WO2006122850A1 - Probiotic bifidobacterial species - Google Patents

Probiotic bifidobacterial species Download PDF

Info

Publication number
WO2006122850A1
WO2006122850A1 PCT/EP2006/061247 EP2006061247W WO2006122850A1 WO 2006122850 A1 WO2006122850 A1 WO 2006122850A1 EP 2006061247 W EP2006061247 W EP 2006061247W WO 2006122850 A1 WO2006122850 A1 WO 2006122850A1
Authority
WO
WIPO (PCT)
Prior art keywords
bifidobacterium
milk
strain
sequence
strains
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2006/061247
Other languages
English (en)
French (fr)
Inventor
Georges Daube
Véronique DELCENSERIE
Françoise GAVINI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universite de Liege
Original Assignee
Universite de Liege
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite de Liege filed Critical Universite de Liege
Priority to DK06725493T priority Critical patent/DK1883695T3/da
Priority to US11/914,434 priority patent/US7959912B2/en
Priority to CA002602693A priority patent/CA2602693A1/en
Priority to JP2008511662A priority patent/JP2008539776A/ja
Priority to DE602006006997T priority patent/DE602006006997D1/de
Priority to EP06725493A priority patent/EP1883695B1/en
Priority to AT06725493T priority patent/ATE432337T1/de
Publication of WO2006122850A1 publication Critical patent/WO2006122850A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/12Antidiarrhoeals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Definitions

  • the invention relates to a bacterium belonging to the genus
  • Bifidobacterium to probiotic compositions comprising said bacterium, particularly food products, and to their use in the treatment of gastrointestinal diseases.
  • Bifidobacteria (or bacteria belonging to the Bifidobacterium genus) constitute one of the most important populations of human and animal faecal flora. It is generally considered an indication of good health when these bacteria are present at a high rate in faecal flora. For this reason, they are known as probiotic bacteria (beneficial microorganisms which improve the natural balance of intestinal flora when ingested alive). Examples of known Bifidobacteria include B. adolescentis, B. animalis, B. bifidum, B. breve, B. catenulatum and B. longum and these bacteria have been shown to have beneficial technological, organoleptic and probiotic effects.
  • Bifidobacteria are most commonly found as an additive in fermented milks (yoghurts with "active Bifidus") and thus constitute an economically important commodity.
  • the strains chosen by the milk industry must meet numerous strict requirements, such as resistance to the process of manufacture and survival within the foodstuff.
  • the most commonly used species in France are B. animalis subsp. lactis and B. animalis subsp. animalis, which is a subspecies from animal origin, never isolated from humans.
  • Bifidobacteria there is a great need to identify novel species within this genus having properties optimally matched to the requirements of the food industry. For example, in 2004, a group identified and isolated Bifidobacterium psychraerophilum from a porcine caecum (Simpson, PJ. et al. (2004) Int J Syst Evol Microbiol 54:
  • a homolog of Bifidobacterium GC56 will be understood to refer to any bifidobacteria strain having DNA sequence homology of greater than 40% with Bifidobacterium GC56 deposited at the Collection Nationale de Cultures de Micro-organismes (CNCM, Institut Pasteur) on 9 December 2004, with accession number CNCM 1-3342 (hereinafter referred to as 'GC56').
  • a GC56 homolog is one having greater than 50% homology with GC56, more preferably greater than 60%, most preferably greater than 70%, especially preferably greater than 80% or most especially preferably greater than 90% (or any range between any of the above values).
  • sequence homology can be tested as described herein with reference to DNA-DNA reassociation experiments. Such experiments may include detection of specific sequences of 16S rDNA or of the hsp60 gene and these sequences and linked endonuclease restriction sites allow the detection of GC56. Other experiments, which may also identify GC56, include ELISA-PCR and PCR-RFLP.
  • GC56 represents a new species of Bifidobacterium called Bifidobacterium crudilactis.
  • the terms GC56, GC56 group, Bifidobacterium GC56 and Bifidobacterium crudilactis are used interchangeably to refer to this new species of Bifidobacterium.
  • strains of GC56 discussed herein include FR62/b/3, FR59/b/2, and FR47/3.
  • the 16S rDNA gene sequences of these strains have been deposited in GenBank and have the accession numbers: AY952449 (Sequence ID No: 3), AY952448 (Sequence ID No: 4) and AY952450 (Sequence ID No: 2) respectively.
  • the 16S rDNA gene sequence for AY952448 deposited at GenBank has an error at the application date of the present application. The inventors have applied to correct the error in the sequence.
  • GC56 was identified during the cheese making of "L'etoile du Vercors" which is a traditional and manual process. GC56 is present throughout the cheese production process (i.e. from raw milk to the end of maturing), with a statistically significant increase during the process. These bacteria belong to a natural microbial population which takes part in the development of organoleptic properties of the end product.
  • GC56 has the key advantage of being the first bifidobacterial species isolated from a food production process whereas previous bifidobacteria have been extracted from the digestive tracts of humans or animals, thus GC56 is easier to integrate into the manufacturing process and is also easier to stabilise in food and fermented products than other bifidobacteria.
  • GC56 has also been found to be psychotrophic and to be able to grow at temperatures as low as 10-12 0 C, the maturing temperature of the "L'etoile du Vercors" process, whereas most others need a temperature of more than
  • GC56 is thought to constitute a milk subdominant population selected by the low temperature of the L'etoile du Vercors process (milk at 4 0 C, warmed to 22 0 C until the removal from the mould at Day 2, then maintained at 12 0 C from the maturing at Day 8 until Day 28).
  • the key advantage of growth at low temperatures is that GC56 bacteria are more likely to survive low storage temperatures than most other probiotic bacterial compositions, which would therefore prolong the shelf-life.
  • GC56 is aero-tolerant, whereas most others need strict anaerobiotic conditions to multiply and survive.
  • Bifidobacterium GC56 provide a good fermentation of milk (alone or in a mix), a good resistance to lactic acid in the end product (more than 10 6 cfu/g), a sufficient growth rate, a good resistance to stomach acidity, the biliary salts and to the intestinal enzymes and a lower need for growth factors (yeast extract, hydrolysed protein, vitamins and other elements).
  • a probiotic composition comprising Bifidobacterium GC56 as hereinbefore defined and one or more acceptable excipients.
  • an acceptable excipient will be well known to the person skilled in the art of probiotic composition preparation.
  • acceptable excipients include: sugars such as sucrose, isomerized sugar, glucose, fructose, palatinose, trehalose, lactose and xylose; sugar alcohols such as sorbitol, xylitol, erythritol, lactitol, palatinol, reduced glutinous starch syrup and reduced glutinous maltose syrup; emulsifiers such as sucrose esters of fatty acid, glycerin esters of fatty acid and lecithin; thickeners (stabilizers) such as carrageenan, xanthan gum, guar gum, pectin and locust bean gum; acidifiers such as citric acid, lactic acid and malic acid; fruit juices such as lemon juice, orange juice and berry juice; vitamins such as vitamin A, vitamin B, vitamin C, vitamin D and vitamin E; and minerals such
  • compositions of the invention may be prepared by admixture, suitably at ambient temperature and atmospheric pressure, usually adapted for oral administration.
  • Such compositions may be in the form of tablets, capsules, oral liquid preparations, conventional food products, powders, granules, lozenges, reconstitutable powders or suspensions.
  • Tablets and capsules for oral administration may be in unit dose form, and may contain one or more conventional excipients, such as binding agents, fillers, tabletting lubricants, disintegrants, and acceptable wetting agents.
  • the tablets may be coated according to methods well known in pharmaceutical practice.
  • Oral liquid preparations may be in the form of, for example, aqueous or oily suspension, solutions, emulsions, syrups or elixirs, or may be in the form of a dry product for reconstitution with water or other suitable vehicle before use.
  • Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), preservatives, and if desired, conventional flavourings or colourants.
  • the composition of the invention is formulated as a conventional food product, more preferably, a dairy based product (e.g. fermented milk, vegetable milk, soybean milk, butter, cheese or yoghurt) or fruit juice.
  • the composition is preferably formulated as a food or drink for adult and infant humans and animals.
  • the composition is formulated as a lyophilised or spray-dried powder.
  • bifidobacteria are also generally believed to be of potential use in the treatment and/or prophylaxis of a variety of disorders, such as gastrointestinal diseases (e.g. diarrhoea), cancer, cholesterol excesses, allergies and infection.
  • Bifidobacterium GC56 for use as a therapeutic substance, in particular in the treatment and/or prophylaxis of the above disorders.
  • the invention further provides a use of Bifidobacterium GC56 in the preparation of a medicament for the treatment and/or prophylaxis of the above disorders.
  • the invention further provides a method of treatment and/or prophylaxis of the above disorders, in a human or animal subject, which comprises administering to the subject a therapeutically effective amount of Bifidobacterium GC56.
  • Bifidobacterium GC56 may be used in combination with other therapeutic agents, for example, other medicaments known to be useful in the treatment and/or prophylaxis of gastrointestinal diseases (e.g. diarrhoea), cancer, cholesterol excesses, allergies and infection.
  • a combination comprising Bifidobacterium GC56 together with a further therapeutic agent or agents.
  • probiotic compositions comprising a combination as defined above together with one or more excipients comprise a further aspect of the invention.
  • the individual components of such combinations may be administered either sequentially or simultaneously in separate or combined probiotic compositions.
  • Bifidobacterium GC56 is combined with other bifidobacteria or other probiotic bacteria such as: bacteria belonging to the genus Lactobacillus such as Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus johnsonii, Lactobacillus gallinarum, Lactobacillus amylovorus, Lactobacillus brevis, Lactobacillus rhamnosus, Lactobacillus kefir, Lactobacillus paracasei, Lactobacillus crispatus, Lactobacillus delbrueckii subsp.
  • Lactobacillus such as Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus johnsonii, Lactobacill
  • lactis bacteria belonging to the genus Bacillus such as Bacillus subtilis; and yeast belonging to the genus Saccharomyces, Torulaspora and Candida such as Saccharomyces cerevisiae, Torulaspora delbrueckii and Candida kefyr.
  • Figure 1 shows the phylogenetic tree of Bifidobacterium 16S rDNA sequences (1419 nucleotides) including FR62/b/3 strain (Genbank
  • FR62/b/3, FR47/3 and FR59/b/2 are all strains of Bifidobacterium crudilactis. The sequences were aligned with ClustalX. The tree was rooted with Actinomyces bovis and constructed using a neighbour- joining algorithm. Bootstrap values, calculated from 1000 trees, are given at each node. Numbers in parenthesis correspond to the GenBank accession numbers;
  • Figure 2 shows sequence alignments of 16S rDNA of GC56 FR62/b/3, Fr47/3 and Fr59/b/2 strains with B. psychraerophilum. The sequences were aligned using the program ClustalW from the European
  • Sequence l (Sequence ID No: 1) is B. psychraerophilum (AY174108), Sequence 2 (Sequence ID No: 2) is GC56 FR47/3 (AY952450), Sequence 3 (Sequence ID No: 3) is GC56 FR62/b/3 (AY952449) and
  • Sequence 4 (Sequence ID No: 4) is GC56 FR59/b/2 (AY952448).
  • 16S rDNAdwn (Sequence ID No: 5)) and 16S rDNAdwn (5' - cgtaaggggcatgatgatct - 3' (Sequence ID No: 6)) includes: AIuI: AGCT cut positions 5, 100, 411, 696, 902 (underlined) and Taql: TCGA cut positions 132, 796 (italics);
  • Figure 3 shows an hsp ⁇ O gene sequence alignment of several strains of the GC56 group with closely identified sequences. More specifically, Figure 3 show the alignment of partial sequences of the hsp60 gene of 4 of the GC56 group (FR47/3, FR51/h/l , FR54/e/l, 59/b/2) with closely identified sequences found on Genbank (PubMed).
  • B. pseudocatenulatum AY004274
  • B. adolescentis AF210319
  • B. ruminantium AF240571
  • B. merycicum AY004277
  • B. angulatum AF240568.
  • ATTTCCGCAGCCAAGGACGTTGA-DQ (Sequence ID No: 43): is a probe used for targeting the hsp60 gene and is specific of the GC56 group.
  • 5'-ATTTCCGCAGCCAAGGACGT-S' (Sequence ID No: 44) and 5'TCCAGAGCTTCGGCGATCTTC-S' (Sequence ID No: 45): are forward and reverse primers specific to the GC56 group used for targeting the hsp ⁇ O gene.; and
  • Figure 4 shows the morphological appearance of GC56.
  • GC56 was isolated from a raw milk cheese process in the industry "L'etoile du Vercors” (France).
  • Cultural methods (Delcenserie et al., (2005) J Microbiol Methods 61 : 55-67), but particularly molecular methods, allowed detection of these bacteria throughout the production chain of the product and the checking of the composition of the end products.
  • 95 strains were isolated from 31/31 studied cheeses "L'Etoile du Vercors" at different stages of the production, in 3/7 cheeses from trade raw milk cheeses other than those from “L'Etoile du Vercors” and in raw milk samples.
  • DNA-extraction (Wizard® genomic DNA purification kit of Promega): One millilitre broth was centrifuged for 2 min. at 13000g. The pellet was suspended in 480 ⁇ l EDTA, 60 ⁇ l of lysozyme, and 120 ⁇ l of cellular lysis solution and incubated for 45 min at 37 0 C. After centrifugation, 600 ⁇ l of nuclei lysis solution was added to the pellet followed by incubation for 5 min at 8O 0 C. When cooled, 200 ⁇ l of protein lysis solution was added followed by vortexing. The resultant suspension was then incubated for 5 min on ice and was centrifuged for 5 min at 13000g.
  • the supernatant was transferred to a clean tube containing 600 ⁇ l of isopropanol and the tube was then centrifuged. The supernatant was decanted and 600 ⁇ l ethanol 70% was added and the tube centrifuged. The ethanol was aspirated and pellet air-dried for 10 min. Finally, the DNA pellet was rehydrated in lOO ⁇ l of rehydration solution overnight at 4 0 C.
  • GC56 can be detected within a complex microbial population by using two
  • the thermal-cycler was programmed as follows: one 10 minute cycle at 95 0 C followed by 30 cycles composed of 30 seconds at 95 0 C, 30 seconds at 64.2 0 C (annealing temperature) and 30 seconds at 72 0 C and ended by 5 minutes at 72 0 C.
  • probes were derived using the primers and probes design guidelines provided by Applied Biosystems (Applied Biosystems, Foster city, USA). To check for specificity, the selected probes were compared to all available hsp ⁇ O gene sequences using the BLAST database search program. The GC56 probe was labelled with FAM (a reporter dye) and DQ.
  • Table 1 Primers and probes used for amplification of bifidobacteria and identification of the GC56 group.
  • PCR was performed on 55 strains belonging to 13 different Bifidobacterium species and 9 Bifidobacterium strains belonging to the GC56 group.
  • the results observed with the GC56 probe revealed a specificity of 98% (only one B. adolescentis strain (503Ie), was positive) and a sensitivity of 100% (the 9 tested strains from the GC56 group were positive).
  • Amplification reaction mixtures contained 10 to 50 ng of DNA, 12.5 ⁇ l of qPCR tm Mastermix (Eurogentec, Seraing, Belgium), 960 nM of each primer, 50 to 150 nM of fluorogenic probe and 5 mM MgCl 2 in a total volume of 25 ⁇ l. In each microwell plate, one well was used as non- template control, which contained all the reagents except the DNA sample.
  • the PCR results for the samples were expressed as deltaRn (relative sensitivity) fluorescence signal.
  • a sample was considered as positive when the Ct value was lower than 25 for a relative fluorescence value higher than 500.
  • PCR-multiplex PCR-multiplex
  • Real-time PCR could be used as well as other techniques such as hybridization techniques, dot-blot hybridization, fluorescent in situ hybridization, colony hybridization, restriction fragment length polymorphism analysis.
  • Results showed better growth in complemented milk:
  • the pH values tended to 4.6-5.3 in all the complemented milk.
  • the aim of this preliminary study was to know the needed initial concentration and to study the evolution of the fermentation process.
  • an innoculum of strain FR62/b/3 (9.5 log cfu/ml from a based milk medium) was cultured at 3O 0 C during 24 hours in a 2OL fermentation vat containing milk based medium (0.3% Peptone-casein, 0.5% Yeast extract and 8% Skimmed milk powder).
  • Eight 50ml samples were harvested at the following times: inoculation time and after 2, 4, 6, 8, 10, 12 and 24 incubation hours. Spiral sowing was straight made for each sample. The pH was followed automatically in the fermentation vat.
  • GC56 is also able to multiply in TPY broth (in bain-marie) up to a maximum temperature of 41.5 0 C and a minimum temperature of 7 0 C, the optimum temperature for growth is 39 0 C. In TPY, the minimum initial pH for growth is 4.7. GC56 is also able to multiply on TPY agar under aerobic conditions at 37 0 C and 39 0 C.
  • Colonies of GC56 on TPY agar at 39 0 C under anaerobic conditions are cream, circular, and convex with entire edges. They reach a diameter of up 1 mm. They reach a reduced diameter (less than 1 mm) under aerobic conditions.
  • the milk media pH was initially 6.6.
  • strain FR62/b/3 of GC56 When cultured alone in the fermentation vat, strain FR62/b/3 of GC56 produced a pH decrease from 5.9 (at inoculation time) to 5.0 after 6 hours, 4.2 after 12 hours and 3.9 after 24 hours.
  • the pH values decreased from 5.9 to 4.4 after 6 hours, 3.8 after 12 hours and 3.5 after 24 hours.
  • the bacterial counts of the 2 species increased to 8 log cfu/ml after 24 hours.
  • strain FR62/b/3 of GC56 reached 8.5 log cfu/ml after 18 days and 7.3 log cfu/ml after 29 days. According to the literature, a rate greater than 10 6 or 10 7 cfu/ml or /g of probiotics in the product is required to allow observation of positive effects.
  • the GC56 group is well phenotypically individualized by numerical analysis (classification based on unweighted average linkage and Hartigan' s clustering methods). No type or reference strains belonging to another species of the Bifidobacterium genus join the group.
  • Phenotypic characteristics that differentiate the new strain isolates of Bifidobacterium crudilactis from B. psychraerophilum, the closest phylogenetically species, are presented in Table 3.
  • the data in Table 3 is based on 141 different isolates of B. crudilactis. The results are given as the percentage of positive responses observed in the 141 isolates, FR62/b/3T (a strain of B. crudilactis), and B. psychraerophilum LMG 21775T.
  • All strains of B. crudilactis ferment galactose, glucose, fructose, maltose, lactose, melibiose, sucrose, raffinose, and D- turanose.
  • arginine dihydrolase ⁇ -galactosidase-6-phosphate, ⁇ - arabinosidase, ⁇ -glucuronidase, ⁇ -N-acetylglucosaminidase, acide glutamique decarboxylase, ⁇ -fucosidase, acide pyroglutamique arylamidase, glutamyl arylamidase.
  • DNA-DNA hybridization DNA-DNA reassociation levels were between 4 and 36% with the type strains of all the Bifidobacterium species and of Aeriscardovia aeriphila, results shown in Table 4 below, and between 76 and 100% within the Bifidobacterium GC56 group (13 experiments). The DNA-DNA homology between B.
  • psychraerophilum and the GC56 group reference strain (FR62/b/3) is equal to 31% (2 measurements) confirming that the GC56 group does not belong to that species (definition threshold of bacterial species upper or equal to 70%; Goebel and Stackebrandt, (1994), Appl Environ Microbiol, 60: 1614-1621 ; Rossello-Mora and Amann (2001), FEMS Microbiol Rev, 25: 39-67).
  • DNA-DNA reassociation levels were determined using the spectrophotometric method from renaturation rates described by De Ley et al. (J. Biochem. (1970) 12, 133-142), slightly modified in hybridization temperature (Gavini et al. Ecology in Health and Disease (2001) 13, 40- 45). The determinations were performed at 67.3 0 C (T m -25°C according to the G+C content of the strain FR62/b/3), using a spectrophotometer Cary
  • Table 4 shows DNA-DNA reassociation of DNA from FR62/b/3 (GC56 group) with DNAs from type strains of the Bifidobacterium genus, including strains of B. crudilactis and of Aeriscardovia aeriphila.
  • B. crudilactis FR62/b/3 (GC56), B. crudilactis FR55/d/2, FR59/b/2, FR98/a/l l, B. crudilactis FR50/f/4, B. crudilactis Brie/9, B. crudilactis PicV/10, B. crudilactis FR35/5 and B. crudilactis Reb/13 are all strains of B. crudilactis which have more than 80% DNA homology with B. crudilactis FR62/b/3. (h) 16S rRNA sequencing
  • Figure 3 shows an hsp ⁇ O gene sequence alignment of several strains of the GC56 group (FR47/3, FR51/h/l, FR54/e/l, 59/b/2) with closely identified sequences found on Genbank (PubMed -BLAST). No difference was observed between the GC56 group strains while differences were observed with other bifidobacterial species. These differences were used for chosen specific PCR primers and a specific probe for real-time PCR (Table 1).
  • GC56 cells are Gram-positive, non-spore-forming bacilli, and irregularly shaped rods.
  • the morphology of the FR62/b/3 strain is shown in Figure 4.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • Immunology (AREA)
  • Pulmonology (AREA)
  • Hematology (AREA)
  • Communicable Diseases (AREA)
  • Diabetes (AREA)
  • Obesity (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Dairy Products (AREA)
PCT/EP2006/061247 2005-05-16 2006-03-31 Probiotic bifidobacterial species Ceased WO2006122850A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
DK06725493T DK1883695T3 (da) 2005-05-16 2006-03-31 Probiotisk bifidobakterieart
US11/914,434 US7959912B2 (en) 2005-05-16 2006-03-31 Probiotic bifidobacterial species
CA002602693A CA2602693A1 (en) 2005-05-16 2006-03-31 Probiotic bifidobacterial species
JP2008511662A JP2008539776A (ja) 2005-05-16 2006-03-31 共生ビフィドバクテリア種
DE602006006997T DE602006006997D1 (de) 2005-05-16 2006-03-31 Probiotische bifidobacterium arten
EP06725493A EP1883695B1 (en) 2005-05-16 2006-03-31 Probiotic bifidobacterial species
AT06725493T ATE432337T1 (de) 2005-05-16 2006-03-31 Probiotische bifidobacterium arten

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP05104071 2005-05-16
EP05104071.5 2005-05-16

Publications (1)

Publication Number Publication Date
WO2006122850A1 true WO2006122850A1 (en) 2006-11-23

Family

ID=34982549

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/061247 Ceased WO2006122850A1 (en) 2005-05-16 2006-03-31 Probiotic bifidobacterial species

Country Status (9)

Country Link
US (1) US7959912B2 (enExample)
EP (1) EP1883695B1 (enExample)
JP (1) JP2008539776A (enExample)
AT (1) ATE432337T1 (enExample)
CA (1) CA2602693A1 (enExample)
DE (1) DE602006006997D1 (enExample)
DK (1) DK1883695T3 (enExample)
ES (1) ES2325887T3 (enExample)
WO (1) WO2006122850A1 (enExample)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1997907A1 (en) 2007-06-01 2008-12-03 Friesland Brands B.V. Bifidobacteria
WO2009049932A1 (en) * 2007-10-20 2009-04-23 Universite De Liege Bifidobacterial species
US20120164274A1 (en) * 2009-12-24 2012-06-28 Csk Food Enrichment B.V. Fermented dairy product
CN107653306A (zh) * 2017-11-13 2018-02-02 江南大学 一种基于高通量测序的双歧杆菌快速检测方法及应用
WO2022101511A1 (fr) 2020-11-16 2022-05-19 Artechno Composition symbiotique comme additif d'alimentation pour les porcelets ou les truies et son utilisation

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9649380B2 (en) * 2009-01-12 2017-05-16 Pfizer Italia S.R.L. Compositions comprising probiotic and prebiotic components and mineral salts, with lactoferrin
RU2451734C2 (ru) * 2010-05-14 2012-05-27 Татьяна Александровна Левченко ШТАММ Bifidobacterium adolescentis 79-82, ИСПОЛЬЗУЕМЫЙ ДЛЯ ПОЛУЧЕНИЯ БИФИДОСОДЕРЖАЩЕЙ ПРОДУКЦИИ
WO2011148220A1 (en) * 2010-05-28 2011-12-01 Compagnie Gervais Danone Probiotic strains for use in improving transepithelial resistance
RU2451735C2 (ru) * 2010-05-28 2012-05-27 Татьяна Александровна Левченко ШТАММ Bifidobacterium adolescentis 79-84, ИСПОЛЬЗУЕМЫЙ ДЛЯ ПОЛУЧЕНИЯ БИФИДОСОДЕРЖАЩЕЙ ПРОДУКЦИИ
US9980501B2 (en) 2014-12-26 2018-05-29 Salah Mohammed Aleid Method of making probiotic dairy products with date syrup additive
IT202200022401A1 (it) * 2022-10-31 2024-05-01 Probionova Sa Ceppi di batteri per il trattamento di disturbi urologici, loro composizioni e usi relativi

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1227152A1 (en) * 2001-01-30 2002-07-31 Société des Produits Nestlé S.A. Bacterial strain and genome of bifidobacterium
US20030092163A1 (en) * 2001-07-26 2003-05-15 Collins John Kevin Probiotic bifidobacterium strains

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL 22 January 2003 (2003-01-22), SIMPSON, P.J. ET AL.: "Bifidobacterium psychraerophilum 16S ribosomal RNA gene, partial sequence", XP002396819, retrieved from EBI Database accession no. AY174108 *
SIMPSON P J ET AL: "Genomic diversity and relatedness of bifidobacteria isolated from a porcine cecum.", JOURNAL OF BACTERIOLOGY, vol. 185, no. 8, April 2003 (2003-04-01), pages 2571 - 2581, XP002396829, ISSN: 0021-9193 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1997907A1 (en) 2007-06-01 2008-12-03 Friesland Brands B.V. Bifidobacteria
WO2009049932A1 (en) * 2007-10-20 2009-04-23 Universite De Liege Bifidobacterial species
JP2011501666A (ja) * 2007-10-20 2011-01-13 ユニベルシテ・ド・リエージュ ビフィズス菌の種
US8658153B2 (en) 2007-10-20 2014-02-25 Universite De Liege Bifidobacterial species
US20120164274A1 (en) * 2009-12-24 2012-06-28 Csk Food Enrichment B.V. Fermented dairy product
CN107653306A (zh) * 2017-11-13 2018-02-02 江南大学 一种基于高通量测序的双歧杆菌快速检测方法及应用
WO2022101511A1 (fr) 2020-11-16 2022-05-19 Artechno Composition symbiotique comme additif d'alimentation pour les porcelets ou les truies et son utilisation
BE1028802A1 (fr) 2020-11-16 2022-06-10 Le Centre Wallon De Rech Agronomiques Développement d'une composition symbiotique comme un additif d'alimentation pour les porcelets ou les truies gestantes pour moduler le microbiote intestinal des porcelets au temps du sevrage

Also Published As

Publication number Publication date
ATE432337T1 (de) 2009-06-15
US20080274085A1 (en) 2008-11-06
DE602006006997D1 (de) 2009-07-09
DK1883695T3 (da) 2009-07-20
JP2008539776A (ja) 2008-11-20
EP1883695B1 (en) 2009-05-27
EP1883695A1 (en) 2008-02-06
US7959912B2 (en) 2011-06-14
ES2325887T3 (es) 2009-09-23
CA2602693A1 (en) 2006-11-23

Similar Documents

Publication Publication Date Title
Gueimonde et al. Viability and diversity of probiotic Lactobacillus and Bifidobacterium populations included in commercial fermented milks
Abdelgadir et al. A traditional Sudanese fermented camel's milk product, Gariss, as a habitat of Streptococcus infantarius subsp. infantarius
Mc Brearty et al. Influence of two commercially available bifidobacteria cultures on Cheddar cheese quality
El-Baradei et al. Bacterial biodiversity of traditional Zabady fermented milk
Londero et al. Kefir grains as a starter for whey fermentation at different temperatures: chemical and microbiological characterisation
Mainville et al. Polyphasic characterization of the lactic acid bacteria in kefir
JP5643285B2 (ja) 新規ビフィドバクテリウム属細菌の作出方法
US20100310513A1 (en) Bifidobacterial species
KR101018274B1 (ko) 발효유의 제조방법
Morea et al. Molecular characterization of the Lactobacillus community in traditional processing of Mozzarella cheese
JP5774517B2 (ja) ビフィドバクテリウム属細菌含有発酵食品の製造方法
Negm El-Dein et al. Probiotic properties and bile salt hydrolase activity of some isolated lactic acid bacteria
Jafari et al. Application of cultivable lactic acid bacteria isolated from Iranian traditional dairy products for the production of liquid and dried kashks
EP1883695B1 (en) Probiotic bifidobacterial species
JP5845169B2 (ja) ビフィドバクテリウム属細菌含有発酵食品の製造方法
Rogelj et al. The survival and persistence of Lactobacillus acidophilus LF221 in different ecosystems
BAMGBOSE et al. Identification of predominant lactic acid bacteria associated with kunun-zaki and kindirmo a traditional fermented food of Nigeria
Terzic-Vidojevic et al. Phenotypic and genotypic characterization of lactic acid bacteria isolated from Azerbaijani traditional dairy products
Dekumpitiya et al. Identification of the microbial consortium in Sri Lankan buffalo milk curd and their growth in the presence of prebiotics
Njeru et al. Identification and characterisation of lactobacilli isolated from Kimere, a spontaneously fermented pearl millet dough from Mbeere, Kenya (East Africa)
Hashem et al. Molecular characterization of Egyptian isolates of Lactobacillus and Bifidobacterium
Jung et al. Isolation and identification of lactic acid bacteria from sourdough with high exopolysaccharide production ability
JP5351113B2 (ja) ビフィドバクテリウム属細菌含有発酵食品の製造方法
Ghafari et al. Genotypic and phenotypic study of Lactobacillus species isolated from traditional yogurt and cheese in southwest Iran.
Al-Zahrani et al. Isolation and identification of Lactobacillus plantarum KM5 from camel milk for β-galactosidase production

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2602693

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2006725493

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 11914434

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2008511662

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

NENP Non-entry into the national phase

Ref country code: RU

WWW Wipo information: withdrawn in national office

Country of ref document: RU

WWP Wipo information: published in national office

Ref document number: 2006725493

Country of ref document: EP