WO2006028497A2 - Lysozyme humaine active et recombinante - Google Patents

Lysozyme humaine active et recombinante Download PDF

Info

Publication number
WO2006028497A2
WO2006028497A2 PCT/US2005/005291 US2005005291W WO2006028497A2 WO 2006028497 A2 WO2006028497 A2 WO 2006028497A2 US 2005005291 W US2005005291 W US 2005005291W WO 2006028497 A2 WO2006028497 A2 WO 2006028497A2
Authority
WO
WIPO (PCT)
Prior art keywords
human lysozyme
recombinant human
fragment
derivative
homolog
Prior art date
Application number
PCT/US2005/005291
Other languages
English (en)
Other versions
WO2006028497A3 (fr
Inventor
Arabinda Mandal
John C. Herr
Original Assignee
University Of Virginia Patent Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Virginia Patent Foundation filed Critical University Of Virginia Patent Foundation
Publication of WO2006028497A2 publication Critical patent/WO2006028497A2/fr
Publication of WO2006028497A3 publication Critical patent/WO2006028497A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2462—Lysozyme (3.2.1.17)

Definitions

  • the present invention relates to a method of preparing and isolating active recombinant human lysozyme and other proteins by rapid folding.
  • Lysozymes are hydrolases capable of lysing many bacteria. They cleave a beta-glycosidic bond between the C-I of N-acetylmuramic acid and the C-4 of N- acetylglucosamine of the bacterial cell wall peptidoglycans (murein). Besides this muramidase activity, they also display some chitinase (fungal cell wall component) activity. Lysozymes also are credited with antibacterial and antiviral capacities different from the bacteriolytic activity. For example, lysozymes have been demonstrated to have HIV 1 antiviral activity.
  • Lysozymes have been found in many biological tissues and secretions. Stomach lysozymes (cow, leaf-eating monkey) are even specialized to function at lower pH. There are two types of lysozymes found in the animal kingdom: C-type or chicken-type lysozymes represented by chicken egg white lysozyme, and G-type or goose type lysozymes represented by goose-egg white lysozyme. The C-type lysozymes are actually considered a superfamily including conventional lysozymes, calcium-binding lysozymes, and alpha-lactalbumins. All lysozymes have very similar tertiary structures, but vary in amino-acid composition.
  • Lysozyme C is a gene of 5856 bp and comprises four exons.
  • the encoded protein is a secretory protein and comprises an 18 amino acid signal sequence and a mature protein of 130 residues.
  • the mature protein contains four disulfide bonds between Cys 6 ⁇ Cys 128, Cys 30 -- Cys 116, Cys 65 - - Cys 81, and Cys 77 — Cys 95. This protein has been isolated from placenta, amniotic fluid, milk, tears, intestinal cells, and leucocytes.
  • the present invention is directed to a method of synthesizing active recombinant human lysozyme, as well as compositions comprising the active recombinant human lysozyme and the use of such compositions as antibacterial, antifungal, and antiviral compositions.
  • Figure 1 comprising left and right panels, depicts electrophoretic images of the expression of human lysozyme in E. coli.
  • the left panel is stained with Coomassie blue.
  • Figure 2 comprising left, middle, and right panels, depicts electrophoretic images of functionally active recombinant human lysozyme expressed in E. coli.
  • the left panel is stained with Coomassie blue.
  • Figure 3 depicts an electrophoretic image of the isolation of folded recombinant human lysozyme.
  • Figure 4 depicts graphically the control enzyme blank in a lysozyme activity assay using M. lysodeikticus as a substrate. Concentrations of 0.3, 0.25, and 0.2 mg/ml are indicated. The ordinate represents absorbance at 450 nm and the abscissa represents time in seconds.
  • Figure 5 depicts graphically the lysis time of Micrococcus lysodeikticus (luteus) by native chicken lysozyme, at 2 ⁇ g per 1 ml in the assay system.
  • the Specific Activity was 26346 U/mg protein.
  • the ordinate represents absorbance at 450 nm and the abscissa represents time in seconds.
  • One Unit O.D. decrease of 0.0026/min.
  • Figure 6 depicts graphically the lysis time of Micrococcus lysodeikticus (luteus) by native human lysozyme, at 0.25 ⁇ g per 1 ml in the assay system.
  • the Specific Activity was 108,000 U/mg protein.
  • the ordinate represents absorbance at 450 nm and the abscissa represents time in seconds.
  • Figure 7 depicts graphically the lysis time of Micrococcus lysodeikticus
  • Figure 8 comprising four panels, depicts micrographs indicating the lack of binding of recombinant active human lysozyme to mouse eggs.
  • the upper two panels are a phase contrast micrograph (upper left panel) of eggs incubated with 40 ⁇ g/ml of active recombinant human lysozyme, and the companion fluorescent micrograph (upper right panel).
  • the lower two panels are a phase contrast micrograph (lower left panel) of eggs incubated with no protein, and the companion fluorescent micrograph (lower right panel).
  • Figure 9 is a schematic diagram indicating the regions of human SLLPl as well as summarizing some of the features of the protein.
  • Figure 10 depicts an evaluation of bacteriolytic activity of soluble human SLLPl expressed in yeast.
  • the left panel depicts images of four sets of electrophoretic gels (A, B, Cl and C2; three lanes each).
  • the right panel depicts an image of bacteriolytic agar assays in dishes: upper left dish- 6 hours at pH 4.4; upper right dish- 6 hours at pH 7.5; lower left dish- 21 hours at pH 4.4; lower right dish- 21 hours at pH 7.5.
  • Figure 11 depicts an image of an electrophoresis analysis of the preparation and isolation of folded soluble human SLLPl protein.
  • Figure 12 depicts micrographically, the binding of soluble human SLLPl expressed in E. coli to Zona-free and Zona-intact mouse eggs.
  • the upper two panels are a phase contrast micrograph (upper left panel) of eggs incubated with 22 ⁇ g/ml of active recombinant human lysozyme, and the companion fluorescent micrograph (upper right panel).
  • the lower two panels are a phase contrast micrograph (lower left panel) of eggs incubated with no protein, and the companion fluorescent micrograph (lower right panel).
  • an element means one element or more than one element.
  • amino acids are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table:
  • amino acid as used herein is meant to include both natural and synthetic amino acids, and both D and L amino acids.
  • Standard amino acid means any of the twenty standard L-amino acids commonly found in naturally occurring peptides.
  • Nonstandard amino acid residue means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source.
  • synthetic amino acid also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and substitutions.
  • Amino acids contained within the peptides of the present invention, and particularly at the carboxy- or amino-terminus, can be modified by methylation, amidation, acetylation or substitution with other chemical groups which can change the peptide's circulating half-life without adversely affecting their activity. Additionally, a disulfide linkage may be present or absent in the peptides of the invention.
  • amino acid is used interchangeably with “amino acid residue,” and may refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide.
  • Amino acids may be classified into seven groups on the basis of the side chain R: (1) aliphatic side chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains containing sulfur atoms, (4) side chains containing an acidic or amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an imino acid in which the side chain is fused to the amino group.
  • side chain R (1) aliphatic side chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains containing sulfur atoms, (4) side chains containing an acidic or amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an imino acid in which the side chain is fused to the amino group.
  • antiviral agent means a composition of matter which, when delivered to a cell, is capable of preventing replication of a virus in the cell, preventing infection of the cell by a virus, or reversing a physiological effect of infection of the cell by a virus.
  • Antiviral agents are well known and described in the literature.
  • AZT zidovudine, Retrovir® Glaxo Wellcome Inc., Research Triangle Park, NC
  • NC is an antiviral agent which is thought to prevent replication of HIV in human cells.
  • basic or “positively charged” amino acid refers to amino acids in which the R groups have a net positive charge at pH 7.0, and include, but are not limited to, the standard amino acids lysine, arginine, and histidine.
  • antibody refers to an immunoglobulin molecule which is able to specifically bind to a specific epitope on an antigen.
  • Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules.
  • the antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies (Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423- 426).
  • synthetic antibody an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein.
  • the term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
  • antisense oligonucleotide or antisense nucleic acid means a nucleic acid polymer, at least a portion of which is complementary to a nucleic acid which is present in a normal cell or in an affected cell.
  • Antisense refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand.
  • an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule.
  • the antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences.
  • the antisense oligonucleotides of the invention include, but are not limited to, phosphorothioate oligonucleotides and other modifications of oligonucleotides.
  • An agent or peptide with "antibacterial” activity may be bacteriocidal or bacteriostatic.
  • growth and “replication” are used interchangeably herein.
  • An antifungal agent is one which is fungicidal or fungistatic, or both.
  • An antiviral agent is one which is virucidal, virustatic, or both.
  • a “coding region” of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotide residues of the non-coding strand of the gene which are homologous with or complementary to, respectively, an mRNA molecule which is produced by transcription of the gene. It is understood that, owing to mRNA processing which occurs in certain instances in eukaryotic cells, the mRNA- coding region of a gene may comprise a single region or a plurality of regions separated from one another in the gene as it occurs in the genome. Where the mRNA-coding region of a gene comprises separate regions in a genome, “mRNA- coding region” refers both individually and collectively to each of these regions.
  • a "coding region" of an mRNA molecule consists of the nucleotide residues of the mRNA molecule which are matched with an anticodon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon.
  • the coding region may thus include nucleotide residues corresponding to amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g. amino acid residues in a protein export signal sequence).
  • “Complementary” refers to the broad concept of sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds ("base pairing") with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine.
  • a first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the first region is capable of base pairing with a residue of the second region.
  • the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.
  • nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.
  • two nucleic acids are complementary to each other when a substantial number (at least 50%) of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T and G:C nucleotide pairs).
  • detect and identity are used interchangeably herein.
  • a “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
  • a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
  • a disease or disorder is "alleviated” if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, are reduced.
  • Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
  • a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
  • Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
  • a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
  • fragment or “segment” is a portion of an amino acid sequence, comprising at least one amino acid, or a portion of a nucleic acid sequence comprising at least one nucleotide.
  • fragment and “segment” are used interchangeably herein.
  • fragment as applied to a nucleic acid, may ordinarily be at least about 20 nucleotides in length, typically, at least about 50 nucleotides, more typically, from about 50 to about 100 nucleotides, preferably, at least about 100 to about 200 nucleotides, even more preferably, at least about 200 nucleotides to about 300 nucleotides, yet even more preferably, at least about 300 to about 350, even more preferably, at least about 350 nucleotides to about 500 nucleotides, yet even more preferably, at least about 500 to about 600, even more preferably, at least about 600 nucleotides to about 620 nucleotides, yet even more preferably, at least about 620 to about 650, and most preferably, the nucleic acid fragment will be greater than about 650 nucleotides in length.
  • a “functional” biological molecule is a biological molecule in a form in which it exhibits a property by which it is characterized.
  • a functional enzyme for example, is one which exhibits the characteristic catalytic activity by which the enzyme is characterized.
  • the terms “functional” and “active” are used interchangeably herein.
  • homologous refers to the subunit sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, e.g., two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomelic subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position.
  • the homology between two sequences is a direct function of the number of matching or homologous positions, e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90% homology.
  • the DNA sequences 3 ⁇ TTGCC5 1 and 3 1 TATGGC share 50% homology.
  • homology is used synonymously with “identity.”
  • identity is used synonymously with “identity.”
  • the determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm.
  • a mathematical algorithm useful for comparing two sequences is the algorithm of
  • BLAST protein searches can be performed with the XBLAST program (designated "blastn" at the NCBI web site) or the NCBI “blastp” program, using the following parameters: expectation value 10.0, BLOSUM62 scoring matrix to obtain amino acid sequences homologous to a protein molecule described herein.
  • Gapped BLAST can be utilized as described in Altschul et al. (1997, Nucleic Acids Res. 25:3389-3402).
  • PSI-Blast or PHI-Blast can be used to perform an iterated search which detects distant relationships between molecules (Id.) and relationships between molecules which share a common pattern.
  • the default parameters of the respective programs e.g., XBLAST and NBLAST. See http://www.ncbi.nlm.nih.gov.
  • the percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps, hi calculating percent identity, typically exact matches are counted.
  • an "instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the peptide of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein.
  • the instructional material may describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal.
  • the instructional material of the kit of the invention may, for example, be affixed to a container which contains the identified compound invention or be shipped together with a container which contains the identified compound. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
  • isolated nucleic acid refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs.
  • nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell.
  • the term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
  • a "detectable marker” or a “reporter molecule” is an atom or a molecule that permits the specific detection of a compound comprising the marker in the presence of similar compounds without a marker.
  • Detectable markers or reporter molecules include, e.g., radioactive isotopes, antigenic determinants, enzymes, nucleic acids available for hybridization, chromophores, fluorophores, chemiluminescent molecules, electrochemically detectable molecules, and molecules that provide for altered fluorescence polarization or altered light scattering.
  • a "ligand” is a compound that specifically binds to a target compound.
  • a ligand e.g., an antibody
  • a ligand "specifically binds to” or “is specifically immunoreactive with” a compound when the ligand functions in a binding reaction which is determinative of the presence of the compound in a sample of heterogeneous compounds.
  • assay e.g., immunoassay
  • the ligand binds preferentially to a particular compound and does not bind to a significant extent to other compounds present in the sample.
  • an antibody specifically binds under immunoassay conditions to an antigen bearing an epitope against which the antibody was raised.
  • immunoassay formats may be used to select antibodies specifically immunoreactive with a particular antigen.
  • solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with an antigen. See Harlow and Lane, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
  • linkage refers to a connection between two groups.
  • the connection can be either covalent or non-covalent, including but not limited to ionic bonds, hydrogen bonding, and hydrophobic/hydrophilic interactions.
  • linker refers to a molecule that joins two other molecules either covalently or noncovalently, e.g., through ionic or hydrogen bonds or van der Waals interactions.
  • nucleic acid typically refers to large polynucleotides.
  • oligonucleotide typically refers to short polynucleotides, generally no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U” replaces "T.” Conventional notation is used herein to describe polynucleotide sequences: the left- hand end of a single-stranded polynucleotide sequence is the 5'-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5'- direction.
  • operably linked refers to a juxtaposition wherein the components are configured so as to perform their usual function.
  • control sequences or promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
  • a single-stranded or double-stranded nucleic acid moiety comprises the two polynucleotides arranged within the nucleic acid moiety in such a manner that at least one of the two polynucleotides is able to exert a physiological effect by which it is characterized upon the other.
  • a promoter operably linked to the coding region of a gene is able to promote transcription of the coding region.
  • peptide typically refers to short polypeptides.
  • a "polynucleotide” means a single strand or parallel and anti-parallel strands of a nucleic acid.
  • a polynucleotide may be either a single-stranded or a double-stranded nucleic acid.
  • a "portion" of a polynucleotide means at least at least about twenty sequential nucleotide residues of the polynucleotide. It is understood that a portion of a polynucleotide may include every nucleotide residue of the polynucleotide.
  • the direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction.
  • the DNA strand having the same sequence as an mRNA is referred to as the "coding strand”; sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as “upstream sequences”; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as "downstream sequences.”
  • Polypeptide refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof. Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer.
  • polypeptide sequences the left-hand end of a polypeptide sequence is the amino-terminus; the right-hand end of a polypeptide sequence is the carboxyl-terminus.
  • Primer refers to a polynucleotide that is capable of specifically hybridizing to a designated polynucleotide template and providing a point of initiation for synthesis of a complementary polynucleotide. Such synthesis occurs when the polynucleotide primer is placed under conditions in which synthesis is induced, i.e., in the presence of nucleotides, a complementary polynucleotide template, and an agent for polymerization such as DNA polymerase.
  • a primer is typically single- stranded, but may be double-stranded. Primers are typically deoxyribonucleic acids, but a wide variety of synthetic and naturally occurring primers are useful for many applications.
  • a primer is complementary to the template to which it is designed to hybridize to serve as a site for the initiation of synthesis, but need not reflect the exact sequence of the template, hi such a case, specific hybridization of the primer to the template depends on the stringency of the hybridization conditions.
  • Primers can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.
  • promoter/regulatory sequence means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulator sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product.
  • the promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
  • a "constitutive promoter” is a promoter which drives expression of a gene to which it is operably linked, in a constant manner in a cell.
  • promoters which drive expression of cellular housekeeping genes are considered to be constitutive promoters.
  • an “inducible" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a living cell substantially only when an inducer which corresponds to the promoter is present in the cell.
  • tissue-specific promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a living cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
  • protecting group with respect to a terminal amino group refers to a terminal amino group of a peptide, which terminal amino group is coupled with any of various amino-terminal protecting groups traditionally employed in peptide synthesis.
  • protecting groups include, for example, acyl protecting groups such as formyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; aromatic urethane protecting groups such as benzyloxycarbonyl; and aliphatic urethane protecting groups, for example, tert-butoxycarbonyl or adamantyloxycarbonyl. See Gross and Mienhofer, eds., The Peptides, vol. 3, pp.
  • protecting group with respect to a terminal carboxy group refers to a terminal carboxyl group of a peptide, which terminal carboxyl group is coupled with any of various carboxyl-terminal protecting groups.
  • protecting groups include, for example, tert-butyl, benzyl or other acceptable groups linked to the terminal carboxyl group through an ester or ether bond.
  • protein typically refers to large polypeptides.
  • purified and like terms relate to an enrichment of a molecule or compound relative to other components normally associated with the molecule or compound in a native environment.
  • the term “purified” does not necessarily indicate that complete purity of the particular molecule has been achieved during the process.
  • a “highly purified” compound as used herein refers to a compound that is greater than 90% pure.
  • purified sperm cell DNA refers to DNA that does not produce significant detectable levels of non-sperm cell DNA upon PCR amplification of the purified sperm cell DNA and subsequent analysis of that amplified DNA.
  • a "significant detectable level” is an amount of contaminate that would be visible in the presented data and would need to be addressed/explained during analysis of the forensic evidence.
  • the term "pharmaceutically acceptable carrier” includes any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents. The term also encompasses any of the agents approved by a regulatory agency of the US Federal government or listed in the US Pharmacopeia for use in animals, including humans.
  • the term “pharmaceutically- acceptable carrier” encompasses a chemical composition with which an appropriate compound or peptide (active ingredient) of the invention may be combined and which, following the combination, can be used to administer the appropriate active ingredient to a subject.
  • the subject is a human.
  • physiologically acceptable ester or salt means an ester or salt form of the active ingredient which is compatible with any other ingredients of the pharmaceutical composition, which is not deleterious to the subject to which the composition is to be administered.
  • Recombinant polynucleotide refers to a polynucleotide having sequences that are not naturally joined together.
  • An amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell.
  • a recombinant polynucleotide may serve a non- coding function (e.g., promoter, origin of replication, ribosome-binding site, etc.) as well.
  • a host cell that comprises a recombinant polynucleotide is referred to as a "recombinant host cell.”
  • a gene which is expressed in a recombinant host cell wherein the gene comprises a recombinant polynucleotide produces a "recombinant polypeptide.”
  • a "recombinant polypeptide” is one which is produced upon expression of a recombinant polynucleotide.
  • secondary antibody refers to an antibody that binds to the constant region of another antibody (the primary antibody).
  • signal sequence is meant a polynucleotide sequence which encodes a peptide that directs the path a polypeptide takes within a cell, i.e., it directs the cellular processing of a polypeptide in a cell, including, but not limited to, eventual secretion of a polypeptide from a cell.
  • a signal sequence is a sequence of amino acids which are typically, but not exclusively, found at the amino terminus of a polypeptide which targets the synthesis of the polypeptide to the endoplasmic reticulum. In some instances, the signal peptide is proteolytically removed from the polypeptide and is thus absent from the mature protein.
  • solid support relates to a solvent insoluble substrate that is capable of forming linkages (preferably covalent bonds) with various compounds.
  • the support can be either biological in nature, such as, without limitation, a cell or bacteriophage particle, or synthetic, such as, without limitation, an acrylamide derivative, agarose, cellulose, nylon, silica, or magnetized particles.
  • Spher-specific refers to an antigen or other molecule which is present at higher levels on sperm than other cells or is exclusively present in sperm.
  • a "subject" of diagnosis or treatment is a mammal, including a human.
  • the term “treating” includes prophylaxis of the specific disorder or condition, or alleviation of the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms.
  • a “prophylactic” treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the disease.
  • a “therapeutic” treatment is a treatment administered to a subject who exhibits signs of pathology for the purpose of diminishing or eliminating those signs.
  • a “therapeutically effective amount” of a compound is that amount of compound which is sufficient to provide a beneficial effect to the subject to which the compound is administered.
  • under transcriptional control or "operatively linked” as used herein means that the promoter is in the correct location and orientation in relation to the polynucleotides to control RNA polymerase initiation and expression of the polynucleotides.
  • a “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell.
  • vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amph philic compounds, plasmids, and viruses.
  • the term “vector” includes an autonomously replicating plasmid or a virus.
  • the term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like.
  • examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.
  • “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
  • An expression vector comprises sufficient cis- acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
  • Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses that incorporate the recombinant polynucleotide.
  • Hen egg white lysozyme was expressed as a protein fusion with the OmpA signal sequence and an octapeptide linker in E. coli.
  • the expression yielded soluble and enzymatically active lysozyme. Lysozyme activity was detected in the periplasmic space, in the cytosol and in the insoluble cytosolic fraction of E. coli.
  • the recombinant human lysozyme in one embodiment is synthesized comprising a peptide tag of 5-20 amino acids that assists the purification of the recombinant protein.
  • the human lysozyme gene can also be modified to include a signal peptide that directs the protein to be exported from the host cell or localized within the host cell.
  • the host cell can be selected from prokaryotic and eukaryotic host cells and in one embodiment, the host cell is E. coli. In one aspect, the host is yeast.
  • composition comprising an active recombinant human lysozyme.
  • the composition may further comprise a pharmaceutically acceptable carrier and/or stabilizing agent.
  • a pharmaceutically acceptable carrier and/or stabilizing agent Many techniques are known to those of skill in the art for preparing peptides to help identify, tag, or direct said peptides to specific tissue, cellular, or subcellular locations.
  • the recombinant human lysozyme further comprises a peptide tag to aid in purification.
  • the recombinant human lysozyme of the invention comprises a signal peptide to direct the location and trafficking of the peptide.
  • the active recombinant human lysozyme has anti ⁇ bacterial activity. In one aspect, the active recombinant human lysozyme is bacteriostatic. In another aspect, the active recombinant human lysozyme is bacteriocidal.
  • the active recombinant human lysozyme of the invention has antiviral activity. In one aspect, the active recombinant human lysozyme has anti-HIV activity.
  • the invention includes an isolated nucleic acid comprising a nucleic acid sequence encoding a recombinant human lysozyme of the present invention.
  • the present invention further includes a host cell comprising nucleic acid comprising a nucleic acid sequence encoding a recombinant human lysozyme of the present invention.
  • the host cell may include a bacterial cell, a yeast cell, and a mammalian cell.
  • the human lysozyme protein, or a homolog, fragment, derivative, or modification thereof is encoded by a nucleic acid comprising the sequence of S ⁇ Q ID NO:3 (ATTGTTCTGGGGCTTGTCCTCCTTTCTGTTACGGTTCAAGGCAAGGTCTT TGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGATTGGGAATGGATGGC TACAGGGGAATCAGCCTAGCAAACTGGATGTGTTTGGCCAAATGGGAGA GTGGTTACAACACACGAGCTACAAACTACAATGCTGGAGACAGAAGCAC TGATTATGGGATATTTCAGATCAATAGCCGCTACTGGTGTAATGATGGCA AAACCCCAGGAGCAGTTAATGCCTGTCATTTATCCTGCAGTGCTTTGCTG CAAGATAACATCGCTGATGCTGTAGCTTGTGCAAAGGGTTGTCCGTG ATCCACAAGGCATTAGCATGGGTGGCATGGAGAAATCGTTGTCAAAA CAGAGATGTCCGTCAGTATGTTTGTTGCTG CAAG
  • the active recombinant human lysozyme can be used in any of the applications described in U.S. patent 4,945,051, U.S. patent 5,585,257, U.S. patent 5,618,712 and WO 9924589 (DE19749973), the disclosures of which are expressly incorporated herein.
  • the human lysozyme nucleic acid and amino acid sequences provided in US patent 4,945,051, US patent 5,585,257, US patent 5,618,712 and WO 9924589 (DE19749973) are useful in the present invention. All of the nucleic acid and amino acid sequences disclosed in U.S. patent 4,945,051, U.S. patent 5,585,257, U.S.
  • novel recombinant active lysozymes of the present invention can also be used as the active agent or compound in antibacterial wound dressings, dental plaque preventing formulations, anti ⁇ inflammatory throat lozenges, anti-acne compositions, as sprays for controlling dry mouth condition, and as food additives to prevent spoilage.
  • Recombinant active lysozymes of the invention can be used as bactericidal or bacteriostatic agents for other conditions as well. It has also been reported that lysozyme may be effective against HIV (Lee-Huang, PNAS 96:2678, 1999).
  • the peptides may incorporate amino acid residues which are modified without affecting activity.
  • the termini may be derivatized to include blocking groups, i.e. chemical substituents suitable to protect and/or stabilize the N- and C-termini from "undesirable degradation," a term meant to encompass any type of enzymatic, chemical or biochemical breakdown of the compound at its termini which is likely to affect the function of the compound, i.e. sequential degradation of the compound at a terminal end thereof.
  • Blocking groups include protecting groups conventionally used in the art of peptide chemistry which will not adversely affect the in vivo activities of the peptide.
  • suitable N-terminal blocking groups can be introduced by alkylation or acylation of the N-terminus.
  • suitable N-terminal blocking groups include C1-C5 branched or unbranched alkyl groups, acyl groups such as formyl and acetyl groups, as well as substituted forms thereof, such as the acetamidomethyl (Acm) group.
  • Desamino analogs of amino acids are also useful N- terminal blocking groups, and can either be coupled to the N-terminus of the peptide or used in place of the N-terminal reside.
  • Suitable C-terminal blocking groups include esters, ketones or amides.
  • Ester or ketone-forming alkyl groups particularly lower alkyl groups such as methyl, ethyl and propyl, and amide-forming amino groups such as primary amines (-NH2), and mono- and di-alkylamino groups such as methylamino, ethylamino, dimethylamino, diethylamino, methylethylamino and the like are examples of C-terminal blocking groups.
  • Descarboxylated amino acid analogues such as agmatine are also useful C-terminal blocking groups and can be either coupled to the peptide's C-terminal residue or used in place of it. Further, it will be appreciated that the free amino and carboxyl groups at the termini can be removed altogether from the peptide to yield desamino and descarboxylated forms thereof without affect on peptide activity.
  • the peptide may include one or more D-amino acid resides, or may comprise amino acids which are all in the D-form.
  • Retro-inverso forms of peptides in accordance with the present invention are also contemplated, for example, inverted peptides in which all amino acids are substituted with D-amino acid forms.
  • Acid addition salts of the present invention are also contemplated as functional equivalents.
  • an inorganic acid such as hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, and the like
  • an organic acid such as an acetic, propionic, glycolic, pyruvic, oxalic, malic, malonic, succinic, maleic, fumaric, tata
  • the present invention also provides for analogs of proteins or peptides encoded by L/STs. Analogs can differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both.
  • conservative amino acid changes may be made, which although they alter the primary sequence of the protein or peptide, do not normally alter its function.
  • Conservative amino acid substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine.
  • Modifications include in vivo, or in vitro chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.
  • polypeptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent.
  • Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids.
  • the peptides of the invention are not limited to products of any of the specific exemplary processes listed herein. To ensure that the peptide obtained from either chemical or biological synthetic techniques is the desired peptide, analysis of the peptide composition should be conducted. Such amino acid composition analysis may be conducted using high resolution mass spectrometry to determine the molecular weight of the peptide.
  • the amino acid content of the peptide can be confirmed by hydrolyzing the peptide in aqueous acid, and separating, identifying and quantifying the components of the mixture using HPLC, or an amino acid analyzer. Protein sequenators, which sequentially degrade the peptide and identify the amino acids in order, may also be used to determine definitely the sequence of the peptide.
  • the peptide Prior to its use, the peptide is purified to remove contaminants. In this regard, it will be appreciated that the peptide will be purified so as to meet the standards set out by the appropriate regulatory agencies. Any one of a number of a conventional purification procedures may be used to attain the required level of purity including, for example, reversed-phase high-pressure liquid chromatography (HPLC) using an alkylated silica column such as C4 -,C8- or C 18- silica. A gradient mobile phase of increasing organic content is generally used to achieve purification, for example, acetonitrile in an aqueous buffer, usually containing a small amount of trifluoroacetic acid. Ion-exchange chromatography can be also used to separate peptides based on their charge.
  • HPLC reversed-phase high-pressure liquid chromatography
  • Substantially pure protein obtained as described herein may be purified by following known procedures for protein purification, wherein an immunological, enzymatic or other assay is used to monitor purification at each stage in the procedure.
  • Protein purification methods are well known in the art, and are described, for example in Deutscher et al. (ed., 1990, Guide to Protein Purification, Harcourt Brace Jovanovich, San Diego).
  • a peptide of the invention can be tested for activity using assays described herein, or which are known in the art. Such assays include anti-bacterial assays and antiviral assays.
  • the active recombinant human lysozyme can also be formulated for delivery by many known techniques, for example, via an aerosol dispenser. Such a device can be used to treat prophylactically, or treat an active respiratory tract infection.
  • an aerosol composition comprising the active recombinant human lysozyme can be administered via inhalation to protect an individual from potential contact with a pathogenic organism such as anthrax.
  • the invention also encompasses the use pharmaceutical compositions of an appropriate compound, analog, or derivative thereof to practice the methods of the invention, the composition comprising at least one appropriate compound, analog, or derivative thereof and a pharmaceutically-acceptable carrier.
  • the present invention is also directed to pharmaceutical compositions comprising the peptides of the present invention. More particularly, such compounds can be formulated as pharmaceutical compositions using standard pharmaceutically acceptable carriers, fillers, solublizing agents and stabilizers known to those skilled in the art.
  • the invention is also directed to methods of administering the peptides of the invention to a subject.
  • the invention provides a method of treating a subject with a bacterial infection by administering active peptides prepared and identified using the methods of the invention description. It is preferred that a compound inhibits bacterial replication by at least 10% relative to a control where a compound is not being used to inhibit bacterial replication. It is more preferred that a compound of the invention inhibits bacterial replication by at least 25% relative to untreated controls. It is further preferred that a compound of the invention inhibits bacterial replication by at least 50% relative to untreated controls. It is even further preferred that a compound of the invention inhibits bacterial replication by at least 75% relative to untreated controls.
  • a compound of the invention inhibits bacterial replication by at least 90% relative to untreated controls. In yet another aspect, it is preferred that a compound of the invention inhibits bacterial replication by at least 95% relative to untreated controls. In one aspect of the invention, bacterial replication is inhibited due to disruption of bacterial membranes. In one aspect of the invention, bacterial is inhibited due to lysis of the bacteria.
  • compositions comprising the present peptides are administered to a subject in need thereof by any number of routes including, but not limited to, topical, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, sublingual, or rectal means.
  • a method of treating a bacterial infection in a subject in need such treatment comprises administering a pharmaceutical composition comprising at least one bacterial inhibitory compound of the present invention to a subject in need thereof.
  • a peptide of the invention is can be administered to prevent a bacterial, fungal, or viral infection.
  • the invention also encompasses the use pharmaceutical compositions of an appropriate compound, analog, or derivative thereof to practice the methods of the invention, the composition comprising at least one appropriate compound, analog, or derivative thereof and a pharmaceutically-acceptable carrier.
  • compositions useful for practicing the invention may be administered to deliver a dose of between 1 ng/kg/day and 100 mg/kg/day.
  • compositions that are useful in the methods of the invention may be administered systemically in oral solid formulations, ophthalmic, suppository, aerosol, topical or other similar formulations.
  • such pharmaceutical compositions may contain pharmaceutically-acceptable carriers and other ingredients known to enhance and facilitate drug administration.
  • Other possible formulations, such as nanoparticles, liposomes, resealed erythrocytes, and immunologically based systems may also be used to administer an appropriate compound according to the methods of the invention.
  • the invention encompasses the preparation and use of pharmaceutical compositions comprising a compound useful for treatment of the diseases disclosed herein as an active ingredient.
  • a pharmaceutical composition may consist of the active ingredient alone, in a form suitable for administration to a subject, or the pharmaceutical composition may comprise the active ingredient and one or more pharmaceutically acceptable carriers, one or more additional ingredients, or some combination of these.
  • the active ingredient may be present in the pharmaceutical composition in the form of a physiologically acceptable ester or salt, such as in combination with a physiologically acceptable cation or anion, as is well known in the art.
  • compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology.
  • preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.
  • compositions are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs, birds including commercially relevant birds such as chickens, ducks, geese, and turkeys.
  • compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, ophthalmic, intrathecal or another route of administration.
  • Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses.
  • a "unit dose" is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient.
  • the amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
  • compositions of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered.
  • the composition may comprise between 0.1% and 100% (w/w) active ingredient.
  • a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents.
  • additional agents include anti-emetics and scavengers such as cyanide and cyanate scavengers. Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.
  • a formulation of a pharmaceutical composition of the invention suitable for oral administration may be prepared, packaged, or sold in the form of a discrete solid dose unit including, but not limited to, a tablet, a hard or soft capsule, a cachet, a troche, or a lozenge, each containing a predetermined amount of the active ingredient.
  • Other formulations suitable for oral administration include, but are not limited to, a powdered or granular formulation, an aqueous or oily suspension, an aqueous or oily solution, or an emulsion.
  • an "oily" liquid is one which comprises a carbon-containing liquid molecule and which exhibits a less polar character than water.
  • a tablet comprising the active ingredient may, for example, be made by compressing or molding the active ingredient, optionally with one or more additional ingredients.
  • Compressed tablets may be prepared by compressing, in a suitable device, the active ingredient in a free-flowing form such as a powder or granular preparation, optionally mixed with one or more of a binder, a lubricant, an excipient, a surface active agent, and a dispersing agent.
  • Molded tablets may be made by molding, in a suitable device, a mixture of the active ingredient, a pharmaceutically acceptable carrier, and at least sufficient liquid to moisten the mixture.
  • compositions used in the manufacture of tablets include, but are not limited to, inert diluents, granulating and disintegrating agents, binding agents, and lubricating agents.
  • Known dispersing agents include, but are not limited to, potato starch and sodium starch glycollate.
  • Known surface active agents include, but are not limited to, sodium lauryl sulphate.
  • Known diluents include, but are not limited to, calcium carbonate, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate.
  • Known granulating and disintegrating agents include, but are not limited to, corn starch and alginic acid.
  • binding agents include, but are not limited to, gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, and hydroxypropyl methylcellulose.
  • Known lubricating agents include, but are not limited to, magnesium stearate, stearic acid, silica, and talc.
  • Tablets may be non-coated or they may be coated using known methods to achieve delayed disintegration in the gastrointestinal tract of a subject, thereby providing sustained release and absorption of the active ingredient.
  • a material such as glyceryl monostearate or glyceryl distearate may be used to coat tablets.
  • tablets may be coated using methods described in U.S. Patents numbers 4,256,108; 4,160,452; and 4,265,874 to form osmotically-controlled release tablets.
  • Tablets may further comprise a sweetening agent, a flavoring agent, a coloring agent, a preservative, or some combination of these in order to provide pharmaceutically elegant and palatable preparation.
  • Hard capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such hard capsules comprise the active ingredient, and may further comprise additional ingredients including, for example, an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin.
  • an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin.
  • Soft gelatin capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin.
  • Such soft capsules comprise the active ingredient, which may be mixed with water or an oil medium such as peanut oil, liquid paraffin, or olive oil.
  • Liquid formulations of a pharmaceutical composition of the invention which are suitable for oral administration may be prepared, packaged, and sold either in liquid form or in the form of a dry product intended for reconstitution with water or another suitable vehicle prior to use.
  • Liquid suspensions may be prepared using conventional methods to achieve suspension of the active ingredient in an aqueous or oily vehicle.
  • Aqueous vehicles include, for example, water and isotonic saline.
  • Oily vehicles include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.
  • Liquid suspensions may further comprise one or more additional ingredients including, but not limited to, suspending agents, dispersing or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavorings, coloring agents, and sweetening agents.
  • Oily suspensions may further comprise a thickening agent.
  • suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, gum tragacanth, gum acacia, and cellulose derivatives such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose.
  • Known dispersing or wetting agents include, but are not limited to, naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with a fatty acid, with a long chain aliphatic alcohol, with a partial ester derived from a fatty acid and a hexitol, or with a partial ester derived from a fatty acid and a hexitol anhydride (e.g. polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively).
  • Known emulsifying agents include, but are not limited to, lecithin and acacia.
  • Known preservatives include, but are not limited to, methyl, ethyl, or n-propyl-para- hydroxybenzoates, ascorbic acid, and sorbic acid.
  • Known sweetening agents include, for example, glycerol, propylene glycol, sorbitol, sucrose, and saccharin.
  • Known thickening agents for oily suspensions include, for example, beeswax, hard paraffin, and cetyl alcohol.
  • Liquid solutions of the active ingredient in aqueous or oily solvents may be prepared in substantially the same manner as liquid suspensions, the primary difference being that the active ingredient is dissolved, rather than suspended in the solvent.
  • Liquid solutions of the pharmaceutical composition of the invention may comprise each of the components described with regard to liquid suspensions, it being understood that suspending agents will not necessarily aid dissolution of the active ingredient in the solvent.
  • Aqueous solvents include, for example, water and isotonic saline.
  • Oily solvents include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.
  • Powdered and granular formulations of a pharmaceutical preparation of the invention may be prepared using known methods. Such formulations may be administered directly to a subject, used, for example, to form tablets, to fill capsules, or to prepare an aqueous or oily suspension or solution by addition of an aqueous or oily vehicle thereto. Each of these formulations may further comprise one or more of dispersing or wetting agent, a suspending agent, and a preservative. Additional excipients, such as fillers and sweetening, flavoring, or coloring agents, may also be included in these formulations.
  • a pharmaceutical composition of the invention may also be prepared, packaged, or sold in the form of oil-in- water emulsion or a water-in-oil emulsion.
  • the oily phase may be a vegetable oil such as olive or arachis oil, a mineral oil such as liquid paraffin, or a combination of these.
  • Such compositions may further comprise one or more emulsifying agents such as naturally occurring gums such as gum acacia or gum tragacanth, naturally-occurring phosphatides such as soybean or lecithin phosphatide, esters or partial esters derived from combinations of fatty acids and hexitol anhydrides such as sorbitan monooleate, and condensation products of such partial esters with ethylene oxide such as polyoxyethylene sorbitan monooleate.
  • These emulsions may also contain additional ingredients including, for example, sweetening or flavoring agents.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for rectal administration.
  • a composition may be in the form of, for example, a suppository, a retention enema preparation, and a solution for rectal or colonic irrigation.
  • Suppository formulations may be made by combining the active ingredient with a non-irritating pharmaceutically acceptable excipient which is solid at ordinary room temperature (i.e. about 20°C) and which is liquid at the rectal temperature of the subject (i.e. about 37°C in a healthy human).
  • Suitable pharmaceutically acceptable excipients include, but are not limited to, cocoa butter, polyethylene glycols, and various glycerides.
  • Suppository formulations may further comprise various additional ingredients including, but not limited to, antioxidants and preservatives.
  • Retention enema preparations or solutions for rectal or colonic irrigation may be made by combining the active ingredient with a pharmaceutically acceptable liquid carrier.
  • enema preparations may be administered using, and may be packaged within, a delivery device adapted to the rectal anatomy of the subject. Enema preparations may further comprise various additional ingredients including, but not limited to, antioxidants and preservatives.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for vaginal administration. Such a composition may be in the form of, for example, a suppository, an impregnated or coated vaginally-insertable material such as a tampon, a douche preparation, or gel or cream or a solution for vaginal irrigation.
  • Methods for impregnating or coating a material with a chemical composition include, but are not limited to methods of depositing or binding a chemical composition onto a surface, methods of incorporating a chemical composition into the structure of a material during the synthesis of the material (i.e. such as with a physiologically degradable material), and methods of absorbing an aqueous or oily solution or suspension into an absorbent material, with or without subsequent drying.
  • Douche preparations or solutions for vaginal irrigation may be made by combining the active ingredient with a pharmaceutically acceptable liquid carrier.
  • douche preparations may be administered using, and may be packaged within, a delivery device adapted to the vaginal anatomy of the subject.
  • Douche preparations may further comprise various additional ingredients including, but not limited to, antioxidants, antibiotics, antifungal agents, and preservatives.
  • parenteral administration of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue.
  • Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like.
  • parenteral administration is contemplated to include, but is not limited to, subcutaneous, intraperitoneal, intramuscular, intrasternal injection, and kidney dialytic infusion techniques.
  • Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous admim ' stration.
  • Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative.
  • Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents.
  • the active ingredient is provided in dry (i.e. powder or granular) form for reconstitution with a suitable vehicle (e.g. sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.
  • a suitable vehicle e.g. sterile pyrogen-free water
  • compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution.
  • This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein.
  • Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3 -butane diol, for example.
  • Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides.
  • compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
  • Formulations suitable for topical administration include, but are not limited to, liquid or semi-liquid preparations such as liniments, lotions, oil-in-water or water-in-oil emulsions such as creams, ointments or pastes, and solutions or suspensions.
  • Topically-administrable formulations may, for example, comprise from about 1% to about 10% (w/w) active ingredient, although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent.
  • Formulations for topical administration may further comprise one or more of the additional ingredients described herein.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity.
  • a formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 0.5 to about 7 nanometers, and preferably from about 1 to about 6 nanometers.
  • Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder or using a self-propelling solvent/powder-dispensing container such as a device comprising the active ingredient dissolved or suspended in a low-boiling propellant in a sealed container.
  • such powders comprise particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 nanometers and at least 95% of the particles by number have a diameter less than 7 nanometers. More preferably, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90% of the particles by number have a diameter less than 6 nanometers.
  • Dry powder compositions preferably include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.
  • Low boiling propellants generally include liquid propellants having a boiling point of below 65°F at atmospheric pressure. Generally the propellant may constitute 50 to 99.9% (w/w) of the composition, and the active ingredient may constitute 0.1 to 20% (w/w) of the composition.
  • the propellant may further comprise additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (preferably having a particle size of the same order as particles comprising the active ingredient).
  • compositions of the invention formulated for pulmonary delivery may also provide the active ingredient in the form of droplets of a solution or suspension.
  • Such formulations may be prepared, packaged, or sold as aqueous or dilute alcoholic solutions or suspensions, optionally sterile, comprising the active ingredient, and may conveniently be administered using any nebulization or atomization device.
  • Such formulations may further comprise one or more additional ingredients including, but not limited to, a flavoring agent such as saccharin sodium, a volatile oil, a buffering agent, a surface active agent, or a preservative such as methylhydroxybenzoate.
  • the droplets provided by this route of administration preferably have an average diameter in the range from about 0.1 to about 200 nanometers.
  • formulations described herein as being useful for pulmonary delivery are also useful for intranasal delivery of a pharmaceutical composition of the invention.
  • Another formulation suitable for intranasal administration is a coarse powder comprising the active ingredient and having an average particle from about 0.2 to 500 micrometers. Such a formulation is administered in the manner in which snuff is taken i.e. by rapid inhalation through the nasal passage from a container of the powder held close to the nares.
  • Formulations suitable for nasal administration may, for example, comprise from about as little as 0.1% (w/w) and as much as 100% (w/w) of the active ingredient, and may further comprise one or more of the additional ingredients described herein.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for buccal administration.
  • Such formulations may, for example, be in the form of tablets or lozenges made using conventional methods, and may, for example, 0.1 to 20% (w/w) active ingredient, the balance comprising an orally dissolvable or degradable composition and, optionally, one or more of the additional ingredients described herein.
  • formulations suitable for buccal administration may comprise a powder or an aerosolized or atomized solution or suspension comprising the active ingredient.
  • Such powdered, aerosolized, or aerosolized formulations, when dispersed preferably have an average particle or droplet size in the range from about 0.1 to about 200 nanometers, and may further comprise one or more of the additional ingredients described herein.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for ophthalmic administration.
  • Such formulations may, for example, be in the form of eye drops including, for example, a 0.1 - 1.0% (w/w) solution or suspension of the active ingredient in an aqueous or oily liquid carrier.
  • Such drops may further comprise buffering agents, salts, or one or more other of the additional ingredients described herein.
  • Other opthalmically- administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form or in a liposomal preparation.
  • additional ingredients include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials.
  • dosages of the compound of the invention which may be administered to an animal, preferably a human, range in amount from 1 ⁇ g to about 100 g per kilogram of body weight of the animal. While the precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of animal and type of disease state being treated, the age of the animal and the route of administration. Preferably, the dosage of the compound will vary from about 1 mg to about 1O g per kilogram of body weight of the animal. More preferably, the dosage will vary from about 10 mg to about 1 g per kilogram of body weight of the animal.
  • the compound may be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even lees frequently, such as once every several months or even once a year or less.
  • the frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the animal, etc.
  • the invention also includes a kit comprising the composition of the invention and an instructional material which describes adventitially administering the composition to a cell or a tissue of a mammal.
  • this kit comprises a (preferably sterile) solvent suitable for dissolving or suspending the composition of the invention prior to administering the compound to the mammal.
  • an "instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the peptide of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein.
  • the instructional material may describe one or more methods of alleviation the diseases or disorders in a cell or a tissue of a mammal.
  • the instructional material of the kit of the invention may, for example, be affixed to a container which contains the peptide of the invention or be shipped together with a container which contains the peptide. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
  • a method for preparing active recombinant human lysozyme is as follows: The cDNA for human lysozyme that encodes for the mature (processed form of 130 amino acids) secreted human lysozyme was amplified by polymerase chain reaction (PCR) from human placental cDNA utilizing forward and reverse gene- specific primers containing Ncol and Xhol restriction site primers respectively.
  • PCR polymerase chain reaction
  • the forward and reverse primer sequences were as follows: HLF-NcoI 5'- CAT GCC ATG GCA AAG GTC TTT GAA AGG TGT GAG TTG (SEQ ID NO: 1 ); HLR- Xhol 5'- CCG CTC GAG CAC TCC ACA ACC TTG AAC ATA CTG (SEQ ID NO:2).
  • the PCR amplified band was subcloned in pCR 2.1 TOPO (3.9 kb) vector and authenticity of the band was confirmed by sequencing of the insert in the vector from both directions.
  • the correct insert sequence was then released from the pCR 2.1 TOPO vector by digestion with Ncol and Xhol restriction enzymes, isolated and ligated into the predigested pET-28b+ expression vector which was then used to transform E. coli expression host cell BL21(DE3) from Novagen (Madison, WI). Expression of the recombinant human lysozyme of expected molecular weight was checked by inducing the BL21(DE3) transformed cells in LB media with IPTG for 3 hours at 37 °C at an OD 600nm of 0.6 to 1.0.
  • E. coli can produce bacteriolytically active human lysozyme
  • the E. coli expressed recombinant human lysozyme was tested for its bacteriolytic properties in the in-gel bacteriolytic assays (zymogram) as follows.
  • Regular LB (RLB) media in phosphate buffer (pH 7.0) containing glycerol (2.5 ml/L) was used to grow the BL21(DE3) cells containing human lysozyme insert to an OD at 600 run of ⁇ 0.7 when the cells were induced with 0.5 inM IPTG for 3 hours.
  • Cells were induced with 0.6 niM IPTG when at OD of 1.0 for 3 hours. Following induction cells were isolated by centrifugation at 3000 x g for 30 minutes. The harvested cells were taken in 50 mM Tris-HCl buffer (pH 7.9) containing an EDTA-free cocktail of protease inhibitors. The cells were then ruptured by either sonication or French press. The mix was then centrifuged at 23000 x g for 20 minutes to isolate the insoluble fraction. The insoluble fraction pellet was dissolved in 1 x binding buffer (8 M urea in
  • the recombinant protein bound column was then washed in 1 x binding buffer for 25 to 30 column volumes to remove the unbound E. coli proteins from the column. The change in OD at 280 nm was followed simultaneously.
  • the column was then further washed in 1 x binding buffer containing higher imidazole concentration between 20 to 25 mM for 25 to 35 column volumes to remove the weakly bound E. coli proteins to the column. The change in OD at 280 nm was also followed simultaneously.
  • the column was then washed in a linear gradient from 8.0 M to 0.0 M urea in 1 x binding buffer to remove the urea from the column and to allow simultaneous protein folding during this urea removal step.
  • the column was then eluted with 300 to 350 mM imidazole in 1 x binding buffer containing no urea in suitable fractions and their relative 280 nm absorbance were monitored. At this stage even in the absence of urea in the elution buffer, the eluted purified protein showed no sign of precipitation at room temperature or at 4°C for several days.
  • the eluted protein from multiple fractions was then concentrated and washed by a buffer of desired pH to remove the imidazole from the elution buffer using
  • bacteriolytic assays were performed using Micrococcus lysodeikticus bacteria as a native substrate in 1 ml assay system as follows, according to Goldberg et al, 1991 (Goldberg et al., Biochemistry, 30:2790-2797, 1991) (See Figures 4-7).
  • Lysozyme activity was determined at room temperature ( ⁇ 21°C) by following the decrease in OD at 450 nm using 0.25 mg/ml of Micrococcus lysodeikticus as substrate in 60 mM phosphate buffer, pH 6.2 in an assay volume of 1 ml. One unit of activity corresponds to an absorbance decrease of 0.0026 per minute.
  • Purified protein was also tested for its ability to bind to mouse eggs.
  • SLLP-I which is lysozyme-like
  • Human SLLPl protein is a testis specific intra-acrosomal processed protein.
  • the full-length protein is 215 amino acid residues, with a MW of 23.4 kDa, and a pl of 8.0.
  • the mature processed SLLPl is 128 amino acid residues, with a MW of 14.6 kDa, and a pi of 5.0.
  • SLLPl has a 52% sequence identity with human lysozyme.
  • Recombinant human SLLPl was prepared as described above. It was then evaluated for bacteriolytic activity following expression in yeast. It was also isolated and tested for purity. Recombinant human SLLPl was expressed in E. coli and tested for binding to mouse eggs (Figure 12).
  • Example 1 and 2) demonstrated that there was none in a yeast system after expressing the recombinant protein in soluble form.
  • the present invention provides a method of isolating and purifying a folded active human lysozyme protein, wherein no special LB medium is required to grow E. coli.
  • the protein can be produced in E. coli as inclusion bodies.
  • the method reduces the time of preparation by eliminating the time consuming batch dilution procedure used in the art for protein folding.
  • the present invention provides for recovery of soluble active protein from inclusion bodies in one purification procedure.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Procédé de préparation et d'isolement d'une lysozyme humaine recombinante et active et d'autres protéines par repliement rapide. Procédé d'utilisation d'une telle protéine comme agent bactériostatique, comme agent bactéricide, comme agent antifongique et comme agent antiviral.
PCT/US2005/005291 2004-02-20 2005-02-22 Lysozyme humaine active et recombinante WO2006028497A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US54614104P 2004-02-20 2004-02-20
US60/546,141 2004-02-20

Publications (2)

Publication Number Publication Date
WO2006028497A2 true WO2006028497A2 (fr) 2006-03-16
WO2006028497A3 WO2006028497A3 (fr) 2006-07-27

Family

ID=36036764

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/005291 WO2006028497A2 (fr) 2004-02-20 2005-02-22 Lysozyme humaine active et recombinante

Country Status (1)

Country Link
WO (1) WO2006028497A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109628430A (zh) * 2018-12-04 2019-04-16 浙江理工大学 来源于褶纹冠蚌基因的病毒型重组溶菌酶
WO2021133852A1 (fr) * 2019-12-24 2021-07-01 Clara Foods Co. Compositions d'enzymes et leurs procédés de production
US11800887B2 (en) 2019-07-11 2023-10-31 Clara Foods Co. Protein compositions and consumable products thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5618712A (en) * 1985-11-12 1997-04-08 Boehringer Ingelheim Zentrale Gmbh Human lysozyme
US20050095612A1 (en) * 1997-08-19 2005-05-05 Human Genome Sciences, Inc. 70 human secreted proteins
US20050118594A1 (en) * 2001-12-14 2005-06-02 Chawla Narinder K. Enzymes
US20050191627A1 (en) * 2001-09-28 2005-09-01 Incyte Corporation Enzymes

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5618712A (en) * 1985-11-12 1997-04-08 Boehringer Ingelheim Zentrale Gmbh Human lysozyme
US20050095612A1 (en) * 1997-08-19 2005-05-05 Human Genome Sciences, Inc. 70 human secreted proteins
US20050191627A1 (en) * 2001-09-28 2005-09-01 Incyte Corporation Enzymes
US20050118594A1 (en) * 2001-12-14 2005-06-02 Chawla Narinder K. Enzymes

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109628430A (zh) * 2018-12-04 2019-04-16 浙江理工大学 来源于褶纹冠蚌基因的病毒型重组溶菌酶
US11800887B2 (en) 2019-07-11 2023-10-31 Clara Foods Co. Protein compositions and consumable products thereof
US11974592B1 (en) 2019-07-11 2024-05-07 Clara Foods Co. Protein compositions and consumable products thereof
WO2021133852A1 (fr) * 2019-12-24 2021-07-01 Clara Foods Co. Compositions d'enzymes et leurs procédés de production
CN115135168A (zh) * 2019-12-24 2022-09-30 克莱拉食品公司 酶组合物及其制备方法

Also Published As

Publication number Publication date
WO2006028497A3 (fr) 2006-07-27

Similar Documents

Publication Publication Date Title
JPH07502490A (ja) 殺菌性／透過性増大タンパク質および脂質担体を含有する組成物、その製造方法、およびそれらの使用
US20110112040A1 (en) Supercharged proteins for cell penetration
US20090069241A1 (en) Compositions and Methods for Use of Pigment Epithelial Derived Factor (PEDF) Peptide Fragments
EP1644410B1 (fr) Multimere de peptide du domaine sushi
JP3908165B2 (ja) 多発性硬化症の治療におけるケモカイン変異体
AU2002215919A1 (en) Chemokine mutants in the treatment of multiple sclerosis
WO2006028497A2 (fr) Lysozyme humaine active et recombinante
US6953833B2 (en) Staphylococcus peptides for bacterial interference
KR20140010879A (ko) 세포내 단백질의 고효율 도입 및 유지용 펩타이드
US20090312252A1 (en) Antimicrobial Activity in Variants of Lacritin
WO2013016896A1 (fr) Lectine d'agrocybe aegerita aal-2, et gène codant pour celle-ci, procédé de préparation pour celle-ci et application de celle-ci
KR20080026085A (ko) 곤충세포에서 제조한 재조합 ｅ-셀렉틴
JP2011503137A (ja) 新規のアルギニン置換ペプチド及びその使用
WO2014194427A1 (fr) Protéines de fusion iduronate-2-sulfatase ciblées
JP4418155B2 (ja) 変異天花粉蛋白
JP2002516087A (ja) 幾つかの重篤な疾患の治療のための医薬組成物を調製するための修飾されたリゾチームｃの使用
EP4133067A1 (fr) Enzyme
WO2009116524A1 (fr) Protéine modifiée
WO2011103458A2 (fr) Compositions et procédés d'utilisation et d'identification d'agents antimicrobiens
CN101525602B (zh) 制备抗pink1多克隆抗血清的多肽及其应用
WO2000012722A1 (fr) Nouveau gene de lysozyme humain, son polypeptide de codage et leur procede de preparation
WO2000012717A1 (fr) Nouveau gene de lysozyme humain, polypeptide codant pour celui-ci et leur procede de preparation
JP3776968B2 (ja) ペプチド性サソリ毒素
JP2004518410A5 (fr)
KR20120035566A (ko) 세포 투과성 ｒｐＳ3 융합 단백질을 포함하는 신경질환 예방 및 치료용 약학 조성물

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase