WO2007043769A1

WO2007043769A1 - Hyperthermophilic dna polymerase and methods of preparation thereof

Info

Publication number: WO2007043769A1
Application number: PCT/KR2006/003988
Authority: WO
Inventors: Jung Hyun Lee; Suk Tae Kwon; Sung Gyun Kang; Sang Jin Kim; Jung Ho Hyun; Kae Kyoung Kwon; Yun Jae Kim; Hyun Sook Lee; Seung Seob Bae; Ki Hoon Nam; Jae Kyu Lim; Jung Ho Jeon; Sung Hyun Yang
Original assignee: Korea Ocean Research & Development Institute
Priority date: 2005-10-08
Filing date: 2006-10-02
Publication date: 2007-04-19
Also published as: KR20070039418A; KR100777227B1; US8257953B2; US20090148896A1

Abstract

The present invention relates to a hyperthermophilic DNA polymerase and a preparation method thereof. The invention provides a novel hyperthermophilic DNA polymerase isolated from a Thermococcus sp. strain, a functional equivalent thereof, a protein having the amino acid sequence thereof, and a preparation method thereof. The DNA polymerase according to the invention is a DNA polymerase, which is hyperthermophilic and has an elongation ability and fidelity higher than those of prior commercial DNA polymerases. Thus, the DNA polymerase according to the invention will be useful in precision analysis, precision diagnosis, identification and the like, which require accurate PCR.

Description

HYPERTHERMOPHILIC DNA POLYMERASE AND METHODS OF PREPARATION

THEREOF

Technical Field

The recent advance of genomic research has produced vast amounts of sequence information. With a generally applicable combination of conventional genetic engineering and genomic research techniques, the genome sequences of some hyperthermophilic microorganisms are of considerable biotechnological interest due to heat-stable enzymes, and many extremely thermostable enzymes are being developed for biotechnological purposes.

PCR, which uses the thermostable DNA polymerase, is one of the most important contributions to protein and genetic research and is currently used in a broad array of biological applications. More than 50 DNA polymerase genes have been cloned from various organisms, including thermophiles and archaeas. Recently, family B DNA polymerases from hyperthermophilic archaea, Pyrococcus and Thermococcus, have been widely used since they have higher fidelity in PCR based on their proof reading activity than Taq polymerase commonly used. However, the improvement of the high fidelity enzyme has been on demand due to lower DNA elongation ability. The present inventors isolated a new hyperthermophilic strain from a deep-sea hydrothermal vent area at the PACMANUS field. It was identified as a member of Thermococcus based on 16S rDNA sequence analysis, and the whole genome sequencing is currently in process to search for many extremely thermostable enzymes. The analysis of the genome information displayed that the strain possessed a family B type DNA polymerase. The present inventors cloned the gene corresponding to the DNA polymerase was cloned and expressed in E. coli. In addition, the recombinant enzyme was purified and its enzymatic characteristics were examined.

Accordingly, the present inventors have isolated and prepared DNA polymerase from hyperthermophilic archaebacterium Thermococcus sp. NA1 , thereby completing the present invention. Background Art

References relating to the background of the present invention are listed as follows: [1] Saiki RK, Gelfand DH, Stoffel S, Higuchi R, Horn G, Mullis KB₁ Erlich HA.

Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491.

[2] lto J, Braithwaite DK. Compilation and alignment of DNA polymerases. Nucleic Acids Res 1991 ; 19:4045-4057. [3] Perler FB, Kumar S, Kong H. Thermostable DNA polymerases. Adv Protein

Chem 1996;48:377-435.

[4] Lundberg KS, Shoemaker DD, Adams MW, Short JM, Sorge JA, Mathur EJ. High-fidelity amplification using a thermostable DNA polymerase isolated from Pyrococcus furiosus. Gene 1991;108:1-6. [5] Mattila P, Korpela J, Tenkanen T, Pitkanen K. Fidelity of DNA synthesis by the Thermococcus litoralis DNA polymerase - an extremely heat stable enzyme with proofreading activity. Nucleic Acids Res 1991 ; 19:4967-73.

[6] Kong H, Kucera RB, Jack WE. Characterization of a DNA polymerase from the hyperthermophile archaea Thermococcus litoralis. Vent DNA polymerase, steady state kinetics, thermal stability, processivity, strand displacement, and exonuclease activities. J Biol Chem 1993;268:1965-1975.

[7] Southworth MW, Kong H, Kucera RB, Ware J, Jannasch HW, Perler FB. Cloning of thermostable DNA polymerases from hyperthermophilic marine Archaea with emphasis on Thermococcus sp. 9 degrees N-7 and mutations affecting 3'-5' exonuclease activity. Proc Natl Acad Sci U S A. 1996;93:5281-5285.

[8] Takagi M, Nishioka M, Kakihara H, Kitabayashi M, lnoue H, Kawakami B, Oka M, lmanaka T. Characterization of DNA polymerase from Pyrococcus sp. strain KOD1 and its application to PCR. Appl Environ Microbiol 1997;63:4504-10.

[9] Barnes WM. PCR amplification of up to 35-kb DNA with high fidelity and high yield from λ bacteriophage templates. Proc Natl Acad Sci USA 1994;91 :2216-2220.

[10] Holden JF, Takai K, Summit M, Bolton S, Zyskowski J, Baross JA. Diversity among three novel groups of hyperthermophilic deep-sea Thermococcus species from three sites in the northeastern Pacific Ocean. FEMS Microbiol Ecol 2001 ;36:51-60.

[11] Robb FT, Place AR, Sowers KR, Schreier HJ, DasSarma S, Fleischmann, EM. Archaea: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 1995.

[12] Sambrook J, Russell DW. Molecular cloning: a laboratory manual, 3^rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 2001.

[13] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248-254.

[14] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680-685.

[15] Choi JJ, Kwon S-T. Cloning, expression, and characterization of DNA polymerase from hyperthermophilic bacterium Aquifex pyrophilus. J Microbiol Biotechnol 2004; 14: 1022-1030.

[16] Kahler M, Antranikian G. Cloning and characterization of family B DNA polymerase from the hyperthermophilic crenarchaeon Pyrobaculum islandicum. J Bacteriol 2000; 182:655-663.

[17] Hodges RA, Perler FB, Noren CJ, Jack WE. Protein splicing removes intervening sequences in an archaea DNA polymerase. Nucleic Acids Res 1992;20:6153-6157.

[18] Perler FB, Olsen GJ, Adam E. Compilation and analysis of intein sequences. Nucleic Acids Res 1997;25: 1087-1093.

[19] Studier FW, Moffatt BA. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J MoI Biol 1986; 189: 113-130.

[20] Lecompte O, Ripp R, Puzos-Barbe V, Duprat S, Heilig R, Dietrich J, Thierry JC, Poch O Genome evolution at the genus level: comparison of three complete genomes of hyperthermophilic archaea. Genome Res 2001 ;11 :981-93.

[21] Fukui T, Atomi H, Kanai T, Matsumi R, Fujiwara S, lmanaka T. Complete genome sequence of the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1 and comparison with Pyrococcus genomes. Genome Res 2005; 15:352-363. [22] Nishioka M, Mizuguchi H, Fujiwara S, Komatsubara S, Kitabayashi M, Uemura H, Takagi M, lmanaka T. Long and accurate PCR with a mixture of KOD DNA polymerase and its exonuclease deficient mutant enzyme. J Biotechnol 2001;88:141- 149.

Technical Problem

It is an object of the present invention to provide a hyperthermophilic DNA polymerase having high fidelity and elongation ability. Another object of the present invention is to provide a method for producing a hyperthermophilic DNA polymerase having high fidelity and elongation ability.

Technical Solution

The present invention provides a DNA polymerase and a preparation method thereof. The preparation method is preferably carried out using a genetic engineering method, but is not limited thereto.

Also, the present invention provides an isolated DNA sequence encoding said DNA polymerase, and a recombinant vector containing said DNA sequence.

Advantageous Effects

The DNA polymerase according to the present invention is a novel DNA polymerase, which is hyperthermophilic and has an elongation ability and fidelity higher than those of prior commercial DNA polymerases. Thus, the DNA polymerase according to the present invention will be useful in precision analysis, precision diagnosis, identification and the like, which require accurate PCR.

Brief Description of the Drawings

FIG. 1 shows the comparison of amino acid sequence of family B-type DNA polymerase from Thermococcus sp. NA1 (TNA1), T. kodakarensis KOD1 (TkKODI, gi:52696275), Pyrococcus furiosus(Pfu, gi: 18892147), and Pyrococcus sp. GB-D (PGBD, gi:436495). In FIG. 1 , the dashes (-) represent gaps, and numerals on the right side represent the numbers of last residues in original sequences. The same residue between four enzymes is indicated as "*", and conservatively substituted residues and semi-conservatively substituted residues are indicated as ":". In a range from Pol I to Pol IV, a region conserved in family B DNA polymerase is shown; in a range from Exo I to Exo III, a conserved motif of a 3'->5' exonuclease domain is shown; and a DNA-binding motif is shown.

FIG. 2 shows the results of SDS-PAGE analysis of TNA1-pol. In FIG. 2, M: a standard sample; 2: a crude extract; 3: His-tagged affinity chromatography after heat treatment. The molecular weight standard sample (lane M) contained phosphorylase b (103 kDa), bovine serum albumin (77 kDa), ovalbumin (50 kDa), carbonic anhydrase (34.3 kDa), soybean trypsin inhibitor (28.8 kDa), and lysozyme (20.7 kDa).

FIG. 3 shows the effect of pH on the DNA polymerase activity of TNA1-pol. The analysis of activity was conducted in the following buffers (each 50 mM) using a standard method: MES, pH 6.0-7.0; Tris-HCI, pH 7.0-9.0; and glycine, pH 9.0-10.0.

FIG. 4 shows the effects of temperature on the DNA polymerase activity and thermal stability of TNA1-pol. In FIG. 4, (A): the effect of temperature on DNA polymerase activity; and (B): the thermal stability of TNA1_pol. Recombinant TNA1_pol was pre-incubated at 95 ^°C (A) and 100 ^"C (•), and the remaining activity was measured at 75 ⁰C.

FIG. 5 shows the effects of magnesium ions (A), ammonium ions (B) and potassium ions (C) on the DNA polymerase activity of TNA1-pol. The analysis of activity was conducted in the presence of MgCI₂, (NH-O₂SO₄, and KCI. FIG. 6 shows the results of exonuclease activity of recombinant TNA_pol. The activity of 3'-> 5' exonuclease was analyzed in the absence (o) or presence (•) of dNTP. The activity of 5'-3' exonuclease was analyzed in the absence (Δ) or presence (A) of dNTP.

FIG. 7(A) shows the results of PCR amplification with various DNA polymerases. In FIG. 7(A), lane M: DNA molecular size marker; lane 1 : negative control group; lane 2: Ex Taq DNA polymerase (TaKaRa); lane 3: Pfu Turbo DNA polymerase (Stratagene); lane 4: KOD DNA polymerase (Novagen); lane 5: TNA1-pol. FIG. 7(B) shows the results of amplification of a long-chain DNA fragment with TNA1-pol. In FIG. 7(B), lane M: DNA molecular size marker; lane 1: 2-kb PCR amplification; lane 2: 4-kb PCR amplification; lane 3: 8-kb PCR amplification. The PCR reaction with TNA1-pol were conducted in 20 mM Tris-HCI (pH 8.5), 30 mM (NhU)₂SO₄, and 1 mM MgCI₂, and PCR amplification reactions with other commercial polymerases were carried out according to standard protocols recommended by the manufacturers.

FIG. 8 shows a cleavage map of a pETNAPm recombinant plasmid having recombinant DNA polymerase TNA1-pol according to the present invention.

Best Mode for Carrying Out the Invention

The present invention provides a DNA polymerase and a preparation method thereof. The preparation method is preferably conducted according to a genetic engineering method, but is not limited thereto.

According to a first aspect, the present invention provides a nucleic acid sequence encoding a DNA polymerase stable at high temperature, and a nucleic acid sequence equivalent to said sequence. More specifically, said nucleic acid sequence is shown in SEQ ID NO: 1.

As used herein, the term "DNA polymerase" refers to an enzyme that synthesizes

DNA in the 5' -> 3' direction from deoxynucleotide triphosphate using a complementary template DNA strand and a primer by successively adding nucleotide to a free 3'- hydroxyl group. The template strand determines the sequence of the added nucleotide by Watson-Crick base pairing.

As used herein, the term "equivalent nucleic acid sequence" is intended to include the degenerate codon sequence of said DNA polymerase sequence.

As used herein, the term "degenerate codon sequence" refers to a nucleic acid sequence, which is different from said naturally occurring sequence, but encodes a polypeptide having the same sequence as that of the naturally occurring DNA polymerase disclosed in the present invention.

According to a second aspect, the present invention provides a DNA polymerase. More particularly, the present invention provides a DNA polymerase shown in SEQ ID NO: 2, and a functional equivalent thereof. As used herein, the term "functional equivalent" is intended to include amino acid sequence variants having amino acid substitutions in some or all of a DNA polymerase of SEQ ID NO: 2, or amino acid additions or deletions in some of the DNA polymerase. The amino acid substitutions are preferably conservative substitutions. Examples of the conservative substitutions of naturally occurring amino acids include aliphatic amino acids (GIy, Ala, and Pro), hydrophobic amino acids (lie, Leu, and VaI), aromatic amino acids (Phe, Tyr, and Trp), acidic amino acids (Asp, and GIu), basic amino acids (His, Lys, Arg, GIn, and Asn), and sulfur-containing amino acids (Cys, and Met). The deletions of amino acids are located in a region which is not involved directly in the activity of the DNA polymerase. According to a third aspect, the present invention provides a recombinant vector comprising an isolated DNA fragment encoding said DNA polymerase.

As used herein, the term "vector" means a nucleic acid molecule that can carry another nucleic acid bound thereto. As used herein, the term "expression vector" is intended to include a plasmid, cosmid or pharge, which can synthesize a protein encoded by a recombinant gene carried by said vector. A preferred vector is a vector that can self-replicate and express a nucleic acid bound thereto.

According to a fourth aspect, the present invention provides cells transformed with said recombinant vector.

As used herein, the term "transformation" means that foreign DNA or RNA is absorbed into cells to change the genotype of the cells.

Cells suitable for transformation include prokaryotic, fungal, plant and animal cells, but are not limited thereto. Most preferably, E. coli cells are used.

According to a fifth aspect, the present invention provides a method for producing a DNA polymerase using said transformed cells or Thermocqccus sp. Hereinafter, the present invention will be described in further detail with reference to examples. It is to be understood, however, that these examples are for illustrative purposes only and are not to be construed to limit the scope of the present invention.

Mode for Carrying Out the Invention

Example 1 : Cloning and primary sequence analysis of TNA1 pol gene

Thermococcus sp. NA1 was isolated from deep-sea hydrothermal vent area at the PACMANUS field (3° 14' S, and 151° 42' E) in East Manus Basin. An YPS medium [see reference 10] was used to culture Thermococcus sp. NA1 for DNA manipulation, and the culture and maintenance of Thermococcus sp. NA1 were conducted according to standard methods [see reference 11]. To prepare a Thermococcus sp. NA1 seed culture, an YPS medium in a 25-ml serum bottle was inoculated with a single colony formed on a phytagel plate, and cultured at 9O⁰C for 20 hours. The seed culture was used to inoculate 700 ml of an YPS medium in an anaerobic jar, and was cultured at 90 ^°C for 20 hours. Preparation of mature TNA1-pol gene

E. coli DH5α was used for plasmid propagation and nucleotide sequence analysis. E. coli BL21-Codonplus(DE3)-RIL cells (Stratagene, La JoIIa, California) and plasmid pET-24a(+) (Novagen, Madison, Wisconsin) were used for gene expression. The E. coli strain was cultured in a Luria-Bertani medium at 37⁰C, and kanamycin was added to the medium to a final concentration of 50 μg/ml.

DNA manipulation was conducted according to a standard method as described by Sambrook and Russell [see reference 11]. The genomic DNA of Thermococcus sp. NA1 was isolated according to a standard method [see reference 11]. Restriction enzymes and other modifying enzymes were purchased from Promega (Madison, Wisconsin). The preparation of a small scale of plasmid DNA from the E. coli cells was performed using the plasmid mini-kit (Qiagen, Hilden, Germany). The sequence analysis of DNA was performed with an automated sequencer (ABI3100) using the BigDye terminator kit (PE Applied Biosystems, Foster City, California).

Through the genomic sequence analysis, an open reading frame (3,927 bp; SEQ ID NO: 3) encoding a protein consisting of 1 ,308 amino acids was found, and it showed a very high similarity to the family B DNA polymerases. The molecular mass of a protein derived from the deduced amino acid sequence (SEQ ID NO: 4) was 151.9 kDa, which was much larger than the size predicted for the average molecular mass thermostable DNA polymerases. The sequence analysis showed that the DNA polymerase gene contained a putative 3'-5' exonuclease domain, an α-like DNA polymerase domain, and a 1605-bp (535 amino acids) in-frame intervening sequence in the middle of a region (Pol III) conserved between the α-like DNA polymerases of eukaryotes and archaeal (Pol III) (see FIG. 1 and reference 16). Also, the deduced amino acid sequence of the intein of the polymerase was highly similar to the intein of the polymerase of other archaeal, and exhibited a identity of 81.0% to a poM intein 1 (derived from a DNA polymerase of Thermococcus sp. strain GE8; 537 amino acids; AJ25033), a identity of 69.0% to IVS-B (derived from KOD DNA polymerase; 537 amino acids; D29671) and a homology of 67.0% to an intein (derived from deep vent DNA polymerase; 537 amino acids; U00707).

The splicing site of the intein could be predicted by sequence analysis, because Cys or Ser was well conserved in the N-terminus of the intein, and His-Asn-Cys/Ser/Thr was well conserved in the C-terminal splice junction [see references 17 and 18]. Thus, a mature polymerase gene (TNA1_pol) containing no intein could be predicted, and it would be a 2,322-bp sequence (SEQ ID NO: 1) encoding a protein consisting of 773 amino acid residues (SEQ ID NO: 2). The deduced sequence of TNA1_pol was compared with those of other DNA polymerases (see FIG. 1). In pairwise alignment, the deduced amino acid sequence of the mature TNA1_pol gene showed a identity of 91.0% to KOD DNA polymerase (gi:52696275), a identity of 82.0% to deep vent DNA polymerase (gi:436495), and a identity of 79.0% to pfu DNA polymerase (gi: 18892147). To examine the performance of TNA1_pol in PCR amplification, TNA1_pol DNA was pconstructed by removing the intein from the full-length polymerase as described above.

The mature DNA polymerase containing no intein was constructed in the following manner. Using primers designed to contain overlapping sequences, each of the TNA1-pol N-terminal region (sense [5'-CGACCCGG C/AT>AΓGATCCTCG

ACGTCGATTACATCACAG-S'] (SEQ ID NO: 5) and antisense [5'-GCCGTAGTACCCG TAATAGCTGTTCGCTAAGATTTTTATTGCCCGCTG-S'] (SEQ ID NO: 6)) and C- terminal portion (sense [δ'-CAGCGGGCAATAAAAATCTTAGCGAACAGCTATTACGG GTACTACGGC-3'] (SEQ ID NO: 7) and antisense [5'-CTCCACATCrCGAGTTTCTTC GGCTTCAACCAAGCCCC-3'] (SEQ ID NO: 8)) was amplified. Then, the full length of a TNA1_pol gene flanked by Λ/ctel and Xho\ sites was amplified by PCR using two primers (sense [δ'-CGACCCGGCΛTATGATCCTCGACGTCGATTAC ATCACAG-3'] (SEQ ID NO: 9) and antisense [δ'-CTCCACATCrCG/AGTTTCTTCGGCTTCAACCAAG CCCC- 3'] (SEQ ID NO: 10)) and a mixture of said partially PCR amplified N-terminal and C- terminal fragments as a template. The amplified fragment was digested with Λ/cfel and Xho\, and ligated with pET-24a(+) digested with Nde\/Xho\. The ligate was transformed into E. coli DH5α. Candidates having a correct construct were selected by restriction enzyme digestion, and were confirmed to have a mature DNA polymerase by analyzing the DNA sequence of the clones.

Example 2: Expression and isolation of TNA1-pol

The pET system having a very strong, stringent T7/lac promoter, is one of the most powerful systems developed for the cloning and expression of a heterologus proteins in E. coli [see reference 19], and the TNA1-po1 gene was amplified and inserted into the Λ/cfel and Xho\ sites of pET-24a(+) in order to facilitate the over- expression of TNA1-pol and the His-tagged purification of recombinant TNA1-pol. The resulting expression plasmid was designated as pETNAPm. The recombinant TNA1_pol was expressed in a soluble form in the cytosol of E. coli BL21-codonPlus(DE3)-RIL harbourng pETNAPm.

The above-prepared expression plasmid, pETNAPm, was transformed into E. coli BL21-CodonPlus(DE3)-RIL. The overexpression of the TNA1_pol gene was induced by adding isopropyl-β-D-thiogalactopyranoside (IPTG) in the mid-exponential growth stage, followed by constant-temperature incubation at 37 ^°C for 3 hours. The cells were harvested by centrifugation (at 4 °C and 6,000 x g for 20 minutes), and re- suspended in a 50 mM Tris-HCI buffer (pH 8.0) containing 0.1 M KCI and 10% glycerol. The cells were ultrasonically disrupted, and isolated by centrifugation (at 4 °C and 20,000 x g for 30 minutes), and a crude enzyme sample was thermally treated at 80 ⁰C for 20 minutes. The resulting supernatant was treated in a column of TALON™ metal affinity resin (BD Bioscience Clontech, Palo Alto, California), and washed with 10 mM imidazole (Sigma, St. Louis, Mo.) in a 50 mM Tris-HCI buffer (pH 8.0) containing 0.1 M KCI and 10% glycerol, and TNA1_pol was eluted with 300 mM imidazole in buffer. The pooled fractions were dialyzed into a storage buffer containing 50 mM Tris-HCI (pH 7.5), 1 mM DTT, 1mM EDTA and 10% glycerol.

The concentrations of proteins were determined by the colorimetric assay of Bradford [see reference 13]. The purification degrees of the proteins were examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis according to a standard method [see reference 14].

As shown in FIG. 2, the thermal treatment conducted at 80 ⁰C for 20 minutes could eliminate effectively several E. coli proteins. However, some E. coli proteins remained in a stable form after the thermal treatment. The soluble supernatant of the heat-treated pool was chromatographied on a column of TALON™ metal affinity resin, and purified as shown in Table 1 and FIG. 2. The specific activity of the purified protein was 231.33 units/mg, and the purification yield was 26.155%. SDS-PAGE analysis revealed a major protein band with a molecular mass of 8OkDa. The purified proteins remained soluble in repeated freezing and thawing cycles.

[Table 1] Isolation of TNA1_pol from E. coli

Example 3: Properties of TNA-pol

Analysis of DNA polymerase activity

The DNA polymerase activity of the purified enzyme was measured according to some modifications of the method described by Choi and Kwon [see reference 15]. The enzyme was incubated in a reaction mixture (25 ≠) consisting of 20 mM Tris-HCI (pH 7.5), 10 mM MgCI₂, 1 mM 2-mercaptoethanol, 100 μM of each of dATP, dCTP and dGTP, 0.25 μCi of [methyl-³H]thymidine 5'-triphosphate, and 625 ng of activated calf thymus DNA (Promega) at 75 ⁰C for 10 minutes. The reaction was stopped on ice, and an aliquot was spotted onto a DE81 filter paper disc (23 mm, Whatman, UK). The disc was dried on a heat block, and washed in 0.5 M sodium phosphate buffer (pH 7.0) for 10 minutes and 70% ethanol for 5 minutes, followed by drying. The incorporated radioactivity of the dried filter paper disc was counted using a Beckman LS6500 scintillation counter (USA). One unit of TNA1_pol is defined as the amount of polymerase that incorporates 1 pmole of [³H]TTP into an acid-insoluble product at 75 ⁰C for 1 minute.

Exonuclease activity analysis To prepare a 3' end-labeled DNA substrate, pBluescript SK-DNA linearized by

Not I was filled by a Klenow fragment in the presence of [α-³²P]dCTP. To prepare a 5' end-labeled DNA substrate, a 2-kb PCR product was phosphorylated by T4 polynucleotide kinase in the presence of [γ-³²P]ATP. After labeling, each of the DNA substrate was purified by ethanol precipitation. For endonuclease activity assay, each of the DNA substrate was incubated with the enzyme in a reaction mixture (25μ£)consisting of 20 mM Tris-HCI (pH 7.5), 10 mM MgCI₂, 1 mM 2-mercaptoethanol, 20 mM (NhU)₂SO₄ and 0.01% BSA at 75 ^°C for 10 minutes in the presence or absence of dNTPs. The reaction was stopped on ice, and precipitated by adding 1 ml of 5% trichloroacetic acid in the presence of BSA as a carrier. After centrifugation, the supernatant was withdrawned and the radioactivity thereof was counted using a Beckman LS6500 scintillation counter (USA).

The pH dependency of TNA1-pol was examined in the range of pH 6.0-10.0. The optimal activity occurred at pH 7.5 (see FIG. 3). The dependency of the polymerase activity on temperature was determined in the temperature range of 40-90 ⁰C , and the optimal activity of TNA1_pol ouccurred at 75 ⁰C in analysis conducted using a activated calf thymus DNA template (see FIG. 4A). Because the TNA1_pol was thermally stable at 95 ⁰C as described below, the optimal temperature thereof was influenced by the denaturation of the bovine thymus DNA template at 75 ⁰C or higher. The thermal stability if TNA1_pol was tested by measuring the activity of the polymerase at 95 ^°C and 100 ⁰C after pre-incubation. The half-life (U_/2) of the enzyme was 3.5 hours at 100^°C (t_1/2), and 12.5 hours at 95 ^°C (t_1/2) (see FIG. 4B).

The effects of concentrations of MgCb, (N H₄J₂SO₄ and KCI on the activity of TNA1_pol were examined (see FIG. 5). TNA1_pol was dependent on the presence of MgCI₂, showed the maximal activity at a 6 mM MgCI₂ concentration. These results were consistent with the effects of cations on other DNA polymerases [see reference 15]. Most DNA binding enzymes, including DNA-dependent DNA polymerases, tend to prefer the presence of Mg²⁺ ion. It is noticeable that the optimal concentration of Mg²⁺ ions for the activity of polymerases can differ from the optimal concentration for PCR amplification, and the practical amplification of TNA1_pol was performed at a significantly low Mg²⁺ concentration. The optimal concentration of (NH₄)SO₄ was determined to be 20 mM, but KCI had no great effect on the activity of TNA1_pol (see FIGS. 5B and C).

Example 4: Exonuclease activity of TNA1 pol

The sequence analysis of TNA1 _pol gene showed the presence of the putative 3'->5' exonuclease domains (Exol, Exoll, and Exolll), implicating that TNA1_pol would have associated 3'->5' exonuclease. To address the issue, the activities of 3'->5' and 5'- >3' exonucleases of TNA1_pol were quantified by measuring the release of ³²P from the 3' and 5' end-labeled DNA substrates. As a result, 68% of ³²P was released from the TNA1_pol 3 end-labeled DNA within one hour, but the release of ³²P from the 5 end- labeled DNA was very low and was not increased with dNTP (FIG. 6). This suggests that TNA1_pol had 3'->5' exonuclease activity which would be supported by the domain structure consisting of three motifs (Exol, Exoll, and Exolll). However, it had no 5'->3' exonuclease activity. Almost all of archaeal family B type DNA polymerases are known to possess associated 3'->5' exonuclease activity [see reference 16]. The comparative genomic analysis of closely related hyperthermophilic species of archaea belonging to the family Thermococcales disclosed a high genomic plasticity comparable to plasticity observed between closely related bacteria [see references 20 and 21]. Furthermore, the comparison between protein profiles related that high amounts of differential gains and losses occurred, and the polymorphisms in such species would probably be associated with the fact that these freely living organisms adapted themselves to other environmental constrains. Nevertheless, orthologous gene groups conserved in the hyperthermophilic archaea species indicated that DNA polymerases having high 3'->5' proofreading exonuclease activity was necessary for minimizing severe mutations in a core gene crucial for the survival of hyperthermophilic bacteria against strong evolutionary pressure. Example 5: PCR with TNA1 pol

The major application of thermostable DNA polymerases is the in vitro amplification of DNA fragments. To test the performance of recombinant TNA1_pol for in vitro amplification, said enzymes was applied to PCR reaction.

PCR amplification with recombinant TNA1-pol was attempted, and compared with PCR amplification reactions of commercial Ex Taq (TaKaRA), pfu Turbo (Stratagene) and KOD (Novagen) DNA polymerases. 2.5 U of each of various DNA polymerases was added to 50 μi of a reaction mixture containing 50 ng of genomic DNA from Thermococcus sp. NA1 as a template, 10 pmole of each of primers, 200 μM dNTP, and PCR reaction buffer. To amplify a 2-kb fragment from the genomic DNA of Thermococcus sp. NA1, primers [sense δ'-ACTAAATTGGTGATACCGTTATGAG-S' (SEQ ID NO: 11) and antisense δ'-GGAACATAAAATGTAAGGGACTTC-S' (SEQ ID NO: 12)] were designed. PCR buffer supplied by the manufacturer was used in the amplification of the commercial polymerases. Also, for the PCR amplification of recombinant TNA1_Pol, a buffer consisting of 20 mM Tris-HCI (pH 8.5), 30 mM (NH-O₂SO₄, 60 mM KCI and 1 mM MgCI₂ was used. The PCR reaction was performed in the following conditions: a single denaturation step at 95 °C, and then 30 cycles with a temperature profile of 1 min at 94 ^°C, 1 min at 55 ^°C and 2 min at 72 °C, followed by final extension for 7 min at 72 ⁰C. The PCR products were analyzed in 0.8% agarsose gel electrophoresis. To test the performance of recombinant TNA1_pol on the amplification of long-chain DNA, PCR reaction was carried out in 50 μJL of a reaction mixture containing 50 ng of genomic DNA from Thermococcus sp. NA1 as a template, 200 μM dNTP, and PCR reaction buffer. Primers were disigned to amplify a 2kb DNA fragment, a 4kb DNA fragment [(sense δ'-ACTAAATTGGTGATA CCGTTATGAG-3' (SEQ ID NO: 13) and antisense δ'-GTCTCTGATGCTCATGATGTAGTTC-S' (SEQ ID NO: 14)], and a 8kb DNA fragment [sense δ'-ACTAAATTGGTGATACCGTTATGAG-S' (SEQ ID NO: 15) and antisense 5'-GAGGAGCT CTTTAGAATTCTCAAGC-3' (SEQ ID NO: 16)], from Thermococcus sp. NA1 (DQ223723).

As shown in FIG. 7A, TNA1_pol successfully amplified the 2kb target gene, and the PCR amplification yield thereof was comparable to those of Ex Taq, Pfu and KOD polymerases performed in their own PCR buffers supplied by the manufacturers, implicating that, when TNA1_pol is optimized, it will be industrially highly valuable (see FIG. 7A). Interestingly, practical pH for PCR amplification appeared to be different from optimal pH for the polymerase activity of TNA1_Pol. The in vitro amplification of DNA fragments is thought to be dependent on the balance between exonuclease activity and polymerase activity in the case of high-fidelity DNA polymerases. It is recommended that other commercial high-fidelity DNA polymerases, such as Pfu DNA polymerase (pH 8.8), KOD DNA polymerase (pH 8.8) and vent DNA polymerase (pH 8.8), which are generally used in PCR, should carry out PCR reactions in the alkaline pH value. High- fidelity DNA polymerases were reported to be unsuitable for the amplification of long DNA fragments due to their strong exonuclease activity [see reference 9]. In order to test whether recombinant TNA1_pol can amplify longer DNA fragments, recombinant TNA1_pol was applied in PCR reactions such that it amplified longer DNA fragments using the genomic DNA of Thermococcus sp. NA1. As shown in FIG. 7B, TNA1_pol could amplify DNA fragments up to a size of 8 kb. However, the yield of the 8kb DNA amplification was lower than that of a 4 kb or 2 kb DNA fragment. This suggests that a wild-type protein of TNA1_pol needs to be introduced with mutations in order to optimize PCR reaction or to amplify longer DNA fragments.

Generally, family B-type DNA polymerases from hyperthermophilic archaea have 3'->5' exonuclease activity, and offer the possibility to amplify DNA fragments with high fidelity. However, most of family B-type DNA polymerases having 3'->5' exonuclease activity were lower in DNA elongation activty than A-type DNA polymerases having no exonuclease activity. The shortcoming of DNA polymerases having associated 3'-5' exonuclease activity can be overcame by the optimization of reaction buffer, the construction of mutations of reducing exonuclease 3'->5' activity, or the use of a mixture of exonuclease activity-free DNA polymerase and highly proofreading DNA polymerase (see reference 22). In addition, it is noted that the PCR-inhibiting effects of various components in biological samples can be eliminated to some extent by the use of appropriate thermostable DNA polymerases among polymerases having slightly different properties. KOD DNA polymerase was successful in overcoming the shortcoming in high processivity and high extention rate. The test results of the present invention show that TNA1-pol maintains high fidelity and has extention rate comparable to that of KOD DNA polymerase.

Industrial Applicability

As described above, the DNA polymerase according to the present invention is a novel DNA polymerase, which is hyperthermophilic and has an elongation ability and fidelity higher than those of prior commercial DNA polymerases. Thus, the DNA polymerase according to the present invention will be useful in precision analysis, precision diagnosis, identification and the like, which require accurate PCR.

Claims

1. A hyperthermophilic DNA polymerase isolated from a Thermococcus sp. strain, and a functional equivalent thereof.

2. A protein having an amino acid sequence of SEQ ID NO: 2.

3. A gene of SEQ ID NO: 1.

4. A gene encoding an amino acid sequence of SEQ ID NO: 2.

5. A nucleic acid sequence encoding the hyperthermophilic DNA polymerase of Claim 1.

6. The nucleic acid sequence of Claim 5, which is selected from among SEQ ID NO: 1 or SEQ ID NO: 3.

7. The nucleic acid sequence of Claim 5, which is equivalent to SEQ ID NO: 1 by codon degeneracy.

8. The hyperthermophilic DNA polymerase of Claim 1 , which has SEQ ID NO: 2.

9. The hyperthermophilic DNA polymerase of Claim 1, which has an amino acid sequence functionally equivalent to SEQ ID NO: 2.

10. A recombinant vector comprising a nucleic acid sequence according to any one of Claims 5 to 7.

11. A plasmid comprising the recombinant vector of Claim 10 and having a cleavage map shown in FIG. 8.

12. A cell transformed with the recombinant vector of Claim 10.

13. A method for producing a hyperthermophilic DNA polymerase, comprising: culturing a Thermococcus sp. NA1 strain or the transformed cell of Claim 12; and isolating a DNA polymerase from the cultured cell.