KR100825279B1 - Protein for enhancing dna polymerase activity and genes encoding it - Google Patents

Abstract

A HAM-1 like protein is provided to increase the processivity of DNA polymerase when used with the DNA polymerase, thereby being used for all reactions requiring DNA polymerization and applied to DNA amplification requiring high sensitivity and rapidity. A protein is described as SEQ ID : NO. 1 and is characterized in that it increases DNA polymerization processivity. A nucleic acid sequence encodes the protein and is described as SEQ ID : NO. 2. The protein is used in order to increase DNA polymerization by DNA polymerase. A host cell transformed by a recombinant vector including a gene described as SEQ ID : NO. 2 is used in order to produce the protein. The DNA polymerase and the protein are used in order to increase DNA replication.

Description

Protein For Enhancing DNA Polymerase Activity and Genes Encoding it}

FIG. 1 shows sequence similarity between HAM-1 like genes and dNTPase pyrophosphatase and TNA1 HAM-1.

2 shows the SDS-PAGE of recombinant His ₆ -tagged TNA1 HAM-1. Lane 1, low molecular weight standard (Bio-Rad); Lane 2, TNA1 HAM-1 isolated by heat tagged affinity chromatography

3 shows the effect of dITP on PCR amplification of various DNA polymerases. (A) PCR amplification of rTaq and TNA1 DNA polymerase according to dITP concentration (0, 0.025, 0.05, 0.1, 0.2 mM), (B) dITP free (dITP X) and dITP free (0.05) PCR amplification of various DNA polymerases in mM dITP)

4 shows the effect of TNA1 HAM-1 on PCR amplification of various DNA polymerases.

5 shows a cleavage map of the recombinant plasmid vector.

The present invention relates to a DNA polymerase activity increasing protein and a gene encoding the same, more specifically Thermococcus sp. It relates to a DNA polymerase activity increasing protein derived from NA1.

Recent advances in genomic research have yielded enormous amounts of gene sequence information. With the general combination of conventional genetic engineering and genomic research techniques, the genomic sequences of some highly thermophilic microorganisms have received a lot of attention because of their ability to be heat-resistant enzymes in the field of biotechnology. Is being developed.

Such thermostable thermophilic DNA polymerase and polymerase chain reaction (PCR) using the same have important contributions in protein and gene research, and are widely used in biological applications. In fact, more than 50 DNA polymerase genes have been cloned from various organisms, including thermophilic and archaea, and recently, highly thermophilic bacteria with higher fidelity in PCR based on proofreading activity than common Taq polymerase. B family DNA polymerase was isolated and widely used from Pyrococcus sp. And Thermococcus sp. Strains. Nevertheless, high fidelity polymerases are low in DNA elongation ability and require many improvements despite the above advantages.

We have already isolated new highly thermophilic strains from the deep-sea hydrothermal spout area of PACMANUS field and analyzed the 16S rDNA sequence for thermococcus. Thermococcus sp. Was identified, and the entire genome sequence was analyzed to find a heat stable enzyme from the strain. Analysis of the genomic information confirmed that the strain had a DNA polymerase of type B, cloned the gene corresponding to the DNA polymerase from the strain and expressed this gene in E. coli, and recombinant DNA polymerase There has been a patent application for a DNA polymerase having high-extension and high-fidelity by pure separation (see Korean Patent Application No. 2005-0094644). However, high-fidelity DNA polymerases require many improvements for various PCR applications due to their strong exonuclease activity and low processivity.

Therefore, the present inventors have found a thermococcus HAM-1-like protein, which, when used with a DNA polymerase, increases the processivity of the DNA polymerase. It was isolated from the genus ( Thermococcus sp.). The HAM-1 like protein of the present invention can be used for all reactions in which DNA polymerization takes place. In particular, in the polymerase chain reaction, it was confirmed that the protein of the present invention can be used for DNA amplification reactions that require high sensitivity and rapidity by assisting the activity of the DNA polymerase.

It is an object of the present invention to provide a novel DNA polymerase increasing protein and a gene encoding the same. It is also an object of the present invention to provide a recombinant vector prepared by inserting the gene, and to provide a method for increasing DNA polymerase activity using a transformed host cell using the same.

For this purpose, a first aspect of the present invention provides a protein having SEQ ID NO: 1 and a functional equivalent. More specifically, it provides a protein for increasing DNA polymerization and a functional equivalent thereof, characterized by increasing the DNA polymerization process (processivity). “Functional equivalents” of the present invention specifically include one or more DNA polymerization-increasing proteins containing the amino acid sequence set forth in SEQ ID NO: 1, or at least one without substantially alleviating DNA polymerization-increasing activity and / or DNA polymerization-increasing activity of the protein. Functional equivalent analogues of said proteins with amino acids added, substituted or removed.

The invention also encompasses the aforementioned proteins synthesized in vitro from the published amino acid sequences of the aforementioned proteins.

The present invention also encompasses purified proteins having an amino acid sequence that is at least 55% similar to the amino acid sequence of the protein of SEQ ID NO: 1 described herein. Preferably, the similarity is at least 60%, more preferably at least 70%, and most preferably at least 80%. In the present invention, the amino acid sequence having 55% or more similarity means that the amino acid at the same position is 55% or more identical or similar when properly arranged, allowing up to 4 gaps but having a total of 10 amino acid residues or less. Means.

 Substitution of some or all of the amino acid sequences is preferably a conservative substitution. Examples of conservative substitutions of amino acids present in nature are as follows; Aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur containing amino acids (Cys, Met). In addition, it is preferable that the deletion of an amino acid is located in the part which is not directly involved in the increase of DNA polymerization activity at this time.

A second aspect of the present invention provides a nucleic acid sequence encoding a protein of SEQ ID NO: 1. The nucleic acid sequence is specifically SEQ ID NO: 2.

As the nucleic acid sequence degenerates, the nucleic acid sequence encoding SEQ ID NO: 1 may be prepared in various ways. The term "nucleic acid sequence" includes a natural mRNA having a selective expression, a cDNA sequence complementary thereto and an equivalent nucleic acid sequence.

“Equivalent nucleic acid sequences” include sequences provided herein, sequences by allyl modifications, sequences by species-to-species variations, or codon degenerate sequences.

"Codon degenerate sequence" refers to a nucleic acid sequence that encodes a polypeptide that is different from the naturally occurring sequence but is identical to the polypeptide of SEQ ID NO: 1 disclosed herein.

"Sequence by Allyl Modification" or "Sequence by Interspecies Modification" is different from the naturally occurring nucleic acid sequence but possesses substantially the same functional properties as the polypeptides disclosed herein. Refers to a nucleic acid sequence encoding a polypeptide.

A third aspect of the invention provides a method of increasing DNA polymerization by DNA polymerase using the protein.

The "DNA polymerase" of the present invention synthesizes DNA in the 5 '-> 3' direction from deoxynucleotide triphosphate by successively adding nucleotides to growing 3'hydroxy groups using complementary template DNA strands and primers. It is an enzyme. The template strand determines the order of nucleotides added by Watson-Crick base pairs.

In the case of using a mixture of the protein of SEQ ID NO: 1 and the DNA polymerase according to the present invention, the DNA replication rate is increased. Therefore, when the mixture of the protein of SEQ ID NO: 1 and the DNA polymerase are used in the polymerase chain reaction (PCR) method, the target DNA can be more efficiently amplified. The method of mixing the DNA polymerase and the protein of SEQ ID NO: 1 may be mixed simultaneously or transplanted. That is, the DNA polymerase and the protein mixture of SEQ ID NO: 1 may be put into the PCR reaction solution, and then the target DNA fragments may be added to the polymerase chain reaction, and the target DNA may be additionally added to the premix containing the DNA polymerase. The protein of SEQ ID NO: 1 may be supplied to perform a polymerase chain reaction.

A fourth aspect of the invention provides a recombinant vector comprising the gene of SEQ ID NO: 1.

The term vector, as used herein, refers to a nucleic acid molecule capable of binding and transferring another nucleic acid thereto. The term expression vector includes plasmids, cosmids or phages capable of synthesizing proteins encoded by each recombinant gene carried by the vector. Preferred vectors are vectors capable of self-replicating and expressing the nucleic acid to which they are bound.

The fifth aspect of the present invention provides a host cell transformed with the recombinant vector.

The term 'transformation' used in the present invention means that foreign DNA or RNA is absorbed into the cell and the genotype of the cell is changed.

Host cells include, but are not limited to, prokaryotic cells, yeast cells, insect cells. Preferably, E. coli is most preferred among prokaryotic cells. Method of culturing E. coli means a method of culturing E. coli commonly used in the art.

A sixth aspect of the present invention provides a method for producing a protein of SEQ ID NO: 2 using the host cell. By any recombinant protein to be expressed is meant any protein used in the treatment of a disease or industrially available, including human proteins.

A seventh aspect of the present invention provides a protein specific antibody of SEQ ID NO: 2, which is prepared by injecting the protein of SEQ ID NO: 2.

Hereinafter, the present invention will be described in more detail with reference to Examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Example 1. Cloning of TNA1 HAM-1 Gene and Expression of Recombinant Enzymes

Strains and Culture Conditions

Thermococcus sp. NA1 was isolated from deep-sea hydrothermal spouts of East Manus Basin. YPS medium was used to manipulate DNA by culturing Thermococcus sp. NA1 and thermococcus sp. NA1, and culture and strain maintenance of Thermococcus sp. NA1 were performed by standard methods. In order to prepare seed cultures of Thermococcus sp. NA1 strains, a single colony formed on a physical plate was inoculated in YPS medium in a 25 ml serum bottle, and 90 hours for 20 hours. Incubated at ℃. Seed culture was used to inoculate 700 ml of YPS medium in an anaerobic jar and incubated at 90 ° C. for 20 hours.

E. coli DH5α was used for plasmid propagation and nucleic acid sequencing. E. coli BL21-Codonplus (DE3) -RIL cells (stratazine, Lazola, Calif.) And plasmid pET-24a (+) (Novagen, Madison, Wisconsin) were used for gene expression. E. coli strains were incubated in Luria-Bertani medium at 37 ° C. and kanamycin was added to the medium to a final concentration of 50 μg / ml.

DNA Manipulation and Sequencing

DNA manipulations were performed by standard methods as described by Sambrok and Russell. Genomic DNA of the Thermococcus sp. Was isolated by standard methods. Restriction enzymes and other modifying enzymes were purchased from Promega (Madison, Wisconsin). Small amounts of plasmid DNA production from E. coli cells were performed using the plasmid mini kit (Qiagen, Hilden, Germany). DNA sequencing was performed with an automated sequencer (AB3100) using the Big Die Terminator Kit (PE Applied Biosystems, Foster City, CA).

Cloning and Expression of the TNA1 HAM-1 Coding Gene

The full length of the gene of Thermococcus sp . NA1 HAM-1 flanked by Nde I and Sal I was amplified using genomic DNA and two primers. The sense primer is 5′- CG ACC CGG CAT ATG AGG CTG GCG TTC ATC ACT TC-3 ′ (SEQ ID NO: 3), and the antisense primer is 5′-CT CCA CAT CTC GAG TTT AAG GTT TTC CTT TAG CCA C-3 ′ (SEQ ID NO: 4). The sequence underlined by the sense primer is the Nde I site and the sequence underlined by the antisense primer is Xho I. The amplified sequence was digested with Nde I and Xho I and linked to Nde I / Xho I digested pET-24a (+). The ligation was transformed into E. coli DH5α, and the resulting plasmids were transformed with E. coli BL21-CodonPlus (DE3) -RIL and E. coli Rosetta (DE3) pLysS, respectively, for sequencing and expression. It was. Overexpression of the gene was induced by adding isopropyl-β-D-thiogalactopyranoside (IPTG) to the intermediate exponential growth phase and incubating at 37 ° C. for 3 hours. Cells were obtained by centrifugation (6,000 × g for 20 min at 4 ° C.) and resuspended in 50 mM Tris-HCl buffer (pH 8.0) containing 0.1M KCl and 10% glycerol. Cells were pulverized by ultrasound and separated by centrifugation (20,000 × g for 30 min at 4 ° C.). The resulting supernatant was treated on a column of TALON ^™ metal affinity resin (BD Bioscience Clontech, Palo Alto, Calif.) And 10 mM imidazole in 50 mM Tris-HCl buffer (pH 8.0) containing 0.1 M KCl and 10% glycerol. (Sigma, St. Louis, Missouri) and eluted at 300 mM in buffer. The collected fractions were then buffer exchanged with 50 mM Tris-HCl (pH 8.0) buffer containing 10% glycerol using Centricon YM-10 (Millipore, Bedford, Mass.).

Protein concentration was measured by the method of Bradford (1976). Purity of the protein was examined by Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis (SDS-PAGE) analysis performed by standard methods (Laemmli, 1970).

result

In genome sequencing of Thermococcus sp. NA1, the inventors of the present invention found an open reading frame (ORF) of a 21 kDa coding gene consisting of 555 bp and consisting of 184 amino acids. The primary structure was compared and analyzed with the sequences of other HAM-1 pseudogenes ( FIG. 1 ). As a result, thermodynamic Rhodococcus genus OGL-20P (Thermococcus sp. OGL -20P) HAM-1 gene (AAP45001) with 79%, and 78% Thermococcus Lactococcus coder color N-Sys KOD1 HAM-1 gene (YP_184524) of (Thermococcus kodakaraensis KOD1) , 46% homology with the mj0226 gene of Methanocaldococcus jannaschii DSM 2661.

TNA1 HAM-1 gene was cloned into pET-24a (+) vector by PCR and transformed and expressed in E. coli BL21-Codonplus (DE3) -RIL. In SDS-PAGE, at least 95% pure isolated enzyme was observed in a single band at 21 kDa estimated from the amino acid sequence ( FIG. 2 ).

Example 2. PCR Application of TNA1 HAM-1 Protein

Using TNA1 HAM-1 protein, we examined the effect of improving PCR yield by overcoming PCR electrolytic activity in the presence of Inosine triphosphate ( ITP ) of high fidelity DNA polymerase. 50 ng of TNA1 HAM-1 protein was added to the PCR reaction of various high fidelity DNA polymerases (TNA1_pol). The PCR reaction consisted of 2.5 U DNA polymerase, 150 ng genomic DNA of Thermococcus sp. NA1 as a template, 10 pmol primer, 200 μM dNTPs, and PCR reaction buffer. Primers were proposed to amplify 15 kb to 2 kb ( Table 1 ).

TABLE 1 PCR primer sequences used in the present invention

 object Forward Primer Backward Primer 2 kb CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 5) CCATGATTCAGTGTGCCCGTCTGG (SEQ ID NO: 6) 5 kb CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 5) CGAACGTCGCGCAGAGAAACAGG (SEQ ID NO: 7) 8 kb CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 5) GCCTCGTTGCGTTTGTTTGCACG (SEQ ID NO: 8) 10 kb CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 5) GCACAGAAGCTATTATGCGTCCCCAGG (SEQ ID NO: 9) 12 kb CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 5) TCTTCCTCGTGCATCGAGCTATTCGG (SEQ ID NO: 10) 15 kb CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 5) CTTGTTCCTTTGCCGCGAGAATGG (SEQ ID NO: 11)

First, it was confirmed that high fidelity DNA polymerase inhibited PCR amplification by the presence of relatively low concentration of dITP ( FIG. 3 ). In PCR amplification, dITP can be generated automatically by deamination of dATP, and appears to be a major cause of lowering the PCR efficiency of high fidelity DNA polymerase. To solve this problem, TNA1 HAM-1 protein was added to the PCR reaction of high fidelity DNA polymerase to confirm the effect.

As shown in FIG. 4 , the addition of the TNA1 HAM-1 protein to the PCR reaction of the high fidelity DNA polymerase was able to amplify the target DNA more effectively than the whole without the addition. This effect seems to be due to the effective removal of dITP in the TNA1 HAM-1 protein in solution, thereby preventing stalling from occurring and effective PCR amplification.

The HAM-1 like protein according to the present invention, when used with a DNA polymerase, increases the processivity of the DNA polymerase. Therefore, the HAM-1 like protein of the present invention can be used for all reactions in which DNA polymerization is performed. In particular, in the polymerase chain reaction, the protein of the present invention can be used for DNA amplification reactions that require high sensitivity and rapidity by assisting the activity of the DNA polymerase.

Attach sequence list electronic file

Claims (12)

A protein having SEQ ID 1; A nucleic acid sequence encoding the protein of claim 1. The nucleic acid sequence of claim 2, wherein the nucleic acid sequence is SEQ ID NO: 2. The protein for increasing DNA polymerization according to claim 1, wherein the protein increases DNA polymerization processability. A method for increasing DNA polymerization by DNA polymerase using the protein of claim 1. Recombinant vector comprising the gene of SEQ ID NO: 2. A host cell transformed with the recombinant vector of claim 6. A method of producing a protein of SEQ ID NO: 1 using the host cell of claim 7. A method for increasing DNA replication, characterized by using a mixture of DNA polymerase and the protein of SEQ ID NO: 1. Polymerase chain reaction (PCR) method, characterized by using a mixture of DNA polymerase and the protein of SEQ ID NO: 1. The method for increasing DNA replication according to any one of claims 9 to 10, wherein the protein of SEQ ID NO: 1 is added to the reaction solution at the same time or at the same time as the DNA polymerase. A protein specific antibody of SEQ ID NO: 1, characterized in that prepared by injecting the protein of SEQ ID NO: 1.

Images