) |
| BR (1) | BRPI0706737A2 (enExample) |
| CA (1) | CA2637945A1 (enExample) |
| GB (1) | GB0601513D0 (enExample) |
| RU (1) | RU2008134519A (enExample) |
| TW (1) | TW200808824A (enExample) |
| WO (1) | WO2007085837A1 (enExample) |
| ZA (1) | ZA200806492B (enExample) |
Cited By (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8629246B2 (en) | 2007-09-26 | 2014-01-14 | Ucb Pharma S.A. | Dual specificity antibody fusions |
| WO2015036582A3 (en) * | 2013-09-16 | 2015-08-13 | Sergej Michailovic Kiprijanov | Tetravalent homodimeric antigen-binding proteins |
| WO2016087416A1 (en) * | 2014-12-03 | 2016-06-09 | F. Hoffmann-La Roche Ag | Multispecific antibodies |
| US9788534B2 (en) | 2013-03-18 | 2017-10-17 | Kymab Limited | Animal models and therapeutic molecules |
| US9879095B2 (en) | 2010-08-24 | 2018-01-30 | Hoffman-La Roche Inc. | Bispecific antibodies comprising a disulfide stabilized-Fv fragment |
| US9890204B2 (en) | 2009-04-07 | 2018-02-13 | Hoffmann-La Roche Inc. | Trivalent, bispecific antibodies |
| US9896516B2 (en) | 2012-03-28 | 2018-02-20 | Kymab Limited | Animal models and therapeutic molecules |
| US9924705B2 (en) | 2012-03-28 | 2018-03-27 | Kymab Limited | Animal models and therapeutic molecules |
| US9963716B2 (en) | 2011-09-26 | 2018-05-08 | Kymab Limited | Chimaeric surrogate light chains (SLC) comprising human VpreB |
| US9994646B2 (en) | 2009-09-16 | 2018-06-12 | Genentech, Inc. | Coiled coil and/or tether containing protein complexes and uses thereof |
| US10064398B2 (en) | 2009-07-08 | 2018-09-04 | Kymab Limited | Animal models and therapeutic molecules |
| US10149462B2 (en) | 2013-10-01 | 2018-12-11 | Kymab Limited | Animal models and therapeutic molecules |
| US10251377B2 (en) | 2012-03-28 | 2019-04-09 | Kymab Limited | Transgenic non-human vertebrate for the expression of class-switched, fully human, antibodies |
| WO2019070901A1 (en) * | 2017-10-04 | 2019-04-11 | Amgen Inc. | IMMUNOGLOBULIN FUSIONS OF TRANSTHYRETIN |
| US10323099B2 (en) | 2013-10-11 | 2019-06-18 | Hoffmann-La Roche Inc. | Multispecific domain exchanged common variable light chain antibodies |
| US10358493B2 (en) | 2014-05-29 | 2019-07-23 | Ucb Biopharma Sprl | Bispecific format suitable for use in high-through-put screening |
| US10370447B2 (en) | 2014-07-16 | 2019-08-06 | Ucb Biopharma Sprl | Molecules with specificity for CD79 and CD22 |
| US10407513B2 (en) | 2008-09-26 | 2019-09-10 | Ucb Biopharma Sprl | Biological products |
| WO2020049128A1 (en) * | 2018-09-06 | 2020-03-12 | Kymab Limited | Antigen-binding molecules comprising unpaired variable domains |
| US10590197B2 (en) | 2015-07-16 | 2020-03-17 | Ucb Biopharma Sprl | Antibody molecules which bind CD22 |
| US10611825B2 (en) | 2011-02-28 | 2020-04-07 | Hoffmann La-Roche Inc. | Monovalent antigen binding proteins |
| US10618957B2 (en) | 2015-07-16 | 2020-04-14 | Ucb Biopharma Sprl | Antibody molecules which bind CD79 |
| US10618979B2 (en) | 2015-12-03 | 2020-04-14 | Ucb Biopharma Sprl | Multispecific antibodies |
| US10640555B2 (en) | 2009-06-16 | 2020-05-05 | Hoffmann-La Roche Inc. | Bispecific antigen binding proteins |
| US10667501B2 (en) | 2012-05-17 | 2020-06-02 | Kymab Limited | Transgenic non-human vertebrate for the in vivo production of dual specificity immunoglobulins or hypermutated heavy chain only immunoglobulins |
| US10730930B2 (en) | 2013-05-02 | 2020-08-04 | Kymab Limited | Antibodies, variable domains and chains tailored for human use |
| US10774157B2 (en) | 2015-12-03 | 2020-09-15 | UCB Biopharma SRL | Multispecific antibodies |
| US10774152B2 (en) | 2014-07-16 | 2020-09-15 | Ucb Biopharma Sprl | Molecules with specificity for CD45 and CD79 |
| US10793621B2 (en) | 2011-02-28 | 2020-10-06 | Hoffmann-La Roche Inc. | Nucleic acid encoding dual Fc antigen binding proteins |
| US10829566B2 (en) | 2015-12-03 | 2020-11-10 | UCB Biopharma SRL | Method employing bispecific antibodies |
| US10946104B2 (en) | 2012-01-13 | 2021-03-16 | Apo-Tb.V. | Aberrant cell-restricted immunoglobulins provided with a toxic moiety |
| US10954312B2 (en) | 2015-12-03 | 2021-03-23 | UCB Biopharma SRL | Method employing bispecific protein complex |
| US11051497B2 (en) | 2011-09-19 | 2021-07-06 | Kymab Limited | Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics |
| US11098115B2 (en) | 2011-09-29 | 2021-08-24 | Apo-T B.V. | Multi-specific binding molecules targeting aberrant cells |
| US11286312B2 (en) | 2015-12-03 | 2022-03-29 | UCB Biopharma SRL | Multispecific antibodies |
| US11692041B2 (en) | 2015-07-16 | 2023-07-04 | UCB Biopharma SRL | Antibody molecules which bind CD45 |
| US11707056B2 (en) | 2013-05-02 | 2023-07-25 | Kymab Limited | Animals, repertoires and methods |
| EP4130046A4 (en) * | 2020-03-31 | 2024-04-24 | Biotheus Inc. | Platform for constructing multispecific antibody |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SG11201401422VA (en) * | 2011-10-27 | 2014-09-26 | Genmab As | Production of heterodimeric proteins |
| CN102851338A (zh) * | 2012-07-25 | 2013-01-02 | 苏州康宁杰瑞生物科技有限公司 | 利用电荷排斥作用制备同二聚体蛋白混合物的方法 |
| US10358497B2 (en) | 2015-09-29 | 2019-07-23 | Amgen Inc. | Methods of treating cardiovascular disease with an ASGR inhibitor |
| MX2021014931A (es) | 2019-06-07 | 2022-01-24 | Amgen Inc | Construcciones de union biespecificas con enlazadores selectivamente escindibles. |
| US20230203198A1 (en) | 2020-06-04 | 2023-06-29 | Amgen Inc. | Bispecific binding constructs |
| CA3203468A1 (en) | 2020-12-03 | 2022-06-09 | Amgen Inc. | Immunoglobuline constructs with multiple binding domains |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0952218A2 (de) * | 1998-04-09 | 1999-10-27 | Hoechst Marion Roussel Deutschland GmbH | Einzelkettiges, mehrfach-antigenbindendes Moleküll, dessen Herstellung und Verwendung |
| WO2002002781A1 (en) * | 2000-06-30 | 2002-01-10 | Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw | Heterodimeric fusion proteins |
| WO2006008548A2 (en) * | 2004-07-22 | 2006-01-26 | Erasmus University Medical Centre Rotterdam | Binding molecules |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1558647B1 (en) * | 2002-11-08 | 2015-06-10 | Ablynx N.V. | Single domain antibodies directed against tumour necrosis factor-alpha and uses therefor |
| US7612181B2 (en) * | 2005-08-19 | 2009-11-03 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
-
2006
- 2006-01-25 GB GBGB0601513.5A patent/GB0601513D0/en not_active Ceased
-
2007
- 2007-01-25 US US12/161,986 patent/US20090169548A1/en not_active Abandoned
- 2007-01-25 RU RU2008134519/13A patent/RU2008134519A/ru not_active Application Discontinuation
- 2007-01-25 KR KR1020087020710A patent/KR20080106201A/ko not_active Withdrawn
- 2007-01-25 TW TW096102902A patent/TW200808824A/zh unknown
- 2007-01-25 CN CNA200780010769XA patent/CN101472946A/zh active Pending
- 2007-01-25 ZA ZA200806492A patent/ZA200806492B/xx unknown
- 2007-01-25 EP EP07705029A patent/EP1989229A1/en not_active Withdrawn
- 2007-01-25 JP JP2008551872A patent/JP2009524422A/ja active Pending
- 2007-01-25 WO PCT/GB2007/000258 patent/WO2007085837A1/en not_active Ceased
- 2007-01-25 CA CA002637945A patent/CA2637945A1/en not_active Abandoned
- 2007-01-25 AU AU2007209130A patent/AU2007209130A1/en not_active Abandoned
- 2007-01-25 BR BRPI0706737-2A patent/BRPI0706737A2/pt not_active IP Right Cessation
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0952218A2 (de) * | 1998-04-09 | 1999-10-27 | Hoechst Marion Roussel Deutschland GmbH | Einzelkettiges, mehrfach-antigenbindendes Moleküll, dessen Herstellung und Verwendung |
| WO2002002781A1 (en) * | 2000-06-30 | 2002-01-10 | Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw | Heterodimeric fusion proteins |
| WO2006008548A2 (en) * | 2004-07-22 | 2006-01-26 | Erasmus University Medical Centre Rotterdam | Binding molecules |
Non-Patent Citations (5)
| Title |
|---|
| CARTER PAUL: "Bispecific human IgG by design", JOURNAL OF IMMUNOLOGICAL METHODS, ELSEVIER SCIENCE PUBLISHERS B.V.,AMSTERDAM, NL, vol. 248, no. 1-2, 2001, pages 7 - 15, XP002974199, ISSN: 0022-1759 * |
| ELS CONRATH K ET AL: "Camel single-domain antibodies as modular building units in bispecific and bivalent antibody constructs", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM,, US, vol. 276, no. 10, 9 March 2001 (2001-03-09), pages 7346 - 7350, XP002248402, ISSN: 0021-9258 * |
| HOLLIGER PHILIPP ET AL: "ENGINEERED ANTIBODY FRAGMENTS AND THE RISE OF SINGLE DOMAINS", NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 23, no. 9, September 2005 (2005-09-01), pages 1126 - 1136, XP008076746, ISSN: 1087-0156 * |
| JENDREYKO NINA ET AL: "Intradiabodies, bispecific, tetravalent antibodies for the simultaneous functional knockout of two cell surface receptors.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 278, no. 48, 28 November 2003 (2003-11-28), pages 47812 - 47819, XP002430788, ISSN: 0021-9258 * |
| PLUCKTHUN A ET AL: "New protein engineering approaches to multivalent and bispecific antibody fragments", IMMUNOTECHNOLOGY, ELSEVIER SCIENCE PUBLISHERS BV, NL, vol. 3, no. 2, June 1997 (1997-06-01), pages 83 - 105, XP004126672, ISSN: 1380-2933 * |
Cited By (67)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9309327B2 (en) | 2007-09-26 | 2016-04-12 | Ucb Pharma S.A. | Dual specificity antibody fusions |
| US11427650B2 (en) | 2007-09-26 | 2022-08-30 | UCB Biopharma SRL | Dual specificity antibody fusions |
| US10100130B2 (en) | 2007-09-26 | 2018-10-16 | Ucb Biopharma Sprl | Dual specificity antibody fusions |
| US8629246B2 (en) | 2007-09-26 | 2014-01-14 | Ucb Pharma S.A. | Dual specificity antibody fusions |
| US9828438B2 (en) | 2007-09-26 | 2017-11-28 | Ucb Pharma S.A. | Dual specificity antibody fusions |
| US10407513B2 (en) | 2008-09-26 | 2019-09-10 | Ucb Biopharma Sprl | Biological products |
| US9890204B2 (en) | 2009-04-07 | 2018-02-13 | Hoffmann-La Roche Inc. | Trivalent, bispecific antibodies |
| US11993642B2 (en) | 2009-04-07 | 2024-05-28 | Hoffmann-La Roche Inc. | Trivalent, bispecific antibodies |
| US11673945B2 (en) | 2009-06-16 | 2023-06-13 | Hoffmann-La Roche Inc. | Bispecific antigen binding proteins |
| US10640555B2 (en) | 2009-06-16 | 2020-05-05 | Hoffmann-La Roche Inc. | Bispecific antigen binding proteins |
| US11606941B2 (en) | 2009-07-08 | 2023-03-21 | Kymab Limited | Animal models and therapeutic molecules |
| US11812731B2 (en) | 2009-07-08 | 2023-11-14 | Kymab Ltd. | Animal models and therapeutic molecules |
| US10165763B2 (en) | 2009-07-08 | 2019-01-01 | Kymab Limited | Animal models and therapeutic molecules |
| US11564380B2 (en) | 2009-07-08 | 2023-01-31 | Kymab Limited | Animal models and therapeutic molecules |
| US10064398B2 (en) | 2009-07-08 | 2018-09-04 | Kymab Limited | Animal models and therapeutic molecules |
| US9994646B2 (en) | 2009-09-16 | 2018-06-12 | Genentech, Inc. | Coiled coil and/or tether containing protein complexes and uses thereof |
| US9879095B2 (en) | 2010-08-24 | 2018-01-30 | Hoffman-La Roche Inc. | Bispecific antibodies comprising a disulfide stabilized-Fv fragment |
| US10611825B2 (en) | 2011-02-28 | 2020-04-07 | Hoffmann La-Roche Inc. | Monovalent antigen binding proteins |
| US10793621B2 (en) | 2011-02-28 | 2020-10-06 | Hoffmann-La Roche Inc. | Nucleic acid encoding dual Fc antigen binding proteins |
| US11051497B2 (en) | 2011-09-19 | 2021-07-06 | Kymab Limited | Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics |
| US9963716B2 (en) | 2011-09-26 | 2018-05-08 | Kymab Limited | Chimaeric surrogate light chains (SLC) comprising human VpreB |
| US11098115B2 (en) | 2011-09-29 | 2021-08-24 | Apo-T B.V. | Multi-specific binding molecules targeting aberrant cells |
| US10946104B2 (en) | 2012-01-13 | 2021-03-16 | Apo-Tb.V. | Aberrant cell-restricted immunoglobulins provided with a toxic moiety |
| US9924705B2 (en) | 2012-03-28 | 2018-03-27 | Kymab Limited | Animal models and therapeutic molecules |
| US11297811B2 (en) | 2012-03-28 | 2022-04-12 | Kymab Limited | Transgenic non-human vertebrate for the expression of class-switched, fully human, antibodies |
| US9896516B2 (en) | 2012-03-28 | 2018-02-20 | Kymab Limited | Animal models and therapeutic molecules |
| US10251377B2 (en) | 2012-03-28 | 2019-04-09 | Kymab Limited | Transgenic non-human vertebrate for the expression of class-switched, fully human, antibodies |
| US9938357B2 (en) | 2012-03-28 | 2018-04-10 | Kymab Limited | Animal models and therapeutic molecules |
| US9938358B2 (en) | 2012-03-28 | 2018-04-10 | Kymab Limited | Animal models and therapeutic molecules |
| US10774155B2 (en) | 2012-03-28 | 2020-09-15 | Kymab Limited | Animal models and therapeutic molecules |
| US10667501B2 (en) | 2012-05-17 | 2020-06-02 | Kymab Limited | Transgenic non-human vertebrate for the in vivo production of dual specificity immunoglobulins or hypermutated heavy chain only immunoglobulins |
| US11297810B2 (en) | 2013-03-18 | 2022-04-12 | Kymab Limited | Animal models and therapeutic molecules |
| US9788534B2 (en) | 2013-03-18 | 2017-10-17 | Kymab Limited | Animal models and therapeutic molecules |
| US10226033B2 (en) | 2013-03-18 | 2019-03-12 | Kymab Limited | Animal models and therapeutic molecules |
| US10730930B2 (en) | 2013-05-02 | 2020-08-04 | Kymab Limited | Antibodies, variable domains and chains tailored for human use |
| US11820810B2 (en) | 2013-05-02 | 2023-11-21 | Kymab Limited | Antibodies, variable domains and chains tailored for human use |
| US11707056B2 (en) | 2013-05-02 | 2023-07-25 | Kymab Limited | Animals, repertoires and methods |
| WO2015036582A3 (en) * | 2013-09-16 | 2015-08-13 | Sergej Michailovic Kiprijanov | Tetravalent homodimeric antigen-binding proteins |
| US10149462B2 (en) | 2013-10-01 | 2018-12-11 | Kymab Limited | Animal models and therapeutic molecules |
| US11399522B2 (en) | 2013-10-01 | 2022-08-02 | Kymab Limited | Animal models and therapeutic molecules |
| US10323099B2 (en) | 2013-10-11 | 2019-06-18 | Hoffmann-La Roche Inc. | Multispecific domain exchanged common variable light chain antibodies |
| US10358493B2 (en) | 2014-05-29 | 2019-07-23 | Ucb Biopharma Sprl | Bispecific format suitable for use in high-through-put screening |
| US10370447B2 (en) | 2014-07-16 | 2019-08-06 | Ucb Biopharma Sprl | Molecules with specificity for CD79 and CD22 |
| US11261252B2 (en) | 2014-07-16 | 2022-03-01 | UCB Biopharma SRL | Molecules with specificity for CD79 and CD22 |
| US10774152B2 (en) | 2014-07-16 | 2020-09-15 | Ucb Biopharma Sprl | Molecules with specificity for CD45 and CD79 |
| CN107001482B (zh) * | 2014-12-03 | 2021-06-15 | 豪夫迈·罗氏有限公司 | 多特异性抗体 |
| CN107001482A (zh) * | 2014-12-03 | 2017-08-01 | 豪夫迈·罗氏有限公司 | 多特异性抗体 |
| US10633457B2 (en) | 2014-12-03 | 2020-04-28 | Hoffmann-La Roche Inc. | Multispecific antibodies |
| WO2016087416A1 (en) * | 2014-12-03 | 2016-06-09 | F. Hoffmann-La Roche Ag | Multispecific antibodies |
| US11999801B2 (en) | 2014-12-03 | 2024-06-04 | Hoffman-La Roche Inc. | Multispecific antibodies |
| US11692041B2 (en) | 2015-07-16 | 2023-07-04 | UCB Biopharma SRL | Antibody molecules which bind CD45 |
| US11472879B2 (en) | 2015-07-16 | 2022-10-18 | UCB Biopharma SRL | Antibody molecules which bind CD22 |
| US12331117B2 (en) | 2015-07-16 | 2025-06-17 | UCB Biopharma SRL | Antibody molecules which bind CD22 |
| US10590197B2 (en) | 2015-07-16 | 2020-03-17 | Ucb Biopharma Sprl | Antibody molecules which bind CD22 |
| US10618957B2 (en) | 2015-07-16 | 2020-04-14 | Ucb Biopharma Sprl | Antibody molecules which bind CD79 |
| US10618979B2 (en) | 2015-12-03 | 2020-04-14 | Ucb Biopharma Sprl | Multispecific antibodies |
| US11286312B2 (en) | 2015-12-03 | 2022-03-29 | UCB Biopharma SRL | Multispecific antibodies |
| US10954312B2 (en) | 2015-12-03 | 2021-03-23 | UCB Biopharma SRL | Method employing bispecific protein complex |
| US10829566B2 (en) | 2015-12-03 | 2020-11-10 | UCB Biopharma SRL | Method employing bispecific antibodies |
| US10774157B2 (en) | 2015-12-03 | 2020-09-15 | UCB Biopharma SRL | Multispecific antibodies |
| US12269898B2 (en) | 2017-10-04 | 2025-04-08 | Amgen Inc. | Transthyretin immunoglobulin fusions |
| CN111164101A (zh) * | 2017-10-04 | 2020-05-15 | 安进公司 | 甲状腺素视黄质运载蛋白免疫球蛋白融合体 |
| WO2019070901A1 (en) * | 2017-10-04 | 2019-04-11 | Amgen Inc. | IMMUNOGLOBULIN FUSIONS OF TRANSTHYRETIN |
| CN111164101B (zh) * | 2017-10-04 | 2025-04-25 | 安进公司 | 甲状腺素视黄质运载蛋白免疫球蛋白融合体 |
| WO2020049128A1 (en) * | 2018-09-06 | 2020-03-12 | Kymab Limited | Antigen-binding molecules comprising unpaired variable domains |
| US12473378B2 (en) | 2018-09-06 | 2025-11-18 | Kymab Limited | Antigen-binding molecules comprising unpaired variable domains |
| EP4130046A4 (en) * | 2020-03-31 | 2024-04-24 | Biotheus Inc. | Platform for constructing multispecific antibody |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20080106201A (ko) | 2008-12-04 |
| GB0601513D0 (en) | 2006-03-08 |
| ZA200806492B (en) | 2009-12-30 |
| CN101472946A (zh) | 2009-07-01 |
| US20090169548A1 (en) | 2009-07-02 |
| JP2009524422A (ja) | 2009-07-02 |
| EP1989229A1 (en) | 2008-11-12 |
| TW200808824A (en) | 2008-02-16 |
| CA2637945A1 (en) | 2007-08-02 |
| RU2008134519A (ru) | 2010-02-27 |
| AU2007209130A1 (en) | 2007-08-02 |
| BRPI0706737A2 (pt) | 2011-04-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20090169548A1 (en) | Binding molecules | |
| US10906970B2 (en) | Methods of making heavy chain only antibodies using transgenic animals | |
| WO2008122886A2 (en) | Transgenic non-human mammal with homodimeric vh binding complex | |
| MX2008009686A (en) | Binding molecules | |
| AU2011203061B2 (en) | Binding molecules |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780010769.X Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2637945 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007209130 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12161986 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008551872 Country of ref document: JP Ref document number: MX/a/2008/009686 Country of ref document: MX Ref document number: 6503/DELNP/2008 Country of ref document: IN |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2007209130 Country of ref document: AU Date of ref document: 20070125 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2007209130 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007705029 Country of ref document: EP Ref document number: 1020087020710 Country of ref document: KR |
|
| ENP | Entry into the national phase |
Ref document number: 2008134519 Country of ref document: RU Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: PI0706737 Country of ref document: BR Kind code of ref document: A2 Effective date: 20080725 |