WO2007058383A2

WO2007058383A2 - Lipid secretion promoter containing lacritin or compound having lacritin activity

Info

Publication number: WO2007058383A2
Application number: PCT/JP2006/323517
Authority: WO
Inventors: Masakatsu Higashine; Mitsuyoshi Azuma
Original assignee: Senju Pharmaceutical Co., Ltd.
Priority date: 2005-11-17
Filing date: 2006-11-17
Publication date: 2007-05-24
Also published as: WO2007058383A3

Abstract

The present invention provides an agent for promoting lipid secretion from the meibomian gland, which contains lacritin or a compound having lacritin activity. The present invention is useful for the prophylaxis, treatment or improvement of dry eye syndrome (inter alia, evaporative dry eye), meibomian gland dysfunction, meibomitis and the like.

Description

DESCRIPTION

LIPID SECRETION PROMOTER CONTAINING IACRITIN OR COMPOUND

HAVING LACRITIN ACTIVITY

Technical Field

The present invention relates to an agent for promoting lipid secretion containing lacritin or a compound having lacritin activity, a treatment method of meibomian gland dysfunction using lacritin or a compound having lacritin activity, and the like.

Background Art

Meibomian gland is present behind the both eyelids and secretes lipid. Tear fluid consists of three layers of an oily layer, an aqueous layer and a mucin layer, of which the oily layer contains, as its component, the lipid supplied from the meibomian gland, and prevents evaporation of tear fluid from the corneal and conjunctival epithelium. It is known that, in patients with meibomian gland dysfunction or meibomitis, since the function of meibomian gland is degraded and the secretion amount of lipid decreases, the patients suffer from evaporative dry eye, corneal and conjunctival epithelial disorder, corneal epithelial erosion or corneal ulcer associated with dry eye, and the like. Lacritin is a protein identified as a tear secretion promoting factor or a growth-factor-like protein (see WO 02/065943 and Sanghi, S. et al . , Journal of Molecular Biology 310, pp.127-139 (2001)). For lacritin, the following 1) to 5) are reported: 1) Lacritin has an activity as a growth factor for a corneal epithelial cell and a lacrimal gland acinar cell.

2) Lacritin shows tear protein secretion promoting effect.

3) Lacritin is expressed in a cell derived from tissues such as the lacrimal gland, parotid gland, minor salivary gland, submandibular gland, thyroid gland and corneal epithelium. 4) Eyedrops containing lacritin are likely to be useful in the treatment of ocular diseases such as dry eye syndrome, Sjogren's syndrome, and corneal epithelial wounds.

5) Compounds that bind to lacritin or lacritin receptors can be screened for using a cell expressing a lacritin receptor with a lacritin-dependent calcium signal as an index.

As mentioned above, what has heretofore been known regarding lacritin is the action as a tear protein secretion promoter, and there has been made no report on promoted lipid secretion by the action of lacritin on meibomian gland cells, and use of lacritin for the treatment and the like of evaporative dry eye.

Disclosure of the Invention It is therefore an object of the present invention to provide an agent for promoting secretion of lipid from the meibomian gland, a prophylactic/therapeutic agent for ocular diseases such as dry eye syndrome and the like derived from meibomian gland dysfunction, and the like. The present inventors diligently investigated to solve the problems described above, and found that lacritin and a compound having lacritin activity act on meibomian gland cells and promote their lipid secretion, which resulted in the completion of the present invention. Accordingly, the present invention provides the following.

(1) An agent for promoting lipid secretion from the meibomian gland, comprising lacritin or a compound having lacritin activity.

(2) The agent of (1), which is an agent for the prophylaxis or treatment of a dry eye syndrome caused by a reduced lipid secretion amount associated with functional degradation of the meibomian gland.

(3) The agent of (2), wherein the dry eye syndrome is evaporative dry eye. (4) The agent of (1), which is an agent for the prophylaxis or treatment of a meibomian gland dysfunction or meibomitis.

(5) The agent of any one of (1) to (4), which is used for topical ophthalmic administration. (6) The agent of (5), which is an eye drop.

(7) A method of screening for a compound having lacritin activity of (1), which comprises the steps of

(a) contacting meibomian gland cells with a test compound,

(b) measuring an expression amount of stearoyl-CoA desaturase- 5 in the cells contacted with the aforementioned test substance, and comparing the amount with that of cells free of contact with the test substance, and

(c) selecting a test substance that increases the expression amount of stearoyl-CoA desaturase-5, based on the aforementioned comparison results.

(8) The method of (7) wherein the stearoyl-CoA desaturase-5 is splice variant 2 of the enzyme.

(9) Use of lacritin or a compound having lacritin activity for the production of an agent for promoting lipid secretion from the meibomian gland.

(10) The use of (9) , wherein the aforementioned agent is a prophylactic or therapeutic agent for a dry eye syndrome caused by a reduced lipid secretion amount associated with functional degradation of the meibomian gland. (11) The use of (10), wherein the dry eye syndrome is evaporative dry eye.

(12) The use of (9), wherein the agent is a prophylactic or therapeutic agent for meibomian gland dysfunction or meibomitis . (13) The use of any one of (9) to (12), wherein the agent is an agent for topical ophthalmic administration.

(14) The use of (13), wherein the agent is an eye drop.

(15) A method of promoting lipid secretion from the meibomian gland, which comprises administering an effective amount of lacritin or a compound having lacritin activity to a subject in need of promotion of lipid secretion from the meibomian gland.

(16) A method for the prophylaxis or treatment of a dry eye syndrome caused by a reduced lipid secretion amount associated with functional degradation of the meibomian gland, which comprises administering an effective amount of lacritin or a compound having lacritin activity to a subject showing a decreased amount of lipid secretion associated with functional degradation of the meibomian gland. (17) The method of (16) , wherein the dry eye syndrome is evaporative dry eye.

(18) The method of (15), wherein the promotion of lipid secretion from the meibomian gland is prophylaxis or treatment of meibomian gland dysfunction or meibomitis. (19) The method of (15), wherein the administration step is topical ophthalmic administration.

(20) The method of (16), wherein the administration step is topical ophthalmic administration.

(21) The method of (19) or (20), wherein the topical ophthalmic administration is instillation.

Brief Description of the Drawings

Fig. 1 shows Oil-red-0 stained lipid accumulated in meibomian gland cells. Fig. 2 is a graph showing the effect of lacritin on the lipid synthesis in meibomian gland cells.

Best Mode for Embodying the Invention

The present invention provides an agent for promoting lipid secretion from the meibomian gland, which contains lacritin or a compound having lacritin activity (hereinafter to be also referred to as the promoter of the present invention) .

The active ingredient, lacritin, to be contained in the promoter of the present invention is not particularly limited as long as it is lacritin (protein) itself/ or any material that enables production of lacritin. For example, lacritin, a lacritin expression vector, a lacritin expression cell and the like can be used. A compound having lacritin activity, which is an active ingredient to be contained in the promoter of the present invention, may be any known or novel compound as long as it has lacritin activity. For example, a nucleic acid, a saccharide, a protein, a peptide, an organic low-molecular compound and the like can be used. "Lacritin activity" means any pharmacological action possessed by lacritin. Because lacritin is known to have actions, including growth action of a cell (e.g., ocular cells such as a corneal epithelial cell, a conjunctival cell and a lacrimal gland cell; acinar cells such as a lacrimal gland acinar cell, a salivary gland acinar cell, and a thymic acinar cell) , secretion promoting action of secretes such as tears and saliva and the like, the lacritin activity can, for example, be one of these actions. In the present -invention, lacritin activity may be a promoting action on lipid secretion from the meibomian gland.

The lacritin can be a naturally occurring or recombinant protein. Examples of the lacritin include lacritin derived from an animal including a mammal such as mouse, rat, hamster, guinea pig, rabbit, dog, monkey or -human, or from a bird such as chicken; for example, when the use in a human or a human cell is intended, human lacritin (see, for example, GenBank/EBI databank accession numbers NM_033277 (cDNA) and ay005150 (genomic) ) is preferred.

The lacritin can also be in a form distinguishable from naturally occurring lacritin. "A form distinguishable" means that there is a detectable difference between the two lacritins being compared. Examples of lacritin in a form distinguishable from naturally occurring lacritin include lacritin with an epitope such as a histidine (His) tag, Flag tag, or Myc tag added thereto. Lacritin can be prepared by a method known per se; for example, 1) lacritin may be recovered from a lacritin secretion site (e.g., lacrimal gland, corneum, conjunctivum, salivary gland and the like), 2) lacritin produced by a transformant prepared by transferring a lacritin expression vector to host cells (e.g., a bacterium of the genus Escherichia, a bacterium of the genus Bacillus, yeast, insect cells, insects, animal cells) may be recovered, or 3) lacritin may be synthesized by a cell-free system using rabbit reticulocyte lysate, wheat germ lysate, Escherichia coli lysate or the like. Lacritin is purified as appropriate by methods based on differences in solubility, such as salting- out and solvent precipitation; methods based mainly on differences in molecular weight, such as dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis; methods based on differences in electric charge, such as ion exchange chromatography; methods based on specific affinity, such as affinity chromatography and use of lacritin antibody; methods based on differences in hydrophobicity, such as reverse phase high performance liquid chromatography; methods based on differences in isoelectric point, such as isoelectric focusing; combinations thereof, and the like.

The lacritin expression vector may be a vector capable of expressing the above-described lacritin. The lacritin expression vector must be such that the polynucleotide that encodes lacritin is functionally linked to a promoter capable of exhibiting promoter activity in the target cells. The promoter used is not subject to any particular limitation, as long as it is capable of functioning in the target cells; examples include viral promoters such as SV40-derived early promoter, cytomegalovirus promoter, Rous sarcoma virus LTR, MoMuLV-derived LTR, and adenovirus-derived early promoter, mammalian constitutive protein gene promoters such as β-actin gene promoter, PGK gene promoter, and transferrin gene promoter, and the like. The promoter may also be a promoter specific to a lacritin receptor expression cell, including a promoter specific to a corneal cell (e.g., keratin 12 (krtl.12), keratocan) , a promoter specific to a conjunctival cell and the like.

The expression vector preferably comprises a transcription termination signal, i.e., a terminator region, at the downstream of the polynucleotide that encodes lacritin. It may further comprise a selection marker gene (a gene that confers resistance to a drug such as tetracycline, ampicillin, kanamycin, hygromycin, or phosphinothricin, a gene that compensates for an auxotrophic mutation, and the like) for selection of a transformant cell.

The base backbone vector used as the expression vector is not subject to any particular limitation, and includes, for example, plasmid vectors and viral vectors such as those of retrovirus, adenovirus, adeno-associated virus and Sendai virus .

When an expression vector is provided as a means capable of provision of lacritin, the expression vector may be transferred to a lacritin receptor expression cell that mediates lacritin expression. The expression vector can be transferred to the cell by a method known per se, for example, electroporation, calcium phosphate precipitation, microinjection, methods using lipids such as liposomes or cationic lipids, and the like. The expression vector (or a portion at least comprising the lacritin-coding region and a promoter region) may be incorporated in the genome of the lacritin receptor expression cell or not. Incorporation of the expression vector to the intracellular genome can be achieved using a method known per se, for example, a method using retrovirus, a method using a targeting vector enabling homologous recombination, and the like.

A "lacritin expression cell" means any cell that express lacritin even in the absence of lacritin. Examples of the lacritin expression cell¹ include a transformant obtained by transferring a lacritin expression vector to a host cell, and a naturally occurring cell that constitutively express lacritin. The lacritin expression cell can, for example, be a cell derived from an animal including a mammal such as mouse, rat, hamster, guinea pig, rabbit, dog, monkey or human, or a bird such as chicken. The lacritin expression cell can also be cell such as a lacrimal gland cell, a parotid gland cell, a minor salivary gland cell, a submandibular gland cell, a corneal cell or a conjunctival cell (these cells are known to express lacritin) or a meibomian gland cell. The lacritin expression cell can still also be a primary culture cell, a cell line derived from a primary culture cell, a cell obtained by culturing an undifferentiated cell such as a stem cell (e.g., a differentiated cell), a commercially available cell line, a cell line available from a cell bank, or the like.

In addition, it is possible to screen for and obtain a compound having lacritin activity from a group of substances so far not known to have a lacritin activity (test compounds), and use the compound as the active ingredient of the present invention. Such compound can be obtained, for example, by screening and the like using the method described in WO02/065943.

To be specific, a method of isolating a ligand that binds to lacritin polypeptide containing a natural receptor of lacritin can be used. This method includes the steps of, for example, (a) contacting lacritin polypeptide with a test compound under physiological conditions, and (b) removing non- binding and non-specifically binding substances to isolate the compound that remains bound with the lacritin polypeptide. In step (a) of the above-mentioned screening method, lacritin polypeptide is placed in contact with the test compound. It is possible to use its biologically active fragment instead of the lacritin polypeptide. The lacritin polypeptide is bound with the solid support by a standard technique to screen for a test compound. The solid support is not particularly limited as long as it is used for immobilizing of a biological compound and, for example, polystyrene, agarose, silica, nitrocellulose and the like can be used. In one embodiment, the solid surface may contain functional silica or agarose beads.

The test compound may be any known or novel compound, and include, for example, a nucleic acid, a saccharide, a lipid, a protein, a peptide, an organic low-molecular compound, a compound library prepared using combinatorial chemistry technology, a random peptide library prepared by solid phase synthesis or the phage display method, or a naturally occurring component derived from a microorganism, an animal, a plant, a marine organism or the like, or the like. In another embodiment, a compound having lacritin activity can be obtained by screening using an assay based on the cells. The method includes contacting a transfected cell with lacritin, and isolating a related gene from a cell showing lacritin-dependent calcium signaling. More preferably, in one embodiment, an available pool of orphan G protein- coupled receptor cDNA is expressed in a cell line such as HEK293T and RH7777 cells, and the transfected cells are contacted with lacritin. A transfectant showing lacritin- dependent calcium signaling should have expressed the aforementioned receptor. When a receptor to be bound to lacritin is not detected in an available pool of orphan G protein-coupled receptor cDNA, cDNA derived from the salivary gland (salivary ductal) cell library is transfected to 293T cells, and the expression product is screened for by FACS using fluorescence-labeled lacritin. In a certain embodiment, a cell expressing a receptor that can be activated by lacritin can be detected using cell-free system. More preferably, the receptor activity is detected by a GTP[γ³⁵S] binding assay using a cell membrane isolated from transfected cells. In another embodiment, a compound having lacritin activity can be obtained by the following screening method. The screening method has been completed based on the finding that the expression of a particular gene increases when meibomian gland cells are treated with lacritin. The method comprises the following -steps of

(a) contacting meibomian gland cells with a test compound,

(c) selecting a test substance that increases the expression amount of stearoyl-CoA desaturase-5, based on the aforementioned comparison results. The present invention also provides such screening method.

(a) Step of contacting meibomian gland cells with a test compound

The meibomian gland cell is, for example, a- cell derived from an animal including a mammal such as mouse, rat, hamster, guinea pig, rabbit, dog, monkey or human, or a bird such as chicken and a primary culture cell, a cell line derived from a primary culture cell, a cell obtained by culturing an undifferentiated cell such as a stem cell (e.g., a differentiated cell) , a commercially available cell line, a cell line available from a cell bank, or the like can be used. To investigate the expression amount of stearoyl-CoA desaturase-5, a cell derived from primate such as monkey, human and the like is preferable.

As the test compound, any known or novel compound can be used, as mentioned above.

As a method for contacting meibomian gland cells with a test compound, for example, meibomian gland cells are placed in a suitable medium, allowed to survive or cultured in an incubator at about 25 - 40°C, a test compound is added to the aforementioned medium, and the incubation is continued to establish a contact. While the contact time is not particularly limited, it is generally 0.5 - 8 hr .

The amount of the aforementioned test compound to be added can be appropriately determined according to the kind of the compound, solubility in a medium, sensitivity of the cell and the like.

As a control, meibomian gland cells cultured in the same manner without addition of the test compound to the medium are prepared. (b) Step of measuring an expression amount of stearoyl-CoA desaturase-5 in the cells contacted with the aforementioned test substance, and comparing the amount with that of cells free of contact with the test substance

Stearoyl-CoA desaturase-5 is a membrane protein of endoplasmic reticulum, and catalyzes production of monounsaturated fatty acid from saturated fatty acid. As the enzyme, two kinds of splice variants (variants 1 and 2) are known. In this screening method, any of them can be used as an index. Preferred is splice variant 2 since the expression remarkably increases in the presence of lacritin. For example, the base sequences and amino acid sequences of human stearoyl- CoA desaturase-5 splice variant 1 and splice variant 2 are disclosed under Genbank accession Nos. NM_001037582 and NM_024906, respectively, and stearoyl-CoA desaturase-5 of other primates such as monkey and the like can be identified by HomoloGene (http: //www.ncbi .nlm.nih. gov/HomoloGene/) based on the human sequence.

In step (b) , the expression amount of stearoyl-CoA desaturase-5 can be examined by a method known per se. For example, a method comprising extracting RNA from a cell contacted with the test compound, and measuring the expression amount of mRNA by Real-time PCR, GeneChip (trademark) , Northern blotting, dot blot method and the like, and a method comprising extracting a protein from a cell and measuring the expression amount of the protein by Western blotting, ELISA and the like can be used.

The expression amount of enzyme in a control cell free of contact with the test compound is simultaneously or separately measured, and compared with that of the enzyme in a cell contacted with the test compound.

(c) Step of selecting a test substance that increases the expression amount of stearoyl-CoA desaturase-5, based on the aforementioned comparison results In step (c) , a test compound that increases the expression of stearoyl-CoA desaturase-5 is selected based on the comparison results obtained in step (b) . As the criteria for the selection, increase in the expression of the enzyme only needs to be an index, and the level of increase in the expression amount is not less than 1.5-fold, preferably not less than 2-fold, more preferably not less than 2.5-fold. When the expression has increased, it means that the test compound has a promoting action on the lipid secretion from the meibomian gland cells and can be a candidate compound having lacritin activity.

The promoter of the present invention can be used as a pharmaceutical, a test reagent or the like, or in vivo or in vitro .

When the promoter of the present invention is used as a test reagent and, for example, added to a medium of meibomian gland cells, the amount of lipid accumulated in the cells can be increased as compared to the cells without the addition. This embodiment can be an efficient supply source for a natural oily layer constituting the tear fluid. According to the promoter, therefore, the lipid in the natural tear fluid component can be efficiently obtained. As discussed above, the promoter of the present invention can be used in various embodiments as a test reagent in the physiological and biochemical fields. When used as a pharmaceutical, the promoter of the present invention acts on meibomian gland cells and promotes lipid secretion, which in turn reduces evaporation of the aqueous layer in the tear fluid. Therefore, it is useful for the prophylaxis or treatment of dry eye syndromes caused by a reduced lipid secretion amount associated with functional degradation of the meibomian gland (disorder in corneal and conjunctival epithelium disorder, corneal epithelium erosion, corneal ulcer, etc. , which are associated with dry eye), particularly evaporative dry eye. Moreover, the promoter of the present invention is useful for the prophylaxis or treatment of a disease associated with abnormalities (decreased secretion amount, component change) in the lipid secreted into the tear fluid. As such disease, meibomian gland dysfunction, meibomitis and the like can be mentioned. In another embodiment, the promoter of the present invention can be a cell transplantation agent for transplanting a lacritin expression cell to an animal such as a mammal. In this case, the lacritin expression cell may be provided in the form of a cell sheet, cell layer or tissue equivalent for transplantation (hereinafter, optionally abbreviated as "graft") . Techniques concerning graft preparation are described in detail in, for example, WO03/084431, WO03/026712, WO03/009783, WO00/29553, WO96/13974, Japanese Patent Unexamined Publication Nos .2003-38170 and 2001-161353, US20020039788 and elsewhere. Also, the cell transplantation agent enables xenogeneic transplantation, allogeneic transplantation or syngeneic transplantation depending on the kind of lacritin expression cell contained therein and the kind of animal intended to receive the graft. For example, syngeneic transplantation in a human is desired, a graft prepared from a cell culture of meibomian gland cells collected from one eye can be transplanted to the other eye. The cell transplantation agent can, for example, be used as a prophylactic/therapeutic agent for ocular disease. The ophthalmic diseases to which application of the cell transplantation agent is desired include, for example, meibomian gland dysfunction, dry eye syndromes caused by a reduced lipid secretion amount associated with functional degradation of the meibomian gland, and a corneal and conjunctival epithelial disorder, corneal epithelial erosion, corneal ulcer, marginal blepharitis, ocular pemphigoid and the like, which are associated with dry eye.

When the promoter of the present invention is used as a pharmaceutical, it can be used in the dosage form of eye drops, patches, ointments, lotions, creams, oral agents and the like. In the present invention, lacritin or a compound having lacritin activity can be used for the production of an agent for promoting lipid secretion from the meibomian gland.

The promoter of the present invention can contain, in addition to the above-mentioned active ingredient, any carrier, such as a pharmaceutically acceptable carrier. In this case, the promoter of the present invention can also be a pharmaceutical composition.

While the administration route of the promoter of the present invention is not particularly limited as long as the aforementioned treatment effect can be afforded, topical ophthalmic administration is preferable. The dosage form of the topical ophthalmic administration includes, for example, eye drop and ophthalmic ointment. For example, when the promoter of the present invention is used as an eye drop or ophthalmic ointments, stabilizers (e.g., sodium bisulfite, thiosodium sulfate, sodium edetate, sodium citrate, ascorbic acid, dibutylhydroxytoluene and the like), dissolution aids (e.g., glycerol, propylene glycol, macrogol, polyoxyethylene hydrogenated castor oil and the like), suspending agents (e.g., polyvinylpyrrolidone, hydroxypropylmethylcellulose, hydroxymethylcellulose, sodium carboxymethylcellulose and the like), emulsifiers (e.g., polyvinylpyrrolidone, soybean lecithin, egg yolk lecithin, polyoxyethylene hydrogenated castor oil, polysorbate 80 and the like), buffers (e.g.¹, phosphate buffer, acetate buffer, boric acid buffer, carbonate buffer, citrate buffer, trisbuffer, glutamic acid, epsilon-aminocapronic acid and the like), thickener (e.g., water-soluble cellulose derivative such as methyl cellulose, hydroxyethylcellulose, hydroxypropylmethylcellulose, carboxymethylcellulose and the like, sodium chondroitin sulfate, sodium hyaluronate, carboxyvinyl polymer, polyvinyl alcohol, polyvinylpyrrolidone, macrogol and the like), preservatives (e.g., benzalkonium chloride, benzethonium chloride, chlorhexidine gluconate, chlorobutanol, benzyl alcohol, sodium dehydroacetate, paraoxybenzoates, sodium edetate, boric acid and the like) , isotonicity agents (e.g., sodium chloride, potassium chloride, glycerol, mannitol, sorbitol, boric acid, glucose, propylene glycol and the like), pH adjusting agents (e.g., hydrochloric acid, sodium hydroxide, phosphoric acid, acetic acid and the like), refreshing agents (e.g., 1-menthol, d-Camphor, d- Borneol, peppermint oil and the like) , ointment base (white petrolatum, purified lanolin, liquid paraffin, vegetable oil (olive oil, camellia oil, peanut oil and the like) and the like) and the like can be used as additives. While the amount of these additives to be added varies depending on the kind and use of additive and the like, they can be added in a concentration capable of achieving the object of the additives. When the promoter of the present invention is produced as eye drops or ophthalmic ointment, they can be produced according to the method generally employed in the field of preparations and, for example, the method described in the Japanese Pharmacopoeia Fourteenth Edition, General Rules of preparations, items of Ophthalmic Solutions and ophthalmic ointments can be employed.

The subject of administration of the promoter of the present invention is not particularly limited and various mammals including human, monkey, mouse, rat, rabbit, swine, dog, horse, bovine and the like can be mentioned. The present invention provides a method of promoting lipid secretion from the meibomian gland/ which comprises administering an effective amount of lacritin or a compound having lacritin activity to a subject in need of promotion of lipid secretion from the meibomian gland.

Furthermore, the present invention provides a method for the prophylaxis or treatment of dry eye syndrome caused by a reduced lipid secretion amount associated with functional degradation of the meibomian gland, which comprises administering an effective amount, of lacritin or a compound having lacritin activity to a subject showing a decreased amount of lipid secretion associated with functional degradation of the meibomian gland.

In the aforementioned method, the subject of administration of lacritin or a compound having lacritin activity is not particularly limited, and various mammals including human, monkey, mouse, rat, rabbit, swine, dog, horse, bovine and the like can be mentioned.

While the effective amount of lacritin or a compound having lacritin activity cannot be defined automatically since it varies depending on the kind of compound, age, body weight and condition of the subject of administration, prophylactic or treatment object and the like, for administration of lacritin to human, a solution containing lacritin at a lacritin concentration of about 0.01 - about 100 μM, preferably about 0.1 - about 100 μM, particularly preferably about 1 - about 10 μM, is administered once to 5 times a day by 1 to 3 drops for one eye per administration, namely, about 50 - 200 μL per dose. The amounts of lacritin within the ranges of such concentration and volume in the solution can be recited as examples of the effective amount.

Moreover, the present invention provides a commercial package containing the promoter of the present invention, and a written matter relating to the promoter, which describes that said preparation can or should be used for promotion of lipid secretion from the meibomian gland.

All contents mentioned in any publications mentioned herein, including patents and patent descriptions, are incorporated herein by reference to the extent that the entire disclosure of which is incorporated herein.

Examples

The present invention is hereinafter described in more detail by means of the following Examples, which, however, are not to be construed as limiting the scope of the invention. Experimental Example 1

Quantification of expression amount of lacritin mRNA in monkey ocular tissues 1. Test method

Total RNA in each ocular tissue of monkey was extracted according to the protocol using a TRIzol reagent (Invitrogen K. K.) and an RNAqueous kit (Ambion) . First, each-tissue frozen with liquid nitrogen was disrupted in an agate mortar, and homogenized with TRIzol in a homogenizer. Then, TRIzol in which the tissue had been dissolved was centrifuged (12000xg) at 4°C for 10 min. The supernatant was transferred into a new tube, chloroform (0.2 inL) was added per 1 iriL of TRIzol reagent, and the mixture was vigorously agitated for 1 min. After agitation, the mixture was incubated at room temperature for

2-3 min and centrifuged (12000xg) at 4°C for 15 min. After centrifugation, the aqueous layer was transferred into a new tube and the same amount of 75% ethanol was added. This was applied to an RNAqueous filter cartridge, rinsed with Wash solution #1 contained in the RNAqueous kit, and rinsed twice with Wash solution #2/3. The eluate (30 - 50 μL) was added, the mixture was reacted at 70°C, and RNA was eluted by a centrifugation operation. The purity of RNA was confirmed by an Agilent Bioanalyzer (Agilent Technologies) . To each of the extracted total RNA was added 1 μL of 2 Unit/mL DNaseI (Ambion) and the mixture was reacted at 37°C for 30 min. After completion of the reaction, 1.5 μL of DNase Inactivation Reagent (Ambion) was added to quench the reaction. After the reaction was quenched, the mixture was centrifuged for 1 min, the supernatant was transferred into a new tube and RNA concentration was determined from the absorbance. The total RNA (200 ng) was subjected to a reverse transcription reaction using a Random primer (Invitrogen K. K.) at 25°C for 2 min, at 42°C for 50 min, and at 70°C for 15 min. Lacritin mRNA expressed in each ocular tissue was quantified by Real-time PCR using sense primer (SEQ ID NO: 1), antisense primer (SEQ ID NO: 2) and FAM-TAMRA probe (SEQ ID NO: 3) . 10 ng of cDNA was reacted using 250 nM probe, 900 nM primer, and PCR Master Mix (Applied Biosystems) , first at 50°C for 2 min and at 95°C for 10 min, after which a reaction at 95°C for 15 sec and at 60⁰C for 1 min was repeated 45 times. The fluorescence intensity of the reaction product was measured after each elongation reaction. Each sample was quantified 3 times and the average of numerical values was taken. The data was analyzed according to the Pfaffl method. The PCR efficiency was evaluated based on an analytical curve drawn using a plasmid containing monkey lacritin cDNA. The plasmid was diluted within the range of IxIO⁴ to IxIO⁸ copies, and the reaction efficiency was calculated from the ratio of the inclination of Ct and logarithm of the copy number. The reaction efficiency was E=10^("1/slope)-l, and the Ct value was determined by the cycle number at the time the fluorescence reached the threshold. The threshold was set higher than the baseline and within the range where the PCR product is linearly amplified. 2. Test results

Table 1 shows lacritin mRNA amount expressed in each ocular tissue. The expression amounts were higher in the order of lacrimal gland, meibomian gland and corneal epithelium, and expression was hardly observed in other ocular tissues. These tissues showing lacritirv expression are tissues deeply involved in dry eye. Since one known action mechanism of lacritin is autocrine, lacritin may act on these tissues.

Table 1 Expression amount of lacritin mRNA in each ocular tissue

Lacritin specific primer, sense: CCTCAAGCAGGCAGGAACTA (SEQ ID NO: 1)

Lacritin specific primer, antisense: TCTTGCAAAGGCTTGTTCTGTTAGT

(SEQ ID NO: 2)

Fam-Tamra probe: CCCCCTGAAATCCA (SEQ ID NO: 3)

Experimental Example 2

Quantification of lipid amount in recombinant lacritin and empty vector extract

1. Preparation of recombinant lacritin and empty vector extract As for lacritin, DNA having the sequence of the lacritin gene from the initiation codon to termination codon was inserted in the pTrcHis-TOPO vector (Invitrogen K. K.) and One Shot competent cells (Invitrogen K. K.) were transformed with the vector. The obtained transformant was cultured, expression was induced with isopropyl-β-D-thiogalactopyranoside (IPTG) for 3 hours, the cells were recovered, and a water-soluble fraction of Escherichia coli was used for purification. The purification was performed by affinity chromatography method with His-Tag and Ni using the PreBond Purification System (Invitrogen K. K.). The empty vector extract was prepared as described below. One Shot competent cells (Invitrogen K. K.) were transformed with the pTrcHisA vector (Invitrogen K. K.) . Expression and purification were induced in the same manner as for the preparation of lacritin. 2. Test method

Meibomian gland cells newly prepared from 3-year-old female rhesus monkey were used for the experiment. The cells were cultured in a growth factor-containing Defined

Keratinocyte-Serum Free medium (DK-SFM, Invitrogen K.K.), where the culture conditions were 5% C0_2/ 95% air, 100% humidity, 37°C. The cells were seeded on a 4-well chamber slide at 5xlO⁴ cells/well, the culture medium was exchanged every other day and the cells were cultured to 80% confluent. Thereafter, the medium was changed to growth factor-free DK- SFM supplemented with recombinant lacritin to the final concentration of 10^"7M and, in a different well, changed to a medium supplemented with an empty vector extract in the same amount as the aforementioned lacritin added, and the meibomian gland cells were further cultured for 5 days. The medium was changed every other day.

After the completion of culture, the culture supernatant was removed, and the aforementioned meibomian gland cells were washed 3 times with PBS (-) . The cells after washing were fixed in 4% para-formaldehyde at room temperature for 10 min and washed 3 times with PBS (-) . Isopropyl alcohol (60%) was added to the cells after fixing and the cells were incubated at room temperature for 1 min. Oil-red-0 (Sigma Ltd. ) dissolved in 60% isopropyl alcohol to 1.6 mg/mL was added to each well, and the intracellular lipid was stained at room temperature for 20 min. Thereafter, 60% isopropyl alcohol was added, and the mixture was incubated at room temperature for 1 min and washed 3 times with PBS (-) . 3. Test results Fig. 1 shows photographs of microscopic images of monkey meibomian gland cells stained with Oil-red-O, wherein 1 shows cells cultured in a medium alone (control group) , 2 shows the cells cultured in a medium supplemented with empty vector extract, and 3 shows the cells cultured in a medium supplemented with recombinant lacritin. Since lipid accumulated in the cells is stained red with Oil-red-0, the density of the red part alone in the microscopic images of the cells was determined with image analysis software Scion Image (Ver4.0.2) . Each well was determined at 3 points. As shown in Fig. 2, the accumulation amount did not change in the cells supplemented with an empty vector extract as compared to the control group, but the lipid accumulation amount in the cells increased in the cells supplemented with lacritin. The results indicate that lacritin improves abnormality in the formation of an oily layer covering the tear fluid, by promoting lipid secretion from the meibomian gland cells, and is useful as an active ingredient of a therapeutic drug for evaporative dry eye syndrome.

Experimental Example 3

Analysis of gene expression in meibomian gland culture cells 1. Test method

Primary meibomian gland cells prepared from female rhesus monkey were used for the experiment. The cells were cultured in a growth factor-containing defined keratinocyte- serum free medium (DK-SFM, Invitrogen K.K.), where the culture conditions were 5% CO₂, 95% air, 100% humidity and 37°C. The cells were seeded in a 6-well plate, the culture medium was exchanged every other day, and the cells were cultured to 80% confluent. Thereafter, the medium was exchanged to growth factor-free DK-SFM and, after incubation for 1 hr, full-length lacritin was added and the cells were cultured for 4 hr. Using TRIzol reagent (Invitrogen K.K.), total RNA was extracted from the cells after culture, according to the protocol. That is, the medium was removed from the well, TRlzol reagent was added and the cells were detached. Then, chloroform (0.2 mL) was added per 1 mL of TRIzol reagent to the cell detached and dissolved with the TRIzol reagent, and the mixture was vigorously agitated for 1 min. After agitation, the mixture was incubated at room temperature for 2-3 min and centrifuged (12000xg) at 4°C for 15 min. After centrifugation, the aqueous layer was transferred into a new tube, 0.5 mL of isopropyl alcohol was added, and the mixture was vigorously agitated again for 1 min. After centrifugation (12000xg) for 15 min thereafter, RNA pellets were prepared, and RNA was rinsed with 80% ethanol. Finally, ethanol was removed from the RNA pellets, and RNA pellets were dried and dissolved in water. The purity of RNA was confirmed by an Agilent Bioanalyzer (Agilent Technologies) .

The analysis of isolated RNA GeneChip (trademark) followed GeneChip Expression Analysis Technical Manual, rev.3 (Affymetrix) .

The labeling was performed in two steps. In the first step, mRNA was converted to double-stranded cDNA using

Superscript Reverse Transcriptase (Invitrogen K. K.) and an oligo-dT primer linked to a T7 RNA polymerase binding site sequence. Second-strand synthesis was accomplished using a reaction cocktail of 0.2 mM dNTP (Invitrogen K.K.), 1OU Escherichia coli DNA Ligase (Invitrogen K.K.), 4OU E. coli DNA Polymerase I (Invitrogen K.K.), and 2U E. coli RNase H (Invitrogen K. K.). In the second labeling step, the cDNA was converted to labeled cRNA (the target) using T7 RNA polymerase in the presence of biotinylated UTP and CTP (Enzo Diagnostics, Farmingdale NY) . Following removal of free nucleotides, the target was fragmented at 94°C in the presence of a high magnesium concentration to an average size of approximately 50 to 100 nucleotides.

The fragmented RNA was combined with control oligomer (used for grid alignment during image processing) and control cRNAs for BioB, BioC, BioD and ere (used for concentration and linearity assessment) in hybridization solution (100 mM MES, 1 M [Na⁺], 20 mM EDTA, 0.01% Tween 20, 0.1 mg/ml herring sperm DNA, 0.5 mg/ml acetylated BSA) . All solutions and hybridization assay procedures were as described in the Affymetrix GeneChip Expression Analysis Technical Manual, rev.3. Ten μg of labeled cRNA was hybridized with the Rhesus GeneChip array (Affymetrix) overnight at 45°C, followed by washing, staining with streptavidin-phycoerythrin (SAPE, Molecular Probes, Eugene, OR) , signal-amplifying with biotinylated anti-streptavidin antibody (Vector Laboratories, Burlingame, CA), and a final staining with SAPE. The distribution of fluorescent material on the array was determined using a confocal laser scanner (GeneArray Scanner, Affymetrix) .

Each array scan was processed using the Microarray Suite (MAS) version 5 (Affymetrix) . This software performs image processing, signal quantification, background adjustment, preprocessing, and scaling. Scaled, intensity data from each array was further analyzed using MAS 5.0 to generate an

"absolute analysis" of a single GeneChip array. The expression analysis algorithm outputs a measurement of relative abundance for each probe set on the array and provides a detection call as either Present (P), Absent or Marginal. The detection signal was determined using the following formula: (PM₁ - MM₁) /N, where, for each oligonucleotide, PM₁ is the intensity of a tile with a perfectly matching oligonucleotide, MM₁ is the intensity of the adjacent tile with a mismatched oligonucleotide, and N is the number of probe pairs used in the calculation. 2. Test results

From the results of GeneChip, it was clarified that addition of full-length monkey lacritin to monkey meibomian gland culture cells increased the expression of splice variant 2 of Stearoyl-CoA desaturase 5 gene involved in lipid synthesis (Table 2) . In β-actin and GAPDH, which are house keeping genes, no remarkable change was observed between the lacritin addition group and non-addition group. In the Table, "P" shows the analysis results by GeneChip analysis software MAS5, that shows detection of statistically significant expression of each gene on the chip. From the foregoing results, monkey lacritin has a possibility of specifically inducing the expression of Stearoyl-CoA desaturase 5 gene involved in the lipid synthesis, and influencing the lipid synthesis and homeostasis of lipid constituent components in the meibomian gland cells.

Table 2 Change in gene expression of control group and lacritin addition group in meibomian gland culture cells

Industrial Applicability

The agent for promoting lipid secretion from the meibomian gland of the present invention, which contains lacritin or a compound having lacritin activity, acts on meibomian gland cells to promote lipid secretion, thereby inhibiting evaporation of aqueous layer in the tear fluid. Hence, the agent of the present invention is extremely useful for the prophylaxis or treatment of dry eye syndrome, particularly, evaporative dry eye syndrome. Moreover, the present invention is useful for the prophylaxis, treatment or improvement of a disease associated with abnormality (decreased secretion amount, component change) of the lipid secreted into the tear fluid, for example, meibomian gland dysfunction, meibomitis and the like.

This application is based on a patent application No. 60/737,374 (filed: November 17, 2005) filed in the US, the contents of which are incorporated in full herein by this reference .

Claims

1. An agent for promoting lipid secretion from the meibomian gland, comprising lacritin or a compound having lacritin activity.

2. The agent of claim 1, which is an agent for the prophylaxis or treatment of a dry eye syndrome caused by a reduced lipid secretion amount associated with functional degradation of the meibomian gland.

3. The agent of claim 2, wherein the dry eye syndrome is evaporative dry eye.

4. The agent of claim 1, which is an agent for the prophylaxis or treatment of a meibomian gland dysfunction or meibomitis.

5. The agent of any one of claims 1 to 4, which is used for topical ophthalmic administration.

6. The agent of claim 5, which is an eye drop.

7. A method of screening for a compound having lacritin activity of claim 1, which comprises the steps of (a) contacting meibomian gland cells with a test compound,

(b) measuring an expression amount of stearoyl-CoA desaturase- 5 in the cells contacted with the test substance, and comparing the amount with that of cells free of contact with the test substance, and (c) selecting a test substance that increases the expression amount of stearoyl-CoA desaturase-5, based on the comparison results .

8. The method of claim 7 wherein the stearoyl-CoA desaturase-5 is splice variant 2 of the enzyme.

9. Use of lacritin or a compound having lacritin activity for the production of an agent for promoting lipid secretion from the meibomian gland.

10. The use of claim 9, wherein the agent is a prophylactic or therapeutic agent for a dry eye syndrome caused by a reduced lipid secretion amount associated with functional degradation of the meibomian gland.

11. The use of claim 10, wherein the dry eye syndrome is evaporative dry eye.

12. The use of claim 9, wherein the agent is a prophylactic or therapeutic agent for meibomian gland dysfunction or meibomitis .

13. The use of any one of claims 9 to 12, wherein- the agent is an agent for topical ophthalmic administration.

14. The use of claim 13, wherein the agent is an eye drop.

15. A method of promoting lipid secretion from the meibomian gland, which comprises administering an effective amount of lacritin or a compound having lacritin activity to a subject in need of promotion of lipid secretion from the meibomian gland.

16. A method for the prophylaxis or treatment of a dry eye syndrome caused by a reduced lipid secretion amount associated with functional degradation of the meibomian gland, which comprises administering an effective amount of lacritin or a compound having lacritin activity to a subject showing a decreased amount of lipid secretion associated with functional degradation of the meibomian gland.

17. The method of claim 16, wherein the dry eye syndrome is evaporative dry eye.

18. The method of claim 15, wherein the promotion of lipid secretion from the meibomian gland is prophylaxis or treatment of meibomian gland dysfunction or meibomitis.

19. The method of claim 15, wherein the administration step is topical ophthalmic administration.

20. The method of claim 1'6, wherein the administration step is topical ophthalmic administration.

21. The method of claim 19 or 20, wherein the topical ophthalmic administration is instillation.