WO2006033352A1

WO2006033352A1 - Antibacterial peptide and lactobacillus capable of producing the peptide

Info

Publication number: WO2006033352A1
Application number: PCT/JP2005/017385
Authority: WO
Inventors: Shoko Koga; Megumi Moriyama; Izumi Kawakami
Original assignee: Omu Milk Products Co., Ltd.; Kumamoto Flour Milling Co., Ltd.
Priority date: 2004-09-22
Filing date: 2005-09-21
Publication date: 2006-03-30
Also published as: JPWO2006033352A1

Abstract

A novel antibacterial peptide (bacteriocin) having a primary structure composed of an amino acid sequence that is Met-Ala-Gly-Phe-Leu-Lys-Val-Val-Gln-Leu-Leu-Ala-Lys-Tyr-Gly-Ser-Lys-Ala-Val-Gln-Trp-Ala-Trp-Ala-Asn-Lys-Gly-Lys-Ile-Leu-Asp-Trp-Leu-Asn-Ala-Gly-Gln-Ala-Ile-Asp-Trp-Val-Val-Ser-Lys-Ile-Lys-Gln-Ile-Leu-Gly-Ile-Lys, which antibacterial peptide is preferred as an antibacterial agent for use in food storage, sterilization/disinfection, etc. effective even in neutral and alkali regions. The novel antibacterial peptide is produced by novel Lactococcus lactis strain QU1005 (NITE BP-23).

Description

Specification

Antibacterial peptide and lactic acid bacteria producing the peptide

Technical field

[0001] The present invention relates to a novel lactic acid strain and a novel antibacterial peptide produced by the strain.

Background art

[0002] As antibacterial substances produced by lactic acid bacteria, low molecular weight compounds such as organic acids such as lactic acid, hydrogen peroxide, and diacetyl are already known. In addition, the existence of antibacterial substances consisting of peptides (pacteriocins) is also known, for example nisin produced by Lactococcus lactis Α ϋ Am Am. Chem. So 1971 Sep 8; 93 (18): 4634-5), Nisin Z (Eur. J.

Biochem. 1991 Nov 1; 201 (3): 581-4). Nisin is derived from lactic acid bacteria and is a highly safe antibacterial substance that is degraded by human digestive enzymes and is widely used as a food preservative mainly in Europe and the United States. However, since nisin is stable in the acidic range and neutral in the alkaline range and unstable in the alkaline range, foods that can be used as food preservatives are limited to those that are acidic or weakly acidic.

In the medical field, nosocomial infections caused by attenuated microorganisms such as MRSA and VRE have become a problem due to the emergence of multidrug-resistant bacteria due to heavy use of antibiotics. At present, sterilization and disinfection with ethanol products are mainly used, but high concentrations of ethanol cause rough hands, and there is concern about infection from that part and the spread of adherent bacteria. Alternative sterilization · Disinfection is required.

Non-Patent Document 1: J. Am. Chem. Soc. 1971 Sep 8; 93 (18): 4634-5

Non-Patent Document 2: Eur. J. Biochem. 1991 Nov 1; 201 (3): 581-4

Disclosure of the invention

Problems to be solved by the invention

[0003] An object of the present invention is to find a novel lactic acid bacterium that can produce an antibacterial substance that has not been known so far, and is effective in the preservation of food, sterilization and disinfection, etc., even in neutral and alkaline regions.

Replacement i¾ 纖 (Rule 26) It is to provide useful technology.

[0004] As a result of repeated researches focusing on antibacterial substances produced by lactic acid bacteria, the present inventor has found that the genus Bacillus, Micrococcus, Listeria, Pediococcus, and Enalococcus (Enterococcus), Lactococcus genus, Lactobacillus genus, Leuconostoc genus, which has antibacterial properties against microorganisms that cause food degradation (ie, sensitive gram-positive bacteria) A new lactic acid strain, Latococcus lactis, that produces a substance that has an inhibitory activity against it, identified the antibacterial substance (peptide), identified its primary structure, and elucidated its properties Thus, the present invention was derived.

In essence, the present invention provides an antimicrobial peptide having a primary structure consisting of the following amino acid sequence (SEQ ID NO: 1). The N-terminal methionine is formylated.

[0005] [Chemical 1] SEQ ID NO: 1

Nth amino acid from the N-terminal

[0006] Further, according to the present invention, there is provided a novel strain of Lactococcus lactis, that is, the QU 1005 strain (accession number: MTE BP-23), which produces the above-mentioned antibacterial peptide.

The invention's effect

[0007] According to the present invention, an antibacterial peptide suitable as a material for an antibacterial agent useful for food preservation, antibacterial 'disinfection and the like is provided.

Brief Description of Drawings [0008] FIG. 1 shows the results of a pH stability test in which the antibacterial peptide of the present invention (latathicin Q) was compared with nisin Z.

FIG. 2 shows the results of a thermal stability test comparing the antibacterial peptide of the present invention (latathicin Q) with nisin Z.

FIG. 3 shows the results of an ethanol stability test in which the antimicrobial peptide (latathicin Q) of the present invention was compared with nisin Z.

BEST MODE FOR CARRYING OUT THE INVENTION

[0009] The antibacterial substance obtained by the present invention is a novel peptide (batteriocin) produced by a ratatococcus' latatis strain isolated from corn produced in Aso, Kumamoto Prefecture. It is considered to be a new type of bacteriocin composed of an amino acid sequence different from that of ratatocossin.

Hereinafter, the implementation of the present invention will be carried out along with the isolation and characterization of a novel strain, the production and purification of antibacterial peptides from the strain, the determination of the sequence of the encoded DNA, and the elucidation of the properties of the peptide. A form is demonstrated in detail.

[0010] (1) Isolation method of lactic acid bacteria

In order to obtain natural wild strains of lactic acid bacteria, various foods are used as the separation source, and MRS medium (manufactured by OXOID), M17 (manufactured by MERCK) medium with high selectivity for lactic acid bacteria, or sterilized distilled water is used for enrichment culture. went. Screening using antibacterial activity as an index was performed using bacteria isolated from the enrichment culture. That is, after growing colonies on the MRS agar medium, overlay the soft agar medium mixed with the culture solution of various gram-positive bacteria (the above-mentioned microorganisms causing food deterioration) as the indicator bacteria, and culture at the optimum temperature. Thereafter, a strain in which a growth inhibition circle of indicator bacteria formed around the colony was observed was isolated.

[0011] (2) Sexuality analysis of isolates

As a result of screening, a strain having excellent antibacterial properties was discovered. This strain was isolated from corn harvested at Aso Pass in Kumamoto Prefecture. Gram staining, catalase activity test, motility test, cell morphology observation, sugar fermentation test, production lactic acid content, production lactic acid rotation, and gas generation test from glucose were investigated. The characteristics of the strain are facultative anaerobic, gram positive, catalase negative, no motility, cell morphology is S. aureus, It was a fermentative fungus. In addition, as a result of 49 kinds of sugar fermentability tests (API system), this strain showed the sugar fermentability shown in Table 1. From this result, this strain was identified as Lactococcus lactis, and named Lactococcus lactis QU 10 05 strain. This QU

The 1005 strain has been deposited with the Patent Microorganism Depositary, and the deposit number is NITE BP-23 (Hara Depositary 15 September 2004).

[table 1]

Sugar fermentation of QU 1005 strain

Identification of strains by 16S rDNA sequencing analysis

Currently, the most widely used method as an index for phylogenetic classification of microorganisms is the base sequence (16S rDNA) of the gene encoding 16S rRNA. In order to clarify the phylogenetic position of QU 1005, the base sequence (16S rDNA) of the gene encoding 16S rRNA was determined, and homology search was performed using a database. That is, the i _6S rDNA was examined for about 500 bp in the upstream portion of about 1.5 kbp.

Using MagExtractor Kit -Genome- (TOYOBO) from the culture solution of QU 1005 strain Total genomic DNA was extracted. A single amplified fragment was obtained by polymerase chain reaction using the primer shown in SEQ ID NO: A as a saddle type. Thereafter, the amplified fragment was ligated to pGEM-T cloning vector (Promega), and E. coli JM109 was transformed by the heat shock method using this ligation product. The transformant was cultured in LB medium for 8 hours, and then the plasmid was extracted using MagExtractor- Plasmid (manufactured by TOYOBO). This plasmid was used as a type of sequence reaction. Thermo Sequence fluore scent labeled primer cycle for sequencing reactions

A sequencing kit (manufactured by Falmasia) was used.

As a result, the base sequence of SEQ ID NO: B (nucleotide alignment IJ) was obtained. As a result of homology search using the nucleotide sequence database of SEQ ID NO: B, it showed 100% homology with Lactococcus lactis.

[0014] [Chemical 2] SEQ ID NO: Λ

8A 5'-AGA-GTT-TGA-TCC-TGG-CTC-AG-3 '(20 mer) Tm = 5S. 3 ° C

1510R 5 '-ATT ACC GC (C / G) GCT GCT G-3' (16 mer) Tm = 55,2 ° C

[0015] [Chemical 3]

SEQ ID NO: B

Query: QU 1005. Subject: Lactococcus I act is subsp. Lactis

I dent i t i es = 540/540 (100%), Gaps = 0/540 (0%)

Query I GAGCGCTGAAGGTTGGTACTTGTACCAACTGGATGAGCAQCQAACGQGTaAGTAACGCGT 60

Sbjct 35 GAGCGCTGAAG6TT66TACTTQTACCAACTGGATGAGCAGCGAACGGGTGA6TAACGCGT 94

Query 61 GGGGAATCTGCCTTTGAGCGGGGGACAACATTTGGAAACGAATGCTAATACCGCATAAAA 120

Sbjct 95 GGGGAATCTGCCTTTGAGCGGGGGACAACATTTGGAAACGAATGCTAATACCGCATAAAA 154

Query 121 ACTTTAAACACAAGTTTTAAGTTTQAAAGAT6CAATTGCATCACTCAAAGATGATCCCGC 180

Sbjct 155 ACTTTAAACACAAGTTTTAAGTTTGAAAGATGCAATTGCATCACTCAAAGAT6ATCCCQC 214

Quer 181 GTTGTA 丌 AGCTAGTTGGTGAGGTAAAGGCTCAGCAAGGGGATGATACATAGCCGACGTG 240

Sbjct 215 GTTGTATTAGCTAGTTGGTGAQGTAAAGGCTCACCAAGGCGATGATACATAGCCGACCTG 274

Query 241 AGAGG6TGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACQ6GA66CA6CAG 300

Sbjct 275 AGAGGGTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAaGCAGCAG 334

Query 301 TAQ6GAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGG 360

Sbjct 335 TAGGGAATCTTCGGCAAT6GACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGG 394

Query 361 TTTTCGGATCGTAAAACTCTQTTGGTAQAGAA6AACGTTGGTGAGAGTGGAAAQCTCATC 420

Sbjct 395 TTTTC6GATCGTAAAACTCTGTTGGTAGAGAAGAACGTTGQTGAGAGTGGAAAGCTCATC 454

Query 421 AAGTGACGGTAACTACCCAGAAAGGGACGGCTAACTACGTGCCAGCAGCCGCGGTAATAC 480

Sbjct 455 AAGTGACGGTAACTACCCAGAAAGGGACGGCTAACTAC6TQCCAGCA6CC6CG6TAATAC 514

Query 481 GTAGGTCCCGAGCGTTGTGCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAA 540

Sbjct 515 GTAGGTCCCGAGCQTTGTCCGGATTTATT66GCGTAAAGCGAGCGCAGGT6GTTTATTAA 574

16S rDNA sequence comparison between QU 1005 and muc lactis (3) Antibacterial activity test

In order to investigate whether antibacterial substances were produced in the liquid medium by the QU 1005 strain, the culture supernatant obtained by centrifuging was collected after culturing in the MRS liquid medium for 18 hours. The pH was adjusted to 6 using 1M NaOH and then sterilized by filtration as a test sample. Test samples were diluted 2-fold and used for antibacterial activity tests. 10 μl of a serial dilution of the test sample was dropped on a soft agar medium containing the indicator bacteria. Antibacterial activity was calculated as XX 1000/10 (AU / ml), where X is the maximum dilution factor at which a well-defined growth-inhibiting circle was observed. As a result, the culture supernatant of the QU 1005 strain showed the antibacterial spectrum shown in Table 2. Antibacterial substances (antibacterial peptides) produced by the QU 1005 strain Called.

[0017] [Table 2] Antibacterial spectrum of culture supernatant of U 1005 strain

[0018] (4) Production and purification method of antibacterial substance

Isolate QU 1005 was precultured in MRS medium, and 8 ml of the preculture was inoculated into 250 ml of MRS medium. After stationary culture at 30 ° C for 12 hours, the supernatant was collected after centrifugation at 6000 rpm. The activity of the culture supernatant (200 ml) against the indicator bacterium Bacillus coagulans JCM 2257 ^{τ was} 2.56 × 10 ⁶ (AU / ml). Three times (600 ml) of chilled acetone was added to the culture supernatant, cooled at 30 ° C. for 1 hour, and then centrifuged at 6000 rpm to precipitate and collect antibacterial substances. The collected precipitate was redissolved in 100 ml of 20 mM sodium phosphate buffer (pH 5.7).

The column was filled with 16 ml of SP-Sepharose cation exchange resin (manufactured by Pharmacia), 100 ml of redissolved sample was added, and the column was equilibrated with sodium phosphate buffer. Sodium phosphate buffer (40 ml each) containing 0.25, 0.5, 0.75, l.OM NaCl was applied at a flow rate of 2 ml / minute, and fractional elution was performed stepwise.

As a result of measuring the antibacterial activity of each eluted fraction, the activity of the 0.25M NaC1 eluted fraction, which had the strongest activity, was 2.05 × 10 ⁶ (AU / ml). The 0.25M NaCl eluate (40 ml) was subjected to reverse phase HPLC (column: RESOURCE RPC 3 ml manufactured by Falumasia). As the mobile phase, MilliQ water containing 0.1% trifluoroacetic acid was used, and linear concentration gradient of acetonitrile (gradient 20 to 80%), flow rate of 1 ml / min, and fractionation at 30 ml at 1 ml per fraction. A UV-visible spectrophotometer (wavelength 220, 280 nm) was used as the detector. Measure the antibacterial activity of 30 fraction samples and A strong fraction was obtained.

The purified antibacterial substance thus obtained exhibited the antibacterial spectrum shown in Table 3. Compared with nisin A, a known bacteriocin, ratathicin Q showed higher levels and antibacterial activity (small level, MIC (minimum growth inhibitory concentration) value) against Enteroocccus genus.

[Table 3] Comparison of antibacterial spectra of lactisin Q and nisin A

[0020] (5) ESI-TOF MS analysis

The antibacterial substance purified as described above was subjected to mass spectrometry using an electrospray time-of-flight mass spectrometer (ESI-TOF MS, manufactured by JEOL Ltd.). As a result, it became clear that Ratathisin Q is a mass of 5926.

[0021] (6) N-terminal amino acid sequence analysis

The antibacterial substance purified as described above was subjected to N-terminal amino acid analysis using an amino acid sequencer utilizing Edman degradation. As a result, Edman degradation did not proceed and the amino acid sequence could not be obtained.

[0022] (7) Cyanogen bromide treatment of antibacterial peptides

Since Edman degradation did not proceed in (6) above, for the purpose of cleaving the N-terminal methionine residue of the antibacterial peptide, it was treated with cyanogen bromide and purified again by reverse phase HPLC. As a result of mass spectrometry of the purified peptide, an actual measurement value of 5767 was obtained. 159, the difference in mass before and after cyanogen bromide treatment, was consistent with the mass of formylmethionine. From this result, it was shown that the N-terminus of the antibacterial peptide was blocked by formylmethionine, so that Edman degradation did not proceed. In addition, N-terminal amino acid analysis of the peptide obtained by cyanogen bromide treatment was performed in the same manner as described above. As a result, 50 amino acid residues were revealed from the N-terminus of the peptide shown in SEQ ID NO: 2. As a result of calculating the mass of the antibacterial peptide deduced from the obtained amino acid sequence IJ, it was not consistent with the mass of the above (5), suggesting that the obtained amino acid sequence was insufficient. .

[Chemical 4]

SEQ ID NO: 2

[0024] (8) Determination of structural gene of antibacterial peptide

A digitate primer was constructed from a part of the amino acid sequence of the antibacterial peptide obtained as described above, and the structural gene of the antibacterial peptide was obtained by polymerase chain reaction (PCR). QU 1005 strain power Whole genomic DNA was extracted by CTAB method and used as PCR in PCR. A single amplified fragment was obtained by the nested PCR method.

Thereafter, the amplified fragment was ligated into pGEM-T cloning vector (Promega), and E. coli JM109 was transformed by the heat shock method using this ligation product. After transformants were cultured in LB medium for 8 hours, the plasmid was extracted using MagExtractor-Plasmid (manufactured by TOYOBO). This plasmid was used as a type of sequencing reaction. Thermo Sequence fluorescent labeled primer cycle

A sequencing kit (manufactured by Falmasia) was used.

As a result, the nucleotide sequence of SEQ ID NO: 3 (nucleotide arrangement was obtained. The amino acid sequence obtained by converting the obtained nucleotide sequence was identical to the sequence of residues 10 to 39 of SEQ ID NO: 2. .

[0025] [Chemical 5] SEQ ID NO: 3

[0026] Furthermore, a new primer was constructed based on the base sequence obtained here, and the base sequence encoding the C-terminal portion of the antibacterial peptide was obtained by anchor PCR. In other words, the whole genomic DNA of the QU 1005 strain was digested with restriction enzymes and ligated randomly to a PUC18 cloning vector in which MCS (multicloning site) was similarly treated with restriction enzymes. A single amplified fragment was obtained by the nested PCR method using the ligation product thus obtained. The obtained PCR amplified fragment was transformed into E. coli JM109 by the same method as described above, and sequence analysis was performed.

As a result, the base sequence of SEQ ID NO: 4 was obtained. The amino acid sequence obtained by converting the obtained base sequence was consistent with the sequence of residues 36 to 50 of SEQ ID NO: 2. In addition, the presence of isoleucine and lysine residues was confirmed after the 50th glycine residue of SEQ ID NO: 2, followed by a stop codon.

[0027] [Chemical 6]

SEQ ID NO: 4

[0028] The theoretical value of the molecular weight of the antibacterial substance deduced from the amino acid base sequence thus obtained was calculated (the methionine of the first residue in SEQ ID NO: 1 was calculated as formylmethionine). Thus, since this theoretical value coincided with the actually measured value obtained in (5), it was revealed that this antibacterial substance was a peptide consisting of 53 amino acid residues represented by SEQ ID NO: 1.

[0029] (9) Elucidation of various properties of antibacterial peptides

(Production of antibacterial substances and preparation of sampnore for testing) The isolate QU 1005 strain and nisin Z-producing strain were cultured in a basic medium containing glucose, yeast extract and calcium carbonate. After centrifuging the culture solution, rataticin Q and nisin Z were roughly purified from the obtained culture solution supernatant using a synthetic adsorbent. The following tests were performed using the obtained roughly purified sample. In HPLC analysis, the amount showing the same peak area as 1 unit of nisin (25 ng of purified nisin) was defined as one unit of each bacteriocin.

[0030] ϋΗ Stability Test

Crudely purified ratathicin Q and nisin koji were prepared using sterile distilled water at 4200 units / ml, respectively. Sampnole adjusted to pH 3-9 with N / 5 hydrochloric acid and N / 10 sodium hydroxide is stored at 45 ° C, and the amount of ratatisin Q and nisin Z remaining over time is measured by HPLC. analyzed.

The results are shown in Figure 1. In Fig. 1, the survival rate is determined as survival rate (%) = (bacteriocin amount after n days / bacteriocin amount on day 0 of experiment) x 100. As a result, at pH7 and pH9, nisin Z was almost completely degraded by the fifth day after the start of the experiment, whereas ratathicin Q was 5% after 47 days in such neutral and alkaline regions. About 80% remained without being decomposed.

[0031] Thermal stability test

Crudely purified ratathicin Q and nisin Z were prepared using sterilized distilled water to 4200 units / ml each, and the pH was adjusted to 3-9 using N / 5 hydrochloric acid and N / 10 sodium hydroxide. It was adjusted. Samples were heat-treated at 90 ° C. for 30 minutes or 110 ° C. for 10 minutes, and the amounts of ratathicin Q and nisin Z remaining after the heat treatment were analyzed by HPLC.

The result is shown in figure 2. In FIG. 2, the survival rate is determined as survival rate (%) = (bacteriocin amount after heat treatment Z amount of bacteriocin before heat treatment) × 100. As a result, it showed higher thermal stability than Nisin Z in the neutral to alkaline range of pH7 and pH9.

[0032] Ethanol stability test

Crude purified products of ratathicin Q and nisin Z were added to 40%, 50% and 60% ethanol solutions to 4200 units / ml, respectively. Each sampnole adjusted to pH 5 with N / 10 sodium hydroxide is stored at 45 ° C, and ratatisin Q and The amount of syn-Z was analyzed by HPLC.

The results are shown in Figure 3. In Fig. 3, the survival rate is obtained as survival rate (%) = (bacteriocin amount after n days elapse z bacteriocin amount on the start date of experiment (day 0)) x 100. As a result, nisin Z has a residual nisin Z content of about 10% in all samples 30 days after the start of storage, whereas ratathicin Q is about 50% in 50, 60% ethanol, 70% remained in 40% ethanol. From these results, it was shown that ratathicin Q is superior to nisin Z in stability in ethanol.

[0033] Nisin, which is actually used as a food preservative overseas, is stable in acidity, but unstable in neutral and alkaline regions and has a property of being easily decomposed. Since the antibacterial peptide (latathicin Q) of the present invention is excellent in neutral and alkaline stability, the bacteriostatic effect of such foods can be expected. Rataticin Q is also excellent in ethanol stability and can be used as a material for ethanol-based antibacterial agents. Accordingly, the force S described below in further detail with reference to examples, and the present invention is not limited to these examples.

Example 1

[0034] Food Preservation Test (Fried Egg Preservation Test)

A comparative study with Nisin Z was conducted based on the bacteriostatic effect of Ratathicin Q on fried eggs, a weak alkaline food.

Using the crudely purified product of ratathisin Q and nisin Z (prepared with sterile distilled water to 4200 units / ml), the ingredients were mixed at the ratios shown in Table 4 to prepare fried eggs. After preparing the fried egg, it was stored at 25 ° C for 24 hours, and the number of viable bacteria after storage was examined. (The amount of batateriocin solution added was 1.5% for eggs.)

[0035] [Table 4] Mixing ratio (wt%)

Unadded Caro Lacticin Q added Nisin Z added

Egg 100 100 100

Water 12.fi 11.1 11.1

1 1 1

Starch 0.6 0.6 0.S

Lacticin Q-1.5

Nisin Z 1 ― 1.5 The results are shown in Table 5. As a result, when ratathicin Q was added to the fried egg, which is a weak alkaline food, the number of viable bacteria could be reduced by about an order of magnitude compared to the case of adding nisin Z.

[Table 5] Food storage stability test results (general viable count: pcs / g)

Example 2

[0037] Antibacterial activity test of ethanol-based ratathicin Q

Ratatisine Q crude purified sample was added to 30% ethanol to a final concentration of 200 μg / ml. The pH was adjusted to 3.5 using N / 5 hydrochloric acid. The antibacterial activity was evaluated by bioassay using a 30% ethanol solution and 200 μg / ml ratathicin Q aqueous solution as controls. To the prepared sample (200 μl), 20 μl of indicator medium culture solution (107 CFU / ml) was added and contacted for 1 minute. Thereafter, sample 1001 mixed with indicator bacteria was mixed with 100 μΐ of SCDLP medium (manufactured by Eiken Kikai Co., Ltd.), and cultured at the optimum temperature for each indicator bacteria. After 24, 48 and 72 hours, the presence or absence of indicator bacteria was visually confirmed. The indicator bacteria include Escherichia c oil, Staphylococcus epidermidis, and Listeria.

innocua).

The results are shown in Table 6. As a result, the aqueous solution containing only ratatisin Q did not show bacteriostatic effects on the indicator bacteria, but by combining ratatisin Q with 30% ethanol, it can be used in staphylococci, listeria, and even gram-negative bacteria. It also showed bacteriostatic effect for 72 hours or more against some E. coli. This effect was superior to the use of 30% ethanol alone.

Ratathicin Q has an excellent antibacterial effect against Enterococcus bacteria, and is therefore expected to show antibacterial effects against nosocomial pathogens such as VRE and MRSA, and can be expected as an excellent antibacterial material.

[0038] [Table 6] Antimicrobial activity of 30% ethanol-based lactisin Q '14 test

Incubation time (hours)

Escherichia coli Staphylococcus re: Suwa ¾

24 48 72 24 48 72 24 48 72

30% ethanol---+ + + + +--+ +

Lacticin Q + + Ten + + + + + + + + + Ten + + + + +

30% Ethal Ratathisin Q

+: Fungus growth · · · No fungus growth Industrial applicability

The new strain of the present invention and the antibacterial peptide produced thereby can be used in many fields as a material for antibacterial agents for the purpose of food preservation and sterilization 'disinfection, and in particular, neutral and alkaline It is valid even if used in the domain.

Claims

The scope of the claims

The following amino acid sequence:

Met- Ala- Gly- Phe- Leu- Lys- Val- Val- Gin- Leu- Leu- Ala- Lys- Tyr- Gly- Ser- Lys- Ala- Val- Gin- Trp- Ala- Trp- Ala- Asn- Lys- Gly- Lys- II e- Leu- Asp- Trp- Leu- Asn- Ala- Gly- Gin- Ala- He- Asp- Trp- Val- Val- Ser- Lys- lie- Lys- Gin- lie- Leu ― Gly— He― Lys

An antibacterial peptide having a primary structure consisting of

A DNA encoding the peptide of claim 1.

The Lactococcus lactis QU 1005 strain (NITE BP-23) which produces the antimicrobial peptide of claim 1.

An antibacterial agent comprising the antibacterial peptide of claim 1 as an active ingredient.