WO2007007054A1 - Phthalamides, succinimides, composes apparentes et leur utilisation en tant que produits pharmaceutiques - Google Patents

Phthalamides, succinimides, composes apparentes et leur utilisation en tant que produits pharmaceutiques Download PDF

Info

Publication number
WO2007007054A1
WO2007007054A1 PCT/GB2006/002517 GB2006002517W WO2007007054A1 WO 2007007054 A1 WO2007007054 A1 WO 2007007054A1 GB 2006002517 W GB2006002517 W GB 2006002517W WO 2007007054 A1 WO2007007054 A1 WO 2007007054A1
Authority
WO
WIPO (PCT)
Prior art keywords
optionally substituted
group
methyl
groups
alkyl
Prior art date
Application number
PCT/GB2006/002517
Other languages
English (en)
Inventor
Richard John Hamlyn
Laurent Jean Martin Rigoreau
Tony Michael Raynham
Rachael Elizabeth Priestley
Christelle Nicole Marguerite Soudy
Frank Lyko
Bodo Bruckner
Oliver Thomas Kern
Original Assignee
Cancer Research Technology Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0514041A external-priority patent/GB0514041D0/en
Application filed by Cancer Research Technology Limited filed Critical Cancer Research Technology Limited
Publication of WO2007007054A1 publication Critical patent/WO2007007054A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/44—Iso-indoles; Hydrogenated iso-indoles
    • C07D209/48—Iso-indoles; Hydrogenated iso-indoles with oxygen atoms in positions 1 and 3, e.g. phthalimide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/06—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/06—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing three or more hetero rings

Definitions

  • the present invention relates to phthalamides, succinimides and related compounds and their use as pharmaceuticals.
  • the present invention relates to the use of these compounds to inhibit DNA methylation in cells, particularly tumour cells.
  • DNA can be methylated through covalent methylation of cytosine residues at their carbon-5 position. It has been found that DNA methylation is an important mechanism of gene regulation, particularly gene silencing. Gene regulation by DNA methylation is an "epigenetic" form of gene regulation, as the DNA sequence information itself remains unaltered.
  • Aberrant DNA methylation patterns are closely associated with epigenetic mutations or epimutations, which can have the same consequences as genetic mutations. For example, many tumours show hypermethylation and concomitant silencing of tumour suppressor genes. Several developmental disorders are also associated with aberrant DNA methylation.
  • DNA methylation reaction is catalyzed by DNA methyl transferases (DNMTs).
  • DNMTs DNA methyl transferases
  • Establishment and maintenance of DNA methylation patterns require the activity of several DNMTs.
  • DNA methylation is established during early embryogenesis by the de novo DNA methyl transferases (DNMT3A and DNMT3B).
  • DNMT1 de novo DNA methyl transferases
  • DNMT1 is therefore also responsible for maintenance of epimutations.
  • DNMTs Genetic inhibition of DNMTs, although theoretically possible (US 6,054,439), suffers from the widely known and currently insurmountable difficulties associated with gene therapy.
  • Pharmacological inhibition of DNMTs has been limited to the use of structural analogues of cytosine, such as 5-azacytidine, 5-aza 2'deoxycytidine (decitabine), and 5,6-dihydro- 5-azacytidine (US 4,058,602; DE 198 23 484 A1).
  • cytosine analogues suffer from low specificity and high toxicity, limiting their use to a very small set of clinical indications.
  • inhibitors of DNA methylation particularly inhibitors of DNMTs.
  • such inhibitors should have a different mode of action than structural analogues of cytidine, and they should be more specific and less toxic than other inhibitors of DNA methylation.
  • a first aspect of the present invention provides, a compound according to formula I:
  • R A is:
  • X 2 and X 3 are either independently -CHR B1 -, where R B1 is selected from H, optionally substituted C 1-7 alkyl, optionally substituted C 5-20 aryl, optionally substituted C 3-20 heterocyclyl, halo, hydroxy and amido; or X 2 and X 3 form part of a fused benzene or pyridine ring, which may be optionally substituted by one or more optionally substituted Ci -7 alkyl, optionally substituted
  • R B is selected from:
  • R B1 and R B2 together with the carbon atoms to which they are bound form an optionally substituted fused benzene or pyridine ring;
  • Y 1 is selected from NR N ⁇ O and S;
  • Y 2 is selected from NR N1 , O and S;
  • Y 3 is selected from CH and N, where R N1 is H or methyl;
  • R c is selected from the group consisting of: (i) -COR G1 , wherein R C1 is selected from the group consisting of: -OH, -NH 2 ,
  • R N2 is H or methyl
  • B is not one or more of the following groups:
  • a second aspect of the present invention provides a pharmaceutical composition comprising a compound according to formula I:
  • R A is:
  • -C(O)-CH 2 - is bonded to N and -CH 2 of -C(O)-CH 2 - is bonded to X 3 ; or X 1 and X 4 are N and NH respectively and there is a double bond between X 1 and N;
  • X 2 and X 3 are either independently -CHR B1 -, where R B1 is selected from H, optionally substituted C 1-7 alkyl, optionally substituted C 5-2 O aryl, optionally substituted C 3-20 heterocyclyl, halo, hydroxy and amido; or X 2 and X 3 form part of a fused benzene or pyridine ring, which may be optionally substituted by one or more optionally substituted C 1-7 alkyl, optionally substituted C 5-20 aryl, optionally substituted C 3-20 heterocyclyl, halo, hydroxy, amido, nitro and carboxy groups;
  • R B is selected from:
  • R B1 and R B2 together with the carbon atoms to which they are bound form an optionally substituted fused benzene or pyridine ring;
  • Y 1 is selected from NR N1 , O and S;
  • Y 2 is selected from NR N1 , O and S;
  • Y 3 is selected from CH and N, where R N1 is H or methyl;
  • R c is selected from the group consisting of:
  • R C1 is selected from the group consisting of: -OH, -NH 2 , -NHNH 2 , -NHCN, -NHSO 2 R S1 , -NR N2 OR 01 , -NH-CN 4 H, where R S1 is H or methyl, R 01 is H or methyl and R N2 is H or methyl;
  • a third aspect of the present invention provides a compound as defined in the second aspect for use in a method of treatment of the human or animal body.
  • a fourth aspect of the present invention provides the use of a compound as defined in the second aspect of the invention in the preparation of a medicament for treating a disease ameliorated by the inhibition of one or more DNMTs, more particularly DNMT1 , and/or the inhibition of DNA methyiation.
  • a fifth aspect of the present invention provides treatment of a disease ameliorated by the inhibition of one or more DNMTs, more particularly DNMT1 , and/or the inhibition of DNA methyiation, comprising administering to a subject in need of treatment a therapeutically-effective amount of a compound as defined in the second aspect, preferably in the form of a pharmaceutical composition.
  • those compounds which are disclaimed from the first aspect may also be disclaimed. This also applies to the compounds which are disclosed as being possibly disclaimed from the first aspect of the invention.
  • DNA methyiation preferably relates to any kind of hypermethylation, be it genome-wide or limited to distinct genomic or chromosomal regions or genes.
  • DNA methyiation can be measured by any of the methods known in the art (e.g. Okamoto, A., et al., JACS, 124, 10262-10263 (2002)), methyiation sensitive arbitrarily primed PCR (Gonzalgo, M.L., et al., Cancer Res., 57, 594-599 (1997)), methylated CpG island amplification (Toyota, M., et al., Cancer Res., 59, 2307-2312 (1999)), restriction landmark genomic scanning (RLGS) (Hayashizaki, Y., ef al., Electrophoresis, 14, 251- 258 (1993)), differential methyiation hybridization (Huang, T.
  • diseases which can be treated with the compounds according to the present invention include developmental disorders and proliferative diseases.
  • Examples for developmental disorders which can be treated with the compounds according to the present invention include Prader-Willi-Syndrome, Angelman-Syndrome (Happy Puppet Syndrome), and Beckwith-Wiedemann-Syndrome.
  • Examples for proliferative diseases which can be treated with the compounds according to the present invention include coronary restenosis and neoplastic diseases.
  • Said neoplastic diseases include neuroblastoma, intestine carcinoma such as rectum carcinoma, colon carcinoma, familiary adenomatous polyposis carcinoma and hereditary non-polyposis colorectal cancer, esophageal carcinoma, labial carcinoma, larynx carcinoma, hypopharynx carcinoma, tongue carcinoma, salivary gland carcinoma, gastric carcinoma, adenocarcinoma, medullary thyroidea carcinoma, papillary thyroidea carcinoma, renal carcinoma, kidney parenchym carcinoma, ovarian carcinoma, cervix carcinoma, uterine corpus carcinoma, endometrium carcinoma, chorion carcinoma, pancreatic carcinoma, prostate carcinoma, testis carcinoma, breast carcinoma, urinary carcinoma, melanoma, brain tumours such as glioblastoma, astrocytoma, meningioma, medulloblastoma and peripheral neuroectodermal tumours, Hodgkin lymphoma, non-Hodgkin lymphoma, Burkitt lymph
  • Preferred indications are colon carcinoma, familiary adenomatous polyposis carcinoma and hereditary non-polyposis colorectal cancer, prostate carcinoma, melanoma, non- Hodgkin lymphoma, acute lymphatic leukemia (ALL), chronic lymphatic leukemia (CLL), acute myeolid leukemia (AML), chronic myeloid leukemia (CML), or hepatocellular carcinoma.
  • ALL acute lymphatic leukemia
  • CLL chronic lymphatic leukemia
  • AML acute myeolid leukemia
  • CML chronic myeloid leukemia
  • the compounds according to the first aspect of the invention can also be used in combination with other pharmaceutically active compounds, preferably compounds which are able to enhance the effect of the compounds according to the first aspect of the invention.
  • examples of such compounds include: (i) antimetabolites, cytarabine, fludarabine, 5-fluoro-2 ' -deoxyuridine, gemcitabine, hydroxyurea or methotrexate; (ii) DNA-fragmenting agents, bleomycin, (iii) DNA-crosslinking agents, chlorambucil, cisplatin, fotemustine, cyclophosphamide or nitrogen mustard; (iv) intercalating agents, adriamycin (doxorubicin) or mitoxantrone; (v) protein synthesis inhibitors, L- asparaginase, cycloheximide, puromycin or diphteria toxin; (vi) topoisomerase I poisons, camptothecin or topotecan; (vii) top
  • microtub ⁇ le-directed agents colcemid, colchicine, paclitaxel (taxol), docetaxel (taxotere), vinblastine or vincristine;
  • kinase inhibitors flavopiridol, staurosporin, STI571 (CPG 57148B) or UCN-01 (7-hydroxystaurosporine);
  • miscellaneous investigational agents trichostatin A, thioplatin, PS-341, phenylbutyrate, ET-I8-OCH 3 , or famesyl transferase inhibitors (L-739749, L-744832); polyphenols, quercetin, resveratrol, piceatannol, epigallocatechine gallate, theaflavins, flavanols, procyanidins, betulinic acid and derivatives thereof; (xi) hormones, glu
  • the compounds of the first aspect of the invention can be used to inhibit DNA methylation in cells either in vivo or in vitro. Particularly, said compounds inhibit one or more DNMTs, more particularly DNMT1 , even more particularly human DNMT1.
  • the compounds of the first aspect of the invention may also be used to induce cellular differentiation in vivo and/or in vitro.
  • Cellular differentiation relates to any differentiation of a cell from a less differentiated (specialized) state to a more differentiated
  • Cell types which can be treated include, but are not limited to, embryonic and adult stem cells, totipotent, omnipotent, pluripotent, multipotent, oligopotent, or monopotent stem cells, progenitor cells, committed progenitor cells, as well as stem cells derived from bone marrow, peripheral blood, umbilical cord blood, adipose tissue, heart muscle, intestine, small intestine, or brain.
  • MPCs multipotent adult progenitor cells
  • mesenchymal stem cells mesenchymal stem cells
  • hematopoetic stem cells intestinal stem cells
  • hepatic stem cells oval cells
  • neuronal stem cells epidermal stem cells
  • myoblasts myoblasts
  • cardiomyoblasts osteoblasts
  • chondroblasts basal cells of epithelia, e.g. the respiratory epithelium.
  • GenBank accession numbers of selected DNMTs of human, mouse, Drosphila melanogaster, Haemophilus haemolyticus and Haemophilus aegyptius are given below: human DNMT1 protein (GenBank Ace. No. NP_001370) human DNMT2 protein (GenBank Ace. No. AAC39764) human DNMT3A protein (GenBank Ace. No. AAD33084) human DNMT3B protein (GenBank Ace. No. AAD53063) mouse DNMT1 protein (GenBank Ace. No. NP_034196) D. melanogaster dDNMT2 protein (GenBank Ace. No. AAF03835) H.
  • the compounds of the first aspect of the invention are capable of binding and inhibiting different DNMTs in different species.
  • One advantage of the compounds according to the present invention is that they are abie to substantially demethylate and reactivate Vietnamese genes (e.g. tumour suppressor genes), but not centromeric satellite sequences. This is an advantage for treatment of cells or patients, as demethylation of satellite sequences has been shown to promote tumourigenesis by destabilizing chromosome organization. This will have a positive effect on maintenance of genome stability in cells or patients treated with the compounds according to the present invention.
  • euchromatic genes e.g. tumour suppressor genes
  • ⁇ -amino acid side chain as used herein, pertains to the group, R, in the following formula for an ⁇ -amino acid:
  • Examples of ⁇ -amino acids include both natural amino acids and non-natural amino acids.
  • the natural amino acids include: those with nonpolar (hydrophobic) R groups: alanine, AIa, A; isoleucine, He, I; leucine, Leu, L; methionine, Met, M; phenylalanine, Phe, F; tryptophan, Trp, W; and valine, VaI, V; those with polar but uncharged R groups: asparagine, Asn, N; cysteine, Cys, C; glutamine, GIn, Q; glycine, GIy, G; serine, Ser, S; threonine, Thr, T; and tyrosine, Tyr, Y; those with (potentially) positively charged R groups: arginine, Arg, R; histidine, His, H; and lysine, Lys, K; and those with (potentially) negatively charged R groups: aspartic acid, Asp, D;
  • natural ⁇ -amino acid side chains include: -CH 3 (A), -C(CH 3 )C 2 H 5 (I),
  • modified natural amino acids include, but are not limited to, hydroxyproline, ⁇ -carboxyg!utamate, and O-phosphoserine.
  • non-natural ⁇ -amino acids include: ⁇ -(napth-2-yl)alanine, ⁇ -(2-cyanophenyl) alanine, ⁇ -(ethinyl)alanine, ⁇ -(furan-2-yl)a!anine, ⁇ -(thien-2- yl)alanine, ⁇ -(4-pyridinyl)alanine,
  • Non-natural amino acid side chains can be defined as being optionally substituted Ci -7 alkyl groups, wherein the substituents are preferably selected from the group consisting of: hydroxy, ether, thio, thioether, C 5-20 aryl, carboxy, amido and imino.
  • Alkyl refers to a monovalent moiety obtained by removing a hydrogen atom from a carbon atom of a hydrocarbon compound having from 1 to 20 carbon atoms (unless otherwise specified), which may be aliphatic or alicyclic, and which may be saturated or unsaturated (e.g. partially unsaturated, fully unsaturated).
  • alkyl includes the sub-classes alkenyl, alkynyl, cycloalkyl, cycloalkyenyl, cylcoalkynyl, etc., discussed below.
  • the prefixes denote the number of carbon atoms, or range of number of carbon atoms.
  • the term "Ci -4 alkyl”, as used herein, pertains to an alkyl group having from 1 to 4 carbon atoms.
  • groups of alkyl groups include C 1-4 alkyl ("lower alkyl"), C 1-7 alkyl, C-i- t o alkyl and Ci -20 alkyl.
  • the first prefix may vary according to other limitations; for example, for unsaturated alkyl groups, the first prefix must be at least 2; for cyclic alkyl groups, the first prefix must be at least 3; etc.
  • Examples of (unsubstituted) saturated alkyl groups include, but are not limited to, methyl (C 1 ), ethyl (C 2 ), propyl (C 3 ), butyl (C 4 ), pentyl (C 5 ), hexyl (C 6 ), heptyl (C 7 ), octyl (C 8 ), nonyl (Cg), decyl (Ci 0 ), undecyl (C 11 ), dodecyl (Ci 2 ), tridecyl (Ci 3 ), tetradecyl (C M ), pentadecyl (Ci 5 ), and eicodecyl (C 20 ).
  • Examples of (unsubstituted) saturated linear alkyl groups include, but are not limited to, methyl (C 1 ), ethyl (C 2 ), n-propyl (C 3 ), n-butyl (C 4 ), n-pentyl (amyl) (C 5 ), n-hexyl (C 6 ), and n-heptyl (C 7 ).
  • Examples of (unsubstituted) saturated branched alkyl groups include iso-propyl (C 3 ), iso-butyl (C 4 ), sec-butyl (C 4 ), tert-butyl (C 4 ), iso-pentyl (C 5 ), and neo-pentyl (C 5 ).
  • Alkenyl refers to an alkyl group having one or more carbon-carbon double bonds. Examples of groups of alkenyl groups include C 2 . 4 alkenyl, C 2-7 alkenyl, C 2-20 alkenyl.
  • Alkynyl The term "alkynyl", as used herein, pertains to an alkyl group having one or more carbon-carbon triple bonds. Examples of groups of alkynyl groups include C 2-4 alkynyl, C 2-7 alkynyl, C 2-2 o alkynyl.
  • Examples of (unsubstituted) unsaturated alkynyl groups include, but are not limited to, ethynyl (ethinyl, -C ⁇ CH) and 2-propynyl (propargyl, -CH 2 -C ⁇ CH).
  • Cycl ⁇ alkyl refers to an alkyl group which is also a cyclyl group; that is, a monovalent moiety obtained by removing a hydrogen atom from an alicyclic ring atom of a carbocyclic ring of a carbocyclic compound, which carbocyclic ring may be saturated or unsaturated (e.g. partially unsaturated, fully unsaturated), which moiety has from 3 to 20 carbon atoms (unless otherwise specified), including from 3 to 20 ring atoms.
  • cycloalkyl includes the sub-classes cycloalkenyl and cycloalkynyl.
  • each ring has from 3 to 7 ring atoms.
  • groups of cycloalkyl groups include C 3-2 O cycloalkyl, C 3-15 cycloalkyl, C 3-10 cycloalkyl, C 3-7 cycloalkyl.
  • cycloalkyl groups include, but are not limited to, those derived from: saturated monocyclic hydrocarbon compounds: cyclopropane (C 3 ), cyclobutane (C 4 ), cyclopentane (C 5 ), cyclohexane (C 6 ), cycloheptane (C 7 ), methylcyclopropane (C 4 ), dimethylcyclopropane (C 5 ), methylcyclobutane (C 5 ), dimethylcyclobutane (C 6 ), methylcyclopentane (C 6 ), dimethylcyclopentane (C 7 ), methylcyclohexane (C 7 ), dimethylcyclohexane (C 8 ), menthane (C 10 ); unsaturated monocyclic hydrocarbon compounds: cyclopropene (C 3 ), cyclobutene (C 4 ), cyclopentene (C 5 ), cyclohexene (C 6 ), methylcyclopropene
  • Heterocyclyl refers to a monovalent moiety obtained by removing a hydrogen atom from a ring atom of a heterocyclic compound, which moiety has from 3 to 20 ring atoms (unless otherwise specified), of which from 1 to 10 are ring heteroatoms.
  • each ring has from 3 to 7 ring atoms, of which from 1 to 4 are ring heteroatoms.
  • the prefixes e.g. C 3-20 , C 3-7 , C 5-6 , etc.
  • the term "C 5 . 6 heterocyclyr, as used herein, pertains to a heterocyclyl group having 5 or 6 ring atoms.
  • groups of heterocyclyl groups include C 3-20 heterocyclyl, C 5-20 heterocyclyl, C 3-15 heterocyclyl, C 5-I5 heterocyclyl, C 3-12 heterocyclyl, C 5-I2 heterocyclyl, C 3-I0 heterocyclyl, C 5-10 heterocyclyl, C 3-7 heterocyclyl, C 5-7 heterocyclyl, and C 5-6 heterocyclyl.
  • monocyclic heterocyclyl groups include, but are not limited to, those derived from:
  • N 1 aziridine (C 3 ), azetidine (C 4 ), pyrrolidine (tetrahydropyrrole) (C 5 ), pyrroline (e.g.,
  • O 1 oxirane (C 3 ), oxetane (C 4 ), oxolane (tetrahydrofuran) (C 5 ), oxole (dihydrofuran) (C 5 ), oxane (tetrahydropyran) (C 6 ), dihydropyran (C 6 ), pyran (C 6 ), oxepin (C 7 );
  • O 3 trioxane (C 6 ); N 2 : imidazolidine (C 5 ), pyrazolidine (diazolidine) (C 5 ), imidazoline (C 5 ), pyrazoline
  • N 1 O 1 tetrahydrooxazole (C 5 ), dihydrooxazole (C 5 ), tetrahydroisoxazole (C 5 ), dihydroisoxazole (C 5 ), morpholine (C 6 ), tetrahydrooxazine (C 6 ), dihydrooxazine (C 6 ), oxazine (C 6 ); N 1 S 1 : thiazoline (C 5 ), thiazolidine (C 5 ), thiomorpholine (C 6 ); N 2 O 1 : oxadiazine (C 6 );
  • O 1 S 1 oxathiole (C 5 ) and oxathiane (thioxane) (C 6 ); and,
  • N 1 O 1 Si oxathiazine (C 6 ).
  • substituted (non-aromatic) monocyclic heterocyclyl groups include those derived from saccharides, in cyclic form, for example, furanoses (C 5 ), such as arabinofuranose, lyxofuranose, ribofuranose, and xylofuranse, and pyranoses (C 6 ), such as allopyranose, altropyranose, glucopyranose, mannopyranose, gulopyranose, idopyranose, galactopyranose, and talopyranose.
  • furanoses C 5
  • arabinofuranose such as arabinofuranose, lyxofuranose, ribofuranose, and xylofuranse
  • pyranoses C 6
  • allopyranose altropyranose
  • glucopyranose glucopyranose
  • mannopyranose gulopyranose
  • idopyranose galactopyr
  • C 5-20 aryl as used herein, pertains to a monovalent moiety obtained by removing a hydrogen atom from an aromatic ring atom of a C 5-20 aromatic compound, said compound having one ring, or two or more rings (e.g., fused), and having from 5 to 20 ring atoms, and wherein at least one of said ring(s) is an aromatic ring.
  • each ring has from 5 to 7 ring atoms.
  • the ring atoms may be all carbon atoms, as in "carboaryl groups” in which case the group may conveniently be referred to as a "C 5-20 carboaryl” group.
  • C 5-20 aryl groups which do not have ring heteroatoms include, but are not limited to, those derived from benzene (i.e. phenyl) (C 6 ), naphthalene (C 10 ), anthracene (C 14 ), phenanthrene (C 14 ), and pyrene (C 16 ).
  • the ring atoms may include one or more heteroatoms, including but not limited to oxygen, nitrogen, and sulfur, as in “heteroaryl groups".
  • the group may conveniently be referred to as a "C 5-20 heteroaryl” group, wherein “C 5-20 " . denotes ring atoms, whether carbon atoms or heteroatoms.
  • each ring has from 5 to 7 ring atoms, of which from 0 to 4 are ring heteroatoms.
  • C 5-20 heteroaryl groups include, but are not limited to, C 5 heteroaryl groups derived from furan (oxole), thiophene (thiole), pyrrole (azole), imidazole (1,3-diazole), pyrazole (1 ,2-diazole), triazole, oxazole, isoxazole, thiazole, isothiazole, oxadiazole, tetrazole and oxatriazole; and C 6 heteroaryl groups derived from isoxazine, pyridine (azine), pyridazine (1 ,2-diazine), pyrimidine (1,3-diazine; e.g., cytosine, thymine, uracil), pyrazine (1 ,4-diazine) and triazine.
  • the heteroaryl group may be bonded via a carbon or hetero ring atom.
  • C 5-20 heteroaryl groups which comprise fused rings include, but are not limited to, C 9 heteroaryl groups derived from benzofuran, isobenzofuran, benzothiophene, indole, isoindole; C 10 heteroaryl groups derived from quinoline, isoquinoline, benzodiazine, pyridopyridine; C 14 heteroaryl groups derived from acridine and xanthene.
  • Halo -F, -Cl, -Br, and -I.
  • Ether -OR, wherein R is an ether substituent, for example, a C 1-7 alkyl group (also referred to as a C 1-7 alkoxy group), a C 3-2O heterocyclyl group (also referred to as a C 3 . 2 o heterocyclyloxy group), or a C 5-20 aryl group (also referred to as a C 5-20 aryloxy group), preferably a C 1-7 alkyl group.
  • R is an ether substituent, for example, a C 1-7 alkyl group (also referred to as a C 1-7 alkoxy group), a C 3-2O heterocyclyl group (also referred to as a C 3 . 2 o heterocyclyloxy group), or a C 5-20 aryl group (also referred to as a C 5-20 aryloxy group), preferably a C 1-7 alkyl group.
  • R is an acyl substituent, for example, H, a C 1-7 alkyl group (also referred to as C 1-7 alkylacyl or C 1-7 alkanoyl), a C 3-20 heterocyclyl group (also referred to as C 3 . 20 heterocyclylacyl), or a C 5-20 aryl group (also referred to as C 5-20 arylacyl), preferably a C 1-7 alkyl group.
  • R is an acyl substituent, for example, H, a C 1-7 alkyl group (also referred to as C 1-7 alkylacyl or C 1-7 alkanoyl), a C 3-20 heterocyclyl group (also referred to as C 3 . 20 heterocyclylacyl), or a C 5-20 aryl group (also referred to as C 5-20 arylacyl), preferably a C 1-7 alkyl group.
  • Ester (carboxylate, carboxylic acid ester, oxycarbonyl): -C( O)OR, wherein R is an ester substituent, for example, a C 1-7 alkyl group, a C 3-20 heterocyclyl group, or a C 5 . 20 aryl group, preferably a C 1-7 alkyl group.
  • Amido (carbamoyl, carbamyl, aminocarbonyl, carboxamide): -C( O)NR 1 R 2 , wherein R 1 and R 2 are independently amino substituents, as defined for amino groups.
  • R 1 and R 2 are independently amino substituents, for example, hydrogen, a C 1-7 alkyl group (also referred to as C 1-7 alkylamino or di-C 1-7 alkylamino), a C 3-20 heterocyclyl group, or a C 5-20 aryl group, preferably H or a C 1-7 alkyl group, or, in the case of a "cyclic" amino group, R 1 and R 2 , taken together with the nitrogen atom to which they are attached, form a heterocyclic ring having from 4 to 8 ring atoms.
  • R 1 and R 2 are independently amino substituents, for example, hydrogen, a C 1-7 alkyl group (also referred to as C 1-7 alkylamino or di-C 1-7 alkylamino), a C 3-20 heterocyclyl group, or a C 5-20 aryl group, preferably H or a C 1-7 alkyl group, or, in the case of a "cyclic" amino group, R 1 and R 2 ,
  • amino groups include, but are not limited to, -NH 2 , -NHCH 3 , -NHCH(CH 3 ) 2 , -N(CH 3 ) 2 , -N(CH 2 CH 3 ) 2 , and -NHPh.
  • cyclic amino groups include, but are not limited to, aziridinyl, azetidinyl, pyrrolidinyl, piperidino, piperazinyl, perhydrodiazepinyl, morpholino, and thiomorpholino.
  • the cylic amino groups may be substituted on their ring by any of the substituents defined here, for example carboxy, carboxylate and amido.
  • R 1 is an amide substituent, for example, hydrogen, a C 1-7 alkyl group, a C 3-20 heterocyclyl group, or a C 5-20 aryl group, preferably H or a C 1-7 alkyl group, most preferably H
  • R 2 is an acyl substituent, for example, a C 1-7 alkyl group, a C 3-20 heterocyclyl group, or a C
  • R 1 and R 2 may together form a cyclic structure, as in, for example, succinimidyl, maleimidyl, and phthalimidyl: succinimidyl maleimidyl phthalimidyl
  • R 2 and R 3 are independently amino substituents, as defined for amino groups, and R1 is a ureido substituent, for example, hydrogen, a C 1-7 alkyl group, a C 3-2 oheterocyclyl group, or a C 5-20 aryI group, preferably hydrogen or a C 1-7 alkyl group.
  • R is an acyloxy substituent, for example, a C 1-7 alkyl group, a C 3-2O heterocyclyl group, or a C 5-20 aryl group, preferably a C 1-7 alky! group.
  • C 1-7 alkylthio groups include, but are not limited to, -SCH 3 and -SCH 2 CH 3 .
  • R is a sulfoxide substituent, for example, a C 1-7 alkyl group, a C 3-20 heterocyclyl group, or a C 5-20 aryl group, preferably a C 1-7 alkyl group.
  • Sulfonyl (sulfone): -S( O) 2 R, wherein R is a sulfone substituent, for example, a C 1-7 alkyl group, a C 3-20 heterocyclyl group, or a C 5-20 aryl group, preferably a C 1-7 alkyl group.
  • R is a sulfone substituent, for example, a C 1-7 alkyl group, a C 3-20 heterocyclyl group, or a C 5-20 aryl group, preferably a C 1-7 alkyl group.
  • Thioamido (thiocarbamyl): -C( S)NR 1 R 2 , wherein R 1 and R 2 are independently amino substituents, as defined for amino groups.
  • R 1 is an amino substituent, as defined for amino groups
  • R is a sulfonamino substituent, for example, a C 1-7 alkyl group, a C 3 . 20 heterocyclyl group, or a C 5 . 20 aryl group, preferably a C 1-7 atky! group.
  • X 2 and X 3 preferably form part of a fused benzene ring, which may be optionally substituted.
  • the fused benzene ring is preferably substituted by one or two groups as defined above. More preferable substituent groups include, but are not limited to, halo
  • R B is preferably benzhydrylsufanylmethyl (-CH 2 SCHPh 2 ).
  • R c R c is preferably selected from the group consisting of: (i) -COR C ⁇ wherein R C1 is selected from the group consisting of: -OH 1 -NHNH 2 , -NHCN,
  • a reference to carboxylic acid (-COOH) also includes the anionic (carboxylate) form (-COO " ), a salt or solvate thereof, as well as conventional protected forms.
  • a reference to an amino group includes the protonated form (-N + HR 1 R 2 ), a salt or solvate of the amino group, for example, a hydrochloride salt, as well as conventional protected forms of an amino group.
  • a reference to a hydroxyl group also includes the anionic form (-0 " ), a salt or solvate thereof, as well as conventional protected forms of a hydroxyl group.
  • Certain compounds may exist in one or more particular geometric, optical, enantiomeric, diasteriomeric, epimeric, stereoisomeric, tautomeric, conformational, or anomeric forms, including but not limited to, cis- and fra/?s-forms; E- and Z-forms; c ⁇ , t ⁇ , and r-forms; endo- and ex ⁇ -forms; R-, S-, and meso-forms; D- and L-forms; d- and /-forms; (+) and (- ) forms; keto-, enol-, and enolate-forms; syn- and anti-forms; synclinal- and anticlinal- forms; ⁇ - and ⁇ -forms; axial and equatorial forms; boat-, chair-, twist-, envelope-, and halfchair-forms; and combinations thereof, hereinafter collectively referred to as "isomers” (or "isomeric forms").
  • the compound is in crystalline form, it may exist in a number of different polymorphic forms.
  • isomers are structural (or constitutional) isomers (i.e. isomers which differ in the connections between atoms rather than merely by the position of atoms in space).
  • a reference to a methoxy group, -OCH 3 is not to be construed as a reference to its structural isomer, a hydroxymethyl group, -CH 2 OH.
  • a reference to ortho-chlorophenyl is not to be construed as a reference to its structural isomer, meta-chlorophenyl.
  • a reference to a class of structures may well include structurally isomeric forms falling within that class (e.g., Ci. 7 alkyl includes /7-propyl and /so-propyl; butyl includes /7-, iso-, sec-, and ferf-butyl; methoxyphenyl includes ortho-, meta-, and para-methoxyphenyl).
  • keto-, enol-, and enolate-forms as in, for example, the following tautomeric pairs: keto/enol, imine/enamine, amide/imino alcohol, amidine/amidine, nitroso/oxime, thioketone/enethiol, ⁇ /-nitroso/hyroxyazo, and nitro/aci-nitro.
  • H may be in any isotopic form, including 1 H, 2 H (D), and 3 H (T); C may be in any isotopic form, including 12 C, 13 C, and 14 C; O may be in any isotopic form, including 16 O and 18 O; and the like.
  • a reference to a particular compound includes all such isomeric forms, including (wholly or partially) racemic and other mixtures thereof.
  • Methods for the preparation (e.g. asymmetric synthesis) and separation (e.g. fractional crystallisation and chromatographic means) of such isomeric forms are either known in the art or are readily obtained by adapting the methods taught herein, or known methods, in a known manner.
  • the chiral carbon at the centre of the compounds of the present invention has the same stereochemistry as natural ⁇ -amino acids, i.e. that the compounds are of formula Ia:
  • a reference to a particular compound also includes ionic, salt, solvate, and protected forms of thereof, for example, as discussed below, as well as its different polymorphic forms.
  • a corresponding salt of the active compound for example, a pharmaceutically-acceptable salt.
  • a pharmaceutically-acceptable salt examples are discussed in Berge, et a/., “Pharmaceutically Acceptable Salts", J. Pharm. ScL, 66, 1-19 (1977).
  • a salt may be formed with a suitable cation.
  • suitable inorganic cations include, but are not limited to, alkali metal ions such as Na + and K + , alkaline earth cations such as Ca 2+ and Mg 2+ , and other cations such as Al 3+ .
  • Suitable organic cations include, but are not limited to, ammonium ion (i.e., NH 4 + ) and substituted ammonium ions (e.g., NH 3 R + , NH 2 R 2 + , NHR 3 + , NR 4 + ).
  • suitable substituted ammonium ions are those derived from: ethylamine, diethylamine, dicyclohexylamine, triethylamine, butylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, benzylamine, phenylbenzylamine, choline, meglumine, and tromethamine, as well as amino acids, such as lysine and arginine.
  • An example of a common quaternary ammonium ion is N(CHa) 4 + .
  • a salt may be formed with a suitable anion.
  • suitable inorganic anions include, but are not limited to, those derived from the following inorganic acids: hydrochloric, hydrobromic, hydroiodic, sulfuric, sulfurous, nitric, nitrous, phosphoric, and phosphorous.
  • Suitable organic anions include, but are not limited to, those derived from the following organic acids: acetic, propionic, succinic, gycolic, stearic, palmitic, lactic, malic, pamoic, tartaric, citric, gluconic, ascorbic, maleic, hydroxymaleic, phenylacetic, glutamic, aspartic, benzoic, cinnamic, pyruvic, salicyclic, sulfanilic, 2-acetyoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethanesulfonic, ethane disulfonic, oxalic, isethionic, valeric, and gluconic.
  • suitable polymeric anions include, but are not limited to, those derived from the following polymeric acids: tannic acid, carboxymethyl cellulose.
  • solvate is used herein in the conventional sense to refer to a complex of solute (e.g. active compound, salt of active compound) and solvent. If the solvent is water, the solvate may be conveniently referred to as a hydrate, for example, a mono-hydrate, a di-hydrate, a tri-hydrate, etc. It may be convenient or desirable to prepare, purify, and/or handle the active compound in a chemically protected form.
  • chemically protected form pertains to a compound in which one or more reactive functional groups are protected from undesirable chemical reactions, that is, are in the form of a protected or protecting group (also known as a masked or masking group or a blocked or blocking group).
  • a protected or protecting group also known as a masked or masking group or a blocked or blocking group.
  • the aldehyde or ketone group is readily regenerated by hydrolysis using a large excess of water in the presence of acid.
  • an amine group may be protected, for example, as an amide or a urethane, for example, as: a methyl amide (-NHCO-CH 3 ); a benzyloxy amide (-NHCO- OCH 2 C 6 H 5 , -NH-Cbz); as a t-butoxy amide (-NHCO-OC(CH 3 ) 3 , -NH-Boc); a 2-biphenyl- 2-propoxy amide (-NHCO-OC(CHs) 2 C 6 H 4 C 6 H 5 , -NH-Bpoc), as a 9-fluorenylmethoxy amide (-NH-Fmoc), as a 6-nitroveratryloxy amide (-NH-Nvoc), as a 2- trimethylsilylethyloxy amide (-NH-Teoc), as a 2,2,2-trichloroethyloxy amide (-NH-Troc), as an allyloxy amide (-NH-Allo
  • a carboxylic acid group may be protected as an ester for example, as: an C 1-7 alkyl ester (e.g. a methyl ester; a f-butyl ester); a C 1-7 haloalkyl ester (e.g. a C 1-7 trihaloalkyl ester); a triC-
  • an C 1-7 alkyl ester e.g. a methyl ester; a f-butyl ester
  • a C 1-7 haloalkyl ester e.g. a C 1-7 trihaloalkyl ester
  • prodrug refers to a compound which, when metabolised (e.g. in vivo), yields the desired active compound.
  • the prodrug is inactive, or less active than the active compound, but may provide advantageous handling, administration, or metabolic properties.
  • some prodrugs are esters of the active compound (e.g. a physiologically acceptable metabolically labile ester).
  • Examples of such metabolically labile esters include those wherein R is Ci -2 o alky! (e.g. -Me, -Et); C 1-7 aminoalkyl (e.g.
  • acyloxy-Ci -7 alkyl e.g. acyloxymethyl; acyloxyethyl; e.g.
  • pivaloyloxymethyl acetoxymethyl; 1-acetoxyethyl; 1-(1-methoxy-1-methyl)ethyl-carbonxyloxyethyl; 1-(benzoyloxy)ethyl; isopropoxy-carbonyloxymethyl; 1-isopropoxy-carbonyloxyethyl; cyclohexyl- carbonyloxymethyl; 1-cyclohexyl-carbonyloxyethyl; cyclohexyloxy-carbonyloxymethyl; 1- cyclohexyl ⁇ xy-carbonyloxyethyl; (4-tetrahydropyranyloxy) carbonyloxymethyl; 1-(4- tetrahydropyranyloxy)carbonyloxyethyl;
  • prodrug forms include phosphonate and glycolate salts.
  • hydroxy groups (-OH)
  • Such a group can be cleared by phosphotase enzymes during metabolism to yield the active drug with the hydroxy group.
  • prodrugs are activated enzymatically to yield the active compound, or a compound which, upon further chemical reaction, yields the active compound.
  • the prodrug may be a sugar derivative or other glycoside conjugate, or may be an amino acid ester derivative.
  • R C can, in general, be synthesised by coupling a compound of formula 1 :
  • the coupling can be with the appropriate anhydride (i.e. a compound of formula 2a), or with a precursor, such as the acid or ester thereof.
  • the coupling reaction is then followed by a ring closure step, often with the use of base, if the compound coupled was not already in a ring, or the original ring was opened in the coupling step.
  • the coupling may be achieved by coupling a precursor of formula 2a, where an aldehyde is in place of the desired -CH 2 - group, followed by reduction.
  • the other end of the coupled molecule can then be ring closed as discussed above.
  • R c is COR 01 wherein R C1 is -NH 2 , -NHNH 2 , -NHCN, -NHSO 2 R S1 , -NR N2 OR 01 , -NH-CN 4 H, where R S1 , R N2 , R 01 are described as above may be synthesised from compounds of formula 1 where R c is -CO 2 H by standard methods known to those skilled in the art, such as amide coupling using EDC and a tertiary amine base.
  • R c is -C(NOH)NH 2 by standard methods such as cyclisation in the presence of 1 ,1'-carbonyldiimidazole.
  • Compounds of formula 1 where R c is -C(NOH)NH 2 are prepared from compounds of formula 1 where R c is -CN by standard methods known to those skilled in the art such as condensation with hydroxylamine hydrochloride in the presence of a base for example sodium bicarbonate.
  • R c is CN by standard methods such as cyclisation in the presence of trimethylsilyl azide and dialkyltin oxides preferably n-butyltin oxide.
  • R G is :-
  • O-protected hydroxamic acids of formula 3 may be prepared from diones of formula 4:
  • Diones of formula 4 may be prepared from compounds of formula 1 where R c is -COCI and 2,2-dimethyl- [1 ,3]dioxane-4,6-dione:
  • a base for example pyridine.
  • Alcohols of formula 5 may be prepared from aldehydes of formula 6:
  • R B group in compounds of the present invention may be present in the molecules coupled together as described above. Alternatively precursors may be present which are then converted after coupling.
  • the compounds of the present invention are capable of binding to DNMTs, particularly human DNMT1 , and inhibiting their catalytic activity.
  • the present invention provides a method of inhibitig DNA methylation in cells either in wVo or in vitro.
  • said compounds inhibit one or more DNMTs, more particularly DNMT1 , even more particularly human DNMT1.
  • a sample of cells may be grown in vitro and an active compound brought into contact with said cells, and the effect of the compound on those cells observed.
  • effect the amount of DNA methylated in a certain time may be determined.
  • the active compound is found to exert an influence on the cells, this may be used as a prognostic or diagnostic marker of the efficacy of the compound in methods of treating a patient carrying cells of the same cellular type.
  • treatment pertains generally to treatment and therapy, whether of a human or an animal (e.g. in veterinary applications), in which some desired therapeutic effect is achieved, for example, the inhibition of the progress of the condition, and includes a reduction in the rate of progress, a halt in the rate of progress, amelioration of the condition, and cure of the condition.
  • Treatment as a prophylactic measure i.e. prophylaxis is also included.
  • Active compounds may also be used as part of an in vitro assay, for example, in order to determine whether a candidate host is likely to benefit from treatment with the compound in question.
  • the active compound or pharmaceutical composition comprising the active compound may be administered to a subject by any convenient route of administration, whether systemically/ peripherally or at the site of desired action, including but not limited to, oral (e.g. by ingestion); topical (including e.g. transdermal, intranasal, ocular, buccal, and sublingual); pulmonary (e.g. by inhalation or insufflation therapy using, e.g. an aerosol, e.g.
  • vaginal parenteral, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, and intrastemal; by implant of a depot, for example, subcutaneously or intramuscularly.
  • the subject may be a eukaryote, an animal, a vertebrate animal, a mammal, a rodent (e.g. a guinea pig, a hamster, a rat, a mouse), murine (e.g. a mouse), canine (e.g. a dog), feline (e.g. a cat), equine (e.g. a horse), a primate, simian (e.g. a monkey or ape), a monkey (e.g. marmoset, baboon), an ape (e.g. gorilla, chimpanzee, orangutang, gibbon), or a human.
  • a rodent e.g. a guinea pig, a hamster, a rat, a mouse
  • murine e.g. a mouse
  • canine e.g. a dog
  • feline e.g. a cat
  • the active compound While it is possible for the active compound to be administered alone, it is preferable to present it as a pharmaceutical composition (e.g., formulation) comprising at least one active compound, as defined above, together with one or more pharmaceutically acceptable carriers, adjuvants, excipients, diluents, fillers, buffers, stabilisers, preservatives, lubricants, or other materials well known to those skilled in the art and optionally other therapeutic or prophylactic agents.
  • a pharmaceutical composition e.g., formulation
  • pharmaceutically acceptable carriers e.g., adjuvants, excipients, diluents, fillers, buffers, stabilisers, preservatives, lubricants, or other materials well known to those skilled in the art and optionally other therapeutic or prophylactic agents.
  • the present invention further provides pharmaceutical compositions, as defined above, and methods of making a pharmaceutical composition comprising admixing at least one active compound, as defined above, together with one or more pharmaceutically acceptable carriers, excipients, buffers, adjuvants, stabilisers, or other materials, as described herein.
  • pharmaceutically acceptable refers to compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgement, suitable for use in contact with the tissues of a subject (e.g. human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • a subject e.g. human
  • Each carrier, excipient, etc. must also be “acceptable” in the sense of being compatible with the other ingredients of the formulation.
  • Suitable carriers, diluents, excipients, etc. can be found in standard pharmaceutical texts. See, for example, “Handbook of Pharmaceutical Additives”, 2nd Edition (eds. M. Ash and I. Ash), 2001 (Synapse Information Resources, Inc., Endicott, New York, USA), “Remington's Pharmaceutical Sciences”, 20th edition, pub. ⁇ ppincott, Williams & Wilkins, 2000; and “Handbook of Pharmaceutical Excipients", 2nd edition, 1994.
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. Such methods include the step of bringing into association the active compound with the carrier which constitutes one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association the active compound with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.
  • Formulations may be in the form of liquids, solutions, suspensions, emulsions, elixirs, syrups, tablets, losenges, granules, powders, capsules, cachets, pills, ampoules, suppositories, pessaries, ointments, gels, pastes, creams, sprays, mists, foams, lotions, oils, boluses, electuaries, or aerosols.
  • Formulations suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active compound; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion; as a bolus; as an electuary; or as a paste.
  • a tablet may be made by conventional means, e.g. compression or molding, optionally with one or more accessory ingredients.
  • Compressed tablets may be prepared by compressing in a suitable machine the active compound in a free-flowing form such as a powder or granules, optionally mixed with one or more binders (e.g. povidone, gelatin, acacia, sorbitol, tragacanth, hydroxypropylmethyl cellulose); fillers or diluents (e.g. lactose, microcrystailine cellulose, calcium hydrogen phosphate); lubricants (e.g. magnesium stearate, talc, silica); disintegrants (e.g.
  • Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
  • the tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active compound therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile. Tablets may optionally be provided with an enteric coating, to provide release in parts of the gut other than the stomach.
  • Formulations suitable for topical administration may be formulated as an ointment, cream, suspension, lotion, powder, solution, past, gel, spray, aerosol, or oil.
  • a formulation may comprise a patch or a dressing such as a bandage or adhesive plaster impregnated with active compounds and optionally one or more excipients or diluents.
  • Formulations suitable for topical administration in the mouth include losenges comprising the active compound in a flavored basis, usually sucrose and acacia or tragacanth; pastilles comprising the active compound in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouthwashes comprising the active compound in a suitable liquid carrier.
  • Formulations suitable for topical administration to the eye also include eye drops wherein the active compound is dissolved or suspended in a suitable carrier, especially an aqueous solvent for the active compound.
  • Formulations suitable for nasal administration, wherein the carrier is a solid include a coarse powder having a particle size, for example, in the range of about 20 to about 500 microns which is administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close up to the nose.
  • Suitable formulations wherein the carrier is a liquid for administration as, for example, nasal spray, nasal drops, or by aerosol administration by nebuliser include aqueous or oily solutions of the active compound.
  • Formulations suitable for administration by inhalation include those presented as an aerosol spray from a pressurised pack, with the use of a suitable propellant, such as dichlorodifluoromethane, trichlorofluoromethane, dichoro-tetrafluoroethane, carbon dioxide, or other suitable gases.
  • a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichoro-tetrafluoroethane, carbon dioxide, or other suitable gases.
  • Formulations suitable for topical administration via the skin include ointments, creams, and emulsions.
  • the active compound When formulated in an ointment, the active compound may optionally be employed with either a paraffinic or a water-miscible ointment base.
  • the active compounds may be formulated in a cream with an oil-in-water cream base.
  • the aqueous phase of the cream base may include, for example, at least about 30% w/w of a polyhydric alcohol, i.e., an alcohol having two or more hydroxyl groups such as propylene glycol, butane-1,3-diol, mannitol, sorbitol, glycerol and polyethylene glycol and mixtures thereof.
  • the topical formulations may desirably include a compound which enhances absorption or penetration of the active compound through the skin or other affected areas. Examples of such dermal penetration enhancers include dimethylsulfoxide and related analogues.
  • the oily phase may optionally comprise merely an emulsifier (otherwise known as an emulgent), or it may comprises a mixture of at least one emulsifier with a fat or an oil or with both a fat and an oil.
  • an emulsifier otherwise known as an emulgent
  • a hydrophilic emulsifier is included together with a lipophilic emulsifier which acts as a stabiliser. It is also preferred to include both an oil and a fat.
  • the emulsifier(s) with or without stabiliser(s) make up the so-called emulsifying wax
  • the wax together with the oil and/or fat make up the so-called emulsifying ointment base which forms the oily dispersed phase of the cream formulations.
  • Suitable emulgents and emulsion stabilisers include Tween 60, Span 80, cetostearyl alcohol, myristyl alcohol, glyceryl monostearate and sodium lauryl sulphate.
  • suitable oils or fats for the formulation is based on achieving the desired cosmetic properties, since the solubility of the active compound in most oils likely to be used in pharmaceutical emulsion formulations may be very low.
  • the cream should preferably be a non-greasy, non-staining and washable product with suitable consistency to avoid leakage from tubes or other containers.
  • Straight or branched chain, mono- or dibasic alkyl esters such as di-isoadipate, isocetyl stearate, propylene glycol diester of coconut fatty acids, isopropyl myristate, decyl oleate, isopropyl palmitate, butyl stearate, 2-ethylhexyl palmitate or a blend of branched chain esters known as Crodamo) CAP may be used, the last three being preferred esters. These may be used alone or in combination depending on the properties required. Alternatively, high melting point lipids such as white soft paraffin and/or liquid paraffin or other mineral oils can be used.
  • Formulations suitable for rectal administration may be presented as a suppository with a suitable base comprising, for example, cocoa butter or a salicylate.
  • Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations containing in addition to the active compound, such carriers as are known in the art to be appropriate.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous isotonic, pyrogen-free, sterile injection solutions which may contain anti-oxidants, buffers, preservatives, stabilisers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents, and liposomes or other microparticulate systems which are designed to target the compound to blood components or one or more organs.
  • Suitable isotonic vehicles for use in such formulations include Sodium Chloride Injection, RingerDs Solution, or Lactated RingerDs Injection.
  • concentration of the active compound in the solution is from about 1 ng/ml to about 10 ⁇ g/ml, for example from about 10 ng/ml to about 1 ⁇ g/ml.
  • the formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets.
  • Formulations may be in the form of liposomes or other microparticulate systems which are designed to target the active compound to blood components or one or more organs.
  • appropriate dosages of the active compounds, and compositions comprising the active compounds can vary from patient to patient. Determining the optimal dosage will generally involve the balancing of the level of therapeutic benefit against any risk or deleterious side effects of the treatments of the present invention.
  • the selected dosage level will depend on a variety of factors including, but not limited to, the activity of the particular compound, the route of administration, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds, and/or materials used in combination, and the age, sex, weight, condition, general health, and prior medical history of the patient.
  • the amount of compound and route of administration will ultimately be at the discretion of the physician, although generally the dosage will be to achieve local concentrations at the site of action which achieve the desired effect without causing substantial harmful or deleterious side-effects.
  • Administration in vivo can be effected in one dose, continuously or intermittently (e.g., in divided doses at appropriate intervals) throughout the course of treatment. Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and will vary with the formulation used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician.
  • a suitable dose of the active compound is in the range of about 100 ⁇ g to about 250 mg per kilogram body weight of the subject per day.
  • the active compound is a salt, an ester, prodrug, or the like
  • the amount administered is calculated on the basis of the parent compound and so the actual weight to be used is increased proportionately.
  • the pumps used were Gilson 306, the mixer was a Gilson 811C, the manometric module was a Gilson 806 and the detector was a Gilson UV/VIS 152.
  • the detection wavelength used was 254 nm
  • the injection volume was 10 micro litres.
  • the flow rate was 1 ml/min and the mobile phases of water and acetonitrile contained 0.1% formic acid.
  • the elution was started at 95% water:5% acetonitrile ramping up to 2% water:98% acetonitrile over 3 minutes. This eluent level was held for 5 minutes before returning to the starting conditions of 95% water:5% acetonitrile over 30 seconds. These conditions were held for 2 minutes to allow equilibration of the column before the next sample was injected.
  • LCMS2 For analysis of samples by High Performance Liquid Chromatography-Mass Spectrometry the following conditions were used.
  • the pumps used were Gilson 306, the mixer was a Gilson 811C, the manometric module was a Gilson 806 and the detector was a Gilson UV/VIS 152.
  • the detection wavelength used was 254 nm
  • the injection volume was 10 micro litres.
  • the flow rate was 1.5 mL/min and the mobile phases of water and acetonitrile contained 0.1% formic acid.
  • the elution was started at 95% water:5% acetonitrile ramping up to 5% water:95% acetonitrile over 5.5 minutes. This eluent level was held for 2 minutes before returning to the starting conditions of 95% water:5% acetonitrile. These conditions were held for 1 minute to allow equilibration of the column before the next sample was injected.
  • Example 1a (S)-2-(1,3-Dihydro-isoindol-2-yl)-3-(1H-indol-2-yl)-propionic acid (2)
  • the intermediate yellow solid was added to triethylamine (1 mL, 7.1 mmol) and toluene (120ml), and refluxed with a Dean-Stark apparatus at 140 0 C for three hours. The mixture was left to cool and evaporated in vacuo. The residue was acidified to pH2 with 2 M HCI and the aqueous phase was extracted twice with ethyl acetate.
  • Example 2b 2-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-3-(1-methyl-1H-indol-3-yl)- propionic acid (49)
  • Example 3b (S)-2-(1 ,3-Dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1 H-indo!-3-yl)-N- methoxy-N-methyl-propionamide (53)
  • Example 3c (S)-2-(1 ,3-Dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1 H-indol-3-yl)-propionic acid hydrazide (54)
  • Example 3f 2-[(S)-2-(1W-lndoI-3-yl)-1-(5-oxo-4,5-dihydro-[1,2,4]oxadiazol-3-yl)- ethyl]-isoindole-1,3-dione (59)
  • Example 3g 2-[(S)-2-(1H-lndol-3-yl)-1-(1H-tetrazoI-5yl)-ethyl]-isoindole-1,3-dione (60)
  • the substrate DNA for the in vitro methylation assay was a 798 bp fragment (-423/+ 375 relative to the initiation codon) from the promoter region of the human p76/nw a gene.
  • the methylation reaction contained 350-400 ng substrate DNA and 4 U of M.Sssl methylase (0.5 ⁇ M, New England Biolabs) in a final volume of 50 ⁇ l. Inhibitors were added to final concentrations of 10, 100, 200, and 500 ⁇ M, respectively. Reactions were performed at 37°C for 2 hours. After completion, the reaction was inactivated at 65 0 C for 15 minutes and the DNA was purified using the QIAquick PCR Purification Kit (Qiagen). 300 ng of purified DNA was digested for 3 hours at 60°C with 30 units of BstUI (New England Biolabs) and analyzed on 2% TBE agarose gels. DNA methylation analysis
  • Genomic DNA was isolated from cells using the DNeasy kit (Qiagen). Genomic cytosine methylation levels were determined by capillary electrophoresis, as described previously (Stach, D., et al., Nucleic Acids Res., 31, e2 (2003)). The methylation status of satellite sequences was analyzed by methylation-sensitive Southern blots, as described previously (Rhee, I., et al., Nature, 416, 552-556 (2002)). Methylation-specific PCR analysis was performed as described previously (Myohanen, S. K., et al., Cancer Res., 58, 591-593 (1998); Bachman, K.
  • 20 ⁇ l reactions contained 2 ocl template, 1x ReddyMix buffer (Abgene), 10 ocM each primer, 1 mM dNTPs (Stratagene), and 1 U of Thermoprime polymerase (Abgene).
  • the primers (M: methylation-specific, U: specific for unmethylated DNA) and the amplification programs were as follows: p16 (M-for TTATTAGAGGGTGGGGCGGATCGC, M-rev GACCCCGAACCGCGACCGTAA-; U-for TTATTAGAGGGTGGGGTGGATTGT, U-rev CAACCCCAAACCACAACCATAA), 95°C 3 min, 35 cycles (95°C 30 s, 60/65 0 C 30 s, 72°C 30 s), 72°C 5 min; TIMP-3 (M-for CGTTGCGTTTTATTTCGTTTCGTC, M-rev TACGCGCCGCCGACG; U-for TTGTTGTGTTTTATTTTGTTTTGTT, U-rev ATTACCATACACACCACCAACA), 95°C 3 min, 35 cycles (95°C 45 s, 52°C s, 72°C 45 s), 72°C 5 min; SFRP1 (M-for GGTAGTAGTTTGCGGTC
  • TACACCCAATACCCATACCAACTCTACA 95°C 3 min, 35 cycles (95 0 C 30 s, 62°C 30 s, 72°C 30 s), 72°C 5 min.
  • genomic DNA was deaminated with sodium bisulfite (Frommer, M, et al., Proc Natl Acad Sci USA, 89, 1827-1831 (1992)) and subsequently amplified by PCR using the following primers and PCR conditions: TIMP3-for TTTGTTTTTTTAGTTTTTGTTTTTTTT, TIMP3-rev
  • PCR products were purified using the QIAquick Gel Extraction Kit (Qiagen). For combined bisulfite restriction analysis of chromosome 1 satellite 2, PCR fragments were digested with Hinfl and separated by agarose gel electrophoresis. For bisulfite sequencing of the TIMP-3 promoter region, PCR fragments were subcloned into the pCR 4-Topo plasmid vector (Invitrogen) and subjected to automated sequencing. Results
  • the following compound were tested using the in vitro methylation assay described above and found to have an IC50 of 450 ⁇ M or less: 2 to 37, 40 to 42, 44, 45, 47, 48, 52, 53, 54, 56, 57, 59, 60, 63 to 66.

Abstract

L'invention concerne certains phthalamides, succinimides et composés apparentés et leur utilisation en tant que produits pharmaceutiques. L'invention porte notamment sur ces composés, sur des compositions pharmaceutiques comprenant ces composés et sur l'utilisation de ces composés, par exemple pour inhiber la méthylation de l'ADN dans des cellules, notamment des cellules tumorales.
PCT/GB2006/002517 2005-07-08 2006-07-07 Phthalamides, succinimides, composes apparentes et leur utilisation en tant que produits pharmaceutiques WO2007007054A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB0514041A GB0514041D0 (en) 2005-07-08 2005-07-08 Compounds
GB0514041.3 2005-07-08
US69817605P 2005-07-11 2005-07-11
US60/698,176 2005-07-11

Publications (1)

Publication Number Publication Date
WO2007007054A1 true WO2007007054A1 (fr) 2007-01-18

Family

ID=37268279

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2006/002517 WO2007007054A1 (fr) 2005-07-08 2006-07-07 Phthalamides, succinimides, composes apparentes et leur utilisation en tant que produits pharmaceutiques

Country Status (1)

Country Link
WO (1) WO2007007054A1 (fr)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009032194A1 (fr) 2007-08-31 2009-03-12 Whitehead Institute For Biomedical Research Stimulation de la voie wnt dans la reprogrammation de cellules somatiques
US20130040865A1 (en) * 2010-03-30 2013-02-14 Jx Nippon Oil & Energy Corporation Succinimide compound, lubricating oil additive, and lubricating oil composition
EP2626416A2 (fr) 2007-04-07 2013-08-14 The Whitehead Institute for Biomedical Research Reprogrammation de cellules somatiques
WO2014168522A1 (fr) 2013-04-12 2014-10-16 Общество С Ограниченной Ответственностью "Фарминтерпрайсез" Dérivés de glutarimides, leur utilisation, composition pharmaceutique sur leur base et procédés de fabrication
US9012466B2 (en) 2013-03-12 2015-04-21 Arqule Inc. Substituted tricyclic pyrazolo-pyrimidine compounds
WO2015072893A1 (fr) 2013-11-14 2015-05-21 Общество С Ограниченной Ответственностью "Фарминтерпрайсез" Composition pharmaceutique contenant des dérivés de glutarimides et leur utilisation dans le traitement d'affections à éosinophiles
WO2015196139A1 (fr) * 2014-06-20 2015-12-23 The Board Of Trustees Of The Leland Stanford Junior University Inhibiteurs mitochondriaux destinés à être utilisés dans la culture de cellules souches pluripotentes
US9266886B2 (en) 2014-02-03 2016-02-23 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
US9481674B1 (en) 2016-06-10 2016-11-01 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
US9663515B2 (en) 2014-11-05 2017-05-30 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
EP3207932A1 (fr) 2016-02-19 2017-08-23 Universität Stuttgart Inhibiteurs de méthyltransférase d'adn pour la thérapie du syndrome de rett
US9796710B2 (en) 2014-10-14 2017-10-24 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
US9845308B2 (en) 2014-11-05 2017-12-19 Vitae Pharmaceuticals, Inc. Isoindoline inhibitors of ROR-gamma
US10301261B2 (en) 2015-08-05 2019-05-28 Vitae Pharmaceuticals, Llc Substituted indoles as modulators of ROR-gamma
US10829481B2 (en) 2016-01-29 2020-11-10 Vitae Pharmaceuticals, Llc Benzimidazole derivatives as modulators of ROR-gamma
US10913739B2 (en) 2017-07-24 2021-02-09 Vitae Pharmaceuticals, LLC (121374) Inhibitors of RORγ
US11008340B2 (en) 2015-11-20 2021-05-18 Vitae Pharmaceuticals, Llc Modulators of ROR-gamma
US11186573B2 (en) 2017-07-24 2021-11-30 Vitae Pharmaceuticals, Llc Inhibitors of ROR gamma

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5855459A (ja) * 1981-09-26 1983-04-01 Dai Ichi Pure Chem Co Ltd 光学活性トリプトフアン誘導体の製造法
WO2002091926A2 (fr) * 2001-05-11 2002-11-21 Methylgene, Inc. Inhibiteurs des isoformes de méthyltransférase d'adn
EP1275730A1 (fr) * 2000-04-04 2003-01-15 Mercian Corporation Methode de production de derives de -3(2-aminopropyl)indole 7-substitue optiquement actifs, et intermediaires servant a produire ces derives
EP1574499A1 (fr) * 2004-03-08 2005-09-14 DKFZ Deutsches Krebsforschungszentrum Inhibiteurs de méthylation d'ADN dans des cellules tumorales
WO2006040646A1 (fr) * 2004-10-14 2006-04-20 Pfizer, Inc. Amides de benzimidazole ou d'indole en tant qu'inhibiteurs de pin1
WO2006044860A2 (fr) * 2004-10-18 2006-04-27 Amgen, Inc. Composes de thiadiazole et leurs procedes d'utilisation

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5855459A (ja) * 1981-09-26 1983-04-01 Dai Ichi Pure Chem Co Ltd 光学活性トリプトフアン誘導体の製造法
EP1275730A1 (fr) * 2000-04-04 2003-01-15 Mercian Corporation Methode de production de derives de -3(2-aminopropyl)indole 7-substitue optiquement actifs, et intermediaires servant a produire ces derives
WO2002091926A2 (fr) * 2001-05-11 2002-11-21 Methylgene, Inc. Inhibiteurs des isoformes de méthyltransférase d'adn
US20030083292A1 (en) * 2001-05-11 2003-05-01 Macleod Alan Robert Inhibitors of DNA methyltransferase isoforms
EP1574499A1 (fr) * 2004-03-08 2005-09-14 DKFZ Deutsches Krebsforschungszentrum Inhibiteurs de méthylation d'ADN dans des cellules tumorales
WO2005085196A2 (fr) * 2004-03-08 2005-09-15 Dkfz Inhibiteurs de methylation de l'adn dans des cellules tumorales
WO2006040646A1 (fr) * 2004-10-14 2006-04-20 Pfizer, Inc. Amides de benzimidazole ou d'indole en tant qu'inhibiteurs de pin1
WO2006044860A2 (fr) * 2004-10-18 2006-04-27 Amgen, Inc. Composes de thiadiazole et leurs procedes d'utilisation

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
10 May 2006, AURORA SCREENING LIBRARY *
18 January 2005, INTERCHIM INTERMDEDIATES *
21 August 2006, RARE CHEMICALS CATALOGUE *
27 March 2006, BIONET SCREENING COMPOUNDS *
3 July 2005, AMBINTER STOCK SCREENING COLLECTION *
3 July 2005, AMINTER STOCK SCREENING COLLECTION *
BODO BRUECKNER, ET AL., CANCER RESEARCH, vol. 65, no. 14, 2005, pages 6305 - 6311, XP002406577 *
BRUECKNER B ET AL: "DNA methyltransferase inhibitors: old and new drugs for an epigenetic cancer therapy", TRENDS IN PHARMACOLOGICAL SCIENCES, ELSEVIER, AMSTERDAM, NL, vol. 25, no. 11, November 2004 (2004-11-01), pages 551 - 554, XP004604038, ISSN: 0165-6147 *
DATABASE CHEMCATS [online] Chemical Abstracts Service, Columbus, Ohio, US; 10 November 2004 (2004-11-10), XP002406945, retrieved from STN *
DATABASE CHEMCATS [online] Chemical Abstracts Service, Columbus, Ohio, US; 10 November 2004 (2004-11-10), XP002406946, retrieved from STN *
DATABASE CHEMCATS [online] Chemical Abstracts Service, Columbus, Ohio, US; 10 November 2004 (2004-11-10), XP002406950, retrieved from STN *
DATABASE CHEMCATS [online] Chemical Abstracts Service, Columbus, Ohio, US; 18 January 2005 (2005-01-18), XP002406947, retrieved from STN *
DATABASE CHEMCATS [online] Chemical Abstracts Service, Columbus, Ohio, US; 27 March 2006 (2006-03-27), XP002406952, retrieved from STN *
DATABASE CHEMCATS [online] Chemical Abstracts Service, Columbus, Ohio, US; 3 July 2005 (2005-07-03), XP002406948, retrieved from STN *
DATABASE CHEMCATS [online] Chemical Abstracts Service, Columbus, Ohio, US; 3 July 2005 (2005-07-03), XP002406949, retrieved from STN *
DATABASE CHEMCATS [online] Chemical Abstracts Service, Columbus, Ohio, US; 3 July 2005 (2005-07-03), XP002406951, retrieved from STN *
DATABASE CHEMCATS [online] Chemical Abstracts Service; 10 May 2006 (2006-05-10), XP002406953, retrieved from STN *
FRANK LYKO, ROBERT BROWN, JOURNAL OF THE NATIONAL CANCER INSTITUTE, vol. 97, no. 20, 2005, pages 1498 - 1506, XP002406578 *
KAWASHIMA K ET AL: "AN INTENSELY SWEET ANALOGUE OF KYNURENINE: 3-(4-CHLOROANTHRANILOYL)-D L-ALANINE", JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY, AMERICAN CHEMICAL SOCIETY. WASHINGTON, US, vol. 28, no. 6, 1980, pages 1338 - 1340, XP002344699, ISSN: 0021-8561 *
PAWEL SIEDLECKI, ET AL., JOURNAL OF MEDICINAL CHEMISTRY, vol. 49, 2005, pages 678 - 683, XP002406576 *
RICHARD G. HISKEY, JOHN B. ADAMS, JR., JOURNAL OF ORGANIC CHEMISTRY, vol. 31, 1966, pages 2178 - 2183, XP002406634 *

Cited By (51)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2626416A2 (fr) 2007-04-07 2013-08-14 The Whitehead Institute for Biomedical Research Reprogrammation de cellules somatiques
EP3878949A1 (fr) 2007-04-07 2021-09-15 Whitehead Institute for Biomedical Research Reprogrammation de cellules somatiques
EP3078738A1 (fr) 2007-08-31 2016-10-12 Whitehead Institute for Biomedical Research Stimulation de la voie wnt dans la reprogrammation de cellules somatiques
WO2009032194A1 (fr) 2007-08-31 2009-03-12 Whitehead Institute For Biomedical Research Stimulation de la voie wnt dans la reprogrammation de cellules somatiques
US20130040865A1 (en) * 2010-03-30 2013-02-14 Jx Nippon Oil & Energy Corporation Succinimide compound, lubricating oil additive, and lubricating oil composition
US8933247B2 (en) * 2010-03-30 2015-01-13 Jx Nippon Oil & Energy Corporation Succinimide compound, lubricating oil additive, and lubricating oil composition
US9012466B2 (en) 2013-03-12 2015-04-21 Arqule Inc. Substituted tricyclic pyrazolo-pyrimidine compounds
US10155744B2 (en) 2013-04-12 2018-12-18 Obschestvo S Ogranichennoi Otvetstvennostiyu “Pharmenterprises” Glutarimide derivatives, use thereof, pharmaceutical composition based thereon and methods for producing glutarimide derivatives
EA031392B1 (ru) * 2013-04-12 2018-12-28 Общество С Ограниченной Ответственностью "Фарминтерпрайсез" Производные глутаримидов, их применение, фармацевтическая композиция на их основе, способы их получения
JP2016516766A (ja) * 2013-04-12 2016-06-09 オブシェストヴォ・ス・オグラニチェンノイ・オトヴェトストヴェンノストジュ・“ファームエンタープライジーズ” グルタルイミド誘導体、その使用、それに基づいた医薬組成物及びグルタルイミド誘導体を製造するための方法
CN110172055B (zh) * 2013-04-12 2021-10-29 瓦伦塔有限责任公司 戊二酰亚胺衍生物、其用途、基于所述衍生物的药物组合物及戊二酰亚胺衍生物的制备方法
CN106061962A (zh) * 2013-04-12 2016-10-26 制药有限责任公司 戊二酰亚胺衍生物、其用途、基于所述衍生物的药物组合物及戊二酰亚胺衍生物的制备方法
WO2014168522A1 (fr) 2013-04-12 2014-10-16 Общество С Ограниченной Ответственностью "Фарминтерпрайсез" Dérivés de glutarimides, leur utilisation, composition pharmaceutique sur leur base et procédés de fabrication
EP2985282A4 (fr) * 2013-04-12 2017-02-22 Obschestvo S Ogranichennoi Otvetstennostiyu "Pharmenterprises" Dérivés de glutarimides, leur utilisation, composition pharmaceutique sur leur base et procédés de fabrication
AU2018236805C1 (en) * 2013-04-12 2020-11-05 Obschestvo S Ogranichennoi Otvetstvennostiyu "Pharmenterprises" Glutarimide derivatives, use thereof, pharmaceutical composition based thereon and methods for producing glutarimide derivatives
EP3725785A1 (fr) 2013-04-12 2020-10-21 Obschestvo S Ogranichennoi Otvetstennostiyu "Pharmenterprises" Dérivés de glutarimide, leur utilisation, composition pharmaceutique basée sur ceux-ci et procédés de production de dérivés de glutarimide
EP3722290A1 (fr) 2013-04-12 2020-10-14 Obschestvo S Ogranichennoi Otvetstennostiyu "Pharmenterprises" Dérivés de glutarimide, leur utilisation, composition pharmaceutique basée sur ceux-ci et procédés de production de dérivés de glutarimide
AU2018236805B2 (en) * 2013-04-12 2020-04-09 Obschestvo S Ogranichennoi Otvetstvennostiyu "Pharmenterprises" Glutarimide derivatives, use thereof, pharmaceutical composition based thereon and methods for producing glutarimide derivatives
US9815814B2 (en) 2013-04-12 2017-11-14 Obschestvo S Ogranichennoi Otvetstvennostiyu “Pharmenterprises” Glutarimide derivatives, use thereof, pharmaceutical composition based thereon and methods for producing glutarimide derivatives
CN110172055A (zh) * 2013-04-12 2019-08-27 制药有限责任公司 戊二酰亚胺衍生物、其用途、基于所述衍生物的药物组合物及戊二酰亚胺衍生物的制备方法
US10377739B2 (en) 2013-04-12 2019-08-13 Obschestvo S Ogranichennoi Otvetstvennostiyu “Pharmenterprises” Glutarimide derivatives, use thereof, pharmaceutical composition based thereon and methods for producing glutarimide derivatives
US10196377B2 (en) 2013-04-12 2019-02-05 Obschestvo S Ogranichennoi Otvetstvennostiyu “Pharmenterprises” Glutarimide derivatives, use thereof, pharmaceutical composition based thereon and methods for producing glutarimide derivatives
US10155746B2 (en) 2013-04-12 2018-12-18 Obschestvo S Ogranichennot Otvetstvennostiyu “Pharmenterprises” Glutarimide derivatives, use thereof, pharmaceutical composition based thereon and methods for producing glutarimide derivatives
US10155747B2 (en) 2013-04-12 2018-12-18 Obschestvo S Ogranichennoi Otvetstvennostiyu “Pharmenterprises” Glutarimide derivatives, use thereof, pharmaceutical composition based thereon and methods for producing glutarimide derivatives
US10155743B2 (en) 2013-04-12 2018-12-18 Obschestvo S Ogranichennoi Otvetstvennostiyu “Pharmaenterprises” Glutarimide derivatives, use thereof, pharmaceutical composition based thereon and methods for producing glutarimide derivatives
US10155745B2 (en) 2013-04-12 2018-12-18 Obschestvo S Ogranichennoi Otvetstvennostiyu “Pharmenterprises” Glutarimide derivatives, use thereof, pharmaceutical composition based thereon and methods for producing glutarimide derivatives
US10220029B2 (en) 2013-11-14 2019-03-05 Obschestvo S Ogranichennoi Otvetstvennostiyu “Pharmenterprises” Pharmaceutical composition comprising glutarimide derivatives and use thereof in the treatment of eosinophilic diseases
WO2015072893A1 (fr) 2013-11-14 2015-05-21 Общество С Ограниченной Ответственностью "Фарминтерпрайсез" Composition pharmaceutique contenant des dérivés de glutarimides et leur utilisation dans le traitement d'affections à éosinophiles
US9949962B2 (en) 2013-11-14 2018-04-24 Obschestvo S Ogranichennoi Otvetstvennostiyu “Pharmenterprises” Pharmaceutical composition comprising glutarimide derivatives and use thereof in the treatment of eosinophilic diseases
EP3466425A1 (fr) 2013-11-14 2019-04-10 Obschestvo S Ogranichennoi Otvetstvennostiyu "Pharmenterprises" Composition pharmaceutique comprenant des dérivés de glutarimide et leur utilisation dans le traitement de maladies éosinophiles
US10399976B2 (en) 2014-02-03 2019-09-03 Vitae Pharmaceuticals, Llc Dihydropyrrolopyridine inhibitors of ROR-gamma
US9624217B2 (en) 2014-02-03 2017-04-18 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
US10047085B2 (en) 2014-02-03 2018-08-14 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
US11535614B2 (en) 2014-02-03 2022-12-27 Vitae Pharmaceuticals, Llc Dihydropyrrolopyridine inhibitors of ROR-gamma
US9266886B2 (en) 2014-02-03 2016-02-23 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
US10807980B2 (en) 2014-02-03 2020-10-20 Vitae Pharmaceuticals, Llc Dihydropyrrolopyridine inhibitors of ROR-gamma
US10196604B2 (en) 2014-06-20 2019-02-05 The Board Of Trustees Of The Leland Stanford Junior University Mitochondrial inhibitors for use in culturing pluripotent stem cells
WO2015196139A1 (fr) * 2014-06-20 2015-12-23 The Board Of Trustees Of The Leland Stanford Junior University Inhibiteurs mitochondriaux destinés à être utilisés dans la culture de cellules souches pluripotentes
US9796710B2 (en) 2014-10-14 2017-10-24 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
US10087184B2 (en) 2014-10-14 2018-10-02 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of RORγ
US9845308B2 (en) 2014-11-05 2017-12-19 Vitae Pharmaceuticals, Inc. Isoindoline inhibitors of ROR-gamma
US9663515B2 (en) 2014-11-05 2017-05-30 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
US11001583B2 (en) 2014-11-05 2021-05-11 Vitae Pharmaceuticals, Llc Dihydropyrrolopyridine inhibitors of ROR-gamma
US10829448B2 (en) 2015-08-05 2020-11-10 Vitae Pharmaceuticals, Llc Substituted benzoimidazoles as modulators of ROR-γ
US10301261B2 (en) 2015-08-05 2019-05-28 Vitae Pharmaceuticals, Llc Substituted indoles as modulators of ROR-gamma
US11008340B2 (en) 2015-11-20 2021-05-18 Vitae Pharmaceuticals, Llc Modulators of ROR-gamma
US10829481B2 (en) 2016-01-29 2020-11-10 Vitae Pharmaceuticals, Llc Benzimidazole derivatives as modulators of ROR-gamma
EP3207932A1 (fr) 2016-02-19 2017-08-23 Universität Stuttgart Inhibiteurs de méthyltransférase d'adn pour la thérapie du syndrome de rett
US9481674B1 (en) 2016-06-10 2016-11-01 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
US11186573B2 (en) 2017-07-24 2021-11-30 Vitae Pharmaceuticals, Llc Inhibitors of ROR gamma
US10913739B2 (en) 2017-07-24 2021-02-09 Vitae Pharmaceuticals, LLC (121374) Inhibitors of RORγ

Similar Documents

Publication Publication Date Title
WO2007007054A1 (fr) Phthalamides, succinimides, composes apparentes et leur utilisation en tant que produits pharmaceutiques
JP4500161B2 (ja) フタラジノン誘導体
AU2016225133B2 (en) Substituted nucleoside derivatives useful as anticancer agents
CA2904641C (fr) Inhibiteurs d'adn-pk
KR101146806B1 (ko) 프탈라지논 유도체
KR20070057859A (ko) 4-헤테로아릴메틸 치환된 프탈라지논 유도체
WO2006090169A1 (fr) Derives de 2 , 4-diamino-pyridopyrimidine et leur utilisation comme inhibiteurs mtor
EP2176237A1 (fr) Dérivés de phtalazinone comme inhibiteurs de parp-1
BRPI0617437A2 (pt) derivados de ftalazinona substituÍda por 4-heteroarimetila
ZA200507097B (en) Phthalazinone derivatives
CA2265854A1 (fr) Nouveaux composes pharmaceutiquement actifs
EP1794151A1 (fr) Inhibiteurs d'adn-pk
EP1828118A1 (fr) Inhibiteurs de parp
KR20100059950A (ko) 프탈라지논 유도체
WO2009153566A1 (fr) Inhibiteurs de cyp26
KR890003357B1 (ko) 신규 티아졸 화합물의 제조방법
KR20080063828A (ko) 4-헤테로아릴메틸 치환된 프탈라지논 유도체
MX2008004913A (en) 4-heteroarymethyl substituted phthalazinone derivatives

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06764909

Country of ref document: EP

Kind code of ref document: A1