CN110093390B - DNA guide-guided RecJ protein with endonuclease activity and application thereof in gene editing - Google Patents

DNA guide-guided RecJ protein with endonuclease activity and application thereof in gene editing Download PDF

Info

Publication number
CN110093390B
CN110093390B CN201910509798.5A CN201910509798A CN110093390B CN 110093390 B CN110093390 B CN 110093390B CN 201910509798 A CN201910509798 A CN 201910509798A CN 110093390 B CN110093390 B CN 110093390B
Authority
CN
China
Prior art keywords
leu
glu
ile
lys
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910509798.5A
Other languages
Chinese (zh)
Other versions
CN110093390A (en
Inventor
郑明刚
王玲
徐孟欣
王闻
马粒雅
吕巧
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CHINA OCEAN MINERAL RESOURCES R & D ASSOCIATION (CHINA'S OCEAN AFFAIRS ADMINISTRATION)
Qingdao University of Science and Technology
Qingdao University
First Institute of Oceanography MNR
Original Assignee
China Ocean Mineral Resources R & D Association (china's Ocean Affairs Administration)
Qingdao University of Science and Technology
Qingdao University
First Institute of Oceanography MNR
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Ocean Mineral Resources R & D Association (china's Ocean Affairs Administration), Qingdao University of Science and Technology, Qingdao University, First Institute of Oceanography MNR filed Critical China Ocean Mineral Resources R & D Association (china's Ocean Affairs Administration)
Publication of CN110093390A publication Critical patent/CN110093390A/en
Application granted granted Critical
Publication of CN110093390B publication Critical patent/CN110093390B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a DNA guide-guided BaRecJ protein with endonuclease activity and application of a mutant BaRecJM thereof in gene editing. The invention provides a RecJ nuclease from bacteria, which can combine phosphorylated small DNA, play the role of endonuclease on a specific site of complementary target DNA and edit genes; the amino acid sequence of the BaRecJ nuclease is SEQ ID NO. 1. In another aspect, the present invention also provides a mutant of the above-mentioned BaRecJ nuclease, thereby effectively weakening the activity of excision enzyme and enhancing the site-directed cleavage capability of target DNA guided by DNA guide; the amino acid sequence of the mutant BaRecJM of the RecJ nuclease is SEQ ID NO. 3. The Ago protein guided by DNA fragment for shearing reported at present is from thermophilic bacteria, and needs more than 65 ℃ to play the role. The BaRecJ and the mutant BaRecJM thereof can shear a DNA double strand under the mild condition of 37 ℃, thereby being more convenient for genetic engineering operation.

Description

DNA guide-guided RecJ protein with endonuclease activity and application thereof in gene editing
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a RecJ protein with endonuclease activity guided by DNA guide and application thereof in gene editing.
Background
RecJ proteins belong to a class of phosphodiesterases and are widely distributed in bacteria, archaea and eukaryotes. A typical RecJ, such as that of E.coli, has three domains, DHH, DHHA1 and OB, and is capable of degrading single-stranded DNA from 5 '-3'. RecJ homologous genes have been found in almost all eukaryotes, prokaryotes, and archaea, indicating that the RecJ gene is present from the early stages of evolution. RecJ protein is capable of specifically degrading DNA from the 5 'end of single-stranded DNA, but also degrading RNA from the 3' end of single-stranded RNA.
To date, all reported RecJ functions only as an exonuclease and acts only on single-stranded DNA or RNA. Through research on RecJ protein from Bacillus alcalophilus, the applicant finds that RecJ from Bacillus alcalophilus can not only play the functions of exonuclease but also can play the functions of endonuclease, and can cut plasmid DNA into open loops and linearization, and completely degrade, and the functions are quite different from the reported RecJ.
Disclosure of Invention
An object of the present invention is to provide a RecJ protein having endonuclease activity guided by DNA guide and the use of its mutant RecJM in gene editing.
The invention provides a RecJ nuclease from bacteria, which can combine phosphorylated small DNA, play the role of endonuclease on a specific site of complementary target DNA and edit genes; the amino acid sequence of the RecJ nuclease is SEQ ID NO: 1:
MLNPKARWKIEEQKEEVVEQLIKELDIAPLVAKLLINRGLTTPEVASTFLNKNQIKYHDPFSLDGMDRVVERIHQAIEKKENILIFGDYDADGVSSTAVMVYTLQMLGAKFDYYIPNRFTEGYGPNEPALRKAKEAGFQLVVTVDTGISAVHEATVAKEIGLDFIVTDHHEAPPQLPDAYAIINPKKPGCPYPFKGLAGVGVAFKVAQALLGRVPKELLDIVVIGTIADLVPLVDENRLLAMEGLSALQSSSKPGLIAIKKVAGIEKETLEADHVGFAIGPRMNAAGRLGSANPAVDLLITDKSDEAKMLAEEIDGLNKERQHIVSAIAKEAIEMVENDFPPEDNAVLIIAKEGWNPGVIGIVASRLVEKFYRPTIVLSIDEEKGIAKGSARSIEGFDMFAELSKSRDILPHFGGHPMAAGLTISLEHLSELRDRLQVQAKESLSEEDFIPVKRVDLVAGVDEISLDIIKQMKQLAPFGVSNPTPKIMLQQANIGEMKKIGSEANHLKIQFKQNGSSLDGIGFHFGYVYEQMSVQDRVSAVGTLSINEWNGHIKPQLMIEDIAVTDWQLFDWRSVQKLRLEDKLKLISLPTQYLIAFNDETKVKLKLENEQIWTREQLSHIDSFENAAVVLLDLPASEQEIKQLFADKGRPSQIFCLFYQEEDSFFSASPNRETFKWFYAFLRKQKKFNLNEQGMKLISYKGWSKESVKFMVEVFVELNFIRQENGWLIIEENPEKKSLTDSVAFQRKENQRTLENDFVYSSFEHLKQLFTTIFEQNTNESTIKETV；
the nucleotide sequence of the gene for coding the RecJ nuclease is SEQ ID NO. 2;
in another aspect, the present invention also provides a mutant of the above RecJ nuclease, thereby effectively weakening the activity of excision enzyme and enhancing the site-directed cleavage capability of target DNA guided by DNA guide; the amino acid sequence of the mutant RecJM of the RecJ nuclease is SEQ ID NO. 3;
MLNPKARWKIEEQKEEVVEQLIKELDIAPLVAKLLINRGLTTPEVASTFLNKNQIKYHDPFSLDGMDRVVERIHQAIEKKENILIFGDYDADGVSSTAVMVYTLQMLGAKFDYYIPNRFTEGYGPNEPALRKAKEAGFQLVVTVDTGISAVHEATVAKEIGLDFIVTDHHEAPPQLPDAYAIINPKKPGCPYPFKGLAGVGVAFKVAQALLGRVPKELLDIVVIGTIAALVPLVDENRLLAMEGLSALQSSSKPGLIAIKKVAGIEKETLEADHVGFAIGPRMNAAGRLGSANPAVDLLITDKSDEAKMLAEEIDGLNKERQHIVSAIAKEAIEMVENDFPPEDNAVLIIAKEGWNPGVIGIVASRLVEKFYRPTIVLSIDEEKGIAKGSARSIEGFDMFAELSKSRDILPHFGGHPMAAGLTISLEHLSELRDRLQVQAKESLSEEDFIPVKRVDLVAGVDEISLDIIKQMKQLAPFGVSNPTPKIMLQQANIGEMKKIGSEANHLKIQFKQNGSSLDGIGFHFGYVYEQMSVQDRVSAVGTLSINEWNGHIKPQLMIEDIAVTDWQLFDWRSVQKLRLEDKLKLISLPTQYLIAFNDETKVKLKLENEQIWTREQLSHIDSFENAAVVLLDLPASEQEIKQLFADKGRPSQIFCLFYQEEDSFFSASPNRETFKWFYAFLRKQKKFNLNEQGMKLISYKGWSKESVKFMVEVFVELNFIRQENGWLIIEENPEKKSLTDSVAFQRKENQRTLENDFVYSSFEHLKQLFTTIFEQNTNESTIKETV；
the nucleotide sequence of the gene for coding the RecJM nuclease is SEQ ID NO. 4;
the RecJ nuclease and the mutant thereof can be used as endonuclease under the guidance of phosphorylated small DNA or small RNA to edit nucleic acid;
the nucleic acid is any one of supercoiled DNA, linear double-stranded DNA, linear single-stranded DNA and circular single-stranded DNA,
the length of the small DNA or the small RNA is 10-60bp,
more preferably, the small DNA or RNA has a length of 20-60bp,
the small DNA or the small RNA is a single-stranded fragment or a double-stranded fragment matched with a sheared target DNA strand;
the invention also provides a preparation method of the RecJ nuclease (RecJ) and the mutant (RecJM) thereof, which comprises the following steps:
1) construction of recombinant expression plasmid of BaRecJ and mutant BaRecJM thereof
Amplifying a gene coding BaRecJ by PCR, mutating D229 amino acid to obtain an amino acid mutation mutant, respectively cloning BaRecJ and BaRecJM to a prokaryotic expression vector pET28, and constructing a recombinant expression plasmid;
2) expression and purification of BaRecJ and BaRecJM
Transforming the constructed recombinant expression plasmid into an escherichia coli expression host BL21(DE3), and performing induction expression by using IPTG; centrifugally collecting the escherichia coli subjected to induced expression, re-suspending the thalli, and ultrasonically crushing the thalli; proteins were purified from the supernatant using an immobilized nickel ion affinity purification resin.
3) Detecting the endoenzyme activity of BaRecJ and BaRecJM under the guidance of phosphorylated DNA fragments, and determining the influence of the DNA fragments with different lengths on the specificity shearing efficiency;
4) and (3) detecting the shearing of different types of DNA phosphorylation guide to specific sites, and detecting the difference of the shearing efficiency of single-strand and double-strand phosphorylation guide to plasmids and linear DNA fragments.
Wherein the IPTG induction culture conditions used in the step (2) are as follows: the recombinant expression strain was cultured at 30 ℃ until the OD was 0.8 to 1.0, the medium was cooled to 16 ℃ in an incubator, IPTG was added to a final concentration of 0.1mM, and the culture was induced overnight at 16 ℃.
In the step (4), the phosphorylated DNA guide is a 10-60bp nucleotide fragment, and the added phosphorylated fragments comprise a single-stranded phosphorylated fragment, a double-stranded phosphorylated fragment, a phosphorylated fragment matched with a substrate, and a phosphorylated DNA unmatched with the substrate.
The Ago protein guided by DNA fragment for shearing reported at present is from thermophilic bacteria, and needs more than 65 ℃ to play the role. The BaRecJ and the mutant BaRecJM thereof can shear a DNA double strand under the mild condition of 37 ℃, thereby being more convenient for genetic engineering operation.
Drawings
FIG. 1: a BaRecJ protein purification map;
FIG. 2: mg (magnesium)2+Graph of the effect on loading and shearing of BaRecJ and guide, wherein 1, plasmid; 2, no guide, with Mg2 +(ii) a 3, pre-loaded guide, Mg-free2+(ii) a 4, with Mg2+Preloading guide under conditions; 5, no Mg2+Pre-loading guide;
FIG. 3: purification of the BaRecJ mutant protein;
FIG. 4: directional scission map of the barrecj mutant guided by phosphorylated fragments; wherein 1, a plasmid; 2, adding guide complementary to the target sequence; 3, no guide is added;
FIG. 5: map of different length phosphorylated fragment-directed site-directed excision; wherein 1, a plasmid; 2, no guide is added; 3,10bp guide; 4,20bp guide; 5,30bp guide; 6,40bp guide.
FIG. 6: map of enhancement of nucleotide-directed site-directed cleavage activity of BaRecJM, wherein 1, plasmid; 2, BaRecJM; 3, BaRecJ.
Detailed Description
The following further describes the embodiments of the present invention with reference to the drawings and examples.
Example 1: 5' phosphorylated fragment-guided directed cleavage of RecJ proteins
1.1 plasmid preparation and leader 5' phosphorylation fragment design
A novel RecJ gene (designated batrecj) was identified by analyzing genomic information of bacillus alcalophilus (b.alcalophilus). Designing a gene specific primer, extracting DNA of the Bacillus alcalophilus by using a bacterial DNA extraction kit, and obtaining a coding region of a BaRecJ gene through PCR amplification, wherein the amino acid sequence of the coding region is SEQ ID NO. 1, and the nucleotide sequence of the coding gene is SEQ ID NO. 2. The BaRecJ protein differs significantly from the structure of RecJ that has been reported so far, and data from NCBI shows that it contains a piwi-like domain in the C-terminal region; the DHH structural domain (1-241 amino acids) of the RecJ gene is cloned to a pET-28a (+) expression vector, a prokaryotic expression vector is constructed, and recombinant protein is obtained through induced expression (figure 1).
Extracting plasmids by DH10B escherichia coli containing pmg36e carrier according to Shanghai biological fluid granule extraction kit, and quantifying by a micro-quantitative instrument. Design 5' phosphorylated DNA fragment, p36e-35-f (AGCGTGGCTTTGCAGCGAAGATGTTGTCTGTTAGA), p36e-35-r (TCTAACAGACAACATCTTCTCGCCTGCAAAGCCACGCT) based on the cleaved target sequence.
1.2 Effect of preloading of 5' phosphorylated fragments on cleavage
According to the protein: fragment 1: 2 the protein was preloaded with fragments and the effect of preloading on shearing, Mg2+The loading was completed by reaction at 37 ℃ for 10min, which had an important effect on the 5' phosphorylated fragment and protein (final concentration of 20 mM).
1.3 fixed-point shearing experiment
The fragment-loaded protein and plasmid were mixed in reaction buffer (50mM Tris/HCl pH 7.4,100mM NaCl, 5mM Mg 2+5% glycerol) were reacted. The ratio of protein to fragment to target substrate is: 5:10:1. According to the experimental design, the full-length protein of RecJ and the protein not of RecJ are respectivelyThe truncation was mixed with the target plasmid, the mixture was incubated at 37 ℃ for 4h, and the shearing effect of the protein on the plasmid was analyzed by electrophoresis on a 1% agarose gel. The result shows that the 5' phosphorylation fragment can inhibit the truncation activity of BaRecJ and enhance the specific cleavage of BaRecJ. Mg (magnesium)2+Can affect the binding of BaRecJ to phosphorylated fragments without Mg2 +The BaRecJ and phosphorylated fragment of (A) do not bind in the presence of Mg2+In the buffer solution of (1), BaRecJ, which preferentially exerts exonuclease activity and degrades phosphorylated fragments, is mixed with a target plasmid, thereby reducing the inhibition of truncation activity (FIG. 2). The above results indicate that the RecJ protein can be used as an endonuclease to edit nucleic acids under the guidance of phosphorylated small DNA or RNA.
Example 2: construction of prokaryotic expression vector of BaRecJ mutant (BaRecJM)
1.1, vector construction:
mutating the BaRecJ protein to obtain a mutant BaRecJM; the amino acid sequence of BaRecJM is SEQ ID NO. 3, and the nucleotide sequence is SEQ ID NO. 4. The vector pET-28a (+) was digested with Nde I and BamHI in two, and the mutated sequence was inserted into the corresponding site by seamless cloning to construct an expression vector pET28 a-RecJM. The primer design and plasmid sequencing are both synthesized by Shanghai bioengineering technology, Inc.
1.2, in vitro induction expression:
the recombinant expression vector pET28a-RecJM was transformed with BL21(DE3) host, and a single colony was selected and inoculated into 3ml of LB liquid medium containing kanamycin (50. mu.g/ml) and cultured overnight at 30 ℃. A portion of the overnight culture was taken, sterile glycerol was added to a final concentration of 10%, mixed well and stored at-70 ℃. And inoculating the residual bacterial liquid serving as a mother liquid for inducing expression into an LB liquid culture medium containing kanamycin (50 mu g/ml), culturing at 30 ℃, precooling the culture medium in a 16 ℃ culture box for 2-3h when OD600 reaches 0.8-1.0, precooling the culture medium to 16 ℃, adding a proper amount of IPTG (final concentration of 0.1mM), and culturing at 16 ℃ overnight.
1.3, purification of induction products:
the overnight induced bacterial liquid was collected in a 50ml centrifuge tube, and centrifuged at 5000g and 4 ℃ for 25min to harvest the cells. Resuspending the cells with column buffer, continuously shaking for 15min with vortex shaker, vortex-crushing in a cell crusher, centrifuging at 13000g for 10min, and collecting the supernatant for purification of target protein (FIG. 1). Diluting the thallus lysate with Binding Buffer, loading the diluted thallus lysate on a column, washing the column by using the Binding Buffer with 15 times of column volume, and removing the foreign proteins; eluting by using an Elution Buffer, collecting an Elution peak (Elution Buffer: 20mM Tris-HCl (PH7.9) 200-500 mM imidazole 0.5M NaCl), and collecting an effluent for later use; after elution, the column was washed with 10 column volumes of deionized water, equilibrated with 3 column volumes of 20% ethanol (ethanol to submerge the packing), and stored at 4 ℃; the effluent after gradient elution was ultrafiltered in Millipore ultrafilter tube (15ml 10KD) for 40min in 5000g horizontal rotor, and the target protein was concentrated and kept at-80 deg.C. The results show that the BaRecJ mutant is easy to form inclusion bodies in the expression process, the culture and induction temperature is changed, the BaRecJ mutant is cultured at 30 ℃ until the OD value is 0.6-0.8, the induction is carried out, the content of an Inducer (IPTG) is 0.1mM-0.5mM, and the induction is carried out for 12-18h, so that the soluble protein with higher yield can be obtained (figure 3).
Example 3: targeted cleavage of plasmids by BaRecJM under the guidance of 5' phosphorylated fragment
1. Design of 5' end phosphorylated fragments of different lengths
Using pmg36e plasmid as substrate, designing relative phosphorylation guide, p36e10-f (AAGCCGATGA), p36e10-r (TCATCGGCTT) according to action site sequence; p36e20-f (TAGATTATGAAAGCCGATGA), P36e20-r (TCATCGGCTTTCATATCTATA); p36e30-f: TGTTGTCTGTTAGATTATGAAAGCCGATGA, P36e30-r: TCATCGGCTTTCATAATCTAACAGACAACA; p36e40-f (GCAGCGAAGATGTTGTCTGTTAGATTATGAAAGCCGATGA), P36e40-r (TCATCGGCTTTTCATAATCTAACAGACATCTTCGCTGC). The effect of shearing by BaRecJM under the guidance of phosphorylated guide of different lengths was analyzed.
2.5' phosphorylation guide guided site-directed cleavage of BaRecJM
Complementary 5' phosphorylated guide in Mg2+Loaded separately with BaRecJM under the action of the enzyme, and the guide-loaded protein and substrate (protein: fragment: substrate ratio: 5:10:1) were reacted in a reaction buffer (50mM Tris/HCl pH 7.4,100mM NaCl, 5mM Mg 2+5% Glycerol) The reaction is carried out. The mixture was incubated at 37 ℃ for 4h and the effect of protein cleavage on the plasmid was analyzed by electrophoresis on a 1% agarose gel. The result shows that the addition of guide which is complementary to the target sequence can inhibit the truncation activity of BaRecJM and enhance the specific shearing activity thereof, thereby forming a specific fragment (figure 4); sequencing results show that BaRecJM cleaves around 89bp downstream of 140bp on the guide binding site, so that 229bp fragments near the guide are deleted.
3. Effect of different length 5' end phosphorylated guide on shearing of BaRecJM
Phosphorylating guide at the 5' end of different lengths on Mg2+The reactions were separately preloaded with BaRecJM, mixed according to the optimized ratio of fractions (protein: fragment: substrate), incubated in reaction buffer at 37 ℃ for 6h, and the cleavage effect of the protein on the plasmid was analyzed by 1% agarose gel electrophoresis. The results show that: the guide with the length of 30 or 40bp can obviously guide the specific shearing of BaRecJM to the substrate and increase the content of linearized fragments. Whereas the sum of 10bp and 20bp was similar without the addition of guide, without significantly increasing the linearized content (FIG. 5).
Enhancement of guide-guided specific cleavage Activity of BaRecJM
BaRecJ and BaRecJM proteins were bound to complementary phosphorylated guide of 30bp, respectively, and the target plasmid was acted upon, incubated at 37 ℃ for 6 hours in a reaction buffer, and the shearing effect of the plasmid was analyzed by 1% agarose gel electrophoresis (FIG. 6). The result shows that the mutant BaRecJM has weakened degradation effect on the target plasmid, the content of linearized fragments of the plasmid is increased, and the site-directed shearing capability of the mutant BaRecJM on the target DNA guided by the DNA guide is enhanced.
Sequence listing
<110> Qingdao university of the first oceanographic institute of Nature resources department
<120> DNA guide-guided BaRecJ protein having endonuclease activity
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 787
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Met Leu Asn Pro Lys Ala Arg Trp Lys Ile Glu Glu Gln Lys Glu Glu
1 5 10 15
Val Val Glu Gln Leu Ile Lys Glu Leu Asp Ile Ala Pro Leu Val Ala
20 25 30
Lys Leu Leu Ile Asn Arg Gly Leu Thr Thr Pro Glu Val Ala Ser Thr
35 40 45
Phe Leu Asn Lys Asn Gln Ile Lys Tyr His Asp Pro Phe Ser Leu Asp
50 55 60
Gly Met Asp Arg Val Val Glu Arg Ile His Gln Ala Ile Glu Lys Lys
65 70 75 80
Glu Asn Ile Leu Ile Phe Gly Asp Tyr Asp Ala Asp Gly Val Ser Ser
85 90 95
Thr Ala Val Met Val Tyr Thr Leu Gln Met Leu Gly Ala Lys Phe Asp
100 105 110
Tyr Tyr Ile Pro Asn Arg Phe Thr Glu Gly Tyr Gly Pro Asn Glu Pro
115 120 125
Ala Leu Arg Lys Ala Lys Glu Ala Gly Phe Gln Leu Val Val Thr Val
130 135 140
Asp Thr Gly Ile Ser Ala Val His Glu Ala Thr Val Ala Lys Glu Ile
145 150 155 160
Gly Leu Asp Phe Ile Val Thr Asp His His Glu Ala Pro Pro Gln Leu
165 170 175
Pro Asp Ala Tyr Ala Ile Ile Asn Pro Lys Lys Pro Gly Cys Pro Tyr
180 185 190
Pro Phe Lys Gly Leu Ala Gly Val Gly Val Ala Phe Lys Val Ala Gln
195 200 205
Ala Leu Leu Gly Arg Val Pro Lys Glu Leu Leu Asp Ile Val Val Ile
210 215 220
Gly Thr Ile Ala Asp Leu Val Pro Leu Val Asp Glu Asn Arg Leu Leu
225 230 235 240
Ala Met Glu Gly Leu Ser Ala Leu Gln Ser Ser Ser Lys Pro Gly Leu
245 250 255
Ile Ala Ile Lys Lys Val Ala Gly Ile Glu Lys Glu Thr Leu Glu Ala
260 265 270
Asp His Val Gly Phe Ala Ile Gly Pro Arg Met Asn Ala Ala Gly Arg
275 280 285
Leu Gly Ser Ala Asn Pro Ala Val Asp Leu Leu Ile Thr Asp Lys Ser
290 295 300
Asp Glu Ala Lys Met Leu Ala Glu Glu Ile Asp Gly Leu Asn Lys Glu
305 310 315 320
Arg Gln His Ile Val Ser Ala Ile Ala Lys Glu Ala Ile Glu Met Val
325 330 335
Glu Asn Asp Phe Pro Pro Glu Asp Asn Ala Val Leu Ile Ile Ala Lys
340 345 350
Glu Gly Trp Asn Pro Gly Val Ile Gly Ile Val Ala Ser Arg Leu Val
355 360 365
Glu Lys Phe Tyr Arg Pro Thr Ile Val Leu Ser Ile Asp Glu Glu Lys
370 375 380
Gly Ile Ala Lys Gly Ser Ala Arg Ser Ile Glu Gly Phe Asp Met Phe
385 390 395 400
Ala Glu Leu Ser Lys Ser Arg Asp Ile Leu Pro His Phe Gly Gly His
405 410 415
Pro Met Ala Ala Gly Leu Thr Ile Ser Leu Glu His Leu Ser Glu Leu
420 425 430
Arg Asp Arg Leu Gln Val Gln Ala Lys Glu Ser Leu Ser Glu Glu Asp
435 440 445
Phe Ile Pro Val Lys Arg Val Asp Leu Val Ala Gly Val Asp Glu Ile
450 455 460
Ser Leu Asp Ile Ile Lys Gln Met Lys Gln Leu Ala Pro Phe Gly Val
465 470 475 480
Ser Asn Pro Thr Pro Lys Ile Met Leu Gln Gln Ala Asn Ile Gly Glu
485 490 495
Met Lys Lys Ile Gly Ser Glu Ala Asn His Leu Lys Ile Gln Phe Lys
500 505 510
Gln Asn Gly Ser Ser Leu Asp Gly Ile Gly Phe His Phe Gly Tyr Val
515 520 525
Tyr Glu Gln Met Ser Val Gln Asp Arg Val Ser Ala Val Gly Thr Leu
530 535 540
Ser Ile Asn Glu Trp Asn Gly His Ile Lys Pro Gln Leu Met Ile Glu
545 550 555 560
Asp Ile Ala Val Thr Asp Trp Gln Leu Phe Asp Trp Arg Ser Val Gln
565 570 575
Lys Leu Arg Leu Glu Asp Lys Leu Lys Leu Ile Ser Leu Pro Thr Gln
580 585 590
Tyr Leu Ile Ala Phe Asn Asp Glu Thr Lys Val Lys Leu Lys Leu Glu
595 600 605
Asn Glu Gln Ile Trp Thr Arg Glu Gln Leu Ser His Ile Asp Ser Phe
610 615 620
Glu Asn Ala Ala Val Val Leu Leu Asp Leu Pro Ala Ser Glu Gln Glu
625 630 635 640
Ile Lys Gln Leu Phe Ala Asp Lys Gly Arg Pro Ser Gln Ile Phe Cys
645 650 655
Leu Phe Tyr Gln Glu Glu Asp Ser Phe Phe Ser Ala Ser Pro Asn Arg
660 665 670
Glu Thr Phe Lys Trp Phe Tyr Ala Phe Leu Arg Lys Gln Lys Lys Phe
675 680 685
Asn Leu Asn Glu Gln Gly Met Lys Leu Ile Ser Tyr Lys Gly Trp Ser
690 695 700
Lys Glu Ser Val Lys Phe Met Val Glu Val Phe Val Glu Leu Asn Phe
705 710 715 720
Ile Arg Gln Glu Asn Gly Trp Leu Ile Ile Glu Glu Asn Pro Glu Lys
725 730 735
Lys Ser Leu Thr Asp Ser Val Ala Phe Gln Arg Lys Glu Asn Gln Arg
740 745 750
Thr Leu Glu Asn Asp Phe Val Tyr Ser Ser Phe Glu His Leu Lys Gln
755 760 765
Leu Phe Thr Thr Ile Phe Glu Gln Asn Thr Asn Glu Ser Thr Ile Lys
770 775 780
Glu Thr Val
785
<210> 2
<211> 2364
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgttgaatc caaaggcaag atggaaaata gaagagcaaa aagaagaggt cgttgagcaa 60
ttaatcaaag agctcgacat cgctccttta gtcgctaaac tcttaattaa tcgcgggtta 120
acgaccccag aagtggcctc taccttttta aataaaaatc aaatcaaata tcatgatcca 180
ttttctttag atgggatgga tagagttgtt gaaagaatcc atcaagcgat cgaaaaaaag 240
gaaaatattc tcatatttgg tgattatgat gcagatggtg taagtagtac cgctgtaatg 300
gtttatacgt tacaaatgct cggagctaag tttgactatt atattcctaa tcgttttaca 360
gaaggctatg gaccgaacga accggcttta cgaaaggcga aggaagcagg gtttcagctt 420
gtcgtgaccg ttgataccgg aatttcagct gttcatgaag caacagtggc aaaagaaatc 480
ggtttagatt ttatcgtgac tgatcaccat gaagccccac cacaattgcc ggatgcctat 540
gcaattatta atccgaaaaa accaggatgt ccttatcctt ttaagggact tgcaggagta 600
ggtgttgctt ttaaagtggc ccaggcttta ttagggagag tcccaaagga attattggac 660
attgttgtca tcggaacgat cgccgattta gttcctttag tagacgaaaa tcgtttatta 720
gcaatggaag ggttaagtgc tctgcaatct agttcaaaac caggcttaat tgcgataaaa 780
aaagtcgcag gaattgaaaa agagacatta gaagcggatc atgtcggttt tgcgattgga 840
ccaagaatga atgccgccgg tcgcttaggc tcagcgaatc cagcggtcga tttgcttatc 900
accgataaaa gcgatgaggc aaaaatgtta gcagaagaaa ttgatgggct aaataaggaa 960
cgacaacata tcgtttctgc catcgcaaaa gaagcgattg aaatggttga aaatgacttt 1020
ccaccagaag ataatgcagt gctgattatc gcaaaagaag gctggaatcc tggagtgatt 1080
ggaattgtcg cttcaagatt agtagagaag ttttatcgac caacgattgt gttaagcatt 1140
gatgaggaaa aaggaattgc taaaggttct gccagaagta ttgaaggttt tgatatgttt 1200
gcggaactat caaaaagtcg tgatatttta cctcattttg gtggtcaccc aatggcggcc 1260
ggattgacga tttctcttga acacttatct gaattaaggg accgtttaca agtgcaggca 1320
aaagaaagtc tttcagaaga agactttatt cctgttaaac gagtggatct agtggccggt 1380
gtcgatgaga tttctttaga tattattaaa caaatgaaac aacttgcacc atttggagtg 1440
agcaatccaa ccccaaaaat tatgctgcaa caagcaaata tcggggaaat gaaaaaaatc 1500
ggtagtgaag ccaatcattt aaagattcag tttaaacaaa acggttcttc attagatgga 1560
attggttttc attttggtta tgtttatgag caaatgtctg tccaagaccg agtctcggca 1620
gttggcacac tttccattaa tgaatggaat ggacatatca aacctcaact tatgattgaa 1680
gatatcgcag ttacggactg gcaattattt gattggcgaa gtgtccagaa actacgtcta 1740
gaagacaagc ttaagttgat ttctttaccg actcaatatt tgattgcatt caatgatgag 1800
acaaaggtaa aattaaaatt agagaatgaa caaatatgga ctcgtgaaca gcttagtcac 1860
attgattctt ttgaaaatgc agcggttgtt ttattagatt taccggcgag tgaacaagaa 1920
attaagcagc tatttgcaga taaaggaaga ccaagtcaaa tcttttgttt attttatcag 1980
gaagaggact cgtttttttc cgctagtcca aatcgtgaaa cttttaaatg gttctatgct 2040
tttttacgaa aacaaaagaa gtttaattta aatgagcaag ggatgaagct gatttcatat 2100
aaaggttggt caaaagaatc agttaaattt atggtcgaag tttttgttga attaaatttt 2160
attcgccaag aaaatggttg gttaatcatc gaggagaacc ctgagaaaaa aagcttaacc 2220
gattcagtcg ccttccagag aaaagaaaat caacggacac tggaaaatga ttttgtctat 2280
tcttcatttg aacatttaaa gcaattgttt acgacaattt ttgaacaaaa cacgaacgaa 2340
agtacaatca aggagacggt ataa 2364
<210> 3
<211> 787
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Met Leu Asn Pro Lys Ala Arg Trp Lys Ile Glu Glu Gln Lys Glu Glu
1 5 10 15
Val Val Glu Gln Leu Ile Lys Glu Leu Asp Ile Ala Pro Leu Val Ala
20 25 30
Lys Leu Leu Ile Asn Arg Gly Leu Thr Thr Pro Glu Val Ala Ser Thr
35 40 45
Phe Leu Asn Lys Asn Gln Ile Lys Tyr His Asp Pro Phe Ser Leu Asp
50 55 60
Gly Met Asp Arg Val Val Glu Arg Ile His Gln Ala Ile Glu Lys Lys
65 70 75 80
Glu Asn Ile Leu Ile Phe Gly Asp Tyr Asp Ala Asp Gly Val Ser Ser
85 90 95
Thr Ala Val Met Val Tyr Thr Leu Gln Met Leu Gly Ala Lys Phe Asp
100 105 110
Tyr Tyr Ile Pro Asn Arg Phe Thr Glu Gly Tyr Gly Pro Asn Glu Pro
115 120 125
Ala Leu Arg Lys Ala Lys Glu Ala Gly Phe Gln Leu Val Val Thr Val
130 135 140
Asp Thr Gly Ile Ser Ala Val His Glu Ala Thr Val Ala Lys Glu Ile
145 150 155 160
Gly Leu Asp Phe Ile Val Thr Asp His His Glu Ala Pro Pro Gln Leu
165 170 175
Pro Asp Ala Tyr Ala Ile Ile Asn Pro Lys Lys Pro Gly Cys Pro Tyr
180 185 190
Pro Phe Lys Gly Leu Ala Gly Val Gly Val Ala Phe Lys Val Ala Gln
195 200 205
Ala Leu Leu Gly Arg Val Pro Lys Glu Leu Leu Asp Ile Val Val Ile
210 215 220
Gly Thr Ile Ala Ala Leu Val Pro Leu Val Asp Glu Asn Arg Leu Leu
225 230 235 240
Ala Met Glu Gly Leu Ser Ala Leu Gln Ser Ser Ser Lys Pro Gly Leu
245 250 255
Ile Ala Ile Lys Lys Val Ala Gly Ile Glu Lys Glu Thr Leu Glu Ala
260 265 270
Asp His Val Gly Phe Ala Ile Gly Pro Arg Met Asn Ala Ala Gly Arg
275 280 285
Leu Gly Ser Ala Asn Pro Ala Val Asp Leu Leu Ile Thr Asp Lys Ser
290 295 300
Asp Glu Ala Lys Met Leu Ala Glu Glu Ile Asp Gly Leu Asn Lys Glu
305 310 315 320
Arg Gln His Ile Val Ser Ala Ile Ala Lys Glu Ala Ile Glu Met Val
325 330 335
Glu Asn Asp Phe Pro Pro Glu Asp Asn Ala Val Leu Ile Ile Ala Lys
340 345 350
Glu Gly Trp Asn Pro Gly Val Ile Gly Ile Val Ala Ser Arg Leu Val
355 360 365
Glu Lys Phe Tyr Arg Pro Thr Ile Val Leu Ser Ile Asp Glu Glu Lys
370 375 380
Gly Ile Ala Lys Gly Ser Ala Arg Ser Ile Glu Gly Phe Asp Met Phe
385 390 395 400
Ala Glu Leu Ser Lys Ser Arg Asp Ile Leu Pro His Phe Gly Gly His
405 410 415
Pro Met Ala Ala Gly Leu Thr Ile Ser Leu Glu His Leu Ser Glu Leu
420 425 430
Arg Asp Arg Leu Gln Val Gln Ala Lys Glu Ser Leu Ser Glu Glu Asp
435 440 445
Phe Ile Pro Val Lys Arg Val Asp Leu Val Ala Gly Val Asp Glu Ile
450 455 460
Ser Leu Asp Ile Ile Lys Gln Met Lys Gln Leu Ala Pro Phe Gly Val
465 470 475 480
Ser Asn Pro Thr Pro Lys Ile Met Leu Gln Gln Ala Asn Ile Gly Glu
485 490 495
Met Lys Lys Ile Gly Ser Glu Ala Asn His Leu Lys Ile Gln Phe Lys
500 505 510
Gln Asn Gly Ser Ser Leu Asp Gly Ile Gly Phe His Phe Gly Tyr Val
515 520 525
Tyr Glu Gln Met Ser Val Gln Asp Arg Val Ser Ala Val Gly Thr Leu
530 535 540
Ser Ile Asn Glu Trp Asn Gly His Ile Lys Pro Gln Leu Met Ile Glu
545 550 555 560
Asp Ile Ala Val Thr Asp Trp Gln Leu Phe Asp Trp Arg Ser Val Gln
565 570 575
Lys Leu Arg Leu Glu Asp Lys Leu Lys Leu Ile Ser Leu Pro Thr Gln
580 585 590
Tyr Leu Ile Ala Phe Asn Asp Glu Thr Lys Val Lys Leu Lys Leu Glu
595 600 605
Asn Glu Gln Ile Trp Thr Arg Glu Gln Leu Ser His Ile Asp Ser Phe
610 615 620
Glu Asn Ala Ala Val Val Leu Leu Asp Leu Pro Ala Ser Glu Gln Glu
625 630 635 640
Ile Lys Gln Leu Phe Ala Asp Lys Gly Arg Pro Ser Gln Ile Phe Cys
645 650 655
Leu Phe Tyr Gln Glu Glu Asp Ser Phe Phe Ser Ala Ser Pro Asn Arg
660 665 670
Glu Thr Phe Lys Trp Phe Tyr Ala Phe Leu Arg Lys Gln Lys Lys Phe
675 680 685
Asn Leu Asn Glu Gln Gly Met Lys Leu Ile Ser Tyr Lys Gly Trp Ser
690 695 700
Lys Glu Ser Val Lys Phe Met Val Glu Val Phe Val Glu Leu Asn Phe
705 710 715 720
Ile Arg Gln Glu Asn Gly Trp Leu Ile Ile Glu Glu Asn Pro Glu Lys
725 730 735
Lys Ser Leu Thr Asp Ser Val Ala Phe Gln Arg Lys Glu Asn Gln Arg
740 745 750
Thr Leu Glu Asn Asp Phe Val Tyr Ser Ser Phe Glu His Leu Lys Gln
755 760 765
Leu Phe Thr Thr Ile Phe Glu Gln Asn Thr Asn Glu Ser Thr Ile Lys
770 775 780
Glu Thr Val
785
<210> 4
<211> 2364
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
atgttgaatc caaaggcaag atggaaaata gaagagcaaa aagaagaggt cgttgagcaa 60
ttaatcaaag agctcgacat cgctccttta gtcgctaaac tcttaattaa tcgcgggtta 120
acgaccccag aagtggcctc taccttttta aataaaaatc aaatcaaata tcatgatcca 180
ttttctttag atgggatgga tagagttgtt gaaagaatcc atcaagcgat cgaaaaaaag 240
gaaaatattc tcatatttgg tgattatgat gcagatggtg taagtagtac cgctgtaatg 300
gtttatacgt tacaaatgct cggagctaag tttgactatt atattcctaa tcgttttaca 360
gaaggctatg gaccgaacga accggcttta cgaaaggcga aggaagcagg gtttcagctt 420
gtcgtgaccg ttgataccgg aatttcagct gttcatgaag caacagtggc aaaagaaatc 480
ggtttagatt ttatcgtgac tgatcaccat gaagccccac cacaattgcc ggatgcctat 540
gcaattatta atccgaaaaa accaggatgt ccttatcctt ttaagggact tgcaggagta 600
ggtgttgctt ttaaagtggc ccaggcttta ttagggagag tcccaaagga attattggac 660
attgttgtca tcggaacgat cgccgcatta gttcctttag tagacgaaaa tcgtttatta 720
gcaatggaag ggttaagtgc tctgcaatct agttcaaaac caggcttaat tgcgataaaa 780
aaagtcgcag gaattgaaaa agagacatta gaagcggatc atgtcggttt tgcgattgga 840
ccaagaatga atgccgccgg tcgcttaggc tcagcgaatc cagcggtcga tttgcttatc 900
accgataaaa gcgatgaggc aaaaatgtta gcagaagaaa ttgatgggct aaataaggaa 960
cgacaacata tcgtttctgc catcgcaaaa gaagcgattg aaatggttga aaatgacttt 1020
ccaccagaag ataatgcagt gctgattatc gcaaaagaag gctggaatcc tggagtgatt 1080
ggaattgtcg cttcaagatt agtagagaag ttttatcgac caacgattgt gttaagcatt 1140
gatgaggaaa aaggaattgc taaaggttct gccagaagta ttgaaggttt tgatatgttt 1200
gcggaactat caaaaagtcg tgatatttta cctcattttg gtggtcaccc aatggcggcc 1260
ggattgacga tttctcttga acacttatct gaattaaggg accgtttaca agtgcaggca 1320
aaagaaagtc tttcagaaga agactttatt cctgttaaac gagtggatct agtggccggt 1380
gtcgatgaga tttctttaga tattattaaa caaatgaaac aacttgcacc atttggagtg 1440
agcaatccaa ccccaaaaat tatgctgcaa caagcaaata tcggggaaat gaaaaaaatc 1500
ggtagtgaag ccaatcattt aaagattcag tttaaacaaa acggttcttc attagatgga 1560
attggttttc attttggtta tgtttatgag caaatgtctg tccaagaccg agtctcggca 1620
gttggcacac tttccattaa tgaatggaat ggacatatca aacctcaact tatgattgaa 1680
gatatcgcag ttacggactg gcaattattt gattggcgaa gtgtccagaa actacgtcta 1740
gaagacaagc ttaagttgat ttctttaccg actcaatatt tgattgcatt caatgatgag 1800
acaaaggtaa aattaaaatt agagaatgaa caaatatgga ctcgtgaaca gcttagtcac 1860
attgattctt ttgaaaatgc agcggttgtt ttattagatt taccggcgag tgaacaagaa 1920
attaagcagc tatttgcaga taaaggaaga ccaagtcaaa tcttttgttt attttatcag 1980
gaagaggact cgtttttttc cgctagtcca aatcgtgaaa cttttaaatg gttctatgct 2040
tttttacgaa aacaaaagaa gtttaattta aatgagcaag ggatgaagct gatttcatat 2100
aaaggttggt caaaagaatc agttaaattt atggtcgaag tttttgttga attaaatttt 2160
attcgccaag aaaatggttg gttaatcatc gaggagaacc ctgagaaaaa aagcttaacc 2220
gattcagtcg ccttccagag aaaagaaaat caacggacac tggaaaatga ttttgtctat 2280
tcttcatttg aacatttaaa gcaattgttt acgacaattt ttgaacaaaa cacgaacgaa 2340
agtacaatca aggagacggt ataa 2364

Claims (3)

1. The mutant of the RecJ nuclease is characterized in that the amino acid sequence of the mutant of the RecJ nuclease is SEQ ID NO. 3.
2. A gene encoding the mutant RecJ nuclease of claim 1, having the nucleotide sequence of SEQ ID NO. 4.
3. Use of a mutant of RecJ nuclease according to claim 1 as an endonuclease to cleave linear double-stranded DNA under the guidance of phosphorylated small DNA, said small DNA having a length of 30-40 bp.
CN201910509798.5A 2018-07-02 2019-06-12 DNA guide-guided RecJ protein with endonuclease activity and application thereof in gene editing Active CN110093390B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201810708639.3A CN108866127A (en) 2018-07-02 2018-07-02 A kind of RecJ albumen with endonuclease activity and the application in gene editing
CN2018107086393 2018-07-02

Publications (2)

Publication Number Publication Date
CN110093390A CN110093390A (en) 2019-08-06
CN110093390B true CN110093390B (en) 2021-08-27

Family

ID=64298085

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201810708639.3A Pending CN108866127A (en) 2018-07-02 2018-07-02 A kind of RecJ albumen with endonuclease activity and the application in gene editing
CN201910509798.5A Active CN110093390B (en) 2018-07-02 2019-06-12 DNA guide-guided RecJ protein with endonuclease activity and application thereof in gene editing

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201810708639.3A Pending CN108866127A (en) 2018-07-02 2018-07-02 A kind of RecJ albumen with endonuclease activity and the application in gene editing

Country Status (1)

Country Link
CN (2) CN108866127A (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109735516B (en) * 2019-01-22 2021-09-03 自然资源部第一海洋研究所 PIWI protein with specific endonuclease activity guided by nucleotide fragment
CN116064475A (en) * 2022-10-07 2023-05-05 自然资源部第一海洋研究所 Nuclease with RecJ-piwi structural domain and application thereof in genome random mutation

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999026959A1 (en) * 1997-11-20 1999-06-03 Smithkline Beecham Corporation NOVEL recJ
CN106399519A (en) * 2016-09-30 2017-02-15 南京迪康金诺生物技术有限公司 Target area capturing method based on hairpin structures and application of target area capturing method

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999026959A1 (en) * 1997-11-20 1999-06-03 Smithkline Beecham Corporation NOVEL recJ
CN106399519A (en) * 2016-09-30 2017-02-15 南京迪康金诺生物技术有限公司 Target area capturing method based on hairpin structures and application of target area capturing method

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
WP_003324372.1;NCBI;《NCBI Reference Sequence》;20130507;序列部分 *

Also Published As

Publication number Publication date
CN108866127A (en) 2018-11-23
CN110093390A (en) 2019-08-06

Similar Documents

Publication Publication Date Title
KR102606680B1 (en) S. Pyogenes ACS9 mutant gene and polypeptide encoded thereby
CN107922931B (en) Thermostable Cas9 nuclease
JP2018068311A (en) Materials and methods for synthesizing nucleic acid molecules with minimum error
WO2022228351A1 (en) Representation and application of novel high temperature argonaute protein tpsago
WO2022222920A1 (en) Characterization and application of novel high-temperature argonaute protein
CN110093390B (en) DNA guide-guided RecJ protein with endonuclease activity and application thereof in gene editing
WO2023138082A1 (en) Eukaryote-derived argonaute protein and use thereof
US8535925B2 (en) Modified DNase compositions and methods of use thereof
CN109735516B (en) PIWI protein with specific endonuclease activity guided by nucleotide fragment
JP4889647B2 (en) Novel endoribonuclease
Monakhova et al. Endonuclease activity of MutL protein of the Rhodobacter sphaeroides mismatch repair system
CN112029744A (en) DNA polymerase and its coding gene, preparation method and PCR application
CN111433373B (en) DNA polymerase
CN114015672B (en) Pfu DNA polymerase
US20090311743A1 (en) Process for the Production, in Prokaryotes, of Active, Stable Transposases of Mariner Mobile Genetic Elements
KR101230362B1 (en) Hot-start pcr based on the protein trans-splicing of nanoarchaeum equitans dna polymerase
Kaplan et al. Recombinant production of Thermus aquaticus single-strand binding protein for usage as PCR enhancer
KR100844358B1 (en) Mutant DNA Polymerases and Their Genes
US7989184B2 (en) Endoribonuclease
CN114164194B (en) Pseudomonas stutzeri-RE nuclease and application thereof
CN111394323A (en) Recombinant RecA protein and expression method and application thereof
US20090259035A1 (en) Method for producing recombinant RNase A
CN114958808B (en) CRISPR/Cas system for small-sized genome editing and special CasX protein thereof
Toksoy et al. High level secretion of TaqI restriction endonuclease by recombinant Escherichia coli
JP4714848B2 (en) DNA polymerase mutant

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20200805

Address after: Laoshan District xianxialing road 266100 Shandong city of Qingdao province No. 6

Applicant after: FIRST INSTITUTE OF OCEANOGRAPHY, MNR

Applicant after: QINGDAO University

Applicant after: CHINA OCEAN MINERAL RESOURCES R&D ASSOCIATION

Address before: Laoshan District xianxialing road 266061 Shandong city of Qingdao province No. 6

Applicant before: FIRST INSTITUTE OF OCEANOGRAPHY, MNR

Applicant before: QINGDAO University

TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20210512

Address after: 266071 No. 308, Ningxia Road, Qingdao, Shandong

Applicant after: QINGDAO University

Applicant after: FIRST INSTITUTE OF OCEANOGRAPHY, MNR

Applicant after: CHINA OCEAN MINERAL RESOURCES R & D ASSOCIATION (CHINA'S OCEAN AFFAIRS ADMINISTRATION)

Applicant after: Qingdao University Of Science And Technology

Address before: No.6 xianxialing Road, Laoshan District, Qingdao City, Shandong Province 266100

Applicant before: FIRST INSTITUTE OF OCEANOGRAPHY, MNR

Applicant before: QINGDAO University

Applicant before: CHINA OCEAN MINERAL RESOURCES R&D ASSOCIATION

GR01 Patent grant
GR01 Patent grant