KR101296882B1 - Thermococcus waiotapuensis DNA polymerase variants, and uses thereof - Google Patents

Abstract

The present invention is a DNA polymerase derived from Thermococcus waotapuensis having both DNA polymerization activity and proofreading activity ( Thermococcus). waiotapuensis -derived Mutants of DNA polymerase (hereinafter referred to as ' Twa DNA polymerase'), and more specifically, a point mutation method in which a mutant thermoform of asparagine, the 501st amino acid of Twa DNA polymerase, is substituted with arginine. Caicos Waiotafuensis N501R DNA polymerase ( Thermococcus) waiotapuensis N501R DNA polymerase, Twa N501R DNA polymerase, '' Twa N501R DNA polymerase ') and mutant thermococcus waotapuensis N501K DNA polymerase ( Thermococcus) substituted with lysine as the 501st amino acid asparagine waiotapuensis N501K DNA polymerase, Twa N501K DNA polymerase, '' Twa N501K DNA polymerase '). The present invention also relates to a nucleic acid sequence encoding a Twa DNA polymerase, a vector comprising the nucleic acid sequence, and a microorganism transformed with the vector. The present invention also relates to a vector, and the transformed microorganism with the vector comprising a nucleic acid sequence, said nucleic acid sequence encoding a DNA polymerase and Twa Twa N501R N501K DNA polymerase. In addition, the present invention is the Twa DNA polymerase, Twa N501R DNA Polymerase and Twa A method for producing N501K DNA polymerase. DNA polymerases according to the present invention have a high fidelity as compared to conventional commercial DNA polymerases, in particular Twa N501R DNA Polymerase and Twa N501K DNA polymerase has significantly improved DNA amplification rate and amplification amount than wild type Twa DNA polymerase.

Description

DNA polymerase variants derived from Thermococcus Waiotapuensis strains and their use {Thermococcus waiotapuensis DNA polymerase variants, and uses approximately}

The present invention is hyperthermophilic archaeum thermococcus thermostat ( Thermococcus) waiotapuensis ) strains, and variants thereof, and their use.

DNA polymerase (deoxyribonucleic acid polymerase, DNA polymerase, EC number 2.7.7.7) is an enzyme that synthesizes DNA in the 5 '→ 3' direction depending on template DNA. Or enzymes that play the most important role in DNA repair (see Lehninger, AL et. al ., 1993, Principles of biochemistry, 2 nd ed ., Worth Publishers). DNA polymerase was first discovered in Escherichia coli in 1957 by Kornberg et al., The DNA polymerase found today is DNA polymerase I (Kornberg, A. and Baker, T., 1992, DNA replication). , 2 nd ed ., Freeman Company). The E. coli DNA polymerase Ⅰ (Escherichia coli DNA polymerase I and E. coli DNA polymerase I) are 5 '→ 3' exonuclease activity (5 '→ 3' exonuclease activity, 3 '→ 5' nucleic acid end hydrolase called proofreading activity). It has activity (3 '→ 5' exonuclease activity) and DNA polymerization activity (5 '→ 3' polymerase activity).

Heat-resistant DNA polymerase was introduced by Chien et al. In 1976 by Thermos Aquaticus Waity-1 (Thermus aquaticusAfter the first separation from YT-1), the summer plaus belonging to the same genusThermus flavus), Thermos Thermophilus HB8 (Thermus thermophilus HB8), etc., and their properties were revealed, but did not receive much attention at that time (see Chien, A.).meat get ., 1976,J. Bacteriol . 127, 1550-1557; Kaledin, A. S.meat get., 1981,Biokhimiya 46, 1576-1584; Ruettimann, C.meat get ., 1985,Eur . J. Biochem.149, 41-46). However, in 1988, Saiki et al. Developed a PCR technique using heat-resistant DNA polymerase (see Saiki, R. K.meat get., 1988,Science 239487-491), the heat-resistant DNA polymerase began to attract attention, Summers Caldophyllus ZK24 (Thermus caldophilus GK24), Summer PhilippiThermus filiformisIn addition to thermophilic bacteria such as)Thermococcus litoralis), Thermococcus Mariners (Thermococcus marinus), Thermocaucus guaimasensis (Thermococcus guaymasensis), Pyrococcus puriosusPyrococcus furiosus), Nanoakeum Iquitans (Nanoarchaeum equitans) And Pyrococcus Wassay (Pyrococcus woeseiHeat-resistant DNA polymerase has been competitively researched and developed from ultra-high temperature archaea such as Park, J. H.meat get ., 1993,Eur . J. Biochem . 214, 135-140; Jung, S. E.meat get ., 1997,Mol . Cells 7, 769-776; Kong, H.meat get., 1993,The Journal of Biological Chemistry 168(3), 1965-1975; Bae, H.meat get., 2009,Extremophiles 13657-667; Lee, J. I.meat get., 2009, Enzyme and Microbial Technology45, 103-111; Lundberg, K. S.meat get ., 1991,Gene 108, 1-6; Choi, J. J.meat get., 2008,Appl . Environ . Microbiol.746563-6569; Dabrowski, S. and Kur, J., 1998,Protein Expres . Purif . 14, 131-138). In particular, DNA polymerases derived from S. aureus and Pyrococcus strains have been attracting more attention because they are heat-resistant DNA polymerases with corrective activity, unlike DNA polymerases derived from S. aureus. It is used for.

PCR is a technique for mass amplification of trace amount of template DNA using DNA polymerase and primer, DNA denaturation (94 ° C), primer annealing (40-65 ° C) and DNA synthesis (DNA) extension, 72 ° C.) is repeated 20-30 times in succession. Therefore, the most important factor in the PCR method is the heat-resistant DNA polymerase because it requires high temperature due to the nature of the PCR reaction (see Erlich HA et. al . , 1989, Stockton Press 193208). Heat-resistant DNA polymerase is a very useful enzyme for identification and amplification of genes by PCR, DNA sequencing, clinical diagnosis, etc., including molecular biology and genetic engineering research, early diagnosis of viral and cancer genes, genetic diagnosis and forensic It is used in a wide range of fields, ranging from research, and the demand is increasing day by day.

Current up to very high temperatures sex archaea of Thermo Caucus Waiotapu N-Sys (Thermococcus waiotapuensis ) has not been identified for the nucleotide sequence of the DNA polymerase gene, the characteristics of the heat-resistant DNA polymerase encoded by the gene and the use of this enzyme. Therefore, the present inventors attempted to isolate a novel heat-resistant DNA polymerase gene from the ultra-high temperature thermophilus thermococcus waotapuensis, express the enzyme encoded by the gene in E. coli, and then purify the enzyme properties and use it for PCR. . In addition, efforts to develop a DNA polymerase that increased the amplification rate of thermococcus wyo-tafuensis DNA polymerase resulted in high fidelity and accuracy of DNA polymerase variants which caused mutations at specific sites. While confirming that the amplification speed is increased and completed the present invention. This is of significant significance for the industrial use of novel heat resistant DNA polymerases to enable short PCR.

It is an object of the present invention to provide a novel thermococcus waotafuensis derived DNA polymerase, and variants thereof. It is another object of the present invention to provide a vector comprising a nucleic acid molecule encoding the Twa DNA polymerase variant and E. coli transformed with the vector.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

The present invention is Thermococcus Waiotapuensis ( Thermococcus waiotapuensis ) provides a Twa DNA polymerase variant, characterized in that the 501st amino acid of the DNA polymerase (derived) is mutated.

In one embodiment of the present invention, the amino acid variation is characterized in that asparagine (501) amino acid (asparagine) is substituted with arginine (arginine) or lysine (lysine).

In another embodiment of the present invention, the variant is characterized by having the amino acid sequence of SEQ ID NO: 23 and 25, respectively.

The present invention also provides a nucleic acid molecule encoding the Twa DNA polymerase variant.

In one embodiment of the present invention, the nucleic acid molecule is characterized by having the nucleotide sequence of SEQ ID NO: 22 or 24.

The present invention also provides a pTWAN501R vector and a pTWAN501K vector comprising the nucleic acid molecule.

The present invention also provides Rosetta (DE3) pLysS / pTWAN501R (Accession No. KACC95108P) Escherichia coli, transformed with the pTWAN501R vector and Rosetta (DE3) pLysS / pTWAN501K (Accession No. KACC95107P) Escherichia coli, transformed with the pTWAN501K vector. .

In addition, the present invention is the Twa It provides a kit comprising a DNA polymerase variant.

Since the Twa DNA polymerase of the present invention has high correction activity, it can be widely used for various nucleic acid polymerization reactions such as PCR. In addition, the Twa N501R DNA polymerase and the Twa N501K DNA polymerase of the present invention significantly improved the PCR efficiency and amplification speed compared to the conventional Twa DNA polymerase. Therefore, the Twa DNA polymerase variants of the present invention are expected to be applied in a wide range of fields such as genetic engineering research, early diagnosis of viral and cancer genes, genetic disease diagnosis, GMO and forensic research.

1 is a schematic diagram showing the construction of a recombinant plasmid pTWAM for the expression of Twa DNA polymerase gene. An active Twa DNA polymerase gene was inserted into plasmid pET-20b (+).
Figure 2 is a diagram showing the results of SDS modified gel electrophoresis according to the purification step of the active Twa DNA polymerase expressed in E. coli. Figure 2 (a) shows the purification step from the expression product derived from recombinant plasmid pTWAM, Figure 2 (b) is a purified picture of the Twa mutant DNA polymerase.
Figure 3 is a graph showing the relative degree of DNA polymerization activity according to the pH of the active Twa DNA polymerase.
Figure 4 is a graph showing the relative degree of DNA polymerization activity according to the temperature of the active Twa DNA polymerase.
5 is a graph showing the relative degree of DNA polymerization activity according to the MgCl ₂ concentration of the active Twa DNA polymerase.
6 is a graph showing the relative degree of DNA polymerization activity according to the KCl concentration of the active Twa DNA polymerase.
Figure 7 is a graph showing the relative thermal stability of the active Twa DNA polymerase at 94 ℃ and 99 ℃.
8 is a graph showing the 3'5 'nucleic acid terminal hydrolase activity of the active Twa DNA polymerase.
FIG. 9 is a diagram showing results according to pH in polymerase chain reaction (PCR) using active Twa DNA polymerase (FIG. 9 (a)) and Twa N501R DNA polymerase (FIG. 9 (b)).
10 is a diagram showing the results according to the concentration of MgCl ₂ in the polymerase chain reaction (PCR) using the active Twa DNA polymerase (Fig. 10 (a)) and Twa N501R DNA polymerase (Fig. 10 (b)) .
11 is a graph showing the results according to the KCl concentration in the polymerase chain reaction (PCR) using the active Twa DNA polymerase (FIG. 11 (a)) and Twa N501R DNA polymerase (FIG. 11 (b)).
FIG. 12 shows (a) polymerase chain reaction (PCR) using lambda phage genomic DNA as a template using active Twa , Twa N501R, Twa N501K, Twa N501D, Twa N501E and Twa N501A DNA polymerases under optimal PCR buffer. As a result, and (b) Pfu DNA polymerase ( Pfu ), Vent DNA polymerase (Vent), active Twa DNA polymerase ( Twa ) and Twa N501R DNA polymerase ( Twa N501R) is a view showing the results of the polymerase chain reaction.
13 is a polymerase chain reaction with an amplification time of min / kb to investigate the amplification length of PCR using an active Twa DNA polymerase and Twa N501R DNA polymerase under an optimal PCR buffer using lambda phage genomic DNA as a template. Is a view showing the results of the operation.

The present inventors OTA the thermopile Rhodococcus and this type of very high temperature property archaea (hyperthermophilic archaea) Fu N-Sys (Thermococcus waiotapuensis ) to study the characteristics of the novel DNA polymerase derived from the industrial use has been completed the present invention.

The present inventors have developed a Twa DNA polymerase gene from a genomic DNA of Thermococcus waotapuensis in order to develop a DNA polymerase ( Twa DNA polymerase) of thermococcus waotafuensis that has not been reported to date. Was selected, and it was confirmed that 4,404 bp including the stop sequence by the sequencing of the gene (SEQ ID NO: 18), consisting of 1,467 amino acids inferred from the gene sequence (SEQ ID NO: 19) was confirmed. As a result of comparative analysis of known DNA polymerase and amino acid sequence, Twa DNA polymerase is a novel heat resistant B series having high amino acid sequence homology with conventional heat resistant B type DNA polymerase. It was confirmed that the DNA polymerase. In addition, the inventors of the amino acid sequence 492 to 1023 amino acid sequence (532 amino acids) and 1073 to 1234 amino acid sequence (162 amino acids) corresponds to the intein (intein), splicing in protein expression ( It was confirmed that the active Twa DNA polymerase (SEQ ID NO: 21) having 773 amino acids from which the intein was cleaved by splicing) was produced. Therefore, an expression vector containing the gene (SEQ ID NO: 20) from which the intein coding region was removed was prepared, and Escherichia coli ) was cloned (cloning) to express the active Twa DNA polymerase (wild type, wild type). Then, the expressed DNA polymerase was purified by a method such as heat treatment and column chromatography. Subsequently, the purified Twa DNA polymerase is 5 ′ → 3 ′ polymerase activity, which is a DNA polymerization activity, as well as 3 ′ → 5, which is called proofreading activity. It was confirmed that the 'nucleic acid terminal hydrolase activity (3' → 5 'exonuclease activity), and the optimum activity conditions were examined by examining various enzyme properties of Twa DNA polymerase. Also, Twa Twa purified using DNA polymerase to perform polymerase chain reaction (PCR) with genomic DNA of lambda phage as a template. It was confirmed that the DNA polymerase can be used for PCR. Especially Twa DNA polymerase was confirmed to have a better correction function than Pfu DNA polymerase, which has been reported to have high commercial activity. But Twa As a result of examining the PCR efficiency characteristics of DNA polymerase, it was confirmed that DNA amplification speed was faster than that of commercial Pfu DNA polymerase, but slower than Vent DNA polymerase. In addition, DNA amplification efficiency was confirmed to be low. Thus Twa In order to improve the DNA amplification rate and amplification rate of DNA polymerase, A382, palm domain of DNA-binding motif of the active Twa DNA polymerase gene was used by using QuikChange site-directed mutagenesis method. Various variants were produced by inducing point mutations by targeting the residues H633 and N688 of the N501, D601, and Thumb domains. The present invention relates to wild-type Twa by deletion, insertion, non-conservative or conservative substitution, addition or combination thereof of some sequences at one or more positions. Protein variants having a sequence different from the amino acid sequence of a DNA polymerase are included within the scope of the present invention. In addition, the Twa DNA polymerase of the present invention includes the modified form of phosphorylation, sulfidation, acrylated, glycosylated, methylated, farnesylated and the like within the scope of the present invention. The variant or modification may be a functional equivalent having substantially the same activity as the wild type protein or a form with increased or decreased physicochemical properties. For example, variants with enhanced enzyme activity. Or physical factors such as temperature, moisture, pH, electrolyte, reducing sugar, pressurization, drying, freezing, interfacial tension, light, repetition of freezing and thawing, high concentration conditions, acid, alkali, neutral salt, organic solvent, metal ion, oxidation It is a variant with enhanced structural stability to the external environment of chemical factors such as reducing agents and proteases.

The present invention also provides information on the base sequence encoding the Twa DNA polymerase. Specifically, the Twa A nucleic acid molecule encoding a DNA polymerase. The Twa DNA polymerase having the amino acid sequence of SEQ ID NO: 21 preferably has the nucleic acid sequence of SEQ ID NO: 20.

The present invention also provides information on the nucleotide sequence encoding the Twa N501R DNA polymerase. Specifically, the Twa A nucleic acid molecule encoding an N501R DNA polymerase. Twa having the amino acid sequence of SEQ ID NO: 23 DNA polymerase preferably has the nucleic acid sequence of SEQ ID NO: 22.

The mutant gene was inserted into an expression vector and used for protein expression. Accordingly, the present invention provides a recombinant vector comprising a nucleic acid molecule encoding the Twa DNA polymerase, and a recombinant vector comprising a nucleic acid molecule encoding Twa N501R DNA polymerase and Twa N501K DNA polymerase.

As used in the present invention, "vector" is a kind of nucleic acid molecule, which means that it can be combined with another nucleic acid and transferred to a host cell to express a target protein. Vectors of the present invention include all conventional vectors, including plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like. Suitable vectors are plasmid vectors. In the present invention, the recombinant plasmid pTWAM (see FIG. 1) was prepared using pET-20b (+), which is a kind of plasmid vector, as an expression vector.

Specifically, the present invention provides a vector, which is a pTWAM expressing an active Twa DNA polymerase having the amino acid sequence of SEQ ID NO: 20 from which the intein region is removed. The present invention also provides a vector, pTWAN501R, which expresses Twa N501R DNA polymerase, which has a point mutation of 501th asparagine (Asn) of the active Twa DNA polymerase with arginine (Arg). The present invention also provides a vector which is a pTWAN501K expressing a Twa N501K DNA polymerase which has a point mutation of the 501th asparagine (Asn) of the active Twa DNA polymerase with lysine (Lys).

The present invention also provides a microorganism transformed with the vectors. Microorganisms usable as host cells that can be transformed are not particularly limited. For example, Escherichia various microorganisms, such as coli), Rhodococcus (rhodococcus), Pseudomonas (Pseudomonas), Streptomyces (Streptomyces), Staphylococcus (Staphylococcus), when Poller bus (Syfolobus), Thermo plasma (Thermoplasma), Thermo Proteus (Thermoproteus) It includes. Preferably, as E. coli, E. coli XL1-blue, E. coli BL21 (DE3), E. coli JM109, E. coli DH series, E. coli TOP10, E. coli HB101 and the like.

Specifically, the present invention, Escherichia coli which is a microorganism transformed with pTWAN501R coli ) Rosetta (DE3) pLysS / pTWAN501R. Escherichia coli Rosetta (DE3) pLysS / pTWAN501R was deposited on August 29, 2011 at KACC (Korean Agricultural Culture Collection, 88-20 Seodun-dong, Gwonseon-gu, Suwon-si). It also includes Escherichia coli Rosetta (DE3) pLysS / pTWAN501K, a microorganism transformed with pTWAN501K. Escherichia coli Rosetta (DE3) pLysS / pTWAN501K was deposited on August 29, 2011 at KACC (Korean Agricultural Culture Collection, 88-20 Seodun-dong, Gwonseon-gu, Suwon-si).

Vector introduction into host cells can be carried out by known methods such as electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, PEG, textlan sulfate, lipofectamine, and the like.

In one embodiment of the present invention it was confirmed that the DNA amplification and amplification rate was significantly increased in the N501 variant of the palm domain estimated to be involved in the binding of dNTPs among the variants. Especially Twa among the variants N501R DNA polymerase and Twa N501K DNA polymerase were found to significantly increase the amount of DNA amplification and amplification rate during PCR (see Example 11). Through the above results, it was confirmed that the Twa DNA polymerase variant of the present invention had significantly higher PCR amplification speed, amplification rate, and fidelity than conventional DNA polymerase.

Specifically, lambda phage as a template with the Twa DNA polymerase of the present invention under a reaction buffer consisting of 50 mM Tris-HCl, pH 8.2, 2.0 mM MgCl ₂ , 30 mM KCl, 0.01% TritonX-100, and 0.005% BSA. PCR was performed using genomic DNA of lambda phage, resulting in efficient DNA amplification. However, the Twa DNA polymerase of the present invention has a pH 6.0, a temperature of 75 ℃, 70 mM KCl concentration and 8 mM Mg ^{2 +} concentration, 5 mM (NH ₄ ) ₂ SO ₄ of the physical activity showing the optimum, Has chemical properties The enzyme activity was measured using activated calf thymus DNA as a template and radioisotope [ methyl - ³ H] thymidine 5′-triphosphate was used as a substrate. Therefore, there is a slight difference between the optimal activity condition of the enzyme itself and the optimal condition of PCR.

Meanwhile, Twa For N501R DNA polymerase, PCR was performed with the template of genomic DNA of lambda phage under reaction buffer consisting of 50 mM Tris-HCl (pH 8.6), 2.0 mM MgCl ₂ , 0.01% TritonX-100, and 0.005% BSA. DNA amplification occurred efficiently. In addition, the results of PCR performed using stop by Twa DNA polymerase and these variants under the PCR buffer solution, a variant of Twa N501R DNA Polymerase and Twa N501K DNA polymerase was much better in PCR efficiency than Twa DNA polymerase, so it was possible to amplify 2 kb of DNA within 10 seconds, and after 30 seconds, the amount of amplification increased significantly (see Example 11). Especially Twa N501R DNA polymerase was found to efficiently amplify 2 kb of DNA in a short time compared to commercially available Pfu DNA polymerase and Vent DNA polymerase (see Example 11), and is also commercially available. It was found to exhibit high fidelity with significantly lower error rates than Pfu and Taq DNA polymerase products (see Example 13).

Accordingly, the present invention provides a Twa DNA polymerase variant, characterized in that the 501st amino acid of Thermococcus waiotapuensis- derived DNA polymerase is modified. In one embodiment of the present invention, the amino acid variation is characterized in that asparagine (501) amino acid (asparagine) is substituted with arginine (arginine) (SEQ ID NO: 23) or lysine (SEQ ID NO: 25).

The present invention also provides information on the nucleotide sequence encoding the Twa N501K DNA polymerase. Specifically, the Twa A nucleic acid molecule encoding an N501K DNA polymerase. Twa having the amino acid sequence of SEQ ID NO: 25 DNA polymerase preferably has the nucleic acid sequence of SEQ ID NO.

The present invention differs from the nucleic acid sequence, but the Twa disclosed in the present invention. Nucleic acid sequences encoding polypeptides of the same sequence as the active DNA polymerase are also included within the scope of the present invention.

In another aspect, the present invention provides a kit comprising a Twa DNA polymerase variant with significantly improved amplification speed, amplification amount and accuracy. The kit is characterized in that it is used for gene amplification, virus gene diagnosis, early diagnosis of cancer genes, genetic disease diagnosis, GMO diagnosis, etc., but is not limited thereto.

Specifically, Twa of the present invention N501R DNA Polymerase and Twa N501K DNA polymerase can be used as a kit component of nucleic acid amplification reactions. Such nucleic acid amplification reactions include polymerase chain reation (PCR), ligand chain reaction (LCR), nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR), strand displacement amplification (SDA), and branched DNA signal amplification. (branched DNA signal amplification), nested PCR (nested PCR), multiplex PCR (multiplex PCR) and the like.

The kit for nucleic acid amplification reaction of the present invention, in addition to the Twa N501R DNA polymerase and Twa N501K DNA polymerase, includes one or more other components, solutions, or devices suitable for analytical methods. For example, the kit of the present invention may include one or more components selected from a container containing a detection primer, an amplification tube or container, a reaction buffer, dNTPs, RNase, sterile water, and the like.

A kit comprising a DNA polymerase and Twa Twa N501R N501K DNA polymerase of the present invention can be utilized is useful in various fields such as genetic engineering and molecular biology experiments, clinical diagnosis, forensic studies.

In another aspect, the present invention provides a method for producing Twa N501R DNA polymerase and DNA polymerase Twa N501K.

Twa N501R DNA polymerase and Twa N501K DNA polymerase of the present invention into a host suitable for the vector coding for the method, a chemical synthesis method or Twa N501R DNA polymerase and Twa N501K DNA polymerase prepared by separation from a source of natural origin It can be prepared by the method of introducing and expressing and then separating from it.

Twa N501R system for producing a DNA polymerase, and Twa N501K expression vector that can efficiently express a DNA polymerase and expressed it in a microorganism are well known to those skilled in the art, it can be implemented by various modifications / applications. One example of such an implementation is as follows.

Twa N501R DNA polymerase and Twa N501K DNA polymerase are prepared by (i) preparing a vector expressing Twa DNA polymerase and Twa N501R DNA polymerase; (ii) transforming the vector with a microorganism; (iii) culturing the transformant; And (iv) may be prepared by a process comprising the step of recovering the protein from the transformant.

The type of vector in step (i), the method for transforming the vector in step (ii) and the type of microorganism used as a host cell are as described above.

The culturing process of step (iii) is carried out according to a method well known for the type of microorganism used as a transformant, and the conditions such as the medium component, the culture temperature and the culture time can be appropriately adjusted. Specifically, the culture medium contains all the nutrients essential for the growth and survival of microorganisms such as carbon sources, nitrogen sources, trace element components and the like. The pH of the medium can be adjusted appropriately, and components such as antibiotics can be included.

Further, by processing the inducing agent (inducer) such as isopropyl Im Dwarf (referred to as isopropyl-β- _D -thiogalactopyranoside, hereinafter 'IPTG') Lactobacillus pyrano side can induce the expression of the protein. The type of inducer to be treated may be determined according to the vector system, and conditions such as the induction agent administration time and dosage may be appropriately controlled.

In step (iv) the protein is recovered and purified in a conventional manner. For example, the cells recovered by the centrifugation method are crushed using a French press, an ultrasonic crusher or the like. If protein is secreted into the culture, the culture supernatant is collected. When aggregated by overexpression, it can be obtained by dissolving, denaturing and refolding the protein in the appropriate solution. Oxidation and reduction systems of glutathione, dithiothreitol, β-mercaptoethanol, cystine and cystamine are used, and refolding agents such as urea, guanidine, arginine and the like are used. Some of the salts may be used in conjunction with refolding agents.

At this time, a step of heat treatment for 10 to 60 minutes at 70 to 85 ℃ can be added.

Proteins obtained by culturing the transformant can be used without purification, and conventional biochemical separation techniques, for example, treatment with protein precipitants (salting), centrifugation, sonication, ultrafiltration, dialysis, chromatography Photography and the like can be used alone or in combination. Chromatography includes ion exchange chromatography, size exclusion chromatography, affinity chromatography, and the like.

The scale of the protein manufacturing process can be adjusted to suit the purpose. In addition, there may be additional and charging processes between each process.

Thus obtained protein can be converted into a salt by a well-known method when obtained as a free body, and when obtained into a salt, it can be converted into a free body or another salt by a well-known method.

In a specific embodiment of the present invention, the cells were recovered by centrifugation of the cultured cells, and then disrupted by ultrasonication and subjected to column chromatography using a HisTrap ^TM HP column (GE Healthcare) and a HiTrap ^TM SP HP column (GE Healthcare) after heat treatment. Obtained by the process performed.

Proteins obtained by this process exist in a "substantially pure" state that is sufficiently separated from other proteins in a physical environment that is distinct from the naturally occurring environment. The protein prepared by the above method can be used as a heat-resistant enzyme having excellent DNA polymerization activity in a wide range of fields from molecular biology and genetic engineering experiments to early diagnosis of viral and cancer genes, genetic disease diagnosis and forensic research.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Example ]

Example  One. Thermococcus Waiotapuensis  Culture of strain

Thermococcus thermococcus wiotapuensis strain (DSM 12768) was cultured in DSMZ 934 medium. DSMZ 934 medium (1.5 g NaCl per 1 L, MgCl ₂ 5.8 g, Na ₂ SO ₄ 4.0 g, CaCl ₂ 1.5 g, KCl 0.7 g, Na ₂ CO ₃ 0.2 g, NaHCO ₃ 0.2 g, KBr 0.1 g, SrCl ₂ 0.025 g, H ₃ BO ₃ 0.03 g, Resazurin 0.1 mg ) Was then adjusted to pH 7.0 with 5 N sulfuric acid. Peptone, yeast extract and elemental sulfur were separately prepared in 10% stock. The solution was heated in an incubator at 100 ° C. for 8 hours to sterilize and remove oxygen in the solution. Some of the precipitate formed after the heating was filtered quickly and again heated for 3 hours in the 100 ℃ incubator. 0.5 g of elemental sulphur (5 g / L) and 100 mL of the heated medium solution are added together to a 120 mL serum bottle (Wheaton Co., USA) and the gas inside the serum bottle containing the medium solution as nitrogen gas. After 30 minutes of exchange, the bottle cap was sealed with a rubber bottle cap and an aluminum ring, and then sterilized at 95 ° C. for 24 hours. Sterilized peptone (5.0 g / L) and yeast extract (1.0 g / L) were added to the medium thus prepared using a sterilized syringe, and then a small amount of 5% Na ₂ S9H ₂ O solution was injected, followed by thermococcus waota After inoculating 1% Fuensis strains, the cells were incubated at 80 ° C for 24 hours.

Example  2. Genomic DNA Extraction of

Cultures cultured under anaerobic conditions were filtered to remove sulfur, and the cells were recovered by centrifugation. The cells were suspended in SET (150 mM NaCl, 1 mM EDTA, 20 mM Tris-HCl (pH 8.0)) buffer, and then reacted for 1 hour at 55 ° C by adding SDS and RNase, followed by protease K (proteinase K). ) Was added and reacted at 37 ° C for 1 hour and 55 ° C for 2 hours. After adding the same amount of chloroform / isoamyl alcohol (24: 1) solution, the reaction was stirred overnight while shaking, followed by 2 volume of 100% ethanol and 1/10 volume of 3M sodium acetate (sodium acetate) , pH 5.2) was added to precipitate genomic DNA, washed with 70% ethanol, dried in vacuo, and suspended in TE (10 mM Tris-HCl (pH 7.6), 1 mM EDTA) buffer. . The extracted thermococcus waotapuensis genomic DNA was quantified by measuring absorbance at 260 nm wavelength.

Example  3. DNA  Screening of Polymerase Genes

Example 2 carried out by the following method to extract selectively the Twa DNA polymerase gene from genomic DNA, Thermo Lactococcus Waiotapu N-Sys it to the genomic DNA as a template, the thermodynamic Lactococcus coder reported previously Karen cis source code (Thermococcus kodakaraensis KOD1), Takagi M. et al ., 1997, Appl . Environ . Microbiol . 63 (11), 4504-4510), Thermococcus sp. NA1 (Kim YJ et. al ., 2007, J Microbiol Biotechnol . 17 (7). 1090-1097), and Pyrococcus furiosus ) (Lundberg, KS et al ., 1991, Gene primers 1 and 2 were prepared by referring to two regions of the amino acid sequence of a well-conserved region of the DNA polymerase genes of Gene 108 (1), 1-6). . The primer of SEQ ID NO: 1 is a nucleotide sequence encoding the amino acid sequence EYDIPFA. The primer of SEQ ID NO: 2 is a complementary sequence of the nucleotide sequence encoding the amino acid sequence YYIENQV. PCR was performed using the primer set as a template for thermococcus waotafuensis genomic DNA. The PCR was performed for 3 minutes at 94 ° C., 1 min at 94 ° C., 1 min at 45 ° C., and 5 min at 72 ° C. for 7 minutes, followed by 1 min at 94 ° C., 1 min at 50 ° C., and the like. The reaction process was repeated 23 times at 72 ° C. for 5 minutes, and extended to 72 minutes at 72 ° C. for 10 minutes. PCR amplification products were confirmed by electrophoresis on 0.8% agarose gel (agarose gel), it was confirmed that the DNA fragment of about 3.9 kb was amplified. Amplified DNA was purified from the 0.8% agarose gel using MEGAquick-spin ^™ PCR & Agarose Gel DNA Extraction Kit (iNtRON Biotechnology, Korea). As a result of requesting Solgent Co., Ltd. for DNA sequencing of the purified DNA, it was confirmed that it shows high homology with DNA polymerase sequences of other known species. Through the above results, it was confirmed that the obtained DNA fragment of 3.9 kb is a part of the Twa DNA polymerase gene of Thermococcus waotapuensis . Therefore, the DNA fragment was used as the center for screening the Twa DNA polymerase gene of Thermococcus watafuensis .

SEQ ID NO: 1 (T-111N primer): 5'-GAA (G) TACGACATACCCTTC (T) GC-3 '

SEQ ID NO: 2 (T-CR primer): 5'-AACCTGGTTCTCA (G) ATA (G) TAGTA-3 '

Example  4. primer walking ( primer walking ) Method Twa DNA  Unknown contiguous from above core of polymerase gene DNA  Search for site (N term and C terminus)

Twa obtained in Example 3 Four internal primers were prepared based on DNA sequence of 3.9 kb of DNA polymerase gene (SEQ ID NOs: 3, 4, 5, and 6 primers). The Walking SpeedUp ^™ Premix Kit (seegene, Korea) was used to find unknown adjacent sequences. Twa In order to clone the gene region corresponding to the 5 'upstream (N-terminal region) of the DNA polymerase gene, four random primers of the Walking SpeedUp ^TM Premix Kit, Twa-N1 primer and thermo The first PCR was performed using Caucus Waiotafuensis genomic DNA. As a template, a second PCR was performed using a primer of SEQ ID NO: 4 (Twa-N2 primer) and a second PCR primer in a kit, and the PCR amplification product was applied to 0.8% agarose gel. As a result of electrophoresis, DNA fragments of about 1,100 bp were amplified. The amplified DNA was extracted and purified using DMEGAquick-spin ^™ PCR & Agarose Gel DNA Extraction Kit (iNtRON Biotechnology, Korea), and then sequencing was determined by Solgent. Through the above results, the base sequence in the 5 'upstream (N-terminal part) including the start codon was obtained.

In addition, four random primers in the Walking SpeedUp ^TM Premix Kit and primers of SEQ ID NO: 5 (Twa-) were used to clone the gene region corresponding to the unknown 3 'downstream (C terminal region) adjacent to the nucleotide sequence on the conserved core. The first PCR was performed using C1 primer) and Thermococcus waotapuensis genomic DNA. Using the PCR product as a template, a second PCR was performed using a primer of SEQ ID NO: 6 (Twa-C2 primer) and a second PCR primer in a kit, and the PCR amplification product was transferred to 0.8% agarose gel. As a result of confirming, the DNA fragment of about 900 bp was amplified. The amplified DNA was extracted and purified using a MEGAquick-spin ^™ PCR & Agarose Gel DNA Extraction Kit (iNtRON Biotechnology, Korea), and then submitted to Solgent Co., Ltd. to determine the base sequence. Through the above results, the nucleotide sequence in the 3 'upstream (terminal C) portion including the stop codon was obtained.

Finally, the total sequence encoding the Twa DNA polymerase gene was determined through the above results (SEQ ID NO: 18). The entire nucleotide sequence of the Twa DNA polymerase gene was composed of 4,404 bp including the start codon (ATG) and the stop codon (TGA), and the total amino acid was 1,467 (SEQ ID NO: 19). A total of 773 amino acids of the active DNA polymerase, consisting of three fragments of extein except for 532 amino acids and 162 amino acids (SEQ ID NO: 21), were identified as the base sequence of the active Twa DNA polymerase. Initiation codons (ATG), including stop codons (TGA) was composed of a total of 2322 bp (SEQ ID NO: 20). The molecular weight converted from the active Twa DNA polymerase gene DNA sequence of the present invention into the sequence of the amino acid was 90,000.037 Da. In addition, thermococcus thermococcus The amino acid sequence of the Twa DNA polymerase isolated from the strain wiotapuensis ) showed very high similarity with the B family type DNA polymerase derived from the thermococcus strain.

SEQ ID NO: 3 (Twa-N1 primer): 5'-CGTAGCTTATCATCAGGATAG-3 '

SEQ ID NO: 4 (Twa-N2 primer): 5'-GAGCGTCTCGATGTCGAAGGC-3 '

SEQ ID NO: 5 (Twa-C1 primer): 5'-ACGTGGCCGTTGCAAAACGT-3 '

SEQ ID NO: 6 (Twa-C2 primer): 5'-TAAGCTACATAGTGCTCAAA-3 '

Example  5. Twa DNA  Expression vector for expression of polymerase gene pTWAM Build

In order to obtain a Twa DNA polymerase, a recombinant plasmid (pTWAM) in which an active Twa DNA polymerase gene was inserted into an expression vector in which an intein coding site was removed and only the extend coding sites were connected in sequence was constructed as follows. . A schematic diagram of the construction of the recombinant plasmid is shown in FIG. 1.

Active Twa without Intein To synthesize the DNA polymerase gene, the coding region (1,473 bp fragment) of the N-terminal extend region (N-extein, 1-491 amino acid sequence), and the middle extend region (M-extein, 1024-1072 amino acid sequence) Amplification of the coding region (147 bp fragment) and the coding region (699 bp fragment) of the C-terminal extend region (C-extein, 1235-1468 amino acid sequence) was performed by PCR, followed by electrophoresis on 0.8% agarose gel. Each was recovered. After mixing and annealing the three kinds of DNA fragments, the active type Twa from which the intein was removed using a primer of SEQ ID NO: 7 (Twa 1F primer) and a primer of SEQ ID NO: 8 (Twa 3R primer) DNA polymerase genes (2,319 bp fragment, except stop codon) were amplified.

More specifically, the Twa 1F primer (5 'terminal primer) and the C-terminal amino acid sequence encoding the N-terminal amino acid sequence from the base sequence of the Twa DNA polymerase gene determined in Example 4 SEQ ID NO: 8 primer (Twa 3R primer) (3 'terminal primer) complementary to the DNA base was prepared, respectively. SEQ ID NO: 7 primer contains the start codon (ATG) and restriction enzyme Nde I cleavage sequence of the Twa DNA polymerase gene, SEQ ID No. 8 primer was prepared to include the restriction enzyme Sal I cleavage sequence. In addition, a primer (Twa 1R primer, SEQ ID NO: 9) complementary to the 3 'end of the coding region (1,473 bp) of the N-terminal extend region (N-extein, 1-491 amino acid sequence) was prepared. Was constructed with 36 bases, including 15 base sequences complementary to the 5 'end of the middle extend region coding region. Subsequently, PCR was performed in the same manner as in Example 3 using the Thermococcus waotapuensis genomic DNA as a template, using SEQ ID NOs. 7 and 9, followed by electrophoresis on a 0.8% agarose gel to give an N terminal of 1,473 bp. DNA fragments encoding the extein region were amplified, and PCR amplification products were confirmed by electrophoresis on a 0.8% agarose gel, and then purified and recovered using a QIAquick Gel Extraction Kit (Qiagen Gmbh, Germany).

A primer complementary to the 5 'end of the coding region of the middle extend region (M-extein, 1024-1072 amino acid sequence) (Twa 2F primer, SEQ ID NO: 10) and a primer complementary to the 3' end (Twa 2R primer, SEQ ID NO: 11) was newly prepared, and the SEQ ID NO: 10 primer was prepared from 36 bases including 21 nucleotide sequences complementary to the 3 'end of the N-terminal extend coding region. 34 bases were constructed, including 17 base sequences complementary to the 5 'end of. Thereafter, PCR was carried out in the same manner as in Example 3 using the Thermococcus waotapuensis genomic DNA as a template, using SEQ ID NOs: 10 and 11, followed by electrophoresis on agarose gel in the same manner as described above. The DNA fragment encoding the middle extin of 147 bp was recovered.

A primer complementary to the 5 'end of the coding region of the C-terminal extend region (C-extein, 1235-1468 amino acid sequence) (Twa 3F primer, SEQ ID NO: 12) was newly constructed, and SEQ ID NO: 12 primer was the middle extein encoding 34 bases were constructed, including 17 base sequences complementary to the 3 ′ end of the site. Subsequently, PCR was carried out in the same manner as described above using Thermococcus waotapuensis genomic DNA as a template using SEQ ID NOs: 8 and 12, and electrophoresed onto agarose gel to encode 699 bp C terminal extein. DNA fragments were recovered.

After mixing and annealing the DNA fragments encoding the three types of extenders in a 1: 1: 1 ratio, the DNA was used as a template to sequence the primers SEQ ID No. 7 and SEQ ID NO. PCR was performed using the Twa 3R primer in the same manner as described above, followed by electrophoresis on agarose gel to obtain an active DNA polymerase gene (except stop codon) from which the intein region of the 2,319 bp fragment was removed. It was.

The active Twa DNA polymerase gene fragment was combined with an expression vector pET-20b (+) (Novagen, USA) digested with the same restriction enzyme and a T4 DNA ligase to prepare a recombinant plasmid. The recombinant plasmid was transformed into E. coli Rosetta (DE3) pLysS (Stratagene, USA) and transformed. Plasmid DNA was isolated from the transformants by alkaline lysis, and then digested with restriction enzymes Nde I and Sal I, followed by electrophoresis with DNA size markers on 0.8% agarose gel for active Twa DNA polymerization. It was again confirmed that the enzyme gene was correctly inserted into the expression vector. The expression vector for expression of the active Twa DNA polymerase gene constructed as described above was named pTWAM.

SEQ ID NO: 7 (Twa 1F primer):

5'-NNNNN CATATG ATCCTCGATGCTGACTACAT -3 '

Nde I

SEQ ID NO: 8 (Twa 3R primer):

5'-NNNNN GTCGAC CGTCTTCGGTTTTAGCCA -3 '

Sal I

SEQ ID NO: 9 (Twa 1R primer):

5'- GTAGCCGTAATAACTGTTGGCCATAATCTTGATGGC -3 '

SEQ ID NO: 10 (Twa 2F primer):

5'- GCCATCAAGATTCTGGCCAACAGTTATTACGGCTAC -3 '

SEQ ID NO: 11 (Twa 2R primer):

5 '-GCAAAGAAACCGTCGGTATCCGCGTAAAGCACTT -3'

SEQ ID NO: 12 (Twa 3F primer):

5'- AAGTGCTTTACGCGGATACCGACGGTTTCTTTGC -3 '

Example  6. Twa DNA  Polymerase Mutant  making

Using the QuikChange site-directed mutagenesis method, point mutations were induced in active Twa DNA polymerase genes (see Stratagene's QuikChange ^® Site-Directed Mutagenesis Kit). manual). As a result, the gene corresponding to position 501 asparagine (Asn) encodes a sequence encoding alginine (Arg), lysine (Lys), asphatic acid (Asp), glutamic acid (Glu), or alanine (Ala). Twa DNA polymerase variants were prepared. Twa Twa from DNA Polymerase Gene Primers for obtaining the N501 mutant polymerase gene are shown in Table 1. PCR was performed using a mixed composition consisting of 0.05 ug of pTWAM and 20 pmole of 5 'and 3' terminal primers, 200 uM of dNTPs, 10X PyroAce DNA polymerase buffer solution and 2.5 U Super PyroAce DNA polymerase at 95 ° C for 30 seconds. After the reaction, the reaction was repeated 12 times under conditions of 30 seconds at 94 ° C., 1 minute at 55 ° C., and 7 minutes at 68 ° C., followed by reaction at 10 ° C. for 10 minutes. In order to remove the original template DNA, the restriction enzyme Dpn I, which specifically cleaves only methylated DNA, was treated at 37 ° C. for 1 hour, and then the uncut amplified mutant DNA (PCR product was methylated). E. coli) was transformed. Then, DNA sequencing confirmed that the Twa DNA polymerase genes cloned into the recombinant plasmid were correctly substituted. Escherichia coli Escherichia coli Rosetta (DE3) pLysS (Stratagene, USA) respectively transformed (Sambrook, J. et. al ., 1989, Molecular cloning, a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory Press). Plasmid DNA was isolated from the transformants by alkaline lysis method, digested with restriction enzymes Nde I and Sal I, and then electrophoresed with DNA size markers on 0.8% agarose gel to Twa. N501R, Twa N501K, Twa N501D, Twa N501E and Twa N501A It was again confirmed that the DNA polymerase gene was correctly inserted into the expression vector. Twa built as above N501R, Twa N501K, Twa N501D, Twa N501E, Twa N501A Expression vectors constructed for the expression of DNA polymerase genes were named pTWAN501R, pTWAN501K, pTWAN501D, pTWAN501E and pTWAN501A, respectively. Expression vectors containing the genes were transformed into E. coli, and then purified by expressing DNA polymerase variants.

And to confirm whether the produced variants function as DNA polymerase, PCR was performed using the purified variants, Twa N501R and Twa It was confirmed that the N501K DNA polymerase variant amplifies DNA very effectively. Therefore, E. coli (Rosetta (DE3) pLysS / pTWAN501R) containing the expression vector and expression vector containing the pTWAN501R gene and E. coli (Rosetta (DE3) pLysS / pTWAN501K) containing the expression vector and the expression vector containing the pTWAN501K gene 8 On March 29, it was deposited with the Korea Agricultural Microbiological Resource Center, Korea Institute of Agricultural Biotechnology. Each accession number is KACC95108P and KACC95107P.

TABLE 1 Primer sequences for the preparation of Twa DNA polymerase variants

Example  7. Wild type Twa DNA  Polymerase and Twa DNA  Polymerase Of variants  Expression and Purification

In order to measure the activity of DNA polymerases, the recombinant strain Escherichia transformed using the plasmid obtained in Example 5 coli After expression of the active Twa DNA polymerase protein from which intein was removed from Rosetta (DE3) pLysS / pTWAM, the expressed protein was purified. In addition, the recombinant strain Escherichia transformed using the plasmid obtained in Example 6 coli After expression of Rosetta (DE3) pLysS / pTWAN501 derived DNA polymerase variants, the expressed proteins were purified.

To purify the protein, the strains were inoculated in LB liquid medium containing ampicillin (100 ug / uL) and chloramphenicol (34 ug / uL), respectively, and incubated for 12 hours at 37 ° C. Inoculated in 500 mL fresh LB liquid medium and incubated again at 37 ℃. When the absorbance of the culture was about 0.6 at 600 nm, IPTG (isopropyl β-D-galactopyranoside) was added to a final concentration of 0.2 mM and then incubated at 25 ° C. for 12 hours. Thereafter, the culture solution was centrifuged at 6,000 rpm for 15 minutes to recover the cells (2.0 g / wet weight), and then 20 mL of sonication buffer containing 20 mM Tris-HCl (pH 7.4) and 0.5 mM NaCl containing 1 mM PMSF. ) And the cells were disrupted by ultrasound. E. coli cell debris was removed by centrifugation at 18,000 rpm for 15 minutes. After heat treatment at 80 ℃ for 30 minutes and centrifuged, the supernatant was recovered to remove most of the E. coli-derived protein. Finally, the DNA polymerase contained in the supernatant was purified by column chromatography using a HisTrap ^™ HP column (GE Healthcare) and a HiTrap ^™ SP HP column (GE Healthcare). Purified DNA polymerases were dialyzed in storage buffer (20 mM Tris-HCl, pH 7.4), 0.1 mM EDTA, 0.1% Tween 20, 0.1% Nonidet P40, 50 mM KCl, 1 mM DTT, 50% Glycerol Then stored at -20 ° C. In purifying DNA polymerase, the results of each step are shown in Table 2 below.

TABLE 2 Purification of Twa DNA Polymerase from E. coli Rosetta (DE3) pLysS / pTWAM

As shown in Table 2, the specific activity of the purified enzyme was determined by Twa derived from pTWAM. DNA polymerase was 0.25 U / mg. Variants of Twa N501-derived DNA polymerase were also purified in the same manner as above. Twa N501R DNA polymerase, Twa N501K DNA polymerase, Twa N501D DNA polymerase, Twa N501E DNA polymerase and Twa N501A DNA polymerase specific activities were 0.23 U / mg, 0.24 U / mg, 0.21 U / mg, 0.22 U / mg and 0.24 U / mg. In this case, one unit (U) was defined as the amount of DNA polymerase required to insert 10 nmol of dNTP in an acid insoluble form at 75 ° C. for 30 minutes.

The amount of protein in purification steps was quantified using Bradford Assay (Bradford MM, 1976, Anal. Biochem. 72 , 248-54). In addition, Twa was performed by performing SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis, SDS-). DNA polymerase and variants were identified. The results are shown in Fig.

As shown in Figure 2 (a), ultrasonic crushed sample of E. coli Rosetta (DE3) pLysS / pTWAM cells cultured without IPTG induction (lane 1), E. coli Rosetta (DE3) pLysS / pTWAM treated with IPTG induction Ultrasonic crushed sample (lane 2), sample after heat treatment at 80 ° C. for 30 minutes (lane 3), sample after HisTrap ^™ HP column chromatography (lane 4), sample after HiTrap ^™ SP HP column chromatography (lane 5) In all, a protein of about 90,000 Da similar to the molecular weight (MW: 90,000.037 Da) converted from the DNA sequence of Twa DNA polymerase was identified. Through the above results, it was confirmed that the wild type Twa DNA polymerase was normally purified through purification.

In addition, as shown in Figure 2 (b), active Twa DNA polymerase (lane 1), Twa N501R DNA polymerase (lane 2), Twa N501K DNA polymerase (lane 3), Twa N501D DNA polymerase (lane 4) ), Twa N501E DNA polymerase (lane 5), and Twa N501A DNA polymerase (lane 6) were all confirmed that the protein of about 90,000 Da. Lane M represents a protein low molecular weight marker.

Example  8. Twa DNA  Polymerase DNA  Investigation of enzyme properties in polymerization activity

Twa The enzymatic properties of DNA polymerase in the DNA polymerizing activity were investigated based on the following DNA polymerizing activity measurement method (Refer to Choi, JJ et. al . , 1999, Biotechnol . Appl . Biochem . 30 , 19-25). Reaction mixture (wild type Twa purified in Example 7 above DNA polymerase, 1.25 ug activated calf thymus DNA, 50 mM Tris-HCl, pH 7.5, 80 mM KCl, 14 mM MgCl ₂ , 1 mM β-mercaptoethanol, 100 μM dATP, dCTP and dGTP, 10 μM dTTP, 0.5 μCi [ methyl - ³ H] thymidine 5′-triphosphate) was reacted at 75 ° C. for 10 minutes and then quenched on ice. Subsequently, the reaction solution was added dropwise to a DE-81 filter paper disk (23 mm, Whatman Co., USA) and dried at 65 ° C., followed by 0.5 M sodium phosphate (pH 7.0) buffer solution. 10 minutes, washed in 70% ethanol for 5 minutes in order, and then dried again at 65 ℃. The DE-81 filter paper disks prepared as above were used to measure DNA polymerization activity using the LS 6500 scintillation system (Beckman Co., USA). When examining the enzyme properties in the DNA polymerization activity, it was carried out in the above method by changing the pH of the reaction mixture or the concentration of each component or the reaction temperature.

In order to observe the effect of pH on the enzyme activity of the Twa DNA polymerase, the enzyme activity was examined using 50 mM MES buffer in the pH 5.0-7.0 range and 50 mM Tris-HCl buffer in the pH 7.0-8.0 range. The results are shown in Fig. As shown in FIG. 3, the optimal DNA polymerization activity was shown in 50 mM MES buffer pH 6.0.

The effect of temperature on the DNA polymerization activity of Twa DNA polymerase in the range of 50-90 ° C. is shown in FIG. 4. As shown in FIG. 4, maximum DNA polymerization activity was exhibited at 75 ° C. FIG.

Twa In the DNA polymerase activity of the DNA polymerase for 2 it has investigated the effect of Mg ^{2 +} cations (divalent cation) is shown in Fig. As shown in FIG. 5, the optimal MgCl ₂ concentration was 8 mM.

Twa The results of examining the effect of KCl, a monovalent cation, on DNA polymerization activity of DNA polymerase are shown in FIG. 6. As shown in FIG. 6, the optimal KCl concentration was 70 mM.

Twa After the samples were taken at intervals of 1 hour while the DNA polymerase was stored at 99 ° C. or 94 ° C. for 14 hours, thermal stability was measured by measuring DNA polymerization activity. As shown in FIG. 7, Twa DNA polymerase maintained 50% DNA polymerization activity at 99 ° C. for about 4 hours, and at 87 ° C., it maintained about 87% DNA polymerization activity.

Example  9. Twa DNA  3 '→ 5' of polymerase Nucleic Acid Terminal Hydrolase  Active measurement

In order to measure 3 '→ 5' exonuclease activity of Twa DNA polymerase, Lambda DNA to be used as a substrate was first digested with restriction enzyme Xap I and then radioisotope [ The 3 'end of Lambda DNA was cleaved by filling reaction at 37 ° C. for 30 minutes using methyl - ³ H] thymidine 5′-triphosphate and Klenow fragment. Then, the reaction mixture ( Twa DNA polymerase, radioisotope labeled substrate at the 3 'end, 50 mM Tris-HCl (pH 7.5), 1 mM 2-mercaptoethanol, 10 mM MgCl ₂ , 0.01% BSA) respectively with or without dNTP The reaction was carried out at 75 ° C. for 40 minutes under. Samples were taken at 5 minute intervals and quenched on ice, followed by addition of 5% trichloroacetic acid solution and centrifugation. The supernatant was recovered and subjected to nucleic acid terminal hydrolysis using the LS 6500 scintillation system. Enzyme activity was measured. The results are shown in Fig.

As shown in FIG. 8, it was confirmed that the Twa DNA polymerase had 3 ′ → 5 ′ nucleic acid terminal hydrolase activity, and in particular, the enzyme activity was higher in the absence (●) than when dNTP was present (○). I could confirm that. The 3 '→ 5' nucleic acid terminal hydrolase activity of Twa DNA polymerase was predicted by amino acid sequence comparison, and the predicted results were confirmed to be in agreement with the experimental results. 3 '→ 5' nucleic acid terminal hydrolase activity is also called corrective activity and plays an important role in enhancing the accuracy during DNA polymerization. Through the above results, it was confirmed that when the Twa DNA polymerase of the present invention was used for PCR, the accuracy could be increased.

Example  10. Twa DNA  Polymerase and Twa N501R DNA  Polymerase PCR Optimal conditions

Active Twa for PCR where heat-resistant DNA polymerase is most important DNA polymerase and Twa In order to examine the availability of N501 mutant DNA polymerases and to determine the optimal composition of PCR buffer for PCR using these polymerases, PCR was performed as follows. First, in Example 8, Twa The experiment was carried out assuming that the optimum activity condition of the enzyme determined by the DNA polymerase characteristics investigation was the basic PCR buffer condition. As the DNA polymerase, Twa N501R DNA polymerase was used in the experiments among the active Twa DNA polymerase (wild type) and variants. Active Twa DNA Polymerase and Twa In order to determine the optimal PCR buffer composition for N501R DNA polymerase, PCR was performed by varying the pH of each basic PCR buffer or the concentration of each component. When performing PCR, 25 ng of lambda phage genomic DNA and primers of 5 'and 3' ends of 20 pmole, 200 uM dNTPs and 0.1 unit (U) of purified Twa DNA polymerase were used as templates in PCR buffer. Twa N501R DNA polymerase (see Example 7 above) was added in common, and the reaction mixture was reacted for 3 minutes at 94 ° C, followed by 30 seconds at 94 ° C, 30 seconds at 62 ° C, and 2 minutes at 72 ° C. After repeating 25 times, the mixture was reacted at the last 72 ° C for 10 minutes. After that, PCR results were confirmed by 0.8% agarose gel electrophoresis. The results are shown in FIGS. 9 to 11.

As shown in Figure 9, both the active Twa DNA polymerase (a) and Twa N501R DNA polymerase (b) showed the expected 2kb PCR amplification product, but showed a difference in the polymerization activity according to pH. In Figure 9, M represents a GeneRuler ™ 1 kb DNA ladder (Fermentas), and the name of each lane represents the pH. As shown in Figure 9 (a) active Twa DNA polymerase showed the highest polymerization activity at pH 8.2, as shown in Figure 9 (b), Twa N501R DNA polymerase was the highest at pH 8.5-8.6 It showed high polymerization activity.

As shown in Figure 10, Twa DNA polymerase (a) and Twa N501R DNA polymerase (b) is a divalent showed the highest polymerization activity capability when the concentration of the cations Mg ^{+ 2} 2.0mM. In FIG. 10, M represents a GeneRuler ™ 1 kb DNA ladder (Fermentas), and the name of each lane represents MgCl ₂ concentration.

As shown in Figure 11, Twa DNA polymerase (a) and Twa As a result of investigating the effect of monovalent cations on PCR using N501R DNA polymerase (b), it was confirmed that the optimum KCl concentrations were 30 mM and 0 mM, respectively. In Figure 11, M represents a GeneRuler ™ 1 kb DNA ladder (Fermentas), and the name of each lane represents the KCl concentration.

Through these results, active Twa DNA polymerase and mutated Twa It was confirmed that both N501R DNA polymerase can be used for PCR, and the optimal PCR buffer composition for PCR using Twa DNA polymerase is 50mM Tris-HCl (pH 8.2), including BSA and Triton X-100 as stabilizers, It was confirmed that 30mM KCl, 2.0mM MgCl _{2 ,} 0.005% BSA, 0.01% Triton X-100. Also Twa The optimal PCR buffer composition for PCR using N501R DNA polymerase was 50 mM Tris-HCl (pH 8.6), 2.0 mM MgCl ₂ , 0.005% BSA, 0.01% Triton X-, including BSA and Triton X-100 as stabilizers. It confirmed that it was 100. Twa in the following experiment Variants other than N501R DNA polymerase are Twa The same buffer as N501R DNA polymerase was used.

Example  11. Twa DNA  Polymerase and Twa DNA  Polymerase Of variants PCR  Shortest Amplification Time Measurement

The In order to determine the PCR shortest amplification time of Twa DNA polymerase and its variants, 25 ng of lambda phage genomic DNA was used as a template with 20 pmole of 5 'and 3' terminal primers, 200 uM dNTPs, respectively. After 3 minutes of reaction at 94 DEG C with an optimal PCR buffer solution and each polymerase, the reaction was carried out at 94 DEG C for 30 seconds, at 72 DEG C for 10, 20, 30 and 60 seconds. After the PCR reaction was completed, PCR amplification products were confirmed by 0.8% agarose gel electrophoresis. The results are shown in Figure 12 (a).

As shown in FIG. 12 (a), the active Twa DNA polymerase is weakly capable of synthesizing 2 kb from 60 seconds, whereas the mutated Twa N501R and Twa N501K DNA polymerases are capable of synthesizing 2 kb from 10 seconds. After 30 seconds, the amount of amplification was confirmed to be significantly increased.

In order to compare the shortest amplification time with commercially available Pfu and Vent DNA polymerase, 25 ng of lambda phage genomic DNA was used as a template for 20 pmole of 5 'and 3' terminal primers and 200 uM dNTPs, respectively. After the reaction was performed at 94 ° C. for 3 minutes using the optimum PCR buffer solution and each polymerase as a reaction mixture, the reaction was performed at 94 ° C. for 30 seconds and at 72 ° C. for 10, 20, 30 and 60 seconds, respectively. After the PCR reaction was completed, PCR amplification products were confirmed by 0.8% agarose gel electrophoresis. The results are shown in Figure 12 (b).

As shown in Figure 12 (b), when using the Pfu DNA polymerase 2 kb synthesis is possible from 90 seconds or more, compared to Twa N501R polymerase was able to confirm that 2 kb synthesis in 10 seconds, the present invention The Twa N501R polymerase was found to have significantly higher amplification than Pfu and Vent DNA polymerase. In particular, in the 90-second reaction condition, Vent DNA polymerase showed a smear of PCR bands, whereas Twa N501R polymerase was confirmed to have amplified a large amount of DNA cleanly without smear. In Figure 12, M represents the GeneRuler ™ 1 kb DNA ladder (Fermentas), and the name of each lane represents the amplification time at 72 ℃.

Example  12. Twa DNA  Polymerase and Twa N501R DNA  Polymerase DNA  Longest Amplifiable Length Measurement

Twa using PCR DNA polymerase and Twa To determine the longest possible amplification range of DNA for N501R DNA polymerase, 25 ng lambda phage genomic DNA was used as a template for 20 pmole of 5 'and 3' terminal primers, 200 uM dNTPs, respectively. The template DNA was denatured at 94 ° C. for 3 minutes using the PCR buffer and each polymerase, followed by PCR at 30 seconds at 94 ° C., 30 seconds at 62 ° C., and kb / min at 72 ° C. After the PCR reaction was completed, PCR amplification products were confirmed by 0.8% agarose gel electrophoresis. The results are shown in Fig.

As shown in Figure 13, while Twa DNA polymerase can be synthesized up to 8 kb, Twa It was confirmed that the N501R DNA polymerase can be synthesized up to 10 kb. In Figure 13, the name of the lane represents the amplification size (Kb), M represents the GeneRuler ™ 1kb DNA ladder (Fermentas). Through the above results, it was confirmed that the longest amplifiable DNA length was significantly increased in comparison with wild type Twa DNA polymerase.

Example  13. Twa DNA  Polymerase, Twa N501R DNA  Polymerase and Twa N501K DNA  Polymerase PCR  accuracy( PCR fidelity ) Measure

Twa In order to measure the PCR fidelity of DNA polymerase, Twa N501R DNA polymerase and Twa N501K DNA polymerase, the Lundberg method was carried out with a slight modification as follows (Lundberg et. al ., 1991, Gene 108 (1), 1-6). In the actual experiment, the same method as that of Song et al. And Choi et al. Was used and the same expression vector pJR2- lacZ (5.7 Kb) and primers were used (see Song JM et. al ., 2007, Enzyme Microbe . Technol . 40 , 1475-1483; Choi JJ et al., 2008, Appl . Environ . Microbio l. 74, 6563-6569). First, lacZ Twa gene is 835 bp fragment of the 5 'portion of the expression vector is inserted pJR2- lacZ DNA polymerase, Twa N501R DNA polymerase and Twa N501K DNA polymerase were used to amplify each enzyme in the optimal PCR buffer. In addition, by performing the same PCR using commercially available Pfu , and Taq DNA polymerase, the PCR accuracy was compared with the polymerases of the present invention. The PCR amplification products were digested with restriction enzymes Bam HI and Cla I, respectively, and then inserted into expression vectors digested with the same restriction enzymes, followed by transformation into E. coli by electroporation. In order to select the vector-inserted strains, the agar plate medium containing the antibiotics ampicillin, IPTG and X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) is evenly distributed. The plate was incubated at 37 ° C. for 16 hours. Since the agar plate was stored at 4 ° C. for 2 hours, the number of blue colonies and white colonies was counted, and the mutation frequency and error rate were calculated based on the number of blue colonies and white colonies. The results are shown in Table 3.

As shown in Table 3, PCR accuracy in PCR using Twa DNA polymerase, Twa N501R DNA polymerase, and Twa N501K DNA polymerase was slightly higher than that of Pfu DNA polymerase, and Taq , which is mainly used for general PCR, was used. It was confirmed that it was significantly higher than the DNA polymerase. Through the above results, it was confirmed that the Twa DNA polymerase, Twa N501R DNA polymerase and Twa N501K DNA polymerase of the present invention can be used for PCR requiring high accuracy.

Table 3 Twa , Twa N501R, Twa PCR Accuracy Comparison of N501K, Taq, and Pfu DNA Polymerases

^a Mutation frequency was calculated as blue colony / (blue colony + white colony).

^b Template doublings were calculated as 2 ^d = PCR product amount / initial target amount.

^c Error rate was calculated as ER = mf / (bp x d ). Where mf is the mutation frequency, bp is the lacZ target size (= 832bp), and d is the number of times the template has been doubled.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the embodiments described above are in all respects illustrative and not restrictive.

Agricultural Biotechnology Research Institute KACC95107 20110829 Agricultural Biotechnology Research Institute KACC95108 20110829

Attach an electronic file to a sequence list

Claims (14)

Asparagine, the 501st amino acid of Thermococcus waiotapuensis- derived DNA polymerase consisting of the amino acid sequence of SEQ ID NO: 21, is substituted with arginine or lysine Characterized by Twa DNA polymerase variant. delete The method of claim 1,
The 501th amino acid asparagine (asparagine) is substituted with arginine (arginine) variant, characterized in that consisting of the amino acid sequence of SEQ ID NO: 23, Twa DNA polymerase variant. A nucleic acid molecule encoding the Twa DNA polymerase variant of claim 3. The method of claim 4, wherein
The nucleic acid molecule, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 22. A pTWAN501R vector comprising the nucleic acid molecule of claim 4. Rosetta (DE3) pLysS / pTWAN501R (accession number KACC95108P) Escherichia coli transformed with the pTWAN501R vector of claim 6. delete The method of claim 1,
The 501th amino acid asparagine (asparagine) is a variant substituted with lysine (lysine), characterized in that consisting of the amino acid sequence of SEQ ID NO: 25, Twa DNA polymerase variant. A nucleic acid molecule encoding the Twa DNA polymerase variant of claim 9. 11. The method of claim 10,
The nucleic acid molecule, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 24. A pTWAN501K vector comprising the nucleic acid molecule of claim 10. Rosetta (DE3) pLysS / pTWAN501K (accession number KACC95107P) Escherichia coli transformed with the pTWAN501K vector of claim 12. The kit for nucleic acid amplification reaction comprising the Twa DNA polymerase variant of claim 1.

Images