WO1999026959A1 - NOVEL recJ - Google Patents

NOVEL recJ Download PDF

Info

Publication number
WO1999026959A1
WO1999026959A1 PCT/US1998/024804 US9824804W WO9926959A1 WO 1999026959 A1 WO1999026959 A1 WO 1999026959A1 US 9824804 W US9824804 W US 9824804W WO 9926959 A1 WO9926959 A1 WO 9926959A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
compnsmg
recj
seq
Prior art date
Application number
PCT/US1998/024804
Other languages
French (fr)
Inventor
Magdalena Zalacain
James R. Brown
Sanjoy Biswas
Richard L. Warren
Lisa K. Shilling
Original Assignee
Smithkline Beecham Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Smithkline Beecham Corporation filed Critical Smithkline Beecham Corporation
Priority to JP2000522116A priority Critical patent/JP2002504305A/en
Priority to EP98959529A priority patent/EP1032582A1/en
Publication of WO1999026959A1 publication Critical patent/WO1999026959A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • C07K14/3156—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci from Streptococcus pneumoniae (Pneumococcus)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • This invention relates to newly identified polynucleotides and polypeptides, and their production and uses, as well as their vanants, agonists and antagonists, and their uses
  • the invention relates to novel polynucleotides and polypeptides of the recJ (single-stranded-DNA specific exonuclease) family, hereinafter referred to as "recJ"
  • Streptococci make up a medically important genera of microbes known to cause several types of disease in humans, including, for example, otitis media, conjunctivitis, pneumonia, bacteremia, meningitis, sinusitis, pleural empyema and endocarditis, and most particularly meningitis, such as for example infection of cerebrospinal fluid Since its isolation more than 100 years ago, Streptococcus pneumoniae has been one of the more intensively studied microbes For example, much of our early understanding that DNA is, in fact, the genetic matenal was predicated on the work of Griffith and of Avery, Macleod and McCarty using this microbe Despite the vast amount of research with S pneumoniae, many questions concerning the virulence of this microbe remain It is particularly preferred to employ Streptococcal genes and gene products as targets for the development of antibiotics
  • RecJ is a smgle-stranded DNA exonuclease that functions methylation-directed mismatch repair recJ mutants decrease recombination which is mdependent of RecBCD but dependent upon RecE or RecF Inhibitors of the proteins mvolved m this type of DNA repair could prevent the bacte ⁇ um from establishing or maintaining infection of the host and thereby have utility in antibacterial therapy
  • Streptococcus pneumoniae infections has nsen dramatically in the past few decades This has been attributed to the emergence of multiply antibiotic resistant strains and an mcreasmg population of people with weakened immune systems It is no longer uncommon to isolate Streptococcus pneumoniae strains which are resistant to some or all of the standard antibiotics This phenomenon has created a demand for both new anU-microbial agents, vaccmes, and diagnostic tests for this organism
  • polypeptides of the invention possess amino acid sequence homology to a known H influenzae recJ protem See Swiss-prot, Accession number P45112 and
  • the polynucleotide compnses a region encodmg recJ polypeptides compnsmg a sequence set out m Table 1 [SEQ ID NO 1] which mcludes a full length gene, or a variant thereof
  • isolated nucleic acid molecules encodmg recJ particularly Streptococcus pneumoniae recJ
  • mcludmg mRNAs particularly Streptococcus pneumoniae recJ
  • cDNAs cDNAs
  • genomic DNAs genomic DNAs
  • Further embodiments of the mvention mclude biologically, diagnostically, prophylactically, clinically or therapeutically useful vanants thereof, and compositions compnsmg the same
  • a polynucleotide of the invention for therapeutic or prophylactic purposes, in particular genetic immunization
  • particularly preferred embodiments of the mvention are naturally occurring allelic vanants of recJ and polypeptides encoded thereby
  • a polypeptide or polynucleotide of the mvention compnsmg contactmg a polypeptide or polynucleotide of the mvention with a compound to be screened under conditions to permit bmdmg to or other mteraction between the compound and the polypeptide or polynucleotide to assess the bmdmg to or other mteraction with the compound, such bmdmg or mteraction bemg associated with a second component capable of providing a detectable signal m response to the bmdmg or mteraction of the polypeptide or polynucleotide with the compound, and determinmg whether the compound bmds to or otherwise interacts with and activates or inhibits an activity of the polypeptide or polynucleotide by detectmg the presence or absence of a
  • recJ agonists and antagonists preferably bactenostatic or bactenocidal agonists and antagonists
  • compositions compnsmg a recJ polynucleotide or a recJ polypeptide for administration to a cell or to a multicellular organism
  • the mvention relates to novel recJ polypeptides and polynucleotides as descnbed m greater detail below
  • the mvention relates to polypeptides and polynucleotides of a novel recJ of Streptococcus pneumoniae, which is related by amino acid sequence homology to H influenzae recJ polypeptide
  • the mvention relates especially to recJ havmg the nucleotide and ammo acid sequences set out m Table 1 as SEQ ID NO 1 and SEQ ID NO 2 respectively, and to the recJ nucleotide sequences of the DNA m the deposited stram and ammo acid sequences encoded thereby TABLE 1 recJ Polynucleotide and Polypeptide Sequences
  • a deposit containing a Streptococcus pneumoniae 0100993 stram has been deposited with the National Collections of Industnal and Marine Bactena Ltd (herem “NCIMB"), 23 St Machar Dnve, Aberdeen AB2 1RY, Scotland on 11 Apnl 1996 and assigned deposit number 40794
  • the deposit was descnbed as Streptococcus peumnoiae 0100993 on deposit On 17 Apnl 1996 a Streptococcus peumnoiae 0100993 DNA library in E coli was similarly depositedwith the NCIMB and assigned deposit number 40800
  • the Streptococcus pneumoniae stram deposit is refened to herem as "the deposited stram" or as "the DNA of the deposited stram "
  • the deposited stram contams the full length recJ gene
  • a license may be required to make, use or sell the deposited stram, and compounds denved therefrom, and no such license is hereby granted Polypeptides
  • polypeptides of the mvention mclude a polypeptide of Table 1 [SEQ ID NO 2] (m particular the mature polypeptide) as well as polypeptides and fragments, particularly those which have the biological activity of recJ, and also those which have at least 70% identity to a polypeptide of Table 1 [SEQ ID NO l]or the relevant portion, preferably at least 80% identity to a polypeptide of Table 1 [SEQ ID NO 2and more preferably at least 90% similanty (more preferably at least 90% identity) to a polypeptide of Table 1 [SEQ ID NO 2] and still more preferably at least 95% similanty (still more preferably at least 95% identity) to a polypeptide of Table 1 [SEQ ID NO 2] and also mclude portions of such polypeptides with such portion of the polypeptide generally containing at least 30 ammo acids and more preferably at least 50 ammo acids
  • the mvention also mcludes polypeptides of the formula
  • R 1 X-(R 1 ) m -(R 2 )-(R 3 ) n -Y
  • X is hydrogen, and at the carboxyl terminus
  • Y is hydrogen or a metal
  • Rj and R3 are any ammo acid residue
  • m is an mteger between 1 and 1000 or zero
  • n is an mteger between 1 and 1000 or zero
  • R 2 is an ammo acid sequence of the mvention, particularly an ammo acid sequence selected from Table 1 In the formula above R 2 is onented so that its ammo terminal residue is at the left, bound to and its carboxy terminal residue is at the nght, bound to R3
  • Any stretch of ammo acid residues denoted by either R group, where m and/or n is greater than 1, may be either a heteropolymer or a homopolymer, preferably a heteropolymer
  • a fragment is a vanant polypeptide havmg an ammo acid sequence that entirely
  • Prefened fragments m include, for example, truncation polypeptides havmg a portion of an ammo acid sequence of Table 1 [SEQ ID NO 2], or of vanants thereof, such as a contmuous senes of residues that mcludes the ammo terminus, or a contmuous senes of residues that mcludes the carboxyl terminus
  • Degradation forms of the polypeptides of the mvention m a host cell, particularly a Streptococcus pneumoniae are also prefened
  • fragments characterized by structural or functional attributes such as fragments that compnse alpha-helix and alpha-helix forming regions, beta-sheet and beta-sheet-formmg regions, turn and turn-formmg regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate bmdmg region, and high antigenic mdex regions
  • Vanants that are fragments of the polypeptides of the mvention may be employed for producmg the conespondmg full-length polypeptide by peptide synthesis, therefore, these vanants may be employed as intermediates for producmg the fiill-length polypeptides of the mvention
  • X or "Xaa” may also be used m descnbmg certain polypeptides of the invention "X” and “Xaa” mean that any of the twenty naturally occurmg amino acids may appear at such a designated position in the polypeptide sequence Polynucleotides
  • Another aspect of the mvention relates to isolated polynucleotides. mcludmg the full length gene, that encode the recJ polypeptide havmg a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] and polynucleotides closely related thereto and vanants thereof Usmg the information provided herem, such as a polynucleotide sequence set out m Table 1
  • a polynucleotide of the mvention encodmg recJ polypeptide may be obtamed usmg standard cloning and screening methods, such as those for cloning and sequencmg chromosomal DNA fragments from bactena usmg Streptococcus pneumoniae 0100993 cells as starting matenal, followed by obtaining a full length clone
  • a polynucleotide sequence of the invention such as a sequence given m Table 1 [SEQ ID NO 1]
  • a library of clones of chromosomal DNA of Streptococcus pneumoniae 0100993 E coli or some other suitable host is probed with a radiolabeled ohgonucleotide, preferably a 17-mer or longer, derived from a partial sequence Clones carrying DNA identical to that of the probe can then be distinguished usmg strmgent conditions By sequencmg the individual clo
  • the DNA sequence set out m Table 1 [SEQ ID NO 1] contams an open reading frame encodmg a protem havmg about the number of ammo acid residues set forth m Table 1 [SEQ ID NO 2] with a deduced molecular weight that can be calculated usmg ammo acid residue molecular weight values well known m the art
  • RecJ of the mvention is structurally related to other proteins of the recJ (single-stranded- DNA specific exonuclease) family, as shown by the results of sequencmg the DNA encodmg recJ of the deposited stram See Swiss-prot, Accession number P45112 and Fleischmann et al , Science. 269 (5223). 496-512 (1995) Also see Ukita and Ikeda, J Bactenol. 178(8). 2362- 2367 (1996), Garzon et al , J Mol Gen Genet. 250(5). 570-580 (1996), and Lovett and Sutera et al , Genetics. 140(1). 27-45 (1995)
  • the invention provides a polynucleotide sequence identical over its entire length to a codmg sequence m Table 1 [SEQ ID NO 1] Also provided by the mvention is the codmg sequence for the mature polypeptide or a fragment thereof, by itself as well as the codmg sequence for the mature polypeptide or a fragment m reading frame with other codmg sequence, such as those encodmg a leader or secretory sequence, a pre-, or pro- or prepro- protem sequence
  • the polynucleotide may also contam non-coding sequences, mcludmg for example, but not limited to non-coding 5' and 3' sequences, such as the transcnbed, non-translated sequences, termmation signals, nbosome bmdmg sites, sequences that stabilize mRNA, mtrons, polyadenylation signals, and additional codmg sequence which encode additional ammo acids
  • a marker sequence that facilitates punfication of the fused polypeptide
  • a prefened embodiment of the mvention is a polynucleotide compnsmg nucleotide 1 to the nucleotide immediately upstream of or mcludmg nucleotide 2233 set forth SEQ ID NO 1 of Table 1 , both of which encode the rec J polypeptide
  • the mvention also mcludes polynucleotides of the formula
  • X-(R 1 ) m -(R 2 )-(R 3 ) n -Y wherein, at the 5' end of the molecule, X is hydrogen, and at the 3' end of the molecule, Y is hydrogen or a metal
  • Ri and R3 is any nucleic acid residue
  • m is an mteger between 1 and 3000 or zero
  • n is an mteger between 1 and 3000 or zero
  • R is a nucleic acid sequence of the mvention, particularly a nucleic acid sequence selected from Table 1 In the polynucleotide formula above R 2 is onented so that its 5' end residue is at the left, bound to R ⁇ and its 3' end residue is at the nght, bound to R3 Any stretch of nucleic acid residues denoted by either R group, where m and/or n is greater than 1, may be either a heteropolymer or a homopolymer, preferably a heteropolymer In a prefened
  • polynucleotides of the inventions are denved from Streptococcus pneumoniae, however, they may preferably be obtamed from organisms of the same taxonomic genus They may also be obtamed.
  • polynucleotide encodmg a polypeptide encompasses polynucleotides that mclude a sequence encodmg a polypeptide of the mvention, particularly a bactenal polypeptide and more particularly a polypeptide of the Streptococcus pneumoniae recJ havmg an ammo acid sequence set out m Table 1 [SEQ ID NO 2]
  • the term also encompasses polynucleotides that mclude a smgle contmuous region or discontinuous regions encodmg the polypeptide (for example, mterrupted by mtegrated phage or an insertion sequence or editmg) together with additional regions, that also may contam codmg and/or non-coding sequences
  • the mvention further relates to vanants of the polynucleotides descnbed herem that encode for vanants of the polypeptide havmg a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] Vanants that are fragments of the polynucleotides of the mvention may be used to synthesize fiill- length polynucleotides of the mvention
  • prefened embodiments are polynucleotides encoding recJ vanants, that have the ammo acid sequence of recJ polypeptide of Table 1 [SEQ ID NO 2] m which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no ammo acid residues are substituted, deleted or added, m any combination Especially prefened among these are silent substitutions, additions and deletions, that do not alter the properties and activities of recJ
  • polynucleotides that are at least 70% identical over their entire length to a polynucleotide encodmg recJ polypeptide havmg an ammo acid sequence set out m Table 1 [SEQ ID NO 2], and polynucleotides that are complementary to such polynucleotides
  • most highly prefened are polynucleotides that compnse a region that is at least 80% identical over its entire length to a polynucleotide encodmg recJ polypeptide of the deposited stram and polynucleotides complementary thereto hi this regard, polynucleotides at least 90% identical over their entire length to the same are particularly prefened, and among these particularly prefened polynucleotides, those with at least 95% are especially prefened Furthermore, those with at least 97% are highly prefened among those with at least 95%, and among these those with at least 98% and at least
  • the mvention further relates to polynucleotides that hybndize to the herem above-descnbed sequences
  • the mvention especially relates to polynucleotides that hybndize under stnngent conditions to the herem above-descnbed polynucleotides
  • strmgent conditions and “stnngent hybndization conditions” mean hybndization will occur only if there is at least 95% and preferably at least 97% identity between the sequences
  • strmgent hybndization conditions is overnight mcubation at 42°C m a solution comprising 50% formamide, 5x SSC (150mM NaCl, 15mM tnsodium citrate), 50 mM sodium phosphate (pH7 6), 5x Denhardt's solution, 10% dextran sulfate, and 20 micrograms/ml denatured, sheared salmon sperm
  • polynucleotide assays of the mvention may be used as a hybndization probe for RNA, cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encodmg recJ and to isolate cDNA and genomic clones of other genes that have a high sequence similanty to the recJ gene
  • probes generally will compnse at least 15 bases
  • probes will have at least 30 bases and may have at least 50 bases
  • Particularly prefened probes will have at least 30 bases and will have 50 bases or less
  • the codmg region of the recJ gene may be isolated by screening usmg a DNA sequence provided m Table 1 [SEQ ID NO 1] to synthesize an ohgonucleotide probe A labeled ohgonucleotide havmg a sequence complementary to that of a gene of the mvention is then used to screen a library of cDNA, genomic DNA or mRNA to determine which members of the library the probe hybndizes to
  • polynucleotides and polypeptides of the mvention may be employed, for example, as research reagents and matenals for discovery of treatments of and diagnostics for disease, particularly human disease, as further discussed herem relatmg to polynucleotide assays
  • Polynucleotides of the mvention that are oligonucleotides derived from the sequences of Table 1 [SEQ ID NOS 1 or 2] may be used in the processes herein as descnbed, but preferably for PCR, to determine whether or not the polynucleotides identified herein in whole or in part are transcnbed m bactena in infected tissue It is recognized that such sequences will also have utility m diagnosis of the stage of mfection and type of mfection the pathogen has attained
  • the mvention also provides polynucleotides that may encode a polypeptide that is the mature protem plus additional ammo or carboxyl-termmal ammo acids, or ammo acids mtenor to the mature polypeptide (when the mature form has more than one polypeptide chain, for instance)
  • Such sequences may play a role m processmg of a protem from precursor to a mature form, may allow protem transport, may lengthen or shorten protem half-life or may facilitate manipulation of a protem for assay or production, among other things
  • the additional ammo acids may be processed away from the mature protem by cellular enzymes
  • a precursor protem, havmg the mature form of the polypeptide fused to one or more prosequences may be an mactive form of the polypeptide When prosequences are removed such inactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called proproteins
  • N may also be used m descnbmg certain polynucleotides of the invention "N" means that any of the four DNA or RNA bases may appear at such a designated position in the DNA or RNA sequence, except it is preferred that N is not a base that when taken m combination with adjacent nucleotide positions, when read m the correct reading frame, would have the effect of generatmg a premature termmation codon m such readmg frame
  • a polynucleotide of the mvention may encode a mature protein, a mature protem plus a leader sequence (which may be refened to as a preprotem), a precursor of a mature protem havmg one or more prosequences that are not the leader sequences of a preprotem, or a preproprotein, which is a precursor to a proprotein, havmg a leader sequence and one or more prosequences, which generally are removed dunng processmg steps that produce active and mature forms of the polypeptide Vectors, host cells, expression
  • the mvention also relates to vectors that compnse a polynucleotide or polynucleotides of the mvention, host cells that are genetically engmeered with vectors of the mvention and the production of polypeptides of the mvention by recombinant techniques
  • Cell-free translation systems can also be employed to produce such proteins usmg RNAs denved from the DNA constructs of the mvention
  • host cells can be genetically engmeered to incorporate expression systems or portions thereof or polynucleotides of the mvention
  • Introduction of a polynucleotide mto the host cell can be effected by methods descnbed m many standard laboratory manuals, such as Davis et al, BASIC METHODS IN MOLECULAR BIOLOGY, (1986) and Sambrook et al , MOLECULAR CLONING A LABORATORY MANUAL, 2nd Ed , Cold Sprmg Harbor Laboratory Press, Cold Sprmg Harbor,
  • appropnate hosts include bactenal cells, such as streptococci, staphylococci, enterococci E cob, streptomyces and Bacillus subtihs cells, fungal cells, such as yeast cells and Aspergillus cells, insect cells such as Drosophila S2 and Spodoptera Sf9 cells, animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells, and plant cells
  • bactenal cells such as streptococci, staphylococci, enterococci E cob, streptomyces and Bacillus subtihs cells
  • fungal cells such as yeast cells and Aspergillus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells
  • vectors include, among others, chromosomal, episomal and virus-denved vectors, e g , vectors denved from bactenal plasmids, from bactenophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors denved from combinations thereof, such as those denved from plasmid and bactenophage genetic elements, such as cosmids and phagemids
  • the expression system constructs may contam control regions that regulate as well as engender expression Generally, any system or vector suitable to maintain, propagate or express polynucleotides and/or to express a polypeptide m a
  • appropnate secretion signals may be incorporated mto the expressed polypeptide These signals may be endogenous to the polypeptide or they may be heterologous signals
  • Polypeptides of the mvention can be recovered and punfied from recombinant cell cultures by well-known methods mcludmg ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic mteraction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography
  • high performance liquid chromatography is employed for punfication
  • Well known techmques for refoldmg protem may be employed to regenerate active conformation when the polypeptide is denatured dunng isolation and or punfication Diagnostic Assays
  • This mvention is also related to the use of the recJ polynucleotides of the mvention for use as diagnostic reagents Detection of recJ m a eukaryote, particularly a mammal, and especially a human, will provide a diagnostic method for diagnosis of a disease Eukaryotes (herem also "md ⁇ v ⁇ dual(s)"), particularly mammals, and especially humans, particularly those mfected or suspected to be infected with an organism compnsmg the recJ gene may be detected at the nucleic acid level by a vanety of techniques
  • Nucleic acids for diagnosis may be obtamed from an infected individual's cells and tissues, such as bone, blood, muscle, cartilage, and skin
  • Genomic DNA may be used directly for detection or may be amplified enzymatically by usmg PCR or other amplification technique pnor to analysis RNA, cDNA and genomic DNA may also be used m the same ways Usmg amplification, characterization of the species and stram of prokaryote present m an mdividual, may be made by an analysis of the genotype of the prokaryote gene
  • Deletions and insertions can be detected by a change in size of the amphfied product m companson to the genotype of a reference sequence
  • Pomt mutations can be identified by hybndizmg amplified DNA to labeled recJ polynucleotide sequences Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences m
  • RT-PCR can be used to detect mutations It is particularly prefened to used RT-PCR m conjunction with automated detection systems, such as, for example, GeneScan RNA, cDNA or genomic DNA may also be used for the same purpose, PCR or RT-PCR
  • PCR primers complementary to a nucleic acid encodmg recJ can be used to identify and analyze mutations Examples of representative primers are shown below m Table 2
  • R 1 X-(R 1 ) m -(R 2 )-(R 3 ) n -Y
  • X is hydrogen
  • Y is hydrogen or a metal
  • Rj and R3 is any nucleic acid residue
  • m is an mteger between 1 and 20 or zero
  • n is an mteger between 1 and 20 or zero
  • R is a primer sequence of the mvention, particularly a primer sequence selected from Table 2
  • R 2 is onented so that its 5' end residue is at the left, bound to R j and its 3' end residue is at the nght, bound to R3
  • Any stretch of nucleic acid residues denoted by either R group, where m and/or n is greater than 1, may be either a heteropolymer or a homopolymer, preferably a heteropolymer bemg complementary to a region of a polynucle
  • the mvention further provides these primers with 1, 2, 3 or 4 nucleotides removed from the 5' and/or the 3' end
  • These primers may be used for, among other things, amplifying recJ DNA isolated from a sample denved from an mdividual
  • the primers may be used to amplify the gene isolated from an infected mdividual such that the gene may then be subject to vanous techmques for elucidation of the DNA sequence In this way, mutations m the DNA sequence may be detected and used to diagnose infection and to serotype and/or classify the infectious agent
  • the mvention further provides a process for diagnosing, disease, preferably bactenal infections, more preferably infections by Streptococcus pneumoniae, comprising determining from a sample derived from an individual a mcreased level of expression of polynucleotide having a sequence of Table 1 [SEQ ID NO 1] Increased or decreased expression of recJ polynucleotide can be measured usmg any on of the methods well known m the art for the quantation of polynucleotides, such as, for example, amplification, PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods
  • a diagnostic assay m accordance with the mvention for detectmg over- expression of recJ protem compared to normal control tissue samples may be used to detect the presence of an infection, for example Assay techmques that can be used to determine levels of a recJ protem, m a sample denved from a host are well-known to those of skill m the art
  • Assay techmques that can be used to determine levels of a recJ protem, m a sample denved from a host are well-known to those of skill m the art
  • Such assay methods mclude radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays Antibodies
  • the polypeptides of the mvention or vanants thereof, or cells expressmg them can be used as an immunogen to produce antibodies lmmunospecific for such polypeptides
  • Antibodies as used herem mcludes monoclonal and polyclonal antibodies, chimenc, smgle chain, simiamzed antibodies and humanized antibodies, as well as Fab fragments, mcludmg the products of an Fab lmmunolglobulm expression library
  • Antibodies generated against the polypeptides of the mvention can be obtamed by administering the polypeptides or epitope-bearmg fragments, analogues or cells to an ammal, preferably a nonhuman, usmg routme protocols
  • an ammal preferably a nonhuman, usmg routme protocols
  • any technique known m the art that provides antibodies produced by contmuous cell line cultures can be used Examples mclude vanous techmques, such as those m Kohler, G and Milstem, C , Nature 256 495-497 (1975), Kozbor et al , Immunology Today 4 72 (1983), Cole et al , pg 77-96 m MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R Liss, Inc (1985)
  • phage display technology may be utilized to select antibody genes with bmdmg activities towards the polypeptide either from repertoires of PCR amphfied v-genes of lymphocytes from humans screened for possessing anti-recJ or from naive hbranes (McCafferty, J et al , (1990), Nature 348, 552-554, Marks, J et al , (1992) Biotechnology 10, 779-783)
  • the affinity of these antibodies can also be improved by chain shuffling (Clackson, T et al , (1991) Nature 352, 624-628) If two antigen bmdmg domains are present each domain may be directed against a different epitope - termed 'bispecific' antibodies
  • the above-descnbed antibodies may be employed to isolate or to identify clones expressmg the polypeptides to purify the polypeptides by affinity chromatography
  • antibodies against recJ- polypeptide may be employed to treat infections, particularly bactenal infections
  • polypeptide variants mclude antigenically, epitopically or lmmunologically equivalent vanants that form a particular aspect of this mvention
  • antigenically equivalent derivative encompasses a polypeptide or its equivalent which will be specifically recognized by certain antibodies which, when raised to the protem or polypeptide accordmg to the mvention, mterfere with the immediate physical interaction between pathogen and mammalian host
  • immunologically equivalent derivative encompasses a peptide or its equivalent which when used in a suitable formulation to raise antibodies m a vertebrate, the antibodies act to interfere with the immediate physical mteraction between pathogen and mammalian host
  • the polypeptide such as an antigenically or lmmunologically equivalent derivative or a fusion protem thereof is used as an antigen to immunize a mouse or other animal such as a rat or chicken
  • the fusion protem may provide stability to the polypeptide
  • the antigen may be associated, for example by conjugation, with an lmmunogenic carrier protein for example bovme serum albumin (BSA) or keyhole limpet haemocyanin (KLH)
  • BSA bovme serum albumin
  • KLH keyhole limpet haemocyanin
  • a multiple antigenic peptide compnsmg multiple copies of the protein or polypeptide, or an antigenically or lmmunologically equivalent polypeptide thereof may be sufficiently antigenic to improve lmmunogemcity so as to obviate the use of a carrier
  • the antibody or variant thereof is modified to make it less lmmunogenic in the mdividual
  • the antibody may most preferably be "humanized", where the compl mentarity determinmg reg ⁇ on(s) of the hybndoma-de ⁇ ved antibody has been transplanted mto a human monoclonal antibody , for example as described in Jones, P et al (1986), Nature 321, 522-525 or Tempest et al , (1991) Biotechnology 9, 266-273
  • a polynucleotide of the invention m genetic immunization will preferably employ a suitable deliver ⁇ ' method such as direct injection of plasmid DNA mto muscles (Wolff et al , Hum Mol Genet 1992, 1 363, Manthorpe et al , Hum Gene Ther 1963 4, 419), delivery of DNA complexed with specific protem carriers (Wu et al , J Biol Chem 1989 264.16985), coprecipitation of DNA with calcium phosphate (Benvenisty & Reshef, PNAS USA, 1986 83,9551), encapsulation of DNA in various forms of hposomes (Kaneda et al , Science 1989 243,375), particle bombardment (Tang et al , Nature 1992, 356 152, Eisenbraun et al , DNA Cell Biol 1993, 12 791) and in vivo mfection usmg cloned retroviral vectors (Seeger et al , direct
  • Polypeptides of the mvention may also be used to assess the bmdmg of small molecule substrates and hgands m, for example, cells, cell-free preparations, chemical libranes, and natural product mixtures
  • substrates and hgands may be natural substrates and hgands or may be structural or functional mimetics See, e g , Cohgan et al , Current Protocols in Immunology 1(2) Chapter 5 (1991)
  • the mvention also provides a method of screening compounds to identify those which enhance (agonist) or block (antagomst) the action of recJ polypeptides or polynucleotides, particularly those compounds that are bactenostatic and/or bactenocidal
  • the method of screening may mvolve high-throughput techmques For example, to screen for agonists or antagoists, a synthetic reaction mix, a cellular compartment, such as a membrane, cell envelope or cell wall, or a preparation of any thereof
  • an assay for recJ antagomsts is a competitive assay that combmes recJ and a potential antagomst with recJ-bmdmg molecules, recombinant recJ bmdmg molecules, natural substrates or hgands, or substrate or gand mimetics.
  • RecJ can be labeled, such as by radioactivity or a colonmetnc compound, such that the number of recJ molecules bound to a bmdmg molecule or converted to product can be determmed accurately to assess the effectiveness of the potential antagomst
  • Potential antagomsts mclude small orgamc molecules, peptides, polypeptides and antibodies that bmd to a polynucleotide or polypeptide of the mvention and thereby inhibit or extinguish its activity
  • Potential antagomsts also may be small orgamc molecules, a peptide, a polypeptide such as a closely related protem or antibody that bmds the same sites on a bmdmg molecule, such as a bmdmg molecule, without mducmg recJ-mduced activities, thereby preventmg the action of recJ by excluding recJ from bmdmg
  • Potential antagomsts m clude a small molecule that bmds to and occupies the bmdmg site of the polypeptide thereby preventmg bmdmg to cellular bmdmg molecules, such that normal biological activity is prevented
  • small molecules include but are not limited to small orgamc molecules, peptides or peptide-like molecules
  • Other potential antagomsts m clude antisense molecules (see Okano, J Neurochem 56 560 (1991), OI1GODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Press, Boca Raton, FL (1988), for a descnption of these molecules)
  • Prefened potential antagomsts m include compounds related to and vanants of red
  • Each of the DNA sequences provided herein may be used m the discovery and development of antibacterial compounds
  • the encoded protem, upon expression, can be used as a target for the screening
  • the mvention also provides the use of the polypeptide, polynucleotide or inhibitor of the invention to mterfere with the initial physical mteraction between a pathogen and mammalian host responsible for sequelae of infection
  • the molecules of the invention may be used m the prevention of adhesion of bacteria, in particular gram positive bacteria, to mammalian extracellular matrix proteins on m-dwelhng devices or to extracellular matrix protems in wounds, to block red protein-mediated mammalian cell invasion by, for example, initiating phosphorylation of mammalian tyrosme kmases (Rosenshme et al , Infect lmmun 60 2211 (1992), to block bacterial adhesion between mammalian extracellular matrix proteins and bacterial recJ proteins that mediate tissue damage and, to block the normal progression of pathogenesis in infections initiated other than by the implantation of m-dwelhng devices or by other surgical techmques
  • the antagomsts and agonists of the mvention may be employed, for instance, to inhibit and treat diseases
  • Hehcobacter pylori herem H pylori
  • bactena infect the stomachs of over one-third of the world's population causmg stomach cancer, ulcers, and gastritis
  • International Agency for Research on Cancer (1994) Schistosomes, Liver Flukes and Hehcobacter Pylon International Agency for Research on Cancer, Lyon, France, http //www uicc ch/ecp/ecp2904 htm
  • the mtemational Agency for Research on Cancer recently recognized a cause-and- effect relationship between H pylori and gastric adenocarcmoma, classifying the bactenum as a Group I (defimte) carcmogen
  • Preferred antimicrobial compounds of the mvention found usmg screens provided by the invention, particularly broad- spectrum antibiotics, should be useful in the treatment of H pylori infection Such treatment should decrease the advent of H pylori -induced cancers, such
  • Another aspect of the invention relates to a method for mducmg an immunological response in an individual, particularly a mammal which compnses inoculating the mdividual with recJ, or a fragment or vanant thereof, adequate to produce antibody and/ or T cell immune response to protect said mdividual from mfection, particularly bactenal infection and most particularly Streptococcus pneumoniae mfection Also provided are methods whereby such immunological response slows bacterial replication
  • Yet another aspect of the mvention relates to a method of mducmg immunological response in an individual which comprises dehvermg to such mdividual a nucleic acid vector to direct expression of recJ, or a fragment or a variant thereof, for expressmg recJ, or a fragment or a vanant thereof in vivo in order to mduce an immunological response, such as, to produce antibody and/ or T cell immune response, mcludmg, for example, cytokine-producing T cells or cytotoxic
  • a further aspect of the mvention relates to an immunological composition which, when introduced mto an individual capable or having induced withm it an immunological response, mduces an immunological response m such mdividual to a recJ or protein coded therefrom wherein the composition comprises a recombinant recJ or protein coded therefrom compnsmg DNA which codes for and expresses an antigen of said recJ or protem coded therefrom
  • the immunological response may be used therapeutically or prophylactically and may take the form of antibody immunity or cellular immunity such as that ansmg from CTL or CD4+ T cells
  • a recJ polypeptide or a fragment thereof may be fused with co-protem which may not by itself produce antibodies, but is capable of stabilizing the first protem and producmg a fused protein which will have lmmunogenic and protective properties
  • fused recombinant protem preferably further comprises an antigenic co-protem, such as hpoprotem D from Hemophilus influenzae, Glutathione-S-transferase (GST) or beta-galactosidase, relatively large co-proteins which solubihze the protein and facilitate production and purification thereof
  • the co-protem may act as an adjuvant m the sense of providing a generalized stimulation of the immune system
  • the co-protein may be attached to either the ammo or carboxy terminus of the first protem
  • compositions particularly vaccme compositions, and methods compnsmg the polypeptides or polynucleotides of the mvention and lmmunostimulatory DNA sequences, such as those described in Sato, Y et al Science 273 352 (1996)
  • this mvention provides methods usmg the descnbed polynucleotide or particular fragments thereof which have been shown to encode non-variable regions of bacterial cell surface protems m DNA constructs used in such genetic immunization experiments m ammal models of infection with Streptococcus pneumoniae will be particularly useful for identifying protem epitopes able to provoke a prophylactic or therapeutic immune response It is believed that this approach will allow for the subsequent preparation of monoclonal antibodies of particular value from the requisite organ of the animal successfully resisting or clearing infection for the development of prophylactic agents or therapeutic treatments of bactenal infection, particularly Streptococcus pneumoniae mfection, m mammals, particularly humans
  • the polypeptide may be used as an antigen for vaccination of a host to produce specific antibodies which protect agamst invasion of bacteria, for example by blocking adherence of bactena to damaged tissue
  • tissue damage include wounds m skin or connective tissue caused, e g , by mechanical, chemical or thermal damage or by implantation of indwelling devices, or wounds m the mucous membranes, such as the mouth, mammary glands, urethra or vagma
  • the mvention also mcludes a vaccme formulation which compnses an lmmunogenic recombinant protem of the mvention together with a suitable earner Smce the protem may be broken down m the stomach, it is preferably administered parenterally, mcludmg, for example, administration that is subcutaneous, intramuscular, intravenous, or intradermal
  • Formulations suitable for parenteral administration mclude aqueous and non-aqueous stenle injection solutions which may contam anti-oxidants, buffers, bacte ⁇ ostats and solutes which render the formulation msotomc with the bodily fluid, preferably the blood, of the mdividual, and aqueous and non-aqueous stenle suspensions which may mclude suspending agents or thickemng agents
  • the formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials and may be stored in a freeze-dned condition
  • compositions, kits and administration The mvention also relates to compositions compnsmg the polynucleotide or the polypeptides discussed above or their agonists or antagomsts
  • the polypeptides of the mvention may be employed m combination with a non-sterile or stenle earner or earners for use with cells, tissues or orgamsms, such as a pharmaceutical earner suitable for administration to a subject
  • Such compositions compnse for instance, a media additive or a therapeutically effective amount of a polypeptide of the mvention and a pharmaceutically acceptable earner or excipient
  • Such earners may mclude, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof
  • the formulation should suit the mode of administration
  • the mvention further relates to diagnostic and pharmaceutical packs and kits compnsmg one or more containers filled with one or more of the ingredients of the aforementioned compositions
  • compositions may be admimstered m any effective, convenient manner mcludmg, for instance, administration by topical, oral, anal, vaginal, intravenous, mtrapentoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others
  • the active agent may be administered to an individual as an mjectable composition, for example as a sterile aqueous dispersion, preferably isotonic
  • compositions may be formulated for topical application for example in the form of omtments, creams, lotions, eye ointments, eye drops, ear drops, mouthwash, impregnated dressings and sutures and aerosols, and may contam appropriate conventional additives, mcludmg, for example, preservatives, solvents to assist drug penetration, and emollients m omtments and creams
  • topical formulations may also contain compatible conventional carriers, for example cream or omtment bases, and ethanol or oleyl alcohol for lotions
  • Such earners may constitute from about 1% to about 98% by weight of the formulation, more usually they will constitute up to about 80% by weight of the formulation
  • the daily dosage level of the active agent will be from 0 01 mg/kg to 10 mg/kg, typically around 1 mg/kg
  • the physician m any event will determine the actual dosage which will be most suitable for an mdividual and will vary with the age, weight and response of the particular mdividual
  • the above dosages are exemplary of the average case
  • In-dwellmg devices mclude surgical implants, prosthetic devices and catheters, I e , devices that are mtroduced to the body of an mdividual and remam m position for an extended time
  • Such devices mclude, for example, artificial jomts, heart valves, pacemakers, vascular grafts, vascular catheters, cerebrospinal fluid shunts, urinary catheters, continuous ambulatory peritoneal dialysis (CAPD) catheters
  • composition of the invention may be administered by injection to achieve a systemic effect agamst relevant bacteria shortly before insertion of an in-dwelhng device Treatment may be continued after surgery during the m-body time of the device
  • composition could also be used to broaden pe ⁇ operative cover for any surgical technique to prevent bacterial wound infections, especially Streptococcus pneumoniae wound infections
  • compositions of this mvention may be used generally as a wound treatment agent to prevent adhesion of bactena to matnx protems exposed in wound tissue and for prophylactic use in dental treatment as an alternative to, or in conjunction with, antibiotic prophylaxis
  • the composition of the mvention may be used to bathe an indwelling device immediately before insertion
  • the active agent will preferably be present at a concentration of 1 ⁇ g/ml to lOmg/ml for bathing of wounds or indwelling devices
  • a vaccme composition is conveniently in mjectable form Conventional adjuvant
  • D ⁇ sease(s) means and disease caused by or related to infection by a bactena, mcludmg otitis media, conjunctivitis, pneumoma, bacteremia, menmgitis, smusitis, pleural empyema and endocarditis, and most particularly menmgitis, such as for example infection of cerebrospinal fluid
  • “Host cell” is a cell which has been transformed or transfected, or is capable of transformation or transfection by an exogenous polynucleotide sequence
  • Identity is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as the case may be, as determmed by companng the sequences
  • identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strmgs of such sequences
  • Identity can be readily calculated by known methods, mcludmg but not limited to those descnbed m (Computational Molecular Biology, Lesk, A M , ed , Oxford Umversity Press, New York, 1988, Biocomputing Informatics and Genome Projects, Smith, D W , ed , Academic Press, New York, 1993, Computer Analysis of Sequence Data, Part I, Griffin, A M , and Griffin.
  • Polynucleotide embodiments further include an isolated polynucleotide compnsmg a polynucleotide sequence havmg at least a 50, 60, 70, 80, 85, 90, 95, 97 or 100% identity to the reference sequence of SEQ ID NO 1 , wherein said polynucleotide sequence may be identical to the reference sequence of SEQ ID NO 1 or may include up to a certain mteger number of nucleotide alterations as compared to the reference sequence, wherem said alterations are selected from the group consistmg of at least one nucleotide deletion, substitution, mcludmg transition and transversion.
  • alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides m the reference sequence or in one or more contiguous groups withm the reference sequence, and wherein said number of nucleotide alterations is determmed by multiplying the total number of nucleotides m SEQ ID NO 1 by the mteger defining the percent identity divided by 100 and then subtractmg that product from said total number of nucleotides m SEQ ID NO 1, or
  • n n is the number of nucleotide alterations
  • x n is the total number of nucleotides m SEQ ID NO 1
  • y is 0 50 for 50%, 0 60 for 60%, 0 70 for 70%, 0 80 for 80%, 0 85 for 85%, 0 90 for 90%, 0 95 for 95%, 0 97 for 97% or 1 00 for 100%
  • • is the symbol for the multiplication operator
  • any non-mteger product of x n and y is rounded down to the nearest mteger pnor to subtractmg it from x n
  • Alterations of a polynucleotide sequence encoding the polypeptide of SEQ ID NO 2 may create nonsense, nussense or frameshift mutations m this codmg sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations
  • a polynucleotide sequence of the present invention may be identical to the reference sequence of SEQ ID NO 1, that is it may be 100% identical, or it may include up to a certain mteger number of nucleic acid alterations as compared to the reference sequence such that the percent identity is less than 100% identity
  • Such alterations are selected from the group consistmg of at least one nucleic acid deletion, substitution, mcludmg transition and transversion, or insertion, and wherem said alterations may occur at the 5' or 3' terminal positions of the reference polynucleotide sequence or anywhere between those terminal positions, mterspersed either individually among the nucleic acids m the reference sequence or m one or more contiguous groups withm the reference sequence
  • the number of nucleic acid alterations for a given percent identity is determmed by multiplying the total number of nucleic acids in SEQ ID NO 1 by the integer defining the percent identity divided by 100 and then subtractmg that product from said total number of nucleic acids m SEQ ID NO 1,
  • Polypeptide embodiments further mclude an isolated polypeptide compnsmg a polypeptide havmg at least a 50,60, 70, 80, 85, 90, 95, 97 or 100% identity to a polypeptide reference sequence of SEQ ID NO 2, wherem said polypeptide sequence may be identical to the reference sequence of SEQ ID NO 2 or may mclude up to a certain mteger number of ammo acid alterations as compared to the reference sequence,
  • n a is the number of ammo acid alterations
  • x a is the total number of ammo acids m SEQ ID NO 2
  • y is 0 50 for 50%, 0 60 for 60%, 0 70 for 70%, 0 80 for 80%, 0 85 for 85%, 0 90 for 90%, 0 95 for 95%, 0 97 for 97% or 1 00 for 100%
  • • is the symbol for the multiplication operator, and wherem any non-mteger product of x a and y is rounded down to the nearest mteger pnor to subtractmg it from x a
  • a polypeptide sequence of the present invention may be identical to the reference sequence of SEQ ID NO 2, that is it may be 100% identical, or it may mclude up to a certain mteger number of ammo acid alterations as compared to the reference sequence such that the percent identity is less than 100% identity
  • Such alterations are selected from the group consisting of at least one ammo acid deletion, substitution, including conservative and non- conservative substitution, or insertion, and wherem said alterations may occur at the ammo- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the ammo acids in the reference sequence or m one or more contiguous groups withm the reference sequence
  • the number of ammo acid alterations for a given % identity is determmed by multiplying the total number of ammo acids in SEQ ID NO 2 by the mteger defining the percent identity divided by 100 and then subtractmg that product from said total number of ammo acids in SEQ ID NO 2, or
  • n a is the number of ammo acid alterations
  • x a is the total number of amino acids m SEQ ID NO 2
  • y is, for instance 0 70 for 70%, 0 80 for 80%, 0 85 for 85% etc
  • • is the symbol for the multiplication operator, and wherem any non-mteger product of x a and y is rounded down to the nearest mteger pnor to subtractmg it from x a
  • Isolated means altered “by the hand of man” from its natural state, l e , if it occurs m nature, it has been changed or removed from its onginal environment, or both
  • a polynucleotide or a polypeptide naturally present m a living organism is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting matenals of its natural state is “isolated", as the term is employed herem
  • Polynucleotide(s) generally refers to any polynbonucleotide or polydeoxnbonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA
  • Polynucleotide(s)” mclude, without limitation, smgle- and double-stranded DNA, DNA that is a mixture of smgle- and double- stranded regions or single-, double- and tnple-stranded regions, smgle- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybnd molecules compnsmg DNA and RNA that may be single-stranded or, more typically, double-stranded, or tnple-stranded regions, or a mixture of smgle- and double-stranded regions
  • polynucleotide as used herem refers to tnple-stranded regions compnsmg RNA or
  • Polypeptide(s) refers to any peptide or protem compnsmg two or more ammo acids jomed to each other by peptide bonds or modified peptide bonds
  • Polypeptide(s) refers to both short chains, commonly refened to as peptides, oligopeptides and o gomers and to longer chains generally refened to as proteins
  • Polypeptides may contam ammo acids other than the 20 gene encoded ammo acids
  • Polypeptide(s)” mclude those modified either by natural processes, such as processmg and other post-translational modifications, but also by chemical modification techmques Such modifications are well descnbed m basic texts and m more detailed monographs, as well as m a voluminous research literature, and they are well known to those of skill m the art It will be appreciated that the same type of modification may be present m the same or varying degree at several sites m a given polypeptide Also, a given polypeptide may contam many types of modifications Modifications
  • covalent attachment of flavin covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide denvative, covalent attachment of a hpid or hpid denvative, covalent attachment of phosphotidyhnositol, cross-linking, cychzation, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteme, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, lodination, methylation, mynstoylation, oxidation, proteolytic processmg, phosphorylation, prenylation, racemization, glycosylation, pid attachment, sulfation, gamma- carboxylation of glutamic acid residues, hydroxylation and ADP-nbosylation, selenoylation.
  • Polypeptides may be branched or cyclic, with or without branching Cychc, branched and branched circular polypeptides may result from post-translational natural processes and
  • 'Nanant(s) is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties
  • a typical vanant of a polynucleotide differs m nucleotide sequence from another, reference polynucleotide Changes m the nucleotide sequence of the vanant may or may not alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Nucleotide changes may result m ammo acid substitutions, additions, deletions, fusions and truncations m the polypeptide encoded by the reference sequence, as discussed below
  • a typical vanant of a polypeptide differs m ammo acid sequence from another, reference polypeptide Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical A vanant and reference polypeptide may differ in ammo acid
  • the polynucleotide havmg a DNA sequence given m Table 1 [SEQ ID NO 1] was obtained from a library of clones of chromosomal DNA of Streptococcus pneumoniae in E cob
  • the sequencmg data from two or more clones contaimng overlapping Streptococcus pneumoniae DNAs was used to construct the contiguous DNA sequence m SEQ ID NO 1 Libraries may be prepared by routme methods, for example Methods 1 and 2 below
  • Total cellular DNA is mechanically sheared by passage through a needle m order to size-fractionate accordmg to standard procedures
  • DNA fragments of up to 1 lkbp m size are rendered blunt by treatment with exonuclease and DNA polymerase, and EcoRI linkers added Fragments are hgated mto the vector Lambda ZapII that has been cut with EcoRI, the library packaged by standard procedures and E coli infected with the packaged library
  • the library is amplified by standard procedures Method 2
  • Total cellular DNA is partially hydrolyzed with a one or a combination of restnction enzymes appropriate to generate a senes of fragments for cloning mto library vectors (e g , Rsal, Pall, Alul, Bshl235I), and such fragments are size-fractionated accordmg to standard procedures EcoRI linkers are hgated to the DNA and the fragments then hgated mto the vector Lambda ZapII that have been cut with EcoRI, the library packaged by standard procedures, and E coli infected with the packaged library The library is amphfied by standard procedures Example 2
  • RNAase free, DNAase free, DNA and protein free preparations of RNA obtained are suitable for Reverse Transcription PCR (RT-PCR) using unique primer pairs designed from the sequence of each gene of Streptococcus pneumoniae 0100993 a) Isolation of tissue infected with Streptococcus pneumoniae 0100993 from a mouse animal model of infection (lungs).
  • RT-PCR Reverse Transcription PCR
  • Streptococcus pneumoniae 0100993 is grown either on TSA/5%horse blood plates or m AGCH medium overnight, 37°C, 5%C0 2 Bactena are then collected and resuspended m phosphate-buffered saline to an A ⁇ oo of approximately 0 4 Mice are anaesthetized with isofluorane and 50ml of bacterial suspension (approximately 2 x 10 5 bactena) is admimstered lntranasally usmg a pipetman Mice are allowed to recover and have food and water ad libitum After 48 hours, the mice are euthanized by carbon dioxide overdose, and lungs are aseptically removed and snap-frozen in liquid nitrogen b) Isolation of Streptococcus pneumoniae 0100993 RNA from infected tissue samples.
  • RNA preparation is extracted with chloroform/isoamyl alcohol, and precipitated with DEPC-treated/Isopropanol Precipitation Solution (BIO101) RNA preparation
  • RNA preparations are stored at -80 °C for up to one month
  • the RNA precipitate can be stored at the wash stage of the protocol in 75% ethanol for at least one year at -20 °C
  • RNA isolation Quality of the RNA isolated is assessed by running samples on 1 % agarose gels 1 x TBE gels stained with ethtdium bromide are used to visualise total RNA yields To demonstrate the isolation of bactenal RNA from the infected tissue 1 x MOPS.
  • DNAase was inactivated and removed by treatment with TRIzol LS Reagent (Gibco BRL, Life Technologies) accordmg to the manufacturers protocol DNAase treated RNA was resuspended m 100 microhtres of DEPC treated water with the addition of Rnasin as descnbed before d)
  • TRIzol LS Reagent Gibco BRL, Life Technologies
  • DNAase treated RNA was resuspended m 100 microhtres of DEPC treated water with the addition of Rnasin as descnbed before d
  • the preparation of cDNA from RNA samples derived from infected tissue. 3 microgram samples of DNAase treated RNA are reverse transcribed using a SuperScnpt Preamphfication System for First Strand cDNA Synthesis kit (Gibco BRL.
  • PCR Master Mix (Advanced Biotechnologies Ltd ), 1 microhtre PCR primers (optimally 18-25 basepairs in length and designed to possess similar annealing temperatures), each primer at 10 mM initial concentration, and 5 microhtres cDNA
  • PCR reactions are run on a Perkm Elmer GeneAmp PCR System 9600 as follows 2 minutes at 94 °C, then 50 cycles of 30 seconds each at 94 °C, 50 °C and 72 °C followed by 7 minutes at 72 °C and then a hold temperature of 20 °C (the number of cycles is optimally 30-50 to determine the appearance or lack of a PCR product and optimally 8-30 cycles if an estimation of the starting quantity of cDNA from the RT reaction is to be made), 10 microhtre ahquots are then run out on 1% 1 x TBE gels stamed with ethidium bromide, with PCR product, if present, sizes estimated by comparison to a 100 bp DNA Ladder (Gibco BRL, Life Technologies) Alternatively if the PCR products are conveniently labelled by the use of a labelled PCR primer (e g labelled at the 5'end with a dye) a suitable aliquot of the PCR product is run out on a polyacrylamide seque
  • RT PCR controls may mclude +/- reverse transc ⁇ ptase reactions, 16S rRNA primers or DNA specific primer pairs designed to produce PCR products from non-transcribed Streptococcus pneumoniae 0100993 genomic sequences
  • RT/PCR are PCR failures and as such are umnformative Of those which give the correct size product with DNA PCR two classes are distinguished m RT/PCR (1) Genes which are not transcnbed in vivo reproducibly fail to give a product in RT/PCR, and (2) Genes which are transcribed in vivo reproducibly give the correct size product m RT/PCR and show a stronger signal in the +RT samples than the signal (if at all present) in -RT controls

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Peptides Or Proteins (AREA)
  • Pulmonology (AREA)
  • Communicable Diseases (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides recJ polypeptides and polynucleotides encoding recJ polypeptides and methods for producing such polypeptides by recombinant techniques. Also provided are methods for utilizing recJ polypeptides to screen for antibacterial compounds.

Description

NOVEL recJ
RELATED APPLICATIONS
This application claims benefit of US Provisional Patent Application Number 60/066,999 filed November 20, 1997
FIELD OF THE INVENTION
This invention relates to newly identified polynucleotides and polypeptides, and their production and uses, as well as their vanants, agonists and antagonists, and their uses In particular, the invention relates to novel polynucleotides and polypeptides of the recJ (single-stranded-DNA specific exonuclease) family, hereinafter referred to as "recJ"
BACKGROUND OF THE INVENTION
The Streptococci make up a medically important genera of microbes known to cause several types of disease in humans, including, for example, otitis media, conjunctivitis, pneumonia, bacteremia, meningitis, sinusitis, pleural empyema and endocarditis, and most particularly meningitis, such as for example infection of cerebrospinal fluid Since its isolation more than 100 years ago, Streptococcus pneumoniae has been one of the more intensively studied microbes For example, much of our early understanding that DNA is, in fact, the genetic matenal was predicated on the work of Griffith and of Avery, Macleod and McCarty using this microbe Despite the vast amount of research with S pneumoniae, many questions concerning the virulence of this microbe remain It is particularly preferred to employ Streptococcal genes and gene products as targets for the development of antibiotics
While certain Streptococcal factors associated with pathogenicity have been identified, e g , capsule polysaccharides, peptidoglycans. pneumolysms, PspA Complement actor H binding component, autolysm, neuraminidase, peptide permeases, hydrogen peroxide, IgAl protease, the list is certainly not complete Moreover, very little is known concerning the temporal expression of such genes dunng infection and disease progression m a mammalian host Discovering the sets of genes the bacterium is likely to be expressing at the different stages of infection, particularly when an infection is established, provides critical information for the screemng and characterization of novel antibactenals which can interrupt pathogenesis In addition to providing a fuller understanding of known protems, such an approach will identify previously unrecognised targets
RecJ is a smgle-stranded DNA exonuclease that functions methylation-directed mismatch repair recJ mutants decrease recombination which is mdependent of RecBCD but dependent upon RecE or RecF Inhibitors of the proteins mvolved m this type of DNA repair could prevent the bacteπum from establishing or maintaining infection of the host and thereby have utility in antibacterial therapy
The frequency of Streptococcus pneumoniae infections has nsen dramatically in the past few decades This has been attributed to the emergence of multiply antibiotic resistant strains and an mcreasmg population of people with weakened immune systems It is no longer uncommon to isolate Streptococcus pneumoniae strains which are resistant to some or all of the standard antibiotics This phenomenon has created a demand for both new anU-microbial agents, vaccmes, and diagnostic tests for this organism
Clearly, there exists a need for factors, such as the recJ embodiments of the mvention, that have a present benefit of bemg useful to screen compounds for antibiotic activity Such factors are also useful to determine their role m pathogenesis of infection, dysfunction and disease There is also a need for identification and characterization of such factors and their antagonists and agonists to find ways to prevent, ameliorate or correct such infection, dysfunction and disease
Certain of the polypeptides of the invention possess amino acid sequence homology to a known H influenzae recJ protem See Swiss-prot, Accession number P45112 and
Fleischmann et al , Science. 269 (5223). 496-512 (1995) Also see Ukita and Ikeda, J Bactenol. 178(8). 2362-2367 (1996), Garzon et al , J Mol Gen Genet. 250(5). 570-580 (1996), and Lovett and Sutera et al , Genetics. 140(1), 27-45 (1995)
SUMMARY OF THE INVENTION
It is an object of the mvention to provide polypeptides that have been identified as novel recJ polypeptides by homology between the ammo acid sequenc7e set out m Table 1 [SEQ ED NO 2] and a known ammo acid sequence or sequences of other proteins such as H influenzae recJ protem
It is a further object of the mvention to provide polynucleotides that encode recJ polypeptides, particularly polynucleotides that encode the polypeptide herem designated recJ In a particularly preferred embodiment of the mvention the polynucleotide compnses a region encodmg recJ polypeptides compnsmg a sequence set out m Table 1 [SEQ ID NO 1] which mcludes a full length gene, or a variant thereof
In another particularly preferred embodiment of the invention there is a novel recJ protein from Streptococcus pneumoniae comprising the amino acid sequence of Table 1 [SEQ ID NO 2], or a vanant thereof
In accordance with another aspect of the mvention there is provided an isolated nucleic acid molecule encodmg a mature polypeptide expressible by the Streptococcus pneumoniae 0100993 stram contained m the deposited stram A further aspect of the mvention there are provided isolated nucleic acid molecules encodmg recJ, particularly Streptococcus pneumoniae recJ, mcludmg mRNAs, cDNAs, genomic DNAs Further embodiments of the mvention mclude biologically, diagnostically, prophylactically, clinically or therapeutically useful vanants thereof, and compositions compnsmg the same
In accordance with another aspect of the invention, there is provided the use of a polynucleotide of the invention for therapeutic or prophylactic purposes, in particular genetic immunization Among the particularly preferred embodiments of the mvention are naturally occurring allelic vanants of recJ and polypeptides encoded thereby
Another aspect of the mvention there are provided novel polypeptides of Streptococcus pneumoniae refened to herem as recJ as well as biologically diagnostically, prophylactically, clinically or therapeutically useful vanants thereof and compositions compnsmg the same
Among the particularly prefened embodiments of the mvention are vanants of recJ polypeptide encoded by naturally occurring alleles of the recJ gene
In a prefened embodiment of the mvention there are provided methods for producmg the aforementioned recJ polypeptides In accordance with yet another aspect of the invention, there are provided inhibitors to such polypeptides, useful as antibacterial agents, mcludmg, for example, antibodies
In accordance with certain prefened embodiments of the mvention, there are provided products, compositions and methods for assessmg recJ expression, treatmg disease, assaying genetic vanation, and admmistenng a recJ polypeptide or polynucleotide to an organism to raise an immunological response against a bactena, especially a Streptococcus pneumoniae bactena In accordance with certain prefened embodiments of this and other aspects of the mvention there are provided polynucleotides that hybndize to recJ polynucleotide sequences, particularly under stringent conditions
In certain prefened embodiments of the mvention there are provided antibodies against recJ polypeptides
In other embodiments of the mvention there are provided methods for identifying compounds which bmd to or otherwise mteract with and inhibit or activate an activity of a polypeptide or polynucleotide of the mvention compnsmg contactmg a polypeptide or polynucleotide of the mvention with a compound to be screened under conditions to permit bmdmg to or other mteraction between the compound and the polypeptide or polynucleotide to assess the bmdmg to or other mteraction with the compound, such bmdmg or mteraction bemg associated with a second component capable of providing a detectable signal m response to the bmdmg or mteraction of the polypeptide or polynucleotide with the compound, and determinmg whether the compound bmds to or otherwise interacts with and activates or inhibits an activity of the polypeptide or polynucleotide by detectmg the presence or absence of a signal generated from the bmdmg or mteraction of the compound with the polypeptide or polynucleotide
In accordance with yet another aspect of the mvention, there are provided recJ agonists and antagonists, preferably bactenostatic or bactenocidal agonists and antagonists
In a further aspect of the mvention there are provided compositions compnsmg a recJ polynucleotide or a recJ polypeptide for administration to a cell or to a multicellular organism
Vanous changes and modifications withm the spint and scope of the disclosed mvention will become readily apparent to those skilled m the art from reading the following descnptions and from reading the other parts of the present disclosure
DESCRIPTION OF THE INVENTION
The mvention relates to novel recJ polypeptides and polynucleotides as descnbed m greater detail below In particular, the mvention relates to polypeptides and polynucleotides of a novel recJ of Streptococcus pneumoniae, which is related by amino acid sequence homology to H influenzae recJ polypeptide The mvention relates especially to recJ havmg the nucleotide and ammo acid sequences set out m Table 1 as SEQ ID NO 1 and SEQ ID NO 2 respectively, and to the recJ nucleotide sequences of the DNA m the deposited stram and ammo acid sequences encoded thereby TABLE 1 recJ Polynucleotide and Polypeptide Sequences
(A) Sequences from Streptococcus pneumoniae recJ polynucleotide sequence [SEQ ID
NO:l].
5'-l GTGGATGTCT TTTGATAAC ACCTACTTAT GAATGGCAGT TTGCCCTGCA
51 GGTAGAAGAT GCGGATTTTA CAAAGATAGC CAAGAAGGCT GGACTGGGTC
101 CTGAGGTGGC TCGGTTATTG TTTGAGAGAG GGATTCAGGA CCAAGAAAGT
151 CTGAAGAAGT TTTTAGAACC TTCCTTGGAG GACTTACATG ATGCTTATCT
201 GCTCCATGAT ATGGACAAGG CAGTGGAGCG GATTCGTCAG GCTATTGAAG
251 AAAGGGAAAA TATTCTCGTT TATGGAGACT ACGATGCGGA TGGCATGACT
301 TCGGCTTCTA TTGTGAAGGA AAGTTTGGAA CAACTTGGTG CTGAGTGCCG
351 AGTTTACCTG CCAAATCGTT TTACCGATGG CTATGGCCCT AATGCTAGTG
401 TTTATAAATA CTTTATCGAG CAAGAAGGGA TTTCCTTGAT TGTGACGGTG
451 GACAATGGGG TTGCTGGTCA TGAGGCTATT GCATTGGCTC AGTCTATGGG
501 AGTAGATGTC ATTGTGACAG ACCATCATTC CATGCCTGAA ACCCTGCCAG
551 ATGCTTATGC TATTGTCCAT CCTGAACATC CAGATGCGGA TTATCCTTTT
601 AAATATTTGG CTGGTTGTGG ATTTGCTTTC AAGTTGGCTT GTGCCCTGTT
651 AGAAGAAGTG CAAGTGGAAT TGCTTGATTT GGTCGCTATT GGAACTATTG
701 CAGATATGGT GAGTCTGACG GATGAAAATC TTATCTTATT TCAATATGGT
751 CTGGAAATGT TGGGTCATAC CCAGCGCATT GGTCTTCAAA AAATGCTGGA 801 CATGGCTGGG ATTGCTGCCT ACGAAGTATC AGAAGAAACG GTTGGTTTCC
851 AGATTGCTCC TCGTTTGAAT GCCTTGGGCC GCTTGGATGA TCCCAATCCT
901 GCCATTGATT TGTTGACTGG ATTTGATGAT GAGGAAGCGC ATGAGATTGC
951 CCTTATGATT CACCAGAAAA ACGAAGAGCG CAAGGAAATC GTTCAGTCTA
1001 TCTATGAAGA AGCCAAGACC ATGGTGGATC CTGAGAAGAA GGTTCAGGTC
1051 TTGGCCAAGG AAGGCTGGAA TCCTGGGGTT CTAGGAATCG TGGCTGGTCG
1101 TTTATTGGAA GAATTGGGAC AGACAGTCAT TGTTCTTAAT ATAGAAGACG
1151 GTCGTGCCAA GGGCAGTGCT CGTAGTGTGG AAGCGGTCGA TATTTTTGAA
1201 GCTCTGGATC CCCATCGAGA CCTCTTCATC GCCTTTGGAG GTCATGCAGG
1251 TGCAGCGGGT ATGACGCTGG AAGTTGAGCA ACTCTCAGAT TTATCTCAGG
1301 TTTTGGAAGA TTATGTTCGT GAAAAAGGTG CAGATGCTGG TGGAAAGAAT
1351 AAGTTAAACC TAGATGAAGA GTTGGATTTG GAGGCACTTA GCTTGGAAAC
1401 GGTCAAAAGT TTTGAACGTT TAGCTCCTTT TGGAATGGAT AATCAGAAAC
1451 CTATTTTTTA TATCAAGAAT TTTCAGGTCG AAAGTGCTCG TACTATGGGG
1501 GCAGGTAATG CCCATCTAAA GCTGAAAATT TCCAAGGGTG AGGCGAGTTT
1551 TGAAGTGGTA GCCTTTGGTC AAGGCAGATG GGCGACAGAG TTTTCTCAAA
1601 CCAAGAATCT AGAGTTAGCG GTTAAATTGT CTGTCAACCA ATGGAATGGC
1651 CAAACTGCCC TCCAGTTGAT GATGGTGGAT GCGCGAGTGG AAGGTGTTCA
1701 ACTTTTTAAC ATTCGTGGAA AAAATACAGT CTTGCCAGAA GGTGTTCCAG
1751 TCTTGGATTT TCCTGGAGAA CTGCCAAATC TTGCGGCTAG TGAAGCTGTT 1801 GTCGTAAAAA ACATTCCAGA GAGTATTACT CAGCTGAAGA CCATTTTTCA
1851 GGAACAGCAT TTCTCTGCTG TCTATTTCAA AAATGATATT GACAAGGCCT
1901 ATTATCTGAC AGGTTATGGG ACTAGAGATC AGTTTGCCAA ATTGTACAAG
1951 ACTATTTACC AGTTCCCAGA GTTTGATATT CGCTACAAGC TGAAAGATTT
2001 GGCTGCATAT CTTAATATTC AACAAATCTT GCTGGTCAAG ATGATTCAAG
2051 TATTTGAAGA ACTAGGCTTT GTGACGATAA AAGATGGTGT GATGACAGTC
2101 AATAAAGAGG CGCCAAAGCG GGAGATAGGA GAAAGTCAAA TTTACCAAAA
2151 TCTCAAACAA ACCGTTAAAG ACCAAGAAAT GATGGCGCTG GGTACGGTGC
2201 AAGAAATTTA TGATTTTTTG ATGGAAAAAG AGTAG
-3'
(B) Streptococcus pneumoniae recJ polypeptide sequence deduced from the polynucleotide sequence in this table [SEQ ID NO:2].
NH2-1 VDVFLITPTY EWQFALQVED ADFTKIAKKA GLGPEVARLL FERGIQDQES
51 LKKFLEPSLE DLHDAYLLHD MDKAVERIRQ AIEERENILV YGDYDADGMT
101 SASIVKESLE QLGAECRVYL PNRFTDGYGP NASVYKYFIE QEGISLIVTV
151 DNGVAGHEAI ALAQSMGVDV IVTDHHSMPE TLPDAYAIVH PEHPDADYPF
201 KYLAGCGFAF KLACALLEEV QVELLDLVAI GTIADMVSLT DENLILFQYG
251 LEMLGHTQRI GLQKMLDMAG IAAYEVSEET VGFQIAPRLN ALGRLDDPNP
301 AIDLLTGFDD EEAHEIALMI HQKNEERKEI VQSIYEEAKT MVDPEKKVQV
351 LAKEGWNPGV LGIVAGRLLE ELGQTVIVLN IEDGRAKGSA RSVEAVDIFE 401 ALDPHRDLFI AFGGHAGAAG MTLEVEQLSD LSQVLEDYVR EKGADAGGKN
451 KLNLDEELDL EALSLETVKS FERLAPFGMD NQKPIFYIKN FQVESARTMG
501 AGNAHLKLKI SKGEASFEW AFGQGRWATE FSQTKNLELA VKLSVNQWNG
551 QTALQLMMVD ARVEGVQLFN IRGKNTVLPE GVPVLDFPGE LPNLAASEAV
601 WKNIPESIT QLKTIFQEQH FSAVYFKNDI DKAYYLTGYG TRDQFAKLYK
651 TIYQFPEFDI RYKLKDLAAY LNIQQILLVK MIQVFEELGF VTIKDGVMTV
701 NKEAPKREIG ESQIYQNLKQ TVKDQEMMAL GTVQEIYDFL MEKE-COOH
Deposited materials
A deposit containing a Streptococcus pneumoniae 0100993 stram has been deposited with the National Collections of Industnal and Marine Bactena Ltd (herem "NCIMB"), 23 St Machar Dnve, Aberdeen AB2 1RY, Scotland on 11 Apnl 1996 and assigned deposit number 40794 The deposit was descnbed as Streptococcus peumnoiae 0100993 on deposit On 17 Apnl 1996 a Streptococcus peumnoiae 0100993 DNA library in E coli was similarly depositedwith the NCIMB and assigned deposit number 40800 The Streptococcus pneumoniae stram deposit is refened to herem as "the deposited stram" or as "the DNA of the deposited stram "
The deposited stram contams the full length recJ gene The sequence of the polynucleotides contained m the deposited stram, as well as the ammo acid sequence of the polypeptide encoded thereby, are controlling m the event of any conflict with any descnption of sequences herem
The deposit of the deposited stram has been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for Purposes of Patent Procedure The stram will be mevocably and without restnction or condition released to the public upon the issuance of a patent The deposited stram is provided merely as convenience to those of skill m the art and is not an admission that a deposit is required for enablement, such as that required under 35 U S C §112
A license may be required to make, use or sell the deposited stram, and compounds denved therefrom, and no such license is hereby granted Polypeptides
The polypeptides of the mvention mclude a polypeptide of Table 1 [SEQ ID NO 2] (m particular the mature polypeptide) as well as polypeptides and fragments, particularly those which have the biological activity of recJ, and also those which have at least 70% identity to a polypeptide of Table 1 [SEQ ID NO l]or the relevant portion, preferably at least 80% identity to a polypeptide of Table 1 [SEQ ID NO 2and more preferably at least 90% similanty (more preferably at least 90% identity) to a polypeptide of Table 1 [SEQ ID NO 2] and still more preferably at least 95% similanty (still more preferably at least 95% identity) to a polypeptide of Table 1 [SEQ ID NO 2] and also mclude portions of such polypeptides with such portion of the polypeptide generally containing at least 30 ammo acids and more preferably at least 50 ammo acids The mvention also mcludes polypeptides of the formula
X-(R1)m-(R2)-(R3)n-Y wherem, at the ammo terminus, X is hydrogen, and at the carboxyl terminus, Y is hydrogen or a metal, Rj and R3 are any ammo acid residue, m is an mteger between 1 and 1000 or zero, n is an mteger between 1 and 1000 or zero, and R2 is an ammo acid sequence of the mvention, particularly an ammo acid sequence selected from Table 1 In the formula above R2 is onented so that its ammo terminal residue is at the left, bound to and its carboxy terminal residue is at the nght, bound to R3 Any stretch of ammo acid residues denoted by either R group, where m and/or n is greater than 1, may be either a heteropolymer or a homopolymer, preferably a heteropolymer A fragment is a vanant polypeptide havmg an ammo acid sequence that entirely is the same as part but not all of the ammo acid sequence of the aforementioned polypeptides As with recJ polypeptides fragments may be "free-standing," or compnsed withm a larger polypeptide of which they form a part or region, most preferably as a smgle continuous region, a smgle larger polypeptide
Prefened fragments mclude, for example, truncation polypeptides havmg a portion of an ammo acid sequence of Table 1 [SEQ ID NO 2], or of vanants thereof, such as a contmuous senes of residues that mcludes the ammo terminus, or a contmuous senes of residues that mcludes the carboxyl terminus Degradation forms of the polypeptides of the mvention m a host cell, particularly a Streptococcus pneumoniae, are also prefened Further prefened are fragments characterized by structural or functional attributes such as fragments that compnse alpha-helix and alpha-helix forming regions, beta-sheet and beta-sheet-formmg regions, turn and turn-formmg regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate bmdmg region, and high antigenic mdex regions
Also prefened are biologically active fragments which are those fragments that mediate activities of recJ, mcludmg those with a similar activity or an improved activity, or with a decreased undesirable activity Also mcluded are those fragments that are antigenic or lmmunogenic m an animal, especially m a human Particularly prefened are fragments compnsmg receptors or domains of enzymes that confer a function essential for viability of Streptococcus pneumoniae or the ability to initiate, or maintain cause disease m an mdividual, particularly a human
Vanants that are fragments of the polypeptides of the mvention may be employed for producmg the conespondmg full-length polypeptide by peptide synthesis, therefore, these vanants may be employed as intermediates for producmg the fiill-length polypeptides of the mvention
In addition to the standard smgle and tnple letter representations for ammo acids, the term "X" or "Xaa" may also be used m descnbmg certain polypeptides of the invention "X" and "Xaa" mean that any of the twenty naturally occurmg amino acids may appear at such a designated position in the polypeptide sequence Polynucleotides
Another aspect of the mvention relates to isolated polynucleotides. mcludmg the full length gene, that encode the recJ polypeptide havmg a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] and polynucleotides closely related thereto and vanants thereof Usmg the information provided herem, such as a polynucleotide sequence set out m Table 1
[SEQ ID NO 1], a polynucleotide of the mvention encodmg recJ polypeptide may be obtamed usmg standard cloning and screening methods, such as those for cloning and sequencmg chromosomal DNA fragments from bactena usmg Streptococcus pneumoniae 0100993 cells as starting matenal, followed by obtaining a full length clone For example, to obtain a polynucleotide sequence of the invention, such as a sequence given m Table 1 [SEQ ID NO 1], typically a library of clones of chromosomal DNA of Streptococcus pneumoniae 0100993 E coli or some other suitable host is probed with a radiolabeled ohgonucleotide, preferably a 17-mer or longer, derived from a partial sequence Clones carrying DNA identical to that of the probe can then be distinguished usmg strmgent conditions By sequencmg the individual clones thus identified with sequencmg primers designed from the origmal sequence it is then possible to extend the sequence m both directions to determine the full gene sequence Conveniently, such sequencing is performed using denatured double stranded DNA prepared from a plasmid clone Suitable techniques are descnbed by Maniatis, T , Fntsch, E F and Sambrook et al , MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed , Cold Sprmg Harbor Laboratory Press, Cold Sprmg Harbor, New York (1989) (see in particular Screening By Hybndization 1 90 and Sequencmg Denatured Double-Stranded DNA Templates 13 70) Illustrative of the mvention, the polynucleotide set out m Table 1 [SEQ ID NO 1] was discovered m a DNA library denved from Streptococcus pneumoniae 0100993
The DNA sequence set out m Table 1 [SEQ ID NO 1] contams an open reading frame encodmg a protem havmg about the number of ammo acid residues set forth m Table 1 [SEQ ID NO 2] with a deduced molecular weight that can be calculated usmg ammo acid residue molecular weight values well known m the art The polynucleotide of SEQ ID NO 1, between nucleotide number 1 and the stop codon which begins at nucleotide number 2233 of SEQ ID NO 1, encodes the polypeptide of SEQ ID NO 2
RecJ of the mvention is structurally related to other proteins of the recJ (single-stranded- DNA specific exonuclease) family, as shown by the results of sequencmg the DNA encodmg recJ of the deposited stram See Swiss-prot, Accession number P45112 and Fleischmann et al , Science. 269 (5223). 496-512 (1995) Also see Ukita and Ikeda, J Bactenol. 178(8). 2362- 2367 (1996), Garzon et al , J Mol Gen Genet. 250(5). 570-580 (1996), and Lovett and Sutera et al , Genetics. 140(1). 27-45 (1995)
The invention provides a polynucleotide sequence identical over its entire length to a codmg sequence m Table 1 [SEQ ID NO 1] Also provided by the mvention is the codmg sequence for the mature polypeptide or a fragment thereof, by itself as well as the codmg sequence for the mature polypeptide or a fragment m reading frame with other codmg sequence, such as those encodmg a leader or secretory sequence, a pre-, or pro- or prepro- protem sequence The polynucleotide may also contam non-coding sequences, mcludmg for example, but not limited to non-coding 5' and 3' sequences, such as the transcnbed, non-translated sequences, termmation signals, nbosome bmdmg sites, sequences that stabilize mRNA, mtrons, polyadenylation signals, and additional codmg sequence which encode additional ammo acids For example, a marker sequence that facilitates punfication of the fused polypeptide can be encoded In certain embodiments of the mvention, the marker sequence is a hexa-histidine peptide, as provided the pQE vector (Qiagen, Inc ) and descnbed m Gentz et al , Proc Natl Acad Sci , USA 86 821-824 (1989), or an HA tag (Wilson et al , Cell 37 767 (1984) Polynucleotides of the mvention also mclude, but are not limited to. polynucleotides compnsmg a structural gene and its naturally associated sequences that control gene expression
A prefened embodiment of the mvention is a polynucleotide compnsmg nucleotide 1 to the nucleotide immediately upstream of or mcludmg nucleotide 2233 set forth SEQ ID NO 1 of Table 1 , both of which encode the rec J polypeptide
The mvention also mcludes polynucleotides of the formula
X-(R1)m-(R2)-(R3)n-Y wherein, at the 5' end of the molecule, X is hydrogen, and at the 3' end of the molecule, Y is hydrogen or a metal, Ri and R3 is any nucleic acid residue, m is an mteger between 1 and 3000 or zero , n is an mteger between 1 and 3000 or zero, and R is a nucleic acid sequence of the mvention, particularly a nucleic acid sequence selected from Table 1 In the polynucleotide formula above R2 is onented so that its 5' end residue is at the left, bound to R\ and its 3' end residue is at the nght, bound to R3 Any stretch of nucleic acid residues denoted by either R group, where m and/or n is greater than 1, may be either a heteropolymer or a homopolymer, preferably a heteropolymer In a prefened embodiment m and/or n is an mteger between 1 and 1000.
It is most prefened that the polynucleotides of the inventions are denved from Streptococcus pneumoniae, however, they may preferably be obtamed from organisms of the same taxonomic genus They may also be obtamed. for example, from orgamsims of the same taxonomic family or order The term "polynucleotide encodmg a polypeptide" as used herem encompasses polynucleotides that mclude a sequence encodmg a polypeptide of the mvention, particularly a bactenal polypeptide and more particularly a polypeptide of the Streptococcus pneumoniae recJ havmg an ammo acid sequence set out m Table 1 [SEQ ID NO 2] The term also encompasses polynucleotides that mclude a smgle contmuous region or discontinuous regions encodmg the polypeptide (for example, mterrupted by mtegrated phage or an insertion sequence or editmg) together with additional regions, that also may contam codmg and/or non-coding sequences
The mvention further relates to vanants of the polynucleotides descnbed herem that encode for vanants of the polypeptide havmg a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] Vanants that are fragments of the polynucleotides of the mvention may be used to synthesize fiill- length polynucleotides of the mvention
Further particularly prefened embodiments are polynucleotides encoding recJ vanants, that have the ammo acid sequence of recJ polypeptide of Table 1 [SEQ ID NO 2] m which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no ammo acid residues are substituted, deleted or added, m any combination Especially prefened among these are silent substitutions, additions and deletions, that do not alter the properties and activities of recJ
Further prefened embodiments of the mvention are polynucleotides that are at least 70% identical over their entire length to a polynucleotide encodmg recJ polypeptide havmg an ammo acid sequence set out m Table 1 [SEQ ID NO 2], and polynucleotides that are complementary to such polynucleotides Alternatively, most highly prefened are polynucleotides that compnse a region that is at least 80% identical over its entire length to a polynucleotide encodmg recJ polypeptide of the deposited stram and polynucleotides complementary thereto hi this regard, polynucleotides at least 90% identical over their entire length to the same are particularly prefened, and among these particularly prefened polynucleotides, those with at least 95% are especially prefened Furthermore, those with at least 97% are highly prefened among those with at least 95%, and among these those with at least 98% and at least 99% are particularly highly prefened, with at least 99% bemg the more prefened Prefened embodiments are polynucleotides that encode polypeptides that retain substantially the same biological function or activity as the mature polypeptide encoded by a DNA ofTable l [SEQ ID N0 1]
The mvention further relates to polynucleotides that hybndize to the herem above-descnbed sequences In this regard, the mvention especially relates to polynucleotides that hybndize under stnngent conditions to the herem above-descnbed polynucleotides As herem used, the terms "stnngent conditions" and "stnngent hybndization conditions" mean hybndization will occur only if there is at least 95% and preferably at least 97% identity between the sequences An example of strmgent hybndization conditions is overnight mcubation at 42°C m a solution comprising 50% formamide, 5x SSC (150mM NaCl, 15mM tnsodium citrate), 50 mM sodium phosphate (pH7 6), 5x Denhardt's solution, 10% dextran sulfate, and 20 micrograms/ml denatured, sheared salmon sperm DNA, followed by washing the hybridization support in 0 lx SSC at about 65°C Hybndization and wash conditions are well known and exemplified in Sambrook, et al , Molecular Cloning A Laboratory Manual, Second Edition, Cold Spring Harbor, N Y , (1989), particularly Chapter 11 therem The invention also provides a polynucleotide consisting essentially of a polynucleotide sequence obtainable by screening an appropnate library containing the complete gene for a polynucleotide sequence set forth in SEQ ID NO 1 under stringent hybridization conditions with a probe having the sequence of said polynucleotide sequence set forth m SEQ ID NO 1 or a fragment thereof, and isolating said DNA sequence Fragments useful for obtaining such a polynucleotide mclude, for example, probes and primers descnbed elsewhere herem
As discussed additionally herem regarding polynucleotide assays of the mvention, for instance, polynucleotides of the mvention as discussed above, may be used as a hybndization probe for RNA, cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encodmg recJ and to isolate cDNA and genomic clones of other genes that have a high sequence similanty to the recJ gene Such probes generally will compnse at least 15 bases Preferably, such probes will have at least 30 bases and may have at least 50 bases Particularly prefened probes will have at least 30 bases and will have 50 bases or less
For example, the codmg region of the recJ gene may be isolated by screening usmg a DNA sequence provided m Table 1 [SEQ ID NO 1] to synthesize an ohgonucleotide probe A labeled ohgonucleotide havmg a sequence complementary to that of a gene of the mvention is then used to screen a library of cDNA, genomic DNA or mRNA to determine which members of the library the probe hybndizes to
The polynucleotides and polypeptides of the mvention may be employed, for example, as research reagents and matenals for discovery of treatments of and diagnostics for disease, particularly human disease, as further discussed herem relatmg to polynucleotide assays
Polynucleotides of the mvention that are oligonucleotides derived from the sequences of Table 1 [SEQ ID NOS 1 or 2] may be used in the processes herein as descnbed, but preferably for PCR, to determine whether or not the polynucleotides identified herein in whole or in part are transcnbed m bactena in infected tissue It is recognized that such sequences will also have utility m diagnosis of the stage of mfection and type of mfection the pathogen has attained
The mvention also provides polynucleotides that may encode a polypeptide that is the mature protem plus additional ammo or carboxyl-termmal ammo acids, or ammo acids mtenor to the mature polypeptide (when the mature form has more than one polypeptide chain, for instance) Such sequences may play a role m processmg of a protem from precursor to a mature form, may allow protem transport, may lengthen or shorten protem half-life or may facilitate manipulation of a protem for assay or production, among other things As generally is the case in v vo, the additional ammo acids may be processed away from the mature protem by cellular enzymes
A precursor protem, havmg the mature form of the polypeptide fused to one or more prosequences may be an mactive form of the polypeptide When prosequences are removed such inactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called proproteins
In addition to the standard A, G, C, T/U representations for nucleic acid bases, the term "N" may also be used m descnbmg certain polynucleotides of the invention "N" means that any of the four DNA or RNA bases may appear at such a designated position in the DNA or RNA sequence, except it is preferred that N is not a base that when taken m combination with adjacent nucleotide positions, when read m the correct reading frame, would have the effect of generatmg a premature termmation codon m such readmg frame
In sum, a polynucleotide of the mvention may encode a mature protein, a mature protem plus a leader sequence (which may be refened to as a preprotem), a precursor of a mature protem havmg one or more prosequences that are not the leader sequences of a preprotem, or a preproprotein, which is a precursor to a proprotein, havmg a leader sequence and one or more prosequences, which generally are removed dunng processmg steps that produce active and mature forms of the polypeptide Vectors, host cells, expression
The mvention also relates to vectors that compnse a polynucleotide or polynucleotides of the mvention, host cells that are genetically engmeered with vectors of the mvention and the production of polypeptides of the mvention by recombinant techniques Cell-free translation systems can also be employed to produce such proteins usmg RNAs denved from the DNA constructs of the mvention For recombinant production, host cells can be genetically engmeered to incorporate expression systems or portions thereof or polynucleotides of the mvention Introduction of a polynucleotide mto the host cell can be effected by methods descnbed m many standard laboratory manuals, such as Davis et al, BASIC METHODS IN MOLECULAR BIOLOGY, (1986) and Sambrook et al , MOLECULAR CLONING A LABORATORY MANUAL, 2nd Ed , Cold Sprmg Harbor Laboratory Press, Cold Sprmg Harbor, N Y (1989), such as, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, micromjection, cationic hpid- mediated transfection, electroporation, transduction, scrape loading, ballistic introduction and infection
Representative examples of appropnate hosts mclude bactenal cells, such as streptococci, staphylococci, enterococci E cob, streptomyces and Bacillus subtihs cells, fungal cells, such as yeast cells and Aspergillus cells, insect cells such as Drosophila S2 and Spodoptera Sf9 cells, animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells, and plant cells
A great vanety of expression systems can be used to produce the polypeptides of the mvention Such vectors mclude, among others, chromosomal, episomal and virus-denved vectors, e g , vectors denved from bactenal plasmids, from bactenophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors denved from combinations thereof, such as those denved from plasmid and bactenophage genetic elements, such as cosmids and phagemids The expression system constructs may contam control regions that regulate as well as engender expression Generally, any system or vector suitable to maintain, propagate or express polynucleotides and/or to express a polypeptide m a host may be used for expression m this regard The appropnate DNA sequence may be inserted mto the expression system by any of a vanety of well-known and routme techniques, such as, for example, those set forth m Sambrook et al , MOLECULAR CLONING, A LABORATORY MANUAL, (supra)
For secretion of the translated protem mto the lumen of the endoplasmic reticulum, mto the penplasmic space or mto the extracellular environment, appropnate secretion signals may be incorporated mto the expressed polypeptide These signals may be endogenous to the polypeptide or they may be heterologous signals Polypeptides of the mvention can be recovered and punfied from recombinant cell cultures by well-known methods mcludmg ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic mteraction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography Most preferably, high performance liquid chromatography is employed for punfication Well known techmques for refoldmg protem may be employed to regenerate active conformation when the polypeptide is denatured dunng isolation and or punfication Diagnostic Assays
This mvention is also related to the use of the recJ polynucleotides of the mvention for use as diagnostic reagents Detection of recJ m a eukaryote, particularly a mammal, and especially a human, will provide a diagnostic method for diagnosis of a disease Eukaryotes (herem also "mdιvιdual(s)"), particularly mammals, and especially humans, particularly those mfected or suspected to be infected with an organism compnsmg the recJ gene may be detected at the nucleic acid level by a vanety of techniques
Nucleic acids for diagnosis may be obtamed from an infected individual's cells and tissues, such as bone, blood, muscle, cartilage, and skin Genomic DNA may be used directly for detection or may be amplified enzymatically by usmg PCR or other amplification technique pnor to analysis RNA, cDNA and genomic DNA may also be used m the same ways Usmg amplification, characterization of the species and stram of prokaryote present m an mdividual, may be made by an analysis of the genotype of the prokaryote gene Deletions and insertions can be detected by a change in size of the amphfied product m companson to the genotype of a reference sequence Pomt mutations can be identified by hybndizmg amplified DNA to labeled recJ polynucleotide sequences Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences m melting temperatures DNA sequence differences may also be detected by alterations m the electrophoretic mobility of the DNA fragments m gels, with or without denaturing agents, or by direct DNA sequencmg See, e g , Myers et al , Science, 230 1242 (1985) Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and S 1 protection or a chemical cleavage method See, e g , Cotton et al , Proc Natl Acad Sci , USA, 85 4397-4401 (1985)
Cells carrying mutations or polymorphisms m the gene of the mvention may also be detected at the DNA level by a vanety of techniques, to allow for serotypmg, for example For example, RT- PCR can be used to detect mutations It is particularly prefened to used RT-PCR m conjunction with automated detection systems, such as, for example, GeneScan RNA, cDNA or genomic DNA may also be used for the same purpose, PCR or RT-PCR As an example, PCR primers complementary to a nucleic acid encodmg recJ can be used to identify and analyze mutations Examples of representative primers are shown below m Table 2
Table 2 Primers for amplification of recJ polynucleotides SEQ ID NO PRIMER SEQUENCE
3 5'-TGGTGCTGAGTGCCGAGTTTA-3'
4 5'-CAATGCGCTGGGTATGAC-3' The mvention also mcludes primers of the formula
X-(R1)m-(R2)-(R3)n-Y wherem, at the 5' end of the molecule, X is hydrogen, and at the 3' end of the molecule, Y is hydrogen or a metal, Rj and R3 is any nucleic acid residue, m is an mteger between 1 and 20 or zero , n is an mteger between 1 and 20 or zero, and R is a primer sequence of the mvention, particularly a primer sequence selected from Table 2 In the polynucleotide formula above R2 is onented so that its 5' end residue is at the left, bound to Rj and its 3' end residue is at the nght, bound to R3 Any stretch of nucleic acid residues denoted by either R group, where m and/or n is greater than 1, may be either a heteropolymer or a homopolymer, preferably a heteropolymer bemg complementary to a region of a polynucleotide of Table 1 In a prefened embodiment m and/or n is an mteger between 1 and 10.
The mvention further provides these primers with 1, 2, 3 or 4 nucleotides removed from the 5' and/or the 3' end These primers may be used for, among other things, amplifying recJ DNA isolated from a sample denved from an mdividual The primers may be used to amplify the gene isolated from an infected mdividual such that the gene may then be subject to vanous techmques for elucidation of the DNA sequence In this way, mutations m the DNA sequence may be detected and used to diagnose infection and to serotype and/or classify the infectious agent
The mvention further provides a process for diagnosing, disease, preferably bactenal infections, more preferably infections by Streptococcus pneumoniae, comprising determining from a sample derived from an individual a mcreased level of expression of polynucleotide having a sequence of Table 1 [SEQ ID NO 1] Increased or decreased expression of recJ polynucleotide can be measured usmg any on of the methods well known m the art for the quantation of polynucleotides, such as, for example, amplification, PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods
In addition, a diagnostic assay m accordance with the mvention for detectmg over- expression of recJ protem compared to normal control tissue samples may be used to detect the presence of an infection, for example Assay techmques that can be used to determine levels of a recJ protem, m a sample denved from a host are well-known to those of skill m the art Such assay methods mclude radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays Antibodies
The polypeptides of the mvention or vanants thereof, or cells expressmg them can be used as an immunogen to produce antibodies lmmunospecific for such polypeptides "Antibodies" as used herem mcludes monoclonal and polyclonal antibodies, chimenc, smgle chain, simiamzed antibodies and humanized antibodies, as well as Fab fragments, mcludmg the products of an Fab lmmunolglobulm expression library
Antibodies generated against the polypeptides of the mvention can be obtamed by administering the polypeptides or epitope-bearmg fragments, analogues or cells to an ammal, preferably a nonhuman, usmg routme protocols For preparation of monoclonal antibodies, any technique known m the art that provides antibodies produced by contmuous cell line cultures can be used Examples mclude vanous techmques, such as those m Kohler, G and Milstem, C , Nature 256 495-497 (1975), Kozbor et al , Immunology Today 4 72 (1983), Cole et al , pg 77-96 m MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R Liss, Inc (1985)
Techmques for the production of smgle chain antibodies (U S Patent No 4,946,778) can be adapted to produce single chain antibodies to polypeptides of this mvention Also, transgenic mice, or other orgamsms such as other mammals, may be used to express humanized antibodies
Alternatively phage display technology may be utilized to select antibody genes with bmdmg activities towards the polypeptide either from repertoires of PCR amphfied v-genes of lymphocytes from humans screened for possessing anti-recJ or from naive hbranes (McCafferty, J et al , (1990), Nature 348, 552-554, Marks, J et al , (1992) Biotechnology 10, 779-783) The affinity of these antibodies can also be improved by chain shuffling (Clackson, T et al , (1991) Nature 352, 624-628) If two antigen bmdmg domains are present each domain may be directed against a different epitope - termed 'bispecific' antibodies
The above-descnbed antibodies may be employed to isolate or to identify clones expressmg the polypeptides to purify the polypeptides by affinity chromatography
Thus, among others, antibodies against recJ- polypeptide may be employed to treat infections, particularly bactenal infections
Polypeptide variants mclude antigenically, epitopically or lmmunologically equivalent vanants that form a particular aspect of this mvention The term "antigenically equivalent derivative" as used herem encompasses a polypeptide or its equivalent which will be specifically recognized by certain antibodies which, when raised to the protem or polypeptide accordmg to the mvention, mterfere with the immediate physical interaction between pathogen and mammalian host The term "lmmunologically equivalent derivative" as used herem encompasses a peptide or its equivalent which when used in a suitable formulation to raise antibodies m a vertebrate, the antibodies act to interfere with the immediate physical mteraction between pathogen and mammalian host
The polypeptide, such as an antigenically or lmmunologically equivalent derivative or a fusion protem thereof is used as an antigen to immunize a mouse or other animal such as a rat or chicken The fusion protem may provide stability to the polypeptide The antigen may be associated, for example by conjugation, with an lmmunogenic carrier protein for example bovme serum albumin (BSA) or keyhole limpet haemocyanin (KLH) Alternatively a multiple antigenic peptide compnsmg multiple copies of the protein or polypeptide, or an antigenically or lmmunologically equivalent polypeptide thereof may be sufficiently antigenic to improve lmmunogemcity so as to obviate the use of a carrier
Preferably, the antibody or variant thereof is modified to make it less lmmunogenic in the mdividual For example, if the mdividual is human the antibody may most preferably be "humanized", where the compl mentarity determinmg regιon(s) of the hybndoma-deπved antibody has been transplanted mto a human monoclonal antibody , for example as described in Jones, P et al (1986), Nature 321, 522-525 or Tempest et al , (1991) Biotechnology 9, 266-273
The use of a polynucleotide of the invention m genetic immunization will preferably employ a suitable deliver}' method such as direct injection of plasmid DNA mto muscles (Wolff et al , Hum Mol Genet 1992, 1 363, Manthorpe et al , Hum Gene Ther 1963 4, 419), delivery of DNA complexed with specific protem carriers (Wu et al , J Biol Chem 1989 264.16985), coprecipitation of DNA with calcium phosphate (Benvenisty & Reshef, PNAS USA, 1986 83,9551), encapsulation of DNA in various forms of hposomes (Kaneda et al , Science 1989 243,375), particle bombardment (Tang et al , Nature 1992, 356 152, Eisenbraun et al , DNA Cell Biol 1993, 12 791) and in vivo mfection usmg cloned retroviral vectors (Seeger et al , PNAS USA 1984 81.5849)
Antagonists and agonists - assays and molecules
Polypeptides of the mvention may also be used to assess the bmdmg of small molecule substrates and hgands m, for example, cells, cell-free preparations, chemical libranes, and natural product mixtures These substrates and hgands may be natural substrates and hgands or may be structural or functional mimetics See, e g , Cohgan et al , Current Protocols in Immunology 1(2) Chapter 5 (1991) The mvention also provides a method of screening compounds to identify those which enhance (agonist) or block (antagomst) the action of recJ polypeptides or polynucleotides, particularly those compounds that are bactenostatic and/or bactenocidal The method of screening may mvolve high-throughput techmques For example, to screen for agonists or antagoists, a synthetic reaction mix, a cellular compartment, such as a membrane, cell envelope or cell wall, or a preparation of any thereof, compnsmg recJ polypeptide and a labeled substrate or hgand of such polypeptide is incubated m the absence or the presence of a candidate molecule that may be a recJ agomst or antagomst The ability of the candidate molecule to agonize or antagonize the recJ polypeptide is reflected m decreased bmdmg of the labeled hgand or decreased production of product from such substrate Molecules that bmd gratuitously, i e , without mducmg the effects of recJ polypeptide are most likely to be good antagomsts Molecules that bmd well and mcrease the rate of product production from substrate are agonists Detection of the rate or level of production of product from substrate may be enhanced by usmg a reporter system Reporter systems that may be useful m this regard mclude but are not limited to colonmetnc labeled substrate converted mto product, a reporter gene that is responsive to changes m recJ polynucleotide or polypeptide activity, and bmdmg assays known m the art
Another example of an assay for recJ antagomsts is a competitive assay that combmes recJ and a potential antagomst with recJ-bmdmg molecules, recombinant recJ bmdmg molecules, natural substrates or hgands, or substrate or gand mimetics. under appropnate conditions for a competitive inhibition assay RecJ can be labeled, such as by radioactivity or a colonmetnc compound, such that the number of recJ molecules bound to a bmdmg molecule or converted to product can be determmed accurately to assess the effectiveness of the potential antagomst
Potential antagomsts mclude small orgamc molecules, peptides, polypeptides and antibodies that bmd to a polynucleotide or polypeptide of the mvention and thereby inhibit or extinguish its activity Potential antagomsts also may be small orgamc molecules, a peptide, a polypeptide such as a closely related protem or antibody that bmds the same sites on a bmdmg molecule, such as a bmdmg molecule, without mducmg recJ-mduced activities, thereby preventmg the action of recJ by excluding recJ from bmdmg
Potential antagomsts mclude a small molecule that bmds to and occupies the bmdmg site of the polypeptide thereby preventmg bmdmg to cellular bmdmg molecules, such that normal biological activity is prevented Examples of small molecules mclude but are not limited to small orgamc molecules, peptides or peptide-like molecules Other potential antagomsts mclude antisense molecules (see Okano, J Neurochem 56 560 (1991), OI1GODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Press, Boca Raton, FL (1988), for a descnption of these molecules) Prefened potential antagomsts mclude compounds related to and vanants of red Each of the DNA sequences provided herein may be used m the discovery and development of antibacterial compounds The encoded protem, upon expression, can be used as a target for the screening of antibactenal drugs Additionally, the DNA sequences encodmg the ammo terminal regions of the encoded protem or Shine-Delgarno or other translation facilitating sequences of the respective mRNA can be used to construct antisense sequences to control the expression of the codmg sequence of interest
The mvention also provides the use of the polypeptide, polynucleotide or inhibitor of the invention to mterfere with the initial physical mteraction between a pathogen and mammalian host responsible for sequelae of infection In particular the molecules of the invention may be used m the prevention of adhesion of bacteria, in particular gram positive bacteria, to mammalian extracellular matrix proteins on m-dwelhng devices or to extracellular matrix protems in wounds, to block red protein-mediated mammalian cell invasion by, for example, initiating phosphorylation of mammalian tyrosme kmases (Rosenshme et al , Infect lmmun 60 2211 (1992), to block bacterial adhesion between mammalian extracellular matrix proteins and bacterial recJ proteins that mediate tissue damage and, to block the normal progression of pathogenesis in infections initiated other than by the implantation of m-dwelhng devices or by other surgical techmques
The antagomsts and agonists of the mvention may be employed, for instance, to inhibit and treat diseases
Hehcobacter pylori (herem H pylori) bactena infect the stomachs of over one-third of the world's population causmg stomach cancer, ulcers, and gastritis (International Agency for Research on Cancer (1994) Schistosomes, Liver Flukes and Hehcobacter Pylon (International Agency for Research on Cancer, Lyon, France, http //www uicc ch/ecp/ecp2904 htm) Moreover, the mtemational Agency for Research on Cancer recently recognized a cause-and- effect relationship between H pylori and gastric adenocarcmoma, classifying the bactenum as a Group I (defimte) carcmogen Preferred antimicrobial compounds of the mvention (agonists and antagonists of red) found usmg screens provided by the invention, particularly broad- spectrum antibiotics, should be useful in the treatment of H pylori infection Such treatment should decrease the advent of H pylori -induced cancers, such as gastromtestinal carcinoma Such treatment should also cure gastric ulcers and gastritis Vaccines
Another aspect of the invention relates to a method for mducmg an immunological response in an individual, particularly a mammal which compnses inoculating the mdividual with recJ, or a fragment or vanant thereof, adequate to produce antibody and/ or T cell immune response to protect said mdividual from mfection, particularly bactenal infection and most particularly Streptococcus pneumoniae mfection Also provided are methods whereby such immunological response slows bacterial replication Yet another aspect of the mvention relates to a method of mducmg immunological response in an individual which comprises dehvermg to such mdividual a nucleic acid vector to direct expression of recJ, or a fragment or a variant thereof, for expressmg recJ, or a fragment or a vanant thereof in vivo in order to mduce an immunological response, such as, to produce antibody and/ or T cell immune response, mcludmg, for example, cytokine-producing T cells or cytotoxic T cells, to protect said individual from disease, whether that disease is already established withm the individual or not One way of admmistenng the gene is by accelerating it into the desired cells as a coating on particles or otherwise Such nucleic acid vector may comprise DNA, RNA, a modified nucleic acid, or a DNA/RNA hybrid
A further aspect of the mvention relates to an immunological composition which, when introduced mto an individual capable or having induced withm it an immunological response, mduces an immunological response m such mdividual to a recJ or protein coded therefrom wherein the composition comprises a recombinant recJ or protein coded therefrom compnsmg DNA which codes for and expresses an antigen of said recJ or protem coded therefrom The immunological response may be used therapeutically or prophylactically and may take the form of antibody immunity or cellular immunity such as that ansmg from CTL or CD4+ T cells
A recJ polypeptide or a fragment thereof may be fused with co-protem which may not by itself produce antibodies, but is capable of stabilizing the first protem and producmg a fused protein which will have lmmunogenic and protective properties Thus fused recombinant protem, preferably further comprises an antigenic co-protem, such as hpoprotem D from Hemophilus influenzae, Glutathione-S-transferase (GST) or beta-galactosidase, relatively large co-proteins which solubihze the protein and facilitate production and purification thereof Moreover, the co-protem may act as an adjuvant m the sense of providing a generalized stimulation of the immune system The co-protein may be attached to either the ammo or carboxy terminus of the first protem
Provided by this mvention are compositions, particularly vaccme compositions, and methods compnsmg the polypeptides or polynucleotides of the mvention and lmmunostimulatory DNA sequences, such as those described in Sato, Y et al Science 273 352 (1996)
Also, provided by this mvention are methods usmg the descnbed polynucleotide or particular fragments thereof which have been shown to encode non-variable regions of bacterial cell surface protems m DNA constructs used in such genetic immunization experiments m ammal models of infection with Streptococcus pneumoniae will be particularly useful for identifying protem epitopes able to provoke a prophylactic or therapeutic immune response It is believed that this approach will allow for the subsequent preparation of monoclonal antibodies of particular value from the requisite organ of the animal successfully resisting or clearing infection for the development of prophylactic agents or therapeutic treatments of bactenal infection, particularly Streptococcus pneumoniae mfection, m mammals, particularly humans
The polypeptide may be used as an antigen for vaccination of a host to produce specific antibodies which protect agamst invasion of bacteria, for example by blocking adherence of bactena to damaged tissue Examples of tissue damage mclude wounds m skin or connective tissue caused, e g , by mechanical, chemical or thermal damage or by implantation of indwelling devices, or wounds m the mucous membranes, such as the mouth, mammary glands, urethra or vagma
The mvention also mcludes a vaccme formulation which compnses an lmmunogenic recombinant protem of the mvention together with a suitable earner Smce the protem may be broken down m the stomach, it is preferably administered parenterally, mcludmg, for example, administration that is subcutaneous, intramuscular, intravenous, or intradermal Formulations suitable for parenteral administration mclude aqueous and non-aqueous stenle injection solutions which may contam anti-oxidants, buffers, bacteπostats and solutes which render the formulation msotomc with the bodily fluid, preferably the blood, of the mdividual, and aqueous and non-aqueous stenle suspensions which may mclude suspending agents or thickemng agents The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials and may be stored in a freeze-dned condition requirmg only the addition of the sterile liquid carrier immediately prior to use The vaccme formulation may also mclude adjuvant systems for enhancing the immunogenicity of the formulation, such as oil-m water systems and other systems known in the art The dosage will depend on the specific activity of the vaccme and can be readily determmed by routme experimentation While the mvention has been described with reference to certain recJ protem, it is to be understood that this covers fragments of the naturally occurnng protein and similar protems with additions, deletions or substitutions which do not substantially affect the lmmunogenic properties of the recombinant protem
Compositions, kits and administration The mvention also relates to compositions compnsmg the polynucleotide or the polypeptides discussed above or their agonists or antagomsts The polypeptides of the mvention may be employed m combination with a non-sterile or stenle earner or earners for use with cells, tissues or orgamsms, such as a pharmaceutical earner suitable for administration to a subject Such compositions compnse, for instance, a media additive or a therapeutically effective amount of a polypeptide of the mvention and a pharmaceutically acceptable earner or excipient Such earners may mclude, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof The formulation should suit the mode of administration The mvention further relates to diagnostic and pharmaceutical packs and kits compnsmg one or more containers filled with one or more of the ingredients of the aforementioned compositions of the mvention Polypeptides and other compounds of the mvention may be employed alone or conjunction with other compounds, such as therapeutic compounds
The pharmaceutical compositions may be admimstered m any effective, convenient manner mcludmg, for instance, administration by topical, oral, anal, vaginal, intravenous, mtrapentoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others In therapy or as a prophylactic, the active agent may be administered to an individual as an mjectable composition, for example as a sterile aqueous dispersion, preferably isotonic
Alternatively the composition may be formulated for topical application for example in the form of omtments, creams, lotions, eye ointments, eye drops, ear drops, mouthwash, impregnated dressings and sutures and aerosols, and may contam appropriate conventional additives, mcludmg, for example, preservatives, solvents to assist drug penetration, and emollients m omtments and creams Such topical formulations may also contain compatible conventional carriers, for example cream or omtment bases, and ethanol or oleyl alcohol for lotions Such earners may constitute from about 1% to about 98% by weight of the formulation, more usually they will constitute up to about 80% by weight of the formulation
For administration to mammals, and particularly humans, it is expected that the daily dosage level of the active agent will be from 0 01 mg/kg to 10 mg/kg, typically around 1 mg/kg The physician m any event will determine the actual dosage which will be most suitable for an mdividual and will vary with the age, weight and response of the particular mdividual The above dosages are exemplary of the average case There can, of course, be mdividual instances where higher or lower dosage ranges are merited, and such are within the scope of this invention
In-dwellmg devices mclude surgical implants, prosthetic devices and catheters, I e , devices that are mtroduced to the body of an mdividual and remam m position for an extended time Such devices mclude, for example, artificial jomts, heart valves, pacemakers, vascular grafts, vascular catheters, cerebrospinal fluid shunts, urinary catheters, continuous ambulatory peritoneal dialysis (CAPD) catheters
The composition of the invention may be administered by injection to achieve a systemic effect agamst relevant bacteria shortly before insertion of an in-dwelhng device Treatment may be continued after surgery during the m-body time of the device In addition, the composition could also be used to broaden peπoperative cover for any surgical technique to prevent bacterial wound infections, especially Streptococcus pneumoniae wound infections
Many orthopaedic surgeons consider that humans with prosthetic joints should be considered for antibiotic prophylaxis before dental treatment that could produce a bacteremia Late deep mfection is a senous complication sometimes leadmg to loss of the prosthetic joint and is accompanied by significant morbidity and mortality It may therefore be possible to extend the use of the active agent as a replacement for prophylactic antibiotics in this situation In addition to the therapy described above, the compositions of this mvention may be used generally as a wound treatment agent to prevent adhesion of bactena to matnx protems exposed in wound tissue and for prophylactic use in dental treatment as an alternative to, or in conjunction with, antibiotic prophylaxis Alternatively, the composition of the mvention may be used to bathe an indwelling device immediately before insertion The active agent will preferably be present at a concentration of 1 μg/ml to lOmg/ml for bathing of wounds or indwelling devices A vaccme composition is conveniently in mjectable form Conventional adjuvants may be employed to enhance the immune response A suitable unit dose for vaccmation is 0 5-5 microgram/kg of antigen, and such dose is preferably admimstered 1-3 times and with an interval of 1-3 weeks With the mdicated dose range, no adverse toxicological effects will be observed with the compounds of the mvention which would preclude their administration to suitable individuals
Each reference disclosed herem is incorporated by reference herem m its entirety Any patent application to which this application claims priority is also incorporated by reference herem m its entirety
GLOSSARY
The following definitions are provided to facilitate understanding of certain terms used frequently herem
"Dιsease(s)" means and disease caused by or related to infection by a bactena, mcludmg otitis media, conjunctivitis, pneumoma, bacteremia, menmgitis, smusitis, pleural empyema and endocarditis, and most particularly menmgitis, such as for example infection of cerebrospinal fluid
"Host cell" is a cell which has been transformed or transfected, or is capable of transformation or transfection by an exogenous polynucleotide sequence
"Identity," as known m the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as the case may be, as determmed by companng the sequences In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strmgs of such sequences "Identity" can be readily calculated by known methods, mcludmg but not limited to those descnbed m (Computational Molecular Biology, Lesk, A M , ed , Oxford Umversity Press, New York, 1988, Biocomputing Informatics and Genome Projects, Smith, D W , ed , Academic Press, New York, 1993, Computer Analysis of Sequence Data, Part I, Griffin, A M , and Griffin. H G , eds Humana Press, New Jersey, 1994. Sequence Analysis in Molecular Biology, von Heinje, G , Academic Press, 1987, and Sequence Analysis Primer, G bskov, M and Devereux, J , eds , M Stockton Press, New York, 1991, and Canllo, H , and Lipman, D , SIAM J Applied Math , 48 1073 (1988) Methods to determine identity are designed to give the largest match between the sequences tested Moreover, methods to determine identity are codified in publicly available computer programs Computer program methods to determine identity between two sequences mclude, but are not limited to, the GCG program package (Devereux, J , et al , Nucleic Acids Research 12(1) 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S F et al , J Molec Biol 215 403-410 (1990) The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S , et al , NCBI NLM NIH Bethesda, MD 20894, Altschul, S , et al , J Mol Biol 215 403-410 (1990) The well known Smith Waterman algonthm may also be used to determine identity
Parameters for polypeptide sequence companson mclude the following Algonthm Needleman and Wunsch, j Mol Biol 48 443-453 (1970) Comparison matnx BLOSSUM62 from Hentikoff and Hentikoff, Proc Natl Acad Sci USA 89 10915-10919 (1992) Gap Penalty 12 Gap Length Penalty 4
A program useful with these parameters is publicly available as the "gap" program from Genetics Computer Group, Madison WI The aforementioned parameters are the default parameters for peptide comparisons (along with no penalty for end gaps)
Parameters for polynucleotide comparison mclude the following Algorithm Needleman and Wunsch, j Mol Biol 48 443-453 (1970) Comparison matrix matches = +10, mismatch = 0 Gap Penalty 50 Gap Length Penalty 3
Available as The "gap" program from Genetics Computer Group, Madison WI These are the default parameters for nucleic acid comparisons
A preferred meaning for "identity" for polynucleotides and polypeptides, as the case may be, are provided m (1) and (2) below (1) Polynucleotide embodiments further include an isolated polynucleotide compnsmg a polynucleotide sequence havmg at least a 50, 60, 70, 80, 85, 90, 95, 97 or 100% identity to the reference sequence of SEQ ID NO 1 , wherein said polynucleotide sequence may be identical to the reference sequence of SEQ ID NO 1 or may include up to a certain mteger number of nucleotide alterations as compared to the reference sequence, wherem said alterations are selected from the group consistmg of at least one nucleotide deletion, substitution, mcludmg transition and transversion. or insertion, and wherein said alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides m the reference sequence or in one or more contiguous groups withm the reference sequence, and wherein said number of nucleotide alterations is determmed by multiplying the total number of nucleotides m SEQ ID NO 1 by the mteger defining the percent identity divided by 100 and then subtractmg that product from said total number of nucleotides m SEQ ID NO 1, or
nn < xn - (xn • y),
wherem nn is the number of nucleotide alterations, xn is the total number of nucleotides m SEQ ID NO 1, y is 0 50 for 50%, 0 60 for 60%, 0 70 for 70%, 0 80 for 80%, 0 85 for 85%, 0 90 for 90%, 0 95 for 95%, 0 97 for 97% or 1 00 for 100%, and • is the symbol for the multiplication operator, and wherem any non-mteger product of xn and y is rounded down to the nearest mteger pnor to subtractmg it from xn Alterations of a polynucleotide sequence encoding the polypeptide of SEQ ID NO 2 may create nonsense, nussense or frameshift mutations m this codmg sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations
By way of example, a polynucleotide sequence of the present invention may be identical to the reference sequence of SEQ ID NO 1, that is it may be 100% identical, or it may include up to a certain mteger number of nucleic acid alterations as compared to the reference sequence such that the percent identity is less than 100% identity Such alterations are selected from the group consistmg of at least one nucleic acid deletion, substitution, mcludmg transition and transversion, or insertion, and wherem said alterations may occur at the 5' or 3' terminal positions of the reference polynucleotide sequence or anywhere between those terminal positions, mterspersed either individually among the nucleic acids m the reference sequence or m one or more contiguous groups withm the reference sequence The number of nucleic acid alterations for a given percent identity is determmed by multiplying the total number of nucleic acids in SEQ ID NO 1 by the integer defining the percent identity divided by 100 and then subtractmg that product from said total number of nucleic acids m SEQ ID NO 1, or
nn < xn - (xn • ), wherem nn is the number of nucleic acid alterations, xn is the total number of nucleic acids in SEQ ID NO 1, y is, for instance 0 70 for 70%, 0 80 for 80%, 0 85 for 85% etc , • is the symbol for the multiplication operator, and wherem any non-mteger product of xn and y is rounded down to the nearest mteger pnor to subtractmg it from xn (2) Polypeptide embodiments further mclude an isolated polypeptide compnsmg a polypeptide havmg at least a 50,60, 70, 80, 85, 90, 95, 97 or 100% identity to a polypeptide reference sequence of SEQ ID NO 2, wherem said polypeptide sequence may be identical to the reference sequence of SEQ ID NO 2 or may mclude up to a certain mteger number of ammo acid alterations as compared to the reference sequence, wherem said alterations are selected from the group consistmg of at least one ammo acid deletion, substitution, mcludmg conservative and non- conservative substitution, or insertion, and wherem said alterations may occur at the ammo- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, mterspersed either individually among the ammo acids m the reference sequence or in one or more contiguous groups within the reference sequence, and wherein said number of ammo acid alterations is determmed by multiplying the total number of ammo acids in SEQ ID NO 2 by the mteger defining the percent identity divided by 100 and then subtractmg that product from said total number of ammo acids in SEQ ID NO 2, or
na ≤ xa C*a • y)>
wherem na is the number of ammo acid alterations, xa is the total number of ammo acids m SEQ ID NO 2, y is 0 50 for 50%, 0 60 for 60%, 0 70 for 70%, 0 80 for 80%, 0 85 for 85%, 0 90 for 90%, 0 95 for 95%, 0 97 for 97% or 1 00 for 100%, and • is the symbol for the multiplication operator, and wherem any non-mteger product of xa and y is rounded down to the nearest mteger pnor to subtractmg it from xa
By way of example, a polypeptide sequence of the present invention may be identical to the reference sequence of SEQ ID NO 2, that is it may be 100% identical, or it may mclude up to a certain mteger number of ammo acid alterations as compared to the reference sequence such that the percent identity is less than 100% identity Such alterations are selected from the group consisting of at least one ammo acid deletion, substitution, including conservative and non- conservative substitution, or insertion, and wherem said alterations may occur at the ammo- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the ammo acids in the reference sequence or m one or more contiguous groups withm the reference sequence The number of ammo acid alterations for a given % identity is determmed by multiplying the total number of ammo acids in SEQ ID NO 2 by the mteger defining the percent identity divided by 100 and then subtractmg that product from said total number of ammo acids in SEQ ID NO 2, or
na ≤ xa " (xa # y),
wherem na is the number of ammo acid alterations, xa is the total number of amino acids m SEQ ID NO 2, y is, for instance 0 70 for 70%, 0 80 for 80%, 0 85 for 85% etc , and • is the symbol for the multiplication operator, and wherem any non-mteger product of xa and y is rounded down to the nearest mteger pnor to subtractmg it from xa
"Isolated" means altered "by the hand of man" from its natural state, l e , if it occurs m nature, it has been changed or removed from its onginal environment, or both For example, a polynucleotide or a polypeptide naturally present m a living organism is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting matenals of its natural state is "isolated", as the term is employed herem
"Polynucleotide(s)" generally refers to any polynbonucleotide or polydeoxnbonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA "Polynucleotide(s)" mclude, without limitation, smgle- and double-stranded DNA, DNA that is a mixture of smgle- and double- stranded regions or single-, double- and tnple-stranded regions, smgle- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybnd molecules compnsmg DNA and RNA that may be single-stranded or, more typically, double-stranded, or tnple-stranded regions, or a mixture of smgle- and double-stranded regions In addition, "polynucleotide" as used herem refers to tnple-stranded regions compnsmg RNA or DNA or both RNA and DNA The strands m such regions may be from the same molecule or from different molecules The regions may mclude all of one or more of the molecules, but more typically mvolve only a region of some of the molecules One of the molecules of a tnple-hehcal region often is an ohgonucleotide As used herein, the term "polynucleotide(s)" also mcludes DNAs or RNAs as descnbed above that contam one or more modified bases Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotide(s)" as that term is intended herem Moreover, DNAs or RNAs compnsmg unusual bases, such as mos e, or modified bases, such as tiitylated bases, to name just two examples, are polynucleotides as the term is used herem It will be appreciated that a great vanety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill m the art The term "polynucleotide(s)" as it is employed herem embraces such chemically, enzymatically or metabo cally modified forms of polynucleotides, as well as the chemical forms of DNA and RNA charactenstic of viruses and cells, mcludmg, for example, simple and complex cells "Polynucleotide(s)" also embraces short polynucleotides often refened to as ohgonucleotide(s)
"Polypeptide(s)" refers to any peptide or protem compnsmg two or more ammo acids jomed to each other by peptide bonds or modified peptide bonds "Polypeptide(s)" refers to both short chains, commonly refened to as peptides, oligopeptides and o gomers and to longer chains generally refened to as proteins Polypeptides may contam ammo acids other than the 20 gene encoded ammo acids "Polypeptide(s)" mclude those modified either by natural processes, such as processmg and other post-translational modifications, but also by chemical modification techmques Such modifications are well descnbed m basic texts and m more detailed monographs, as well as m a voluminous research literature, and they are well known to those of skill m the art It will be appreciated that the same type of modification may be present m the same or varying degree at several sites m a given polypeptide Also, a given polypeptide may contam many types of modifications Modifications can occur anywhere m a polypeptide, mcludmg the peptide backbone, the ammo acid side-chains, and the ammo or carboxyl termini Modifications mclude, for example, acetylation, acylation, ADP-nbosylation, amidation. covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide denvative, covalent attachment of a hpid or hpid denvative, covalent attachment of phosphotidyhnositol, cross-linking, cychzation, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteme, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, lodination, methylation, mynstoylation, oxidation, proteolytic processmg, phosphorylation, prenylation, racemization, glycosylation, pid attachment, sulfation, gamma- carboxylation of glutamic acid residues, hydroxylation and ADP-nbosylation, selenoylation. sulfation, transfer-RNA mediated addition of ammo acids to proteins, such as arginylation, and ubiquitmation See, for instance, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed , T E Creighton, W H Freeman and Company, New York (1993) and Wold, F , Posttranslational Protem Modifications Perspectives and Prospects, pgs 1-12 m POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B C Johnson, Ed , Academic Press, New York (1983), Serfter et al , Meth Enzymol 182 626-646 (1990) and Rattan et al , Protein Synthesis Posttranslational Modifications and Aging, Ann N Y Acad Sci 663 48- 62 (1992) Polypeptides may be branched or cyclic, with or without branching Cychc, branched and branched circular polypeptides may result from post-translational natural processes and may be made by entirely synthetic methods, as well
'Nanant(s)" as the term is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties A typical vanant of a polynucleotide differs m nucleotide sequence from another, reference polynucleotide Changes m the nucleotide sequence of the vanant may or may not alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Nucleotide changes may result m ammo acid substitutions, additions, deletions, fusions and truncations m the polypeptide encoded by the reference sequence, as discussed below A typical vanant of a polypeptide differs m ammo acid sequence from another, reference polypeptide Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical A vanant and reference polypeptide may differ in ammo acid sequence by one or more substitutions, additions, deletions m any combination A substituted or inserted amino acid residue may or may not be one encoded by the genetic code A variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic vanant, or it may be a variant that is not known to occur naturally Non- naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techmques, by direct synthesis, and by other recombinant methods known to skilled artisans
EXAMPLES The examples below are earned out usmg standard techmques, which are well known and routme to those of skill m the art, except where otherwise descnbed m detail The examples are illustrative, but do not limit the mvention
Example 1 Strain selection, Library Production and Sequencing
The polynucleotide havmg a DNA sequence given m Table 1 [SEQ ID NO 1] was obtained from a library of clones of chromosomal DNA of Streptococcus pneumoniae in E cob
The sequencmg data from two or more clones contaimng overlapping Streptococcus pneumoniae DNAs was used to construct the contiguous DNA sequence m SEQ ID NO 1 Libraries may be prepared by routme methods, for example Methods 1 and 2 below
Total cellular DNA is isolated from Streptococcus pneumoniae 0100993 accordmg to standard procedures and size-fractionated by either of the following two methods Method 1
Total cellular DNA is mechanically sheared by passage through a needle m order to size-fractionate accordmg to standard procedures DNA fragments of up to 1 lkbp m size are rendered blunt by treatment with exonuclease and DNA polymerase, and EcoRI linkers added Fragments are hgated mto the vector Lambda ZapII that has been cut with EcoRI, the library packaged by standard procedures and E coli infected with the packaged library The library is amplified by standard procedures Method 2
Total cellular DNA is partially hydrolyzed with a one or a combination of restnction enzymes appropriate to generate a senes of fragments for cloning mto library vectors (e g , Rsal, Pall, Alul, Bshl235I), and such fragments are size-fractionated accordmg to standard procedures EcoRI linkers are hgated to the DNA and the fragments then hgated mto the vector Lambda ZapII that have been cut with EcoRI, the library packaged by standard procedures, and E coli infected with the packaged library The library is amphfied by standard procedures Example 2
The determination of expression during infection of a gene from Streptococcus pneumoniae
Excised lungs from a 48 hour respiratory tract infection of Streptococcus pneumoniae 0100993 m the mouse is efficiently disrupted and processed in the presence of chaotropic agents and RNAase inhibitor to provide a mixture of animal and bacterial RNA The optimal conditions for disruption and processmg to give stable preparations and high yields of bacterial RNA are followed by the use of hybndisation to a radiolabelled ohgonucleotide specific to Streptococcus pneumoniae 16S RNA on Northern blots The RNAase free, DNAase free, DNA and protein free preparations of RNA obtained are suitable for Reverse Transcription PCR (RT-PCR) using unique primer pairs designed from the sequence of each gene of Streptococcus pneumoniae 0100993 a) Isolation of tissue infected with Streptococcus pneumoniae 0100993 from a mouse animal model of infection (lungs). Streptococcus pneumoniae 0100993 is grown either on TSA/5%horse blood plates or m AGCH medium overnight, 37°C, 5%C02 Bactena are then collected and resuspended m phosphate-buffered saline to an A^oo of approximately 0 4 Mice are anaesthetized with isofluorane and 50ml of bacterial suspension (approximately 2 x 105 bactena) is admimstered lntranasally usmg a pipetman Mice are allowed to recover and have food and water ad libitum After 48 hours, the mice are euthanized by carbon dioxide overdose, and lungs are aseptically removed and snap-frozen in liquid nitrogen b) Isolation of Streptococcus pneumoniae 0100993 RNA from infected tissue samples. Infected tissue samples, in 2-ml cryo-strorage tubes, are removed from -80°C storage mto a dry ice ethanol bath In a microbiological safety cabmet the samples are disrupted up to eight at a time while the remaining samples are kept frozen m the dry ice ethanol bath To disrupt the bactena withm the tissue sample, 50-100 mg of the tissue is transfered to a FastRNA tube contaimng a silica/ceramic matrix (BIO 101) Immediately, 1 ml of extraction reagents (FastRNA reagents, BIO 101) are added to give a sample to reagent volume ratio of approximately 1 to 20 The tubes are shaken in a reciprocating shaker (FastPrep FP120, BIO 101) at 6000 rpm for 20-120 sec The crude RNA preparation is extracted with chloroform/isoamyl alcohol, and precipitated with DEPC-treated/Isopropanol Precipitation Solution (BIO101) RNA preparations are stored in this lsopropanol solution at -80°C if necessary The RNA is pelleted (12,000g for 10 mm ), washed with 75% ethanol (v/v m DEPC-treated water), air-dried for 5-10 mm, and resuspended m 0 1 ml of DEPC-treated water, followed by 5-10 minutes at 55 °C Finally, after at least 1 mmute on ice, 200 units of Rnasin (Promega) is added
RNA preparations are stored at -80 °C for up to one month For longer term storage the RNA precipitate can be stored at the wash stage of the protocol in 75% ethanol for at least one year at -20 °C
Quality of the RNA isolated is assessed by running samples on 1 % agarose gels 1 x TBE gels stained with ethtdium bromide are used to visualise total RNA yields To demonstrate the isolation of bactenal RNA from the infected tissue 1 x MOPS. 2 2M formaldehyde gels are run and vacuum blotted to Hybond-N (Amersham) The blot is then hybridised with a 32P-labelled ohgonucletide probe, of sequence 5' AACTGAGACTGGCTTTAAGAGATTA 3' [SEQ ID NO 5], specific to 16S rRNA of Streptococcus pneumoniae The size of the hybridising band is compared to that of control RNA isolated from in vitro grown Streptococcus pneumoniae 0100993 in the Northern blot Correct sized bacterial 16S rRNA bands can be detected in total RNA samples which show degradation of the mammalian RNA when visualised on TBE gels c) The removal of DNA from Streptococcus pneumoniae-derw' ed RNA. DNA was removed from 50 microgram samples of RNA by a 30 mmute treatment at 37°C with 20 umts of RNAase-free DNAasel (GenHunter) m the buffer supplied m a final volume of 57 microliters
The DNAase was inactivated and removed by treatment with TRIzol LS Reagent (Gibco BRL, Life Technologies) accordmg to the manufacturers protocol DNAase treated RNA was resuspended m 100 microhtres of DEPC treated water with the addition of Rnasin as descnbed before d) The preparation of cDNA from RNA samples derived from infected tissue. 3 microgram samples of DNAase treated RNA are reverse transcribed using a SuperScnpt Preamphfication System for First Strand cDNA Synthesis kit (Gibco BRL. Life Technologies) according to the manufacturers instructions 150 nanogram of random hexamers is used to prime each reaction Controls without the addition of SuperScnptll reverse transcnptase are also run Both +/-RT samples are treated with RNaseH before proceeding to the PCR reaction e) The use of PCR to determine the presence of a bacterial cDNA species. PCR reactions are set up on ice in 0 2 ml tubes by adding the followmg components 43 microhtres
PCR Master Mix (Advanced Biotechnologies Ltd ), 1 microhtre PCR primers (optimally 18-25 basepairs in length and designed to possess similar annealing temperatures), each primer at 10 mM initial concentration, and 5 microhtres cDNA
PCR reactions are run on a Perkm Elmer GeneAmp PCR System 9600 as follows 2 minutes at 94 °C, then 50 cycles of 30 seconds each at 94 °C, 50 °C and 72 °C followed by 7 minutes at 72 °C and then a hold temperature of 20 °C (the number of cycles is optimally 30-50 to determine the appearance or lack of a PCR product and optimally 8-30 cycles if an estimation of the starting quantity of cDNA from the RT reaction is to be made), 10 microhtre ahquots are then run out on 1% 1 x TBE gels stamed with ethidium bromide, with PCR product, if present, sizes estimated by comparison to a 100 bp DNA Ladder (Gibco BRL, Life Technologies) Alternatively if the PCR products are conveniently labelled by the use of a labelled PCR primer (e g labelled at the 5'end with a dye) a suitable aliquot of the PCR product is run out on a polyacrylamide sequencmg gel and its presence and quantity detected using a suitable ge) scanning system (e g ABI Prism™ 377 Sequencer usmg GeneScan software as supplied by Perkin Elmer)
RT PCR controls may mclude +/- reverse transcπptase reactions, 16S rRNA primers or DNA specific primer pairs designed to produce PCR products from non-transcribed Streptococcus pneumoniae 0100993 genomic sequences
To test the efficiency of the pnmer pairs they are used m DNA PCR with Streptococcus pneumoniae 0100993 total DNA PCR reactions are set up and run as described above usmg approx 1 microgram of DNA m place of the cDNA Primer pairs which fail to give the predicted sized product m either DNA PCR or
RT/PCR are PCR failures and as such are umnformative Of those which give the correct size product with DNA PCR two classes are distinguished m RT/PCR (1) Genes which are not transcnbed in vivo reproducibly fail to give a product in RT/PCR, and (2) Genes which are transcribed in vivo reproducibly give the correct size product m RT/PCR and show a stronger signal in the +RT samples than the signal (if at all present) in -RT controls

Claims

What is claimed is:
1 An isolated polynucleotide compnsmg a polynucleotide havmg at least a 70% identity to a polynucleotide encodmg a polypeptide compnsmg the ammo acid sequence of SEQ ID NO 2
2 An isolated polynucleotide compnsmg a polynucleotide having at least a 70% identity to a polynucleotide encodmg the same mature polypeptide expressed by the recJ gene contained in the Streptococcus pneumoniae of the deposited stram
3 An isolated polynucleotide compnsmg a polynucleotide encodmg a polypeptide compnsmg an ammo acid sequence which is at least 70% identical to the ammo acid sequence of SEQ ID NO 2
4 An isolated polynucleotide that is complementary to the polynucleotide of claim 1
5 The polynucleotide of Claim 1 wherem the polynucleotide is DNA or RNA
6 The polynucleotide of Claim 1 compnsmg the nucleic acid sequence set forth m SEQ ID NO 1
7 The polynucleotide of Claim 1 compnsmg nucleotide 1 to the stop codon which begins at nucleotide number 2233 set forth m SEQ ID NO 1
8 The polynucleotide of Claim 1 which encodes a polypeptide compnsmg the ammo acid sequence of SEQ ID NO 2
9 A vector compnsmg the polynucleotide of Claim 1
10 A host cell compnsmg the vector of Claim 9
11 A process for producmg a polypeptide compnsmg expressmg from the host cell of Claim 10 a polypeptide encoded by said DNA
12 A process for producmg a recJ polypeptide or fragment compnsmg cultunng a host of claim 10 under conditions sufficient for the production of said polypeptide or fragment
13 A polypeptide compnsmg an ammo acid sequence which is at least 70% identical to the ammo acid sequence of SEQ ID NO 2
14 A polypeptide compnsmg an ammo acid sequence as set forth m SEQ ID NO 2
15 An antibody against the polypeptide of claim 14
16 An antagomst which inhibits the activity or expression of the polypeptide of claim 14
17 A method for the treatment of an mdividual m need of recJ polypeptide compnsmg admmistenng to the mdividual a therapeutically effective amount of the polypeptide of claim 14 18 A method for the treatment of an mdividual havmg need to inhibit recJ polypeptide compnsmg admmistenng to the mdividual a therapeutically effective amount of the antagomst of Claim 14
19 A process for diagnosing a disease related to expression or activity of the polypeptide of claim 14 m an mdividual compnsmg
(a) determinmg a nucleic acid sequence encodmg said polypeptide, and/or
(b) analyzing for the presence or amount of said polypeptide in a sample denved from the mdividual
20 A method for identifying compounds which interact with and inhibit or activate an activity of the polypeptide of claim 14 compnsmg contacting a composition compnsmg the polypeptide with the compound to be screened under conditions to permit mteraction between the compound and the polypeptide to assess the mteraction of a compound, such mteraction bemg associated with a second component capable of providing a detectable signal m response to the mteraction of the polypeptide with the compound, and determinmg whether the compound interacts with and activates or inhibits an activity of the polypeptide by detectmg the presence or absence of a signal generated from the mteraction of the compound with the polypeptide
21 A method for inducing an immunological response in a mammal which comprises inoculating the mammal with recJ polypeptide of claim 14, or a fragment or vanant thereof, adequate to produce antibody and/or T cell immune response to protect said animal from disease
22 A method of inducing immunological response in a mammal which compnses dehvermg a nucleic acid vector to direct expression of recJ polypeptide of claim 14, or fragment or a vanant thereof, for expressmg said recJ polypeptide, or a fragment or a vanant thereof in vivo in order to induce an immunological response to produce antibody and/ or T cell immune response to protect said ammal from disease
23 An isolated polynucleotide compnsmg a polynucleotide havmg at least a 70% identity to a polynucleotide encodmg a polypeptide compnsmg the ammo acid sequence of SEQ ID NO 4
24 An isolated polynucleotide compnsmg a polynucleotide having at least a 70% identity to the polynucleotide sequence of SEQ ID NO 3
PCT/US1998/024804 1997-11-20 1998-11-20 NOVEL recJ WO1999026959A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2000522116A JP2002504305A (en) 1997-11-20 1998-11-20 New recJ
EP98959529A EP1032582A1 (en) 1997-11-20 1998-11-20 NOVEL recJ

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US6699997P 1997-11-20 1997-11-20
US60/066,999 1997-11-20

Publications (1)

Publication Number Publication Date
WO1999026959A1 true WO1999026959A1 (en) 1999-06-03

Family

ID=22073095

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/024804 WO1999026959A1 (en) 1997-11-20 1998-11-20 NOVEL recJ

Country Status (3)

Country Link
EP (1) EP1032582A1 (en)
JP (1) JP2002504305A (en)
WO (1) WO1999026959A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110093390A (en) * 2018-07-02 2019-08-06 自然资源部第一海洋研究所 The RecJ albumen that there is endonuclease activity by DNA guide guidance and its application in gene editing

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5656432A (en) * 1992-02-10 1997-08-12 Bio Merieux Genomic DNA fragment of Streptococcus pneumoniae, hybridization probe, amplification primer, reagent and method for the detection of Streptococcus pneumoniae
US5858754A (en) * 1989-05-12 1999-01-12 Duke University Methods of analysis and manipulation of DNA utilizing mismatch repair systems

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5858754A (en) * 1989-05-12 1999-01-12 Duke University Methods of analysis and manipulation of DNA utilizing mismatch repair systems
US5656432A (en) * 1992-02-10 1997-08-12 Bio Merieux Genomic DNA fragment of Streptococcus pneumoniae, hybridization probe, amplification primer, reagent and method for the detection of Streptococcus pneumoniae

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
"BOEHRINGER MANNHEIM BIOCHEMICALS.", BOEHRINGER MANNHEIM BIOCHEMICALS CATALOG, XX, XX, 1 January 1991 (1991-01-01), XX, pages 557+A., XP002916307 *
ARRECUBIETA C., LOPEZ R., GARCIA E.: "MOLECULAR CHARACTERIZATION OF CAP3A, A GENE FROM THE OPERON REQUIRED FOR THE SYNTHESIS OF THE CAPSULE OF STREPTOCOCCUS PNEUMONIAE TYPE 3: SEQUENCING OF MUTATIONS RESPONSIBLE FOR THE UNENCAPSULATED PHENOTYPE AND LOCALIZATION OF THE CAPSULAR CLUSTER ON THE PNEUMOCOCCAL CHROMOSOME.", JOURNAL OF BACTERIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 176., no. 20., 1 October 1994 (1994-10-01), US, pages 6375 - 6383., XP002916306, ISSN: 0021-9193 *
DARNELL J., ET AL.: "MOLECULAR CELL BIOLOGY.", MOLECULAR CELL BIOLOGY, XX, XX, 1 January 1986 (1986-01-01), XX, pages 107/108 + 255 - 258 + A., XP002916308 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110093390A (en) * 2018-07-02 2019-08-06 自然资源部第一海洋研究所 The RecJ albumen that there is endonuclease activity by DNA guide guidance and its application in gene editing
CN110093390B (en) * 2018-07-02 2021-08-27 青岛大学 DNA guide-guided RecJ protein with endonuclease activity and application thereof in gene editing

Also Published As

Publication number Publication date
JP2002504305A (en) 2002-02-12
EP1032582A1 (en) 2000-09-06

Similar Documents

Publication Publication Date Title
US6706508B1 (en) Ornithine carbamoyltransferase
US6100069A (en) DNA encoding streptococcus pneumoniae trigger factor polypeptides
EP1037661A1 (en) ribH
EP1034296A1 (en) ribH POLYPEPTIDES AND POLYNUCLEOTIDES
EP1037530A1 (en) ribG
EP1040124A1 (en) Novel abc transporter
US6261817B1 (en) Guaa
EP1032591A1 (en) NOVEL pth
US5885804A (en) PhoH
US6558919B1 (en) AmpS from Streptococus pneumoniae
EP0961778A1 (en) 3-hydroxyacyl-coa dehydrogenase from staphylococcus aureus
EP1038019A1 (en) NOVEL ribB
WO1999026959A1 (en) NOVEL recJ
US6165762A (en) DNA encoding adenine phosphoribosyltransferase from Streptococcus pneumoniae
EP0913478A2 (en) Histidine kinase from Streptococcus pneumoniae 0100993
EP0905249A2 (en) Alcohol dehydrogenase
WO1999036508A1 (en) Histidine kinase
WO2000015769A1 (en) Topa
EP1036188A1 (en) ribG
EP1034276A1 (en) Novel era
WO1999026650A1 (en) ribB
WO2000075357A1 (en) NOVEL aroA
WO1999047537A1 (en) Staphylococcus aureus spo0j2: polynucleotide and protein
WO1998041234A1 (en) Novel compounds
EP0913479A2 (en) Adenine glycosylase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1998959529

Country of ref document: EP

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 522116

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1998959529

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1998959529

Country of ref document: EP