KR20100064731A - Polymerase derived from thermococcus marinus and its use - Google Patents

Abstract

PURPOSE: A DNA polymerase derived from Thermococcus marinus is provided to use in nucleic acid polymerization such as PCR. CONSTITUTION: A heat resistant Tma DNA polymerase isolated from Thermococcus marinus has an amion acid sequence of sequence number 12. The Tma DNA polymerase is optimally active at pH 7.0, 75°C, 0-20 mM of KCl, 0-15 mM of (NH_4)_2SO_4, and 12-16 mM of Mg^2+. A nucleic acid encoding the Tma DNA polymerase has nucleic acid sequence of sequence number 11. A method for manufacturing Tma DNA polymerase comprises: a step of preparing a vector expressing Tma DNA polymerase; a step of transforming the vector to microorganism; a step of culturing the transformant; and a step of collecting the proteins from the transformant.

Description

Heat-resistant DNA polymerase derived from Thermococcus marinus strain and its use DNA {polymerase derived from Thermococcus marinus and its use}

The present invention relates to a DNA polymerase derived from a hyperthermophilic archaeum Thermococcus marinus strain and its use.

DNA polymerase (deoxyribonucleic acid polymerase, DNA polymerase, EC number 2.7.7.7) is an enzyme that synthesizes DNA in the 5 '→ 3' direction depending on template DNA. It is the enzyme that plays the most important role in DNA repair (Lehninger, AL et al ., 1993, Principles of biochemistry, 2nd ed ., Worth Publishers). DNA polymerase was first discovered in Escherichia coli by Kornberg et al in 1957, which is the current E. coli DNA polymerase I (Konberg, A. and Baker, T., 1992, DNA replication, 2nd ed ., Freeman Company). This Escherichia coli DNA polymerase I ( E. coli DNA polymerase I) is a 5 '→ 3' nucleic acid terminal hydrolase activity (5 '→ 3' exonuclease activity, 3 'called proofreading activity) → 5 'nucleic acid terminal hydrolase activity (3' → 5 'exonuclease activity) and DNA polymerization activity (DNA polymerization activity) 5' → 3 'polymerase activity (5' → 3 'polymerase activity) together. The heat-resistant DNA polymerase was first isolated from the thermophilic Thermos aquaticus YT-1 by Chien et al. In 1976, and then Thermus flavus belonging to the same genus ) And its properties have been isolated from Thermus thermophilus HB8 and the like, but have not received much attention (see Chien, A. et al. , 1976, J. Bacteriol. 127 , 1550-1557; Kaledin, AS et al ., 1981, Biokhimiya 46 , 1576-1584; Ruettimann, C. et al. , 1985, Eur. J. Biochem . 149 , 41-46). However, in 1988, Saiki et al . Developed a PCR technique using heat-resistant DNA polymerase (see Saiki, RK et al ., 1988, Science 239 , 487-491). as Thermococcus litoralis (Thermococcus litoralis), pie far Caucus furiosus (Pyrococcus furiosus), nanoah keum Iquique Tansu (Nanoarchaeum equitans), sseomeoseu knife filler's not K-24 (Thermus caldophilus GK24), sseomeoseu Filippo Miss (Thermus Heat-resistant DNA polymerase has been competitively researched and developed from several thermophile and hyperthermic archaea, such as filiformis ) and Pyrococcus woesei ( Hong , H. et al ., 1993, The Journal of Biological Chemistry 168 (3) 1965-1975; Lundberg, KS et al. , 1991, Gene 108 , 1-6; Choi, JJ et al ., 2008, Appl. Environ.Microbiol. 74 , 6563-6569; Park, JH et al. , 1993, Eur. J. Biochem. 214 , 135-140; Jung, SE et al. , 1997, Mol. Cells 7 , 769-776; Dabrowski, S. and Kur, J., 1998, Protein Expres. Purif. 14 , 131-138). In particular, DNA polymerases derived from S. aureus and Pyrococcus strains have been attracting more attention because they are heat-resistant DNA polymerases with corrective activity, unlike DNA polymerases derived from S. aureus, and PCR requiring high accuracy. It is used for.

Intein is a protein insertion sequence present in the precursor protein sequence, which is self-removed during the splicing process of the precursor protein, and thus does not affect the structure or activity of the final protein produced from the precursor protein. Non-affected site (Perler, FB et al ., 1994, Nucleic Acids Res. 22, 1125-1127). Protein splicing is a process that occurs after protein translation, during which the intein is precisely cleaved from the precursor protein by its action and is the site of the final protein that is active. The exteins are connected to each other by normal peptide bonds (Kane, PM et al. , 1990, Science 250, 651-657). Common inteins have both a domain involved in self-splicing and a homing endonuclease domain.

About 300 inteins known to date have generally been shown to have both a domain involved in self-splicing and a homing endonuclease domain (see http: //www.neb.com/neb/inteins.html).

PCR is a technique for mass amplification of trace amounts of template DNA using DNA polymerase and primers, including DNA denaturation (94 ° C.), primer annealing (40-65 ° C.), and DNA synthesis (DNA). extension, 72 ° C.) is repeated 20-30 times in succession. Therefore, since high temperature is required due to the nature of the reaction, the development of heat-resistant DNA polymerase, which is the most important factor in PCR, is indispensable for the development and development of various PCR technologies (see Erlich HA et al. , 1989, Stockton Press 193). -208). Heat-resistant DNA polymerase is a very useful enzyme for identification and amplification of genes by PCR, DNA sequencing, clinical diagnosis, etc., including molecular biology and genetic engineering research, early diagnosis of viral and cancer genes, genetic diagnosis and forensic It is used in a wide range of fields from research to the demand is increasing day by day.

To date, there has been no information on the use of the enzyme and thermostable DNA polymerase sequence of the thermococcus marineus, which is the DNA sequence of the DNA polymerase gene and the heat-resistant DNA polymerase encoded by the electric gene. Therefore, the present inventors have isolated the heat-resistant DNA polymerase gene from the ultra-high temperature bacterium Thermococcus marinus, expressed and purified the enzyme encoded by the gene in E. coli, and then used the PCR to identify the enzyme properties. This will be of significant significance for the industrial use of heat-resistant DNA polymerases from the Thermococcus mariners, which has not been the case so far.

Accordingly, the present inventors have attempted to identify a heat-resistant DNA polymerase derived from Thermococcus marinus , which is a kind of hyperthermophilic archaea, and from the Thermococcus marineus genomic DNA, the thermococcus mariners DNA polymerase ( Thermococcus marinus DNA polymerase, Tma DNA polymerase, hereinafter "Tma DNA polymerase, ") by selecting a gene and determining the nucleotide sequence and amino acid sequence deduced therefrom of the gene, Tma DNA polymerase is a conventional heat-resistant B type DNA It was confirmed that it is a new heat-resistant B series DNA polymerase having high amino acid sequence homology with family B type DNA polymerases. Next, an expression vector of the gene was prepared, cloned into Escherichia coli and expressed, and the protein was purified through heat treatment and column chromatography. Subsequently, various enzyme properties of the purified Tma DNA polymerase were investigated to confirm the optimum activity condition, and it was confirmed that the Tma DNA polymerase had a proofreading activity to improve the accuracy during DNA polymerization. Finally, Tma by using the DNA polymerase to perform the (known as polymerase chain reaction, hereinafter 'PCR') polymerase chain reaction (PCR), has confirmed that the availability of purified Tma DNA polymerase in PCR, a lambda phage (λ The genomic DNA of phage) as a template was confirmed that the synthesis is possible up to 12 kb by PCR using an electric enzyme, and completed the present invention.

The present invention relates to a Tma DNA polymerase isolated from Thermococcus marinus , a kind of hyperthermic archaea. More specifically, the present invention provides a heat-resistant Tma DNA polymerase and the retain heat Tma DNA polymerase in an active form has the amino acid sequence of the coding are removed SEQ ID NO: 14 regions separate from Thermococcus Lactococcus Mariners has the amino acid sequence of SEQ ID NO: 12 It is about.

The Tma DNA of the present invention is a heat-resistant B-type DNA polymerase, which is a DNA polymerization activity of 5 ′ → 3 ′ polymerase activity, as well as 5 ′ → 3 ′ polymerase activity. , 3 '→ 5' nucleic acid terminal hydrolase activity (proof'ing activity) is characterized in that it has an exonuclease activity (3 '→ 5').

Tma DNA polymerase of the present invention is composed of 3,939 bp, including stop codon, consists of 1312 amino acids, amino acid sequence of amino acids 492 to 1028 of 1-1312 amino acids of Tma DNA polymerase ( 537 amino acids) corresponds to intein (intein), and the splicing cleaves the intein portion and converts it into an active Tma DNA polymerase.

The Tma DNA polymerase of the form containing the intein region has the amino acid sequence of SEQ ID NO: 12, and the form from which the entire intein region is removed has the amino acid sequence of SEQ ID NO: 14. However, the Tma DNA polymerase of the present invention is not only a Tma DNA polymerase having the amino acid sequence of SEQ ID NO: 14 in which the entire intein region is removed, but also a form in which some regions of the intein are removed, the N-terminus and All forms in which the additional amino acid sequence has been removed by the C-terminus are included in the scope of the present invention.

The protein expressed by the vector into which the gene encoding the protein having the amino acid sequence of SEQ ID NO: 12 is inserted also undergoes self-splicing during the purification process including heat treatment, resulting in cleavage of the intein moiety. Processed with active Tma DNA polymerase. In this specification, the intein-free Tma DNA polymerase may be referred to separately as an "active" Tma DNA polymerase, but is also referred to as Tma DNA polymerase throughout the specification.

The Tma DNA polymerase of the present invention has a pH of pH 7.0, a temperature of 75 ° C., a concentration of KCl of 0-20 mM, a concentration of 0-15 mM (NH ₄ ) ₂ SO _{4, and a} concentration of Mg ²⁺ of 12-16 mM. It has physical and chemical characteristics that indicate optimal activity.

Furthermore, the 50 mM Tris-HCl (pH 8.4 ) / 40 mM KCl / 12.5 mM (NH 4) 2 SO 4/2 mM MgCl 2 / 0.05% Lambda phage (λ phage) under a reaction buffer consisting of Triton X-100 As a result of performing PCR using the Tma DNA polymerase of the present invention with the genomic DNA as a template, synthesis was possible up to 12 kb. In addition, PCR was performed using the Tma DNA polymerase under the buffer. As a result, DNA of 2 kb was amplified in a short time compared with Taq DNA polymerase and Pfu DNA polymerase. In addition, the accuracy of PCR showed high accuracy with a fairly low error rate.

The present invention provides protein variants having sequences that differ from the amino acid sequence of wild-type Tma DNA polymerase by deletion, insertion, non-conservative or conservative substitution, addition or combination of some sequences at one or more positions within the scope of the present invention. Include. In addition, the Tma DNA polymerase of the present invention includes the modified form of phosphorylation, sulfidation, acrylated, glycosylated, methylated, farnesylated and the like within the scope of the present invention.

The variant or modification may be a functional equivalent having substantially the same activity as the wild type protein or a form with increased or decreased physicochemical properties. For example, variants with enhanced enzyme activity. Or physical factors such as temperature, moisture, pH, electrolyte, reducing sugar, pressurization, drying, freezing, interfacial tension, light, repetition of freezing and thawing, high concentration conditions, acid, alkali, neutral salt, organic solvent, metal ion, oxidation It is a variant with enhanced structural stability to the external environment of chemical factors such as reducing agents and proteases.

The present invention also relates to a nucleic acid molecule encoding the heat resistant Tma DNA polymerase or an active type heat resistant Tma DNA polymerase.

Tma DNA polymerase having an amino acid sequence of SEQ ID NO: 12 preferably has a nucleic acid sequence of SEQ ID NO: 11, and an active type heat resistant Tma DNA polymerase having an amino acid sequence of SEQ ID NO: 14 from which an intein region has been removed is preferably Has a nucleic acid sequence of SEQ ID NO: 13.

The present invention also encompasses nucleic acid molecules encoding the aforementioned Tma DNA polymerase variants.

Of the present invention, Tma DNA polymerase, the active form of Tma DNA polymerase or nucleic acid molecules encoding a variant thereof may be mutated by substitution, deletion, insertion or a combination thereof at one or more positions. Such nucleic acid sequence variants are also within the scope of the present invention.

The present invention also relates to a vector comprising a nucleic acid molecule encoding the heat resistant Tma DNA polymerase or an active type heat resistant Tma DNA polymerase.

In the present invention, a "vector" is a recombinant vector capable of expressing a protein of interest in a host cell, and is a gene construct containing essential regulatory elements operably linked to express a gene insert. As used herein, “operably linked” refers to a functional linkage between an expression control sequence and a nucleic acid sequence encoding a protein of interest to perform a general function. Can be prepared using well-known genetic recombination techniques, and site-specific DNA cleavage and ligation can be facilitated using enzymes generally known in the art, etc. The vector of the present invention is a plasmid vector, course All common vectors, including mid vectors, bacteriophage vectors, viral vectors, etc. Preferably, they are plasmid vectors.

Suitable expression vectors can include expression control element sequences such as promoters, initiation codons, termination codons, polyadenylation signals and enhancers. The start codon and the stop codon must be functional in the subject when the gene construct is administered and must be in frame with the coding sequence. The promoter may be constitutive or inducible and may include the origin of replication in the case of a replicable expression vector. It may also include selectable markers that confer a selectable phenotype, such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of surface proteins for screening transformed microorganisms.

Specifically, the present invention provides a vector, which is pTMAP expressing Tma DNA polymerase having the amino acid sequence of SEQ ID NO: 12. The present invention also provides a vector, which is a pTMAM expressing an active Tma DNA polymerase having the amino acid sequence of SEQ ID NO: 14 from which an intein region has been removed.

In addition, the present invention relates to a microorganism transformed with the vector.

Microorganisms usable as host cells that can be transformed are not particularly limited. For example, E. coli (Escherichia coli), Rhodococcus (rhodococcus), Pseudomonas (Pseudomonas), Streptomyces (Streptomyces), Staphylococcus ( Staphylococcus ), Syfolobus , Thermoplasma , Thermoproteus and the like. Preferably E. coli.

Specifically, the present invention provides E. coli Rosetta (DE3) pLysS / pTMAP, a microorganism transformed with a pTMAP vector. Escherichia coli Rosetta (DE3) pLysS / pTMAP was deposited in KACC (Korean Agricultural Culture Collection, 88-20 Seodun-dong, Suwon-si, Suwon-si) under accession number KACC 95094P. The present invention also provides Escherichia coli Rosetta (DE3) pLysS / pTMAM, which is a microorganism transformed with a pTMAM vector. Escherichia coli Rosetta (DE3) pLysS / pTMAM was deposited in KACC (Korean Agricultural Culture Collection, 88-20, Seodun-dong, Gwonseon-gu, Suwon-si) under accession number KACC 95093P on October 28, 2008.

Vector introduction into host cells can be carried out by known methods such as electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, PEG, textlan sulfate, lipofectamine, and the like. Can be done.

In addition, the kit comprises a heat-resistant Tma DNA polymerase isolated from the Thermococcus mariners having the amino acid sequence of SEQ ID NO: 12 and an active heat-resistant Tma DNA polymerase having the amino acid sequence of SEQ ID NO: 14 from which the intein coding region is removed. It is about.

The Tma DNA polymerase of the present invention can be used as a kit component of a nucleic acid amplification reaction. Such nucleic acid amplification reactions include ligand chain reaction (LCR), nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR), strand displacement amplification (SDA), branched DNA signal amplification, PCR (polymerase chain reation), etc. can be illustrated. Preferably, the PCR also includes real time PCR, nested PCR, multiplex PCR, and the like.

In addition to the Tma DNA polymerase, the kit for nucleic acid amplification reaction of the present invention includes one or more other components, solutions or devices suitable for the analysis method. For example, the kit of the present invention may include one or more components selected from a container containing a detection primer, an amplification tube or container, reaction buffer, dNTPs, RNAse, sterile water, and the like.

Kits containing the Tma DNA polymerase of the present invention can be usefully used in various fields such as genetic engineering and molecular biology experiments, clinical diagnosis, forensic research.

The present invention also relates to a method for producing Tma DNA polymerase.

The Tma DNA polymerase of the present invention can be prepared by a method of separating from a source of natural origin, a method of chemical synthesis, or a method of introducing a vector encoding a Tma DNA polymerase into a suitable host, expressing it, and then separating it from the host.

A system for preparing an expression vector capable of efficiently expressing Tma DNA polymerase and expressing it in a microorganism is well known to those skilled in the art, and can be implemented by various modifications / applications. One example of such an implementation is as follows.

Tma DNA polymerase comprises the steps of (i) preparing a vector expressing Tma DNA polymerase; (ii) transforming the vector with a microorganism; (iii) culturing the transformant; And (iv) may be prepared by a process comprising the step of recovering the protein from the transformant.

The type of vector in step (i), the method of transforming the vector in step (ii), and the type of microorganism used as a stem cell are as described above.

The culturing process of step (iii) is carried out according to a method well known for the type of microorganism used as a transformant, and conditions such as a medium component, a culture temperature and a culture time can be appropriately adjusted. Specifically, the culture medium contains all the nutrients essential for the growth and survival of microorganisms such as carbon sources, nitrogen sources, trace element components and the like. The pH of the medium can be adjusted appropriately, and components such as antibiotics can be included.

In addition, the expression of the protein may be induced by treating an inducer such as isopropyl thiogalactopyranoside (hereinafter referred to as “IPTG”). The type of inducer to be treated may be determined according to the vector system, and conditions such as the induction agent administration time and dosage may be appropriately controlled.

In step (iv) the protein is recovered and purified in a conventional manner. For example, the cells recovered by the centrifugation method are crushed using a French press, an ultrasonic crusher or the like. If protein is secreted into the culture, the culture supernatant is collected. When aggregated by overexpression, it can be obtained by dissolving, denaturing and refolding the protein in the appropriate solution. Oxidation and reduction systems of glutathione, dithiothreitol, β-mercaptoethanol, cystine and cystamine are used, and refolding agents such as urea, guanidine, arginine and the like are used. Some of the salts may be used with the refolding agent.

At this time, the step of heat treatment for 10 to 60 minutes at 70 to 85 ℃ can be added.

Proteins obtained by culturing the transformant can be used without purification and are subjected to conventional biochemical separation techniques such as treatment with protein precipitants (salting), centrifugation, sonication, ultrafiltration, dialysis, chromatography Photography and the like can be used alone or in combination. Chromatography includes ion exchange chromatography, size exclusion chromatography, affinity chromatography, and the like.

The scale of the protein manufacturing process can be adjusted to suit the purpose of experiments, industrial, etc. As a result, the process conditions for each step can be changed. In addition, there may be additional and charging processes between each process.

Thus obtained protein can be converted into a salt by a well-known method when obtained as a free body, and when obtained into a salt, it can be converted into a free body or another salt by a well-known method.

In a specific embodiment of the present invention, the cells were recovered by centrifugation of the cultured cells, and then disrupted by ultrasonication and subjected to column chromatography using a HiTrapTM Heparin HP column (GE Healthcare).

Proteins obtained by this process exist in a "substantially pure" state that is sufficiently separated from other proteins in a physical environment that is distinct from the naturally occurring environment. The protein prepared by the above method can be used as a heat-resistant enzyme having excellent DNA polymerization activity in a wide range of fields from molecular biology and genetic engineering experiments to early diagnosis of viral and cancer genes, genetic disease diagnosis and forensic research.

Since the Tma DNA polymerase of the present invention has excellent DNA polymerization activity and high correction activity, it can be widely used in various nucleic acid polymerization reactions such as PCR.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example 1 Culture of Thermococcus Mariners Strains

Thermococcus marinus strain (DSM 15227) was incubated in 990 medium. 990 medium (4.0 g peptone per liter, 2.0 g yeast extract, 35.0 g sea salts (sigma), 3.46 g PIPES, 5 g Elemental sulphur, 0.5 g NH ₄ Cl, 0.35 KH ₂ PO ₄ 0.35 g, CaCl ₂ 0.2 g, FeCl ₃ 6.7 mg, Na ₂ WO ₄ 2.9 mg, Resazurin 0.1 mg) was prepared, followed by pH 6.8 with 5 N sulfuric acid. At this time, peptone and yeast extract (prepared as 10% stock) and elemental sulphur are prepared separately without adding together. The solution was heated overnight (about 8 hours) in an incubator at 100 ° C. to sterilize and remove oxygen from the solution. Some of the precipitate formed after the heating was quickly filtered and then again heated for 3 hours in a 100 ℃ incubator. 0.5 g of Elemental sulphur was added to a 120 ml serum bottle (Wheaton Co., USA) and 100 ml of heated electric media solution was added. The gas inside the serum bottle containing the media solution was replaced with nitrogen gas for 30 minutes. Then, after closing the entrance of the serum bottle with a rubber bottle cap and an aluminum ring, it was sterilized for 24 hours at 95 ℃. After the sterilized peptone and yeast extract were added to the prepared medium by using a sterilized syringe, a small amount of 5% Na ₂ S.9H ₂ O solution was injected, and the 1% inoculation of the Thermococcus mariners strain was then inoculated at 80 ° C. Incubated for 24 hours.

Example 2: Isolation of Genomic DNA

The cultures incubated under anaerobic conditions were filtered to remove sulfur, the cells were recovered by centrifugation, and the cells were suspended in 10 mM Tris-HCl (pH 8.0) buffer containing 20% sucrose. After freezing and thawing, the cell membrane was attenuated twice, and Triton X-100 was added to a final concentration of 0.3%, followed by reaction at room temperature for 1 hour. To this was added SET (150 mM NaCl / 1 mM EDTA / 20 mM Tris-HCl (pH 8.0)) buffer, SDS and RNase were added and reacted at 55 ° C for 1 hour, followed by proteinase K ( proteinase K) was added and reacted at 37 ° C for 1 hour and at 55 ° C for 2 hours. Subsequently, the same amount of chloroform / isoamylalcohol (24: 1) was added thereto, followed by shaking overnight, followed by 2 times volume of 100% ethanol and 1/10 volume of 3M sodium acetate ( Genomic DNA was precipitated by addition of sodium acetate (pH 5.2), washed with 70% ethanol and dried in vacuo and dissolved in TE (10 mM Tris-HCl (pH 7.6) / 1 mM EDTA) buffer. Thermococcus mariners genomic DNA isolated as described above was quantified by measuring the absorbance at 260 nm wavelength.

Example 3: Selection of DNA Polymerase Genes

Thermo Lactococcus Mariners to as a template for genomic Thermo Lactococcus Mariners to genomic DNA to screen the Tma DNA polymerase gene from the DNA, and the thermopile Lactococcus coder reported previously Karen cis source code (Thermococcus kodakaraensis KOD1) (see: M. Takagi et al , 1997, Appl.Environ.Microbiol . 63 (11), 4504-4510), Thermococcus sp. NA1 (Kim YJ et al ., 2007, J Microbiol Biotechnol. 17 (7) 1090-7), and well conserved sites in the DNA polymerase genes of Pyrococcus furiosus (Lundberg, KS et al ., 1991, Gene 108 (1), 1-6). The mixed primers of SEQ ID NOS: 1 and 2 were prepared with reference to two amino acid sequences. SEQ ID NO: 1 primer is the nucleotide sequence encoding the amino acid sequence EYDIPFA. SEQ ID NO: 2 primer is a complementary sequence of nucleotide sequence encoding amino acid sequence YYIENQV. PCR was performed using these primers as a template for the Thermococcus marineus genomic DNA. The PCR conditions were reaction for 3 minutes at 94 ℃, 1 minute at 94 ℃, 1 minute at 47 ℃ and 6 minutes at 67 ℃ 5 times the reaction after 1 minute at 94 ℃ 1 minute at 48 ℃ and 69 ℃ The reaction process was repeated 25 times for 6 minutes, and the reaction product was electrophoresed on 0.8% agarose gel for 10 minutes at 72 ° C. to confirm that the DNA fragment of about 3.3 kb was amplified. The PCR reaction products were also purified on the 0.8% agarose gel using the QIAquick Gel Extraction Kit (QIAGEN). The purified DNA was commissioned by CoBio Systems Co., Ltd. to determine the nucleotide sequence, and compared with other DNA polymerase sequences of other known species, and showed high homology. Therefore, it was confirmed that the purified 3.3 kb DNA fragment was part of the Tma DNA polymerase gene of Thermococcus mariners. This was used as the center for screening the Tma DNA polymerase gene of Thermococcus mariners.

SEQ ID NO: 1 Primer (T-111N): 5'-GARTACGACATACCCTTYGC-3 '

SEQ ID NO: 2 Primer (T-CR): 5'-AACCTGGTTCTCRATKTAGTA-3 '

(Wherein R is an A or G base, Y is a C or T base, and K is a base of G or T.)

Example 4 Using Primer Walking Method Tma Search for unknown contiguous DNA sites (N and C termini) from the center of the DNA polymerase gene

Four internal primers were prepared based on the DNA nucleotide sequence of 3.3 kb of the Tma DNA polymerase gene already secured in Example 3 (SEQ ID NOs: 3, 4, 5, and 6 primers). The Walking SpeedUp ™ Premix Kit (seegene, Korea) was used to find unknown contiguous sequences. In order to clone the gene region corresponding to the 5 'upstream (N-terminal region) of the Tma DNA polymerase gene, four random primers and SEQ ID NO: 3 primer (Tma-N-1) in the Walking SpeedUp TM Premix Kit and The first PCR was performed using Thermococcus mariners genomic DNA. As a template, a second PCR was performed using a SEQ ID No. 4 primer (Tma-N-2) and a second PCR primer in the kit as a template to specifically amplify a DNA fragment of about 1,200 bp. The amplified DNA fragments were electrophoresed on an agarose gel, extracted and purified using a QIA quick Gel Extraction Kit (QIAGEN Gmbh, Germany), and then subjected to Cobiobiosystem Co., Ltd. to determine the base sequence. As a result of determining the nucleotide sequence of these fragments, the nucleotide sequence in the 5 'upstream (N-terminal portion) including the start codon was obtained.

In addition, four random primers in the Walking SpeedUp TM Premix Kit and SEQ ID NO: 5 primers (Tma-C-) were used to clone the gene region corresponding to the unknown 3 'downstream (C-terminal region) adjacent to the conserved nucleotide sequence. 1) and the first PCR was performed using Thermococcus mariners genomic DNA. The PCR product was specifically amplified by about 1,200 bp of DNA fragment using the SEQ ID NO: 6 primer (Tma-C-2) and the second PCR primer in the kit. The amplified DNA fragments were electrophoresed on agarose gel, extracted and purified using a QIA quick Gel Extraction Kit (QIAGEN Gmbh, Germany), and commissioned to Cobiobiosystem to determine the base sequence. As a result of determining the nucleotide sequence of these fragments, a nucleotide sequence in the 3 'upstream (terminal C) portion including the stop codon was obtained. Thus, the entire nucleotide sequence encoding the Tma DNA polymerase gene was determined (SEQ ID NO: 11).

Internal primer sequence

SEQ ID NO: 3 Primer (Tma-N-1): 5'-GAAGGTCAATCCTCTTCCAGGT-3 '

SEQ ID NO: 4 Primer (Tma-N-2): 5'-AATCATCTCCTTCTCGGTCGAA-3 '

SEQ ID NO: 5 Primer (Tma-C-1): 5'-GTAATCCACGAGCAGATAACGC-3 '

SEQ ID NO: 6 Primer (Tma-C-2): 5'-GAGAAGCTCGTAATCCACGAG-3 '

Tma DNA polymerase gene sequences were analyzed using the DNASTAR (DNASTAR Inc., USA) program, and thermococcus onnurineus TNA1 and Pyrococcus gibi were analyzed using the NCBI BLAST program. The sequence and similarity of Pyrococcus GB-D (Deep Vent) and Pyrococcus furiosus DNA polymerase genes were compared.

As a result, the entire nucleotide sequence of the DNA polymerase gene isolated from the Thermococcus marinus strain was composed of 3,939 bp including the start codon (ATG) and the stop codon (TGA) and a total of 1312 amino acids. (SEQ ID NO: 12), and the total number of amino acids in the active DNA polymerase, consisting of two fragments of extein, except for 537 amino acids (SEQ ID NO: 14). From the amino acid sequence, it was estimated that the molecular weight of the active DNA polymerase enzyme of the present invention was about 90,000.60 Da. In addition, when comparing the amino acid sequence of the active DNA polymerase of the present invention isolated from the Thermococcus marinus strain and the amino acid sequence of other DNA polymerases, Thermococcus onnurineus TNA1 (see : Kim YJ et al ., 2007, J Microbiol Biotechnol. 17 (7), 1090-7) showed a sequence homology of 91.4%, and Pyrococcus GB-D, Deep Vent (See Holger WJ et al ., 1992, Appl. Environ Microbiol. 58 (11), 3472-3481), and showed 83% sequence homology with Pyrococcus furiosus . (Refer to Lundberg, KS et al ., 1991, Gene 108 (1), 1-6) and 79.6% sequence homology with the DNA polymerase (see Fig. 1).

Example 5: Tma  Construction of Expression Vectors pTMAP and pTMAM for Expression of DNA Polymerase Gene

Recombinant plasmid (pTMAP) in which the Tma DNA polymerase precursor gene including the intein coding site was inserted into the expression vector and the active Tma DNA polymerase gene were expressed by removing the intein coding site and connecting only the intein coding sites in sequence. Recombinant plasmids (pTMAM) inserted into the vectors were constructed as follows (see FIGS. 2A and 2B).

First, to obtain a Tma DNA polymerase precursor gene, SEQ ID NO: 7 primer (TmaN) (5 'terminal primer) and C-terminal amino acid encoding the N-terminal amino acid sequence from the nucleotide sequence of the Tma DNA polymerase gene determined in Example 4 After preparing each SEQ ID NO: 8 primer (TmaC) (3 'terminal primer) complementary to the DNA base encoding the sequence, the Tma DNA polymerase precursor gene was amplified by PCR. SEQ ID NO: 7 primer was synthesized to contain the restriction enzyme Nde I cleavage site containing the start codon (ATG) of the Tma DNA polymerase gene and SEQ ID NO: 8 primer containing the stop codon and restriction enzyme Hind III cleavage site, respectively. Thermococcus mariners genomic DNA was subjected to PCR using SEQ ID NOs: 7 and 8 primers. PCR was carried out at 95 ° C using a mixed composition consisting of 0.2 μg Thermococcus marine genomic DNA, 20 pmole 5 ′ and 3 ′ primers, 200 μM dNTPs, 10X PyroAce DNA polymerase buffer and 2.5 U Super PyroAce DNA polymerase. After the reaction was performed for 3 minutes at 50 ° C. at 60 ° C., 60 seconds at 58 ° C., and 360 seconds at 72 ° C., the reaction was carried out for 10 minutes at 72 ° C. Electrophoresis on 0.8% agarose gel with DNA size marker confirmed the presence of a band at about 3.9 kb. After completion of the PCR, the reaction mixture was electrophoresed on a 0.8% agarose gel, and the DNA product of about 3.9 kb amplified by PCR was purified by using a QIAquick Gel Extraction Kit (Qiagen Gmbh, Germany). The recovered DNA was digested with restriction enzymes Nde I and Hin dIII, and then electrophoresed again on a 0.8% agarose gel to purify the Tma DNA polymerase gene fragment using an electric kit using a gel fragment corresponding to about 3.9 kb. Recovery was carried out. The purified Tma DNA polymerase gene fragment was inserted into the expression vector pET-22b (+) (Novagen, USA) digested with the same restriction enzyme and ligated overnight at 16 ° C. using a T4 DNA ligase. E. coli Escherichia coli Rosetta (DE3) pLysS (Stratagene, USA) was transformed (Sambrook, J. et al ., 1989, Molecular cloning, a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory Press). Plasmid DNA was isolated from the transformants by alkaline lysis method, digested with restriction enzymes Nde I and Hin dIII, and then electrophoresed with DNA size marker on 0.8% agarose gel to express Tma DNA polymerase gene. It was again confirmed that it was correctly inserted in the vector. The expression vector constructed for expression of the Tma DNA polymerase gene constructed as described above was named pTMAP (FIG. 2A). The E. coli containing the expression vector and the expression vector containing the Tma DNA polymerase precursor gene and the gene were deposited on October 28, 2008, at the Korea Institute of Agricultural Biotechnology, Rural Development Agency, Agricultural Science and Technology Center, Escherichia coli Rosetta (DE3) pLysS. / pTMAP, accession number KACC95094P.

SEQ ID NO: 7 Primer (TmaN):

5'-NNNNN CATATG ATTCTCGATACCGACTGCATC-3 '

Nde I

SEQ ID NO: 8 Primer (TmaC):

5'-NNNNN AAGCTT CACTTCTTTCCCTTCGGC -3 '

Hind III

Next, in order to synthesize the active Tma DNA polymerase gene from which the inteins are removed, first, an N-extein region (N-extein, 1-491 amino acid sequence) coding region (1,473 bp fragment) and a C-terminal extend region (C -extein, 1029-1312 amino acid sequence) coding sites (855 bp fragment) were each amplified by PCR method and then electrophoresed on 0.8% agarose gel and recovered. After the two DNA fragments were mixed and annealed, the active Tma DNA polymerase gene (2.328 bp fragment) from which the intein was removed was prepared using SEQ ID NO. 7 primer (TmaN) and SEQ ID NO. 8 primer (TmaC). Amplified.

In more detail, first, a primer (TmaEx1, SEQ ID NO: 9) complementary to the 3 'end of the N-terminal extension region (N-extein, 1-491 amino acid sequence) coding region (1,473 bp) was newly prepared. Primer No. 9 was synthesized with 39 bases, including 19 bases complementary to the 5 ′ end of the C-terminal extend region coding region. Subsequently, PCR was performed under the PCR reaction conditions described above using the Thermococcus mariners genomic DNA as a template using SEQ ID NOs: 7 and 9 primers, followed by electrophoresis on a 0.8% agarose gel, and a 1,473 bp N-terminal extend region. DNA fragments encoding the genes were identified. After completion of the PCR, the reaction mixture was electrophoresed on a 0.8% agarose gel, and about 1.47 kb of DNA product amplified by PCR was purified by using a QIAquick Gel Extraction Kit (Qiagen Gmbh, Germany).

A primer (TmaEx2, SEQ ID NO: 10) complementary to the 5 ′ end of the C-termin extend region (C-extein, 1029-1312 amino acid sequence) coding region was constructed. 40 bases were synthesized, including 20 bases complementary to the 3 'end. Subsequently, PCR was carried out in the same manner as described above using the Thermococcus mariners genomic DNA as the template using SEQ ID NOs: 8 and 10 primers, followed by electrophoresis on an agarose gel using the same method described above. The DNA fragment encoding the stain was recovered.

The recovered DNA fragment encoding the N-terminal extender and the DNA fragment encoding the C-terminal extender were annealed in a 1: 1 ratio, and the DNA was then used as a template to sequence SEQ ID No. 7 primer (TmaN). PCR was carried out using the same method as described above using the above) and SEQ ID NO: 8 primer (TmaC). The PCR product was subjected to electrophoresis on a 0.8% agarose gel to isolate the active DNA polymerase gene from which the intein region of the 2.328 bp fragment (including stop codons) was removed.

The purified active Tma DNA polymerase gene fragment was inserted into the expression vector pET-22b (+) (Novagen, USA) digested with the same restriction enzyme and linked by the same method described above using T4 DNA ligase. E. coli Rosetta (DE3) pLysS (Stratagene, USA) was transformed. Plasmid DNA was isolated from the transformants by alkaline lysis method, digested with restriction enzymes Nde I and Hin dIII, and then electrophoresed with DNA size markers on 0.8% agarose gel to activate the active Tma DNA polymerase gene. It was reconfirmed that was correctly inserted into the expression vector. The expression vector for the expression of the active Tma DNA polymerase gene constructed as described above was named pTMAM (FIG. 2B). E. coli, including the expression vector and the expression vector containing the active Tma DNA polymerase gene and the gene was deposited on October 28, 2008, at the Korea Institute of Agricultural Biotechnology, Rural Development Institute of Agriculture and Biotechnology, Escherichia coli Rosetta (DE3). ) pLysS / pTMAM, Accession No. KACC95093P.

SEQ ID NO: 9 Primer (TmaEx1):

 5 '-CGTAGTAGCCGTAGTAACTGTTCGCCAGGATTTTGATAG -3'

SEQ ID NO: 10 Primer (TmaEx2):

5'- CTATCAAAATCCTGGCGAACAGTTACTACGGCTACTACGG -3 '

Example 6: Expression and Purification of Recombinant DNA Polymerase Gene

Is an octane from the above embodiments by the 5 method of transfection in which the recombinant strain of E. coli, Escherichia coli Rosetta (DE3) pLysS / pTMAP the Tma DNA containing the heptane from the Polymerase precursor protein and Escherichia coli Rosetta (DE3) pLysS / pTMAM After expression with each of the removed active Tma DNA polymerase proteins, the expressed proteins were purified as follows. In Example 5, E. coli Rosetta (DE3) pLysS, each having a recombinant plasmid, was inoculated in LB liquid medium to which 100 ug / ul ampicillin was added, incubated overnight at 37 ° C, and 5 ml was inoculated into 500 ml of the same medium. Incubated at 37 ° C. When the absorbance at 600 nm was about 0.6, IPTG (isopropyl β-D-galactopyranoside) was added to a final concentration of 0.1 mM and incubated overnight. Cells (2.1 g / wet weight) were recovered by centrifugation at 6,000 rpm for 15 minutes and then 25 ml of sonication buffer (20 mM Tris-HCl, pH 8.0), 0.5 mM NaCl containing 1 mM PMSF. Suspension) was disrupted by ultrasonication and centrifuged at 18,000 rpm for 15 minutes to remove E. coli cell debris. Next, after heat treatment at 80 ° C. for 30 minutes, the supernatant was recovered by centrifugation to remove most of E. coli-derived proteins. The supernatant was finally purified by column chromatography using HiTrap ™ Heparin HP column (GE Healthcare). Each Tma DNA polymerase purified as described above was stored in storage buffer (20 mM Tris-HCl, pH 8.0), 0.1 mM EDTA, 0.1% Tween 20, 0.5% Nonidet P40, 200 mM KCl, 50% dialyzed in Glycerol), and then, was used to perform PCR and stored at -20 ℃ using Tma DNA polymerase and to investigate the enzymatic properties of Tma DNA polymerase. In purifying heat-resistant Tma DNA polymerase from E. coli Rosetta (DE3) pLysS having recombinant plasmids pTMAP and pTMAM, the purification step results were as shown in Tables 1 and 2, respectively.

Purification of Tma DNA Polymerase from E. Coli Rosetta (DE3) pLysS / pTMAP Whole protein
(mg) Full active
(Unit) Inactivity
(U / mg) Recovery rate
(%) Sonication 1125.66 29421.78 26.14 100 Heat 70.2 26994.1 384.53 91.75 Heparin 17.3 15025.35 868.52 51.07

Purification of Tma DNA Polymerase from E. Coli Rosetta (DE3) pLysS / pTMAM Whole protein
(mg) Full active
(Unit) Inactivity
(U / mg) Recovery rate
(%) Sonication 3022.4 117462.88 38.86 100 Heat 187.41 106409.62 567.79 90.59 Heparin 73.1 73108.9 1000.12 62.24

The amount of protein in purification steps was determined using Lowry Assay . See J. Biol. Chem. 193, 261 (1951). In addition, denatured gel electrophoresis (sodium dodecyl sulfate-polyacrylamide gel electrophoresis, SDS-PAGE) was performed to confirm the degree of purification (see Figure 3). Particularly E. coli Rosetta (DE3) expression and enzymatic activity of Tma DNA polymerase pLysS / pTMAM origin is much higher than the expression and enzymatic activity of the E. coli Rosetta (DE3) Tma DNA polymerase precursor of pLysS / pTMAP origin (Table 1 and 2, see ). The degree of purification according to the purification step of E. coli Rosetta (DE3) pLysS / pTMAP derived Tma DNA polymerase is shown in Figure 3a by SDS-PAGE electrophoresis picture. lane 1 is an ultrasonic disrupted sample of E. coli Rosetta (DE3) pLysS / pTMAP cells cultured without IPTG induction, lane 2 is an ultrasonic crushed sample of E. coli Rosetta (DE3) pLysS / pTMAP cells cultured by IPTG induction, lane 3 is a sample after heat treatment at 80 ℃ 30 minutes, lane 4 is a sample after HiTrapTM Heparin HP column chromatography. Through the purification process, the Tma DNA polymerase precursor protein was confirmed to have a molecular weight of about 90,000 Da by heat treatment at 80 ° C. for 30 minutes (see lane 3 of FIG. 3A), which was derived from Tma DNA polymerase precursor protein (molecular weight of about 152,384.40 Da). It is believed that the tain protein (molecular weight about 62,383.80 Da) has been self-spliced by heat and converted to an active Tma DNA polymerase having a molecular weight of 90,000.60 Da.

In addition, the purification effect of the purification step of the Tma DNA polymerase derived from E. coli Rosetta (DE3) pLysS / pTMAM is shown in SDS-PAGE electrophoresis picture 3b. Lane 1 is an ultrasonic disrupted sample of E. coli Rosetta (DE3) pLysS / pTMAM cells cultured without IPTG induction, lane 2 is an ultrasonic crushed sample of E. coli Rosetta (DE3) pLysS / pTMAM cells cultured with IPTG induction, lane 3 Sample after heat treatment at 80 ° C. for 30 minutes, lane 4 is a sample after HiTrapTM Heparin HP column chromatography. Purification confirmed that the active Tma DNA polymerase protein had a molecular weight of about 90,000 Da, which was similar to 90,000.60 Da of the molecular weight estimated from the amino acid sequence of Example 4 (see FIG. 3B). lane M represents a protein low molecular weight marker. The specific activity of the purified enzyme is 868.52 U / mg and 1000.12 U / mg, respectively.

Example 7: Tma  Investigation of enzyme properties in DNA polymerization activity of DNA polymerase

The enzymatic properties of the DNA polymerization activity of Tma DNA polymerase were investigated based on the following DNA polymerization activity measurement method (see Choi, JJ et al. , 1999, Biotechnol. Appl. Biochem. 30 , 19- 25). Reaction mixture ( Tma DNA polymerase purified in Example 6, 1.25 μg activated calf thymus DNA, 50 mM Tris-HCl, pH 7.5), 80 mM KCl, 14 mM MgCl ₂ , 1 mM β-mercaptoethanol, 100 μM dATP , dCTP and dGTP, 10 μM dTTP, 0.5 μCi [ methyl - ³ H] thymidine 5′-triphosphate) were reacted at 75 ° C. for 10 minutes and then quenched on ice. The reaction solution was added dropwise to a DE-81 filter paper disk (23 mm, Whatman Co., USA) and dried at 65 ° C., followed by 0.5 M sodium phosphate (pH 7.0) buffer. 10 minutes, and washed in 70% ethanol for 5 minutes in order, and then dried again at 65 ℃. The DE-81 filter paper disk prepared as above was used to measure DNA polymerization activity using the LS 6500 scintillation system (Beckman Co., USA). When examining the enzyme properties in the DNA polymerization activity, it was carried out in the above method by changing the pH of the reaction mixture or the concentration of each component or the reaction temperature.

In order to observe the effect of pH on the enzyme activity of the two types of Tma DNA polymerase purified in Example 6, 50 mM MOPS buffer solution in the pH 6.0-7.0 range, 50 mM Tris-HCl in the pH 7.0-9.0 range Enzyme activity was investigated using each buffer solution. As a result, both Tma DNA polymerases showed similar results, in particular, the maximum DNA polymerization activity at pH 7.0 (see Fig. 4). Therefore, these two enzymes are obviously the same enzyme. Figure 4 is a graph showing the degree of DNA polymerization activity relatively according to the pH of the Tma DNA polymerase, in Figure 4 △ represents a result of using the Tma DNA polymerase and 50 mM MOPS buffer solution pTMAP origin, ○ is pTMAP derived Tma DNA polymerase and 50 mM Tris-HCl buffer solution are shown. In addition, ▲ shows the result using pTMAM-derived Tma DNA polymerase and 50 mM MOPS buffer solution, and ● shows the result using pTMAM-derived Tma DNA polymerase and 50 mM Tris-HCl buffer solution.

The effects of temperature on the DNA polymerization activity of the two Tma DNA polymerases purified in Example 6 were examined at 55-90 ° C., and both enzymes showed the same pattern according to temperature, and the maximum DNA at 75 ° C. Polymerization activity was shown respectively (see FIG. 5). 5 is a relatively graphs the degree DNA polymerase activity according to the temperature of the Tma DNA polymerase, in Figure 5 ○ represents the result of the use of Tma DNA polymerase pTMAP origin, ● is used for Tma DNA polymerase pTMAM derived Results are shown. Both of these enzymes have proven to be the same because they have the same pH, optimum temperature, and molecular weight of the same size in electrophoresis. Therefore, from the next experiment, various enzyme properties were investigated using the active Tma DNA polymerase purified from Escherichia coli Rosetta (DE3) pLysS / pTMAM.

After a while the Tma DNA polymerase stored respectively in 94 ℃ and 99 ℃ for 8 hours sampling every hour, examination, the thermal stability by measuring DNA polymerization activity as described above, Tma DNA polymerase is 94 ℃ 50% DNA polymerization activity was maintained for about 2 hours (see FIG. 6). FIG. 6 is a graph showing the thermosafety of Thermococcus marineus DNA polymerase. In FIG. 6, ● and ▲ show the results of Tma DNA polymerase after incubation at 94 ° C. and 99 ° C., respectively.

Investigation of the effects of monovalent cations on the DNA polymerization activity of Tma DNA polymerase showed that the optimal KCl concentration was 0-20 mM (see FIG. 7), and the optimal (NH ₄ ) ₂ SO ₄ concentration was 0-. 15 mM (see FIG. 8). 7 is Tma DNA and relative graphs showing the degree of DNA polymerase activity according to the KCl concentration of the polymerase, Figure 8 (NH _{4) 2} SO DNA polymerization activity level graphs relatively showing the according to the _fourth concentration of the Tma DNA polymerase to be.

As a result of examining the effect of Mg ²⁺ , a divalent cation, on the DNA polymerization activity of Tma DNA polymerase, the optimum Mg ²⁺ concentration was 12-16 mM (see FIG. 9). 9 is a graph showing the relative degree of DNA polymerization activity according to the concentration of Mg ²⁺ of Tma DNA polymerase.

Example 8: Tma  Measurement of 3 '→ 5' Nucleic Acid Terminal Hydrolase Activity of DNA Polymerase

The 3 '→ 5' nucleic acid terminal hydrolase activity of Tma DNA polymerase was measured as follows. First, as a substrate for measuring 3 ′ → 5 ′ exonuclease activity, a pBluescript SK-vector was cleaved with restriction enzyme Not I, followed by radioisotope [α- ³² P] dCTP and the Klenow fragment were used to mark the 3 ′ end of the pBluescript SK-vector digested with the restriction enzyme. Next, the reaction mixture ( Tma DNA polymerase, radioisotope labeled substrate at the 3 ′ end, 50 mM Tris-HCl (pH 7.5), 1 mM 2-mercaptoethanol, 10 mM MgCl ₂ , 0.01% BSA), respectively Samples were taken at 10-minute intervals, stored at 75 ° C for 1 hour in the presence or absence of dNTP, quenched on ice, centrifuged with 5% trichloroacetic acid solution, and the supernatant recovered. The nucleic acid terminal hydrolase activity was measured using the LS 6500 scintillation system. As a result, it was confirmed that the Tma DNA polymerase had 3 ′ → 5 ′ nucleic acid terminal hydrolase activity (see FIG. 10). In particular, it can be seen that the enzyme activity is higher in the absence of dNTP. The 3 '→ 5' nucleic acid terminal hydrolase activity of Tma DNA polymerase was estimated by amino acid sequence comparison and was consistent with the experimental results. This 3 ′ → 5 ′ nucleic acid terminal hydrolase activity is also called corrective activity and plays a role of enhancing the accuracy during DNA polymerization. FIG. 10 is a graph showing 3 ′ → 5 ′ nucleic acid terminal hydrolase activity of Thermococcus marinus DNA polymerase. In FIG. 10, 3 ′ → 5 ′ nucleic acid terminal hydrolase activity in the presence of dNTP and ○ in the absence of dNTP. The result of a measurement is shown, respectively.

Example 9: Tma  Determination of Optimum Conditions for PCR Using DNA Polymerase

To examine the availability of Tma DNA polymerase in PCR where heat-resistant DNA polymerase is most importantly used, and to determine the optimal composition of reaction buffer for PCR using Tma DNA polymerase, PCR was performed as follows. Was performed. 23 ng lambda phage genomic DNA was used as a template, respectively, based on the optimal conditions determined by the 5 'and 3' terminal primers of 1 pmole, 250 μM dNTPs, and the characterization of the Tma DNA polymerase in Example 8. Repeat the procedure of 20 seconds at 94 ° C. and 1 minute at 72 ° C. for 25 times using 1 × Tma DNA polymerase reaction buffer solution and 0.1 unit of purified Tma DNA polymerase (see Example 6 above) as a reaction mixture. PCR results were confirmed by 0.8% agarose gel electrophoresis. When determining the optimal composition of the reaction buffer in PCR using Tma DNA polymerase, the pH of the reaction buffer or the concentration of each component were varied.

As a result of investigating the effect of pH on PCR using Tma DNA polymerase, the optimum pH of the PCR reaction buffer was 8.4 (see FIG. 11). Figure 11 shows the results according to pH in the polymerase chain reaction using Tma DNA polymerase, in Figure 11 M represents a 1 kb DNA ladder (New England BioLabs), each lane represents a pH. PCR amplification size is 2 kb.

As a result of investigating the effects of monovalent cations on PCR using Tma DNA polymerase, the optimum KCl concentration was 40 mM (see FIG. 12). FIG. 12 shows the results according to the KCl concentration in the polymerase chain reaction using Tma DNA polymerase. In FIG. 12, M represents the 1 kb DNA ladder (New England BioLabs), and each lane represents the KCl concentration. .

As a result of investigating the effect of (NH ₄ ) ₂ SO ₄ on PCR using Tma DNA polymerase, the optimum concentration was 12.5 mM (see FIG. 13). FIG. 13 shows the results according to (NH ₄ ) ₂ SO ₄ concentration in the polymerase chain reaction using Tma DNA polymerase. In FIG. 13, M represents a 1 kb DNA ladder (New England BioLabs), and each lane Shows the (NH ₄ ) ₂ SO ₄ concentration.

As a result of examining the effect of divalent cation Mg ²⁺ on PCR using Tma DNA polymerase, the optimal concentration was 2 mM (see FIG. 14). Figure 14 shows the results according to MgCl ₂ concentration in the polymerase chain reaction using Tma DNA polymerase, in Figure 14 M represents a 1 kb DNA ladder (New England BioLabs), each lane represents the MgCl ₂ concentration It is shown.

The results showed that Tma DNA polymerase was available for PCR, and the optimal reaction buffer composition for PCR using Tma DNA polymerase was 50 mM Tris-HCl (pH) containing Triton X-100 as a stabilizer. 8.4), 40 mM KCl, 12.5 mM (NH ₄ ) ₂ SO ₄ , 2 mM MgCl ₂ , 0.05% Triton X-100, 0.0075% BSA, 0.5 mM EDTA.

Example 10: Tma  Longest Length Amplification PCR Using DNA Polymerase

23 ng of lambda phage genomic DNA was used as a template for the 5 ′ and 3 ′ terminal primers of each 1 pmole, 250 μM dNTPs, the 1 × Tma DNA polymerase optimal reaction buffer determined in Example 9 above and purified in Example 6 above. According to the length of the target amplification product expected to investigate the amplifiable length of the PCR using the Tma DNA polymerase, PCR was performed as follows. The reaction was carried out at 94 DEG C for 20 seconds, and then at 50 DEG C / kb according to the expected size of the DNA fragment at 72 DEG C. After PCR reaction, 0.8% agarose gel electrophoresis confirmed the PCR results. As a result, Tma DNA polymerase can be synthesized up to 12 kb by PCR using genomic DNA of lambda phage under optimal reaction buffer solution. It could be confirmed (see Fig. 15). FIG. 15 shows the results of a polymerase chain reaction using Tma DNA polymerase using lambda phage genomic DNA as a reaction mixture under an optimal reaction buffer solution. In FIG. Represents the 1 kb DNA ladder (New England BioLabs).

Example 11: Tma  PCR at the shortest amplification time using DNA polymerase

23 ng of lambda phage genomic DNA as template, 5 'and 3' terminal primers of each 1 pmole, 250 μM dNTPs, optimal reaction buffer for each polymerase and each polymerase with Tma , Taq And to investigate the shortest amplification time of PCR using Pfu DNA polymerase PCR was performed as follows according to the amplification time. The reaction was carried out at 94 DEG C for 20 seconds and then at 72 DEG C for 5, 10, 20, 40 and 60 seconds. After PCR reaction, 0.8% agarose gel electrophoresis confirmed the PCR results. In the case of PCR using Taq and Pfu DNA polymerase, Tma DNA polymerase was 5 compared to 40 kb from 40 seconds or more. It was confirmed that the synthesis of 2 kb in seconds (see Fig. 16). FIG. 16 illustrates the results of polymerase chain reaction using a thermococcus mariners DNA polymerase under an optimal reaction buffer using lambda phage genomic DNA as a template. In FIG. 16, lane represents amplification time at 72 ° C. , First lane 5-60 is PCR result using Tma DNA polymerase, middle lane 60-60 is PCR result using Taq DNA polymerase, last lane 5-60 is PCR result using Pfu DNA polymerase, M Represents the 1 kb DNA ladder (New England BioLabs).

Example 12: Tma  Investigation of accuracy in PCR using DNA polymerase

PCR fidelity (PCR fidelity) in PCR using Tma DNA polymerase was performed by slightly modifying the Lundberg method as follows (Lundberg et al ., 1991, Gene 108 (1), 1). -6). In fact, the experiment was measured by the same method as used by Song et al . And Choi, and the same expression vector pJR- lacZ (5.7 Kb) and primers were used (Song JM et al ., 2007, Enzyme Microbe.Technol . 40 , 1475-1483; Choi JJ et al., 2008, Appl. Environ.Microbio l. 74, 6563-6569). First, the 835 bp fragment of the 5 'portion of the expression vector pJR- lacZ into which the lacZ gene was inserted was amplified by PCR using Tma DNA polymerase. At this time, PCR using Tma DNA polymerase later by performing the same PCR using DNA polymerase already advanced to the goods in place of Tma DNA polymerase was to compare the results. Next, each of the PCR amplification products was digested with restriction enzymes Bam HI and Cla I, and then reinserted into the expression vector digested with the same restriction enzymes, and then transformed into E. coli by electroshock gene transfer. Antibiotic ampicillin and IPTG and X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) was evenly plated in agar plate medium and incubated for 16 hours at 37 ℃. Subsequently, the agar plate was stored at 4 ° C. for 2 hours, and then the number of blue colonies and white colonies was counted, and mutation frequencies and error rates were calculated based on the numbers of blue colonies and white colonies. The results are shown in Table 3 below, and the PCR accuracy in PCR using Tma DNA polymerase was similar to that of Pfu DNA polymerase, but much higher than that of Taq DNA polymerase, which is mainly used for general PCR. It was confirmed that Tma DNA polymerase can be used for PCR requiring a high degree of accuracy.

Error Rate Comparison of PCR Products with Tma DNA Polymerase and Taq and Pfu DNA Polymerase Target
(ng) Mold doubling
(Template doubling) Mutation frequency
Mutant frequencies Error rate (10-5) Tma 58.85 5.17 0.026 0.63 Taq 58.85 5.84 0.081 1.76 Pfu 58.85 4.43 0.021 0.59

The present invention is expected to be applied in a wide range of fields, such as heat resistance polymerase, genetic engineering research, early diagnosis of viral and cancer genes, genetic disease diagnosis, GMO and forensic research.

Figure 1 shows the amino acid sequence of the active type Tma DNA polymerase from which the intein is removed compared with the amino acid sequence of the conventional heat-resistant B-based DNA polymerase.

2 shows the construction of recombinant plasmids pTMAP (FIG. 2A) and pTMAM (FIG. 2B) for expression of the Tma DNA polymerase gene. Figure 2a is a Tma DNA polymerase whole gene containing the intein is inserted into the plasmid pET-22b (+), Figure 4b is a Tma DNA polymerase gene is inserted into the plasmid pET-22b (+) removed intein It is.

Figure 3 shows the results of SDS modified gel electrophoresis according to the purification step of the Tma DNA polymerase expressed in E. coli. Figure 3a shows the purification step from the expression product derived from recombinant plasmid pTMAP, Figure 3b shows the purification step from the expression product derived from recombinant plasmid pTMAM.

Figure 4 is a graph showing the relative degree of DNA polymerization activity according to the pH of the Tma DNA polymerase. Tma DNA polymerase activity (Δ, ○) purified from plasmid pTMAP and Tma DNA polymerase activity (▲, ●) purified from plasmid pTMAM are shown.

5 is a graph showing the degree of DNA polymerization activity relative to each temperature of Tma DNA polymerase (O) purified from plasmid pTMAP and Tma DNA polymerase (●) purified from plasmid pTMAM.

Figure 6 is a graph showing the thermal stability of the Tma DNA polymerase relative to 99 ℃ and 94 ℃, respectively.

7 is a graph showing the relative degree of DNA polymerization activity according to the KCl concentration of Tma DNA polymerase.

8 is a graph showing the relative degree of DNA polymerization activity according to (NH ₄ ) ₂ SO ₄ concentration of Tma DNA polymerase.

9 is a graph showing the relative degree of DNA polymerization activity according to the concentration of MgCl ₂ of Tma DNA polymerase.

10 is a graph showing 3'-5 'nucleic acid terminal hydrolase activity of Tma DNA polymerase.

Figure 11 shows the results according to pH in the polymerase chain reaction (PCR) using Tma DNA polymerase.

Figure 12 shows the results according to the KCl concentration in the polymerase chain reaction using Tma DNA polymerase.

Figure 13 shows the results according to (NH ₄ ) ₂ SO ₄ concentration in the polymerase chain reaction using Tma DNA polymerase.

Figure 14 shows the results according to the concentration of MgCl ₂ in the polymerase chain reaction using Tma DNA polymerase.

Figure 15 shows the results of the polymerase chain reaction with amplification time of 50 seconds per kb using the Tma DNA polymerase under the optimal reaction buffer as lambda phage genomic DNA template.

16 is a comparison of the results of polymerase chain reaction at various amplification times using Tma DNA polymerase, Taq DNA polymerase and Pfu DNA polymerase under an optimal reaction buffer using lambda phage genomic DNA as a template. It is shown.

<110> SUNGKYUNKWAN UNIVERSITY Foundation for Corporate Collaboration <120> DNA polymerase derived from Thermococcus marinus D and its use <160> 14 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer T-111N <400> 1 gartacgaca tacccttygc 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer T-CR <400> 2 aacctggttc tcratktagt a 21 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer Tma-N-1 <400> 3 gaaggtcaat cctcttccag gt 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer Tma-N-2 <400> 4 aatcatctcc ttctcggtcg aa 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer Tma-C-1 <400> 5 gtaatccacg agcagataac gc 22 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer Tma-C-2 <400> 6 gagaagctcg taatccacga g 21 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer TmaN <400> 7 nnnnncatat gattctcgat accgactgca tc 32 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer TmaC <400> 8 nnnnnaagct tcacttcttt cccttcggc 29 <210> 9 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer TmaEx1 <400> 9 cgtagtagcc gtagtaactg ttcgccagga ttttgatag 39 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer TmaEx2 <400> 10 ctatcaaaat cctggcgaac agttactacg gctactacgg 40 <210> 11 <211> 3939 <212> DNA <213> Thermococcus marinus <220> <221> CDS (222) (1) .. (3936) <223> Tma DNA Polymerase <400> 11 atg att ctc gat acc gac tgc atc acc gag aac ggg aag cct gtg ata 48 Met Ile Leu Asp Thr Asp Cys Ile Thr Glu Asn Gly Lys Pro Val Ile   1 5 10 15 agg gtc ttc aag aag gag aac ggc gag ttt aaa atc gag tac gac aga 96 Arg Val Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg              20 25 30 acc ttc gag ccc tac ttc tac gcc ctc ctg aag gac gat tca gca ata 144 Thr Phe Glu Pro Tyr Phe Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile          35 40 45 gaa gac gtg aag aaa gta acc gct aaa agg cat ggg acg gtc gtg aag 192 Glu Asp Val Lys Lys Val Thr Ala Lys Arg His Gly Thr Val Val Lys      50 55 60 gtg aag cgc gcc gag aag gtg cag agg aag ttc ctc ggc agg ccg ata 240 Val Lys Arg Ala Glu Lys Val Gln Arg Lys Phe Leu Gly Arg Pro Ile  65 70 75 80 gag gtc tgg aag ctc tac ttc acg cac cct cag gac gtt cca gcg att 288 Glu Val Trp Lys Leu Tyr Phe Thr His Pro Gln Asp Val Pro Ala Ile                  85 90 95 cga gac aag att agg gag cat ccg gcc gtt gtg gac atc tac gag tac 336 Arg Asp Lys Ile Arg Glu His Pro Ala Val Val Asp Ile Tyr Glu Tyr             100 105 110 gac ata ccc ttc gcc aag cgc tac ctc atc gac aag ggc ctg att ccg 384 Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro         115 120 125 atg gag ggc gac gag gag ctc acg atg ctc gcc ttc gac atc gag acg 432 Met Glu Gly Asp Glu Glu Leu Thr Met Leu Ala Phe Asp Ile Glu Thr     130 135 140 ctc tac cat gag ggt gag gag ttt gga acc gga ccg att ctc atg ata 480 Leu Tyr His Glu Gly Glu Glu Phe Gly Thr Gly Pro Ile Leu Met Ile 145 150 155 160 agc tac gcc gac gag aac gag gca agg gtg ata acc tgg aag aag att 528 Ser Tyr Ala Asp Glu Asn Glu Ala Arg Val Ile Thr Trp Lys Lys Ile                 165 170 175 gac ctt ccg tac gtt gag gtc gtt tcg acc gag aag gag atg att aag 576 Asp Leu Pro Tyr Val Glu Val Val Ser Thr Glu Lys Glu Met Ile Lys             180 185 190 cgc ttc ctc cgc gtc gtc aag gag aag gac ccc gac gtg ctc atc acc 624 Arg Phe Leu Arg Val Val Lys Glu Lys Asp Pro Asp Val Leu Ile Thr         195 200 205 tac aac ggc gac aac ttc gac ttc gct tat cta aaa aag cgc tgt gag 672 Tyr Asn Gly Asp Asn Phe Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu     210 215 220 aaa ctc ggg ata aag ttc acg ctc ggg aga gac gga agc gag ccg aaa 720 Lys Leu Gly Ile Lys Phe Thr Leu Gly Arg Asp Gly Ser Glu Pro Lys 225 230 235 240 atc cag cgc atg ggc gac cgc ttt gcc gtc gag gta aag ggc agg att 768 Ile Gln Arg Met Gly Asp Arg Phe Ala Val Glu Val Lys Gly Arg Ile                 245 250 255 cac ttt gac ctc tat cca gtc ata agg cgc acg ata aac ctc ccg act 816 His Phe Asp Leu Tyr Pro Val Ile Arg Arg Thr Ile Asn Leu Pro Thr             260 265 270 tac acc ctt gag gca gtg tac gag gcc gtc ttt gga aag cct aag gag 864 Tyr Thr Leu Glu Ala Val Tyr Glu Ala Val Phe Gly Lys Pro Lys Glu         275 280 285 aag gtt tac gcc gag gag ata aca gag gcc tgg gag agc ggg gag ggc 912 Lys Val Tyr Ala Glu Glu Ile Thr Glu Ala Trp Glu Ser Gly Glu Gly     290 295 300 ctt gaa agg gtt gcc cgc tac tcg atg gag gac gcg aag gtg acc tac 960 Leu Glu Arg Val Ala Arg Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr 305 310 315 320 gag ctc gga agg gag ttc ttt ccg atg gag gcc cag ctt tca agg ctc 1008 Glu Leu Gly Arg Glu Phe Phe Pro Met Glu Ala Gln Leu Ser Arg Leu                 325 330 335 ata ggc cag agc ctc tgg gac gtc tcg cgc tcg agc acg ggc aac ctg 1056 Ile Gly Gln Ser Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu             340 345 350 gtt gag tgg ttc ctt ctg cgg aag gcc tac gag agg aac gaa ctg gcc 1104 Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala         355 360 365 cca aac aag ccc gac gag agg gag ctc gcg aga cgg cgc gag agc tac 1152 Pro Asn Lys Pro Asp Glu Arg Glu Leu Ala Arg Arg Arg Glu Ser Tyr     370 375 380 gcg ggt ggg tac gtt aag gag ccc gag cgc ggg ctg tgg gag aac att 1200 Ala Gly Gly Tyr Val Lys Glu Pro Glu Arg Gly Leu Trp Glu Asn Ile 385 390 395 400 gtc tac cta gat ttc atg agc cta tac ccc tca atc atc ata acc cac 1248 Val Tyr Leu Asp Phe Met Ser Leu Tyr Pro Ser Ile Ile Ile Thr His                 405 410 415 aac gtc tcg ccg gac acc ctc aac cgc gag ggc tgt aaa gag tac gac 1296 Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp             420 425 430 gtc gcc cca gag gtt ggg cac cgc ttt tgt aag gac ttt cca ggc ttc 1344 Val Ala Pro Glu Val Gly His Arg Phe Cys Lys Asp Phe Pro Gly Phe         435 440 445 ata cca agt ctc ctc ggc gac ctg ctt gag gag aga cag aag ata aag 1392 Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys     450 455 460 aaa aag atg aag gcc aca ata gac ccg ctg gag aag aaa atc ctc gat 1440 Lys Lys Met Lys Ala Thr Ile Asp Pro Leu Glu Lys Lys Ile Leu Asp 465 470 475 480 tac agg cag agg gct atc aaa atc ctg gcg aac agc ctc ctg cca gag 1488 Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Leu Leu Pro Glu                 485 490 495 gaa tgg att ccg gta gtt gag aac gga aaa gtc aag ctc gtc agg att 1536 Glu Trp Ile Pro Val Val Glu Asn Gly Lys Val Lys Leu Val Arg Ile             500 505 510 ggc gag ttc gtg gat gga ctc atg aag gac gaa aag gga agg gcc aaa 1584 Gly Glu Phe Val Asp Gly Leu Met Lys Asp Glu Lys Gly Arg Ala Lys         515 520 525 agg gac gga aac act gag gtt ctt gaa gtc agc gga att cgc gcg gtc 1632 Arg Asp Gly Asn Thr Glu Val Leu Glu Val Ser Gly Ile Arg Ala Val     530 535 540 tcc ttt gac agg aag acg aag aaa gcc cgc tta atg ccc gtg aag gcc 1680 Ser Phe Asp Arg Lys Thr Lys Lys Ala Arg Leu Met Pro Val Lys Ala 545 550 555 560 gtg ata agg cac cgc tat tca gga gat gtc tac aaa ata acc ctg agt 1728 Val Ile Arg His Arg Tyr Ser Gly Asp Val Tyr Lys Ile Thr Leu Ser                 565 570 575 tca gga agg aag ata aca gta acc aaa ggc cac agc ctt ttc gcg tac 1776 Ser Gly Arg Lys Ile Thr Val Thr Lys Gly His Ser Leu Phe Ala Tyr             580 585 590 aga aat gga gag ctc gtc gaa gtg cct ggt gaa gaa att aag gct gga 1824 Arg Asn Gly Glu Leu Val Glu Val Pro Gly Glu Glu Ile Lys Ala Gly         595 600 605 gac ctc ctc gcg gtt cca aga cgc gtg cac ctg ccc gag agg tat gaa 1872 Asp Leu Leu Ala Val Pro Arg Arg Val His Leu Pro Glu Arg Tyr Glu     610 615 620 cgg ctg gac ctt gtt gaa ctc ctc cta aaa ctg cct gag gaa gaa acg 1920 Arg Leu Asp Leu Val Glu Leu Leu Leu Lys Leu Pro Glu Glu Glu Thr 625 630 635 640 gag gac ata atc ctt acg att cca gca aag ggc aga aag aat ttc ttc 1968 Glu Asp Ile Ile Leu Thr Ile Pro Ala Lys Gly Arg Lys Asn Phe Phe                 645 650 655 aag gga atg ctg aga acc ctt cgc tgg att ttt ggg gag gaa aag aga 2016 Lys Gly Met Leu Arg Thr Leu Arg Trp Ile Phe Gly Glu Glu Lys Arg             660 665 670 ccg aga act gcg agg cgc tac ctg aga cac ctc gaa ggc ctc ggc tac 2064 Pro Arg Thr Ala Arg Arg Tyr Leu Arg His Leu Glu Gly Leu Gly Tyr         675 680 685 gta aag ctg aga aaa atc ggc tat gag atc att gat aga gaa gga ctc 2112 Val Lys Leu Arg Lys Ile Gly Tyr Glu Ile Ile Asp Arg Glu Gly Leu     690 695 700 aaa agg tac agg aaa ctt tac gag cgc tta gct gag gtc gtt cgt tac 2160 Lys Arg Tyr Arg Lys Leu Tyr Glu Arg Leu Ala Glu Val Val Arg Tyr 705 710 715 720 aat ggc aac aaa aga gaa tac ctt ata gaa ttc aac gcc gtt cgc gat 2208 Asn Gly Asn Lys Arg Glu Tyr Leu Ile Glu Phe Asn Ala Val Arg Asp                 725 730 735 gtt att tcc ctt atg cca gag gaa gaa ctc aat gag tgg cag gtg ggg 2256 Val Ile Ser Leu Met Pro Glu Glu Glu Leu Asn Glu Trp Gln Val Gly             740 745 750 acg agg aac ggc ttc aga ata aag cca ctc att gag gtt gac gaa gac 2304 Thr Arg Asn Gly Phe Arg Ile Lys Pro Leu Ile Glu Val Asp Glu Asp         755 760 765 ttt gca aag ctc ctc ggc tac tac gtg agc gag ggc tac gcg ggc aag 2352 Phe Ala Lys Leu Leu Gly Tyr Tyr Val Ser Glu Gly Tyr Ala Gly Lys     770 775 780 cag agg aac cag aaa aac ggg tgg agc tac acc gtg aag ctc tac aac 2400 Gln Arg Asn Gln Lys Asn Gly Trp Ser Tyr Thr Val Lys Leu Tyr Asn 785 790 795 800 gag gac gag aga gtt ctt gat gac atg gag aac ctc gcg agg gag ttc 2448 Glu Asp Glu Arg Val Leu Asp Asp Met Glu Asn Leu Ala Arg Glu Phe                 805 810 815 ttt gga aag gcc cgg cgc gga agg aac tac gtt gaa atc cca agg aag 2496 Phe Gly Lys Ala Arg Arg Gly Arg Asn Tyr Val Glu Ile Pro Arg Lys             820 825 830 atg gct tat ata atc ttt gag agc ctc tgc ggc acc ttg gcc gag aac 2544 Met Ala Tyr Ile Ile Phe Glu Ser Leu Cys Gly Thr Leu Ala Glu Asn         835 840 845 aag agg gtt cca gag gta att ttc acg tcg ccg gaa gac gtc agg tgg 2592 Lys Arg Val Pro Glu Val Ile Phe Thr Ser Pro Glu Asp Val Arg Trp     850 855 860 gcg ttc ctt gag ggg tac ttc ata gga gac ggg gac gtc cac ccg agc 2640 Ala Phe Leu Glu Gly Tyr Phe Ile Gly Asp Gly Asp Val His Pro Ser 865 870 875 880 aag agg gtc agg ctc tca acg aaa agc gag ctc ctt gca aac ggt ctc 2688 Lys Arg Val Arg Leu Ser Thr Lys Ser Glu Leu Leu Ala Asn Gly Leu                 885 890 895 gtc ctt ctc ctc aat tcg ctc ggc gtt tca gcg gtt aag ctc ggg cac 2736 Val Leu Leu Leu Asn Ser Leu Gly Val Ser Ala Val Lys Leu Gly His             900 905 910 gac agc gga gtt tac agg gtc tac gtg aac gag gaa ctt cct ttc acg 2784 Asp Ser Gly Val Tyr Arg Val Tyr Val Asn Glu Glu Leu Pro Phe Thr         915 920 925 ggg tac aaa aag aag aaa aac gcc tac tac tcc cac gtt att cca aag 2832 Gly Tyr Lys Lys Lys Lys Asn Ala Tyr Tyr Ser His Val Ile Pro Lys     930 935 940 gaa gtg ctt gag gaa acg ttc ggt aag gtc ttc caa agg aat atg agc 2880 Glu Val Leu Glu Glu Thr Phe Gly Lys Val Phe Gln Arg Asn Met Ser 945 950 955 960 tac gaa aag ttc caa gag ctc gtt gag agt gaa aaa ctc gag ggg gag 2928 Tyr Glu Lys Phe Gln Glu Leu Val Glu Ser Glu Lys Leu Glu Gly Glu                 965 970 975 aag gcc aag aga ata gaa tgg ctt atc agt ggg gac atc atc ctc gat 2976 Lys Ala Lys Arg Ile Glu Trp Leu Ile Ser Gly Asp Ile Ile Leu Asp             980 985 990 aag gtc gtg gaa gtc aaa aag atg aac tat gaa ggc tac gtc tac gac 3024 Lys Val Val Glu Val Lys Lys Met Asn Tyr Glu Gly Tyr Val Tyr Asp         995 1000 1005 ctg agc gtt gag gag gac gag aac ttt ctg gcg ggc ttt gga ttc ctc 3072 Leu Ser Val Glu Glu Asp Glu Asn Phe Leu Ala Gly Phe Gly Phe Leu    1010 1015 1020 tac gcg cac aac agt tac tac ggc tac tac ggc tac gcc aag gcc cgc 3120 Tyr Ala His Asn Ser Tyr Tyr Gly Tyr Tyr Gly Tyr Ala Lys Ala Arg 1025 1030 1035 1040 tgg tac tgc agg gag tgc gcc gag agc gtg acc gcg tgg gga agg gag 3168 Trp Tyr Cys Arg Glu Cys Ala Glu Ser Val Thr Ala Trp Gly Arg Glu                1045 1050 1055 tac ata gag acc aca att cat gaa ata gag gaa aag ttt ggc ttc aaa 3216 Tyr Ile Glu Thr Thr Ile His Glu Ile Glu Glu Lys Phe Gly Phe Lys            1060 1065 1070 gtg ctt tac gca gac act gat gga ttt ttt gcc aca ata cca gga gca 3264 Val Leu Tyr Ala Asp Thr Asp Gly Phe Phe Ala Thr Ile Pro Gly Ala        1075 1080 1085 gat gca gaa act gtg aaa aag aag gcc aag gag ttc ctc aag tac atc 3312 Asp Ala Glu Thr Val Lys Lys Lys Ala Lys Glu Phe Leu Lys Tyr Ile    1090 1095 1100 aac gcc aaa ctg ccc ggc ctg ctc gaa ctt gag tac gag ggc ttc tac 3360 Asn Ala Lys Leu Pro Gly Leu Leu Glu Leu Glu Tyr Glu Gly Phe Tyr 1105 1110 1115 1120 gtg agg ggg ttc ttc gtc acg aag aag aag tac gcg gtc ata gac gag 3408 Val Arg Gly Phe Phe Val Thr Lys Lys Lys Tyr Ala Val Ile Asp Glu                1125 1130 1135 gag ggc aag ata acc acg cgc ggg ctg gag att gtg agg cgt gac tgg 3456 Glu Gly Lys Ile Thr Thr Arg Gly Leu Glu Ile Val Arg Arg Asp Trp            1140 1145 1150 agc gag ata gcg aag gag acg cag gcg agg gtt ctt gag gcg ata ctt 3504 Ser Glu Ile Ala Lys Glu Thr Gln Ala Arg Val Leu Glu Ala Ile Leu        1155 1160 1165 aag cac ggt gac gtc gaa aaa gca gtc agg ata gtc aag gag gtg acc 3552 Lys His Gly Asp Val Glu Lys Ala Val Arg Ile Val Lys Glu Val Thr    1170 1175 1180 gaa aag ctg agc aag tat gaa gtc ccg ccc gag aag ctc gta atc cac 3600 Glu Lys Leu Ser Lys Tyr Glu Val Pro Pro Glu Lys Leu Val Ile His 1185 1190 1195 1200 gag cag ata aca cgc gat ttg aag gat tac aaa gcc aca ggt cca cac 3648 Glu Gln Ile Thr Arg Asp Leu Lys Asp Tyr Lys Ala Thr Gly Pro His                1205 1210 1215 gtt gca gta gca aag cgc ctc gcg gcg agg gga gtg aaa atc cgt cct 3696 Val Ala Val Ala Lys Arg Leu Ala Ala Arg Gly Val Lys Ile Arg Pro            1220 1225 1230 gga acg gtg ata agc tac atc gtc cta aag ggc tct ggt agg ata ggc 3744 Gly Thr Val Ile Ser Tyr Ile Val Leu Lys Gly Ser Gly Arg Ile Gly        1235 1240 1245 gac agg gcg att ccg gct gac gag ttc gac ccg acg aag cac aag tac 3792 Asp Arg Ala Ile Pro Ala Asp Glu Phe Asp Pro Thr Lys His Lys Tyr    1250 1255 1260 gac gcc gaa tac tac atc gaa aac cag gtt ctt ccc gcc gtt gag agg 3840 Asp Ala Glu Tyr Tyr Ile Glu Asn Gln Val Leu Pro Ala Val Glu Arg 1265 1270 1275 1280 att ctc agg gcc ttc ggc tac agg aag gag gat ttg cgc tac cag aag 3888 Ile Leu Arg Ala Phe Gly Tyr Arg Lys Glu Asp Leu Arg Tyr Gln Lys                1285 1290 1295 acg aag cag gtg ggt ttg agc gcg tgg ctg aag ccg aag gga aag aag 3936 Thr Lys Gln Val Gly Leu Ser Ala Trp Leu Lys Pro Lys Gly Lys Lys            1300 1305 1310       tga 3939 <210> 12 <211> 1312 <212> PRT <213> Thermococcus marinus <400> 12 Met Ile Leu Asp Thr Asp Cys Ile Thr Glu Asn Gly Lys Pro Val Ile   1 5 10 15 Arg Val Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg              20 25 30 Thr Phe Glu Pro Tyr Phe Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile          35 40 45 Glu Asp Val Lys Lys Val Thr Ala Lys Arg His Gly Thr Val Val Lys      50 55 60 Val Lys Arg Ala Glu Lys Val Gln Arg Lys Phe Leu Gly Arg Pro Ile  65 70 75 80 Glu Val Trp Lys Leu Tyr Phe Thr His Pro Gln Asp Val Pro Ala Ile                  85 90 95 Arg Asp Lys Ile Arg Glu His Pro Ala Val Val Asp Ile Tyr Glu Tyr             100 105 110 Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro         115 120 125 Met Glu Gly Asp Glu Glu Leu Thr Met Leu Ala Phe Asp Ile Glu Thr     130 135 140 Leu Tyr His Glu Gly Glu Glu Phe Gly Thr Gly Pro Ile Leu Met Ile 145 150 155 160 Ser Tyr Ala Asp Glu Asn Glu Ala Arg Val Ile Thr Trp Lys Lys Ile                 165 170 175 Asp Leu Pro Tyr Val Glu Val Val Ser Thr Glu Lys Glu Met Ile Lys             180 185 190 Arg Phe Leu Arg Val Val Lys Glu Lys Asp Pro Asp Val Leu Ile Thr         195 200 205 Tyr Asn Gly Asp Asn Phe Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu     210 215 220 Lys Leu Gly Ile Lys Phe Thr Leu Gly Arg Asp Gly Ser Glu Pro Lys 225 230 235 240 Ile Gln Arg Met Gly Asp Arg Phe Ala Val Glu Val Lys Gly Arg Ile                 245 250 255 His Phe Asp Leu Tyr Pro Val Ile Arg Arg Thr Ile Asn Leu Pro Thr             260 265 270 Tyr Thr Leu Glu Ala Val Tyr Glu Ala Val Phe Gly Lys Pro Lys Glu         275 280 285 Lys Val Tyr Ala Glu Glu Ile Thr Glu Ala Trp Glu Ser Gly Glu Gly     290 295 300 Leu Glu Arg Val Ala Arg Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr 305 310 315 320 Glu Leu Gly Arg Glu Phe Phe Pro Met Glu Ala Gln Leu Ser Arg Leu                 325 330 335 Ile Gly Gln Ser Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu             340 345 350 Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala         355 360 365 Pro Asn Lys Pro Asp Glu Arg Glu Leu Ala Arg Arg Arg Glu Ser Tyr     370 375 380 Ala Gly Gly Tyr Val Lys Glu Pro Glu Arg Gly Leu Trp Glu Asn Ile 385 390 395 400 Val Tyr Leu Asp Phe Met Ser Leu Tyr Pro Ser Ile Ile Ile Thr His                 405 410 415 Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp             420 425 430 Val Ala Pro Glu Val Gly His Arg Phe Cys Lys Asp Phe Pro Gly Phe         435 440 445 Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys     450 455 460 Lys Lys Met Lys Ala Thr Ile Asp Pro Leu Glu Lys Lys Ile Leu Asp 465 470 475 480 Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Leu Leu Pro Glu                 485 490 495 Glu Trp Ile Pro Val Val Glu Asn Gly Lys Val Lys Leu Val Arg Ile             500 505 510 Gly Glu Phe Val Asp Gly Leu Met Lys Asp Glu Lys Gly Arg Ala Lys         515 520 525 Arg Asp Gly Asn Thr Glu Val Leu Glu Val Ser Gly Ile Arg Ala Val     530 535 540 Ser Phe Asp Arg Lys Thr Lys Lys Ala Arg Leu Met Pro Val Lys Ala 545 550 555 560 Val Ile Arg His Arg Tyr Ser Gly Asp Val Tyr Lys Ile Thr Leu Ser                 565 570 575 Ser Gly Arg Lys Ile Thr Val Thr Lys Gly His Ser Leu Phe Ala Tyr             580 585 590 Arg Asn Gly Glu Leu Val Glu Val Pro Gly Glu Glu Ile Lys Ala Gly         595 600 605 Asp Leu Leu Ala Val Pro Arg Arg Val His Leu Pro Glu Arg Tyr Glu     610 615 620 Arg Leu Asp Leu Val Glu Leu Leu Leu Lys Leu Pro Glu Glu Glu Thr 625 630 635 640 Glu Asp Ile Ile Leu Thr Ile Pro Ala Lys Gly Arg Lys Asn Phe Phe                 645 650 655 Lys Gly Met Leu Arg Thr Leu Arg Trp Ile Phe Gly Glu Glu Lys Arg             660 665 670 Pro Arg Thr Ala Arg Arg Tyr Leu Arg His Leu Glu Gly Leu Gly Tyr         675 680 685 Val Lys Leu Arg Lys Ile Gly Tyr Glu Ile Ile Asp Arg Glu Gly Leu     690 695 700 Lys Arg Tyr Arg Lys Leu Tyr Glu Arg Leu Ala Glu Val Val Arg Tyr 705 710 715 720 Asn Gly Asn Lys Arg Glu Tyr Leu Ile Glu Phe Asn Ala Val Arg Asp                 725 730 735 Val Ile Ser Leu Met Pro Glu Glu Glu Leu Asn Glu Trp Gln Val Gly             740 745 750 Thr Arg Asn Gly Phe Arg Ile Lys Pro Leu Ile Glu Val Asp Glu Asp         755 760 765 Phe Ala Lys Leu Leu Gly Tyr Tyr Val Ser Glu Gly Tyr Ala Gly Lys     770 775 780 Gln Arg Asn Gln Lys Asn Gly Trp Ser Tyr Thr Val Lys Leu Tyr Asn 785 790 795 800 Glu Asp Glu Arg Val Leu Asp Asp Met Glu Asn Leu Ala Arg Glu Phe                 805 810 815 Phe Gly Lys Ala Arg Arg Gly Arg Asn Tyr Val Glu Ile Pro Arg Lys             820 825 830 Met Ala Tyr Ile Ile Phe Glu Ser Leu Cys Gly Thr Leu Ala Glu Asn         835 840 845 Lys Arg Val Pro Glu Val Ile Phe Thr Ser Pro Glu Asp Val Arg Trp     850 855 860 Ala Phe Leu Glu Gly Tyr Phe Ile Gly Asp Gly Asp Val His Pro Ser 865 870 875 880 Lys Arg Val Arg Leu Ser Thr Lys Ser Glu Leu Leu Ala Asn Gly Leu                 885 890 895 Val Leu Leu Leu Asn Ser Leu Gly Val Ser Ala Val Lys Leu Gly His             900 905 910 Asp Ser Gly Val Tyr Arg Val Tyr Val Asn Glu Glu Leu Pro Phe Thr         915 920 925 Gly Tyr Lys Lys Lys Lys Asn Ala Tyr Tyr Ser His Val Ile Pro Lys     930 935 940 Glu Val Leu Glu Glu Thr Phe Gly Lys Val Phe Gln Arg Asn Met Ser 945 950 955 960 Tyr Glu Lys Phe Gln Glu Leu Val Glu Ser Glu Lys Leu Glu Gly Glu                 965 970 975 Lys Ala Lys Arg Ile Glu Trp Leu Ile Ser Gly Asp Ile Ile Leu Asp             980 985 990 Lys Val Val Glu Val Lys Lys Met Asn Tyr Glu Gly Tyr Val Tyr Asp         995 1000 1005 Leu Ser Val Glu Glu Asp Glu Asn Phe Leu Ala Gly Phe Gly Phe Leu    1010 1015 1020 Tyr Ala His Asn Ser Tyr Tyr Gly Tyr Tyr Gly Tyr Ala Lys Ala Arg 1025 1030 1035 1040 Trp Tyr Cys Arg Glu Cys Ala Glu Ser Val Thr Ala Trp Gly Arg Glu                1045 1050 1055 Tyr Ile Glu Thr Thr Ile His Glu Ile Glu Glu Lys Phe Gly Phe Lys            1060 1065 1070 Val Leu Tyr Ala Asp Thr Asp Gly Phe Phe Ala Thr Ile Pro Gly Ala        1075 1080 1085 Asp Ala Glu Thr Val Lys Lys Lys Ala Lys Glu Phe Leu Lys Tyr Ile    1090 1095 1100 Asn Ala Lys Leu Pro Gly Leu Leu Glu Leu Glu Tyr Glu Gly Phe Tyr 1105 1110 1115 1120 Val Arg Gly Phe Phe Val Thr Lys Lys Lys Tyr Ala Val Ile Asp Glu                1125 1130 1135 Glu Gly Lys Ile Thr Thr Arg Gly Leu Glu Ile Val Arg Arg Asp Trp            1140 1145 1150 Ser Glu Ile Ala Lys Glu Thr Gln Ala Arg Val Leu Glu Ala Ile Leu        1155 1160 1165 Lys His Gly Asp Val Glu Lys Ala Val Arg Ile Val Lys Glu Val Thr    1170 1175 1180 Glu Lys Leu Ser Lys Tyr Glu Val Pro Pro Glu Lys Leu Val Ile His 1185 1190 1195 1200 Glu Gln Ile Thr Arg Asp Leu Lys Asp Tyr Lys Ala Thr Gly Pro His                1205 1210 1215 Val Ala Val Ala Lys Arg Leu Ala Ala Arg Gly Val Lys Ile Arg Pro            1220 1225 1230 Gly Thr Val Ile Ser Tyr Ile Val Leu Lys Gly Ser Gly Arg Ile Gly        1235 1240 1245 Asp Arg Ala Ile Pro Ala Asp Glu Phe Asp Pro Thr Lys His Lys Tyr    1250 1255 1260 Asp Ala Glu Tyr Tyr Ile Glu Asn Gln Val Leu Pro Ala Val Glu Arg 1265 1270 1275 1280 Ile Leu Arg Ala Phe Gly Tyr Arg Lys Glu Asp Leu Arg Tyr Gln Lys                1285 1290 1295 Thr Lys Gln Val Gly Leu Ser Ala Trp Leu Lys Pro Lys Gly Lys Lys            1300 1305 1310 <210> 13 <211> 2328 <212> DNA <213> Thermococcus marinus <220> <221> CDS (222) (1) .. (2325) <223> Tma DNA Polymerase <400> 13 atg att ctc gat acc gac tgc atc acc gag aac ggg aag cct gtg ata 48 Met Ile Leu Asp Thr Asp Cys Ile Thr Glu Asn Gly Lys Pro Val Ile   1 5 10 15 agg gtc ttc aag aag gag aac ggc gag ttt aaa atc gag tac gac aga 96 Arg Val Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg              20 25 30 acc ttc gag ccc tac ttc tac gcc ctc ctg aag gac gat tca gca ata 144 Thr Phe Glu Pro Tyr Phe Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile          35 40 45 gaa gac gtg aag aaa gta acc gct aaa agg cat ggg acg gtc gtg aag 192 Glu Asp Val Lys Lys Val Thr Ala Lys Arg His Gly Thr Val Val Lys      50 55 60 gtg aag cgc gcc gag aag gtg cag agg aag ttc ctc ggc agg ccg ata 240 Val Lys Arg Ala Glu Lys Val Gln Arg Lys Phe Leu Gly Arg Pro Ile  65 70 75 80 gag gtc tgg aag ctc tac ttc acg cac cct cag gac gtt cca gcg att 288 Glu Val Trp Lys Leu Tyr Phe Thr His Pro Gln Asp Val Pro Ala Ile                  85 90 95 cga gac aag att agg gag cat ccg gcc gtt gtg gac atc tac gag tac 336 Arg Asp Lys Ile Arg Glu His Pro Ala Val Val Asp Ile Tyr Glu Tyr             100 105 110 gac ata ccc ttc gcc aag cgc tac ctc atc gac aag ggc ctg att ccg 384 Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro         115 120 125 atg gag ggc gac gag gag ctc acg atg ctc gcc ttc gac atc gag acg 432 Met Glu Gly Asp Glu Glu Leu Thr Met Leu Ala Phe Asp Ile Glu Thr     130 135 140 ctc tac cat gag ggt gag gag ttt gga acc gga ccg att ctc atg ata 480 Leu Tyr His Glu Gly Glu Glu Phe Gly Thr Gly Pro Ile Leu Met Ile 145 150 155 160 agc tac gcc gac gag aac gag gca agg gtg ata acc tgg aag aag att 528 Ser Tyr Ala Asp Glu Asn Glu Ala Arg Val Ile Thr Trp Lys Lys Ile                 165 170 175 gac ctt ccg tac gtt gag gtc gtt tcg acc gag aag gag atg att aag 576 Asp Leu Pro Tyr Val Glu Val Val Ser Thr Glu Lys Glu Met Ile Lys             180 185 190 cgc ttc ctc cgc gtc gtc aag gag aag gac ccc gac gtg ctc atc acc 624 Arg Phe Leu Arg Val Val Lys Glu Lys Asp Pro Asp Val Leu Ile Thr         195 200 205 tac aac ggc gac aac ttc gac ttc gct tat cta aaa aag cgc tgt gag 672 Tyr Asn Gly Asp Asn Phe Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu     210 215 220 aaa ctc ggg ata aag ttc acg ctc ggg aga gac gga agc gag ccg aaa 720 Lys Leu Gly Ile Lys Phe Thr Leu Gly Arg Asp Gly Ser Glu Pro Lys 225 230 235 240 atc cag cgc atg ggc gac cgc ttt gcc gtc gag gta aag ggc agg att 768 Ile Gln Arg Met Gly Asp Arg Phe Ala Val Glu Val Lys Gly Arg Ile                 245 250 255 cac ttt gac ctc tat cca gtc ata agg cgc acg ata aac ctc ccg act 816 His Phe Asp Leu Tyr Pro Val Ile Arg Arg Thr Ile Asn Leu Pro Thr             260 265 270 tac acc ctt gag gca gtg tac gag gcc gtc ttt gga aag cct aag gag 864 Tyr Thr Leu Glu Ala Val Tyr Glu Ala Val Phe Gly Lys Pro Lys Glu         275 280 285 aag gtt tac gcc gag gag ata aca gag gcc tgg gag agc ggg gag ggc 912 Lys Val Tyr Ala Glu Glu Ile Thr Glu Ala Trp Glu Ser Gly Glu Gly     290 295 300 ctt gaa agg gtt gcc cgc tac tcg atg gag gac gcg aag gtg acc tac 960 Leu Glu Arg Val Ala Arg Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr 305 310 315 320 gag ctc gga agg gag ttc ttt ccg atg gag gcc cag ctt tca agg ctc 1008 Glu Leu Gly Arg Glu Phe Phe Pro Met Glu Ala Gln Leu Ser Arg Leu                 325 330 335 ata ggc cag agc ctc tgg gac gtc tcg cgc tcg agc acg ggc aac ctg 1056 Ile Gly Gln Ser Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu             340 345 350 gtt gag tgg ttc ctt ctg cgg aag gcc tac gag agg aac gaa ctg gcc 1104 Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala         355 360 365 cca aac aag ccc gac gag agg gag ctc gcg aga cgg cgc gag agc tac 1152 Pro Asn Lys Pro Asp Glu Arg Glu Leu Ala Arg Arg Arg Glu Ser Tyr     370 375 380 gcg ggt ggg tac gtt aag gag ccc gag cgc ggg ctg tgg gag aac att 1200 Ala Gly Gly Tyr Val Lys Glu Pro Glu Arg Gly Leu Trp Glu Asn Ile 385 390 395 400 gtc tac cta gat ttc atg agc cta tac ccc tca atc atc ata acc cac 1248 Val Tyr Leu Asp Phe Met Ser Leu Tyr Pro Ser Ile Ile Ile Thr His                 405 410 415 aac gtc tcg ccg gac acc ctc aac cgc gag ggc tgt aaa gag tac gac 1296 Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp             420 425 430 gtc gcc cca gag gtt ggg cac cgc ttt tgt aag gac ttt cca ggc ttc 1344 Val Ala Pro Glu Val Gly His Arg Phe Cys Lys Asp Phe Pro Gly Phe         435 440 445 ata cca agt ctc ctc ggc gac ctg ctt gag gag aga cag aag ata aag 1392 Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys     450 455 460 aaa aag atg aag gcc aca ata gac ccg ctg gag aag aaa atc ctc gat 1440 Lys Lys Met Lys Ala Thr Ile Asp Pro Leu Glu Lys Lys Ile Leu Asp 465 470 475 480 tac agg cag agg gct atc aaa atc ctg gcg aac agt tac tac ggc tac 1488 Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Tyr Tyr Gly Tyr                 485 490 495 tac ggc tac gcc aag gcc cgc tgg tac tgc agg gag tgc gcc gag agc 1536 Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Arg Glu Cys Ala Glu Ser             500 505 510 gtg acc gcg tgg gga agg gag tac ata gag acc aca att cat gaa ata 1584 Val Thr Ala Trp Gly Arg Glu Tyr Ile Glu Thr Thr Ile His Glu Ile         515 520 525 gag gaa aag ttt ggc ttc aaa gtg ctt tac gca gac act gat gga ttt 1632 Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ala Asp Thr Asp Gly Phe     530 535 540 ttt gcc aca ata cca gga gca gat gca gaa act gtg aaa aag aag gcc 1680 Phe Ala Thr Ile Pro Gly Ala Asp Ala Glu Thr Val Lys Lys Lys Ala 545 550 555 560 aag gag ttc ctc aag tac atc aac gcc aaa ctg ccc ggc ctg ctc gaa 1728 Lys Glu Phe Leu Lys Tyr Ile Asn Ala Lys Leu Pro Gly Leu Leu Glu                 565 570 575 ctt gag tac gag ggc ttc tac gtg agg ggg ttc ttc gtc acg aag aag 1776 Leu Glu Tyr Glu Gly Phe Tyr Val Arg Gly Phe Phe Val Thr Lys Lys             580 585 590 aag tac gcg gtc ata gac gag gag ggc aag ata acc acg cgc ggg ctg 1824 Lys Tyr Ala Val Ile Asp Glu Glu Gly Lys Ile Thr Thr Arg Gly Leu         595 600 605 gag att gtg agg cgt gac tgg agc gag ata gcg aag gag acg cag gcg 1872 Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala     610 615 620 agg gtt ctt gag gcg ata ctt aag cac ggt gac gtc gaa aaa gca gtc 1920 Arg Val Leu Glu Ala Ile Leu Lys His Gly Asp Val Glu Lys Ala Val 625 630 635 640 agg ata gtc aag gag gtg acc gaa aag ctg agc aag tat gaa gtc ccg 1968 Arg Ile Val Lys Glu Val Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro                 645 650 655 ccc gag aag ctc gta atc cac gag cag ata aca cgc gat ttg aag gat 2016 Pro Glu Lys Leu Val Ile His Glu Gln Ile Thr Arg Asp Leu Lys Asp             660 665 670 tac aaa gcc aca ggt cca cac gtt gca gta gca aag cgc ctc gcg gcg 2064 Tyr Lys Ala Thr Gly Pro His Val Ala Val Ala Lys Arg Leu Ala Ala         675 680 685 agg gga gtg aaa atc cgt cct gga acg gtg ata agc tac atc gtc cta 2112 Arg Gly Val Lys Ile Arg Pro Gly Thr Val Ile Ser Tyr Ile Val Leu     690 695 700 aag ggc tct ggt agg ata ggc gac agg gcg att ccg gct gac gag ttc 2160 Lys Gly Ser Gly Arg Ile Gly Asp Arg Ala Ile Pro Ala Asp Glu Phe 705 710 715 720 gac ccg acg aag cac aag tac gac gcc gaa tac tac atc gaa aac cag 2208 Asp Pro Thr Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln                 725 730 735 gtt ctt ccc gcc gtt gag agg att ctc agg gcc ttc ggc tac agg aag 2256 Val Leu Pro Ala Val Glu Arg Ile Leu Arg Ala Phe Gly Tyr Arg Lys             740 745 750 gag gat ttg cgc tac cag aag acg aag cag gtg ggt ttg agc gcg tgg 2304 Glu Asp Leu Arg Tyr Gln Lys Thr Lys Gln Val Gly Leu Ser Ala Trp         755 760 765 ctg aag ccg aag gga aag aag tga 2328 Leu Lys Pro Lys Gly Lys Lys     770 775 <210> 14 <211> 775 <212> PRT <213> Thermococcus marinus <400> 14 Met Ile Leu Asp Thr Asp Cys Ile Thr Glu Asn Gly Lys Pro Val Ile   1 5 10 15 Arg Val Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg              20 25 30 Thr Phe Glu Pro Tyr Phe Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile          35 40 45 Glu Asp Val Lys Lys Val Thr Ala Lys Arg His Gly Thr Val Val Lys      50 55 60 Val Lys Arg Ala Glu Lys Val Gln Arg Lys Phe Leu Gly Arg Pro Ile  65 70 75 80 Glu Val Trp Lys Leu Tyr Phe Thr His Pro Gln Asp Val Pro Ala Ile                  85 90 95 Arg Asp Lys Ile Arg Glu His Pro Ala Val Val Asp Ile Tyr Glu Tyr             100 105 110 Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro         115 120 125 Met Glu Gly Asp Glu Glu Leu Thr Met Leu Ala Phe Asp Ile Glu Thr     130 135 140 Leu Tyr His Glu Gly Glu Glu Phe Gly Thr Gly Pro Ile Leu Met Ile 145 150 155 160 Ser Tyr Ala Asp Glu Asn Glu Ala Arg Val Ile Thr Trp Lys Lys Ile                 165 170 175 Asp Leu Pro Tyr Val Glu Val Val Ser Thr Glu Lys Glu Met Ile Lys             180 185 190 Arg Phe Leu Arg Val Val Lys Glu Lys Asp Pro Asp Val Leu Ile Thr         195 200 205 Tyr Asn Gly Asp Asn Phe Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu     210 215 220 Lys Leu Gly Ile Lys Phe Thr Leu Gly Arg Asp Gly Ser Glu Pro Lys 225 230 235 240 Ile Gln Arg Met Gly Asp Arg Phe Ala Val Glu Val Lys Gly Arg Ile                 245 250 255 His Phe Asp Leu Tyr Pro Val Ile Arg Arg Thr Ile Asn Leu Pro Thr             260 265 270 Tyr Thr Leu Glu Ala Val Tyr Glu Ala Val Phe Gly Lys Pro Lys Glu         275 280 285 Lys Val Tyr Ala Glu Glu Ile Thr Glu Ala Trp Glu Ser Gly Glu Gly     290 295 300 Leu Glu Arg Val Ala Arg Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr 305 310 315 320 Glu Leu Gly Arg Glu Phe Phe Pro Met Glu Ala Gln Leu Ser Arg Leu                 325 330 335 Ile Gly Gln Ser Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu             340 345 350 Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala         355 360 365 Pro Asn Lys Pro Asp Glu Arg Glu Leu Ala Arg Arg Arg Glu Ser Tyr     370 375 380 Ala Gly Gly Tyr Val Lys Glu Pro Glu Arg Gly Leu Trp Glu Asn Ile 385 390 395 400 Val Tyr Leu Asp Phe Met Ser Leu Tyr Pro Ser Ile Ile Ile Thr His                 405 410 415 Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp             420 425 430 Val Ala Pro Glu Val Gly His Arg Phe Cys Lys Asp Phe Pro Gly Phe         435 440 445 Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys     450 455 460 Lys Lys Met Lys Ala Thr Ile Asp Pro Leu Glu Lys Lys Ile Leu Asp 465 470 475 480 Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Tyr Tyr Gly Tyr                 485 490 495 Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Arg Glu Cys Ala Glu Ser             500 505 510 Val Thr Ala Trp Gly Arg Glu Tyr Ile Glu Thr Thr Ile His Glu Ile         515 520 525 Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ala Asp Thr Asp Gly Phe     530 535 540 Phe Ala Thr Ile Pro Gly Ala Asp Ala Glu Thr Val Lys Lys Lys Ala 545 550 555 560 Lys Glu Phe Leu Lys Tyr Ile Asn Ala Lys Leu Pro Gly Leu Leu Glu                 565 570 575 Leu Glu Tyr Glu Gly Phe Tyr Val Arg Gly Phe Phe Val Thr Lys Lys             580 585 590 Lys Tyr Ala Val Ile Asp Glu Glu Gly Lys Ile Thr Thr Arg Gly Leu         595 600 605 Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala     610 615 620 Arg Val Leu Glu Ala Ile Leu Lys His Gly Asp Val Glu Lys Ala Val 625 630 635 640 Arg Ile Val Lys Glu Val Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro                 645 650 655 Pro Glu Lys Leu Val Ile His Glu Gln Ile Thr Arg Asp Leu Lys Asp             660 665 670 Tyr Lys Ala Thr Gly Pro His Val Ala Val Ala Lys Arg Leu Ala Ala         675 680 685 Arg Gly Val Lys Ile Arg Pro Gly Thr Val Ile Ser Tyr Ile Val Leu     690 695 700 Lys Gly Ser Gly Arg Ile Gly Asp Arg Ala Ile Pro Ala Asp Glu Phe 705 710 715 720 Asp Pro Thr Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln                 725 730 735 Val Leu Pro Ala Val Glu Arg Ile Leu Arg Ala Phe Gly Tyr Arg Lys             740 745 750 Glu Asp Leu Arg Tyr Gln Lys Thr Lys Gln Val Gly Leu Ser Ala Trp         755 760 765 Leu Lys Pro Lys Gly Lys Lys     770 775  

Claims (17)

A heat resistant Tma DNA polymerase isolated from Thermococcus mariners having the amino acid sequence of SEQ ID NO: 12. An active type heat resistant Tma DNA polymerase isolated from Thermococcus mariners having the amino acid sequence of SEQ ID NO: 14 having an intein coding region removed. 3. The method of claim 1, wherein the pH of pH 7.0, a temperature of 75 ° C., a KCl concentration of 0-20 mM, a (NH ₄ ) ₂ SO ₄ concentration of 0-15 mM, and a Mg ²⁺ of 12-16 mM Tma DNA polymerase, characterized in that the optimum activity at a concentration. A nucleic acid molecule encoding the heat resistant Tma DNA polymerase of claim 1. 5. A nucleic acid molecule according to claim 4 having a nucleic acid sequence of SEQ ID NO. A nucleic acid molecule encoding the active type heat resistant Tma DNA polymerase of claim 2. 7. The nucleic acid molecule of claim 6 having the nucleic acid sequence of SEQ ID NO. A vector comprising a nucleic acid molecule encoding the heat resistant Tma DNA polymerase of claim 1. The vector of claim 8, wherein the vector is pTMAP. A vector comprising a nucleic acid sequence encoding the active type heat resistant Tma DNA polymerase of claim 2. The vector of claim 10, wherein the vector is pTMAM. Microorganism transformed with the vector of claim 8. The microorganism according to claim 12, wherein the microorganism is Escherichia coli Rosetta (DE3) pLysS / pTMAP (accession number KACC 95094P) transformed with a pTMAP vector. Microorganisms transformed with the vector of claim 10. The microorganism according to claim 14, wherein the microorganism is Escherichia coli Rosetta (DE3) pLysS / pTMAM (accession number KACC 95093P) transformed with a pTMAM vector. A kit comprising the Tma DNA polymerase of claim 1. (i) preparing a vector expressing the Tma DNA polymerase of claim 1; (ii) transforming the vector with a microorganism; (iii) culturing the transformant; And (iv) recovering the protein from the transformant Including, Tma DNA polymerase production method.

Images