KR101132371B1 - Non-toxic new microbes having inhibitory activity growing for Bacillus cereus and sauce including them - Google Patents

Abstract

The present invention relates to a novel strain Bacillus licheniformis SCK 121057 strain (KCCM 11052P) having an inhibitory effect on Bacillus cereus proliferation and to Jangjang containing the same.
More specifically, the strain produces a polyglutamate as a non-toxic strain, but does not produce a biogenic amine, and Bacillus rickenomyces SCK 121057 strain having excellent bacillus cereus growth inhibition ability and the same It contains tojang, makjang miso, makjang, juice juice, Cheonggukjang, Dambukjang, Gochujang.
Through the present invention, it is possible to produce safer food products, so it can contribute to the development of the food industry and further development of the domestic food industry, the industrial applicability is very high.

Description

Non-toxic new microbes having inhibitory activity growing for Bacillus cereus and sauce including them}

The present invention relates to a microorganism, called antagonitic microbe, which can inhibit the growth and proliferation of pathogens.

More specifically, the present invention relates to a non-toxic new strain having an inhibitory effect on Bacillus cereus growth, and to entertaining the same, wherein the toxin-producing Bacillus cereus (hereinafter referred to as B. cereus ), which is a problem during fermentation of traditional intestines. The present invention relates to a technology for producing non-toxic, traditional toxin-free B. cereus by separating antagonists that effectively inhibit the growth of bacteria, examining their properties, and then applying them to the production of soy.

In the present invention, Bacillus licheniformis SCK121057 strain, which is a non-toxic antagonist that inhibits the growth of Bacillus cereus bacteria, was isolated and identified from traditional Korean berries.

Furthermore, in order to ensure the completion and repeatability of the invention, the Bacillus rickenformis strain was deposited with the Korean spawn association on November 9, 2009 (Accession No. KCCM11052P).

Since 2007, to ensure food safety, the Korea Food and Drug Administration (KFDA) has announced that the number of B. cereus bacteria allowed in all commercial enteric products, including Doenjang, Kochujang, Cheonggukjang and Chunjang, is less than 1 x 10 ⁴ CFU / g. . However, because B. cereus is not only common in nature, but also forms spores, resists heat, and grows well in soybeans, the number of B. cereus bacteria defined by KFDA is found in most traditional types of farmers who do not have a Hazard Analysis Critical Control System (HACCP). It is difficult to keep the acceptable range.

The present invention has found that the B. cereus bacterial count is very low in some products during the monitoring of B. cereus counts in traditional intestines. This was separated gilhanggyun of inhibiting B. cereus in these Paste Because be thought to be caused predominantly of bacteria in the antibacterial ability for B. cereus by acting as antagonists to each other Bacillus sokdeul ever.

B. cereus is a Gram-positive bacterium belonging to Bacillus sub group I together with Bacillus mycoides, Bacillus thuringiensis, and Bacillus anthracis.It is a soil and air floating microorganism. -Secretes hemolytic enterotoxin (Nhe), hemolytic enterotoxin (Hbl), cytotoxin K (CytK). Among them, cereulide, which contains D-type amino acids and has a structure of cyclic peptide, has a strong resistance to heat and proteolysis, unlike protein diarrhea toxins. Since the diarrhea toxin gene of B. cereus is located on the chromosome, the vomiting toxin gene is located on the plasmid, so B. cereus can be divided into a species that causes both vomiting and diarrhea and only diarrhea. In the case of diarrheal toxin strains, the amount of toxin secretion varies depending on the fermentation state because the phospholipase C regulator (PlcR), a transcriptional regulator protein, binds to the transcription factor PapR to regulate the expression of toxins (Gohar, M., K). Faegri, S. Perchat, S. Ravnum, O. Okstad, M. Gominet, A. Kolste, and D. Lereclus. 2008. The PlcR virulence regulon of Bacilluscereus. PLoSOne 3, 1-9.).

Bacillus subtilis and Bacillus licheniformis are the most important bacteria in enteric fermentation, and some of these strains have been reported to produce a variety of surfactants or antibiotics that inhibit the proliferation of competitive bacteria (Grangemard). , I., J. Wallach, R. Maget-Dana, and F. Peypoux. 2001. Lichenysin: A more efficient cation chelator than surfactin.Appl. Biochem. Biotechnol. 90,199-210.). Bacillus subtilis bacitracin, surfactin, iturins and Bacillus licheniformis lichenysin, lichenicidine and others are anti-bacterial or antifungal properties as peptide-based small molecule materials (De Lucca, AJ and TJ Walsh. 1999. Antifungal peptides: Novel therapeutic compounds against emerging pathogens.Antimicrob.Agents Chemother. 43, 1-11.).

In the present invention, Bacillus licheniformis SCK121057 strain, which is a non-toxic antagonist that inhibits the growth of Bacillus cereus bacteria, was isolated and identified from traditional Korean berries.

Furthermore, in order to ensure the completion and repeatability of the invention, the Bacillus rickenformis strain was deposited with the Korean spawn association on November 9, 2009 (Accession Number: KCCM11052P).

Health authorities around the world regulate the number of these bacteria in food because of the toxins produced by B. cereus . Since 2007, the Korea Food and Drug Administration has been managing the number of B. cereus bacteria that are allowed in all commercial marketed products including Doenjang, Kochujang, Cheonggukjang, and Chunjang at 1 x 10 ⁴ CFU / g or less.

However, B. cereus is not only common in nature, but also spore-forming, heat-resistant, and growing well in soybeans, making it difficult to manage B. cereus bacteria below a certain number in traditional small and medium sized soybean manufacturers.

Therefore, after separating the antagonistic bacteria, which are microorganisms that can inhibit the growth or proliferation of B. cereus , investigate the characteristics thereof, and then apply them to the production of soybeans to develop a technology for producing non-toxic traditional tofu without B. cereus There is a purpose.

The technical objects to be achieved by the present invention are not limited to the above-mentioned technical problems, and other technical subjects which are not mentioned can be clearly understood by those skilled in the art from the description of the present invention .

In order to solve the problems of the prior art, the present invention provides Bacillus licheniformis SCK 121057 strain (KCCM 11052P).

The strain may be characterized by inhibiting the growth of Bacillus cereus ( Bacillus cereus ).

The strain may be characterized by not producing toxins (Non-toxic).

The strain may be characterized in that it does not produce a biogenic amine.

The biogenic amine may be characterized as tyramine or histamine.

The strain may be characterized by producing polyglutamate.

In another aspect, the present invention provides a bowel containing Bacillus rickeniformis SCK 121057 strain (KCCM 11052P).

Preferably the Jangjang may be characterized in that any one selected from the group consisting of meju, Korean soy sauce, brewed soy sauce, mixed soy sauce, Korean soybean paste, miso, seasoned soybean paste, red pepper paste, seasoned red pepper paste, Chunjang, Cheonggukjang and mixed soy sauce. .

The present invention is to isolate the antagonistic bacteria inhibiting the growth of toxin-producing B. cereus bacteria during fermentation of traditional intestines, culture the antagonists to measure the antagonism, isolate and identify the antagonists, and then check the antagonism Identify genes of toxins and antimicrobials and inoculate antagonists into intestine at the same time to inhibit the growth of B. cereus .

The novel strain Bacillus licheniformis SCK 121057 (KCCM11052P) of the present invention may have a beneficial effect of inhibiting the growth of Bacillus cereus bacteria and producing safe food products without toxicity.

In Figure 1 (A) is a colony form of the SCK121057 strain of the present invention, (B) is a scanning electron micrograph (SEM) photograph of SCK121057.
Figure 2 shows the growth curve of the SCK121057 strain and the production of antimicrobial agents. '●' represents growth of SCK121057 strain, and '○' represents production of antibacterial agent.
Figure 3 shows that the SCK 121057 bacteria by PCR ((Polymerase Chain Reaction) to determine whether they have these synthetic or modified enzyme genes, through gel electrophoresis (A) is' B .licheniformis SCD112023 as a positive control, (B) is ' B.licheniformis SCD112028 as a negative control', (C) is 'The strain SCK121057', while lane 1 represents lichenysin synthetase A, lane 2 lane 3 represents lichenysin synthetase B, lane 3 represents lichenysin synthetase C, lane 4 represents lantibiotic modification enzyme 1, lane 5 represents lantibiotic modification enzyme 2, lane 6 represents surfactin synthetase A, lane 7 represents surfactin synthetase B Lane 8 represents surfactin synthetase C.
Figure 4 shows the results of electron microscopy after centrifugation supernatant of SCK 121057 culture medium in B. cereus culture medium and further incubation. (A) is one that will not process the SCK121057 B.cereus strain as a control, (B) and (C) processing the SCK121057 strain for 8 hours to B.cereus. Bar length is 5 micrometers.
Figure 5 shows the bacterial count of B. cereus for each culture period put strain SCK121057 of the present invention in enteric fermentation. '●' was incubated for 31 days at the mixing ratio of B. licheniformis (SCK 121057) in B. cereus at 1:10, and '○' was not treated with B. licheniformis (SCK 121057) in B. cereus . Incubated for 31 days on nutrient broth.

The present invention relates to a non-toxic novel strain having a bacillus cereus proliferation inhibitory ability and to enteric foods containing the same.

More specifically, the present invention relates to Bacillus licheniformis SCK 121057 strain (KCCM 11052P).

The strain may be characterized by inhibiting the growth of Bacillus cereus ( Bacillus cereus ).

The strain may be characterized by not producing toxins (Non-toxic).

The strain may be characterized in that it does not produce a biogenic amine.

The biogenic amine may be characterized as tyramine or histamine.

The strain may be characterized by producing polyglutamate.

The present invention also relates to enteric foods comprising Bacillus rickenomyces SCK 121057 strain (KCCM 11052P).

Preferably the Jangjang may be characterized in that any one selected from the group consisting of meju, Korean soy sauce, brewed soy sauce, mixed soy sauce, Korean soybean paste, miso, seasoned soybean paste, red pepper paste, seasoned red pepper paste, Chunjang, Cheonggukjang and mixed soy sauce. .

Hereinafter, the present invention will be described in detail with reference to the accompanying drawings.

Bacillus cereus- inhibiting bacteria were isolated from 150 kinds of traditional Jangjang collected nationwide for isolation of Bacillus cereus . (1) The strains were selected first after co-cultivation in Nutrient agar and B. cereus selective medium. (2) Among the isolates isolated above, the strain producing high viscosity polyglutamate was identified. (3) Among the strains selected above, strains that do not produce tyramine and histamine were isolated. (4) Among the isolates isolated above, antagonists were isolated through PCR-free separation of non-toxin producing strains, and identified by 16S rRNA sequence analysis.

Finally, polyglutamate was produced as a non-toxin producing strain, but biogenic amine was not produced. Screening of Bacillus licheniformis SCK121057 strain with excellent Bacillus cereus growth inhibition was performed.

Furthermore, in order to ensure the completion and repeatability of the invention, the Bacillus rickenformis strain was deposited with the Korean spawn association on November 9, 2009 (Accession Number: KCCM11052P).

Experimental Example 1 Isolation of B. cereus Antagonists

150 kinds of Doenjang, Kochujang, and Cheonggukjang prepared by the traditional method were purchased, and 5 g of them were diluted with 0.3 mM phosphate buffer (pH 7.2). Nutrient Agar (NA) and B. cereus selective medium (chromogenic polymyxin B-methoprim agar; CPMA) The bacterial solution was diluted in each of the coating surface by 200 ㎕ and after 24 hours incubation at 30 ℃, in CPMA than the number of colonies grown in NA Twelve species of rodents were selected from which the percentage of colonies grown was very low.

Colonies of the selected entrepreneurs grown in NA were inoculated with toothpick at the same location of the previously prepared NA and CPMA medium, and only 24 hours later, only bacteria that did not grow in CPMA were collected. Yun, SH, YS Kim, SK So, DY Jeong, KS Hahn, and TB Uhm. 2009. Detection of plcR-papR genes by PCR inidentifying enterotoxin genes-harboring Bacillus cereus strains. According to Kor.J.Microbiol.45,425-429), B. cereus toxin was examined and the selected bacteria were incubated in Nutrient broth (NB) at 37 ° C for 78 hours, and centrifuged at 1,000 rpm for 3 minutes. Collected and stored at -20 ° C.

Standard strains B. cereus KACC 11240 and B. cereus JBE 0001 (GenBank accession no.FJ 982655), B. cereus JBE 0002 (GenBank accession no.FJ 982656), B. cereus JBE 0004 (GenBank accession) no.FJ 982654), B. cereus JBE 0005 (GenBank accession no.FJ 982657), B. cereus JBE 0006 (GenBank accession no.FJ 982658), B. cereus JBE 0008 (GenBank accession no.FJ 982659), B. After incubating cereus JBE 0011 (GenBank accession no. FJ 982661) at 37 ° C. for 21 hours in NB, 100 μl was evenly spread on each NA surface and a 4 mm paper disc (3M filter paper) was placed in the center of the medium. Dissolve the frozen supernatant centrifuged supernatant and dispense 20 µl in the center of the paper disc, incubate at 37 ° C for 21 hours, and measure the size of the clear ring to isolate one species with antagonistic ability against all 8 species of B. cereus , This was named Bacillus licheniformis SCK 121057.

Experimental Example 2 Method of Measuring Experimental Culture and Antagonistic Force

B. cereus , Bacillus. licheniformis , Bacillus. subtilis, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa, Staphylococcus aureus culture was Nutrient broth (NB) medium, B. cereus is detected CPMA, Lactobacillus brevis and Enterococcus faecalis cultures were Lactobacilli MRS broth, and Trypticase soy broth, Aspergillus flavus, A. Potato dextrose broth was used for fumigatus , A. ochraceus and A. parasiticus , and Yeast extract broth was used for Candida albicans . The strains used were standard strains, except for B. cereus JBE and B. licheniformis SCD strains. JBE and SCD strains were collected by the Rangang Institute and collected by 16S rRNA gene sequence analysis. The strains were identified by biochemical testing of the kind.

Meanwhile, the following relates to a phylogenetic relationship between Bacillus licheniformis SCK121057 and adjacent strains with a phylogenetic tree based on 16S rRNA sequences (1,443 bp).

At the incubation temperature, A. ochraceus was incubated at 25 ℃, L. brivis at 28 ℃, Aspergillus and C. albicans at 30 ℃, and the remaining bacteria at 37 ℃. The antagonism of SCK 121057 against these strains was incubated at the optimum temperature of each strain and expressed as the diameter of the transparent ring around the paper disc.

Experimental Example 3 Identification and Characteristics of SCK 121057

For biochemical identification of SCK 121057, an antagonist of B. cereus , the bacteria were inoculated in fresh NA medium and incubated at 37 ° C for 18 hours. The colonies formed were diluted in NA culture and injected into a BCL ID card (bioMVitek Inc., Hazelwood, USA) consisting of 46 dry media and biochemical reactants, and the results were integrated in the VITEK 2 Compact software (bioMVitek) at 15 minute intervals. The analysis was completed after 14 hours.

For the identification of 16S rRNA genes by nucleotide sequence, 518F (5'-CCAGCAGCCGCGGTAATACG-3 ') and 800R (5'-TACCAGGGTATCTAATCC-3') were used as universal primers, and the 16S rRNA gene was amplified by PCR. 1,443 bp containing a 50-900 bp nucleotide sequence of interest was read using the BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems Inc., USA). This base sequence is obtained from the NCBI database and the BLASTN program (Zhang, Z., S. Schwarz, L. Wagner, and W. Miller. 2000. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 7,203-214.) The homology with 16S rRNA gene sequences of standard strains was compared using the Seqmatch program (version 3) of Ribosomal Database Project 10.10 (RDP).

Among the strains that showed high sequence identity with the 16S rRNA gene sequence along with the standard strains, the strains whose reliability was identified through the genome project were also used. The mutual comparison between the base sequences was performed by the CLUSTALW program (Thompson, JD, DG). Higgins, and TJ Gibson. 1994. CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighing position-specific gap penalties and weight matrix choice.Nucleic Acids Res. 22,4673-4680.

The phylogenetic tree aligns the 16S rRNA gene sequences of the strains, corrects them to minimize the gap by visual observation and by hand, and then Kimura's two-parameter method (Kimura, M. 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences.J. Mol. Evolution 16, 111-120.) and the maximum parsimony method. Bootstrap analysis was performed 1,000 times to calculate statistical reliability for each branch in each phylogenetic tree, and system analysis and bootstrap analysis were performed using PAUP (version 4.0b) (Swofford, DL 1998. PAUP *. PhylogeneticAnalysisUsingParsimony. 4.0 ed. Sinauer Associates, Sunderland, MA, USA.).

After incubation at NA the morphology formed a translucent glossy ring around the white colonies (FIG. 1A). When the bacteria were observed under an optical microscope at 1,500 × magnification, the movement was very active and positive in Gram staining. Scanning electron microscope (SEM) observations magnified 10,000 times showed that the bacterium had a size of 0.7-0.8 μm x 2.2-4.0 μm as bacilli and had flagella (FIG. 1B).

A total of 46 biochemical test results were analyzed by Vitec 2 Compact Software, with a 91% chance of being classified as B. licheniformis (Table 2). Schematic analysis showed that SCK 121057 was the closest to the standard strain B. licheniformis DSM 13 The 16S rDNA gene sequence homology was 99.72% (1439 bp / 1443 bp). Therefore, SCK 121057 was identified as B. licheniformis in consideration of biochemical analysis and systematic classification. Table 1 below relates to the biochemical properties for the isolation identification of SCK 121057.

Test Reaction Test Reaction β-Xylosidase - Phenylalanine arylamidase + L-Lysine arylamidase - L-Proline arylamidase - L-Aspartate arylamidase - ββ-galactosidase + D-Mannose + L-Pyrrolydonyl arylamidase + D-Melezitose - α-Galactosidase - N-Acetyl-D-glucosamine - Alanine arylamidase + Palatinose + Tyrosine arylamidase + L-Rhammose - β-N-Acetyl-glucosaminidase - β-glucosidase + Ala-Phe-Pro arylamidase - ββ- Mannosidase - Cyclodextrin + Phosphorylcholine esterase + D-Galactose - Pyruvate - Glycogen + α-Glucosidase + Myoinositol + D-Tagatose - Methyl--D-glucopyranose + D-Trehalose + Ellman + Inulin - Methyl-D-xylosidase - D-Glucose + α-Mannosidase - D-Ribose - Maltotriose + Putrescine assimilation - Glycine arylamidase - Growth in 6.5% NaCl + D-Mannitol + Kanamycin resistance + Esculin hydrolase + Oleandomycin resistance - Tetrazolium red + Leucine arylamidase + Polymyxin B resistance +

Experimental Example 4 presence of toxin and antimicrobial genes of SCK 121057

Multiplex PCR was performed to determine whether SCK 121057 had diarrhea toxin genes ( nheABC, hblACD, cytK ) or vomiting toxin synthase genes ( cesA and cesB ) of B. cereus . The primer sequences for detecting the plcR-papR transcription control genes expressing the cereulide synthase genes cesA, cesB and diarrhea toxin are shown in Table 2, after initial denaturation at 94 ° C for 2 minutes under PCR conditions, and then denatured at 94 ° C for 1 minute, and 58 ° C 1 The binding was repeated for 30 minutes at 72 ° C. for 1 minute and the final amplification was performed at 72 ° C. for 5 minutes.

PCR was performed by selecting lchAA, lchAB, lchAC, the lichenysin synthase genes of B. licheniformis , and licM1 , licM2 , and surfactin synthase genes srfAA , srfAB , and srfAC, which are the lantibiotic modified enzyme genes, licM1 , licM2 , and B. subtilis . Was performed. Table 2 below relates to the primer sequence for detecting the transcriptional regulator plcR-papR .

Primer pair Sequence Target sequence
(GenBank accession no) Size (bp) cesAF
cesAR GTTGGCGTGTTATGTGATCG
GGTGAAACAGCTTCTCCTGC Cereulide synthetase A,
cesA (AB248763) 662 cesBF
cesBR AAAGAATGTTTCACCGAAGACGGTT
ACACACTTCTTTTCCGATTCCACCT Cereulide synthetase B,
cesB (AB248763) 1161 plcRF
plcRR CRGGYGCRGTATACCCAAGT
TGAAATACCCCATGYCATYG Phospholipase C regulatory protein, plcRpapR (DQ153391) 888 lchAF
lchAR ACGGCCGATCAGGAGCTTTC
TCTCAGCGCCTTCGATCTGC Lichenysin synthetase, lchAA
(AJ005061) 557 lchBF
lchBR TTTGACCCGGAGCTCGTTGA
CTGAGGGCGGAAAGCAGGAT Lichenysin synthetase, lchAB
(AJ005061) 706 lchCF
lchCR CATGTATACGGGCCGACGGA
CTGAAGGCCGGAGATGGCTT Lichenysin synthetase, lchAC
(AJ005061) 1173 lanM1F
lanM1R TCGCTGACCACCGAGGAAAA
CGCTTTCTGCATGGTCCCAG Lantibiotic modification enzyme 1, licM1 (NC006270) 571 lanM2F
lanM2R CGACAGCGCACTACGCCTCT
TCCCGCATGCTGCAGAAAAT Lantibiotic modification enzyme2, licM2 (NC006270) 776 srfAF
srfAR CAGCGGCAGCGGATTAAATG
GGCCTTCAAAATCGCCTGCT Surfactin synthetase A, srfAA
(NC000964) 1,025 srfBF
srfBR CGGTGTGTCATGGCGGATTT
TCGAAAGCGGACGGTTCAAA Surfactin synthetase AB, srfAB
(NC000964) 696 srfCF
srfCR TTCACTGTCGGAGGCGGAAA
ACCGGCAGATAGGCTGCTCC Surfactin synthetase AC, srfAC
(NC000964) 933

Figure 2 shows the growth curve and the production of antimicrobial material according to the culture time when SCK 121057 bacteria incubated at 37 ℃ in NB medium. The bacterial growth reached a maximum at 18 hours after incubation, but the antimicrobial production increased rapidly after 48 hours and showed a constant activity after 90-100 hours.

Since the release of antimicrobial substances began in the process of killing microorganisms, the production of surfactin, an antibacterial substance produced by B. subtils , and the initiation of sporulation were associated with depletion or sporulation of nutrients. It is considered to have been.

On the other hand, the diameter of the transparent ring exhibiting antimicrobial activity was 5.5 mm at 27 ° C. for 82 hours, 8 mm at 37 ° C., and 4 mm at 47 ° C., and 37 ° C. was suitable for the production of antimicrobial substances.

Experimental Example 5 Characteristics of Antimicrobial Substances

In order to know the physicochemical properties of the antimicrobial substances, the effects of temperature and the reactivity of the hydrolase were investigated. After the culture solution (pH 8.6 ℃ ± 0.2) sealed storage at 37 ℃ for 3 months, the antimicrobial activity was the same as before sealing.

After sterilizing the culture supernatant at 121 ° C. for 10 minutes, the antimicrobial activity was not different from before sterilization. After adding 400 U proteinase K per ml of the culture solution and reacting at 50 ° C. for 30 minutes, the antimicrobial activity was the same as the non-treated group.

Some of B. subtilis , a representative enteric fermentor, produce a number of bacteriocins, including surfactin, a surfactant with erythrocyte hemolysis at a concentration of 200 μM. Some B. licheniformis produce lichenicidine and bacteriocins with antifungal and antibacterial properties in addition to lichenysin. do. B. subtilis surfactin (MW 1.036 kDa) with cyclic lipopeptide structure and B. licheniformis lichenysin A (MW 1.006-1.034 kDa) are composed of D-type amino acids and cyclic peptides that exhibit protease resistance in the structure, resulting in protease resistance. Lichenicidin, a peptide antibiotic produced by B. licheniformis , does not lose activity after 4 hours storage at 100 ° C or after protease K treatment.

The heat and protease resistance of the antimicrobial agent were similar to those of lichenysin or lichenicidin produced by B. licheniformis or surfactin of B. subtilis . Was performed.

B. licheniformis SCD 112023 used as a positive control contained all lichenysin A synthase genes lchAA, lchAB, lchAC and lichenicidine modifier genes licM1, licM2 , and surfactin synthase genes srfAA, srfAb, srfAC (Fig. A), none of these genes were detected in SCK 121057 (see Figures 3B and 3C). Also it showed that the B. cereus of a vomiting SCK 121057 toxin synthase gene cesA, cesB and diarrhea toxin gene transcription and plcR papR also does not contain the B. cereus enterotoxin also not produced. Antimicrobial substances of SCK 121057 are peptide-containing substances in cyclic form or D-type amino acids that are not components of normal proteins, or low molecular weight non-proteins, in view of storage retention, very high thermal stability, and are not degraded by non-specific protease. Presumed to be a chemical in the system.

Experimental Example 6 Antibacterial Spectra of SCK 121057

The antimicrobial effect of SCK 121057 against pathogenic bacteria and fungi is summarized in Table 3 below.

Test strain Halo (mm) Culture condition B. cereus KACC 10001 11-14 NA, 37 ° C B. cereus KACC 10004 10-11 NA, 37 ° C B. cereus KACC 11240 12-14 NA, 37 ° C B. cereus KACC 12672 7-9 NA, 37 ° C B. cereus KACC 12682 12-15 NA, 37 ° C B. cereus JBE 0001 7-9 NA, 37 ° C B. cereus JBE 0002 11-13 NA, 37 ° C B. cereus JBE 0004 15-19 NA, 37 ° C B. cereus JBE 0005 6-8 NA, 37 ° C B. cereus JBE 0006 13-17 NA, 37 ° C B. cereus JBE 0008 7-8 NA, 37 ° C B. cereus JBE 0011 10-11 NA, 37 ° C B. licheniformis KCTC 1918 0 NA, 37 ° C B. licheniformis SCD 121033 0 NA, 37 ° C B. licheniformis SCD 121035 0 NA, 37 ° C B. licheniformis SCD 122037 0 NA, 37 ° C B. licheniformis SCD 123021 0 NA, 37 ° C B. licheniformis SCD 124031 0 NA, 37 ° C B. subtilis KCTC 1021 8-9 NA, 37 ° C B. subtilis KCTC 1107 10-11 NA, 37 ° C B. subtilis KCTC 1326 9-10 NA, 37 ° C B. subtilis KACC 11974 9 NA, 37 ° C B. subtilis KACC 12610 9-10 NA, 37 ° C B. subtilis KACC 12680 6-7 NA, 37 ° C E. coli KACC 13821 11-13 NA, 37 ° C E. faecalis KACC 11304 7 TSA, 37 ℃ M. luteus KACC 13377 10-11 NA, 37 ° C L. brevis KACC 11433 7-8 MRS, 28 ℃ P. aeruginosa KACC 10259 0 NA, 37 ° C S. aureus KACC 10778 11-12 NA, 37 ° C S. aureus subsp. aureus KCTC 1621 10-11 NA, 37 ° C S. aureus subsp. aureus KCTC 1916 10-11 NA, 37 ° C S. aureus subsp. aureus KCTC 1927 11-12 NA, 37 ° C S. aureus subsp. aureus KCTC 3881 8-9 NA, 37 ° C A. flavus KACC 41403 14-15 PDA, 30 ℃ A. flavus KACC 41809 9-10 PDA, 30 ℃ A. flavus KCTC 6134 16-17 PDA, 30 ℃ A. flavus KCTC 6905 9-11 PDA, 30 ℃ A. flavus KCTC 16682 9-10 PDA, 30 ℃ A. fumigates KACC 41186 0 PDA, 30 ℃ A. ochraceus KACC 40077 10 PDA, 25 ℃ A. parasiticus KACC 40074 15-16 PDA, 30 ℃ A. parasiticus KACC 41862 11-12 PDA, 30 ℃ A. parasiticus KCTC 6598 15-16 PDA, 30 ℃ C. albicans KACC 30062 0 YEA, 30 ℃

In the anti-proliferative effect of 12 strains of B. cereus isolated from the standard strains and traditional Jangjang, there was a difference in the degree of inhibition, but all 12 species were inhibited by the antimicrobial substance of SCK 121057.

In view of this, the use of B. cereus inhibitors such as SCK 121057 as fermented bacteria is considered to be an effective alternative to contaminant problems in farmers, where it is difficult to introduce HACCP systems.

Inhibition of 6 major B. subtilis and B. licheniformis fermented strains showed no proliferation inhibition against B. licheniformis , but all proliferation was inhibited against B. subtilis . Therefore, if SCK 121057 was used as the main fermented strain of enteric bacteria, B. subtilis could not be effectively involved in fermentation process due to inhibition of proliferation. The antimicrobial agent also exhibited antifungal properties against fungi, except for the yeast Candida albicans , against A. ochraceus , which produces ochratoxin A, and A. flavus and A. parasiticus , which produce aflatoxin B, G, and M. It was effective (transparent ring diameter 9-17 mm).

The production of mycotoxins in traditional enteric fermentation is an important hygiene issue and because these toxins can cause liver cancer and kidney toxicity, the use of this fungus with antifungal effects is expected to be of value for sanitary fermentation during aging. In addition, the antimicrobial agent was a pathogenic bacterium that had the ability to inhibit S. aureus, E. coli and M. luteus (translucent ring diameter 10-12 mm). In particular, S. aureus , an important pathogenic bacterium for food poisoning and inflammatory reactions, was found in all five strains. Proliferation was certainly suppressed. In the future, the antimicrobial activity of S. aureus , including methicillin resistant strains (MRSA), needs to be extensively investigated for possible use in medical or sanitary fields.

Experimental Example 7 Confirmation of Antagonism by Scanning Electron Microscopy (SEM)

2 ml of SCK 121057 centrifuged supernatant cultured in 1 ml of B. cereus JBE 0006 incubated for 21 hours at 37 ℃ was incubated for 8 hours at 37 ℃. After centrifugation of the culture solution at 1,000 rpm for 3 minutes, the supernatant was removed, washed pellet 2 with 9% NaCl, and then fixed with 2.5% glutaraldehyde primary, 1% osmium tetroxide secondary fixation, and ethanol dehydration. The fixed dehydrated bacteria were transferred to a membrane filter (0.22 μm, Millipore JG), dried at 80 ° C. for 10 hours, and coated with gold (Au) for 20 minutes with ion sputter (Bio-LV SEM, Hitachi, Japan). Observed at After centrifugation supernatant of SCK 121057 culture medium in B. cereus culture solution and further incubation for 8 hours, the electron microscope results are shown in FIG. Figure 4A is a B. cereus photograph without the centrifugation supernatant showed a neat bacilli morphology. However, when the supernatant was added, the cell membrane burst or melted, and the contents flowed out (FIG. 4B), and ghosts with only cell shells were also shown (FIG. 4C).

In general, after treatment, the surface of the bacteria was rougher and partially melted than the control group, and the size of the bacteria was reduced overall. Electron microscopy suggests that the antimicrobial component of SCK 121057 acts directly on cell membrane structure or affects cell membrane synthesis or metabolism. In addition, 0.5 ml of SCK121057 culture centrifugal supernatant was added to 0.5 ml of B. cereus JBE0006 culture medium, which was actively grown, and the motility of B. cereus was observed under a phase contrast microscope equipped with a green filter after 3 and 6 hours at 37 ° C. . B. cereus microorganisms showed very active motility immediately before the addition, but after 3 hours, the movement was significantly decreased, and after 6 hours, it was almost stopped.

[Experimental Example 8] Application of Soy Sauce

B. cereus BE008 and B. licheniformis SCK121057 bacteria were inoculated in boiled soybeans at a ratio of 1:10 for the application of anti- B. Cereus growth inhibitory bacteria (SCK121057) in the production of Cheonggukjang. The proliferation of B. cereus was measured by 21 and 31 days.

0.1 ml of B. cereus JBE 0008 culture incubated for 21 hours at 37 ° C. and 0.9 ml of SCK 121057 culture incubated under the same conditions were inoculated into boiled sterilized soybeans and incubated at 47 ° C. for 50 hours to prepare Cheonggukjang.

In the control group, 0.1 ml of B. cereus JBE 0008 culture and 0.9 ml of NB were added thereto to prepare a cheonggukjang.

The fermented Cheonggukjang was transferred to room temperature (22-24 ℃), and a certain amount of soybeans were taken out for each day, diluted in NB, and 100 μl of a diluent was applied to the surface of CPMA to measure B. cereus colony count.

SCK 121057 on agar medium showed proliferation inhibition against all 12 other B. cereus . However, SCK 121057 and B. cereus JBE0008 were mixed at 2.2 x 10 ⁵ CFU and 2.33 x 10 ⁴ CFU (about 10: 1) per gram of boiled soybeans to confirm the growth inhibition against B. cereus during the actual fermentation process. After inoculation, changes of B. cereus bacteria were observed for 31 days at 21-23 ° C. (see Table 4 and FIG. 5).

The value of the ratio 10 between the two organisms assumes that B. cereus is contaminated at the rate of 1/10 while SCK 121057, the main fermentor, grows in boiled soybeans. The control group inoculated only with B. cereus increased steadily with the incubation time and increased to 5.1 x 10 ⁶ CFU / g after one month, whereas the number of B. cereus cells when mixed with SCK 121057 was 1.3 x 10 ² CFU / g. It can be seen that it is suitable for the preparation of soy sauce.

Therefore, in the application of SCK 121057 in enteric applications, the safety level is much lower than the B. cereus acceptance standard (1 x 10 ⁴ CFU / g sample) of the health authorities. Table 4 summarizes the changes in B. cereus bacteria according to the culture days.

Incubation days B. cereus bacteria (x 10 / g) B. cereus alone
B. cereus + SCK 121057
1:10 (mixture ratio CFU / g) 0 2,330 2,330 2 13,900 One 7 120,000 30 14 310,000 33 21 470,000 42 31 510,000 13

On the basis of the embodiments with reference to the accompanying drawings it was described in detail. However, this is not intended to limit the scope of the present invention to this intended to illustrate the present invention, there are various equivalents that can replace them. In addition, the terms or words used in the specification and claims should not be construed as being limited to the common or dictionary meanings, and the inventors should properly define the concept of terms in order to best explain their invention in the best way. It should be interpreted as meaning and concept corresponding to the technical idea of the present invention based on the principle that it can.

The US Food and Drug Administration recognized the six enzyme products (GRAS Notice Inventory No. 22, 24, 72, 79, 265, 277) produced by B. licheniformis fermentation as generally Recognized Aa Safe, and the US environment. EPA assessed the risk and safety of B. licheniformis in humans.

EPA has been evaluated to be low in human risk at the same level as B. subtilis because B. licheniformis has been used in fermentation industries such as amylase, protease and antibiotics for a long period of time without reporting harm to human health and the environment. It was.

Recently, we have examined 150 kinds of Korean traditional Jang B. licheniformis, B. velezensis and B. subtilis . It was a major fermenting bacterium, and no hygiene problems caused by these bacteria except for B. cereus have been reported to date.

In the present invention, by providing a bacterium Bacillus licheniformis SCK121057 strain, which is a non-toxic antagonist inhibiting the growth of Bacillus cereus bacteria, to enable the production of safer food products and to contribute to the development of the food industry and further development of the domestic food industry Therefore, the industrial availability is very high.

Korea Microorganism Conservation Center (overseas) KCCM11052 20091109

Attach an electronic file to a sequence list

Claims (8)

Bacillus licheniformis SCK 121057 strain (KCCM 11052P).
According to claim 1, The strain Bacillus rickeniformis SCK 121057 strain (KCCM 11052P), characterized in that to inhibit the growth of Bacillus cereus ( Bacillus cereus ).
The method of claim 1, wherein the strain is Bacillus rickeniformis SCK 121057 strain (KCCM 11052P) characterized in that the non-toxic production (Non-toxic).
The method of claim 1, wherein the strain is Bacillus rickenformis SCK 121057 strain (KCCM 11052P), characterized in that does not produce a biogenic amine (biogenic amine).
The method of claim 4, wherein the biogenic amine is tyramine or histamine (histamine) Bacillus rickenformis SCK 121057 strain (KCCM 11052P) characterized in that.
The method of claim 1, wherein the strain is Bacillus rickeniformis SCK 121057 strain (KCCM 11052P), characterized in that for producing polyglutamate (polyglutamate).
Enteric containing the Bacillus rickeniformis SCK 121057 strain (KCCM 11052P) of claim 1.
The method of claim 7, wherein the soy sauce is any one selected from the group consisting of meju, Korean soy sauce, brewed soy sauce, mixed soy sauce, Korean soybean paste, miso, seasoned soybean paste, red pepper paste, seasoned red pepper paste, Chunjang, Cheonggukjang and mixed soy sauce. Enteric containing Bacillus rickeniformis SCK 121057 strain (KCCM 11052P).

Images