WO2006116688A2 - Agonistes et antagonistes de mif et leurs utilisations therapeutiques - Google Patents

Agonistes et antagonistes de mif et leurs utilisations therapeutiques Download PDF

Info

Publication number
WO2006116688A2
WO2006116688A2 PCT/US2006/016254 US2006016254W WO2006116688A2 WO 2006116688 A2 WO2006116688 A2 WO 2006116688A2 US 2006016254 W US2006016254 W US 2006016254W WO 2006116688 A2 WO2006116688 A2 WO 2006116688A2
Authority
WO
WIPO (PCT)
Prior art keywords
mif
expression
subject
disease
low
Prior art date
Application number
PCT/US2006/016254
Other languages
English (en)
Other versions
WO2006116688A3 (fr
Inventor
Richard Bucala
Lin Leng
Sarah Doernberg
Michael Bukrinsky
Seamas Donnelly
Original Assignee
Yale University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yale University filed Critical Yale University
Priority to US11/919,307 priority Critical patent/US20100143379A1/en
Publication of WO2006116688A2 publication Critical patent/WO2006116688A2/fr
Publication of WO2006116688A3 publication Critical patent/WO2006116688A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • Macrophage migration inhibitory factor is a critical regulator of the innate and adaptive immune response. MIF is encoded by a unique polymorphic gene, and crystallization studies have shown MJJF to define a new protein fold and structural superfamily. Despite the fact that the biological activity attributed to MIF first was described almost 30 years ago, information regarding MIF's precise role in cell physiology and immunity has emerged only recently.
  • Macrophage migration inhibitory factor is a pleiotropic multifunctional cytokine with a mostly proinflammatory spectrum of action in the host immune response. MIF promotes the production of TNF ⁇ and other inflammatory mediators in an autocrine-paracrine fashion, and mice genetically-deficient in MIF are known to have a reduced inflammatory cytokine response by cells of the monocyte/macrophage lineage (Morand (2005). Intern. Med. J. 35:419- 426; Gregory et al. (2004). Arthritis Rheum. 50:3023-3034; and Ichiyama et al. (2004). Cytokine 26:187-194).
  • MIF levels have been reported to be increased in infectious and autoimmune diseases and have been reported to correlate with the severity of septic shock, rheumatoid arthritis, systemic sarcoidosis and inflammatory bowel disease (Amoli et al. (2002). J. Rheumatol. 29:1671-1673 and Leech et al. (1999/ Arthritis Rheum. 42:1601-1608). It has been reported that anti-MEF monoclonal antibodies can prevent septic shock in mice (Calandra et al. Nat Med 2000;6:164-70 and Lolis et al. (2003). Expert Opin. Ther. Targets.
  • MIF also antagonizes the action of glucocorticoids (Calandra et al. (1995). Nature 377:68-71 and Calandra et al. (2003). Nat Rev Immunol 3:791-800), upregulates Toll-like receptor 4 (TLR-4) expression (Roger et al. (2001). Nature 414:920-924), controls Jabl transcriptional effects (Kleemann et al. (2000).
  • the Type II transmembrane protein, CD74 binds to MIF with high-affinity and is important for MIF biological activity (Leng et al. (2003). J Exp Med 197:1467-1476). MIF binds to the extracellular domain of CD74, and CD74 is required for MIF-induced activation of the extracellular signal-regulated kinase-1/2 MAP kinase cascade, cell proliferation, and PG ⁇ 2 production.
  • a recombinant, soluble form of CD74 binds MIF with a dissociation constant of approximately 9 x 10 "9 Kd, as defined by surface plasmon resonance (BIAcore analysis), and soluble CD74 inhibits MIF-mediated extracellular signal-regulated kinase activation in defined cell systems.
  • Polymorphisms in cytokine genes may influence the severity of diseases in which the host inflammatory response plays a key role (McGuire et al. (1994). Nature 371:508-510; Pawlik et al. (2005). Scand. J. Rheumatol. 34:109-113; Cantor et al. (2005). Am. J. Gastroenterol. 100:1134-1142; and Wilson et al. (2005). J Infect. Dis. 191:1705-1709). Recently, a search for DNA polymorphisms in human MIF revealed variants in the structure of the promoter region that affect the level of MIF expression (Baugh et al. (2002) Genes Immun.
  • a tetranucleotide CATT repeat at position -794 regulates MIF transcriptional activity and subsequent protein production, with the number of repeats (5, 6, 7, or 8) proportional to the level of transcription in in vitro assays (Baugh et al. (2002) Genes Immun. 3:170-176). Individuals with greater number of CATT repeats (e.t, 6, 7, or 8) express more MIF.
  • SNP single nucleotide polymorphism
  • the invention relates to novel uses for MIF agonists and MIF antagonists, and to novel types of MIF agonists and MIF antagonists. Further, the invention relates to methods of prognosis and diagonisis involving determining the MIF genotype of a subject. hi one aspect, the invention relates to a method of selecting a subject for treatment with a MIF antagonist, wherein the subject has a disease associated with high MIF expression or is at risk of developing a disease associated with high MIF expression, comprising genotyping the subject for the presence of a polymorphism associated with MIF expression, wherein a subject having a polymorphism associated with high MIF expression is selected for treatment with a MIF antagonist.
  • the disease associated with high MIF expression is a disease caused by a protozoan. In another embodiment, the disease associated with high MIF expression is malaria. In another embodiment, the disease associated with high MIF expression is anemia of chronic disease, hi another embodiment, the disease associated with high MIF expression is asthma.
  • the invention also relates to a method of selecting a subject for treatment with a MIF agonist, wherein the subject has a disease associated with low MIF expression or is at risk of developing a disease associated with low MIF expression, comprising genotyping the subject for the presence of a polymorphism associated with MIF expression, wherein a subject having a polymorphism associated with low MIF expression is selected for treatment with a MIF agonist, hi one embodiment, the disease associated with low MIF expression is an infection.
  • the infection leads to respiratory disease
  • the disease associated with low MIF expression is pneumonia
  • the disease associated with low MIF expression is Community Acquired Pneumonia (CAP)
  • the disease associated with low MIF expression is meningitis
  • hi another embodiment, the disease associated with low MIF expression is influenza.
  • the disease associated with low MIF expression is sepsis
  • hi another embodiment, the disease associated with low MIF expression is HIV infection
  • hi another embodiment, the disease associated with low MIF expression is infection with a virus or another pathogen that uses CCR5 as a receptor.
  • the invention relates to a method of identifying a subject at risk of developing a disease associated with high MIF expression, comprising genotyping the subject for the presence of a polymorphism associated with MIF expression, wherein a subject having a polymorphism associated with high MIF expression is at a higher risk of developing a disease or disorder associated with high MIF expression than a subject having a polymorphism associated with low MIF expression.
  • the disease associated with high MIF expression is a disease caused by a protozoan.
  • the disease associated with high MIF expression is malaria.
  • the disease associated with high MIF expression is anemia of chronic disease.
  • the invention relates to a method of identifying a subject at risk of developing a disease associated with low MIF expression, comprising genotyping the subject for the presence of a polymorphism associated with MIF expression, wherein a subject having a polymorphism associated with low MIF expression is at a higher risk of developing a disease or disorder associated with low MIF expression than a subject having a polymorphism associated with high MIF expression.
  • the disease associated with low MIF expression is an infection.
  • the infection leads to respiratory disease.
  • the disease associated with low MIF expression is pneumonia.
  • the disease associated with low MIF expression is Community Acquired Pneumonia (CAP).
  • the disease associated with low MIF expression is meningitis. In another embodiment, the disease associated with low MIF expression is influenza. In another embodiment, the disease associated with low MIF expression is sepsis. In another embodiment, the disease associated with low MIF expression is HIV infection. In another embodiment, the disease associated with low MIF expression is infection with a virus or another pathogen that uses CCR5 as a receptor.
  • the invention relates to a method of predicting the severity of a disease associated with high MIF expression in a subject, comprising genotyping the subject for the presence of a polymorphism associated with MIF expression, wherein a subject having a polymorphism associated with high MIF expression is at a higher risk of developing a more severe disease than a subject having a polymorphism associated with low MIF expression.
  • the disease associated with high MIF expression is a disease caused by a protozoan.
  • the disease associated with high MIF expression is malaria.
  • the disease associated with high MIF expression is anemia of chronic disease.
  • the disease associated with high MIF expression is asthma.
  • the invention relates to a method of predicting the severity of a disease associated with low MIF expression in a subject, comprising genotyping the subject for the presence of a polymorphism associated with MIF expression, wherein a subject having a polymorphism associated with low MIF expression is at a higher risk of developing a more severe disease than a subject having a polymorphism associated with high MIF expression.
  • the disease associated with low MIF expression is an infection.
  • the infection leads to respiratory disease.
  • the disease associated with low MIF expression is pneumonia.
  • the disease associated with low MIF expression is Community Acquired Pneumonia (CAP).
  • the disease associated with low MIF expression is meningitis.
  • the disease associated with low MIF expression is influenza. In another embodiment, the disease associated with low MIF expression is sepsis. In another embodiment, the disease associated with low MIF expression is HIV infection. In another embodiment, the disease associated with low MIF expression is infection with a virus or another pathogen that uses CCR5 as a receptor.
  • the invention relates to a method of predicting whether a subject is susceptible to a disease associated with low MIF expression, comprising genotyping a subject for the presence of a polymorphism associated with MIF expression, wherein a subject having a polymorphism associated with low MIF expression is more susceptible to the disease than a subject having a polymorphism associated with high MIF expression.
  • the disease associated with low MIF expression is an infection.
  • the infection leads to respiratory disease.
  • the disease associated with low MIF expression is pneumonia.
  • the disease associated with low MIF expression is Community Acquired Pneumonia (CAP).
  • the disease associated with low MIF expression is meningitis.
  • the disease associated with low MIF expression is influenza. In another embodiment, the disease associated with low MIF expression is sepsis. In another embodiment, the disease associated with low MIF expression is HIV infection. In another embodiment, the disease associated with low MIF expression is infection with a virus or another pathogen that uses CCR5 as a receptor.
  • the invention in another aspect, relates to a method of predicting whether a subject is susceptible to a disease associated with high MIF expression, comprising genotyping a subject for the presence of a polymorphism associated with MIF expression, wherein a subject having a polymorphism associated with high MEF expression is more susceptible to the disease than a subject having a polymorphism associated with low MIF expression.
  • the disease associated with high MIF expression is a disease caused by a protozoan.
  • the disease associated with high MIF expression is malaria.
  • the disease associated with high MIF expression is anemia of chronic disease.
  • the polymorphism associated with MEF expression may be selected from the group consisting of: (a) the presence of five, six, seven or eight CATT repeats in the -794 region of the MEF promoter, and (b) the presence of guanine or cytosine at position -173 of the MEF promoter.
  • a subject having a polymorphism associated with high MEF expression is a subject having a C at position -173 in at least one of the two alleles of the MEF gene, or having six or more CATT repeats in at least one of the two alleles of the MEF gene.
  • a subject having a polymorphism associated with high MEF expression is a subject: (a) having six or more CATT repeats in the -794 region of the MEF promoter in each of the two alleles of the MIF gene, or (b) having six or more CATT repeats in the -794 region of the MEF promoter in one allele and having a C at position -173 in each of the two alleles of the MEF gene.
  • a subject having a polymorphism associated with low MEF expression is a subject having a G at position -173 of each of the two alleles of the MEF gene and having five CATT repeats in the -794 region of each of the two alleles of the MIF gene.
  • genotyping the subject for the presence of a polymorphism associated with MEF expression comprises: (a) contacting a sample obtained from the subject with a polynucleotide probe that hybridizes specifically to a polymorphism associated with high or low MEF expression; and (b) determining whether hybridization occurs, wherein hybridization indicates whether the subject comprises a polymorphism associated with high MEF expression or a polymorphism associated with low MEF expression, thereby genotyping the subject for the presence of a polymorphism associated with MEF expression.
  • This genotyping method may further comprise: (c) contacting the sample with a control polynucleotide probe, wherein the control polynucleotide probe does not hybridize specifically to a polymorphism associated with MEF expression, and wherein hybridization of the polynucleotide probe but not the control polynucleotide probe indicates the presence of a MEF polymorphism associated with MEF expression.
  • genotyping the subject for the presence of a polymorphism associated with MIF expression comprises: (a) contacting a sample obtained from the subject with a pair of amplifications primers, wherein said primers are capable of amplifying a portion of the MIF promoter comprising a polymorphism associated with MIF expression ; (b) amplifying DNA in the sample, thereby producing amplified DNA; and (c) determining whether the amplified DNA comprises a polymorphism associated with high MIF expression or a polymorphism associated with low MIF expression, thereby genotyping the subject for the presence of a polymorphism associated with MIF expression.
  • the determining step comprises sequencing the amplified DNA.
  • the determining step comprises determining whether the sample hybridizes specifically to a polynucleotide probe that is specific for a polymorphism associated with high MIF expression or to a polynucleotide probe that is specific for a polymorphism associated with low MIF expression.
  • the invention provides a novel solid substrate for simultaneously genotyping a microsatellite repeat and a SNP, comprising at least two polynucleotide probes that are complementary to one or more polymorphic regions of the MIF gene wherein at least one of the probes detects a microsatellite repeat and at least one of the probes detects a SNP.
  • At least one of the probes in the solid substrate hybridizes specifically to a guanine or a cytosine in the -173 region of the MIF promoter.
  • at least one of the probes in the solid substrate comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.
  • the solid support comprises: (a) a probe hybridizing specifically to SEQ ID NO: 1; (b) a probe hybridizing specifically to SEQ ID NO: 2; (c) a probe hybridizing specifically to SEQ ID NO: 3; (d) a probe hybridizing specifically to SEQ ID NO: 4; (e) a probe hybridizing specifically to guanine in the -173 region of the MIF promoter; and (f) a probe hybridizing specifically to cytosine in the -173 region of the MIF promoter.
  • the solid support may be a chip or a microarray.
  • the solid substrate is a thin film chip or microarray which permits the visual detection of a nucleic acid targets (indicating the presence/absence of a MIF polymorphism associated with high or low MIF expression) in the solid substrate with the unaided eye.
  • the invention comprises a method of determining the MIF genotype of a subject, comprising: (a) contacting a solid substrate as described above for simultaneously genotyping a microsatellite repeat and a SNP with a sample obtained from a subject; and (b) determining whether the subject comprises a polymorphism associated with high MIF expression or whether the subject comprises a polymorphism associated with low MIF expression, thereby determining the MIF genotype of the subject.
  • the invention comprises a method of determining the MIF genotype of a subject, comprising: (a) amplifying a portion of the MIF gene comprising a polymorphism associated with MIF expression; (b) contacting a solid substrate as described above for simultaneously genotyping a microsatellite repeat and a SNP with the amplified portion; and (c) determining whether the subject comprises a polymorphism associated with high MIF expression or whether the subject comprises a polymorphism associated with low MIF expression, thereby determining the MIF genotype of the subject.
  • the invention provides methods of treating diseases associated with high or low MIF expression.
  • the invention provides a method of treating anemia of chronic disease comprising administering to a subject a therapeutically effective amount of a MIF antagonist.
  • the subject is not responsive to erythropoietin (EPO) prior to the administration of the MIF antagonist, hi one embodiment, the method further comprises dministering to a subject a therapeutically effective amount of a MIF antagonist and one or more other agents that stimulate erythropoiesis.
  • the method further comprises administering EPO to the subject.
  • the method further comprises administering a TNF ⁇ antagonist or an IFN ⁇ antagonist to the subject.
  • the anemia of chronic disease may be caused by any condition, including a pathogenic infection, cancer, an autoimmune disease or disorder, a kidney disease or disorder, organ transplant rejection and aging.
  • the anemia of chronic disease results from malaria infection.
  • the invention provides a method of treating malaria comprising administering to a subject in need thereof a therapeutically effective amount of a MIF antagonist.
  • the invention provides a method of treating an infection comprising administering to a subject in need thereof a therapeutically effective amount of a MIF agonist.
  • the infection is a bacterial infection.
  • the infection is a viral infection or a retroviral infection.
  • the infection is a fungal infection.
  • the infection has resulted, or may result, in a respiratory disease.
  • the subject has a respiratory disease resulting from an infection. Li another embodiment, the subject has pneumonia.
  • the subject has CAP.
  • the subject has meningitis.
  • the subject has influenza.
  • the subject has sepsis.
  • the subject is infected with HIV.
  • the subject is infected with HIV-I.
  • the subject is infected with a virus or pathogen that uses the CCR5 receptor.
  • the invention provides a method of attenuating the expression of CCR5 rnRNA or protein in a subject with a disease associated with low MIF expression comprising the use of a MIF agonist.
  • the invention provides a method of inhibiting the life cycle of a virus that uses the CCR5 receptor during infection comprising administering to a subject infected with the virus, or at risk of being infected with the virus, a MIF agonist.
  • the virus is HIV-I.
  • the method further comprises administering to the subject another anti-viral agent.
  • the invention provides a method of treating HIV infection in a subject comprising administering to the subject a therapeutically effective amount of a MIF agonist.
  • the HIV infection is at an acute stage.
  • the method further comprises administering to the subject another anti- viral agent.
  • the invention provides a method of modulating the biological function of MIF, comprising the use of an agent that interacts modulates the interaction of CD44 with CD74.
  • the invention provides a method of attenuating the biological function of MIF, comprising the use of an agent that inhibits the interaction between CD44 and CD74.
  • the agent may be any agent, hi one embodiment, the agent is selected from the group consisting of: a fragment of CD44, an extracellular fragment of CD44, an agent that binds CD44, an antibody or fragment thereof that binds to CD44, a small molecule, a small molecule mimic of chondroitin sulfate, heparin and a macromolecular mimic of chondroitin sulphate.
  • the invention provides a method of attenuating the biological function of MIF, comprising the use of an agent that inhibits the expression of CD44.
  • the agent may be any agent.
  • the agent is an siRNA or antisense polynucleotide that targets CD44.
  • the invention provides a method of increasing the biological function of MIF, comprising the use of an agent that increases the interaction between MIF, CD44 and CD74.
  • trie invention provides a method of increasing the biological function of MIF, comprising the use of an agent that increases the interaction between CD44 and CD74.
  • the invention also provides novel methods of identifying potential agonists or antagonists of MIF.
  • the invention provides a method of identigying potential agonists or antagonists of MIF , comprising: (a) contacting a CD44 polypeptide, or a portion thereof, with a CD74 polypeptide, or portion thereof, in the presence and absence of a candidate agent; and (b) comparing the interaction of the CD44 and CD74 polypeptides in the presence of said candidate agent with the interaction in the absence of said candidate agent, wherein a candidate agent that enhances the interaction of the CD44 polypeptide and the CD74 polypeptide is identified as a potential agonist of MIF, and a candidate agent that inhibits the interaction of the CD44 polypeptide and the CD74 polypeptide is identified as a potential antagonist of MIF.
  • the invention provides a method of identifying potential agonists or antagonists of MIF, comprising: (a) contacting a CD44 polypeptide or a portion thereof, with a MIF polypeptide or a portion thereof and a CD74 polypeptide or a portion thereof, in the presence and absence of a candidate agent; and (b) comparing the interaction of the CD44 polypeptide and the MIF and CD74 polypeptides in the presence of said candidate agent with the interaction in the absence of said candidate agent, wherein a candidate agent that enhances the interaction of the CD44 polypeptide and the MIF and CD74 polypeptides is identified as a potential agonist of MIF, and a candidate agent that inhibits the interaction of CD44 polypeptide and the MIF and CD74 polypeptides is identified as a potential antagonist of MIF.
  • the invention comprises a kit comprising: (a) at least one container means comprising one or more reagents for genotyping a subject for the presence of a polymorphism associated with high or low MIF expression, wherein said genotyping reagent is a polynucleotide probe, a polynucleotide primer, or a solid substrate that is capable of detecting a polymorphism associated with high or low MIF expression; and, (b) a label or instructions for use of the kit.
  • the invention comprises a kit comprising: (a) at least one container means comprising a premeasured dose of one or more MIF antagonists or MIF agonists; and, (b) a label or instructions for use of the kit.
  • Figure 1 is a pair of graphs showing the dose-dependent impact of MIF, TNF ⁇ , and IFN ⁇ on colony formation in murine bone marrow progenitor cultures in vitro. Bone marrow cells were harvested, plated in a methylcellulose-based medium, and colony numbers scored after the addition of murine cytokines. Individual assays were performed in duplicate, and the data shown is a compilation of 3-6 independently performed experiments. % inhibition of colony formation is calculated with reference to a cytokine-minus control. All values shown are the mean + SD and are significant when compared to wells with no cytokine addition (P ⁇ 0.05).
  • CFU-E colony forming unit - erythroid
  • BFU-E burst-forming unit - erythroid.
  • Figures 2A and 2B are graphs showing MIF inhibition of cytodifferentiation and hemoglobin production in human (K562) erythroid progenitors.
  • Figure 2A terminal erythropoietic differentiation was assayed with diaminofluorene (DAF) after culture in differentiation medium together with MIF (200 ng/ml) for 96 hrs. The neutralizing anti-MIF mAb was added at 100 ⁇ g/ml. DAF positive cells were enumerated and expressed as fold- change over total, input cells.
  • Figure 2B cellular hemoglobin content of cultured K562 progenitor cells.
  • FIGs 3 A and 3B are graphs showing that malaria-infected, MIF-KO mice (MIF "7” ) suffer from less severe anemia and show increased survival when compared to genetically- matched, wild-type controls (MIF +/+ ).
  • Figure 3 A time course for the development of anemia, as assessed by q.o.d. peripheral blood sampling. The data shown are the means ⁇ SD of 10 mice per group from one of two experiments, which yielded similar results. For differences in mean hemoglobin concentrations between the MIF +/+ and MIF "7” mice, *P ⁇ 0.01 for days 6, 8, 15, and *P ⁇ 0.05 for days 10 and 12. Due to low numbers of survivors, the wild-type mice were not further studied after day 15.
  • Figures 4A-4C show detection of a target nucleic acid by a biosensor chip.
  • Figure 4 A is a schematic representation for the detection of the MIF CATT tetranucleotide repeat by ligation of biotinylated detection probe P2 to a set of capture probes Pl with different copies of CATT repeat immobilized on thin-film biosensor chip surface in the presence of certain CATT target (i.e. CATT 6).
  • Figure 4B shows an array template for the detection of the 5-, 6-, 7- and 8-CATT repeats, and the -173 G/C SNP. Oligonucleotides are arrayed in duplicates, as shown. +: positive control, an aldehyde modified dA20-biotin probe.
  • Figure 4C shows the visual appearance of the biosensor chip of the representative MIF genotypes.
  • Figure 5 is a graph showing Kaplan-Meier survival curves for MIF -173 genotypes.
  • the CC and CG genotypes were associated with improved survival in subjects with community- acquired pneumonia.
  • Figure 6 is a bar graph showing the production of MIF by HTV-infected macrophages.
  • Triplicate cultures of monocyte-derived macrophages were infected with HIV- I AD A and cultivated until infection reached its peak (day 12, RT activity 10,500 cpm/ ⁇ l). Cells were washed, and cultured in fresh medium. Aliquots of culture medium were withdrawn on the indicated days and analyzed by MIF-specific ELISA. Results are mean ⁇ SD.
  • Statistical analysis using Student's t-test demonstrated significant differences between the amounts of MIF produced by mock-infected and HIV-infected cultures, p ⁇ 0.05.
  • Figures 7A-7C are graphs showing that MIF suppresses HIV-I replication in macrophages.
  • Figure 7A shows that anti-MIF MAb enhances HIV-I replication in MDM cultures. Triplicate cultures of monocyte-derived macrophages were infected with HFV-IA DA in the presence of anti-MIF MAb (25 ⁇ g/ml) or isotype control. Virus replication was monitored by RT activity in culture supernatants. Results are presented as mean ⁇ SD.
  • Figure 7B shows that recombinant MIF suppresses HIV-I replication in MDM cultures.
  • Macrophages were infected as in A and cultured without adding any reagent (control) or in the presence of recombinant MIF (50 ng/ml), polymyxin B (PMB, 10 ⁇ g/ml), or both agents together. Virus replication was monitored as in A.
  • Figure 7C shows that MIF-mediated inhibition of HIV-I replication is reduced by anti-CD74 MAb.
  • Macrophages were infected as in A and cultured in the presence of MIF (50 ng/ml) mixed with PMB (10 ⁇ g/ml) and anti-CD74 MAb (25 ⁇ g/ml). Control cultures were cultivated with PMB mixed with an isotype immunoglobulin with or without MIF.
  • Figure 8 is a pair of graphs that show that MIF inhibits replication in PBMC of R5, but not X4, HIV-I strain.
  • Triplicate PHA-activated PBMC cultures were infected with R5 (ADA) or X4 (LAI) strains of HIV-I and cultivated in the presence or absence (control) of recombinant MIF (50 ng/ml).
  • ADA R5
  • LAI X4
  • results are mean ⁇ SD.
  • differences between MIF- treated and control cultures of ADA-infected PBMCs are highly statistically significant (p ⁇ 0.01), differences between MIF-treated and control cultures of LAI-infected cells are not significant (p>0.05).
  • Figure 9 is a graph showing MIF downregulation of CCR5 expression in macrophages.
  • Monocyte-derived macrophages were cultured in the presence of recombinant MIF (50 ng/ml) and polymyxin B (PMB, 10 ⁇ g/ml) for 48 h.
  • Cell surface expression of CCR5 and CXCR4 was analyzed by FACS after staining with FITC-conjugated anti-CCR5 and PE-conjugated anti- CXCR4 antibodies (Pharmingen). Results (percent of receptor-positive cells) are shown as mean ⁇ SE for three performed experiments.
  • FIG 10 is a schematic diagram of the structures of the human CD74 and CD44 proteins used to create stable cell lines.
  • CD44 ⁇ 67 encodes a truncated CD44 lacking the cytoplasmic domain.
  • IC, TM, and EC are the intracellular, transmembrane, and extracellular domains respectively. The location of the known intracytoplasmic serine phosphorylation sites are indicated.
  • Figures 1 IA-I ID show that MIF-induced ERK-1/2 phosphorylation requires CD74 and full-length, intact CD44.
  • Figure HA COS-7/M6 cells stably-transfected with CD74, CD44, CD74+CD44, or CD74+CD44 ⁇ 67 were washed and stimulated with recombinant human MIF for the indicated times. Whole cell lysates then were prepared and analyzed by Western blotting with specific anti- ⁇ hos ⁇ ho-ERK-1/2 ( ⁇ -ERKl/2) or anti-total ERK/1/2 antibodies.
  • Figure HB primary murine embryonic fibroblasts (MEFs) or, Figure HC: peritoneal macrophages, were prepared from the genetically-defined mouse strains shown and stimulated with recombinant murine MIF. Peritoneal macrophages were stimulated for 10 mins (Mitchell et al. (1999). J Biol Chem 274: 18100-6) and the lysates then analyzed by Western blotting.
  • Figure 1 ID Pre-formed MIF/sCD74 complexes do not stimulate ERK-1/2 phosphorylation in CD44-expressing COS- 7/M6 cells. Recombinant, sCD74 was incubated with MIF overnight in a 3: 1 molar ratio prior to addition to cells for 10 mins. Epidermal growth factor (EGF) was used as a positive control for ERK-1/2 phosphorylation (Yamamoto et al. (2003). Develop Biol 260:512-521). Data shown are representative of three experiments.
  • EGF epi
  • Figures 12A-12E show the phosphoserine content of CD74 and CD44 measured by ELISA.
  • Figure 12 A COS-7-derived cell lines and mouse embryonic fibroblasts (MEFs) were treated with MIF (100 ng/ml) for 10 mins and the cell lysates analyzed for phospho-serine by a CD74-specific sandwich ELISA.
  • Figure 12B the COS-7/CD74+CD44 cell line was pre-treated with the protein kinase A (PKA) inhibitor, H-89 (20 ⁇ M), or the protein kinase C (PKC) inhibitor, RO-31-28801 (10 ⁇ M), for 30 and 60 mins prior to MIF (100 ng/ml) stimulation.
  • PKA protein kinase A
  • H-89 20 ⁇ M
  • PKC protein kinase C
  • RO-31-28801 10 ⁇ M
  • FIG. 12C COS-7- derived cell lines and MEFs were treated with MIF (100 ng/ml) for 10 mins and the cell lysates analyzed for phospho-serine by a CD44-specif ⁇ c sandwich ELISA.
  • Figure 12D analysis of CD44 phospho-serine content in control and MIF-stimulated, COS-7 cell lines after preincubation with the protein kinase A (PKA) inhibitor, H-89, or the protein kinase C (PKC) inhibitor, RO-31-2880, for 30 mins.
  • PKA protein kinase A
  • H-89 protein kinase A
  • PKC protein kinase C
  • Figure 12E western analysis of COS-7/CD74+CD44 cells before and after stimulation with MIF (100 ng/ml for 10 minutes). Cell lysates were prepared and probed for PKA and PKC using phospho-specific, and total anti-PKA and anti-PKC antibodies.
  • Figures 13A and 13B are graphs showing the serum (A), and OVA-specific (B), immunoglobulin response in MIF +/+ and MIF "7" mice. Results are the mean ⁇ SD from two independent experiments using 4-6 mice per group. *p ⁇ 0.05, ** pO.Ol, *** pO.OOl for MIF +/+ versus MIF "7' by Student's t-test (two-tailed).
  • Figure 14 is a graph showing airway response curves in OVA-challenged and PBS- challenged mice.
  • MIF +/+ and MIF '7" mice were administered methacoline 12 hrs after the last challenge.
  • OVA-challenged mice (MIF +/+ and MIF '7" ) also showed a significant increase in Penh values when compared to PBS-challenged mice.
  • Figures 15A-15H are bar graphs showing leukocyte numbers in the BALF of MIF +/+ and MIF "7" mice collected 16 hrs after challenge (A-E). Cell types were identified by morphological criteria. Eosinophil content additionally was quantitated by BALF eosinophil peroxidase (F). IL-5 and eoxtaxin were measured by ELISA (G 5 H). Results are the mean ⁇ SD for each group from two independent experiments using 4-6 mice per group. *p ⁇ 0.005, **p ⁇ 0.001, ***p ⁇ 0.0005 for experimental conditions versus the OVA-challenged control by the Student's t- test (two-tailed).
  • Figure 16 is a diagram of the human MIF gene showing transcriptional factor binding sites and the position of the of the -794 CATT tetranucleotide repeat (5-,6-,7-, and 8-CATT), and the -173 G/C SNP.
  • the invention also provides novel methods of diagnosing a patient for a disease associated with high or low MIF expression.
  • novel methods for genotyping a subject for the presence of a polymorphism associated with high or low MIF expression comprising the use of a solid support or substrate (for example a chip or microarray) having polynucleotide probes attached thereto capable of simultaneously genotyping a microsatellite repeat and a SNP.
  • This genotyping method may be used in a variety of contexts and to assess the status or genotype of a variety of individuals.
  • Methods for treating a subject having a disease or disorder associated with high or low MIF expression are also described.
  • novel agonists of MIF that increase the interaction between CD74 and CD44, or that increase the interaction between MIF, CD74 and CD44.
  • novel antagonists of MIF that decrease (or inhibit) the interaction between CD74 and CD44, or that decrease (or inhibit) the interaction between MIF, CD74 and CD44.
  • agent is used herein to denote a chemical compound, a mixture of chemical compounds, a biological macromolecule (such as a nucleic acid, an antibody, a protein or portion thereof, e.g., a peptide), or an extract made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues.
  • a biological macromolecule such as a nucleic acid, an antibody, a protein or portion thereof, e.g., a peptide
  • an extract made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues.
  • the activity of such agents may render it suitable as a "therapeutic agent” which is a biologically, physiologically, or pharmacologically active substance (or substances) that acts locally or systemically in a subject.
  • Agents can comprise, for example, drugs, metabolites, intermediates, cofactors, transition state analogs, ions, metals, toxins and natural and synthetic polymers (e.g., proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors and cell surfaces such as cell walls and cell membranes. Agents may also comprise alcohols, alkyl halides, amines, amides, esters, aldehydes, ethers and other classes of organic agents.
  • drugs metabolites, intermediates, cofactors, transition state analogs, ions, metals, toxins and natural and synthetic polymers (e.g., proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors and cell surfaces such as cell walls and cell membranes. Agents may also comprise alcohols, alkyl halides, amines, amides, esters, aldehydes, ethers and other classes of organic agents.
  • a “patient”, “subject”, or “individual” are used interchangeably and refer to either a human or a non-human animal. These terms include mammals, such as humans, primates, livestock animals (including bovines, porcines, etc.), companion animals (e.g., canines, felines, etc.) and rodents (e.g., mice and rats).
  • polynucleotide and “nucleic acid” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown.
  • polynucleotides coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs.
  • modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
  • the sequence of nucleotides may be interrupted by non- nucleotide components.
  • a polynucleotide may be further modified, such as by conjugation with a labeling component.
  • the term "recombinant" polynucleotide means a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which either does not occur in nature or is linked to another polynucleotide in a nonnatural arrangement.
  • prophylactic or therapeutic treatment refers to administration of a drug to a patient. If it is administered prior to clinical manifestation of the unwanted condition (e.g., disease or other unwanted state of the host animal) then the treatment is prophylactic, i.e., it protects the host against developing the unwanted condition, whereas if administered after manifestation of the unwanted condition, the treatment is therapeutic (i.e., it is intended to diminish, ameliorate or maintain the existing unwanted condition or side effects therefrom).
  • the unwanted condition e.g., disease or other unwanted state of the host animal
  • MIF macrophage migration inhibitory factor
  • Accession number EMBL Z23063 describes the nucleic acid sequence encoding human MEP (Bernhagen et al., Biochemistry 33:14144-14155 (1994)).
  • An active fragment of MIF may comprise a fragment or a portion of the MIF protein encoding the tautomerase enzymatic activity of MIF, or a fragment that is capable of binding CD74.
  • MIF agonist refers to any agent that mimics, activates, stimulates, potentiates or increases the biological activity of MIF.
  • a MIF agonist may be MIF or a fragment thereof; an agent that mimics MIF (such as a small molecule); an agent that increases or enhances the expression of MIF, CD74 or CD44; an agent that enhances the binding of MEF to CD74; an agent than enhances the interaction between CD74 and CD44 (including, without limitation, a bivalent agent).
  • the "biological function of MEF” refers to the ability of MEF to carry out one or more of the biological functions of MEF including, without limitation, sustaining immune cell survival or activation, promoting cytokine promotion, down-regulating CCR5, binding to CD74, activating MAP kinase signaling (e.g., ERK1/2, JNK, and SAPK MAP kinase signaling), inhibiting p53, acting as a tautomerase, and/or acting as a thiol reductase.
  • a "MIF antagonist” refers to any agent that attenuates, inhibits, opposes, counteracts, or decreases the biological activity of MIF.
  • a MIF antagonist may be an agent that inhibits or neutralizes MIF activity (including, without limitation, small molecules and anti-MIF antibodies); an agent that inhibits or decreases the expression of MIF (including, without limitation, an antisense molecule); an agent that inhibits or decreases the expression of the CD44 receptor (including, without limitation, an antisense molecule or an RNAi molecule); an agent that prevents the binding of MIF to CD74 (including, without limitation, an anti-CD74 antibody or an anti-MIF antibody or a fragment thereof); an agent that prevents the interaction between CD74 and CD44 (such as an anti-CD74 antibody or an anti-CD44 antibody or a fragment thereof); or an agent that prevents the interaction between CD74 and CD44.
  • MIF activity including, without limitation, small molecules and anti-MIF antibodies
  • an agent that inhibits or decreases the expression of MIF including, without limitation, an antisense molecule
  • an agent that inhibits or decreases the expression of the CD44 receptor including, without limitation, an antisense molecule
  • Examples of such molecules are fragments of CD74 and CD44, such as soluble fragments of such receptors.
  • MIF antagonists have been disclosed previously, see, e.g., U.S. Patent Nos. 6,774,227, Bernhagen et al., Nature 365, 756-759 (1993), Senter et al., Proc Natl Acad Sci USA 99:144-149 (2002); Dios et al., J. Med. Chem. 45:2410-2416 (2002); Lubetsky et al., J Biol Chem 277:24976-24982 (2002), which are hereby incorporated by reference.
  • treating refers to preventing, slowing, delaying, stopping or reversing the progression of a condition.
  • a "disease associated with high MIF expression” or a “disease associated with low MIF expression” is a disease associated with high or low MIF expression, respectively. This association can be established using well known methods.
  • diseases that are associated with high MIF expression include: autoimmunity, cancer, anemia of chronic disease, malaria, and asthma.
  • Diseases that are associated with low, or insufficient, MIF expression include: infections (including viral, bacterial and fungal infections) and diseases resulting from, or caused by, infections, including respiratory diseases resulting from any infection, meningitis, pneumonia, CAP, influenza, sepsis, HIV infection, and infection with a pathogen that uses CCR5 as a receptor (such as HIV-I, Hepatitis C Virus (HCV), Epstein-Barr Virus, or Yersinia pestis).
  • infections including viral, bacterial and fungal infections
  • anemia of chronic disease refers to anemia that is immune driven.
  • Anemia of chronic disease also known as “anemia of inflammation.” This condition can result from a condition selected from the group consisting of: a pathogenic infection, cancer, an autoimmune disease or disorder, a kidney disease or disorder, organ transplant rejection, and aging. See, e.g., Weiss and Goodnought, "Anemia of Chronic Disease", N. Engl. J. Med. 352(10): 1011-23 (2005).
  • a polymorphism associated with MIF expression refers to any polymorphisms in the MIF gene that correlate with high or low expression of the MIF gene, including without limitation: a single nucleotide polymorphism (G/C) at position -173 of the MIF promoter or the presence of five, six, seven or eight CATT repeats at position in the -794 region of the MIF promoter.
  • G/C single nucleotide polymorphism
  • a polymorphism associated with low MIF expression refers to the presence of a guanine (G) at position -173 of the MIF promoter or the presence five CATT boxes at position in the —794 region of the MIF promoter.
  • a polymorphism associated with high MIF expression refers to the presence of a cytosine (C) at position -173 of the MIF promoter or the presence of six or more CATT boxes at position in the -794 region of the MIF promoter. (The positions of the MIF promoter are defined by reference to the nucleic acid sequence disclosed in EMBL Z23063.)
  • a subject having a polymorphism associated with high MIF expression refers to a subject that has a polymorphism associated with high MIF expression in at least one of its alleles.
  • a subject having a polymorphism associated with low MIF expression refers to a subject that has a G at position -173 of the MIF promoter in both alleles and that has five CATT repeats in the -794 region of the MIF promoter in both alleles. See, e.g., Table 1.
  • the term "severity" of a disease refers to the seriousness, degree or state of a disease or condition.
  • a disease may be characterized as mild, moderate or several.
  • a person of skill in the art would be able to determine or assess the severity of a particular disease.
  • the severity of a disease may be determined by comparing the likelihood or length of survival of a subject having a disease with the likelihood or length of survival in other subjects having the same disease.
  • the severity of a disease may be determining by comparing the symptoms of the disease in a subject having a disease with the severity of the symptoms in other subjects having the same disease.
  • the term "therapeutically effective amount” refers to the amount of a MIF agonist or antagonist (isolated or recombinantly produced), or a composition comprising a MIF agonist or antagonist, that is in sufficient quantities to treat a subject having, or at risk of developing, a disease associated with low or high MIF expression, or to treat a disease associated with high or low MIF expression itself.
  • an effective amount is sufficient to delay, slow, or prevent the onset or progression of a disease associated with high or low MIF expression, or related symptoms.
  • the invention comprises: (i) methods of diagnosing a patient for a disease associated with high or low MIF expression, (ii) methods of identifying patients at risk of developing a disease associated with high or low MIF expression, (iii) methods of predicting the severity of a disease associated with high or low MIF expression, (iv) methods of predicting the susceptibility of a patient to a disease associated with high or low MIF expression, (v) methods for selecting a patient for treatment with a MIF agonist or antagonist, and the like; comprising genotyping the subject for the presence of a polymorphism associated with high or low MIF expression.
  • a polymorphism associated with MIF expression may be any genetic alteration that modifies or correlates with the expression or activity of MIF.
  • the polymorphism associated with MIF expression is selected from the group consisting of: (i) the presence of five, six, seven or eight CATT repeats in the -794 region of the MIF promoter; and (ii) the presence of guanine or cytosine at position -173 of the MIF promoter.
  • Polymorphisms associated with high MIF expression include, without limitation, the presence of six, seven or eight CATT repeats in the -794 region of the MIF promoter and the presence of a cytosine (C) at position -173 of the MIF promoter.
  • Polymorphisms associated with low MIF expression include, without limitation, the presence of five CATT repeats in the -794 region of the MIF promoter and the presence of a guanine (G) at position -173 of the MIF promoter.
  • G guanine
  • the greater number of CATT repeats that are present in the -794 region of the MIF promoter the greater the expression and/or activity of MIF.
  • the above polymorphisms are illustrative of polymorphisms that may be associated with MIF expression. Nevertheless, the present invention encompasses all other polymorphisms that are associated with the expression or activity of the MIF gene.
  • polymorphisms consisting of a G/A or G/T nucleotide change at position -173 of the MIF promoter may be associated with high or low MIF expression.
  • polymorphisms the presence of two, three, four, nine, ten, eleven or twelve or more CATT repeats in the -794 region of the MIF promoter may be associated with high or low MIF expression.
  • a subject having a polymorphism associated with low MIF expression refers to a subject having a G at position - 173 of the MIF promoter in both alleles of the MIF gene and having five CATT boxes in the - 794 region of the MIF promoter in both alleles of the MIF gene. See, e.g., Table I.
  • a subject having a polymorphism associated with high MIF expression refers to a subject having a polymorphism associated with high MIF expression in at least one of its alleles. (See Table I.)
  • a subject having a polymorphism associated with high MIF expression refers to (i) a subject that has more than 6 CATT boxes in both alleles of the MIF gene, or (ii) a subject having a C at position -173 of the MIF gene in each of the two alleles of the MIF gene and having 6 or more CATT boxes in at least one of the two alleles of the MIF gene.
  • a subject having a polymorphism associated with high MIF expression refers to a subject having 7 CATT repeats in at least one of the two alleles in the -794 region of the MIF promoter and having a C at position -173 in at least one of the two alleles of the MIF gene.
  • Diseases associated with high MIF expression include, without limitation, diseases caused by infection by a protozoan, such as malaria; anemia of chronic disease; and asthma.
  • Diseases associated with low MIF expression include, without limitation: infections (in particular acute infections) and the diseases caused by infections.
  • the disease associated with low MIF expression is a respiratory disease caused by an infection, including without limitation, infection by gram positive and gram negative bacteria (e.g., Legionella), mycobacteria (such as Mycobacterium tuberculosis or other Mycobacterium species), fungal infections (e.g., infections of Pneumocystis, Candida, and Histoplasma) and viral infections (e.g., infections of influenza, varicella, and corona virus such as SARS- associated coronoavirus).
  • infection gram positive and gram negative bacteria
  • mycobacteria such as Mycobacterium tuberculosis or other Mycobacterium species
  • fungal infections e.g., infections of Pneumocystis, Candida, and Histoplasma
  • viral infections e.g., infections of influenza, varicella, and corona virus such as SARS- associated cor
  • the disease associated with low MIF expression is sepsis, hi another embodiment, the disease associated with low MIF expression is an infection is pneumonia (regardless of whether it is caused by a bacterial, viral or fungal infection).
  • the pneumonia is Community Acquired Pneumonia (CAP)
  • the disease associated with low MIF expression is meningitis.
  • the disease associated with low MB? expression is influenza.
  • Microbial infections that lead to pneumonia include bacterial infections (e.g., infections of gram positive bacteria, gram negative bacteria, and mycobacteria such as mycobacterium tuberculosis), fungal infections (e.g., infections of Pneumocystis, Candida, and Histoplasma) and viral infections (e.g., infections of influenza, varicella, and corona virus such as SARS-associated coronoavirus).
  • a disease associated with low MIF expression is infection by a virus or other pathogen that use the CCR5 receptor for infection, for example Human Immunodeficiency Virus-1 (HIV-I), Hepatitis C Virus (HCV), Epstein-Barr Virus, or Yersinia Pestis.
  • HCV-I Human Immunodeficiency Virus-1
  • HCV Hepatitis C Virus
  • Epstein-Barr Virus Epstein-Barr Virus
  • the methods of the invention are useful for selecting a subject for treatment with a MIF antagonist, wherein the subject has a disease or is at risk of developing a disease associated with high MIF expression.
  • Such methods comprise genotyping the subject for the presence of a polymorphism associated with MIF expression.
  • a subject having a polymorphism associated with high MIF expression is selected for treatment with a MIF antagonist.
  • MIF antagonists are useful for treating a subject having, or is at risk of developing, a disease associated with high MIF expression, hi one embodiment, the subject has or is at risk of developing a disease caused by infection by a protozoan.
  • the subject has or is at risk of developing malaria
  • the subject has or is at risk of developing anemia of chronic disease.
  • the subject has or is at risk of developing asthma.
  • the methods of the invention are useful for selecting a subject for treatment with a MEF agonist, wherein the subject has a disease or is at risk of developing a disease associated with low MB? expression.
  • Such methods comprise genotyping the subject for the presence of a polymorphism associated with MD? expression, wherein a subject having a polymorphism associated with low MD? expression is selected for treatment with a MD? agonist.
  • MIF agonists are useful for treating a subject having, or is at risk of developing, a disease associated with low MD? expression, hi one embodiment, the subject has, or is at risk of being infected with, a pathogen and/or of developing a disease caused by an infection with a pathogen.
  • the subject has, or is at risk of developing, sepsis. In another embodiment, the subject has, or is at risk of developing, an infection that leads to a respiratory disease or has a respiratory disease caused by an infection. In another embodiment, the subject has, or is at risk of developing, pneumonia. In another embodiment, the subject has, or is at risk of developing, CAP. In another embodiment, the subject has, or is at risk of developing, meningitis. In another embodiment, the subject has, or is at risk of developing, influenza.
  • the subject is infected with, or is at risk of being infected with, a pathogen that uses the CCR5 as a receptor, or has, or is at risk of developing, a disease caused by infection with a pathogen that uses the CCR5 receptor.
  • the subject is infected with, or is at risk of being infected with, HIV-I.
  • the subject is infected with, or is at risk of being infected with, Hepatitis C Virus (HCV), Epstein-Barr Virus, or Yersinia Pestis.
  • HCV Hepatitis C Virus
  • Epstein-Barr Virus Epstein-Barr Virus
  • the methods of the invention are useful for identifying a subject at risk for developing a disease associated with high MD? expression.
  • Such methods comprise genotyping the subject for the presence of a polymorphism associated with high or low MD? expression.
  • a subject having a polymorphism associated with high MD? expression is at a higher risk of developing a disease associated with high MIF expression than a subject having a polymorphism associated with low MIF expression.
  • a subject having a polymorphism associated with low MIF expression is at a lower risk of developing a disease associated with high MD? expression than a subject having a polymorphism associated with high MD? expression, hi one embodiment, the subject is at risk of developing a disease caused by infection by a protozoan, hi another embodiment, the subject is at risk of developing malaria. In another embodiment, the subject is at risk of developing anemia of chronic disease.
  • the methods of the invention are useful for identifying a subject at risk for developing a disease associated with low MD? expression.
  • Such methods comprise genotyping the subject for the presence of a polymorphism associated with high or low MD? expression.
  • a subject having a polymorphism associated with low MlF expression is at a higher risk of developing a disease associated with low MIF expression than a subject having a polymorphism associated with high MIF expression.
  • a subject having a polymorphism associated with high expression is at a lower risk of developing a disease associated with low MIF expression than a subject having a polymorphism associated with low MIF expression.
  • the subject is at risk of developing a disease caused by an infection.
  • the subject is at risk of developing sepsis.
  • the subject is at risk of developing an infection that leads to a respiratory disease or is at risk of developing a respiratory disease caused by an infection.
  • the subject is at risk of developing pneumonia (for example CAP).
  • the subject is at risk of developing meningitis.
  • the subject is at risk of developing influenza.
  • the subject is at risk of developing a disease caused by an infection with a pathogen that uses the CCR5 receptor.
  • the subject at risk of developing an HIV infection or is at risk of developing AIDS.
  • the subject is at risk of developing a disease caused by an infection with HCV, Epstein-Barr Virus, or Yersinia pestis.
  • the methods of the invention are useful for predicting the severity of a disease associated with high MIF expression in a subject.
  • Such methods comprise genotyping the subject for the presence of a polymorphism associated with MIF expression.
  • a subject having a polymorphism associated with high MIF expression is at a higher risk for, or has a greater likelihood of, developing a more severe disease associated with high MIF expression than a subject having a polymorphism associated with low MIF expression.
  • a subject having a polymorphism associated with low MIF expression has a greater likelihood of developing a milder (i.e. less severe) form of a disease associated with high MIF expression than a subject having a polymorphism associated with high MIF expression.
  • the disease associated with high MIF expression is caused by infection with a protozoan, hi another embodiment, the disease associated with high MIF expression is malaria. In another embodiment, the disease associated with high MIF expression is anemia of chronic disease.
  • a person of skill in the art would be able to determine or assess the severity of a particular disease. For example, the severity of a disease may be determined by comparing the likelihood or length of survival of a subject having a disease with the likelihood or length of survival in other subjects having the same disease. In another embodiment, the severity of a disease may be determining by comparing the symptoms of the disease in a subject having a disease with the severity of the symptoms in other subjects having the same disease.
  • the invention provides a method for predicting the severity of asthma in a patient having asthma, or at risk of developing asthma, comprising genotyping the subject for the presence of a polymorphism associated with MIF expression.
  • a subject having a polymorphism associated with high MIF expression is at a higher risk for, or has a greater likelihood of, developing more severe asthma than a subject having a polymorphism associated with low MIF expression.
  • a subject having a polymorphism associated with low MIF expression has a greater likelihood of developing a milder asthma than a subject having a polymorphism associated with high MIF expression.
  • the severity of asthma can be determined by using any method.
  • the severity of asthma is determined by using the GINA criteria outlined by WHO (which classifies asthma as intermittent; mild persistent, moderately persistent or severe persistent), by measuring airflow obstruction in the lungs (for example, by measuring airflow obstruction by spirometry or peak expiratory flow (PEF) or by measuring the forced expiratory volume in one second (FEV 1 )), or by determining the need for steroid and immunosuppressive medication (See Example 7).
  • WHO GINA criteria outlined by WHO (which classifies asthma as intermittent; mild persistent, moderately persistent or severe persistent)
  • PEF peak expiratory flow
  • FEV 1 forced expiratory volume in one second
  • the methods of the invention are useful for predicting the severity of a disease associated with low MIF expression in a subject.
  • Such methods comprise genotyping the subject for the presence of a polymorphism associated with MIF expression.
  • a subject having a polymorphism associated with low MIF expression is at a higher risk for developing a more severe form of a disease associated with low MIF expression than a subject having a polymorphism associated with high MIF expression.
  • a subject having a polymorphism associated with high MIF expression has a greater likelihood of developing a milder (i.e. less severe) form of a disease associated with low MIF expression.
  • the disease associated with low MIF expression is a disease caused by an infection, particularly a disease caused by an acute infection or a disease caused by a respiratory infection, m another embodiment, the disease associated with low MIF expression is sepsis, m another embodiment, the disease associated with low MIF expression is an infection leading to a respiratory disease. In another embodiment, the disease associated with low MIF expression is pneumonia. In another embodiment, the disease associated with low MIF expression is CAP. In one embodiment, the disease associated with low MF expression is meningitis. Ih one embodiment, the disease associated with low MF expression is influenza.
  • the disease associated with low MIF expression is infection by a pathogen that uses the CCR5 receptor, or a disease caused by infection with a pathogen that uses the CCR5 receptor.
  • the disease associated with low MIF expression is infection with HIV or AIDS.
  • the disease associated with low MIF expression is infection with HCV, Epstein-Barr Viruse, or Yersinia pestis.
  • the methods of the invention are useful for predicting whether a subject is susceptible to a disease that is associated with high MIF expression.
  • Such methods comprise genotyping a subject for the presence of a polymorphism associated with high or low MIF expression.
  • a subject having a polymorphism associated with high MIF expression is more susceptible to a disease associated with high MIF expression than a subject having a polymorphism associated with low MIF expression.
  • a subject having a polymorphism associated with low MIF expression is less susceptible to a disease associated with high MIF expression than a subject having a polymorphism associated with high MIF expression.
  • the disease associated with high MIF expression is caused by infection of a protozoan.
  • the disease associated with high MIF expression is malaria.
  • the disease associated with high MIF expression is anemia of chronic disease.
  • the methods of the invention are useful for predicting whether a subject is susceptible to a disease that is associated with low MIF expression.
  • Such methods comprise genotyping a subject for the presence of a polymorphism associated with high or low MIF expression.
  • a subject having a polymorphism associated with low MIF expression is more susceptible to a disease associated with low MIF expression than a subject having a polymorphism associated with high MIF expression.
  • a subject having a polymorphism associated with high MIF expression is less susceptible to a disease associated with low MIF expression than a subject having a polymorphism associated with low MlF expression.
  • the disease associated with low MIF expression is a disease caused by an infection, particularly a disease caused by an acute infection.
  • the disease associated with low MIF expression is sepsis. In one embodiment, the disease associated with low MIF expression is an infection leading to a respiratory disease or a respiratory disease caused by an infection. In one embodiment, the disease associated with low MIF expression is pneumonia. In one embodiment, the disease associated with low MIF expression is CAP. In one embodiment, the disease associated with low MIF expression is meningitis, hi one embodiment, the disease associated with low MIF expression is influenza. In one embodiment, the disease associated with low MIF expression is infection by a pathogen that uses the CCR5 receptor, or a disease caused by infection with a pathogen that uses the CCR5 receptor. In another embodiment, the disease associated with low MIF expression is infection with HIV or ADDS. In other embodiments, the disease associated with low MIF expression is infection with HCV, Epstein-Barr Viruse, or Yersinia pestis.
  • Certain aspects of the invention comprise the step of genotyping a subject for the presence of a polymorphism associated with MIF expression (e.g., high or low MIF expression).
  • a polymorphism associated with MIF expression e.g., high or low MIF expression.
  • Any assay that permits detection of a polymorphism in the MIF gene (which is used herein to include the MIF coding region and the MIF promoter region) may be used in the claimed methods.
  • the preferred method for detecting a polymorphism will depend, in part, upon the molecular nature of the polymorphism. For example, certain methods may be amenable to the detection of insertions, deletions, substitutions, repeats, or single nucleotide polymorphisms (SNPs).
  • SNPs single nucleotide polymorphisms
  • Such assays are well known in the art and may encompass, for example, DNA sequencing, hybridization, ligation, or primer extension methods.
  • the step of genotyping a subject may comprise contacting a sample obtained from the subject with a polynucleotide probe that hybridizes specifically to a polymorphism associated with MIF expression, and, determining whether hybridization occurs.
  • the polynucleotide probe can be engineered to hybridize specifically to a polymorphism associated with high MIF expression, but not to a polymorphism associated with low MIF expression.
  • the polynucleotide probe can be engineered to hybridize specifically to a polymorphism associated with low MIF expression, but not to a polymorphism associated with high MIF expression.
  • Hybridization of the probe to the DNA in the sample indicates whether the subject comprises a polymorphism associated with high MIF expression or a polymorphism associated with low MIF expression, thereby genotyping the subject for the presence of a polymorphism associated with MIF expression, hi certain embodiments, methods for genotyping a subject for the presence of a polymorphism that is associated with MIF expression further comprises contacting a sample obtained from the subject with a control polynucleotide probe.
  • a control polynucleotide probe will not, for example, hybridize specifically to a polymorphism associated with high or low MIF expression.
  • the polynucleotide probe may comprise nucleotides that are fluorescently, radioactively, or chemically labeled to facilitate detection of hybridization.
  • Hybridization may be performed and detected by standard methods known in the art, such as by Northern blotting, Southern blotting, fluorescent in situ hybridization (FISH), or by hybridization to polynucleotides immobilized on a solid support, such as a DNA array or microarray.
  • Array elements may comprise any polynucleotide, including genomic DNA, cDNA, synthetic DNA or other types of nucleic acid array elements.
  • the probe is a DNA probe that is immobilized on a solid support, such as a DNA array or microarray. In one embodiment, the probe is from about 8 nucleotides to about 500 nucleotides.
  • a subject is genotyped for the presence of a polymorphism associated with MIF expression by hybridization to a DNA array or microarray, by incorporation of biotinylated primers followed by avidin-enzyme conjugate detection, or by incorporation of 32 P-labeled deoxynucleotide triphosphates, such as dCTP or dATP, into the target polynucleotides (e.g., a polynucleotide that may include a polymorphism that is associated with MIF expression).
  • Hybridization may be detected, for example, by measuring the intensity of the labeled probe remaining on a DNA array after washing.
  • Methods of detecting a polymorphism associated with MIF expression may include amplification of a region of DNA that comprises a polymorphism that is associated with MIF expression. Any method of amplification may be used.
  • a region of DNA comprising the variation is amplified by using polymerase chain reaction (PCR).
  • PCR was initially described by Mullis (See e.g., U.S. Pat. Nos. 4,683,195 4,683,202, and 4,965,188, herein incorporated by reference), which describes a method for increasing the concentration of a region of DNA, in a mixture of genomic DNA, without cloning or purification.
  • PCR methods may also be used for nucleic acid amplification, including but not limited to RT-PCR, quantitative PCR, real time PCR, Rapid Amplified Polymorphic DNA Analysis, Rapid Amplification of cDNA Ends (RACE), rolling circle amplification, or multiple displacement amplification.
  • RT-PCR quantitative PCR
  • real time PCR Rapid Amplified Polymorphic DNA Analysis
  • RACE Rapid Amplification of cDNA Ends
  • multiple displacement amplification polynucleotide primers that flank the MIF gene (including the MIF promoter) are combined with a DNA mixture.
  • the mixture also includes the necessary amplification reagents (e.g., deoxyribonucleotide triphosphates, buffer, etc.) necessary for the thermal cycling reaction.
  • necessary amplification reagents e.g., deoxyribonucleotide triphosphates, buffer, etc.
  • the mixture undergoes a series of denaturation, primer annealing, and polymerase extension steps to amplify the region of DNA that comprises a polymorphism that is associated with MIF expression.
  • the length of the amplified region of DNA is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter.
  • hybridization of the primers may occur such that the ends of the primers proximal to the variation are separated by 1 to 10,000 base pairs (e.g., 10 base pairs (bp) 50 bp, 200 bp, 500 bp, 1,000 bp, 2,500 bp, 5,000 bp, or 10,000 bp).
  • methods for genotypmg a subject tor trie presence ot a polymorphism that is associated with MIF expression comprise: (a) contacting a sample obtained from the subject with a pair of amplification primers, wherein said primers are capable of amplifying a portion of the MIF promoter comprising a polymorphism associated with MIF expression; (b) amplifying DNA in the sample, thereby producing amplified DNA; and (c) determining whether the amplified DNA comprises a polymorphism associated with high MIF expression or a polymorphism associated with low MIF expression, thereby genotypmg the subject for the presence of a polymorphism associated with MIF expression.
  • the step of determining whether the amplified DNA comprises a polymorphism associated with high or low MIF expression can be carried out using any method known in the art and/or described herein.
  • the method may further comprise sequencing the amplified DNA.
  • the presence of a polymorphism associated with MIF expression is detected and/or determined by DNA sequencing.
  • Any of a variety of sequencing reactions known in the art can be used to directly sequence the allele. Examples of sequencing reactions include those based on techniques developed by Maxim and Gilbert ((1977) Proc. Natl. Acad. Sci. USA 74:560) or Sanger (Sanger et al (1977) Proc. Nat. Acad. Sci. USA 74:5463). DNA sequence determination may be performed by standard methods such as dideoxy chain termination technology and gel-electrophoresis, or by other methods such as by pyrosequencing (Biotage AB, Uppsala, Sweden).
  • DNA sequencing by dideoxy chain termination may be performed using unlabeled primers and labeled (e.g., fluorescent or radioactive) terminators.
  • sequencing may be performed using labeled primers and unlabeled terminators.
  • any of a variety of automated sequencing procedures may be utilized when performing the subject assays (see, for example Biotechniques (1995) 19:448), including sequencing by mass spectrometry (see, for example PCT publication WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36:127-162; and Griffin et al. (1993) Appl. Biochem. Biotechnol. 38:147-159).
  • the nucleic acid sequence of the DNA in the sample can be studied to determine whether a polymorphism associated with high or low MIF expression is present. It will be evident to one of skill in the art that, for certain embodiments, the occurrence of only one, two or three of the nucleic acid bases need be determined in the sequencing reaction. For instance, A-track or the like, e.g., where only one nucleic acid is detected, can be carried out.
  • the presence of a polymorphism associated with MIF expression is detected and/or determined using FISH.
  • a probe that specifically hybridizes to a polymorphism associated with MIF expression is hybridized to a subject's genomic DNA by FISH.
  • FISH can be used, for example, in metaphase cells, to detect a deletion or repeat region in genomic DNA. Genomic DNA is denatured to separate the complimentary strands within the DNA double helix structure. The polynucleotide probe of the invention is then added to the denatured genomic DNA.
  • a probe that specifically hybridizes to a polymorphism associated with high MIF expression is used.
  • the probe will hybridize to the genomic DNA.
  • the probe signal e.g., fluorescence
  • the probe signal can then be detected through a fluorescent microscope for the presence of absence of signal.
  • the presence of signal therefore, indicates the presence of a polymorphism associated with high MIF expression.
  • a probe that specifically hybridizes to a polymorphism associated with low MIF expression is used.
  • the probe signal e.g., fluorescence
  • the probe signal can then be detected through a fluorescent microscope for the presence of absence of signal. The presence of signal, therefore, indicates the presence of a polymorphism associated with low MIF expression.
  • the presence of a polymorphism associated with MIF expression is detected and/or determined by primer extension with DNA polymerase.
  • a polynucleotide primer of the invention hybridizes immediately adjacent to the polymorphism.
  • a single base sequencing reaction using labeled dideoxynucleotide terminators may be used to detect the polymorphism.
  • the presence of a polymorphism associated with high or low MIF expression will result in the incorporation of the labeled terminator, whereas the absence of a polymorphism associated with high or low MIF expression will not result in the incorporation of the terminator.
  • the dideoxynucleotides maybe labeled (e.g., fluorescently, radio actively, chemically, etc.) and the polymorphism is detected by detecting the incorporation of the labeled dideoxynucleotides during o ⁇ after primer extension.
  • a polynucleotide primer of the invention hybridizes specifically to a polymorphism associated with high or low MIF expression. The presence of a polymorphism will result in primer extension, whereas the absence of a polymorphism will not result in primer extension.
  • the primers and/or nucleotides may further include fluorescent, radioactive, or chemical probes.
  • a primer labeled by primer extension may be detected by measuring the intensity of the extension product, such as by gel electrophoresis, mass spectrometry, or any other method for detecting fluorescent, radioactive, or chemical labels.
  • the presence of a polymorphism associated witn Mil* expression is detected and/or determined by ligation.
  • a polynucleotide primer hybridizes specifically to a polymorphism associated with high or low MIF expression.
  • a second polynucleotide that hybridizes to a region of the MIF gene immediately adjacent to the first primer is also provided.
  • One, or both, of the polynucleotide primers may be fluorescently, radioactively, or chemically labeled.
  • Ligation of the two polynucleotide primers will occur in the presence of DNA ligase if a polymorphism associated with high or low MIF expression is present. Ligation may be detected by gel electrophoresis, mass spectrometry, or by measuring the intensity of fluorescent, radioactive, or chemical labels.
  • identification of a polymorphism can be carried out using an oligonucleotide ligation assay (OLA), as described, e.g., in U.S. Pat. No. 4,998,617 and in Landegren, U. et al. ((1988) Science 241:1077-1080).
  • OLA oligonucleotide ligation assay
  • the OLA protocol uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target.
  • One of the oligonucleotides is linked to a separation marker, e.g,. biotinylated, and the other is detectably labeled.
  • oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. Ligation then permits the labeled oligonucleotide to be recovered using avidin, or another biotin ligand.
  • Nickerson, D. A. et al. have described a nucleic acid detection assay that combines attributes of PCR and OLA (Nickerson, D. A. et al. (1990) Proc. Natl. Acad. Sci. USA 87:8923-27). In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA.
  • U.S. Pat. No. 5,593,826 discloses an OLA using an oligonucleotide having 3'-amino group and a 5'-phosphorylated oligonucleotide to form a conjugate having a phosphoramidate linkage.
  • OLA OLA combined with PCR permits typing of two alleles in a single microtiter well. By marking each of the allele-specific primers with a unique hapten, i.e.
  • each OLA reaction can be detected by using hapten specific antibodies that are labeled with different enzyme reporters, alkaline phosphatase or horseradish peroxidase.
  • This system permits the detection of polymorphisms using a high throughput format that leads to the production of two different colors.
  • the presence of a polymorphism associated with MIF expression is detected and/or determined by single-base extension (SBE).
  • SBE single-base extension
  • a fluorescently- labeled primer that is coupled with fluorescence resonance energy transfer (FRET) between the label of the added base and the label of the primer may be used.
  • FRET fluorescence resonance energy transfer
  • the method such as that described by Chen et al. 5 (PNAS 94:10756-61 (1997), incorporated herein by reference) uses a locus-specific polynucleotide primer labeled on the 5' terminus with 5-carboxyfiuorescein (FAM). This labeled primer is designed so that the 3' end is immediately adjacent to the polymorphic site of interest.
  • FAM 5-carboxyfiuorescein
  • the labeled primer is hybridized to the locus, and single base extension of the labeled primer is performed with fluorescently labeled dideoxyribonucleotides (ddNTPs) in dye-terminator sequencing fashion, except that no deoxyribonucleotides are present.
  • ddNTPs dideoxyribonucleotides
  • An increase in fluorescence of the added ddNTP in response to excitation at the wavelength of the labeled primer is used to infer the identity of the added nucleotide.
  • a polymorphism that is associated with MIF expression may be detected using single-strand conformation polymorphism analysis, which identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. ScI 86, 2766-2770 (1989).
  • Amplified PCR products can be generated as described above, and heated or otherwise denatured, to form single stranded amplification products.
  • Single-stranded nucleic acids may refold or form secondary structures which are partially dependent on the base sequence.
  • the different electrophoretic mobilities of single-stranded amplification products can be related to base-sequence differences between alleles of target sequences.
  • the single base polymorphism can be detected by using a specialized exonuclease-resistant nucleotide, as disclosed, e.g., in Mundy, C. R. (U.S. Pat. No. 4,656,127).
  • a primer complementary to the allelic sequence immediately adjacent 3' to the polymorphic site is permitted to hybridize to a target molecule obtained from a subject. If the polymorphic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant nucleotide derivative present, then that derivative will be incorporated onto the end of the hybridized primer. Such incorporation renders the primer resistant to exonuclease, and thereby permits its detection.
  • a primer is employed that is complementary to allelic sequences immediately 3' to a polymorphic site.
  • the method determines the identity of the nucleotide of that site using labeled dideoxynucleotide derivatives, which, if complementary to the nucleotide of the polymorphic site will become incorporated onto the terminus of the primer.
  • GBATM Genetic Bit Analysis
  • Goelet, P. et al. PCT Appln. No. 92/157112.
  • the method of Goelet, P. et al. uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymorphic site.
  • the labeled terminator that is incorporated is thus determined by, and complementary to, the nucleotide present in the polymorphic site of the target molecule being evaluated.
  • Li contrast to the method of Cohen et al. (French Patent 2,650,840; PCT Appln. No. WO91/02087)
  • the method of Goelet, P. et al. is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized to a solid phase.
  • RNA is initially isolated from available tissue and reverse-transcribed, and the segment of interest is amplified by PCR. The products of reverse transcription PCR are then used as a template for nested PCR amplification with a primer that contains an RNA polymerase promoter and a sequence for initiating eukaryotic translation.
  • the unique motifs incorporated into the primer permit sequential in vitro transcription and translation of the PCR products.
  • the appearance of truncated polypeptides signals the presence of a mutation that causes premature termination of translation, hi a variation of this technique, DNA (as opposed to RNA) is used as a PCR template when the target region of interest is derived from a single exon.
  • Diagnostic procedures may also be performed in situ directly upon tissue sections (fixed and/or frozen) of subject tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary.
  • Nucleic acid reagents may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G. J., 1992, PCR in situ hybridization: protocols and applications, Raven Press, N. Y.).
  • protection from cleavage agents can be used to detect mismatched bases in RNA/RNA or RNA/DNA or DNA/DNA heteroduplexes (Myers, et al. (1985) Science 230:1242).
  • cleavage agents such as a nuclease, hydroxylamine or osmium tetraoxide and with piperidine
  • cleavage agents such as a nuclease, hydroxylamine or osmium tetraoxide and with piperidine
  • RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with Sl nuclease to enzymatically digest the mismatched regions
  • either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation.
  • control DNA or RNA can be labeled for detection.
  • the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes).
  • DNA mismatch repair enzymes
  • the rnutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15:1657-1662).
  • Commercial assays such as the Taqman assay (Applied ⁇ iosystems, Foster City, CA), may also be used for geno typing a subject for the presence of a polymorphism that is associated with MIF expression. Genotyping and uses therefore are shown in U.S.
  • Polynucleotides used in any of the methods of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • Polynucleotides of the invention can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • Polynucleotide probes of the invention may hybridize to a segment of target DNA such that the variation aligns with a central position of the probe, or the variation may align with a terminal position of the probe.
  • Standard instrumentation known to those skilled in the art can be used for the amplification and detection of amplified DNA.
  • PCR e.g. U.S. Pat. No. 5,038,852 (computer-controlled thermal cycler); Wittwer et al., Nucleic Acids Research, 17: 4353-4357 (1989) (capillary tube PCR); U.S. Pat. No. 5,187,084 (air-based temperature control); Garner et al, Biotechniques, 14: 112-115 (1993)(high-throughput PCR in 864-well plates); International application No.
  • PClYUS 93/04039 PCR in micro-machined structures
  • European patent application No. 90301061.9 (publ. No. 0381501 A2)(disposable, single use PCR device), and the like.
  • the invention described herein utilizes real-time PCR or other methods known in the art such as the Taqman assay.
  • a polymorphism in the MIF gene that is associated with MIF expression may be detected using polynucleotide probes that have been immobilized on a solid support or substrate. Immobilized polynucleotide probes hybridize to a region of the MIF gene (including the promoter region of the MIF gene) that comprises a polymorphism that is associated with MIF expression.
  • the present invention may employ any solid substrate known in the art, including arrays in some preferred embodiments. Methods and techniques applicable to polymer (including protein) array synthesis have been described in U.S. Ser. No. 09/536,841, WO 00/58516, U.S. Pat. Nos.
  • PCT/US99/00730 International Publication No. WO 99/36760
  • PCT/USO 1/04285 International Publication No. WO 01/58593
  • Patents that describe synthesis techniques in specific embodiments include U.S. Pat. Nos. 5,412,087, 6,147,205, 6,262,216, 6,310,189, 5,889,165, and 5,959,098.
  • the invention provides a solid support or substrate for simultaneously genotyping a microsatellite repeat and a SNP in the MIF gene (including the promoter region).
  • solid supports and substrates include, without limitation, a nucleic acid probe array (e.g., a chip, a microarray, or an array), a nitrocellulose filter, a microwell, a bead, a sample tube, a microscope slide, a microfluidics device, and the like.
  • the solid support maybe made of various materials, including paper, cellulose, nylon, polystyrene, polycarbonate, plastics, glass, ceramic, stainless steel, or the like.
  • the solid support may have a rigid or semi-rigid surface, and may be spherical (e.g., bead) or substantially planar (e.g., flat surface) with appropriate wells, raised regions, etched trenches, or the like.
  • the solid support may also include a gel or matrix in which nucleic acids may be embedded or fibers or any solid support comprising bound nucleic acids.
  • the solid support comprises at least two polynucleotide probes that are complementary to one or more polymorphisms associated with MIF expression. In a preferred embodiment, at least one of the probes detects a microsatellite repeat associated with MIF expression and at least one of the other probes detects a SNP associated with MIF expression.
  • Hybridization to the polynucleotide probes can be detected using any of the detection method, m one embodiment, hybridization may be detected by the naked eye, without the aid of instruments for visualizing hybridization.
  • Platforms for detection by the naked eye include thin- film technologies such as those described in Jenison et al.. Expert Rev. MoI. Diagn, 6:89-99 (2006); Ostroff et al., Clinical Chemistry 45:1659-1664 (1999) and Zhong et al., PNAS 100: 11559-11564 (2003), which are hereby incorporated by reference.
  • the invention provides the use of thin film technology to simultaneously genotype a microsatellite repeat and a SNP in the MIF gene. (See Example 2).
  • the invention provides the use of a thin film chip or microarray. Thin-film technology permits the visual detection of nucleic acid targets with the unaided eye. The assay is inexpensive, robust, highly specific, rapid and easy to use, thus permitting its implementation in rural settings with limited technology. See Jenison et al. (2006) Expert Rev. MoI. Diagn. 6:89-99.
  • Thin film technology is capable of generating a visual signal by the direct interaction of light with thin films formed on a solid surface (e.g., a silicon surface).
  • the surface is constructed to be antireflective to specific wavelengths of light by the addition of antireflective coatings that create destructive interference.
  • a solid surface e.g., a silicon surface.
  • the surface is constructed to be antireflective to specific wavelengths of light by the addition of antireflective coatings that create destructive interference.
  • Optical thickness of the thin film which is a function of both refractive index and physical thickness, determines which wavelengths of light are antireflected. Changes in the optical thickness of the thin film will result in a visible color change on the surface, once it is dried.
  • This optical principle has been exploited to configure biologic assays on optical surfaces that transduce a thickness change into a surface color change that is a direct measure of interactions between target molecules in solution and capture molecules on the surface of the chip.
  • the method is sensitive to thickness changes in the angstrom range, translating into highly sensitive detection of target molecules in very rapid assay formats.
  • Thin film formation can be accomplished by a variety of signal amplification techniques, such as by the enzymatic turnover of precipitating substrates.
  • thin film development may utilize, for example, the detection of biotin-labeled probes by binding of an antibiotin antibody conjugated to horseradish perixidase (HRP).
  • HRP horseradish perixidase
  • Li the presence of a precipitating substrate for HRP, an enhanced molecular thin film is deposited onto the surface of the solid substrate. Control of the reflective properties to create, for example, a gold-colored surface is achieved by the coating of surfaces with optical layers of defined refractive index and thickness, using well-established semiconductor processes.
  • the base surface of the chip is crystalline silicon, which provides a highly reflective, inert and molecularly flat surface to which the antireflective coating (silicon nitride) is applied by vapor deposition (e.g., to a thickness of 475 angstroms).
  • An attachment layer such as T-structure aminoalkyl polydimethy siloxane (TSPS) can be coated on the surface to provide better immobilization of biological materials, such as nucleic acid capture probes or antibodies.
  • TSPS T-structure aminoalkyl polydimethy siloxane
  • a solid support as described above comprises at least one probe that hybridizes specifically to a guanine or to a cytosine at position -173 of the MIF promoter.
  • a solid support as described above comprises at least one probe that hybridizes specifically to a sequence selected from the group consisting of SEQ DD NO: 1 (CATTCATTCATTCATTCATT), SEQ ID NO: 2 (CATTCATTCATTCATTCATTCATT), SEQ ID NO: 3 (CATTCATTCATTCATTCATTCATTCATT), and SEQ ID NO: 4 (CATTCATTCATTCATTCATT CATTCATTCATT).
  • a solid support as described above comprises: (a) at least one probe that hybridizes specifically to a guanine or a cytosine at position -173 of the MIF promoter; and, (b) at least one probe that hybridizes specifically to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.
  • a solid support as described above (such as a chip or microarray) comprises a probe that hybridizes specifically to a guanine at position -173 of the MIF promoter and another probe that hybridizes specifically to a cytosine at position -173 of the MIF promoter.
  • a solid support as described above (such as a chip or microarray) comprises: (a) a probe that hybridizes specifically to SEQ DD NO: 1 ; (b) a probe that hybridizes specifically to SEQ DD NO: 2; (c) a probe that hybridizes specifically to SEQ DD NO: 3; and, (d) a probe that hybridizes specifically to SEQ DD NO: 4.
  • a solid support as described above comprises: (a) a probe that hybridizes specifically to a guanine at position -173 of the MD? promoter; (b) a probe that hybridizes specifically to a cytosine at position -173 of the MD? promoter; (c) a probe that hybridizes specifically to SEQ ID NO: 1; (d) a probe that hybridizes specifically to SEQ DD NO: 2; (e) a probe that hybridizes specifically to SEQ DD NO: 3; and, (f) a probe that hybridizes specifically to SEQ DD NO: 4.
  • the invention provides a method of determining the MD 7 genotype of a subject comprising contacting a solid substrate as disclosed herein with a sample obtained from the subject and determining the MIF genotype of the subject.
  • the sample may be amplified prior to contacting the sample with the solid substrate disclosed herein.
  • the invention provides a method of determining the MIF genotype of a subject comprising: (a) amplifying a portion of the MIF gene comprising a polymorphism associated with MIF expression; (b) contacting a solid substrate as disclosed herein with the amplified portion; and, (c) determining whether the subject comprises a polymorphism associated with high MIF expression or whether the subject comprises a polymorphism associated with low MIF expression, thereby determining the MD? genotype of the subject.
  • genotyping methods disclosed herein can be substituted by the use of other methods that can establish whether a subject expresses MIF at high or low levels. Such methods are therefore useful for diagnosing a patient for a disease associated with high or low ML? expression, identifying patients at risk of developing a disease associated with high or low MD? expression, predicting the severity of a disease associated with high or low MD? expression, predicting the susceptibility of a patient to a disease associated with high or low MD? expression, or selecting a patient for treatment with a MD? agonist or antagonist as described above.
  • the MD? protein levels can be measured in a subject having a disease associated with high or low MD? expression and compared to the MD 7 protein levels in a subject that does not suffer from, or is not at risk for developing, a disease associated with high or low MIF expression.
  • MD 7 protein levels can be measured in a subject and compared to the MD? protein levels in a subject with a genotype that is associated with low MD? expression (e.g., a guanine at position -173 of both alleles of the MD? promoter and five CATT repeats in the -794 region of both alleles of the MD? promoter).
  • MIF protein levels can be measured in a subject and compared to the MD?
  • protein levels in a subject with a genotype that is associated with high MD? expression e.g., a cytosine at position -173 of at least one of the alleles of the MD? promoter and/or six or more CATT repeats in the —794 region of at least one of the alleles of the MD? promoter.
  • MD? protein levels can be measured by measuring the amount of light aborbance in a sample of the protein.
  • MD? protein levels can be measured using an agent that binds to MD? protein, such as an antibody, an aptamer, a small molecule, another protein or an enzyme. Binding of the agent to MD? can be detected by the use of a signal (e.g., fluorescent, radioactive, chemical, or enzymatic), or may be detected by a chemical or enzymatic reaction.
  • a signal e.g., fluorescent, radioactive, chemical, or enzymatic
  • ⁇ ther methods oi measuring protein levels may include mass spectrometry, suriace plasmon resonance or using protein chips.
  • the invention features methods of treating diseases associated with high or low MIF expression comprising administering to a subject in need thereof a therapeutically effective amount of a MIF agonist or a MIF antagonist.
  • the invention comprises administering to a subject having, or at risk of developing, a disease associated with high MIF expression a therapeutically effective amount of a MIF antagonist.
  • the invention comprises administering to a subject having, or at risk of developing, a disease associated with low MIF expression a therapeutically effective amount of a MIF agonist.
  • Diseases associated with high MIF expression include, without limitation, diseases caused by infection by a protozoan (for example malaria); anemia of chronic disease; and asthma.
  • Diseases associated with low MIF expression include, without limitation, any infection and the diseases caused by infections.
  • the infection is an acute infection.
  • the infection is a bacterial infection.
  • the infection is a viral infection.
  • the infection is a fungal infection.
  • the disease associated with low MIF expression is sepsis.
  • the disease associated with low MIF expression is an infection that leads to a respiratoiy disease (or a respiratory disease resulting from an infection), including without limitation, infections and diseases caused by gram positive and gram negative bacteria, mycobacteria (such as mycobacterium tuberculosis), fungal infections (e.g., infections of Pneumocystis, Candida, and Histoplasma) and viral infections (e.g., infections of influenza, varicella, and corona virus such as SARS-associated coronoavirus).
  • the disease associated with low MIF expression is meningitis.
  • the disease associated with low MIF expression is influenza.
  • the disease associated with low MIF expression is pneumonia (regardless of whether it is caused by a bacterial, viral or fungal infection).
  • the pneumonia is Community Acquired Pneumonia (CAP).
  • the viral infection is a retroviral infection.
  • the retroviral infection is HIV infection.
  • the disease associated with low MIF expression is infection by a virus or other pathogen that use the CCR5 receptor for infection, including, without limitation, HIV-I, HCV, Epstein-Barr Viruse, and Yersinia pestis.
  • MIF agonists and MIF antagonists can comprise, for example, drugs, metabolites, intermediates, cofactors, transition state analogs, ions, metals, toxins and natural and synthetic polymers (e.g., proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors and cell surfaces such as cell walls and cell membranes. Agents may also comprise alcohols, alkyl halides, amines, amides, esters, aldehydes, ethers and other classes of organic agents. Exemplary MIF agonists and MIF antagonists are known in the art. Further, certain MIF agonists and MIF antagonists are described infra and supra.
  • the invention provides a method of treating anemia of chronic disease comprising administering to a subject a therapeutically effective amount of a MIF antagonist.
  • the subject has or is at risk of developing anemia of chronic disease.
  • the subject has anemia of chronic disease and the subject is not responsive to erythropoietin (EPO) prior to the administration of the MIF antagonist.
  • EPO erythropoietin
  • the subject is has a genotype that is associated with high MIF expression. Ih one embodiment, the subject is Caucasian.
  • Anemia of chronic disease may result from, among other conditions, pathogenic infection (e.g., a malaria infection), cancer, autoimmune diseases or disorders, kidney diseases or disorders, organ transplant rejection and aging.
  • pathogenic infection e.g., a malaria infection
  • cancer e.g., a malaria infection
  • autoimmune diseases or disorders e.g., a malaria infection
  • kidney diseases or disorders e.g., kidney diseases or disorders
  • organ transplant rejection aging.
  • the invention provides a method of treating anemia of chronic disease regardless of its cause.
  • the invention provides a method of treating anemia of chromic disease comprising administering to a subject a therapeutically effective amount of a MIF antagonist in combination with one or more other agents that stimulate erythropoiesis.
  • erythropoiesis-stimulating agents include, without limitation: erythropoietin ("EPO"), iron, folate, vitamin B 12, blood, blood substitute, and plasma or serum that contains a composition with the activity of blood, hi a specific embodiment, the invention provides a method of treating anemia of chromic disease, comprising administering to a subject in need thereof a MIF antagonist in combination with EPO.
  • the invention provides a method of treating anemia of chronic disease, comprising administering to a subject a MIF antagonist in combination with a tumor necrosis ⁇ actor- ⁇ (IJNJh ⁇ ) antagonist or an interteron (It 1 JN) antagonist (e.g., an ibJN ⁇ antagonist) to a subject.
  • a MIF antagonist in combination with a tumor necrosis ⁇ actor- ⁇ (IJNJh ⁇ ) antagonist or an interteron (It 1 JN) antagonist (e.g., an ibJN ⁇ antagonist) to a subject.
  • TNF ⁇ and IFN ⁇ antagonists include, without limitation, anti-TNF, soluble TNF receptor, anti-IFN ⁇ , soluble IFN ⁇ receptor, p38 MAPK inhibitors, and JAK-STAT inhibitors.
  • the invention also comprises a method of treating malaria comprising administering to a subject in need thereof a MIF antagonist.
  • the subject has malaria or is at risk of developing malaria.
  • the subject is has a genotype that is associated with high MIF expression.
  • the subject is Caucasian.
  • the methods described herein may also comprise the administration of one or more other therapeutic agents.
  • the invention also comprises a method of treating an infection comprising administering to a subject a therapeutically effective amount of a MIF agonist.
  • the subject is has a genotype that is associated with low MIF expression.
  • MIF agonists include, without limitation, viral infections (including retroviral infections), bacterial infections, fungal infections, infections leading to respiratory disease, infections with HIV, pneumonia, Community Acquired Pneumonia (CAP), meningitis, and influenza.
  • a MIF agonist is used to treat pathogenic infections during acute stages of infection, including during a flare-up of the infection, during a change of therapy, when signs of resistance to therapy are displayed in the subject, or as an early intervention.
  • the invention provides a method of treating an infection that leads to a respiratory disease comprising administering to a subject a therapeutically effective amount of a MIF agonist.
  • Infections that lead or may lead to respiratory disease include, without limitation, infections by gram positive and gram negative bacteria, mycobacteria (such as mycobacterium tuberculosis), fungal infections (e.g., infections of Pneumocystis, Candida, and Histoplasma) and viral infections (e.g., infections of influenza, varicella, and corona virus such as SARS-associated coronoavirus).
  • the invention also provides a method of treating a respiratory disease resulting from an infection comprising administering to a subject a therapeutically effective amount of a MIF agonist.
  • the invention provides a method of treating pneumonia in a subject comprising administering to the subject a therapeutically effective amount of a MIF agonist.
  • Microbial infections that lead to pneumonia include, without limitation, bacterial infections (e.g., infections of gram positive bacteria, gram negative bacteria, and mycobacteria such as Mycobacterium tuberculosis), fungal infections (e.g., infections of Pneumocystis, Candida, and Histoplasma) and viral infections (e.g., infections of influenza, varicella, and corona virus such as SARS-associated coronoavirus).
  • bacterial infections e.g., infections of gram positive bacteria, gram negative bacteria, and mycobacteria such as Mycobacterium tuberculosis
  • fungal infections e.g., infections of Pneumocystis, Candida, and Histoplasma
  • viral infections e.g., infections of influenza, varicella, and corona virus such as SARS-associated coronoavirus
  • the invention provides a method of treating a retroviral infection comprising administering to a subject a therapeutically effective amount of a MIF agonist.
  • the invention provides a method of treating HIV infection comprising administering to a subject a therapeutically effective amount of a MIF agonist.
  • the invention also comprises the use of a MIF agonist as an immunoadjuvant.
  • the methods described herein may also comprise the administration of one or more other therapeutic agents, including without limitation anti-bacterial agents, anti-fungal agents and antimicrobial agents.
  • anti- viral agents include, without limitation, reverse transcriptase inhibitors such as, for example, zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir, nevirapine, delavirdine, and efavirenz; protease inhibitors such as, for example, saquinavir, ritonavir, nelfinavir, indinavir, amprenavir, and lopinavir; agents for treating herpes viruses such as, for example, acyclovir, valacyclovir, valacyclovir, famciclovir, ganciclovir, foscarnet, and cidolovir; and, agents for treating influenza such as, for example, oseltamivir, amantadine, rimatadine, and zanamivir.
  • anti-bacterial agents include, without limitation, penicillins, cephalosporins, quino
  • the invention provides a method of attenuating the expression of CCR5 mRNA or protein, comprising the use of a MIF agonist.
  • a MIF agonist for example, in one embodiment, cells expressing a CCR5 receptor are contacted with a MIF agonist wherein said contacting results in the attenuation of the expression of CCR5 mRNA or protein.
  • the invention provides a method of inhibiting the life-cycle of a virus in a subject infected with said virus or at risk of being infected with said virus, wherein the virus uses the CCR5 as a receptor, administering to the subject a MIF agonist.
  • the pathogen that uses the CCR5 for infection is HIV-I.
  • the "inhibiting the life cycle of a virus” includes, inhibiting viral replication, inhibiting viral infection, latency and oncogenesis.
  • the invention provides a method of treating HIV infection in a subject infected or at risk of being infected with HIV, comprising administering to the subject a MIF agonist.
  • the subject is has a genotype that is associated with low MIF expression.
  • a MIF agonist is administered to a subject during acute HIV infection or during a flareup.
  • the methods described herein may also comprise the administration of one or more other therapeutic agents.
  • the methods described herein comprise the administration of a MIF agonist in combination with anti-viral agents.
  • anti-viral agents include, without limitation, reverse transcriptase inhibitors such as, for example, zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir, nevirapine, delavirdine, and efavirenz; protease inhibitors such as, for example, saquinavir, ritonavir, nelfinavir, indinavir, amprenavir, and lopinavir; agents for treating herpes viruses such as, for example, acyclovir, valacyclovir, valacyclovir, famciclovir, ganciclovir, foscarnet, and cidolovir; and, agents for treating influenza such as, for example, osel
  • any agent that mimics, activates, stimulates, potentiates or increases the biological activity of MIF can be used as a MIF agonist, and any agent that inhibits, opposes, counteracts, or decreases the biological activity of MIF can be used as a MIF antagonist.
  • MIF agonists include purified or recombinant nucleic acids that encode MIF proteins or fragments thereof; purified or recombinant MIF polypeptides or fragments thereof; or other agents that mimic, activate, stimulate, potentiate or increase the biological activity of MIF.
  • MIF agonist examples include, without limitation, agents that increase MIF mRNA or protein expression; agents that enhance CD44 mRNA or protein expression; agents that enhance CD74 mRNA or protein expression; agents that increase interaction between MEF, CD74 and CD44 (e.g., bivalent antibodies that bind two out of three of MIF, CD74 and CD44, fusion proteins with CDR combinations that bind two out of three of MIF, CD74 and CD44, and other agents that are identified by any of the screening methods described herein); agents that increase interaction between CD44 and CD74 (e.g., bivalent antibodies that bind CD74 and CD44, fusion proteins with CDR combinations that bind CD74 and CD44, and other agents that are identified by any of the screening methods described herein); and agents that increase interaction between MIF and CD74 (e.g., bivalent antibodies that bind MIF and CD74, fusion proteins with CDR combinations that bind MEF and CD74, and other agents that are identified by any of the screening methods described herein).
  • the MEF agonist is recombinant MIF.
  • MIF antagonists include antibodies that bind to MB? (anti-MB? antibodies); small molecules that mimic MB? and inhibit MB? biological function (e.g., small molecules that bind CD74 and prevent MB? from binding CD74); agents that decrease or inhibit MB? mRNA or protein expression (e.g., antisense polynucleotides and RNAi); agents that decrease or inhibit CD74 mRNA or protein expression; agents that decrease or inhibit CD44 mRNA or protein expression; agents that prevent or decrease interaction between MB?, CD74 and CD44 (e.g., anti-MB? antibodies, anti-CD74 antibodies, anti-CD44 antibodies, or soluble fragments of CD74 or CD44); agents that prevent or decrease interaction between MB?
  • CD74 e.g., anti-MB? antibodies, anti-CD74 antibodies, or soluble fragments of CD74
  • agents that prevent or decrease interaction between CD74 and CD44 e.g., anti-CD74 antibodies, anti-CD44 antibodies, or soluble fragments of CD74 or CD44.
  • the MB? antagonist is COR100140 (a small molecule compound developed by Cortical Pty Ltd.), a small molecule compound developed by Avanir Pharmaceuticals, or an anti-MB? antibody.
  • the D-dopachrome tautomerase (DDT) protein, or fragments thereof is used to modulate (e.g., agonize or antagonize) the biogical activity of MEF.
  • an agonist or antagonist of DDT is used to modulate (agonize or antagonize) the activity of MIF.
  • An exemplary nucleotide sequence that encodes DDT is found in GenBank Accession No. AH006997.
  • a cell surface receptor for MIF was cloned in 2003 and identified to be the widely- expressed, Type II transmembrane protein, CD74 (Leng et al. (2003). J Exp Med 197:1467- 1476).
  • the data described herein (Example 6) demonstrates that CD44 is also required for MIF- mediated ERK- 1/2 activity.
  • the present invention provides novel agonists and antagonists of MIF that modulate the interaction between MIF, CD74 and CD44.
  • the invention also provides methods of agonizing or antagonizing the biological function of MIF, comprising the use of agents that modulate the interaction between MIF 5 CD74 and CD44.
  • Agents that may be used in the invention include, without limitation, drugs, metabolites, intermediates, cofactors, transition state analogs, ions, metals, toxins and natural and synthetic polymers (e.g., proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors and cell surfaces such as cell walls and cell membranes.
  • Agents may also comprise alcohols, alkyl halides, amines, amides, esters, aldehydes, ethers and other classes of organic agents.
  • the invention provides a method of attenuating (agonizing or antagonizing) the biological function of MIF, comprising the use of an agent that inhibits the interaction between CD44 and CD74.
  • the agent is a fragment or an extracellular fragment of CD44.
  • the agent is an agent that binds to CD44.
  • the agent is an antibody or fragment thereof that binds to CD44.
  • the agent is a small molecule, such as a small molecule mimic of chondroitin sulphate.
  • the agent is heparin.
  • the agent is a macromolecular mimic of chondroitin sulphate.
  • the invention provides a method of attenuating the biological function of MIF, comprising the use of an agent that inhibits or decreases the expression of CD44.
  • Agents that may be useful for inhibiting or decreasing the expression of CD44 include, for example, siRNAs (or other antisense polynucleotide) that target CD44 mRNA.
  • the invention provides a method of attenuating the biological function of MIF, comprising the use of an agent that inhibits or decreases the activation of a src family tyrosine kinase (e.g., p561ck).
  • Agents that may be useful for inhibiting or decreasing the activation of src family tyrosine kinases include, for example, siRNAs that target src family tyrosine kinase niKJNAs ⁇ e.g., piolcfc: nUKJNA) or small molecules such as, tor example, damnacanthal.
  • agents that may be useful for inhibiting the activation of a src family tyrosine kinase include, for example, agents that inhibit PKA phosphorylation or agents that antagonize the activity of a src tyrosine kinase family member.
  • the invention provides a method of enhancing or increasing the biological function of MIF, comprising the use of an agent that enhances the interaction between MIF, CD44 and CD74.
  • Agents that may be useful for enhancing the interaction of MIF, CD44 and CD74 include, for example, antibodies and fusion proteins that bind to CD44 and CD74 and antibodies and fusion protein that bind to MIF and CD44.
  • an agent that enhances the interaction between MIF, CD44 and CD74 is an anti-MIF and anti-CD74 bivalent antibody, an anti-CD74 and anti-CD44 bivalent antibody, or an anti-MIF and anti- CD44 bivalent antibody.
  • an agent that enhances the interaction between MIF, CD44 and CD74 is a recombinant fusion protein that comprises the complementarity determining regions (CDRs) of anti-MIF and anti-CD74, anti-CD74 and anti-CD44, or anti-MIF and anti-CD44 antibodies, or of an anti-MIF, anti-CD74 and anti-CD44 antibody.
  • CDRs complementarity determining regions
  • Antisense polynucleotides can also be used as MIF agonist or MEF antagonists.
  • the invention provides polynucleotides that comprise an antisense sequence that acts through an antisense mechanism for inhibiting expression of a MIF gene or a gene encoding a protein that affects MEF expression or MIF biological function (including, without limitation CD44 and CD74).
  • a MIF antagonist may be an antisense polynucleotide that binds to a MIF gene and decreases expression of said MEF gene.
  • a MEF antagonist may be an antisense polynucleotide that binds to a CD44 gene and decreases expression of said CD44 gene.
  • a MEF antagonist may be an antisense polynucleotide that binds to a CD74 gene and decreases expression of said CD74 gene.
  • antisense technologies have been widely utilized to regulate gene expression (Buskirk et al., Chem. Biol. 11, 1157-63 (2004); and Weiss et al., Cell MoI. Life Sd. 55, 334-58 (1999)).
  • antisense technology refers to administration or in situ generation of molecules or their derivatives which specifically hybridize (e.g., bind) under cellular conditions, with the target nucleic acid of interest (mRNA and/or genomic DNA) encoding one or more of the target proteins so as to inhibit expression of that protein, e.g., by inhibiting transcription and/or translation, such as by steric hinderance, altering splicing, or inducing cleavage or other enzymatic inactivation of the transcript.
  • binding may be by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix.
  • antisense technology refers to the range of techniques generally employed in the art, and includes any therapy that relies on specific binding to nucleic acid sequences.
  • a polynucleotide that comprises an antisense sequence of the present invention can be delivered, for example, as a component of an expression plasmid which, when transcribed in the cell, produces a nucleic acid sequence that is complementary to at least a unique portion of the target nucleic acid.
  • the polynucleotide that comprises an antisense sequence can be generated outside of the target cell, and which, when introduced into the target cell causes inhibition of expression by hybridizing with the target nucleic acid.
  • Polynucleotides of the invention may be modified so that they are resistant to endogenous nucleases, e.g. exonucleases and/or endonucleases, and are therefore stable in vivo.
  • nucleic acid molecules for use in polynucleotides of the invention are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Pat. Nos. 5,176,996; 5,264,564; and 5,256,775).
  • General approaches to constructing polynucleotides useful in antisense technology have been reviewed, for example, by van der krol et al. (1988) Biotechniques 6:958-976; and Stein et al. (1988) Cancer Res. 48:2659-2668.
  • Antisense approaches involve the design of polynucleotides (either DNA or RNA) that are complementary to a target nucleic acid that modulates MIF biological function.
  • antisense polynucleotides complementary to nucleic acids that encode MIF, a protein that regulates MIF, or a protein that is important for the biological function of MIF may modulate MIF biological function.
  • the antisense polynucleotide may bind to an mRNA transcript and prevent translation of a protein of interest.
  • Absolute complementarity although preferred, is not required, hi the case of double-stranded antisense polynucleotides, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
  • the ability to hybridize will depend on both the degree of complementarity and the length of the antisense sequence. Generally, the longer the hybridizing nucleic acid, the more base mismatches with a target nucleic acid it may contain and still form a stable duplex (or triplex, as the case may be).
  • One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • Antisense polynucleotides that are complementary to the 5' end of an rnRNA target should work most efficiently at inhibiting translation of the mRNA.
  • sequences complementary to the 3' untranslated sequences of mRNAs have recently been shown to be effective at inhibiting translation of mRNAs as well (Wagner, R. 1994. Nature 372:333).
  • antisense polynucleotides complementary to either the 5' or 3' untranslated, non-coding regions of a gene that modulates the biological function of MIF e.g., a nucleic acid that encodes MIF, a protein that regulates MIF, or a protein that is important for the biological function of MIF such as CD74 and CD44
  • a nucleic acid that encodes MIF, a protein that regulates MIF, or a protein that is important for the biological function of MIF such as CD74 and CD44 could be used in an antisense approach to inhibit translation of a protein that modulates the biological function of MIF.
  • Antisense polynucleotides complementary to the 5' untranslated region of an mRNA should include the complement of the AUG start codon.
  • Antisense polynucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could also be used in accordance with the invention.
  • antisense polynucleotides should be at least six nucleotides in length, and are preferably less that about 100 and more preferably less than about 50, 25, 17 or 10 nucleotides in length.
  • in vitro studies are first performed to quantitate the ability of the antisense polynucleotide to inhibit expression of a gene that modulates the biological function of MIF (e.g., a nucleic acid that encodes MIF, a protein that regulates MIF, or a protein that is important for the biological function of MIF such as CD74 and CD44). It is preferred that these studies utilize controls that distinguish between antisense gene inhibition and nonspecific biological effects of antisense polynucleotide. It is also preferred that these studies compare levels of the target RNA or protein with that of an internal control RNA or protein.
  • a gene that modulates the biological function of MIF e.g., a nucleic acid that encodes MIF, a protein that regulates MIF, or a protein that is important for the biological function of MIF such as CD74 and CD44. It is preferred that these studies utilize controls that distinguish between antisense gene inhibition and nonspecific biological effects of antisense polynucleotide. It is also preferred that these studies compare levels
  • results obtained using the antisense polynucleotide are compared with those obtained using a control antisense polynucleotide.
  • the control antisense polynucleotide is of approximately the same length as the test antisense polynucleotide and that the nucleotide sequence of the control antisense polynucleotide differs from the antisense sequence of interest no more than is necessary to prevent specific hybridization to the target sequence.
  • Polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • Polynucleotides of the invention can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • Polynucleotides of the invention may include other appended groups such as peptides (e.g., for targeting host cell receptors), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc Natl Acad ScL USA 86:6553-6556; Lemaitre et al., 1987, Proc Natl Acad Sci. USA 84:648-652; PCT Publication No. W088/09810, published Dec. 15, 1988) or the blood- brain barrier (see, e.g., PCT Publication No. W089/10134, published Apr. 25, 1988), hybridization-triggered cleavage agents.
  • peptides e.g., for targeting host cell receptors
  • agents facilitating transport across the cell membrane see, e.g., Letsinger et al., 1989, Proc Natl Acad ScL USA 86:6553-6556; Lemaitre et al., 1987, Proc
  • a polynucleotide of the invention may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
  • Polynucleotides of the invention may comprise at least one modified base moiety which is selected from the group including but not limited to 5- fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxytriethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thi
  • Polynucleotides of the invention may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.
  • a polynucleotide of the invention can also contain a neutral peptide-like backbone.
  • Such molecules are termed peptide nucleic acid (PNA)-oligomers and are described, e.g., in Perry- O'Keefe et al. (1996) Proc. Natl. Acad. Sci. USA 93:14670 and in Eglom et al. (1993) Nature 365:566.
  • PNA peptide nucleic acid
  • One advantage of PNA oligomers is their capability to bind to complementary DNA essentially independently from the ionic strength of the medium due to the neutral backbone of the DNA.
  • a polynucleotide of the invention comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • polynucleotides of the invention including antisense polynucleotides are -anomeric oligonucleotides.
  • An -anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual -units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641).
  • the oligonucleotide is a 2'-O-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15:6131- 6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).
  • Polynucleotides of the invention maybe synthesized by standard methods known in the art, e.g., by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
  • an automated DNA synthesizer such as are commercially available from Biosearch, Applied Biosystems, etc.
  • phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. Nucl. Acids Res. 16:3209 (1988)
  • methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., Proc. Natl. Acad. ScL USA 85:7448-7451 (1988)), etc.
  • antisense sequences complementary to the coding region of an mRNA sequence can be used, those complementary to the transcribed untranslated region and to the region comprising the initiating methionine are most preferred.
  • Antisense polynucleotides can be delivered to cells that express target genes in vivo.
  • a number of methods have been developed for delivering nucleic acids into cells; e.g., they can be injected directly into the tissue site, or modified nucleic acids, designed to target the desired cells (e.g., antisense polynucleotides linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systematically.
  • Another approach utilizes a recombinant DNA construct in which the antisense polynucleotide is placed under the control of a strong pol III or pol ⁇ promoter.
  • the use of such a construct to transfect target cells in the patient will result in the transcription of sufficient amounts of antisense polynucleotides to attenuate the activity of the targeted gene or protein.
  • a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense polynucleotide that targets a gene that modulates the biological function of MIF (e.g., a nucleic acid that encodes MIF, a protein that regulates MIF, or a protein that is important tor the biological function oi MlF such as (JD74 and CD44).
  • a gene that modulates the biological function of MIF e.g., a nucleic acid that encodes MIF, a protein that regulates MIF, or a protein that is important tor the biological function oi MlF such as (JD74 and CD44).
  • Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense polynucleotide.
  • Such vectors can be constructed by recombinant DNA technology methods standard in the art.
  • Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells.
  • a promoter may be operably linked to the sequence encoding the antisense polynucleotide. Expression of the sequence encoding the antisense polynucleotide can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive.
  • Such promoters include but are not limited to: the SV40 early promoter region (Bernoist and Chambon, Nature 290:304-310 (1981)), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell 22:787-797 (1980)), the herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sd. USA 78:1441-1445 (1981)), the regulatory sequences of the metallothionine gene (Brinster et al, Nature 296:3942 (1982)), etc.
  • plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct that can be introduced directly into the tissue site.
  • viral vectors can be used which selectively infect the desired tissue, in which case administration may be accomplished by another route (e.g., systematically).
  • RNAi constructs - siRNAs and miRNAs
  • RNAi molecules can also be used as MIF agonist or MIF antagonists. Accordingly, the present invention provides a polynucleotide comprising an RNAi sequence that acts through an RNAi or miRNA mechanism to attenuate expression of a MIF gene or a gene encoding a protein that affects MIF expression or MIF biological function. Accordingly, RNAi polynucleotides can act as MIF agonists or MIF antagonists.
  • a MIF antagonist may be an RNAi polynucleotide that binds to a MIF gene and decreases expression of said MIF gene.
  • a MIF antagonist may be an RNAi polynucleotide that binds to a CD44 gene and decreases expression of said CD44 gene.
  • a MIF antagonist may be an RNAi polynucleotide that binds to a CD74 gene and decreases expression of said CD74 gene.
  • the miRNA or siRNA sequence is between about 19 nucleotides and about 75 nucleotides in length, or preferably, between about 25 base pairs and about 35 base pairs in length.
  • the polynucleotide is a hairpin loop or stem-loop that may be processed by RNAse enzymes (e.g., Drosha and Dicer).
  • RNA interference is a phenomenon describing double-stranded (ds)RNA- dependent gene specific posttranscriptional silencing. Initial attempts to harness this phenomenon for experimental manipulation of mammalian cells were foiled by a robust and nonspecific antiviral defense mechanism activated in response to long dsRNA molecules. Gil et al. Apoptosis 2000, 5:107-114.
  • RNAs small- interfering RNAs
  • miRNAs micro RNAs
  • RNAi construct contains a nucleotide sequence that hybridizes under physiologic conditions of the cell to the nucleotide sequence of at least a portion of the niRNA transcript of a gene that modulates the biological function of MIF (e.g., a nucleic acid that encodes MIF, a protein that regulates MIF, or a protein that is important for the biological function of MIF such as CD74 and CD44).
  • MIF e.g., a nucleic acid that encodes MIF, a protein that regulates MIF, or a protein that is important for the biological function of MIF such as CD74 and CD44.
  • the double-stranded RNA need only be sufficiently similar to natural RNA that it has the ability to mediate RNAi.
  • the number of tolerated nucleotide mismatches between the target sequence and the RNAi construct sequence is no more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs. It is primarily important that the RNAi construct is able to specifically target a MIF gene, or a gene important for the biological function of MIF. Mismatches in the center of the siRNA duplex are most critical and may essentially abolish cleavage of the target RNA. In contrast, nucleotides at the 3' end of the siRNA strand that is complementary to the target RNA do not significantly contribute to specificity of the target recognition.
  • Sequence identity may be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith- Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90% sequence identity, or even 100% sequence identity, between the inhibitory RNA and the portion of the target gene is preferred.
  • the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript (e.g., 400 mM NaCl, 4OmM PIPES pH 6.4, 1 mM EDTA, 50 0 C or 70 0 C hybridization for 12-16 hours; followed by washing).
  • a portion of the target gene transcript e.g., 400 mM NaCl, 4OmM PIPES pH 6.4, 1 mM EDTA, 50 0 C or 70 0 C hybridization for 12-16 hours; followed by washing).
  • polynucleotides comprising RNAi sequences can be carried out by any of the methods for producing polynucleotides described herein.
  • polynucleotides comprising RNAi sequences can be produced by chemical synthetic methods or by recombinant nucleic acid techniques. Endogenous RNA polymerase of the treated cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vitro.
  • Polynucleotides of the invention may include modifications to either the phosphate-sugar backbone or the nucleoside, e.g., to reduce susceptibility to cellular nucleases, improve bioavailability, improve formulation characteristics, and/or change other pharmacokinetic properties.
  • the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. Modifications in RNA structure may be tailored to allow specific genetic inhibition while avoiding a general response to dsRNA.
  • bases may be modified to block the activity of adenosine deaminase.
  • Polynucleotides of the invention may be produced enzymatically or by partial/total organic synthesis, any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis.
  • RNAi constructs see, for example, Heidenreich et al. (1997) Nucleic Acids Res., 25:776-780; Wilson et al. (1994) J MoI. Recog. 7:89-98; Chen et al. (1995) Nucleic Acids Res. 23:2661-2668; Hirschbein et al. (1997) Antisense Nucleic Acid Drug Dev. 7:55-61).
  • RNAi construct can be modified with phosphorothioates, phosphoramidate, phosphodithioates, chimeric methylphosphonate-phosphodiesters, peptide nucleic acids, 5- propynyl-pyrimidine containing oligomers or sugar modifications (e.g., 2'-substituted ribonucleosides, a-configuration).
  • the double-stranded structure may be formed by a single self-complementary RNA strand or two complementary RNA strands. RNA duplex formation may be initiated either inside or outside the cell.
  • the RNA may be introduced in an amount which allows delivery of at least one copy per cell.
  • RNAi constructs are "siRNAs.” These nucleic acids are between about 19-35 nucleotides in length, and even more preferably 21-23 nucleotides in length, e.g., corresponding in length to the fragments generated by nuclease "dicing" of longer double-stranded RNAs.
  • siRNAs are understood to recruit nuclease complexes and guide the complexes to the target mRNA by pairing to the specific sequences.
  • the target mRNA is degraded by the nucleases in the protein complex or translation is inhibited
  • the 21-23 nucleotides siRNA molecules comprise a 3' hydroxyl group.
  • the subject RNAi constructs are "miRNAs.”
  • microRNAs miRNAs
  • miRNAs are small non-coding RNAs that direct post transcriptional regulation of gene expression through interaction with homologous mRNAs. miRNAs control the expression of genes by binding to complementary sites in target mRNAs from protein coding genes. miRNAs are similar to siRNAs.
  • miRNAs are processed by nucleolytic cleavage from larger double- stranded precursor molecules. These precursor molecules are often hairpin structures of about 70 nucleotides in length, with 25 or more nucleotides that are base-paired in the hairpin.
  • the RNAse Ill-like enzymes Drosha and Dicer (which may also be used in siRNA processing) cleave the miRNA precursor to produce an miRNA.
  • the processed miRNA is single-stranded and incorporates into a protein complex, termed RISC or miRNP. This RNA-protein complex targets a complementary mRNA. miRNAs inhibit translation or direct cleavage of target mRNAs.
  • miRNA and siRNA constructs can be generated by processing of longer double-stranded RNAs, for example, in the presence of the enzymes Dicer or Drosha.
  • Dicer and Drosha are RNAse Ill-like nucleases that specifically cleave dsRNA.
  • Dicer has a distinctive structure which includes a helicase domain and dual RNAse III motifs.
  • Dicer also contains a region of homology to the RDE 1/QDE2/ ARGON AUTE family, which have been genetically linked to RNAi in lower eukaryotes.
  • Dicer activation of, or overexpression of Dicer may be sufficient in many cases to permit RNA interference in otherwise non-receptive cells, such as cultured eukaryotic cells, or mammalian (non-oocytic) cells in culture or in whole organisms.
  • otherwise non-receptive cells such as cultured eukaryotic cells, or mammalian (non-oocytic) cells in culture or in whole organisms.
  • the Drosophila in vitro system is used.
  • a polynucleotide comprising an RNAi sequence or an RNAi precursor is combined with a soluble extract derived from Drosophila embryo, thereby producing a combination.
  • the combination is maintained under conditions in which the dsRNA is processed to RNA molecules of about 21 to about 23 nucleotides.
  • the miRNA and siRNA molecules can be purified using a number of techniques known to those of skill in the art. For example, gel electrophoresis can be used to purify such molecules. Alternatively, non-denaturing methods, such as non-denaturing column chromatography, can be used to purify the siRNA and miRNA molecules. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, affinity purification with antibody can be used to purify siRNAs and miRNAs.
  • gel electrophoresis can be used to purify such molecules.
  • non-denaturing methods such as non-denaturing column chromatography
  • chromatography e.g., size exclusion chromatography
  • glycerol gradient centrifugation glycerol gradient centrifugation
  • affinity purification with antibody can be used to purify siRNAs and miRNAs.
  • At least one strand of the siRNA sequence of an effector domain has a 3' overhang from about 1 to about 6 nucleotides in length, or from 2 to 4 nucleotides in length, hi other embodiments, the 3' overhangs are 1-3 nucleotides in length. In certain embodiments, one strand has a 3' overhang and the other strand is either blunt-ended or also has an overhang. The length of the overhangs may be the same or different for each strand, hi order to further enhance the stability of the siRNA sequence, the 3' overhangs can be stabilized against degradation. In one embodiment, the RNA is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides.
  • substitution of pyrimidine nucleotides by modified analogues e.g., substitution of uridine nucleotide 3' overhangs by 2'- deoxythyinidine is tolerated and does not affect the efficiency of RNAi.
  • the absence of a 2' hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium and may be beneficial in vivo.
  • a polynucleotide of the invention that comprises an RNAi sequence or an RNAi precursor is in the form of a hairpin structure (named as hairpin RNA).
  • the hairpin RNAs can be synthesized exogenously or can be formed by transcribing from RNA polymerase III promoters in vivo.
  • hairpin RNAs for gene silencing in mammalian cells are described in, for example, Paddison et al., Genes Dev., 2002, 16:948-58; McCaffrey et al., Nature, 2002, 418:38-9; McManus et al., RNA 2002, 8:842-50; Yu et al., Proc Natl Acad Sci USA, 2002, 99:6047-52).
  • hairpin RNAs are engineered in cells or in an animal to ensure continuous and stable suppression of a desired gene. It is known in the art that miRNAs and siRNAs can be produced by processing a hairpin RNA in the cell.
  • a plasmid is used to deliver the double-stranded RNA, e.g., as a transcriptional product. After the coding sequence is transcribed, the complementary RNA transcripts base-pair to form the double-stranded RNA.
  • Aptamers can also be used as MIF agonist or MIF antagonists.
  • the present invention provides therapeutic aptamers that specifically bind to a MIF polypeptide or a polypeptide that affects MIF expression or MIF biological function, thereby modulating (e.g., agonizing or antagonizing) activity of MIF.
  • a MIF agonist may be an aptamer that binds to a MIF polypeptide and activates, stimulates or potentiates the activity of said MIF polypeptide.
  • a MIF agonist may be an aptamer that binds to a CD44 polypeptide and activates, stimulates or potentiates the activity of said CD44 polypeptide.
  • a MIF agonist may be an aptamer that binds to a CD74 polypeptide and activates, stimulates or potentiates the activity of said CD74 polypeptide.
  • a MIF antagonist may be an aptamer that binds to a MIF polypeptide and attenuates, inhibits, opposes, counteracts, or decreases the activity of said MIF polypeptide.
  • a MIF antagonist may be an aptamer that binds to a CD44 polypeptide and attenuates, inhibits, opposes, counteracts, or decreases the activity of said CD44 polypeptide.
  • a MD? agonist may be an aptamer that binds to a CD74 polypeptide and attenuates, inhibits, opposes, counteracts, or decreases the activity of said CD74 polypeptide.
  • An “aptamer” may be a nucleic acid molecule, such as RNA or DNA that is capable of binding to a specific molecule with high affinity and specificity (Ellington et al., Nature 346, 818-22 (1990); and Tuerk et al., Science 249, 505-10 (1990)). An aptamer will most typically have been obtained by in vitro selection for binding of a target molecule.
  • an aptamer that specifically binds to polypeptide important for the biological function of MIF can be obtained by in vitro selection from a pool of polynucleotides for binding to a polypeptide important for the biological function of MIF (e.g., MIF, CD74 or CD44).
  • a polypeptide important for the biological function of MIF e.g., MIF, CD74 or CD44
  • Aptamers have specific binding regions which are capable of forming complexes with an intended target molecule in an environment wherein other substances in the same environment are not complexed to the nucleic acid.
  • the specificity of the binding is defined in terms of the comparative dissociation constants (Kd) of the aptamer for its ligand (e.g., a MIF polypeptide, or a polypeptide important for the biological function of MIF such as CD74 or CD44) as compared to the dissociation constant of the aptamer for other materials in the environment or unrelated molecules in general.
  • a ligand e.g., a MIF, CD74 or CD44 polypeptide
  • the Kd for the aptamer with respect to its ligand will be at least about 10-fold less than the Kd for the aptamer with unrelated material or accompanying material in the environment.
  • the Kd will be at least about 50-fold less, more preferably at least about 100-fold less, and most preferably at least about 200-fold less.
  • An aptamer will typically be between about 10 and about 300 nucleotides in length. More commonly, an aptamer will be between about 30 and about 100 nucleotides in length.
  • aptamers specific for a target of interest are known in the art.
  • organic molecules, nucleotides, amino acids, polypeptides, target features on cell surfaces, ions, metals, salts, saccharides have all been shown to be suitable for isolating aptamers that can specifically bind to the respective ligand.
  • organic dyes such as Hoechst 33258 have been successfully used as target ligands for in vitro aptamer selections (Werstuck and Green, Science 282:296-298 (1998)).
  • Other small organic molecules like dopamine, theophylline, sulforhodamine B, and cellobiose have also been used as ligands in the isolation of aptamers.
  • RNA aptamers of the invention can be comprised entirely of RNA. In other embodiments of the invention, however, the aptamer can instead be comprised entirely of DNA, or partially of DNA, or partially of other nucleotide analogs.
  • RNA aptamers are preferred. Such RNA aptamers are preferably introduced into a cell as DNA that is transcribed into the RNA aptamer. Alternatively, an RNA aptamer itself can be introduced into a cell.
  • Aptamers are typically developed to bind particular ligands by employing known in vivo or in vitro (most typically, in vitro) selection techniques known as SELEX (Ellington et al., Nature 346, 818-22 (1990); and Tuerk et al., Science 249, 505-10 (1990)). Methods of making aptamers are also described in, for example, U.S. Pat. No. 5,582,981, PCT Publication No. WO 00/20040, U.S. Pat. No. 5,270,163, Lorsch and Szostak, Biochemistry, 33:973 (1994), Mannironi et al., Biochemistry 36:9726 (1997), Blind, Proc. Natl Acad.
  • in vitro selection techniques for identifying aptamers involve first preparing a large pool of DNA molecules of the desired length that contain at least some region that is randomized or mutagenized.
  • a common oligonucleotide pool for aptamer selection might contain a region of 20-100 randomized nucleotides flanked on both ends by an about 15-25 nucleotide long region of defined sequence useful for the binding of PCR primers.
  • the oligonucleotide pool is amplified using standard PCR techniques, although any means that will allow faithful, efficient amplification of selected nucleic acid sequences can be employed.
  • the DNA pool is then in vitro transcribed to produce RNA transcripts.
  • RNA transcripts may then be subjected to affinity chromatography, although any protocol which will allow selection of nucleic acids based on their ability to bind specifically to another molecule (e.g., a protein or any target molecule) may be used, m the case of affinity chromatography, the transcripts are most typically passed through a column or contacted with magnetic beads or the like on which the target ligand has been immobilized. RNA molecules in the pool which bind to the ligand are retained on the column or bead, while nonbinding sequences are washed away. The RNA molecules which bind the ligand are then reverse transcribed and amplified again by PCR (usually after elution). The selected pool sequences are then put through another round of the same type of selection.
  • affinity chromatography any protocol which will allow selection of nucleic acids based on their ability to bind specifically to another molecule (e.g., a protein or any target molecule) may be used, m the case of affinity chromatography, the transcripts are most
  • the pool sequences are put through a total of about three to ten iterative rounds of the selection procedure.
  • the cDNA is then amplified, cloned, and sequenced using 1 standard procedures to identify the sequence of the RNA molecules which are capable of acting as aptamers for the target ligand.
  • the aptamer may be further optimized by performing additional rounds of selection starting from a pool of oligonucleotides comprising the mutagenized aptamer sequence.
  • the aptamer is preferably selected for ligand binding in the presence of salt concentrations and temperatures which mimic normal physiological conditions. The unique nature ot the m vitro selection process allows for the isolation of a suitable aptamer that binds a desired ligand despite a complete dearth of prior knowledge as to what type of structure might bind the desired ligand.
  • the association constant for the aptamer and associated ligand is preferably such that the ligand functions to bind to the aptamer and have the desired effect at the concentration of ligand obtained upon administration of the ligand.
  • the association constant should be such that binding occurs well below the concentration of ligand that can be achieved in the serum or other tissue.
  • the required ligand concentration for in vivo use is also below that which could have undesired effects on the organism.
  • the present invention also provides small molecules and antibodies that specifically bind to a polypeptide important for the biological function of MIF (e.g., MIF, CD74 or CD44), thereby modulating (agonizing or antagonizing) the biological function of MIF.
  • small molecules include, without limitation, drugs, metabolites, intermediates, cofactors, transition state analogs, ions, metals, toxins and natural and synthetic polymers (e.g., proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors and cell surfaces such as cell walls and cell membranes).
  • Antibodies or fragments thereof specifically reactive with a polypeptide that affects the expression or biological function of MIF may be used as MIF agonists or MIF antagonists.
  • Antibodies or fragments thereof directed, for example, to MIF, CD44, CD74, and/or combinations thereof, may be agonists or antagonists of the expression or biological function of MIF.
  • Antibodies or fragments thereof can also be used to detect MIF or a protein important for the biological function of MIF (e.g., CD74 or CD44).
  • an antibody or fragment thereof that is specifically reactive with a MIF polypeptide may be used to detect the presence of a MIF polypeptide.
  • an antibody or fragment thereof that is specifically reactive with a CD74 polypeptide may be used to detect the presence of a CD74 polypeptide.
  • an antibody or fragment thereof that is specifically reactive with a CD44 polypeptide may be used to detect the presence of a CD44 polypeptide.
  • an antibody or a fragment thereof that is specifically reactive with a MIF polypeptide may be used as a MIF antagonist to inhibit the activity of a MIF polypeptide.
  • an antibody or fragment thereof that is specifically reactive with CD44 may be used as a MIF antagonist to inhibit the biological function of MIF.
  • an antibody or fragment thereof that is specifically reactive with CD74 may be used as a MIF antagonist to inhibit the biological function of MIF.
  • an antibody or fragment thereof that is specifically reactive with a MIF polypeptide may be used as a MIF agonist to increase or activate the activity or a MIF polypeptide.
  • a MIF agonist is an antibody, such as a bivalent antibody or a fragment thereof, that is able to bind MIF.
  • a MIF agonist is be an antibody, such as a bivalent antibody or a fragment thereof, that is able to bind MIF and CD44.
  • a MIF agonist is be an antibody, such as a bivalent antibody or a fragment thereof, that is able to CD44 and CD74.
  • anti-protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (see, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)).
  • a mammal such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the MIF polypeptide, an antigenic fragment which is capable of eliciting an antibody response, or a fusion protein.
  • Such mammals can also be immunized with an immunogenic form of a polypeptide that affects the expression or biological function of MIF.
  • Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art.
  • An immunogenic portion of a MIF polypeptide or a polypeptide that affects the expression or biological function of MIF can be administered in the presence of adjuvant.
  • the progress of immunization can be monitored by detection of antibody titers in plasma or serum.
  • Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies.
  • antibody-producing cells can be harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells.
  • Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with a MIF polypeptide or a polypeptide that affects the expression or biological function of MIF.
  • Monoclonal antibodies can be isolated from a culture comprising such hybridoma cells.
  • antibody as used herein is intended to include fragments thereof which are also specifically reactive with a MIF polypeptide or a polypeptide that affects the expression or biological function of MIF.
  • Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab)2 fragments can be generated by treating antibody with pepsin. The resulting fragments thereof.
  • F(ab)2 fragment can be treated to reduce disulfide bridges to produce Fab fragments.
  • Antigen- binding portions may also be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies.
  • Antigen-binding portions include, inter alia, Fab, Fab 1 , F(ab')2, Fv, dAb, and complementarity determining region (CDR) fragments, single-chain antibodies (scFv), single domain antibodies, bispecific antibodies, chimeric antibodies, humanized antibodies, diabodies and polypeptides that contain at least a portion of an immunoglobulin that is sufficient to confer specific antigen binding to the polypeptide.
  • the antibody further comprises a label attached thereto and able to be detected (e.g., the label can be a radioisotope, fluorescent compound, enzyme or enzyme co- factor).
  • an antibody of the invention is a monoclonal antibody
  • the invention makes available methods for generating novel antibodies that bind specifically to MIF polypeptides or to polypeptides that affect the expression or biological function of MIF.
  • a method for generating a monoclonal antibody that binds specifically to a MIF polypeptide, or to a polypeptide that affects the expression or biological function of MIF may comprise administering to a mouse an amount of an immunogenic composition comprising the MIF polypeptide or the polypeptide that affects the expression or biological function of MIF, effective to stimulate a detectable immune response, obtaining antibody-producing cells (e.g., cells from the spleen) from the mouse and fusing the antibody-producing cells with myeloma cells to obtain antibody-producing hybridomas, and testing the antibody-producing hybridomas to identify a hybridoma that produces a monocolonal antibody that binds specifically to the MIF polypeptide or the polypeptide that affect
  • antibody-producing cells e.g.
  • a hybridoma can be propagated in a cell culture, optionally in culture conditions where the hybridoma-derived cells produce the monoclonal antibody that binds specifically to the MIF polypeptide or the polypeptide that affects the expression or biological function of MIF.
  • the monoclonal antibody may be purified from the cell culture.
  • the term "specifically reactive with” as used in reference to an antibody is intended to mean, as is generally understood in the art, that the antibody is sufficiently selective between the antigen of interest (e.g., a MIF polypeptide or a polypeptide that affects the expression or biological function of MIF) and other antigens that are not of interest that the antibody is useful for, at minimum, detecting the presence of the antigen of interest in a particular type of biological sample.
  • the antibody is sufficiently selective between the antigen of interest (e.g., a MIF polypeptide or a polypeptide that affects the expression or biological function of MIF) and other antigens that are not of interest that the antibody is useful for, at minimum, detecting the presence of the antigen of interest in a particular type of biological sample.
  • the antibody In certain methods employing the antibody, such as therapeutic applications, a higher degree of specificity in binding may be desirable.
  • Monoclonal antibodies generally have a greater tendency (as compared to polyclonal antibodies) to discriminate effectively between the
  • antigen interaction is the affinity of the antibody for the antigen.
  • affinity a dissociation constant
  • the techniques used to screen antibodies in order to identify a desirable antibody may influence the properties of the antibody obtained. For example, if an antibody is to be used for binding an antigen in solution, it may be desirable to test solution binding.
  • a variety of different techniques are available for testing interaction between antibodies and antigens to identify particularly desirable antibodies. Such techniques include ELISAs, surface plasmon resonance binding assays (e.g., the Biacore binding assay, Bia-core AB, Uppsala, Sweden), sandwich assays (e.g., the paramagnetic bead system of IGEN International, Inc., Gaithersburg, Maryland), western blots, immunoprecipitation assays, and immunohistochemistry.
  • a composition comprising a MIF agonist or antagonist is administered in an amount and dose that is sufficient to delay, slow, or prevent the onset of a disease or condition associated with high or low MIF expression, or related symptoms, or to reverse a disease or condition associated with high or low MIF expression.
  • an effective amount of a composition for treating a subject who has been diagnosed or predicted to be at risk for developing a disease or condition associated with high or low MIF expression is a dose or amount that is in sufficient quantities to treat a subject or to treat the disorder itself.
  • MIF agonists and antagonists may be formulated with a pharmaceutically acceptable carrier.
  • a MIF agonist or antagonist can be administered alone or as a component of a pharmaceutical formulation (therapeutic composition).
  • the MEF agonist or antagonist may be formulated for administration in any convenient way for use in human medicine.
  • the therapeutic methods of the invention include administering the composition topically, systemically, or locally.
  • therapeutic compositions of the invention may be formulated for administration by, for example, injection (e.g., intravenously, subcutaneously, or intramuscularly), inhalation or insufflation (either through the mouth or the nose) or oral, buccal, sublingual, transdermal, nasal, or parenteral administration.
  • the compositions described herein may be formulated as part of an implant or device.
  • the therapeutic composition for use in this invention is in a pyrogen-free, physiologically acceptable form.
  • the composition may be encapsulated or injected in a viscous form for delivery to the site where the target cells are present.
  • therapeutically useful agents may optionally be included in any of the compositions described herein.
  • therapeutically useful agents may, alternatively or additionally, be administered simultaneously or sequentially with a MIF agonist or antagonist according to the methods of the invention.
  • compositions comprising a MIF agonist or antagonist can be administered orally, e.g., in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of an agent as an active ingredient.
  • An agent may also be administered as a bolus, electuary or paste.
  • one or more compositions comprising a MIF agonist or antagonist may be mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose, and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7)
  • compositions may also comprise buffering agents.
  • Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
  • Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs.
  • the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3- butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
  • the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents,
  • Suspensions in addition to the active compounds, may contain suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • Certain compositions disclosed herein may be administered topically, either to skin or to mucosal membranes.
  • the topical formulations may further include one or more of the wide variety of agents known to be effective as skin or stratum corneum penetration enhancers.
  • Examples of these are 2-pyrrolidone, N-methyl-2-pyrrolidone, dimethylacetamide, dimethylformamide, propylene glycol, methyl or isopropyl alcohol, dimethyl sulfoxide, and azone. Additional agents may further be included to make the formulation cosmetically acceptable. Examples of these are fats, waxes, oils, dyes, fragrances, preservatives, stabilizers, and surface active agents. Keratolytic agents such as those known in the art may also be included. Examples are salicylic acid and sulfur.
  • Dosage forms for the topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants.
  • the active compound may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants that may be required.
  • the ointments, pastes, creams and gels may contain, in addition to a MIF agonist or antagonist, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
  • Powders and sprays can contain, in addition to a MIF agonist or antagonist, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, and polyamide powder, or mixtures of these substances.
  • Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
  • compositions suitable for parenteral administration may comprise a MIF agonist or antagonist in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • a composition comprising a MIF agonist or antagonist may also contain adjuvants, such as preservatives, wetting agents, emulsifying agents and dispersing agents.
  • microorganisms Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
  • agents which delay absorption such as aluminum monostearate and gelatin.
  • the present invention also provides gene therapy for the in vivo production of a MIF agonist or antagonist.
  • Such therapy would achieve its therapeutic effect by introduction of a polynucleotide sequence that encodes a MIF agonist or antagonist into cells or tissues that are deficient for normal MIF function.
  • Delivery of MIF agonist or antagonist polynucleotide sequences can be achieved using a recombinant expression vector such as a chimeric virus or a colloidal dispersion system.
  • Targeted liposomes may also be used for the therapeutic delivery of CFH polynucleotide sequences.
  • retroviral vectors which can be utilized for gene therapy as taught herein include adenovirus, herpes virus, vaccinia, or an RNA virus such as a retrovirus.
  • a retroviral vector may be a derivative of a murine or avian retrovirus.
  • retroviral vectors in which a single foreign gene can be inserted include, but are not limited to: Moloney murine leukemia virus (MoMuLV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), and Rous Sarcoma Virus (RSV).
  • MoMuLV Moloney murine leukemia virus
  • HaMuSV Harvey murine sarcoma virus
  • MuMTV murine mammary tumor virus
  • RSV Rous Sarcoma Virus
  • a number of additional retroviral vectors can incorporate multiple genes.
  • Retroviral vectors can transfer or incorporate a gene for a selectable marker so that transduced cells can be identified and generated.
  • Retroviral vectors can be made target-specific by attaching, for example, a sugar, a glycolipid, or a protein. Preferred targeting is accomplished by using an antibody.
  • specific polynucleotide sequences can be inserted into the retroviral genome or attached to a viral envelope to allow target specific delivery of the retroviral vector containing the polynucleotide that encodes the MIF agonist or antagonist.
  • tissue culture cells can be directly transfected with plasmids encoding the retroviral structural genes gag, pol and env, by conventional calcium phosphate transfection. These cells are then transfected with the vector plasmid containing the genes of interest. The resulting cells release the retroviral vector into the culture medium.
  • Another targeted delivery system for polynucleotides that encode MIF agonists or antagonists is a colloidal dispersion system. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The preferred colloidal system of this invention is a liposome.
  • Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (see, e.g., Fraley, et al., Trends Biochem. ScL 6:77, 1981). Methods for efficient gene transfer using a liposome vehicle, are known in the art, see e.g., Mannino, et al., Biotechniques, 6:682, 1988.
  • the composition of the liposome is usually a combination of phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used.
  • the physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.
  • lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides.
  • Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine, and distearoylphosphatidylcholine.
  • the targeting of liposomes is also possible based on, for example, organ-specificity, cell-specificity, and organelle-specificity and is known in the art.
  • a composition comprising a MIF agonist or antagonist can consist essentially of the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.
  • methods of introducing the viral packaging cells may be provided by, for example, rechargeable or biodegradable devices.
  • Various slow release polymeric devices have been developed and tested in vivo in recent years for the controlled delivery of drugs, including proteinacious biopharmaceuticals, and can be adapted for release of viral particles through the manipulation of the polymer composition and form.
  • biocompatible polymers including hydrogels
  • biodegradable and non- degradable polymers can be used to form an implant for the sustained release of the viral particles by cells implanted at a particular target site.
  • Such embodiments of the present invention can be used for the delivery of an exogenously purified virus, which has been incorporated in the polymeric device, or tor the delivery ot viral particles produced Dy a ceil encapsulated in the polymeric device.
  • the amount of a MIF agonist or antagonist administered to effectively treat a disease or condition associated with high or low MIF expression is an amount that significantly decreases or inhibits any symptom associated with the disease or condition. It is understood that the dosage regimen will be determined for an individual, taking into consideration, for example, various factors that modify the action of a MIF agonist or antagonist, the severity or stage of the disease or condition associated with high or low MIF expression, route of administration, and characteristics unique to the individual, such as age, weight, and size. In one embodiment, the dosage can range from about 1.0 ng/kg to about 100 mg/kg body weight of the subject.
  • a composition comprising a MIF agonist or antagonist for topical, systemic or local administration can be administered in a range from about 0.001% to about 3.0% (weight per volume or weight per weight), or from about 0.001% to about 0.01%, from about 0.01% to about 0.025%, from about 0.025% to about 0.05%, from about 0.05% to about 0.1%, from about 0.1% to about 0.25%, from about 0.25% to about 1.0%, from about 1.0% to about 2.0%, or from about 2.0% to greater than 3.0%, i.e., about 3.0% to about 10.0% or greater.
  • a composition comprising a MIF agonist or antagonist is administered in a range from about 0.25% to about 3.0%.
  • a composition comprising a MIF agonist or antagonist is administered in a range of from about 1 ng/ml to about 1 g/ml, or from about 1 ng/ml to about 10 ng/ml, from about 10 ng/ml to about 100 ng/ml, from about 100 ng/ml to about 1 mg/ml, from about 1 mg/ml to about 10 mg/ml, from about 10 mg/ml to about 100 mg/ml or from about 100 mg/ml to about 1 g/ml.
  • a composition comprising a MIF agonist or antagonist is administered in a range of from about 40 ng/ml to about 100 ng/ml.
  • the volume of composition administered according to the methods described herein is also dependent on factors such as the mode of administration, quantity of the MIF agonist or antagonist, age and weight of the patient, and type and severity of the disease being treated.
  • the liquid volume comprising a composition comprising a MIF agonist or antagonist may be from about 0.5 milliliters to about 2.0 milliliters, from about 2.0 milliliters to about 5.0 milliliters, from about 5.0 milliliters to about 10.0 milliliters, or from about 10.0 milliliters to about 50.0 milliliters.
  • the liquid volume comprising a composition comprising a MIF agonist or antagonist may be from about 5.0 microliters to about 50 microliters, from about 50 microliters to about 250 microliters, from about 250 microliters to about 1 milliliter, from about 1 milliliter to about 5 milliliters, from about 5 milliliters to about 25 milliliters, from about 25 milliliters to about 100 milliliters, or from about 100 milliliters to about 1 liter.
  • the dose can be delivered continuously, or at periodic intervals (e.g., on one or more separate occasions). Desired time intervals of multiple doses of a particular composition can be determined without undue experimentation by one skilled in the art.
  • the compound may be delivered hourly, daily, weekly, monthly, yearly (e.g. in a time release form) or as a one time delivery.
  • such a preparation can be administered 1 to 6 times per day for a period of 1-4 weeks, 1-3 months, 3-6 months, 6-12 months, 1-2 years, or more, up to the lifetime of the patient.
  • MIF agonist or antagonist compositions can be delivered one or more times periodically throughout the life of a patient.
  • a MIF agonist or antagonist composition can be delivered once per year, once every 6-12 months, once every 3-6 months, once every 1-3 months, once every 1-4 weeks, one or more times per day. Alternatively, more frequent administration may be desirable for certain conditions or disorders. If administered by an implant or device, MIF agonist or antagonist compositions can be administered one time, or one or more times periodically throughout the lifetime of the patient as necessary.
  • Samples used in the methods described herein may comprise cells from the eye, ear, nose, throat, teeth, tongue, epidermis, epithelium, blood, tears, saliva, mucus, urinary tract, urine, muscle, cartilage, skin, or any other tissue or bodily fluid from which sufficient DNA, RNA or protein can be obtained, m certain embodiments, samples used in the methods described herein comprise cells from a tracheal aspirate or nasal washing.
  • the sample should be sufficiently processed to render the DNA, RNA or protein that is present in the sample available for assaying in the methods described herein.
  • samples may be processed such that DNA from the sample is available for amplification or for hybridization to another polynucleotide.
  • the processed samples may be crude lysates where available DNA, RNA or protein is not purified from other cellular material.
  • samples may be processed to isolate the available DNA, RNA or protein from one or more contaminants that are present in its natural source. Samples may be processed by any means known in the art that renders DNA, RNA or protein available for assaying in the methods described herein.
  • Methods for processing samples may include, without limitation, mechanical, chemical, or molecular means of lysing and/or purifying cells and cell lysates.
  • Processing methods may include, for example, ion-exchange chromatography, size exclusion chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for particular epitopes of the polypeptide
  • the present invention relates to the use of MIF, CD44 and/or CD74 to identify agents that are agonists or antagonists of the biological function of MIF.
  • Agents identified through this screening can be tested in cells and tissues to assess their ability to modulate the biological activity of MIF in vivo or in vitro.
  • these agents can further be tested in animal models to assess their ability to modulate the biological activity of MIF in vivo.
  • the compounds identified in these methods can be used to treat diseases associated with high or low MIF expression as described herein.
  • CD44 functionally interacts with MIF (Meyer-Siegler et al, BMC Cancer, 4:34 (2004) and Meyer-Siegler et al, J Urol, 173:615-620 (2005)).
  • the invention provides a method of identifying potential agonists or antagonists of the biological function of MIF, comprising: (a) contacting a CD44 polypeptide, or a portion thereof, with a CD74 polypeptide, or portion thereof, in the presence and absence of a candidate agent; and (b) comparing the interaction of the CD44 and CD74 polypeptides in the presence of said candidate agent with the interaction in the absence of said candidate agent.
  • a candidate agent that enhances the interaction of the CD44 polypeptide and the CD74 polypeptide is thus identified as a potential agonist of MIF biological function, and a candidate agent that inhibits the interaction of the CD44 polypeptide and the CD74 polypeptide is identified as a potential antagonist of MIF biological function.
  • the invention provides a method of identifying potential agonists or antagonists of the biological function of MIF, comprising: (a) contacting a CD44 polypeptide or a portion thereof, with a MIF polypeptide, or a portion thereof, and a CD74 polypeptide or a portion thereof, in the presence and absence of a candidate agent; and, (b) comparing the interaction of the CD44 polypeptide or portion thereof and the MIF and CD74 polypeptides or portions thereof in the presence of said candidate agent with the interaction in the absence of said candidate agent.
  • a candidate agent that enhances the interaction of the CD44 polypeptide and the MIF and CD74 polypeptides is thus identified as a potential agonist of MIF biological function, and a candidate agent that inhibits the interaction of the the CD44 polypeptide and the MIF and CD74 polypeptides is identified as a potential antagonist of MIF biological function.
  • the interaction between the agent and the subject polypeptide may be covalent or non-covalent.
  • the agent may be covalent or non-covalent.
  • such interaction can be identified at the protein level using in vitro biochemical methods, including photo-crosslmking, radiolabeled ligand binding, and affinity chromatography (Jakoby WB et al., 1974, Methods in Enzymology 46: 1).
  • the agents may be screened in a mechanism based assay, such as an assay to detect agents which bind to the subject polypeptide (e.g., CD44, CD74, MEF, and/or MIF/CD74). This may include a solid phase or fluid phase binding event.
  • the gene or genes encoding one or more of the subject polypeptides can be transfected with a reporter system (e.g., ⁇ -galactosidase, luciferase, or green fluorescent protein) into a cell and screened against the library preferably by a high throughput screening or with individual members of the library.
  • a reporter system e.g., ⁇ -galactosidase, luciferase, or green fluorescent protein
  • Other mechanism based binding assays may be used, for example, binding assays which detect changes in free energy. Binding assays can be performed with the target fixed to a well, bead or chip or captured by an immobilized antibody or resolved by capillary electrophoresis. The bound agents may be detected usually using colorimetric or fluorescence or surface plasmon resonance.
  • test agents of the invention may be created by any combinatorial chemical method.
  • the subject agents may be naturally occurring biomolecules synthesized in vivo or in vitro.
  • Agents to be tested for their ability to act as modulators of the biological function of MIF can be produced, for example, by bacteria, yeast, plants or other organisms (e.g., natural products), produced chemically (e.g., small molecules, including peptidomimetics), or produced recombinantly.
  • Test agents contemplated by the present invention include non-peptidyl organic molecules, peptides, polypeptides, polysaccharides, peptidomimetics, sugars, hormones, and nucleic acid molecules.
  • the candidate agents of the invention can be provided as single, discrete entities, or provided in libraries of greater complexity, such as made by combinatorial chemistry.
  • the agents can comprise, for example, drugs, metabolites, intermediates, cofactors, transition state analogs, ions, metals, toxins and natural and synthetic polymers (e.g., proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors and cell surfaces such as cell walls and cell membranes. Agents may also comprise alcohols, alkyl halides, amines, amides, esters, aldehydes, ethers and other classes of organic agents. Presentation of candidate agents to the test system can be in either an isolated form or as mixtures of agents, especially in initial screening steps.
  • the agents maybe derivatized with other agents and have derivatizing groups that facilitate isolation of the agents.
  • derivatizing groups include biotin, fluorescein, digoxygenin, green fluorescent protein, isotopes, polyhistidine, magnetic beads, glutathione S transferase (GST), photoactivatible crosslinkers or any combinations thereof.
  • kits for therapeutic purposes or kits for: (i) diagnosing a patient for a disease associated with high or low MIF expression, (ii) identifying patients at risk of developing a disease associated with high or low MIF expression, (iii) predicting the severity of a disease associated with high or low MIF expression, (iv) predicting the susceptibility of a patient to a disease associated with high or low MIF expression, (v) selecting a patient for treatment with a MIF agonist or antagonist, and (vi) genotyping a patient for the presence of a polymorphism associated with high or low MIF expression.
  • a kit comprises at least one container means having disposed therein reagents for genotyping a subject for the presence of a polymorphism associated with high or low MIF expression.
  • genotyping reagents may include polynucleotide probes or primers, or solid substrates such as chips or microarrays that are capable of detecting whether a polymorphism associated with high or low MD? expression is present.
  • polynucleotides may be any of a variety of natural and/or synthetic compositions, or chimeric mixtures thereof, such as synthetic polynucleotides, restriction fragments, cDNAs, synthetic peptide nucleic acids (PNAs), and the like.
  • the assay kit and method may also employ labeled polynucleotides to allow ease of identification in the assays.
  • labels which may be employed include radiolabels, enzymes, fluorescent compounds, streptavidin, avidin, biotin, magnetic moieties, metal binding moieties, antigen, enzymatic or antibody moieties, and the like.
  • the kit may optionallycomprise a label and/or instructions for use.
  • the kit may, optionally, also include DNA sampling means.
  • DNA sampling means are well known to one of skill in the art and can include, but not be limited to substrates, such as filter papers, the AmpliCardTM (University of Sheffield, Sheffield, England SlO 2JF; Tarlow, J W, et al., J. of Invest. Dematol.
  • DNA purification reagents such as NucleonTM kits, lysis buffers, proteinase solutions and the like; PCR reagents, such as 1OX reaction buffers, thermostable polymerase, dNTPs, and the like; and allele detection means such as the Hinfl restriction enzyme, allele specific oligonucleotides, degenerate oligonucleotide primers for nested PCR from dried blood.
  • kit reagents may include enzymes, buffers, small molecules, nucleotides or their analogs, labels (e.g., fluorescent, radioactive, enzymatic or chemical) and/or co-factors as required for the genotyping assay.
  • kits comprises at least one container means having disposed therein a premeasured dose of one or more MIF antagonists and/or MIF agonists.
  • a kit may optionally comprise devices for contacting cells with the MIF antagonists and/or MIF agonists and a label and/or instructions for use.
  • Devices include syringes, dispensers, stents and other devices for introducing a MIF antagonist and/or MIF agonist into a subject (e.g., the blood vessel of a subject) or applying it to the skin of a subject.
  • Kits may also include packaging material such as, but not limited to, ice, dry ice, styrofoam, foam, plastic, cellophane, shrink wrap, bubble wrap, paper, cardboard, starch peanuts, twist ties, metal clips, metal cans, drierite, glass, and rubber (see products available from www.papermart.com. for examples of packaging material).
  • packaging material such as, but not limited to, ice, dry ice, styrofoam, foam, plastic, cellophane, shrink wrap, bubble wrap, paper, cardboard, starch peanuts, twist ties, metal clips, metal cans, drierite, glass, and rubber (see products available from www.papermart.com. for examples of packaging material).
  • the effect of MIF on murine erythroid precursor development was examined using defined, erythropoietin-dependent colony assays, including both the early, burst forming unit- erythroid (BFU-E), and the late, colony forming unit-erythroid (CFU-E).
  • BFU-E burst forming unit- erythroid
  • CFU-E colony forming unit-erythroid
  • the two inflammatory cytokines, TNF ⁇ and IFN ⁇ were also studied. TNF ⁇ and IFN ⁇ are produced as a consequence of macrophage and T cell activation (McDevitt et al. 2004. Curr Hematol Rep 3:97-106).
  • the appearance of BFU-E and CFU-E were quantified after culture with these cytokines, applied either alone or in combination.
  • Erythroid progenitors such as the Friend murine erythroleukemia (MEL) (Terada et al. 1977. Proc Natl Acad Sd USA 74:248-252) or the human K562 (Witt et al. 2000. Blood 95:2391-2396) cell line undergo cytodifferentiation in vitro, leading to the initiation of hemoglobin synthesis and to a more mature, erythroid phenotype. These model cell systems were examined because they replicate certain features of erythroid differentiation, and they are more amenable to biochemical analysis than methylcellulose cultures of primary progenitor cells.
  • MEL Friend murine erythroleukemia
  • K562 human K562
  • MEL cells were induced to undergo cytodifferentiation in the presence of recombinant MIF and then analyzed for intracellular hemoglobin content by benzidine staining.
  • MIF decreased the cytodifferentiation response of MEL cells. The specificity of this effect was verified by the application of a neutralizing, anti-MIF mAb. Quantification of cellular hemoglobin by a sensitive chemical analysis also showed that lower amounts of MIF (20, 100 ng/ml) reduced hemoglobin content by 12% and 20% respectively.
  • MIF diaminofluorene
  • Erythropoiesis requires the coordinate activation of several growth factor-dependent, signal transduction pathways (Arcasoy et al. 2005. Br J Haematol 130:121-129 and Klingmuller 1997 EurJBiochem 249:637-647), and certain of these pathways may be faithfully represented in model, progenitor cell systems.
  • both primary erythroid and K562 progenitor cells exhibit differentiation-dependent modulation in the different subtamilies oi the mitogen-activated protein (MAP) kinases (ERK-1/2, JNK-l/2 5 p38) (Terada et al. 1977. Proc Natl Acad Sci USA 74:248-252 and Witt et al. 2000. Blood 95:2391-2396).
  • MAP mitogen-activated protein
  • MIF promotes pro-inflammatory functions in monocytes/macrophages and fibroblasts by activating the ERK-1/2 family of MAP kinases (Mitchell et al. 1999. J Biol Chem 274:18100-6).
  • a distinguishing feature of MIF action is that it induces a sustained rather than a transient pattern of ERK-1/2 activation (Mitchell et al. 1999. J Biol Chem 274:18100-6), which is noteworthy because the kinetics of the ERK-1/2 activation influence significantly the differentiation pathway of different progenitor cell types (Howe et al. 1998. J Biol Chem 273:27268-27274).
  • K562 progenitors were cultured in differentiation medium together with MIF, or MIF plus a neutralizing anti-MIF mAb, and the cell lysates were analyzed using phospho-specif ⁇ c antibodies directed against different MAP kinases. It was observed that the erythroid differentiation of K562 progenitors is associated with a time-dependent inhibition of ERK-1/2 and JNK-1/2 phosphorylation (beginning at 16 and at 96 hrs, respectively), and a complementary activation of the p38 phosphorylation (beginning at 16 hrs). MEF addition markedly affected these differentiation-associated, MAP kinase responses.
  • the differentiation-associated changes in p38 MAP kinase phosphorylation were reduced by MIF, however (16 hrs, pO.Ol; 96 hrs, p ⁇ 0.04).
  • the phosphorylation patterns induced by MIF were normalized by anti-MIF mAb (96 hrs: ERK-1/2: p ⁇ 0.04; p38: p ⁇ 0.04, for anti-MIF mAb treatment vs. non-treatment), and the time course for these effects was consistent with the increase in hemoglobin synthesis observed after anti-MIF treatment.
  • MIF is a direct and potent inhibitor of erythroid progenitor development. MIF Mediates Anemia in Experimental Malaria Infection.
  • mice After intraperitoneal injection with a modest inoculum of P, chabaudi-pa ⁇ asi ⁇ zed red blood cells (10 6 per mouse), the BALB/c mouse strain develops an acute parasitemia that peaks on approximately day 8 of infection (Stevenson et al. 2004. Nature Reviews Immunology 4:169- 180). More than 50% of mice will succumb to infection by 3 weeks, and anemia contributes importantly to death since the administration of a blood transfusion late in infection can rescue up to 90% of the infected mice (Yap et al. 1994. Infect Immun 62:3761-3765).
  • MIF-KO mice To determine the role of MIF in the anemic complications of acute malaria infection in vivo, a recently developed MIF-KO strain (Bozza 1999. J Exp Med 189:341-346) was backcrossed into the BALB/c genetic background for experimental infection with P. chabaudi. Before study, the hematopoietic competence of the MIF-KO strain was assessed by bone marrow histochemistry and enumeration of the different hematopoietic lineages. There were no significant differences between wild-type controls and MIF-KO mice with respect to the number of mature, peripheral blood cells, or in the numbers of CFU-E and BFU-E in bone marrow. Infection of wild-type or MIF-KO mice with P.
  • chabaudi AS resulted in a significant parasitemia that peaked on post-infection day 8 at 47%+15%.
  • Peripheral blood was sampled every two days and there was no significant difference in the mean level of parasitemia in the wild-type versus the MIF-deficient mice over the 4 week course of the study.
  • the severity of anemia that developed in the two different experimental groups was quite different, especially as the infection progressed (Figure 3A). Hemoglobin levels progressively declined in the wild-type mice, with the lowest levels recorded on post-infection day 15, after which time > 90% of the animals in this group perished.
  • mice experienced a less severe anemia than the wild-type mice, and this difference remained statistically significant after the first week.
  • mice c/i ⁇ w ⁇ -infected wild- type mice.
  • the levels of bone marrow production of the cytokines TNF ⁇ and IFN ⁇ were indistinguishable in the infected MIF-KO and wild-type strains, and the measured values mirrored closely the circulating levels of these mediators.
  • the wild-type mice nevertheless showed a prominent induction of MIF protein in the bone marrow that increased over time during the period critical for anemia development.
  • Plasmodium-mfQctcd red cells stimulate MIF secretion by cultured macrophages (Martiney et al. 2000. Infection and Immunity 68:2259-2267).
  • hemozoin was used as a stimulant. Hemozoin is a metabolite of Plasmodium hemoglobin degradation that accumulates within the reticuloendothelial system of the infected host (Slater, A.F. G. 1994. Malaria pigment. Exp Parasitol 74:362-365). Hemozoin induces cytokine release from monocytes/macrophages (Sherry et al. 1995.
  • MIF Cytokine Quantification.
  • MIF was measured by sandwich ELISA employing human or mouse MIF-speciflc antibodies developed in the laboratory (Donnelly et al. 1997. Nature Medicine 3 :320-323 and Calandra et al. 2000. Nature Medicine 6: 164-169).
  • the MIF content of bone marrow was determined by Western blotting and detection with rabbit polyclonal antibody (Rl 02) (Donnelly et al. 1997. Nature Medicine 3:320-323).
  • TNF ⁇ and IFN ⁇ levels in sera and in supernatants of bone marrow lysates were measured by the Quantikine ® M TNF- ⁇ or IFN- ⁇ Immunoassay kit (R&D Systems, Inc., Minneapolis, MN).
  • mice and Murine Cell Cultures The MIF "7' (MIF-KO) mice (Bozza 1999. J Exp Med 189:341-346) were bred onto the BALB/c genetic background by Charles River Laboratories (Wilmington, MA), and studied between 8-10 weeks of age. The mice were at generation N6. AU mouse studies were performed in accordance with protocols approved by Institutional Animal Care and Use Committees.
  • Bone marrow precursors were harvested from the femora and tibia of mice in 3 ml of Iscove's MDM containing 2% FBS. The viability of marrow cells was determined to be > 97% by Trypan blue exclusion staining. Bone marrow lysates were collected by flushing two femurs and two tibias per mouse with 1 ml of lysis buffer (150 mM NaCl, 50 mM Tris, pH 7.5, 1% NP- 40, 0.5% deoxycholic acid, 0.1% SDS, and 2 mM EDTA) using a 25G5/8 gauge needle.
  • lysis buffer 150 mM NaCl, 50 mM Tris, pH 7.5, 1% NP- 40, 0.5% deoxycholic acid, 0.1% SDS, and 2 mM EDTA
  • the bone marrow plug was homogenized, the cellular debris pelleted, and the lysate supernatant concentrated using an Amicon Centricon 10 membrane (Amico, Beverly, MA).
  • Mouse macrophages were prepared from the adherent cultures of thioglycollate-elicited peritoneal macrophages, as described previously (Calandra et al. 1994. J. Exp. Med. 179:1895-902).
  • BFU-E and CFU-E Progenitor Cell Assays were performed according to the standardized methods described previously (Martiney et al. 2000. Infection and Immunity 68:2259-2267) and protocols from StemCell Technologies (Vancouver, BC, Canada). Briefly, washed murine bone marrow cells were plated in sterile 35-mm dishes containing a methylcellulose-based medium and growth factors. The total number of bone marrow cells plated in duplicate culture dishes were as follows: 2 x 10 5 for CFU-E and 5 x 10 5 for BFU-E. MethoCultTM M3334 was utilized for the CFU-E and BFU-E colony assays.
  • the media for CFU-E and BFU-E was volume adjusted by adding 1 part Isocove's MDM to 9 parts MethoCultTM M3334 to give final concentrations of the following components: 15% fetal bovine serum, 1% BSA, 200 mg/ml transferrin, 10 mg/ml insulin, 1% methylcellulose, 10 "4 M 2- mercaptoethanol, 2 mM L-glutamine and 3 units/ml erythropoietin.
  • Each assay of different bone marrow progenitor cells was performed independently 3 - 6 times.
  • the Friend murine erythroleukemia (MEL) cell line was cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS. Differentiation was induced with dimethyl sulfoxide differentiation medium for 4 days as described (Terada et al. 1977. Proc. Natl. Acad. Sd. USA 74:248-252). Hemoglobin synthesis was assessed by cyto-centrifugation onto glass slides followed by staining with benzidine (Worthington), and by the hemoglobin kit from Sigma.
  • MEL erythroleukemia
  • the human K562 progenitor cell line (ATCC, CCL-243) was cultured in RPMI/10% FBS supplemented with penicillin and streptomycin.
  • sodium butyrate (AldRick, Milwaukee, WI) was added in the medium (Witt et al. 2000. Blood 95:2391-2396).
  • Terminal erythropoietic differentiation was measured as described by McGukin et al. (McGuckin et al. 2003. European Journal of Haematology 70:106-114) and positive cells enumerated after staining with 2,7-diarninofluorene (Sigma, St. Louis, MO).
  • the cells were centrifuged and washed in PBS, and the cell pellet resuspended in lysis buffer (100 mM potassium phosphate pH 7.8, 0.2% Triton X-100) before disruption by aspiration through a 21 -gauge needle. After microcentrifugation, the supernatant was collected and the hemoglobin concentration was determined using the hemoglobin kit from Sigma. Cell viability was assessed by trypan blue dye exclusion and found to be equivalent (85 - 90% viability) between all samples studied.
  • lysis buffer 100 mM potassium phosphate pH 7.8, 0.2% Triton X-100
  • mice were inoculated intraperitoneally with 10 parasitized red blood cells. The course of experimental infection in mice was monitored every other day by examining DiffQuik (Baxter Scientific Products, West Chester, PA)-stained thin smears from blood. Parasitemias were determined by counting a minimum of 200 erythrocytes per blood sample.
  • Hemoglobin was determined by using Drabkin's procedure (Sigma Diagnostics, St Louis, MO) on 1 ⁇ l of tail vein blood prepared on every second day, post-infection, for 3 weeks. Mice were observed daily for at least 30 days, and mortality was recorded. At pre-determined times post-infection, five animals per group were euthanized by CO 2 , and the blood was collected by cardiac puncture.
  • Human mononuclear cells were prepared from the adherent leukocyte fraction of volunteers and genotyped for the (-794) CATT tetranucleotide repeat and for a (-173) G/C SNP (Baugh et al. 2002. Genes Immun. 3:170-176). Two homozygous and one heterozygous MIF promoter genotypes were studied: 5-CATT/5-CATT; 6-CATT/6-CATT; and 6-CATT/7- CATTC. The mononuclear cells were cultured in 24 well plates (10 4 cells/well) and stimulated with hemozoin (42 nM) for 48 hrs. Cells from 3 individuals were studied within each genotyped group, and the results were repeated twice
  • This example summarizes the development and implementation of a thin-film optical biosensor chip for genotyping both tetranucleotide CATT repeats and SNPs in a single analysis that greatly facilitates the examination of small quantities of DNA which are usually obtained in the field.
  • These chips are based on an allele-discriminating oligonucleotide array that provides a direct visual readout of the different MIF promoter polymorphisms.
  • the MIF CATT repeat polymorphism and the -173 QIC SNP detection were performed by modifying solid-phase techniques described previously (Zhong et al. (2003) Proc. Natl. Acad. Sci. USA, 100, 11559-11564).
  • Prior ligation-based assays have been found to be efficient only for discriminating polymorphic alleles of short microsatellite repeats ⁇ 30 bases (Zhong et al. (2003) Proc. Natl Acad. Sci. USA, 100, 11559-11564 and Zirvi et al. (1999) Nucleic Acids Res., 27, e41). Ligation of longer repeats lacks specificity because of the looping out of repeat units in the probe/target hybrids.
  • the loopout often occurs in an area outside of the ligase footprint that can span 26-30 bases (Zirvi et al. (1999) Nucleic Acids Res., 27, e41).
  • the repeat was divided into the capture probes 'Pl ', with CATT 1, 2, 3 or 4, and 'P2', with CATT4 ( Figure 4A), thereby ensuring that the ligase footprint covers 6-7-C ATT repeat units.
  • a detection probe, P2 with 4 copies of the CATT unit and 20 bases of the downstream adjacent and unique MIF sequence carried a biotin at the 3' end for detection and a phosphate at its 5' end for ligation.
  • the Pl capture probes were manually spotted on hydrazine-functionalized, thin-film biosensor chips (Thermo Electron, Louisville, CO) using 0.3 ⁇ l of 1 ⁇ M Pl in 0.1 M phosphate buffer, pH 7.8 and 10% glycerol. After incubation for 2 h at room temperature in a humid chamber, the chips were washed with 0.1% SDS at 6O 0 C for 30 min, rinsed with water and dried.
  • a ligation mixture containing 20 mM Tris-HCl, pH 8.3, 25 mM KCl, 10 mM MgCl 2 , 0.5 mM NAD, 0.01% Triton X-100, 5 mg/ml acid-treated casein, 10% formamide and 0.04 U/ ⁇ l mutant Ampligase (Lys294Arg of Thermus thermophilus ligase) was applied to each chip and prewarmed to 60°C.
  • the synthetic targets or MIF PCR amplicons from patient samples at a concentration of 100 fmol in 10 ⁇ l water were denatured at 95°C for 3 min in the presence of 100 fmol of the P2-biotin probe.
  • the CATT repeat polymorphism is detected by capillary electrophoresis of PCR products amplified to span the tetranucleotide region, and the -173 G/C SJNF is determined by the ddNTP primer extension method and capillary electrophoresis, or by pyrosequencing (Baugh et al. (2002) Genes Immun., 3, 170-176).
  • the typings of the CATT repeat and -173 SNP obtained by using the biosensor methodology were compared initially in a blinded fashion.
  • MDA multiple displacement amplification
  • PCR Forward primer CTATGTCATGGCTTATCTTC (SEQ ID NO: 14) primer Reverse primer: TCCACTAATGGTAAACTCGG (SEQ ID NO: 15) and PCR products: 119, 123, 127 or 131 product CTATGTCATGGCTTATCTTCTTTCACC(CATT)S-SCAGCAGTATTAGTCAATGTCTCTTGATATGCCTGGCACCTGCTAGATGGTCCCC GAGTTTACCATTAGTGGA (SEQ ID NO: 16)
  • Synthetic MIF-173 Target G target AGCCCGGCGCACCGCTCCAACCTGTTCTCCACTTGGCGGCTAGAAATCGGCCTGTTCCGG(SEQID NO: 20)
  • the underlined sequences designate the unique repeated sequences (5-8 repeats) present in the synthetic oligonucleotide target
  • the bolded residue designates the -173 G/C SNP.
  • Genomic DNA Forty samples from patients in Zambia with P. falciparum malaria were collected and dried onto filter papers, stored at ambient temperature and the genomic DNA extracted with the QIAamp DNA Blood Mini kit (Qiagen). DNA yields were reliably 10-20 ng per sample. Ten nanograms of the isolated, genomic DNA was used for whole genome amplification by MDA in a standard 50 ⁇ l reaction, resulting in 15-20 ⁇ g of the MDA product per reaction. Targets for the MIF polymorphic genotyping were prepared by PCR of 100 ng of MDA-amplified products. The genotyping was performed on optical biosensor chips, and the genotypes and allele frequencies were compared with that of a previously reported Caucasian control group (Table 4).
  • the robust optical biosensor methodology described herein has high fidelity when compared with the currently used methods and instrumention, and it can be readily combined with the MDA technique to analyze minute quantities of DNA extracted from dried, whole blood specimens. This method will greatly facilitate the genotyping and population studies in different field settings, and it makes possible the rapid translation of genotyping information in the clinic into medical intervention.
  • DNA specimens from normal controls of known MIF genotype were used to develop the biosensor methodology. Validation was performed on a random selection of DNA specimens culled from ongoing studies of MIF genotype, and included Caucasians, African- Americans, North East Asians (Koreans) and Africans (Zambia and North Africa). The African sub-group specimens were collected either by K. K. Kidd and J. R. Kidd, or by one of their collaborators as part of their long-term studies on human genetic diversity. The malaria-infected samples were obtained as part of investigations at the Macha Mission Hospital in Choma, Zambia, which is holoendemic for Plasmodium falciparum malaria. These specimens consisted of blood samples that had been spotted on filter paper, dried and stored for several months.
  • DNA extracted from blood spots dried on filter papers was amplified by multiple displacement amplification (MDA) (Dean et al. (2002) Proc. Natl Acad. ScL USA, 99, 5261- 5266).
  • MDA multiple displacement amplification
  • the MDA reactions were performed overnight at 31 0 C in 50 ⁇ l of reaction solution containing 37.5 mM Tris-HCl (pH 7.5), 50 mM KCl, 10 mM MgCl 2 , 5 mM (NH 4 ) 2 SO 4 , 1 mM dNTP, 0.05 mM thiophosphate-modified random hexamer (5'-NNNN s N s N), 1-5 ng genomic DNA, 0.2 U yeast pyrophosphatase and 1 U Phi29 polymerase.
  • the products of the MDA reaction were resolved on a 1% agarose gel stained with ethidium bromide.
  • the yield of amplified genomic DNA was between 15 and 20 ⁇ g in
  • Oligonucleotide primer sets were designed to amplify regions within the MIF promoter that corresponded to DNA product sizes of 119, 123, 127 and 131 bp for the 5-, 6-, 7- and 8- CATT repeat polymorphisms, respectively (Table 2).
  • An additional set of primers was used for the -173 G/C SNP and produced a PCR product size of 129 bp.
  • the PCRs were carried out in a 50 ⁇ l solution containing Ix PCR buffer (AmpliTaq Gold; Applied Biosystem), 2.5 mM MgCl 2 , 0.2 mM dNTP, 10 pmol of each forward and reverse primers, 100 ng of genomic DNA or MDA- amplified genomic DNA and 1 U AmpliTaq Gold DNA polymerase.
  • Ix PCR buffer AmpliTaq Gold; Applied Biosystem
  • 2.5 mM MgCl 2 0.2 mM dNTP
  • 10 pmol of each forward and reverse primers 100 ng of genomic DNA or MDA- amplified genomic DNA and 1 U AmpliTaq Gold DNA polymerase.
  • the PCR program was as follows: 95°C for 10 min, followed by 40 cycles at 94°C for 30 s, 56°C for 30 s, 72°C for 1 min and final extension at 72°C for 10 min, and for the -173 SNP, the PCR program was 95 0 C for 10 min, followed by 40 cycles of 94°C for 30 s, 62 0 C for 30 s, 72°C for 1 min and final extension at 72 0 C for 10 min.
  • the oligonucleotide probes were designed based on the general approach described previously (Zhong et al. (2003) Proc. Natl. Acad. Sd. USA, 100, 11559-11564), and with the detailed sequence information provided in Table 2.
  • the 4 Pl capture probes have 5 '-aldehyde groups, 10 deoxyadenosine residues at their 5' ends and 30 bases of upstream sequence, followed by a different number (from 1 to 4) of the CATT repeat, respectively.
  • the P2 detection probe contains 4 copies of CATT and 20 bases of downstream sequence, with a biotin at its 3' end for detection and a phosphate group at its 5' end for ligation.
  • the Pl and P2 probes were synthesized by the Yale Keck Biotechnology Facility at 40/50 nmol scale and were used without post-synthesis purification.
  • Four complementary, single-stranded artificial targets with 5-8 copies of the AATG repeat flanked by 30 bases of the MIF promoter sequences both upstream and downstream of the repeat motif also were synthesized.
  • CAP cases were recruited as part of the Genetic and Inflammatory Markers of Sepsis (GenEVIS) study, a large, multicenter study of subjects presenting to the EDs of 28 teaching and non-teaching hospitals in 4 regions (Western Pennsylvania, Connecticut, Michigan, and Tennessee) between November 2001 and November 2003. Eligible subjects were >18 years and had a clinical and radiologic diagnosis of pneumonia. Exclusion criteria were: transfer from another hospital; discharge from a hospital within the prior 10 days; episode of pneumonia within the past 30 days; chronic mechanical ventilation dependency, cystic fibrosis; active pulmonary tuberculosis; positive HIV antibody titer; alcoholism with evidence of end-organ damage; admission for palliative care; prior enrollment in the study; incarceration, and; pregnancy. Informed consent was obtained from the patient or a proxy. The Institutional Review Boards of the University of Pittsburgh and all participating sites approved the study. AU human participants gave -written informed consent.
  • Severe sepsis was defined as pneumonia plus acute organ dysfunction following the International Consensus Criteria (Levy et al. 2001 Crit. Care Med. 2003;31 : 1250-56).
  • Acute organ dysfunction was defined as a new Sequential Organ Failure Assessment (SOFA) score of >3 in any of six organ systems, following the Sepsis Occurrence in the Acutely ill Patient (SOAP) study criteria (Vincent et al. Crit. Care Med. 1998;26:1793-1800 and Vincent et al. Intensive Care Med. 1996;22:707-10).
  • SOFA Sequential Organ Failure Assessment
  • 90-day mortality was chosen based on international expert panel recommendations for clinical trials in sepsis (Angus et al. Intensive Care Med.
  • genomic DNA was extracted using QIAamp DNA Blood Mini Kits (QIAGEN Ltd., UK.) and genotyped using previously described techniques with error rates of 1.4% and 0.6% for the MIF -173 G/C and -794 CATT repeat polymorphisms (Baugh et al. Genes Immun. 2002;3: 170-6 and Radstake et al. Arthritis Rheum. 2005;52:3020-29).
  • cytokine measurement plasma TNF, IL-6, and IL-10 concentrations were measured daily for the first week in the hospitalized subjects using an automated chemiluminescent immunoassay analyzer (Diagnostic Products Corp., Los Angeles, CA).
  • Day 1 plasma MIF concentrations were measured in 48 subjects (homozygotes matched by age, gender, and comorbidity) using an ELISA assay (R & D System, Minneapolis, MN).
  • Day 1 plasma procalcitonin concentrations were measured using a time resolved amplified cryptate emission assay (BRAHMS, Hennigsdorf, Germany) (Christ-Crain et al. Lancet 2004;363:600-7).
  • Logistic regression models were used to adjust for potential confounders for susceptibility to severe sepsis. Kaplan-Meier plots with log rank test were constructed and Cox regression models were used for survival analyses. Haplotypes were constructed and exact P values were used to assess the association between individual haplotypes and outcomes. Association between individual genotypes and cytokine concentrations was tested using log transformed data and mixed models to evaluate concentrations over time (Laird et al. Biometrics 1982;38:963-74). Tobit models were used to account for censoring when concentrations were below assay detection limits (Epstein et al. Am. J. Hum. Genet. 2003;72:611-20).
  • Sensitivity analyses were performed using more stringent definitions of CAP, restricting to microbiologically confirmed cases and using circulating procalcitonin concentrations to classify subjects as having low ( ⁇ 0.1ng/ml), intermediate (0.1- 0.5ng/ml), and high (>0.5ng/ml) probability of bacterial pneumonia (Christ-Crain et al. Lancet 2004;363:600-7).
  • Analyses were performed assuming significance at p ⁇ 0.05 and using SAS 9.1 and SAS genetics (SAS, Gary, NC). Hazard ratios (HR) and odds ratios (OR) are shown with 95% confidence intervals.
  • results for the MIF polymorphisms were available in 1673 (96.5%) participants. Table 6 describes their clinical characteristics. One hundred and ninety eight (11.8%) were discharged after treatment in the EDs. Among the remaining 1475 participants, the incidence of severe sepsis was 32.3%. The 90-day mortality rates for those discharged from EDs, hospitalized subjects, and those with severe sepsis were 1.5%, 12.7% and 27.5%, respectively.
  • APACHE III score 1 mean (SD) 54.2 (19.5) 30.3 (17.7) 57.4 (17.3) 66 (19.3) 53.3 (14.6)
  • APACHE III score assessed on first hospital day, regardless of whether subject was admitted to ICU or not
  • Severe sepsis status 2 90-day mortality 3 -173 G/C /-794 CATT repeat haplotype With severe sepsis Without severe _ , 4 Dead at 90-days A 1 . , _.. , mecanic ., _, . 4 P value justify ordinary J Alive at 90 days (%) P value sepsis (%)
  • the presence of the C allele at the MIF -173 site was associated with better 90-day survival (p ⁇ 0.001) ( Figure 5).
  • Day 1 circulating MIF concentrations were also determined in a subset of 48 subjects with CC and GG genotypes at the MIF-173 G/C site. A difference was not detected (17.1 vs. 22.1 ng/ml for CC and GG genotypes, p-0.15).
  • the MIF -173 G/C polymorphism was associated with survival, but no association was seen with the -794 CATT repeat.
  • the C/7 haplotype was associated with decreased CAP susceptibility and the C/6 haplotype was associated with lower risk of severe sepsis, suggesting that both markers within the MIF gene play an important role in susceptibility to and outcomes of CAP.
  • S. pneumoniae causes a spectrum of disease severity, and human host factors likely play a role in this variation. It was examined whether high-expressing MIF alleles (e.g., MIF alleles with >5 CATT repeats in the -794 region of the MIF promoter) were associated with severe invasive pneumococcal disease, including meningitis. Blood samples and patient chart findings were collected prospectively at three Connecticut hospitals from 24 inpatients with documented invasive S. pneumoniae infections. Genomic DNA was isolated from blood, amplified, and genotyped using optical biosensor chips. Fisher's exact tests were used to compare subjects with the high-expressing 7,7 CATT genotype to all other genotypes.
  • MIF alleles e.g., MIF alleles with >5 CATT repeats in the -794 region of the MIF promoter
  • Genotypes were completed for each allele of 9 of the bacteremic subjects. Compared to normal healthy control samples previously analyzed, the genotype frequences were observed as in the table below:
  • MIF is a component of innate HIV immunity.
  • MIF monocyte-derived macrophage
  • HEV-infected macrophages were cultured in the presence of a neutralizing anti-MEF antibody or isotype control.
  • Triplicate cultures of monocyte-derived macrophages were infected with HEV- IA DA in the presence of anti-MEF MAb (25 ⁇ g/ml) or isotype control.
  • Virus replication was monitored by RT activity in culture supernatants.
  • a significant increase in replication of the CCR5-tropic (R5) HEV-I strain ADA was observed in the presence of anti-MEF antibody (Figure 7A).
  • This finding was confirmed by experiments using recombinant MEF, which significantly suppressed replication of HEV-I in macrophage cultures ( Figure 7B).
  • the observed effect was not due to the presence of endotoxin in recombinant MEF, as addition of an LPS inhibitor, polymyxin B (10 ⁇ g/ml), did not significantly reduce the inhibitory effect of MEF on viral replication (Figure 7B).
  • the effect of MEF was reduced by the antibody to the MEF receptor, CD74 ( Figure 7C).
  • Macrophages were infected with HEV-I ADA and cultured in the presence of MEF (50 ng/ml) mixed with PMB (10 ⁇ g/ml) and anti-CD74 MAb (25 ⁇ g/ml). Control cultures were cultivated with PMB mixed with an isotype immunoglobulin with or without MEF. These data indicate that MLF is a component of innate anti-HIV immunity.
  • MIF inhibits replication in PBMC ofR5, but notX4, HIV-I strain.
  • MIF reduced R5 HIV-I replication in PBMC cultures. MIF did not reduce replication of the CXCR4-dependent strain LAI.
  • MDM cultures were treated with recombinant MIF. The expression of CCR5 and CXCR4 was measured by flow cytometry. This experiment demonstrated that MIF substantially reduces CCR5 expression, without altering expression of CXCR4 ( Figure 9). This result is consistent with observed inhibition of R5 HIV strains by MIF.
  • MIF downregulates CCR5 expression in macrophages.
  • Monocyte-derived macrophages were cultured in the presence of recombinant MIF (50 ng/ml) and polymyxin B (PMB, 10 ⁇ g/ml) for 48 h.
  • Cell surface expression of CCR5 and CXCR4 was analyzed by FACS after staining with FITC-conjugated anti-CCR5 and PE- conjugated anti-CXCR4 antibodies (Pharmingen) ( Figure 9).
  • Stable cell lines expressing combinations of CD74 and different forms of CD44 were created to investigate the roles of CD74 and CD44 in MIF signal transduction.
  • Mammalian COS-7 cells do not bind MIF unless engineered to express CD74 (Leng et al. (2003). J Exp Med 197:1467-1476), and the COS-7/M6 subline additionally is known to be CD44 nu " (Jiang et al. (2002). J Biol Chem 277:10531-10538).
  • CD74 and CD44 were confirmed in COS-7/M6 cells by western blotting, and the cells then were transfected with plasmid DNA encoding full-length human CD74 (1-232 aa), full-length CD44 (1-361 aa of the hematopoietic "F£" isoform of CD44), or a truncated CD44 lacking its cytoplasmic domain (CD44 ⁇ 67 ) ( Figure 10).
  • Cell lines expressing the corresponding cDNAs were propagated and selected for further study based on the stable expression of these proteins.
  • the cell surface expression of the transfected proteins was confirmed by flow cytometry using directly conjugated (FITC-labeled) anti-CD74 and anti-CD44 antibodies. Equivalent surface expression of the full-length and truncated forms of CD44 was verified - which is important for functional analyses. It was also verified that expression of the MIF binding receptor, CD74, was not influenced by the presence of CD44 or CD44 ⁇ 67 . These stable cell lines were utilized to assess the potential contribution of CD44 to the MIF binding interaction with CD74. There is evidence that CD44 may associate with CD74 (Naujokas et al. (1993). Cell 74:257-268 and Meyer-Siegler et al. (1996).
  • CD44 is Required for MIF-mediated ERK- 1/2 Phosphorylation
  • ERK-1/2 phosphorylation and activation of the ERK-1/2 (p42/p44) subfamily of MAP kinases is an established feature of MIF signal transduction (Mitchell et al. (1999). J Biol Chem 274:18100-6; Lacey et al. (2003). Arthritis Rheum 48:103-109; and Amin et al. (2003). Ore Res 93:321-329).
  • ERK-1/2 phosphorylation was examined in response to a stimulatory concentration of MIF (100 ng/ml) in the transfected cell lines over time. MIF induced ERK-1/2 phosphorylation only in those cells expressing both CD74 and full-length CD44 ( Figure 1 IA).
  • ERK-1/2 phosphorylation was induced as early as 10 mins, which is in accord with prior studies (Mitchell et al. (1999). J Biol. Chem. 274:18100-6). While MIF can induce a sustained pattern (> 90 mins) of ERK-1/2 phosphorylation in some cell types (Mitchell et al. (1999). J Biol. Chem. 274:18100-6 and Liao et al. (2003). J. Biol. Chem. 278:76-81, this was not observed in the stable COS-7 expression system. ERK-1/2 phosphorylation decayed at 30 mins.
  • CD44 in MIF signal transduction was verified by examining ERK- 1/2 phosphorylation in primary, murine embryonic fibroblasts (MEFs) ( Figure HB), and in peritoneal macrophages prepared from wild-type, CD74-KO, and CD44-KO mice ( Figure 11C). MIF induced ERK-1/2 phosphorylation only in wild-type cells, and not in cells genetically- deficient in CD74 or CD44.
  • the CD44 requirement for MIF signal transduction may be due to CD44 binding to a MIF that has undergone conformational modification by complexation with CD74.
  • a soluble, recombinant CD74 ectodomain (sCD74) was prepared, which binds MIF with a Kd ⁇ 9x 10 "9 (Leng et al. (2003). J. Exp. Med. 197:1467-1476).
  • Increasing concentrations of pre-formed MIF/sCD74 complexes were added to cells expressing CD44 alone ( Figure 1 ID). No increase in ERK-1/2 phosphorylation was observed under these conditions, supporting the requirement for an interaction between membrane-expressed CD74 and CD44.
  • PKA Protein kinase A
  • Ser325 is constitutively phosphorylated in resting cells, but undergoes de-phosphorylation in response to PKC activating stimuli such as phorbol esters.
  • Ser291 and Ser316 are unphosphorylated in resting cells, but then may be phosphorylated by the activation of PKC (Ser291) and PKA (Ser316) (Legg et al. (2002). Nature Cell Biol 4:399-407; Ponta et al. (2003). Nature Revs. MoIr. Cell Biol.
  • the Protein Tyrosine Kinase p56 lck is Activated by MIF Engagement of the CD74/CD44 Complex
  • An increase in the phosphorylation of the Src kinase was not detected in either cell type however, suggesting that this kinase is not involved in the CD44-dependent, signal transduction of MIF.
  • siRNA short interfering RNA directed against p56 lck
  • CD74 and CD44 are Required for MIF -mediated Pr otectiort from p53-dependent Apoptosis
  • MIF reduces p53 accumulation in the cytoplasm by a pathway that requires an ERK1/2 effector response leading to arachidonic acid metabolism and cyclooxygenase-2 activation (Hudson et al. (1999). J Exp. Med.
  • CD74 and CD44 were tested for whether they were necessary for this action of MIF by assessing the apoptotic response of the different COS-7 cell lines and primary macrophages genetically-deficient in CD74 or CD44.
  • the COS-7 cell lines showed a brisk response to apoptotic induction, but only in the case of the COS- 7/CD74+CD44 cell line did MIF exert a significant protective effect.
  • MIF anti-apoptotic action of MIF in turn was associated with a reduction in the intracytoplasmic content of a Serl5- phosphorylated, p53 species, as reported previously (Mitchell et al. (2002). Proc. Natl. Acad. Sc.i USA 99:345-350).
  • MIF protection from apoptosis of primary macrophages also was found to be dependent on CD74 and CD44, and in these cells the protective effect of MIF was almost complete, which is consistent with prior reports (Hudson et al. (1999). J Exp Med 190:1375- 1382 and Mitchell et al. (2002). Proc. Natl. Acad. Sd. USA 99:345-350).
  • MIF treatment of macrophages during apoptosis induction also was associated with a diminution in the cellular content of Serl5-phosphorylated, p53.
  • MIF-CD74/CD44 signal transduction pathway was analyzed in vivo by examining macrophage apoptosis in endotoxemic mice.
  • Wild-type, MIF-KO, CD74-KO, and CD44-KO mice were primed with endotoxin (LPS) and their macrophages harvested one day later by peritoneal lavage.
  • LPS endotoxin
  • Initial assessment of macrophage viability by fluorescent-annexin staining showed that endotoxemic, wild-type mice had a several-fold increase in apoptotic macrophage numbers when compared to saline-treated controls.
  • the apoptotic response was enhanced in the MIF-KO mice when compared to the wild-type controls, which is in agreement with a prior report (Mitchell et al. (2002). Proc. Natl. Acad. Sd. USA 99:345-350), and apoptosis also appeared increased in the CD74-KO and the CD44-KO mouse strains.
  • a more quantitative assessment of apoptosis in macrophages was obtained by oligonucleosome ELISA. This analysis showed an equivalent level of LPS-induced apoptosis in macrophages isolated from the MIF-KO, CD74-KO, and CD44-KO strains that in turn was enhanced when compared to wild-type controls.
  • CD74 and CD44 are reminiscent of the signaling mechanism established for the IL-6 family of cytokines, whereby a binding receptor (i.e. IL-6R ⁇ ) associates with a transmembrane glycoprotein (i.e. gpl30) leading to kinase activation (Hibi et al. (2001).
  • IL-6 Receptor hi Cytokine Reference, VoI 2: Receptors, JJ.Oppenheim and M.Feldmann, eds. (San Diego: Academic Press), pp. 1761-1778).
  • Several of the biologic activities of MIF have been identified to proceed via ERKl /2 activation.
  • mice were bred at the Yale Animal Resource Center under strict, pathogen-free conditions.
  • the KO strains were in genetically pure BALB/c or C57/B16 backgrounds (each at generation >N 10).
  • Mouse embryonic fibroblasts (MEFs) were obtained from 2 week-old embryos as described (Fingerle-Rowson et al. (2003).
  • the pcDNA3.1 -CD 74 plasmid was constructed by inserting a full length, human CD74 cDNA fragment (l-232aa) into the pcDNA3.1/V5-His-TOPO vector (Invitrogen) at a multiple cloning site (Leng et al. (2003). J Exp Med 197:1467-1476).
  • the pTracer-CD44 and pTracer-CD44 ⁇ 67 plasmids which encode the human hematopoietic form of CD44 (CD44H, 1- 361 aa) and a truncated CD44 lacking the cytoplasmic domain (CD44 ⁇ 67 5 1- 294 aa) respectively, were created by subcloning into the pTracer-SV40 vector (Invitrogen) a human full-length CD44 cDNA or a CD44 cDNA created by substitution of a stop codon for cysteine 295 using site-directed mutagenesis (Jiang et al. (2002). J Biol Chem 277:10531- 10538). Structural fidelity was confirmed by DNA sequencing.
  • COS-7/M6 cells which express neither CD74 nor CD44 (Jiang et al. (2002). J Biol Chem 277:10531-10538) (null expression was confirmed by flow cytometry and Western blotting), were stably transfected with ⁇ cDNA3.1-CD74, pTracer- CD44, ⁇ cDNA3.1-CD74 plus ⁇ Tracer-CD44, or ⁇ cDNA3.1-CD74 plus ⁇ Tracer-CD44 ⁇ 67 by using the LipofectAMINE PLUS Kit (Invitrogen). Stable transformants were selected by culture in G418 (1.5 mg/ml, Sigma).
  • Washed cells (-4.0 x 10 s ) were re-suspended in PBS/2%FBS and stained on ice for 30 minutes with isotypic controls, anti-human CD74, anti-human CD44, or anti-mouse CD44 (BD Pharmingen) antibodies conjugated with FITC or Alexa 488-labeled MIF (Leng et al. (2003). J Exp Med 197:1467-1476).
  • the labeled cells were studied with a FACS- Calibur (BD Pharmingen) and the data were analyzed with CellQuest software (BD Pharmingen).
  • the secondary antibodies included anti-mouse IgG or anti-rabbit IgG conjugated with horseradish peroxidase (Cell Signaling).
  • the ECL detection reagents (Amersham) were used to visualize bands.
  • the blots displayed are representative of stimulation studies that were repeated at least three times.
  • Protein kinase inhibition was performed by pre-incubating cells for 30-120 mins with 20 ⁇ M of the PKA inhibitor, H-89, 10 ⁇ M of the PKC inhibitor, RO-31-2880, or 20 nM of the p56 lck inhibitor, damnacanthal (Calbiochem) (Faltynek et al. (1995). Biochemistry 34:12404- 12410).
  • Cell lysates were collected and analyzed by immunoblots using a pair of anti-phospho- PKA and anti-(total)-PKA antibodies, a pair of anti-phospho-PKC (all from Cell Signaling) and anti-(total)-PKC (Santa Cruz) antibodies, or a pair of anti-phospho-p56 lck (Cell Signaling) and anti-(total) p56 lck (sc-433, Santa Cruz) antibodies.
  • siRNA Studies An siRNA specific for ⁇ 56 lck mRNA (Csk 2033) and its mutant control (Csk 2033-M3) were prepared as described previously (Iversen et al. (2004). FASEB J 18, C258). Both the siRNAs Csk 2033 and Csk 2033-M3 are two 21-nucleotide double-stranded RNAs with 2-nucleotide 3 Overhangs.
  • the sense sequence is 5'- ACUCGCCUUCUUAGAGUUUUA-3' (SEQ ID NO: 25) and antisense sequence is 5'- AAACUC-UAAGAAGGCGAGUGG-3' (SEQ ID NO: 26).
  • Csk 2033-M3 the sense sequence is 5'-ACUCGGCUUGUUAG-ACUUUUA-S' (SEQ ID NO: 27), and antisense sequence is 5'-AAAGUCUAACAA-GCCGAGUGG-S' (SEQ ID NO: 28).
  • MIF' s role in asthma was examined using genetic approaches in an experimental mouse model and in a cohort of asthma patients.
  • Murine models of asthma such as the OVA-prime and aerosol challenge model are characterized by the preferential induction of a T H 2 immunologic response.
  • a standard protocol was used for OVA-priming to examine first the total and OVA-specific, serum immunoglobulin response in MIF ' ⁇ mice and genetically-matched, MIF +/+ mice.
  • Both total and OVA-specific IgM, IgE, IgGl, and IgG2a increased in serum by day 8 of OVA-sensitization in the wild-type, MIF +/+ strain ( Figure 13). There were significantly lower levels of these antibodies (with the exception of IgM) in the MIF "7" than in the MIF +/+ mice.
  • MIF "7" mice showed a significant impairment in the generation of an IgE response prompted the further examination of these mice for a lung-specific, T H 2 inflammatory response leading to asthma.
  • MIF' Mice Show Decreased Airway Hyper-responsiveness, Peri-bronchial Infiltration, and Mucus Hyper-production.
  • OVA-primed mice were subjected to aerosol challenge and measured airway reactivity in response to methacoline administration.
  • OVA-challenge increased airway hyper-responsiveness in both the MIF +/+ and the MIF 7' mice when compared to the control, PBS-challenged mice ( Figure 14).
  • Airway responsiveness to methacholine (50 mg/ml) was reduced in the MIF '7" mice.
  • Lung tissues from five mice in each group then were stained with PAS and examined histologically.
  • BALF analysis of the different experimental groups showed that total cell numbers were reduced in the setting of genetic MIF deficiency, irrespective of OVA challenge ( Figure 15).
  • Leukocyte sub- fractionation revealed lower numbers of macrophages, lymphocytes, neutrophils, and eosinophils of MIF 7" mice when compared to MIF +/+ mice; however this result was significant only for the eosinophil subpopulation.
  • IL-5 which mediates eosinophil activation and recruitment
  • eotaxin which is a potent, eosinophil-selective chemokine were also measured in BALF. Both IL-5 and eotaxin levels were significantly lower in the MIF " ' " mice than in the MIF +/+ mice.
  • the mRNA levels for these T H 2 cytokines did not differ between the MIF '7" and MIF +/+ mice under control conditions, but the increase in mRNA levels for IL-4, IL-5, and IL- 13 in response to OVA-challenge was less for the MIF than the wild-type mice.
  • the mRNA levels for IL-10, or for IFN- ⁇ . were not markedly different between the MIF "7" and MIF +/+ mice.
  • the small increase in IFN- ⁇ mRNA in the MIF " " mice was not reflected by a significant change in the levels of IFN- ⁇ protein.
  • MIF protein was confirmed in the lungs of wild-type mice after aerosolized OVA-challenge. A significant decrease in IL-4, IL-5, IL-13, and eotaxin production was observed in MIF "7' versus MIF +7+ mice. The concentrations of IFN- ⁇ and IL-10 protein also were not significantly different in the absence of MIF, which is consistent with the mRNA data. Taken together, these data support a reduction in the expression and production of T H 2 -cytokines that mediate allergic inflammation in mice deficient in MIF.
  • the splenic T cell response to OVA was significantly attenuated in the MIF " " mice, as was the production of IL-2.
  • T cell MIF production in response to antigen stimulation in wild- type mice was rapid, peaking at 24 hrs, and preceding IL-2 production.
  • Purified B cells proliferated equally well to OVA stimulation whether the cells were from wild-type, or MIF "7" mice, suggesting that there is no intrinsic defect in B cell responses in this model of asthma.
  • Splenic T cells were obtained from OVA-sensitized, and PBS or OVA-challenged mice, and re-stimulated with OVA for 72 hrs for the measurement of T cell polarization responses.
  • the intracellular production of IFN- ⁇ (T H I response) and IL-4 (T H 2 response) was then measured in the CD4 + T cell population segregated electronically by flow cytometry.
  • CD4 + T cells from the OVA-sensitized, wild-type mice showed an enhanced IL-4 response and a poor IFN- ⁇ response, which is in accord with this disease model (Wills-Karp (1999) Anna Rev Immunol 17:255-81).
  • T H I and T H 2 cytokine production were analyzed for T H I and T H 2 cytokine production.
  • Splenic T cells obtained from MIF "7' mice and stimulated with OVA showed a marked reduction in the secretion of the TH2 cytokines, IL-4, IL-5, IL-IO, IL-13, when compared to T cells obtained from their MIF +/+ counterparts.
  • IFN- ⁇ secretion by MIF '7" T cells also appeared reduced, but it was not significantly different from the low levels observed in the MIF +/+ T cells.
  • Functional promoter polymorphisms in human MIF have been identified. These polymorphisms include a tetranucleotide sequence, CATT, that is repeated between 5-8 times at position -794 in the gene promoter ( Figure 16). An increase in CATT repeat number produces a corresponding increase in MIF promoter activity (Baugh et al. (2002) Genes Immun. 3:170-176), and SNP mapping in the promoter region further supports a role for promoter polymorphisms in regulating MIF production in vivo (De Benedetti et al. (2003) Arthritis & Rheum 48:1398-1407). Individuals with the 5-CATT (low repeat) MIF allele may be considered low MIF "expressors", and those bearing non-5-CATT repeats (6-CATT, 7-CATT, or 8-CATT) are high MZF expressors.
  • CATT tetranucleotide sequence
  • the present study assigns an important function for MIF in the immunopathogenesis of asthma via the promotion of T H 2 responses.
  • the human genetic data suggest that different MIF promoter alleles, which are prevalent in the population and may exist in a balanced polymorphism (Gregersen et al. (2003) Arthritis & Rheum. 48: 1171-1176), play a role in asthma clinical severity.
  • MIF inhibition in asthma may be therapeutically beneficial, and specific intervention may be guided by the MIF genotype of affected individuals.
  • mice were from Jackson Labs or bred at the Yale Animal Resources Center. MIF " mice (Fingerle-Rowson et al. (2003) Proc. Natl. Acad. Sd. USA 100:9354-9359; Bozza et al. (1999) J. Exp. Med. 189:341-346) in the BALB/c genetic background were used at generation N8. BALB/c mice transgenic for the T cell receptor recognizing ovalbumin (OVA) residues 323-339 (DO 11.10H2dTg) were provided by L. Cohn (Whittaker et al. (2002) American Journal of Respiratory Cell and Molecular Biology 27:593-602). Studied mice were age-matched females (6 - 9 wks of age) and maintained on OVA-free diets in a pathogen-free environment.
  • OVA ovalbumin
  • mouse MIF Cytokines and Antibodies. Recombinant mouse MIF was prepared and purified free of endotoxin as described (Bernhagen et al. (1994) Biochemistry 33:14144-14155). Mouse IL-2, IL-4, and IL-12p70 were from R&D Systems.
  • mice were sensitized with an i.p. injection of OVA (20 ⁇ g, low endotoxin) in aluminum hydroxide gel and PBS on days 0 and 5. On days 12, 13 and 14, mice inhaled aerosolized OVA or PBS for 40 mins in a chamber connected to a NE- U07 nebulizer (OMURON Co.). OVA or PBS-challenged MIF +/+ and MIF "7" mice were sacrificed 16 hrs after the last challenge.
  • OVA i.p. injection of OVA (20 ⁇ g, low endotoxin
  • OVA or PBS-challenged MIF +/+ and MIF "7" mice were sacrificed 16 hrs after the last challenge.
  • Immunoglobulin subtypes and isotypes were measured by specific ELISA (Bethyl Laboratories).
  • OVA-specific IgE, IgGl, and IgG2a were measured in OVA-coate microtiter plates and revealed with HRP-conjugated, anti-IgE, IgGl, or IgG2a antibodies (Bethyl Laboratories).
  • OVA-specific IgE, IgGl, and IgG2a levels were expressed as the OD at 450nm.
  • Airway Measurements Airway hyper-responsiveness was assessed by methacoline- induced airflow obstruction of conscious mice placed in a plethysmograph (Zhu et al. (1999) Journal of Clinical Investigation 103:779-880). Mice were exposed to PBS (3 mins) and to increasing concentrations of methacholine via a NE-U07 nebulizer. Airflow obstruction was monitored for 3 mins after challenge and the Penh values were measured and averaged (Zhu et al. (1999) Journal of Clinical Investigation 103:779-88). Bronchoalveolar Lavage Fluid (BALF) and Histologic Analysis.
  • BALF Bronchoalveolar Lavage Fluid
  • Lungs were lavaged with ice-cold PBS 16 hrs after the last challenge, and the BALF pooled for analysis.
  • One half of the BALF cells were cyto-centrifuged and stained with May-Grunwald-Giemsa solution. Cells were classified as macrophages, lymphocytes, neutrophils, and eosinophils by morphological criteria. Eosinophils were quantitated by eosinophil peroxidase (Hisada et al. (1999) American Journal of Respiratory Cell and Molecular Biology 20:992-1000). Lungs were removed 16 hrs after the last challenge, inflated, and fixed overnight prior to paraffin-embedding and staining with periodic acid-Shiff (PAS).
  • PAS periodic acid-Shiff
  • RNA Analysis Total RNA was isolated using Trizol (GIBCO BRL). cDNA was prepared and amplified by SuperscriptTM One-Step RT-PCR using Platinum Taq polymerase (Invitrogen) and specific primers for MIF, IL-4, IL-5, IL-10, IL-13, IFN- ⁇ , and ⁇ -actin (MIF: 5'- ACGACATGAACGCTGCCAAC-3' (SEQ ID NO: 29) and 5'- ACCGTGGTCTCTTATAAACC-3' (SEQ ID NO: 30), IL-4: 5'- TATTGATGGGTCTCAACCCC-3' (SEQ ID NO: 31) and 5'- AAGTTAAAGC ATGGTGGCTCA-S' (SEQ ID NO: 32), IL-5: 5'- AGCAATGAGACGATGAGGCT-3' (SEQ ID NO: 33) and 5'- CATTTGC AC AGTTTTGTGGG-3' (SEQ ID NO: 34), IL-IO: 5'-
  • TGCTATGCTGCCTGCTCTTA-3' SEQ ID NO: 35
  • 5'-TCATTTCCGATAAGGCTTGG- 3' SEQ ID NO: 36
  • 5'-TCCACAGGATCCGTGTTTTAGC-S ' SEQ ID NO: 37
  • IL-13 5'-AGACCAGACTCCCCTGTGCA-S '
  • 5'- TGGGTCCTGTAGATGGCATTG-3' SEQ ID NO: 39
  • IFN- ⁇ 5.'- TTTGAGGTCAACAACCCACA-3' (SEQ ID NO: 40) and 5'- CGCAATCACAGTCTTGGCTA-3' (SEQ ID NO: 41), ⁇ -actin: 5'- GGTACCACCATGTACCCAGG-3' (SEQ ID NO: 42) and 5'-
  • ACATCTGCTGGAAGGTGGAC-3' (SEQ ID NO: 43)). Cycle conditions were: 30 mins at 48 0 C, 10 mins at 94 0 C, and each cycle (MIF: 28 cycles, IL-4: 38 cycles, IL-5 : 33 cycles, IL-IO: 40 cycles, IL-13: 38 cycles, IFN- ⁇ : 36 cycles, ⁇ -actin: 25 cycles) with 10 sec at 94 0 C, 45 sec at 6O 0 C, and 1 min at 72 0 C and 10 mins at 72 0 C. The RT-PCR of all samples from individual experiments were done in the same reaction and run on the same agarose gel.
  • CD4 + T cells, B cells, and APCs were >95% CD4 + , >95% B220 + , and ⁇ 5% Thyl.2 + , respectively.
  • B cell studies were performed at 2x10 5 cells/well.
  • CD4 + T cells from DOl 1.10H2dTg mice were co-cultured with APCs for 3 days (1 x 10 5 /well CD4+ T cells plus 3xlO 5 APCs/well) prior to the addition of [ 3 H]- thymidine.
  • IL-4, IL-5, IL-IO, and IFN- ⁇ were assayed with BD Biosciences ELISAs, and IL-2, eotaxin, and IL- 13 were measured with kits from R&D Systems.
  • the MIF ELISA followed a previously reported capture method employing an anti-MIF IgG polyclonal antibody (detection limit: 0.16 ng/ml) (Mizue et al. (2000) InternationalJournal of Molecular Medicine 5:397-403). Intracellular staining of IL-4 and IFN- ⁇ was performed by using Fixation/Permeabilization Solution Kit (BD Biosciences).
  • BTS British Thoracic Society
  • Asthma severity was defined by the Global Initiative for Asthma (GINA) criteria (mild intermittent, mild persistent, moderate persistent and severe persistent) based on clinical and lung function assessments (Global Initiative for Asthma (GINA). Global Strategy for Asthma management & Prevention. 2002. NHLBI/WHO Workshop report, Bethesda, MD, National Heart, Lung & Blood Institute for Health). Additional criteria pertaining to asthma severity that were studied included: a) lowest FEV 1 recorded in case notes, b) number of hospital admissions for asthma, c) number of days on oral corticosteroids in prior 12 months. The control group had similar pulmonary function studies performed and no evidence of airflow obstruction was found. Atopy was defined as a positive response to an allergen panel (Hizawa et al. (2004) American Journal of Respiratory & Critical Care Medicine 169:1014-8). AU studies were approved by institutional medical ethics committees.
  • Genotype Analysis Genomic DNA was isolated with the QIAamp DNA Blood Mini Kits (QIAGEN Ltd.). Analysis for the CATT MIF polymorphism was performed as previously described (Baugh et al. (2002) Genes Immun. 3:170-176). Statistical analysis was performed using the open-source R-package (R Development Core Team, 2004). The associations between categorical variables were explored using tabulations, and analysed using the Chi 2 test and log- linear modelling (R Development Core Team. R: Language and environment for statistical computing. R Foundation for statistical computing. (ISDN: 3-900051-00-3). 2004. Vienna, Austria).
  • any polynucleotide and polypeptide sequences which reference an accession number correlating to an entry in a public database, such as those maintained by The Institute for Genomic Research (TIGR) (www.tigr.org) and/or the National Center for Biotechnology Information (NCBI) (www.ncbi.nlm.nih. gov).
  • TIGR The Institute for Genomic Research
  • NCBI National Center for Biotechnology Information

Abstract

L'invention concerne des méthodes et des compositions pour sélectionner un patient à traiter à l'aide d'un agoniste ou d'un antagoniste d'un facteur d'inhibition de migration de macrophages (MIF), pour identifier un patient présentant un risque de développer une maladie associée à une expression MIF élevée ou faible, pour prédire la gravité d'une maladie associée à une expression MIF élevée ou faible chez un patient, et pour prédire si un patient est susceptible de développer une maladie associée à une expression MIF élevée ou faible. L'invention concerne également de nouvelles méthodes pour diagnostiquer un patient présentant une maladie associée à une expression MIF élevée ou faible. L'invention concerne encore des méthodes pour traiter un patient présentant une maladie ou un trouble associé à une expression MIF élevée ou faible.
PCT/US2006/016254 2005-04-26 2006-04-26 Agonistes et antagonistes de mif et leurs utilisations therapeutiques WO2006116688A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/919,307 US20100143379A1 (en) 2005-04-26 2006-04-26 Mif agonists and antagonist and therapeutic uses thereof

Applications Claiming Priority (14)

Application Number Priority Date Filing Date Title
US67530305P 2005-04-26 2005-04-26
US60/675303 2005-04-26
US68553305P 2005-05-27 2005-05-27
US60/685533 2005-05-27
US68748105P 2005-06-02 2005-06-02
US60/687481 2005-06-02
US68886505P 2005-06-08 2005-06-08
US60/688865 2005-06-08
US69883305P 2005-07-12 2005-07-12
US60/698833 2005-07-12
US72504905P 2005-10-07 2005-10-07
US60/725049 2005-10-07
US73279705P 2005-11-02 2005-11-02
US60/732797 2005-11-02

Publications (2)

Publication Number Publication Date
WO2006116688A2 true WO2006116688A2 (fr) 2006-11-02
WO2006116688A3 WO2006116688A3 (fr) 2007-07-26

Family

ID=37215552

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/016254 WO2006116688A2 (fr) 2005-04-26 2006-04-26 Agonistes et antagonistes de mif et leurs utilisations therapeutiques

Country Status (1)

Country Link
WO (1) WO2006116688A2 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009051846A3 (fr) * 2007-10-18 2010-03-18 Cell Signaling Technology, Inc. Translocation et kinase ros mutante dans l'épithélioma pulmonaire humain à grandes cellules
EP2198879A1 (fr) 2008-12-11 2010-06-23 Institut Curie Agent modulateur de CD74 pour la régulation de la migration de cellules dendritiques et dispositif pour l'étude de la capacité de motilité d'une cellule
US20110117107A1 (en) * 2009-04-29 2011-05-19 Morehouse School Of Medicine Compositions and methods for diagnosis, prognosis and management of malaria
US9238689B2 (en) 2011-07-15 2016-01-19 Morpho Sys AG Antibodies that are cross-reactive for macrophage migration inhibitory factor (MIF) and D-dopachrome tautomerase (D-DT)
WO2022124900A1 (fr) * 2020-12-11 2022-06-16 Sanquin Innovatie B.V. Traitement et prévention de l'anémie inflammatoire
CN115252636A (zh) * 2022-06-15 2022-11-01 南方医科大学顺德医院(佛山市顺德区第一人民医院) 一种寡聚脱氧核苷酸及其在制备抗肿瘤药物中的应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001083813A1 (fr) * 2000-05-02 2001-11-08 Centre National De La Recherche Scientifique Identification de marqueurs genetiques
WO2002007720A1 (fr) * 2000-07-26 2002-01-31 The Picower Institute For Medical Research Composes ayant une activite d'antagoniste de mif
US20030099653A1 (en) * 1993-05-17 2003-05-29 Bucala Richard J. Inhibition of migration inhibitory factor in the treatment of diseases involving cytokine-mediated toxicity
WO2003060468A2 (fr) * 2001-12-21 2003-07-24 Cytokine Pharmasciences, Inc. Polymorphisme promoteur du facteur d'inhibition des macrophages dans les maladies inflammatoires
WO2005020919A2 (fr) * 2003-08-29 2005-03-10 Cytokine Pharmasciences, Inc. Methode de traitement et dosage biologique faisant appel a un facteur d'inhibition de la migration des macrophages (mif) utilise comme facteur depresseur du myocarde d'origine cardiaque

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030099653A1 (en) * 1993-05-17 2003-05-29 Bucala Richard J. Inhibition of migration inhibitory factor in the treatment of diseases involving cytokine-mediated toxicity
WO2001083813A1 (fr) * 2000-05-02 2001-11-08 Centre National De La Recherche Scientifique Identification de marqueurs genetiques
WO2002007720A1 (fr) * 2000-07-26 2002-01-31 The Picower Institute For Medical Research Composes ayant une activite d'antagoniste de mif
WO2003060468A2 (fr) * 2001-12-21 2003-07-24 Cytokine Pharmasciences, Inc. Polymorphisme promoteur du facteur d'inhibition des macrophages dans les maladies inflammatoires
WO2005020919A2 (fr) * 2003-08-29 2005-03-10 Cytokine Pharmasciences, Inc. Methode de traitement et dosage biologique faisant appel a un facteur d'inhibition de la migration des macrophages (mif) utilise comme facteur depresseur du myocarde d'origine cardiaque

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BAUGH & DONNELLY: "Macrophage migration inhibitory factor: a neuroendocrine modulator of chronic inflammation." THE JOURNAL OF ENDOCRINOLOGY. OCT 2003, vol. 179, no. 1, October 2003 (2003-10), pages 15-23, XP002408028 ISSN: 0022-0795 *
BAUGH J A ET AL: "A functional promoter polymorphism in the macrophage migration inhibitory factor (MIF) gene associated with disease severity in rheumatoid arthritis." GENES AND IMMUNITY. MAY 2002, vol. 3, no. 3, May 2002 (2002-05), pages 170-176, XP008039746 ISSN: 1466-4879 *
DE BENEDETTI FABRIZIO ET AL: "FUNCTIONAL AND PROGNOSTIC RELEVANCE OF THE -173 POLYMORPHISM OF THE MACROPHAGE MIGRATION INHIBITORY FACTOR GENE IN SYSTEMIC-ONSET JUVENILE IDIOPATHIC ARTHRITIS" ARTHRITIS AND RHEUMATISM, LIPPINCOTT, PHILADELPHIA, US, vol. 48, no. 5, May 2003 (2003-05), pages 1398-1407, XP008071511 ISSN: 0004-3591 *
DONN RACHELLE P ET AL: "Macrophage migration inhibitory factor gene polymorphism is associated with psoriasis." THE JOURNAL OF INVESTIGATIVE DERMATOLOGY. SEP 2004, vol. 123, no. 3, September 2004 (2004-09), pages 484-487, XP002408026 ISSN: 0022-202X *
MORAND ERIC F ET AL: "Macrophage Migration Inhibitory Factor" ARTHRITIS AND RHEUMATISM. FEB 2003, vol. 48, no. 2, February 2003 (2003-02), pages 291-299, XP002408029 ISSN: 0004-3591 *
RENNER ET AL: "Macrophage Migration Inhibitory Factor: Gene polymorphisms and susceptibility to inflammatory disease." CLINICAL INFECTIOUS DISEASES, THE UNIVERSITY OF CHICAGO PRESS, CHICAGO, IL, US, vol. 41, 15 November 2005 (2005-11-15), pages S513-S519, XP008071560 ISSN: 1058-4838 *
SHI ET AL: "Technologies for detecting genetic polymorphisms in pharmacogenomics" MOLECULAR DIAGNOSIS, NAPERVILLE, IL, US, vol. 4, no. 4, December 1999 (1999-12), pages 343-351, XP005533504 ISSN: 1084-8592 *
SHI M W: "TECHNOLOGIES FOR INDIVIDUAL GENOTYPING: DETECTION OF GENETIC POLYMORHPISMS IN DRUG TARGETS AND DISEASE GENES" AMERICAN JOURNAL OF PHARMACOGENOMICS, XX, XX, vol. 2, no. 3, 2002, pages 197-205, XP009065150 ISSN: 1175-2203 *
ZHONG XIAO-BO ET AL: "Simultaneous detection of microsatellite repeats and SNPs in the macrophage migration inhibitory factor (MIF) gene by thin-film biosensor chips and application to rural field studies." NUCLEIC ACIDS RESEARCH. 2005, vol. 33, no. 13, 2005, page e121, XP002408027 ISSN: 1362-4962 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3072963A1 (fr) * 2007-10-18 2016-09-28 Cell Signaling Technology, Inc. Translocation et kinase ros mutante dans l'épithélioma pulmonaire humain à grandes cellules
US9328349B2 (en) 2007-10-18 2016-05-03 Cell Signaling Technology, Inc. Translocation and mutant ROS kinase in human non-small cell lung carcinoma
EP3741851A1 (fr) * 2007-10-18 2020-11-25 Cell Signaling Technology, Inc. Translocation et kinase ros mutante dans un carcinome pulmonaire non à petites cellules humaines
WO2009051846A3 (fr) * 2007-10-18 2010-03-18 Cell Signaling Technology, Inc. Translocation et kinase ros mutante dans l'épithélioma pulmonaire humain à grandes cellules
US10526661B2 (en) 2007-10-18 2020-01-07 Cell Signaling Technology, Inc. Translocation and mutant ROS kinase in human non-small cell lung carcinoma
AU2008314567B2 (en) * 2007-10-18 2014-11-20 Cell Signaling Technology, Inc. Translocation and mutant ROS kinase in human non-small cell lung carcinoma
US9096855B2 (en) 2007-10-18 2015-08-04 Cell Signaling Technology, Inc. Translocation and mutant ROS kinase in human non-small cell lung carcinoma
EP2198879A1 (fr) 2008-12-11 2010-06-23 Institut Curie Agent modulateur de CD74 pour la régulation de la migration de cellules dendritiques et dispositif pour l'étude de la capacité de motilité d'une cellule
US8846048B2 (en) 2009-04-29 2014-09-30 Morehouse School Of Medicine Compositions and methods for diagnosis, prognosis and management of malaria
US8367350B2 (en) * 2009-04-29 2013-02-05 Morehouse School Of Medicine Compositions and methods for diagnosis, prognosis and management of malaria
US20110117107A1 (en) * 2009-04-29 2011-05-19 Morehouse School Of Medicine Compositions and methods for diagnosis, prognosis and management of malaria
US9238689B2 (en) 2011-07-15 2016-01-19 Morpho Sys AG Antibodies that are cross-reactive for macrophage migration inhibitory factor (MIF) and D-dopachrome tautomerase (D-DT)
WO2022124900A1 (fr) * 2020-12-11 2022-06-16 Sanquin Innovatie B.V. Traitement et prévention de l'anémie inflammatoire
CN115252636A (zh) * 2022-06-15 2022-11-01 南方医科大学顺德医院(佛山市顺德区第一人民医院) 一种寡聚脱氧核苷酸及其在制备抗肿瘤药物中的应用

Also Published As

Publication number Publication date
WO2006116688A3 (fr) 2007-07-26

Similar Documents

Publication Publication Date Title
US20240124937A1 (en) Therapeutic and diagnostic methods for il-33-mediated disorders
Wei et al. Hypomethylation of the IL17RC promoter associates with age-related macular degeneration
US10765739B2 (en) Use of MIF and MIF pathway agonists
US8114590B2 (en) Diagnosis and treatment of chronic lymphocytic leukemia (CLL)
Devauchelle‐Pensec et al. Gene expression profile in the salivary glands of primary Sjögren's syndrome patients before and after treatment with rituximab
EP3250599B1 (fr) Biomarqueur
JP2017513937A (ja) Ｉｌ−１３アンアゴニストを用いて喘息を選択的に治療する方法
RU2663724C2 (ru) Способы определения восприимчивости пациента к внутрибольничной инфекции и составления прогноза развития септического синдрома
US20130316338A1 (en) CCR6 As A Biomarker of Alzheimer's Disease
WO2006116688A2 (fr) Agonistes et antagonistes de mif et leurs utilisations therapeutiques
JP2009520460A (ja) 心筋梗塞に関連する遺伝的多型、その検出方法および使用
CN104244979A (zh) 使用il-17拮抗剂治疗强直性脊柱炎的方法
US20100143379A1 (en) Mif agonists and antagonist and therapeutic uses thereof
US6913888B2 (en) Toll-like receptor 4 mutations
WO2015093557A1 (fr) Nouveau gène de fusion en tant que gène responsable du cancer de l'estomac
EP3922641A1 (fr) Procédés de détection et de traitement de patients covid nécessitant des soins intensifs
EP2391734A1 (fr) Marqueurs pour la prédiction et le suivi de réaction à une thérapie à base d'inhibiteurs des kinases aurora b
WO2019208542A1 (fr) Biomarqueur permettant de différencier la maladie de still et la septicémie
WO2018200755A1 (fr) Biomarqueurs de monocytes pour l'hypertension
CN116287272B (zh) Prdx5在诊断及治疗胶质瘤中的应用
KR102015527B1 (ko) 데스모글레인 3의 유전적 변이 및 이의 용도
KR20230165212A (ko) 적혈구 장애의 치료 방법
CN115315527A (zh) 用于治疗il33中存在风险等位基因的受试者的治疗方法
EP2524220A1 (fr) Facteurs de risque des phénotypes spirométriques induits par la fumée de cigarette
Ramsuran Genetic/epigenetic determinants in chemokines and chemokine receptor genes that influence HIV susceptibility in a cohort of high-risk women from South Africa.

Legal Events

Date Code Title Description
NENP Non-entry into the national phase in:

Ref country code: DE

NENP Non-entry into the national phase in:

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 06751775

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 11919307

Country of ref document: US