WO2007071069A1 - Oligonucleotides presentant plusieurs elements cis, servant de leurre a un facteur de transcription - Google Patents

Oligonucleotides presentant plusieurs elements cis, servant de leurre a un facteur de transcription Download PDF

Info

Publication number
WO2007071069A1
WO2007071069A1 PCT/CA2006/002125 CA2006002125W WO2007071069A1 WO 2007071069 A1 WO2007071069 A1 WO 2007071069A1 CA 2006002125 W CA2006002125 W CA 2006002125W WO 2007071069 A1 WO2007071069 A1 WO 2007071069A1
Authority
WO
WIPO (PCT)
Prior art keywords
cis elements
decoy
decoy oligodeoxynucleotide
cis
oligodeoxynucleotide
Prior art date
Application number
PCT/CA2006/002125
Other languages
English (en)
Inventor
Zhiguo Wang
Original Assignee
Institut De Cardiologie De Montreal
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut De Cardiologie De Montreal filed Critical Institut De Cardiologie De Montreal
Priority to CA002634291A priority Critical patent/CA2634291A1/fr
Priority to US12/086,852 priority patent/US20090227661A1/en
Publication of WO2007071069A1 publication Critical patent/WO2007071069A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/13—Decoys

Definitions

  • the present invention relates to decoy oligodeoxynucleotides and their use in gene expression modulation. Specifically, the present invention comprises decoy oligodeoxynucleotides including multiple cis elements each targeting a transcription factor and methods of using same.
  • the 'drug cocktail' therapy of AIDS is one example of such a strategy (Henkel, 1999) and similar approaches have been used for a variety of other diseases including cancers (Charpentier, 2002; Konlee, 1998; Kumar, 2005; Lin et al., 2005b; Nabholtz and Gligorov, 2005; Ogihara, 2003).
  • the currently available 'drug-cocktail' therapy is costly and may involve complicated treatment regimen, undesired drug-drug interactions and increased side effects as well (Konlee, 1998).
  • the decoy oligodeoxynucleotides (dODN) technology of the present invention involves synthetic double-stranded ODNs containing a cis- element with high affinity for a target transcription factor (TF) but with low affinity for non-target TFs.
  • the dODNs can bind the target TF after being introduced into target cells competitively inhibiting endogenous cis-trans interactions, leading to removal of trans-factors from the endogenous cis-element with subsequent modulation of gene expression (Morishita et al., 1995 & 1997).
  • the use of dODN is therefore promising for the treatment of many diseases as it allows for the downregulation of the genes transcribed by the target TFS.
  • TFs bind to a cis-element in a cooperative manner, where one molecule of TF binds weakly, but multiple molecules of the same TF engage in protein-protein interactions that increase each of their bindings to the cis-element.
  • a dODN To facilitate TF binding to a dODN, one can elevate molar concentration of the dODNs, but this may well elicit toxicity.
  • the invention concerns an innovative decoy oligodeoxynucleotide
  • dODN complex decoy oligodeoxynucleotides
  • the cdODN targeting NF- ⁇ B, E2F and Stat3 together demonstrated more than two-fold enhancement of the efficacy and two orders of magnitude increases in potency, compared with each of the separate dODNs or the combination of all three separate dODNs.
  • the cdODN also showed an earlier onset and longer-lasting action.
  • the cdODN demonstrated an ability to attack multiple molecules critical to cancer progression via multiple mechanisms, leading to elimination or regression.
  • cdODNs knocked down expression of the genes regulated by the target transcription factors.
  • the cdODN strategy offers resourceful combinations of varying cis-elements for concomitantly targeting multiple molecules in cancer and other biological processes and opens the door to 'one drug-multiple targets' therapy for a broad range of mammalian diseases.
  • dODN simplex decoy ODN
  • cdODN complex decoy ODN
  • the invention provides a double-stranded decoy oligodeoxynucleotide, the decoy oligodeoxynucleotide comprising a first strand of deoxynucleotides and a second strand of deoxynucleotides substantially complementary to the first strand of deoxynucleotides, the decoy oligodeoxynucleotide comprising at least two cis elements, each of the cis elements specifically targeting a transcription factor.
  • the decoy oligodeoxynucleotide as defined in claim 1 wherein the cis elements all target specifically the same transcription factor.
  • the decoy oligodeoxynucleotide have cis elements that are substantially identical.
  • the cis elements target specifically different transcription factors.
  • Non-limiting examples of cis elements usable in the present invention includes cis elements cis elements targeting specifically and simultaneously at least two transcription factors selected from the group consisting of : NF- ⁇ B, E2F, Stat3, SNAIL, a transcription factor targeting the estrogen receptor responsive element, Brn-3b, SLUG and Ets-binding sites.
  • Other non-limiting examples of cis elements usable in the present invention includes cis elements targeting specifically and simultaneously at least two transcription factors selected from the group consisting of : tumor necrosis factor-alpha, GATA-4, FOG-2 and Janus tyrosine kinase-signal transducer and activator of transcription, Irx5, Irx3 and Etv1.
  • one of the cis elements is comprised in the first strand of deoxynucleotides and another one of the cis elements is in the second strand of deoxynucleotides.
  • decoy oligodeoxynucleotide as defined in claim 1 wherein one of the first and second strands of deoxynucleotides has the sequence set forth in one of the following SEQ Ids: [0015] GAGUGGGATTTCUCCAGCGTG (SEQ ID NO. 04)
  • At least one of the cis elements has the sequence set forth in one of the following SEQ IDs
  • AAAGCGCG (SEQ ID No. 02)
  • the decoy oligodeoxynucleotide includes at least three cis elements, the at least three cis elements having respectively the sequences set forth in SEQ IDs NOs: 1 , 2 and 3.
  • the invention provides a method for treating or preventing a disease in a mammal, the disease resulting from the increased presence of a specific transcription factor, the method comprising the administration to the mammal of a therapeutically effective amount of a decoy oligodeoxynucleotide, the decoy oligodeoxynucleotide comprising at least two cis elements, each of the cis elements specifically targeting a respective transcription factor, at least one of the cis elements specifically targeting the specific transcription factor.
  • the decoy oligodeoxynucleotide is carried in a pharmaceutically acceptable carrier.
  • a non-limiting example of a disease treatable or preventable using the above method include cancer, such as breast cancer and lung cancer.
  • the cancer may include cancer cells from a cell line selected from breast cancel cell line SK-BR-3, breast cancer cell line MCF-7 and lung cancer cell line A549.
  • Other non- limiting examples of a diseases treatable or preventable using the above method include heart failure and arrhythmia.
  • the method may result in an inhibition in the growth of a tumor.
  • the invention provides a method for reducing tumor growth in a mammal, the method comprising the administration to the mammal of a therapeutically effective amount of a substance simultaneously reducing the expression of transcription factors NF- ⁇ B, E2F and Stat3.
  • the substance is administered intra-tumorally.
  • the substance includes a decoy oligodeoxynucleotide comprising a first strand of deoxynucleotides and a second strand of deoxynucleotides substantially complementary to the first strand of deoxynucleotides and bound thereto, the decoy oligodeoxynucleotide comprising at least three cis elements, the at least three cis elements each specifically targeting a respective transcription factor selected from transcription factors NF- ⁇ B, E2F and Stat3.
  • the invention provides a method for interfering with the expression of at least two genes in mammalian cells, the expression of each of the at least two genes being regulated by a respective transcription factor, the method comprising the transfection in the cells of a decoy oligodeoxynucleotide, the decoy oligodeoxynucleotide comprising at least two cis elements, each of the cis elements specifically targeting one of the respective transcription factors, the decoy oligodeoxynucleotide being administered in an amount effective for substantially reducing the regulatory action of each of the transcription factors.
  • each of the cis element is identical with a target core sequence of the respective transcription factor targeted by the cis element.
  • each of the cis elements is between 8 and 9 bases long.
  • the subject is a non-human mammal or a human.
  • strands of deoxynucleotide are substantially complementary to each other if they are stable at their intended use temperature and are able to have a biological effect on their target transcription factors. Thus, they need not be 100% complementary to each other.
  • Cis elements are substantially identical if they are identical to each other or if they have the same effect on their target transcription factor, i.e. the ability to successfully compete with endogenous TF binding sites.
  • a cis element specifically targets a TF if it produces significant biological effects onto that TF while producing negligible biological effects on other TF. Also, for the purpose of this document, the terminology cis element applies to a sequence of oligonucleotide.
  • the present invention has the potential to enhance the effect of dODNs on mammalian cells while reducing the toxicity of these dODNs.
  • the present invention decreases the delay required to obtain biologically significant effects after the administration of dODNs.
  • Figure 1 illustrates decoy oligodeoxynucleotides (dODNs) sequences designed to specifically target various transcription factors (TFs); the consensus binding sites are in bold and underlined, and the number of consensus binding sites for the specified TF is indicated by the value in the subscript; the substituted nucleotides are indicated by the enlarged letters; for convenience, the negative control are labeled ODNs NC1 , NC2 and NC3;
  • dODNs decoy oligodeoxynucleotides
  • NC1 and NC2 are scrambled ODNs and NC3 is a mutated NES with nucleotide substitution in the core sequences of the cis-elements (see Figure 1); panel (B) : comparison of decreases in cell viability produced by NES and co- transfection of the three sdODNs (N+E+S) as a combination treatment.
  • Figure 4 illustrates the validation of the cdODN technology as an anti-cancer therapeutic approach in an in vivo s.c. model of tumors induced by SKBr-3 cells in nude mice;
  • Figure 5 illustrates the validation of dODNs' ability to bind target transcription factors (TFs) and to manipulate expression of the target genes;
  • A EMSA showing the ability of the dODNs to bind the target TFs; the numbers above each lane indicate the number of consensus cis-elements; the arrows indicate the positions of the DNA-protein complexes; NC2: negative control with a scrambled ODN; NEP — P: nuclear extract minus; Cold: in the presence of unlabeled dODNs; Anti-N (p65), Anti-E and Anti-S: treated with the antibodies directed against NF-kB, E2F and Stat3, respectively; and Anti-N/-E, Anti-E/-S and Anti-S/-N: concomitantly treated with two antibodies, as indicated; WT, wild-type NES; MT, mutant NES ( Figure 1); arrows indicate the supershift bands; (B) subcellular localization of transfected the cdODN (
  • Figure 6 illustrates the validation of dODNs' ability to bind target transcription factors (TFs) and to manipulate gene expression;
  • TFs target transcription factors
  • NC concentration-dependent downregulation of the selected genes by NES; shown are mean data from four independent samples; the data for NES and NC3 were first normalized to those for NC2 and then to the lowest concentration of NES or NC3 (0.01 nM), and NC2 data were not normalized its lowest concentration (0.01 nM); All data are expressed as relative level over control non-treated cells.
  • the double-stranded dODNs were then prepared by annealing complementary single stranded oligodeoxynucleotides (Figure 1) by heating to 95 0 C for 10 min followed by cooling to room temperature (RT) slowly over 2 h.
  • Electrophoresis mobility shift assay (EMSA).
  • the dODNs were labeled by mixing 4 ⁇ l (50 ng) annealed dODNs with 4 ⁇ l T4 kinase buffer (5x), 1 ⁇ l DTT (0.1 M), 6 ⁇ l [ ⁇ - 32 P]-ATP, 3 ⁇ l ddH 2 O and 2 ⁇ l T4 kinase.
  • the sample was incubated at 37 0 C for 1 h and then 80 ⁇ l TE (10 mM Tris-HCL pH 8.0) was added to complete the reaction.
  • the sample was then loaded into the G-25 column and centrifuged at 7000 g for 2 min.
  • the nuclear extract of human cancer cell lines SKBr-3 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Binding reactions were carried out at RT for 15 min in a buffer containing 1.2 ⁇ g nuclear extracts in 10 ⁇ l H 2 O and 8 ⁇ l of master mix (12x) containing 1 M Tris-HCI (pH7.5), 0.5 M EDTA, 5 M NaCI, 1 M DTT, 50% glycerol, 100 mg/ml BSA, and 1 mg/ml poly dldC.
  • Decoy ODN transfection The cells were transfected with different concentrations of dODNs using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). For viability studies, cells were seeded in 96-well tissue culture plates. At 50% confluence, the cells were washed with serum-free medium once and then incubated with 50 ⁇ l fresh fetal bovine serum (FBS)-free medium. Decoy ODNs of varying concentrations and lipofectamine (0.25 ⁇ l) were separately mixed with 25 ⁇ l of Opti-MEM® I Reduced Serum Medium (Gibco, Grand Island, NY) for 5 min. Then the two mixtures were combined and incubated for 20 min at RT.
  • Lipofectamine 2000 Invitrogen, Carlsbad, CA.
  • FBS fresh fetal bovine serum
  • the lipofectamine.dODNs mixture was added dropwise to the cells and incubated at 37°C for 5 h. Subsequently, 25 ⁇ l fresh medium containing 30% FBS was added to the well and the cells were maintained in the culture until use, either for cell growth assays or for RNA extraction.
  • Subcellular localization of transfected dODNs The dODNs were labeled with Alexa Flour 488 using ULYSISP®P Nucleic Acid Labeling kits (Invitrogen). The labeled dODNs were purified with micro Bio-spin30 columns (BioRad). The cells grown on sterile coverslips in 12-well plate were transfected with the dODNs, as described.
  • the cells were washed twice with phosphate-buffered saline (PBS) and fixed with 2% paraformaldehyde for 20 min.
  • PBS phosphate-buffered saline
  • the fixed cells were equilibrated in 2 x SSC solution (0.3 M NaCI, 0.03 M sodium Citrate, pH 7.0) and incubated with 100 ⁇ g/ml DNase-free RNase in 2 x SSC for 20 min at 37°C.
  • the sample was rinsed three times in 2 x SSC and incubated with 5 ⁇ M propidium iodide (Pl, Invitrogen) for 30 min at RT.
  • the coverslips were mounted onto slides with DABCO medium.
  • the samples were examined under a laser scanning confocal microscope (Zeiss LSM 510) with Alexa Flour 488 (excitation at 492 nm and emission at 520 nm) or with Pl (excitation at 535 nm and emission at 617 nm).
  • the images were analyzed by Zeiss LSM software suite.
  • Cell viability was determined by three methods, as previously described in detail (Wang et al., 2002; Ji et al., 2004; Lin et al., 2005b). In the first method, cells were seeded in 96-well tissue culture plates. At 50% confluence, the growth of cells was synchronized in defined serum- free medium for 5 h. The cells were then transfected with decoy ODNs as described above. Sixteen hours later, the cells were washed with PBS, harvested by trypsinization and suspended in 100 ⁇ l medium. Ten ⁇ l cell suspension was used for manual counting using hemacytometer (Sigma-Aldrich, Horsham, PA) and the counting for each sample was performed in duplicate.
  • the third method used to determine cell viability in our study was the WST-1 kit (Roche, Penzberg, Germany). Briefly, 18 h after treatment with dODNs, cells were washed with PBS and grown in 100 ⁇ l fresh culture medium plus 10 ⁇ l WST-1 reagent for 30 min. The absorbance was measured at 425 nm using a Spectra Rainbow microplate reader (TECAN, Austria) with a reference wavelength of 690 nm.
  • mice Four-week-old female BALBc nu/nu nude mice (Charles River Laboratories, Willington, MA) were housed five/cage in a pathogen-free environment Punder controlled conditions of light and humidity in the Animal House of Harbin Medical University on a standard sterilizable laboratory diet. Mice were quarantined one week before experimental manipulation and at the end of the quarantine SKBr-3 cells (5x10 6 ) were inoculated subcutaneously (s.c.) to the left dorsal flank of mice.
  • xenograft pieces were dissected from the animals injected with NES (100 nM):lipofectamine mix for 3 days and 7 days. The preparation was minced and then digested with 0.5 mg/ml collagenase type IV (SIGMA Chemical Co) at 37°C. Cells were dispersed by trituration and washed three times with PBS. The amount of cell-associated phosphorothioate ODNs was determined by flow cytometry, as described above.
  • NC negative control
  • NC1 was used and for those with cdODNs, NC2 was used. Additional control was carried out with NC3 as specified. The data presented were all normalized to their respective NCs.
  • NF- ⁇ B is known to antagonize apoptosis and promote cell proliferation
  • E2F is the major factor for the regulation of cell cycle progression
  • cumulative evidence supports a role for aberrant Stat3 activation in transformation and tumor progression partly due to its anti-apoptotic effects via repression of p53.
  • each of the cis-elements contained 100% homology to the consensus core sequences for the target TFs and optimal matrix similarity (optimal similarity with base pairs adjacent the consensus core sequence).
  • Second, multiple cis-elements were organized in a way that should produce the least non-specific binding to non-targeted TFs and this is one of the reasons that the E2F cis-element was placed on the antisense strand of the cdODN (NES, Figure 1).
  • sdODN for E2F TCTAAGTTTCGCGCCCTAGC SEQ ID No.
  • Negative control 1 TTGCCGTACCTGACTTAGCC SEQ ID NO: 1
  • the IC 50 was reduced by one order of magnitude with the homomeric cdODNs compared with their relative sdODNs, and NES further reduced the IC 50 value by another order of magnitude to the pico-molar concentration range (Figure 2). This is particularly important because the scrambled ODN for negative control (both NC1 and NC2, Figure 1) also demonstrated non- negligible though not statistically significant decreases in gene expression (10%) and cell viability (15%) at 1 ⁇ M, suggesting non-specific and toxic actions of the dODNs at higher concentrations.
  • the heterogeneous cdODN should have substantially smaller toxicity.
  • mice began to receive daily intratumoral injection of lipofectamine 2000- treated ODNs from 7 days after subcutaneous inoculation of SKBr-3 cells and the volume of tumors were measured at fixed time points up to 7 days after drug administration.
  • panel A the growth of tumors was retarded with the sdODNs NF- ⁇ B1 , E2F1 , Stat31 alone, relative to administration of a scrambled control ODN (NC2).
  • the band shift was not seen with E2F and Stat3 antibodies, the DNA bands signals were significantly decreased, indicating the specific bindings of the dODNs with their target proteins.
  • the cdODNs demonstrated remarkably greater, i.e. synergistic, binding with their respective TFs than the sdODNs, as determined by quantification of the bands using ImageQuant software.
  • the band density with NF- ⁇ B3 was 4450 ⁇ 108 (pixel), 18 times greater than that with NF- ⁇ B1 (240 ⁇ 18); similarly, E2F3 was -12 times greater than E2F1 and Stat33 was 10 times greater than Stat31.
  • the [NES]i reached a maximum level within approximately 18-24 h and the peak [NES]i was 8.1 ⁇ 0.7 nM in the presence of 100 nM [NES]O and 119.5 ⁇ 11.0 nM in the presence of 1 imM [NES]o, equivalent to -8% and -12% of the 100 nM and 1 mM [NES]o, respectively.
  • the dODNs knocked down the transcription of their respective genes.
  • Stat3 dODNs up-regulated p53 transcription, and so did NES.
  • the cdODNs consistently produced more pronounced effects on the transcription than the sdODNs.
  • NF- ⁇ B1 and NF- ⁇ B3 reduced Myc mRNA levels by -13% and -48%, respectively.
  • the heterogeneous cdODN NES affected transcription of all the genes examined in this study which are regulated by NF- ⁇ B, E2F and Stat3, respectively (Figure 6, panel A).
  • this cdODN "one drug-multiple targets" strategy is that it can be used to target one TF using a decoy containing multiple, identical cis elements or can be used to target multiple TFs using a decoy containing multiple cis elements, each or several targetting a different TF.
  • TFs comprise 6% of the human genome ranking the second position for their abundance and have recently been considered a new class of candidate targets for drug discovery (Roth, 2005).
  • dODN technology using TFs as molecular targets is emerging as a powerful strategy for gene therapy of broad range of human diseases (Mann and Dzau, 2000; Morishita et al., 2001).
  • our cdODN "one drug-multiple targets" strategy mimics the well- known 'drug-cocktail' therapy.
  • the present "one drug-multiple targets” strategy is devoid of the weaknesses of the 'drug-cocktail' therapy involving complicated treatment regimen, undesired drug-drug interactions and increased side effects as well.
  • the cdODN strategy offers resourceful combinations of varying cis-elements for concomitantly targeting multiple molecules in particular biological processes.
  • the cdODNs potentially applicable to a wide spectrum of cancers since the target oncoproteins NF- ⁇ B/E2F/Stat3 are not tissue specific. It is worthy of noting that the cdODN strategy has the potential of targeting specific types of cancers.
  • a cdODN can be designed to treat breast cancer in particular by targeting SNAIL (Martin et al., 2005), ERE (Wang et al., 2003), Brn-3b (Budhram-Mahadeo et al., 1999), SLUG (Tripathi, 2005), and EBS.
  • An ERE (estrogen receptor responsive element) decoy has been shown to be effective in suppressing breast cancer cell growth.
  • the present invention in which multiple ERE sites could be put on one decoy would be predicted to exponentially increase the efficacy of this previously tested decoy. Previous to the instant invention, such a synergy was unexpected.
  • Brn-3b is a repressor of BRCA1 and SLUG is a repressor of BRCA2 (down-regulation and/or mutations of BRCA1/2 have been shown to be critical for breast cancer development).
  • the cdODN strategy can also be applied to other disorders in addition to cancer. For instance, TNF-a, GATA-4, FOG-2, and JAK-STAT could be a reasonable set of combination for a cdODN aiming to treat heart failure by reducing apoptosis (Suzuki and Evans, 2004; Kassiri et al., 2005).
  • a cdODN targeting Irx5, Irx3 and Etv1 may be applied to reduce regional heterogeneity of cardiac repolarization so as to minimize arrhythmogenesis since these TFs have been shown to be expressed in transmural gradients across the ventricular wall (Rosati et al., 2006; Costantini et al., 2006) and to be responsible for the transmural difference of a K+ channel (Costantini et al., 2006). Therefore, the cdODN technology opens the door to 'one drug-multiple targets' intervention, providing promising prototypes of gene therapeutic agents for a wide range of human diseases.
  • the cdODN technology also opens up new opportunities for creative and rational designs of a variety of combinations integrating varying cis- elements for various purposes and provides an extraordinarily tool for functional genomics analysis related to identification and characterization of new and known transcription factors and their functions in gene controlling program. It can also be used as a simple and straightforward approach for studying any other biological processes involving multiple factors, multiple genes, multiple signaling pathways, etc.
  • Konlee MTH (1998) An evaluation of drug cocktail combinations for their immunological value in preventing/remitting opportunistic infections. HTPosit Health NewsTH 16:2-4.
  • Lin LM, Li BX, Xiao JB, Lin DH, and Yang BF (2005b) Synergistic effect of all-trans-retinoic acid and arsenic trioxide on growth inhibition and apoptosis in human hepatoma, breast cancer, and lung cancer cells in vitro.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un oligodésoxynucléotide bicaténaire servant de leurre, comprenant un premier brin de désoxynucléotides, et un second brin de désoxynucléotides sensiblement complémentaire au premier brin de désoxynucléotide. Cet oligodésoxynucléotide formant leurre comprend au moins deux éléments cis. Chaque élément cis cible spécifiquement un facteur de transcription. L'invention concerne également des méthodes d'utilisation de cet oligodésoxynucléotide formant leurre.
PCT/CA2006/002125 2005-12-22 2006-12-22 Oligonucleotides presentant plusieurs elements cis, servant de leurre a un facteur de transcription WO2007071069A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CA002634291A CA2634291A1 (fr) 2005-12-22 2006-12-22 Oligonucleotides presentant plusieurs elements cis, servant de leurre a un facteur de transcription
US12/086,852 US20090227661A1 (en) 2005-12-22 2006-12-22 Transcription factor decoy oligodeoxynucleotides having multiple cis elements

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US75236305P 2005-12-22 2005-12-22
US60/752,363 2005-12-22

Publications (1)

Publication Number Publication Date
WO2007071069A1 true WO2007071069A1 (fr) 2007-06-28

Family

ID=38188244

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2006/002125 WO2007071069A1 (fr) 2005-12-22 2006-12-22 Oligonucleotides presentant plusieurs elements cis, servant de leurre a un facteur de transcription

Country Status (3)

Country Link
US (1) US20090227661A1 (fr)
CA (1) CA2634291A1 (fr)
WO (1) WO2007071069A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100298415A1 (en) * 2009-03-23 2010-11-25 Northwestern University Targeted schiff base complexes
WO2014202640A1 (fr) * 2013-06-18 2014-12-24 Ucb Biopharma Sprl Leurres en séquence
WO2018067165A1 (fr) * 2016-10-07 2018-04-12 Miami University Virus oncolytiques modifiés comprenant des sites d'hyper-liaison en vue de séquestrer et de supprimer l'activité de facteurs de transcription oncogènes, en tant que nouveau traitement du cancer humain
WO2024044770A1 (fr) * 2022-08-26 2024-02-29 Core Biotherapeutics, Inc. Oligonucléotides pour le traitement du cancer du sein

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2022324844A1 (en) * 2021-08-04 2024-02-15 The University Of Tokyo Hairpin nucleic acid composition

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1362600A1 (fr) * 2001-02-20 2003-11-19 Anges MG Inc. Compositions pharmaceutiques contenant un leurre et procede d'utilisation associe
EP1470826A1 (fr) * 2002-02-01 2004-10-27 Anges MG Inc. Compositions pharmaceutiques contenant un leurre et procede d'utilisation
WO2004098634A2 (fr) * 2003-04-30 2004-11-18 Government Of The United States Of America As Represented By The Sercretary Of The Department Of Health And Human Services National Institutes Of Health Proteine arginine n-methyltransferase 2 (prmt-2)
US6821956B2 (en) * 1993-10-29 2004-11-23 The Brigham And Women's Hospital, Inc. Therapeutic use of cis-element decoys in vivo
WO2005079217A2 (fr) * 2003-12-19 2005-09-01 University Of Cincinnati Leurres d'oligonucleotides et leurs procedes d'utilisation

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6821956B2 (en) * 1993-10-29 2004-11-23 The Brigham And Women's Hospital, Inc. Therapeutic use of cis-element decoys in vivo
EP1362600A1 (fr) * 2001-02-20 2003-11-19 Anges MG Inc. Compositions pharmaceutiques contenant un leurre et procede d'utilisation associe
EP1470826A1 (fr) * 2002-02-01 2004-10-27 Anges MG Inc. Compositions pharmaceutiques contenant un leurre et procede d'utilisation
WO2004098634A2 (fr) * 2003-04-30 2004-11-18 Government Of The United States Of America As Represented By The Sercretary Of The Department Of Health And Human Services National Institutes Of Health Proteine arginine n-methyltransferase 2 (prmt-2)
WO2005079217A2 (fr) * 2003-12-19 2005-09-01 University Of Cincinnati Leurres d'oligonucleotides et leurs procedes d'utilisation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GAO H. ET AL.: "A single decoy oligodeoxynucleotides targeting multiple oncoproteins produces strong anticancer effects", MOLECULAR PHARMACOLOGY, vol. 70, no. 5, November 2006 (2006-11-01), pages 1621 - 1629, XP003015863 *
LEONG P. ET AL.: "Targeted inhibition of Stat3 with a decoy oligonucleotide abrogates head and neck cancer cell growth", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 100, no. 7, 1 April 2003 (2003-04-01), pages 4138 - 4143, XP005027097 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100298415A1 (en) * 2009-03-23 2010-11-25 Northwestern University Targeted schiff base complexes
WO2014202640A1 (fr) * 2013-06-18 2014-12-24 Ucb Biopharma Sprl Leurres en séquence
WO2018067165A1 (fr) * 2016-10-07 2018-04-12 Miami University Virus oncolytiques modifiés comprenant des sites d'hyper-liaison en vue de séquestrer et de supprimer l'activité de facteurs de transcription oncogènes, en tant que nouveau traitement du cancer humain
WO2024044770A1 (fr) * 2022-08-26 2024-02-29 Core Biotherapeutics, Inc. Oligonucléotides pour le traitement du cancer du sein

Also Published As

Publication number Publication date
CA2634291A1 (fr) 2007-06-28
US20090227661A1 (en) 2009-09-10

Similar Documents

Publication Publication Date Title
Denby et al. miR-21 and miR-214 are consistently modulated during renal injury in rodent models
Cogoi et al. MAZ-binding G4-decoy with locked nucleic acid and twisted intercalating nucleic acid modifications suppresses KRAS in pancreatic cancer cells and delays tumor growth in mice
Bennett et al. RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform
Fathi Dizaji Strategies to target long non-coding RNAs in cancer treatment: progress and challenges
Zhang et al. MiR-221 and miR-222 target PUMA to induce cell survival in glioblastoma
KR101201664B1 (ko) 신규한 형태의 간섭 ｒｎａ 분자
Wu et al. The miR-92b functions as a potential oncogene by targeting on Smad3 in glioblastomas
US20140080894A1 (en) Enhanced biodistribution of oligomers
US8318921B2 (en) Triggered RNAi
Gao et al. A single decoy oligodeoxynucleotides targeting multiple oncoproteins produces strong anticancer effects
KR101605932B1 (ko) Ｈｓｆ1-관련 질환을 치료하기 위한 유기 조성물
KR101142080B1 (ko) 전립선암 및 다른 암의 치료 방법 및 조성물
Di Cresce et al. Antisense treatment in human prostate cancer and melanoma
Zhang et al. Novel antisense anti-MDM2 mixed-backbone oligonucleotides: proof of principle, in vitro and in vivo activities, and mechanisms
US20090227661A1 (en) Transcription factor decoy oligodeoxynucleotides having multiple cis elements
JP4274831B2 (ja) シス・エレメントのデコイを用いる抗ガン剤
Bennett Pharmacological properties of 2-O-methoxyethyl-modified oligonucleotides
JP2007510408A (ja) Ｉａｐ核酸塩基オリゴマーおよび核酸塩基オリゴマー複合体ならびにそれらの使用
US20100113284A1 (en) Small interfering rna (sirna) target site blocking oligos and uses thereof
WO2011065677A2 (fr) Composition pharmaceutique pour le traitement du cancer
KR20120029002A (ko) 신규한 형태의 간섭 ｒｎａ 분자
Higuchi et al. Specific regulation of point-mutated K-ras-immortalized cell proliferation by a photodynamic antisense strategy
AU2017445584B2 (en) SiRNA molecule inhibiting the expression of the PCSK9 gene and use thereof
Wang et al. Polypharmacology in Drug Design and Discovery—Basis for Rational Design of Multitarget Drugs
WO2015148624A1 (fr) Blocage du développement d'une tumeur hépatique associée à une infection par le virus de l'hépatite c avec un arn antisens spécifique du vhc

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2634291

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 12086852

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06840551

Country of ref document: EP

Kind code of ref document: A1