WO2006024640A2 - Triazolophthalazines - Google Patents

Triazolophthalazines Download PDF

Info

Publication number
WO2006024640A2
WO2006024640A2 PCT/EP2005/054266 EP2005054266W WO2006024640A2 WO 2006024640 A2 WO2006024640 A2 WO 2006024640A2 EP 2005054266 W EP2005054266 W EP 2005054266W WO 2006024640 A2 WO2006024640 A2 WO 2006024640A2
Authority
WO
WIPO (PCT)
Prior art keywords
phenyl
methoxy
alkyl
compounds
alkoxy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2005/054266
Other languages
English (en)
French (fr)
Other versions
WO2006024640A3 (en
Inventor
Beate Schmidt
Steffen Weinbrenner
Dieter Flockerzi
Raimund Kuelzer
Hermann Tenor
Hans-Peter Kley
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Takeda GmbH
Original Assignee
Altana Pharma AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020077006869A priority Critical patent/KR101368093B1/ko
Priority to HK08106059.7A priority patent/HK1115590B/xx
Priority to CA2578368A priority patent/CA2578368C/en
Priority to US11/660,748 priority patent/US7851472B2/en
Priority to AU2005279221A priority patent/AU2005279221C9/en
Priority to EA200700537A priority patent/EA014324B1/ru
Priority to BRPI0514586-4A priority patent/BRPI0514586A/pt
Priority to CN200580038057XA priority patent/CN101133057B/zh
Priority to NZ553160A priority patent/NZ553160A/en
Priority to JP2007528875A priority patent/JP5140427B2/ja
Priority to DE602005021894T priority patent/DE602005021894D1/de
Priority to AT05784647T priority patent/ATE471324T1/de
Application filed by Altana Pharma AG filed Critical Altana Pharma AG
Priority to EP05784647A priority patent/EP1791543B1/en
Publication of WO2006024640A2 publication Critical patent/WO2006024640A2/en
Priority to IL181271A priority patent/IL181271A/en
Priority to NO20071127A priority patent/NO20071127L/no
Anticipated expiration legal-status Critical
Publication of WO2006024640A3 publication Critical patent/WO2006024640A3/en
Priority to US12/766,478 priority patent/US20100286140A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42Oxazoles
    • A61K31/424Oxazoles condensed with heterocyclic ring systems, e.g. clavulanic acid
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D487/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04Ortho-condensed systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/10Antioedematous agents; Diuretics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/06Antiarrhythmics

Definitions

  • the invention relates to novel triazolophthalazine derivatives, which can be used in the pharmaceutical industry for the production of pharmaceutical compositions.
  • Triazolophthalazines are known from prior art. For example, EP85840, WO98/04559, WO98/50385,
  • the invention thus relates in a first aspect (aspect a) to compounds of formula I
  • R1 is -U-A, in which
  • U is a direct bond, or methylene (-CH 2 -),
  • A is phenyl, pyridinyl, thiophenyl, or R11- and/or R111 -substituted phenyl, in which R11 is 1-4C-alkyl, halogen, trifluoromethyl, hydroxyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, phenoxy, 1-4C-alkoxycarbonyl, morpholino, or di-1-4C- alkylamino,
  • R111 is 1-4C-alkoxy, halogen, hydroxyl, or 1-4C-alkyl
  • R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
  • R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31- and/or R311- substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)- piperidinyl, in which
  • R31 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
  • R311 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R31 and R311 together are a 1-2C-alkylenedioxy group
  • R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321- and/or R3211 -substituted phenyl, mono- or di-1-4C-alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
  • R3211 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R321 and R3211 together are a 1-2C-alkylenedioxy group, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
  • R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42- and/or R421 -substituted phenyl, or pyridinyl, in which
  • R41 is hydroxyl, 1-4C-alkoxy, mono- or di-1-4C-alkylamino, or morpholino
  • R42 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
  • R421 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R42 and R421 together are a 1-2C-alkylenedioxy group
  • R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
  • 1-4C-Alkyl is a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, and, particularly, the ethyl and methyl radicals.
  • 2-4C-Alkyl is a straight-chain or branched alkyl radical having 2 to 4 carbon atoms. Examples are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl and ethyl radicals.
  • 3-7C-Cycloalkyl stands for cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl, of which cyclopropyl, cyclopentyl and cyclohexyl are in particular to be mentioned.
  • 2-4C-Alkenyl is a straight chain or branched alkenyl radical having 2 to 4 carbon atoms. Examples are the ethenyl (vinyl), 2-butenyl, 3-butenyl, 1-propenyl and the 2-propenyl (allyl) radicals.
  • Halogen within the meaning of the present invention is iodine or, in particular, bromine, chlorine or fluorine.
  • 1-4C-Alkoxy represents radicals which, in addition to the oxygen atom, contain a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, isopropoxy and preferably the ethoxy and methoxy radicals.
  • 1-4C-Alkoxycarbonyl is a carbonyl group to which one of the abovementioned 1-4C-alkoxy radicals is bonded.
  • Examples are the methoxycarbonyl (CH 3 O-C(O)-) and the ethoxycarbonyl (CH 3 CH 2 O-C(O)-) radical.
  • 3-7C-Cycloalkylmethoxy stands for cyclopropylmethoxy, cyclobutylmethoxy, cyclopentylmethoxy, cyclohexylmethoxy or cycloheptylmethoxy, of which cyclopropylmethoxy and cyclopentylmethoxy are to be emphasized.
  • 1-2C-Alkylenedioxy stands, for example, for the methylenedioxy (-0-CH 2 -O-) or the ethylenedioxy radical (-0-CH 2 -CH 2 -O-).
  • Completely or predominantly fluorine-substituted 1-4C-alkoxy is, for example, the 2,2,3,3,3- pentafluoropropoxy, the perfluoroethoxy, the 1 ,2,2-trifluoroethoxy and in particular the 1 ,1 ,2,2- tetrafluoroethoxy, the 2,2,2-trifluoroethoxy, the trifluoromethoxy and the difluoromethoxy radical, of which the difluoromethoxy radical is preferred.
  • "Predominantly” in this connection means that more than half of the hydrogen atoms of the 1-4C-alkoxy groups are replaced by fluorine atoms.
  • Di-1-4C-alkylamino stands for an amino group, which is substituted by two different or two identical of the abovementioned 1-4C-alkyl radicals. Examples are the dimethylamino, the diethylamino and the diisopropyl radical.
  • Di-(I -4C-alkoxy)-phenyl stands for a phenyl radical, which is substituted at any possible positions by two of the abovementioned 1-4C-alkoxy radicals, which may be the same or different.
  • Mono- or Di-1-4C-alkylamino radicals contain in addition to the nitrogen atom, one or two of the abovementioned 1-4C-alkyl radicals.
  • Phenyl-1-4C-alkoxy stands for one of the abovementioned 1-4C-alkoxy radicals, which is substituted by the phenyl radical. Examples which may be mentioned are the benzyloxy and the phenethoxy radical.
  • 1-4C-Alkylcarbonyl is a carbonyl group to which one of the abovementioned 1-4C-alkyl radicals is bonded.
  • An example is the acetyl radical (CH 3 CO-).
  • heterocyclic groups mentioned herein refer, unless otherwise mentioned, to all of the possible isomeric forms thereof.
  • heterocyclic groups mentioned herein refer, unless otherwise noted, in particular to all of the possible positional isomers thereof.
  • pyridyl or pyridinyl alone or as part of another group, includes pyridin-
  • 1 N-(R33)-piperidinyl includes 1 N-(R33)-piperidin-2-yl, 1 N-(R33)- piperidin-3-yl and 1 N-(R33)-piperidin-4-yl.
  • N-(R33)-Piperidinyl stands for a piperidinyl radical which is substituted by R33 at the nitrogen atom, such as, for example, any radical, which is selected from the group consisting of piperidin-2-yl, piperidin-3-yl and piperidin-4-yl, and which is substituted by R33 at its nitrogen atom.
  • 4N-(R322)-Piperazin-1-yl stands for a piperazin-1-yl radical which is substituted at its nitrogen atom in the 4-position by R322.
  • 4N-(1-4C-Alkyl)-piperazin-1-yl stands for a piperazin-1-yl radical which is substituted at its nitrogen atom in the 4-position by one of the abovementioned 1-4C-alkyl radicals, such as e.g. 4N-methyl- piperazin-1-yl.
  • each definition is independent.
  • Suitable salts for compounds according to this invention - depending on substitution - are all acid addi ⁇ tion salts or all salts with bases. Particular mention may be made of the pharmacologically tolerable inorganic and organic acids and bases customarily used in pharmacy.
  • Those suitable are, on the one hand, water-insoluble and, particularly, water-soluble acid addition salts with acids such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulphuric acid, acetic acid, citric acid, D-gluconic acid, benzoic acid, 2-(4-hydroxybenzoyl)benzoic acid, butyric acid, sulphosalicylic acid, maleic acid, lauric acid, malic acid, fumaric acid, succinic acid, oxalic acid, tartaric acid, embonic acid, stearic acid, toluenesulphonic acid, methanesulphonic acid or 3-hydroxy-2- naphthoic acid, the acids being employed in salt preparation - depending on whether a mono- or polybasic acid is concerned and depending on which salt is desired - in an equimolar quantitative ratio or one differing therefrom.
  • acids such as, for example, hydrochloric acid, hydrobromic acid
  • salts with bases are - depending on substitution - also suitable.
  • salts with bases are mentioned the lithium, sodium, potassium, calcium, aluminium, magnesium, titanium, ammonium, meglumine or guanidinium salts, here, too, the bases being employed in salt preparation in an equimolar quantitative ratio or one differing therefrom.
  • Pharmacologically intolerable salts which can be obtained, for example, as process products during the preparation of the compounds according to this invention on an industrial scale, are converted into pharmacologically tolerable salts by processes known to the person skilled in the art.
  • the compounds according to this invention as well as their salts may contain, e.g. when isolated in crystalline form, varying amounts of solvents. Included within the scope of the invention are therefore all solvates and in particular all hydrates of the compounds according to this invention as well as all solvates and in particular all hydrates of the salts of the compounds according to this invention.
  • R1 is -U-A, in which
  • U is a direct bond, or methylene (-CH 2 -),
  • A is phenyl, pyridinyl, thiophenyl, di-(1-4C-alkoxy)-phenyl, or R11 -substituted phenyl, in which R11 is 1-4C-alkyl, halogen, trifluoromethyl, hydroxyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, phenoxy, 1-4C-alkoxycarbonyl, morpholino, or di-1-4C- alkylamino,
  • R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)-piperidinyl, in which
  • R31 is 1-4C-alkoxy, morpholino, or di-1-4C-alkylamino
  • R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321 -substituted phenyl, di-1-4C- alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
  • R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
  • R41 is hydroxyl, 1-4C-alkoxy, di-1-4C-alkylamino, or morpholino
  • R42 is 1-4C-alkoxy, or di-1-4C-alkylamino
  • R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
  • R1 is -U-A, in which
  • U is a direct bond, or methylene (-CH 2 -),
  • A is phenyl, pyridinyl, thiophenyl, dimethoxyphenyl, or R11 -substituted phenyl, in which
  • R11 is methyl, tertbutyl, chlorine, fluorine, bromine, trifluoromethyl, hydroxyl, methoxy, ethoxy, trifluoromethoxy, phenoxy, methoxycarbonyl, morpholino, or dimethylamino,
  • R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)-piperidinyl, in which R31 is 1-4C-alkoxy, morpholino, or di-1-4C-alkylamino,
  • R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321 -substituted phenyl, di-1-4C- alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
  • R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
  • R41 is hydroxyl, 1-4C-alkoxy, di-1-4C-alkylamino, or morpholino
  • R42 is 1 -4C-alkoxy, or di-1 -4C-alkylamino
  • R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
  • A is phenyl, or R11 -substituted phenyl, in which
  • R11 is methyl, chlorine, fluorine, bromine, trifluoromethyl, hydroxyl, methoxy, phenoxy, methoxycarbonyl, or dimethylamino,
  • R2 is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
  • R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
  • R31 is methoxy, morpholino, or dimethylamino
  • R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
  • R33 is hydrogen, methyl, or acetyl
  • R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which R41 is hydroxyl, methoxy, dimethylamino, or morpholino, R42 is methoxy, or dimethylamino,
  • R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-methyl-piperazin-1-yl,
  • A is phenyl, or R11 -substituted phenyl, in which
  • R11 is fluorine, bromine, trifluoromethyl, or methoxy, whereby in particular
  • R1 is 4-methoxy-phenyl, 2-methoxy-phenyl, 2-bromo-phenyl, 2-fluoro-phenyl, or 2- (trifluoromethyl)-phenyl;
  • R2 is attached in the meta or para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
  • R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
  • R31 is methoxy, morpholino, or dimethylamino
  • R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
  • R33 is hydrogen, methyl, or acetyl
  • R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
  • R41 is hydroxyl, methoxy, dimethylamino, or morpholino
  • R42 is methoxy, or dimethylamino
  • R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-methyl-piperazin-1-yl, and the salts of these compounds.
  • R1 is -U-A, in which
  • A is phenyl, or R11 -substituted phenyl, in which
  • R11 is fluorine, bromine, chlorine, trifluoromethyl, methyl or methoxy
  • R2 is attached in the meta or para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
  • R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
  • R31 is methoxy, morpholino, or dimethylamino
  • R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
  • R33 is hydrogen, methyl, or acetyl
  • R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
  • R41 is hydroxyl, methoxy, dimethylamino or morpholino
  • R42 is methoxy, or dimethylamino
  • R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, 4N-methyl-piperazin-1-yl, or 4N-ethyl-piperazin-1-yl
  • a special interest in the compounds according to this invention refers to those compounds of formula I which are included -within the scope of this invention- by one or, when possible, by more of the following special embodiments:
  • a special embodiment (embodiment 1 ) of the compounds according to the present invention refers to those compounds of formula I, in which
  • A is phenyl, or R11 -substituted phenyl.
  • Another special embodiment (embodiment 2) of the compounds according to the present invention refers to those compounds of formula I, in which
  • A is pyridinyl or thiophenyl, such as e.g. pyridin-4-yl.
  • A is phenyl, or R11 -substituted phenyl.
  • R1 is -U-A, in which
  • U is methylene (-CH 2 -),
  • A is phenyl, or R11 -substituted phenyl
  • Another special embodiment (embodiment 3-1-1) of the compounds according to the present invention refers to those compounds of formula I, in which R1 is (4-methoxy-phenyl)-methyl; and the salts of these compounds.
  • A is pyridinyl or thiophenyl, such as e.g. thiophen-2-yl.
  • Another special embodiment (embodiment 5) of the compounds according to the present invention refers to those compounds of formula I, in which R2 is -N(H)-C(O)R3.
  • Another special embodiment (embodiment 6) of the compounds according to the present invention refers to those compounds of formula I, in which R2 is -C(O)-N(R4)R5.
  • R1 is (4-methoxy-phenyl)-methyl, or 4-methoxy-phenyl.
  • Another special embodiment (embodiment 8) of the compounds according to the present invention refers to those compounds of formula I, in which R1 is 4-methoxy-phenyl.
  • R1 is (4-methoxy-phenyl)-methyl, 2-hydroxy-phenyl, phenyl, 3-methoxycarbonyl-phenyl, or
  • R1 is 4-methoxy-phenyl, 2-methoxy-phenyl, 2-bromo-phenyl, 2-fluoro-phenyl, or 2- (trifluoromethyl)-phenyl.
  • Another special embodiment (embodiment 11) of the compounds according to the present invention refers to those compounds of formula I, in which R1 is 2-bromo-phenyl.
  • R2 is -N(H)-C(O)R3, in which
  • R3 is 1 N-H-piperidinyl, especially 1 N-H-piperidin-2-yl or 1 N-H-piperidin-3-yl.
  • R2 is attached in the meta position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold.
  • R2 is attached in the para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold.
  • R2 is attached in the para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold; and R2 is -N(H)-C(O)R3, in which
  • R3 is 1 N-H-piperidinyl; and the salts of these compounds.
  • a special group of the compounds according to the present invention refers to those compounds of formula I, in which
  • R1 is 4-methoxy-phenyl, or 2-bromo-phenyl,
  • R2 is attached in the para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is -N(H)-C(O)R3, in which R3 is 1 N-H-piperidinyl, especially 1 N-H-piperidin-2-yl or 1 N-H-piperidin-3-yl.
  • the compounds according to the invention can be prepared e.g. as described exemplarily as follows and according to the following specified reaction steps, or, particularly, in a manner as described by way of example in the following examples, or analogously or similarly thereto according to preparation procedures or synthesis strategies known to the person skilled in the art.
  • Said nucleophilic substitution reaction can be carried out as described in the following examples or as known to the skilled person; thus, depending on the reactivity of the reactants, it can be carried out by melting the reaction partners without solvent together or by reacting the reaction partners in a suitable solvent, such as e.g. N,N-dimethylformamide, in the presence of a suitable base, such as e.g. sodium hydride or potassium carbonate, at a temperature to allow the reaction to proceede (this may be e.g., depending on the reactants, ambient temperature, elevated temperature, or reflux temperature of the solvent used or, under appropriate conditions, beyond it), optionally under microwave irradiation.
  • a suitable solvent such as e.g. N,N-dimethylformamide
  • a suitable base such as e.g. sodium hydride or potassium carbonate
  • compounds of the formula Ia' can also be prepared from the corresponding compounds of formula Ia and corresponding compounds of formula R3-C(O)Y, in which Y is hydroxyl, by reaction with amide bond linking reagents known to the person skilled in the art under conditions customary to the skilled person.
  • amide bond linking reagents known to the person skilled in the art which may be mentioned are, for example, the carbodiimides (e.g. dicyclohexylcarbodiimide or, preferably, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride), azodicarboxylic acid derivatives (e.g.
  • uronium salts e.g. O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium tetrafluoroborate or O-(benzotriazol-1yl)-N,N,N',N'-tetramthyl-uronium-hexafluorophosphate] and N 1 N'- carbonyldiimidazole.
  • 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC or EDCI) is particularly to be mentioned.
  • This amidification reaction can be carried out in the presence of suitable amide bond linking reagents, such as e.g. those mentioned above, particularly 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC or EDCI).
  • suitable amide bond linking reagents such as e.g. those mentioned above, particularly 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC or EDCI).
  • Benzoic acids of formula Ib in which R1 has the meanings given above, can be prepared by saponification of corresponding ester compounds of formula I, in which R2 is 1-4C-alkoxycarbonyl, particularly methoxycarbonyl.
  • Said reactions can be carried out as described in the following examples, or under conditions known to the skilled person or analogously to art-known reactions similar thereto.
  • the aforementioned one-step cyclization reaction can be carried out similarly as described in J. Med. Chem. Vol. 31 , 1988, p. 1115, in a suitable solvent, such as e.g. toluene, pyridine or dioxane, in the presence of a suitable base (e.g. triethylamine) at elevated temperature or the reflux temperature of the solvent used.
  • a suitable solvent such as e.g. toluene, pyridine or dioxane
  • a suitable base e.g. triethylamine
  • Compounds of formula IV can be obtained by nucleophilic substitution of compounds of formula V, in which X and X' can be the same and are suitable leaving groups, particularly X and X' are both chlorine, and hydrazine.
  • the substances of formula I according to the invention are isolated and purified in a manner known per se, for example by distilling off the solvent under reduced pressure and recrystallizing the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as, for example, column chromatography on a suitable support material.
  • Salts are obtained by dissolving the free compound in a suitable solvent (e.g. a ketone, such as aceto ⁇ ne, methyl ethyl ketone or methyl isobutyl ketone, an ether, such as diethyl ether, tetrahydrofuran or dioxane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or a low-molecular- weight aliphatic alcohol, such as ethanol or isopropanol) which contains the desired acid or base, or to which the desired acid or base is then added.
  • a suitable solvent e.g. a ketone, such as aceto ⁇ ne, methyl ethyl ketone or methyl isobutyl ketone, an ether, such as diethyl ether, tetrahydrofuran or dioxane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or
  • the salts are obtained by filtering, reprecipitating, preci ⁇ pitating with a nonsolvent for the addition salt or by evaporating the solvent. Salts obtained can be converted into the free compounds, which can in turn be converted into salts, by alkalization or by aci ⁇ dification. In this manner, pharmacologically unacceptable salts can be converted into pharmacologically acceptable salts.
  • MS mass spectrum
  • the product is purified by column chromatography via silica gel.
  • Furan-3-carboxy lie acid ⁇ 4-[3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl ⁇ -amide
  • the following compounds 113 and 114 can be obtained by reduction reaction analogously as described for compound 74a; or, alternatively, starting from B8 (for 113) or B9 (for 114) the following compounds 113 and 114 can be obtained analogously as described for compound 1.
  • the products can be purified by column chromatography via silica gel.
  • the compounds according to the invention have useful pharmacological properties which make them industrially utilizable.
  • selective inhibitors of cyclic GMP-hydrolysing phosphodiesterases (cGMP- PDE inhibitors) - prefentially of type 2 - they are suitable on the one hand as therapeutics for conditions of pathologically enhanced endothelial activity and impaired endothelial barrier function such as septic shock, vascular edema, or diseases associated with unwanted neoangiogenesis.
  • cGMP- PDE inhibitors cyclic GMP-hydrolysing phosphodiesterases
  • the compounds according to the invention can be employed in human and veterinary medicine as therapeutics, where they can be used, for example, for the treatment and prophylaxis of the following illnesses: (1) all conditions of pathologically enhanced endothelial activity/impaired endothelial barrier function such as multi-organ failure in particular acute respiratory distress syndrome (ARDS) in septic shock, pneumonia, acute and chronic airway disorders of varying origin (rhinitis, bronchitis, bronchial asthma, emphysema, COPD), angioedema, peripheral edema, cerebral edema for example traumatic or following stroke; (2) all conditions associated with pathologically enhanced neoangiogenesis such as all kinds of tumors (benign or malignant) which are associated with neoangiogenesis and all kinds of inflammatory diseases associated with neoangiogenesis for example disorders of the arthritis type (rheumatoid arthritis, r
  • the invention further relates to a method for the treatment of mammals, including humans, which are suffering from one of the above mentioned illnesses.
  • the method is characterized in that a therapeuti ⁇ cally active and pharmacologically effective and tolerable amount of one or more of the compounds according to the invention is administered to the ill mammal.
  • the invention further relates to a method for inhibiting PDE, particularly PDE2, comprising contacting said PDE with an effective amount of a compound according to the invention.
  • the invention further relates to a method for inhibiting PDE, particularly PDE2, comprising administering a pharmacologically active and therapeutically effective and tolerable amount of at least one compound according to the invention to a mammal in need of such inhibition.
  • the invention further relates to the compounds according to the invention for use in the treatment and/or prophylaxis of illnesses, especially the illnesses mentioned.
  • the invention further relates to the compounds according to the invention having PDE, particularly PDE2, inhibitory activity.
  • the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of the illnesses mentioned.
  • the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of PDE-, particularly PDE2-, associated diseases.
  • the invention furthermore relates to pharmaceutical compositions for the treatment and/or prophylaxis of the illnesses mentioned, which contain one or more of the compounds according to the invention.
  • the invention moreover relates to pharmaceutical compositions having PDE, particularly PDE2, inhibitory activity.
  • the invention relates to an article of manufacture, which comprises packaging material and a pharmaceutical agent contained within said packaging material, wherein the pharmaceutical agent is therapeutically effective for antagonizing the effects of the cyclic nucleotide phosphodiesterase of type 2 (PDE2), ameliorating the symptoms of an PDE2-mediated disorder, and wherein the packaging material comprises a label or package insert which indicates that the pharmaceutical agent is useful for preventing or treating PDE2-mediated disorders, and wherein said pharmaceutical agent comprises one or more compounds of formula 1 according to the invention.
  • the packaging material, label and package insert otherwise parallel or resemble what is generally regarded as standard packaging material, labels and package inserts for pharmaceuticals having related utilities.
  • compositions according to the invention may be performed in any of the generally accepted modes of administration available in the art.
  • suitable modes of administration include intravenous, oral, nasal, parenteral, topical, transdermal and rectal delivery. Intravenous and oral delivery is preferred.
  • compositions are prepared by processes which are known per se and familiar to the person skilled in the art.
  • the compounds according to the invention are either employed as such, or preferably in combination with suitable pharmaceutical auxiliaries and/or excipients, e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between 0.1 and 95% and where, by the appropriate choice of the auxiliaries and/or excipients, a pharmaceutical administration form (e.g. a delayed release form or an enteric form) exactly suited to the active compound and/or to the desired onset of action can be achieved.
  • suitable pharmaceutical auxiliaries and/or excipients e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between
  • auxiliaries or excipients which are suitable for the desired pharmaceutical formulations on account of his/her expert knowledge.
  • gel for ⁇ mers, ointment bases and other active compound excipients for example antioxidants, dispersants, emulsifiers, preservatives, solubilizers, colorants, complexing agents or permeation promoters, can be used.
  • the compounds according to the invention are preferably also administered by inhalation in the form of an aerosol; the aerosol particles of solid, liquid or mixed composition preferably having a diameter of 0.5 to 10 ⁇ m, advantageously of 2 to 6 ⁇ m.
  • Aerosol generation can be carried out, for example, by pressure-driven jet atomizers or ultrasonic atomizers, but advantageously by propellant-driven metered aerosols or propellant-free administration of micronized active compounds from inhalation capsules.
  • the administration forms additionally contain the required excipients, such as, for example, propellants (e.g. Frigen in the case of metered aerosols), surface-active substances, emulsifiers, stabilizers, preservatives, flavorings, fillers (e.g. lactose in the case of powder inhalers) or, if appropriate, further active compounds.
  • propellants e.g. Frigen in the case of metered aerosols
  • surface-active substances e.g. Frigen in the case of metered aerosols
  • emulsifiers emulsifiers
  • stabilizers emulsifiers
  • preservatives e.g., emulsifiers, stabilizers, preservatives
  • flavorings e.g. lactose in the case of powder inhalers
  • fillers e.g. lactose in the case of powder inhalers
  • the compounds according to the invention are in particular admi ⁇ nistered in the form of those pharmaceutical compositions which are suitable for topical application.
  • suitable pharmaceutical formulations are, for example, powders, emulsions, suspensions, sprays, oils, ointments, fatty ointments, creams, pastes, gels or solutions.
  • compositions according to the invention are prepared by processes known per se.
  • the dosage of the active compounds is carried out in the order of magnitude customary for PDE inhibitors.
  • Topical application forms (such as ointments) for the treatment of dermatoses thus contain the active compounds in a concentration of, for example, 0.1-99%.
  • the dose for administration by inhalation is customarly between 0.1 and 3 mg per day.
  • the customary dose in the case of systemic therapy (p.o. or i.v.) is between 0.03 and 3 mg/kg per day.
  • PDE phosphodiesterase
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription- polymerase chain reaction
  • dNTPs deoxynucleoside triphosphates
  • RNA ribonucleic acid
  • cDNA complementary deoxyribonucleic acid
  • bp basepairs
  • (dT) 15 pentadecathymidylic acid
  • ORF open reading frame
  • GB no. GenBank database accession number
  • rBV recombinant baculovirus
  • wt wild type
  • aa aminoacid
  • UCR upstream conserved region
  • PAA polyacrylamide.
  • Aminoacids are abbreviated with the 1 -character symbol: A for alanine, C for cysteine, D for aspartic acid, E for glutamic acid, F for phenylalanine, G for glycine, H for histidine, I for isoleucine, K for lysine , L for leucine, M for methionine, N for asparagine, P for proline, Q for glutamine, R for arginine, S for serine, T for threonine, V for valine , W for tryptophane, Y for tyrosine.
  • PCR was carried out in a Stratagene Robocycler 40 or in a MWG Primus 96 plus thermocycler. Typically, PCR was carried out with the Expand Lond Template PCR System from Roche in buffer 3 plus 0.75 mM MgCI 2 , 0.3 ⁇ M each primer, 500 ⁇ M dNTPs.
  • PCR products were purified with the High Pure PCR Product Purification Kit (Roche) or from agarose gel with the QIAquick Gel Extraction kit from Qiagen, and cloned into the pCR2.1-TOPO vector from Invitrogen.
  • the ORFs were subcloned in baculovirus expression vectors (transfer plasmids).
  • the pCR- Bac and pVL vectors were from Invitrogen.
  • the pBacPak vectors (pBP8 or pBP9) were from Clontech. Restriction endonucleases were from Roche and MBI Fermentas. Modifying enzymes and T4 DNA ligase were from New England Biolabs.
  • the PDE2A3 (GB no. U67733) was amplified in 2 steps using PCR from brain cDNA.
  • a N-terminal fragment was isolated using primers CP1 PD2AS (5'- GAGGAGTGATGGGGCAGGC -3') and PR9PD2AA ( 5'- GCGAAGTGGGAGACAGAAAAG -3'), a C-terminal fragment was isolated using primers PR7PD2AS (5'- GATCCTGAACATCCCTGACG -3') and CP3PD2AA (5'- GGGATCACTCAGCATCAAGGC-3').
  • the PCR products were cloned into the vector pCR2.1-Topo.
  • the N-terminal fragment was first subcloned with EcoRI into pBluescript Il KS (-), afterwards a Bst1107l/EcoRV fragment was exchanged with the corresponding restriction fragment from the C- terminal clone, to obtain a complete ORF.
  • the ORF for the PDE2A3 was subcloned into pBP8 using Xbal and Kpnl.
  • the rBV was prepared by means of homologous recombination in Sf9 insect cells.
  • the expression plasmids were cotransfected with Bac-N-Blue (Invitrogen) or Baculo-Gold DNA (Pharmingen) using a standard protocol (Pharmingen).
  • Wt virus-free recombinant virus supernatants were selected using plaque assay methods. After that, high-titre virus supernatants were prepared by amplifying 3 times.
  • PDE2 was expressed in Sf21 cells by infecting 2x10 6 cells/ml with an MOI (multiplicity of infection) between 1 and 10 in serum-free SF900 medium (Life Technologies).
  • Cells were cultured at 28°C , typically for 48 hours, after which they were pelleted for 5-10 min at 1000 g and 4°C. In spinner flasks, cells were cultured at a rotational speed of 75 rpm. The SF21 insect cells were resuspended, at a concentration of approx.
  • the test volume is 100 ⁇ l and contains 20 mM Tris buffer (pH 7.4), 0.1 mg of BSA (bovine serum albumin)/ml, 5 mM Mg 2+ , 0.5 ⁇ M cAMP (including about 50,000 cpm of [3H]CAMP), 5 ⁇ M cGMP (to activate PDE2A3), 2 ⁇ l of the respective substance dilution in DMSO and sufficient recombinant PDE (1000xg supernatant, see above) to ensure that 15-20% of the cAMP is converted under the said experimental conditions.
  • Tris buffer pH 7.4
  • BSA bovine serum albumin
  • 5 mM Mg 2+ 0.5 ⁇ M cAMP (including about 50,000 cpm of [3H]CAMP)
  • 5 ⁇ M cGMP to activate PDE2A3
  • the reaction is started by adding the substrate (cAMP) and the assays are incubated for a further 15 min; after that, they are stopped by adding SPA beads (50 ⁇ l).
  • the SPA beads had previously been resuspended in water and then diluted 1 :3 (v/v); the diluted solution also contains 3 mM IBMX.
  • the MTP's are analyzed in commercially available measuring appliances and the corresponding IC 50 values of the compounds for the inhibition of PDE activities are determined from the concentration-effect curves by means of non-linear regression.
  • EBM endothelial cell basal medium
  • FCS fetal calf serum
  • HUVECs were cultured in EGM2 (100 ⁇ l in the upper wells and 600 ⁇ l in the lower wells) over four days prior the experiments and medium was changed every other day. At the day of the experiment culture medium was replaced by M199 with 1 % human serum albumin.
  • Endothelial cells were preincubated with cyclic nucleotide modifiers (the selective PDE3 inhibitor motapizone, the selective PDE4 inhibitor RP73401 , the cGMP generators ANP or SNP and PDE2 inhibitors) for 15 min.
  • HUVECs were then stimulated with Thrombin (1 U ml "1 ) (Sigma, Taufkichen, Germany) and horsh radish peroxidase (5 ⁇ g/ml) (Sigma, Taufmün, Germany) as the macromolecule marker protein was added to the upper wells.
  • compounds according to the invention can inhibit Thrombin-induced permeability of HUVEC monolayers for horsh radish peroxidase (HRP) as a macromolecule marker. Therefore, PDE2 inhibitors are suggested to improve the endothelial barrier function, which is impaired in numerous conditions such as acute respiratory distress syndrome (ARDS) or severe pneumonia.
  • ARDS acute respiratory distress syndrome
  • the system to measure these cellular effects of the PDE2 inhibitors observed the enzymological characteristics of PDE2 which exhibits a rather high Km for cAMP and the activity of which is activated by cGMP.
  • the Thrombin-induced increase of HRP permeability was completely abolished by complete inhibition of PDE3 (10 ⁇ M Motapizone) and PDE4 (1 ⁇ M RP73401).
  • HUVEC cells on 3 ⁇ m polycarbonate filters were preincubated with 1 ⁇ M RP73401 (to block PDE4) and 10 ⁇ M Motapizone (to block PDE3), 1mM SNP or 10OnM ANP and 1 ⁇ M of test sample over 15 min and then stimulated with 1 U/ml thrombin.
  • HRP passage into the lower wells was assessed after 60 min.
  • RP73401 and Motapizone completely blocked thrombin-induced hyperpermeability, which was partially reversed by SNP and ANP.
  • Compounds according to this invention can inhibit the SNP- or ANP-induced permeability increase in a concentration-dependent fashion.
  • Representative inhibitory values [measured as -log IC 50 (mol/l)] determined in the aforementioned assay follow from the following table B, in which the numbers of the compounds correspond to the numbers of the examples.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Communicable Diseases (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Oncology (AREA)
  • Diabetes (AREA)
  • Immunology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pulmonology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Compositions Of Macromolecular Compounds (AREA)
PCT/EP2005/054266 2004-09-02 2005-08-31 Triazolophthalazines Ceased WO2006024640A2 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
DE602005021894T DE602005021894D1 (de) 2004-09-02 2005-08-31 Triazolophthalazine
CA2578368A CA2578368C (en) 2004-09-02 2005-08-31 Triazolophthalazines
US11/660,748 US7851472B2 (en) 2004-09-02 2005-08-31 Triazolophthalazines
AU2005279221A AU2005279221C9 (en) 2004-09-02 2005-08-31 Triazolophthalazines
EA200700537A EA014324B1 (ru) 2004-09-02 2005-08-31 Триазолофталазины
BRPI0514586-4A BRPI0514586A (pt) 2004-09-02 2005-08-31 triazolftalazinas
CN200580038057XA CN101133057B (zh) 2004-09-02 2005-08-31 三唑并酞嗪化合物
NZ553160A NZ553160A (en) 2004-09-02 2005-08-31 Anilino-substituted triazolophthalazine derivatives having PDE2 inhibitory activity
JP2007528875A JP5140427B2 (ja) 2004-09-02 2005-08-31 トリアゾロフタラジン
KR1020077006869A KR101368093B1 (ko) 2004-09-02 2005-08-31 트리아졸로프탈라진
HK08106059.7A HK1115590B (en) 2004-09-02 2005-08-31 Triazolophthalazines
AT05784647T ATE471324T1 (de) 2004-09-02 2005-08-31 Triazolophthalazine
EP05784647A EP1791543B1 (en) 2004-09-02 2005-08-31 Triazolophthalazines
IL181271A IL181271A (en) 2004-09-02 2007-02-11 Annilino-preserved triazolopathalines and their pharmacological preparations for the treatment of infectious shock, edema, arthritis and airway irregularities
NO20071127A NO20071127L (no) 2004-09-02 2007-02-28 Triazoloftalaziner
US12/766,478 US20100286140A1 (en) 2004-09-02 2010-04-23 Triazolophthalazines

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP04104221 2004-09-02
EP04104221.9 2004-09-02

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/766,478 Continuation US20100286140A1 (en) 2004-09-02 2010-04-23 Triazolophthalazines

Publications (2)

Publication Number Publication Date
WO2006024640A2 true WO2006024640A2 (en) 2006-03-09
WO2006024640A3 WO2006024640A3 (en) 2007-06-07

Family

ID=34929521

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2005/054266 Ceased WO2006024640A2 (en) 2004-09-02 2005-08-31 Triazolophthalazines

Country Status (17)

Country Link
US (2) US7851472B2 (https=)
EP (1) EP1791543B1 (https=)
JP (1) JP5140427B2 (https=)
KR (1) KR101368093B1 (https=)
CN (1) CN101133057B (https=)
AT (1) ATE471324T1 (https=)
AU (1) AU2005279221C9 (https=)
BR (1) BRPI0514586A (https=)
CA (1) CA2578368C (https=)
DE (1) DE602005021894D1 (https=)
EA (1) EA014324B1 (https=)
ES (1) ES2347337T3 (https=)
IL (1) IL181271A (https=)
NO (1) NO20071127L (https=)
NZ (1) NZ553160A (https=)
WO (1) WO2006024640A2 (https=)
ZA (1) ZA200701137B (https=)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006072615A3 (en) * 2005-01-05 2007-01-04 Altana Pharma Ag Triazolophthalazines as pde2-inhibitors
WO2006072612A3 (en) * 2005-01-05 2007-11-29 Nycomed Gmbh Triazolophthalazines as pde2- inhibitors
WO2014019979A1 (en) 2012-07-31 2014-02-06 Boehringer Ingelheim International Gmbh 4-methyl-2,3,5,9,9b-pentaaza-cyclopenta[a]naphthalenes
WO2015096651A1 (en) 2013-12-23 2015-07-02 Merck Sharp & Dohme Corp. Pyrimidone carboxamide compounds as pde2 inhibitors
WO2015106032A1 (en) 2014-01-08 2015-07-16 Intra-Cellular Therapies, Inc. Products and pharmaceutical compositions
WO2016149058A1 (en) 2015-03-17 2016-09-22 Merck Sharp & Dohme Corp. Triazolyl pyrimidinone compounds as pde2 inhibitors
WO2016154081A1 (en) 2015-03-26 2016-09-29 Merck Sharp & Dohme Corp. Pyrazolyl pyrimidinone compounds as pde2 inhibitors
WO2016209749A1 (en) 2015-06-25 2016-12-29 Merck Sharp & Dohme Corp. Substituted pyrazolo/imidazolo bicyclic compounds as pde2 inhibitors
US9540379B2 (en) 2011-01-31 2017-01-10 Boehringer Ingelheim International Gmbh (1,2,4)triazolo[4,3-A]quinoxaline derivatives as inhibitors of phosphodiesterases
EP3156405A1 (en) 2015-10-13 2017-04-19 Boehringer Ingelheim International GmbH Spirocyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxamide
US9682991B2 (en) 2009-12-31 2017-06-20 Fundación Centro Nacional De Investigaciones Oncologicas Carlos Iii Tricyclic compounds for use as kinase inhibitors
EP3328840A1 (en) 2015-07-01 2018-06-06 Merck Sharp & Dohme Corp. Substituted triazolo bicyclic compounds as pde2 inhibitors
US10105349B2 (en) 2014-12-06 2018-10-23 Intra-Cellular Therapies, Inc. Organic compounds
US10160762B2 (en) 2015-05-29 2018-12-25 Merck Sharp & Dohme Corp. 6-alkyl dihydropyrazolopyrimidinone compounds as PDE2 inhibitors
US10174037B2 (en) 2015-06-04 2019-01-08 Merck Sharp & Dohme Corp. Dihydropyrazolopyrimidinone compounds as PDE2 inhibitors
US10195201B2 (en) 2015-05-05 2019-02-05 Merck Sharp & Dohme Corp. Heteroaryl-pyrimidinone compounds as PDE2 inhibitors
US10287293B2 (en) 2015-07-01 2019-05-14 Merck Sharp & Dohme Corp. Bicyclic heterocyclic compounds as PDE2 inhibitors
US10285989B2 (en) 2015-05-15 2019-05-14 Merck Sharp & Dohme Corp. Pyrimidinone amide compounds as PDE2 inhibitors
US10300064B2 (en) 2014-12-06 2019-05-28 Intra-Cellular Therapies, Inc. Organic compounds
WO2019101970A1 (en) 2017-11-23 2019-05-31 Oslo University Hospital Hf Treatment of tachycardia

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
HUE057317T2 (hu) 2014-04-23 2022-04-28 Dart Neuroscience Llc Helyettesített [1,2,4]triazolo[1,5-A]pirimidin-7-IL vegyületeket tartalmazó készítmények mint PDE2 inhibítorok
TWI568737B (zh) 2014-11-05 2017-02-01 達特神經科學(開曼)有限責任公司 作為pde2抑制劑之經取代的5-甲基-[1,2,4]三唑并[1,5-a]嘧啶-2-胺化合物

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PH21834A (en) * 1982-01-18 1988-03-17 Lepetit Spa New 6-substituted-s-triazolo(3,4-a)phthalazine derivatives
RU2128175C1 (ru) * 1994-08-09 1999-03-27 Эйсай Ко., Лтд. Конденсированный пиридазин или его фармакологически приемлемая соль, средство, проявляющее ингибирующую активность в отношении циклической гмф- фосфодиэстеразы
WO1996008496A1 (en) * 1994-09-16 1996-03-21 Takeda Chemical Industries, Ltd. Triazolopyridazines process and intermediates for their preparation and their use as medicaments
US5869486A (en) 1995-02-24 1999-02-09 Ono Pharmaceutical Co., Ltd. Fused pyrimidines and pyriazines as pharmaceutical compounds
KR20000029548A (ko) * 1996-07-25 2000-05-25 더블유. 지. 콜 가바수용체에대한리간드로서의치환된트리아졸로-피리다진유도체
CA2288789C (en) 1997-05-08 2009-07-21 Merck Sharp & Dohme Limited Substituted 1,2,4-triazolo[3,4-a]phthalazine derivatives as gaba alpha 5 ligands
US6235741B1 (en) * 1997-05-30 2001-05-22 Merck & Co., Inc. Angiogenesis inhibitors
GB9715977D0 (en) 1997-07-29 1997-10-01 Merck Sharp & Dohme Therapeutic agents
GB9801208D0 (en) * 1998-01-21 1998-03-18 Merck Sharp & Dohme Therapeutic agents
IT1303272B1 (it) * 1998-10-29 2000-11-06 Zambon Spa Derivati triciclici inibitori della fosfodiesterasi 4
GB0028583D0 (en) * 2000-11-23 2001-01-10 Merck Sharp & Dohme Therapeutic compounds
GB0108475D0 (en) * 2001-04-04 2001-05-23 Merck Sharp & Dohme New compounds
US6958334B2 (en) * 2001-04-10 2005-10-25 Merck & Co., Inc. Inhibitors of Akt activity
CA2591991C (en) * 2005-01-05 2013-11-19 Altana Pharma Ag Triazolophthalazines
CN101103033B (zh) * 2005-01-05 2010-08-04 尼科梅德有限责任公司 作为pde2抑制剂的三唑并酞嗪

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006072615A3 (en) * 2005-01-05 2007-01-04 Altana Pharma Ag Triazolophthalazines as pde2-inhibitors
WO2006072612A3 (en) * 2005-01-05 2007-11-29 Nycomed Gmbh Triazolophthalazines as pde2- inhibitors
EA012505B1 (ru) * 2005-01-05 2009-10-30 Никомед Гмбх Триазолофталазины в качестве ингибиторов pde-2
US7671050B2 (en) 2005-01-05 2010-03-02 Nycomed Gmbh Triazolophthalazines
AU2006204454B2 (en) * 2005-01-05 2011-11-10 Takeda Gmbh Triazolophthalazines as PDE2-inhibitors
US8106047B2 (en) 2005-01-05 2012-01-31 Nycomed Gmbh Triazolophthalazines
US9682991B2 (en) 2009-12-31 2017-06-20 Fundación Centro Nacional De Investigaciones Oncologicas Carlos Iii Tricyclic compounds for use as kinase inhibitors
US9540379B2 (en) 2011-01-31 2017-01-10 Boehringer Ingelheim International Gmbh (1,2,4)triazolo[4,3-A]quinoxaline derivatives as inhibitors of phosphodiesterases
WO2014019979A1 (en) 2012-07-31 2014-02-06 Boehringer Ingelheim International Gmbh 4-methyl-2,3,5,9,9b-pentaaza-cyclopenta[a]naphthalenes
US9085584B2 (en) 2012-07-31 2015-07-21 Boehringer Ingelheim International Gmbh Substituted pyrido[3,2-E][1,2,4]-triazolo[4,3-A]pyrazines for the treatment of central nervous system disorders
WO2015096651A1 (en) 2013-12-23 2015-07-02 Merck Sharp & Dohme Corp. Pyrimidone carboxamide compounds as pde2 inhibitors
US9815796B2 (en) 2013-12-23 2017-11-14 Merck Sharp & Dohme Corp. Pyrimidone carboxamide compounds as PDE2 inhibitors
WO2015106032A1 (en) 2014-01-08 2015-07-16 Intra-Cellular Therapies, Inc. Products and pharmaceutical compositions
US10543194B2 (en) 2014-12-06 2020-01-28 Intra-Cellular Therapies, Inc. Organic compounds
US10105349B2 (en) 2014-12-06 2018-10-23 Intra-Cellular Therapies, Inc. Organic compounds
US10300064B2 (en) 2014-12-06 2019-05-28 Intra-Cellular Therapies, Inc. Organic compounds
WO2016149058A1 (en) 2015-03-17 2016-09-22 Merck Sharp & Dohme Corp. Triazolyl pyrimidinone compounds as pde2 inhibitors
US10358435B2 (en) 2015-03-17 2019-07-23 Merck Sharp & Dohme Corp. Triazolyl pyrimidinone compounds as PDE2 inhibitors
WO2016154081A1 (en) 2015-03-26 2016-09-29 Merck Sharp & Dohme Corp. Pyrazolyl pyrimidinone compounds as pde2 inhibitors
US10287269B2 (en) 2015-03-26 2019-05-14 Merck Sharp & Dohme Corp. Pyrazolyl pyrimidinone compounds as PDE2 inhibitors
US10195201B2 (en) 2015-05-05 2019-02-05 Merck Sharp & Dohme Corp. Heteroaryl-pyrimidinone compounds as PDE2 inhibitors
US10285989B2 (en) 2015-05-15 2019-05-14 Merck Sharp & Dohme Corp. Pyrimidinone amide compounds as PDE2 inhibitors
US10160762B2 (en) 2015-05-29 2018-12-25 Merck Sharp & Dohme Corp. 6-alkyl dihydropyrazolopyrimidinone compounds as PDE2 inhibitors
US10174037B2 (en) 2015-06-04 2019-01-08 Merck Sharp & Dohme Corp. Dihydropyrazolopyrimidinone compounds as PDE2 inhibitors
US10647727B2 (en) 2015-06-25 2020-05-12 Merck Sharp & Dohme Corp. Substituted pyrazolo/imidazolo bicyclic compounds as PDE2 inhibitors
WO2016209749A1 (en) 2015-06-25 2016-12-29 Merck Sharp & Dohme Corp. Substituted pyrazolo/imidazolo bicyclic compounds as pde2 inhibitors
US10287293B2 (en) 2015-07-01 2019-05-14 Merck Sharp & Dohme Corp. Bicyclic heterocyclic compounds as PDE2 inhibitors
US10357481B2 (en) 2015-07-01 2019-07-23 Merck Sharp & Dohme Corp. Substituted triazolo bicyclic compounds as PDE2 inhibitors
EP3328840A1 (en) 2015-07-01 2018-06-06 Merck Sharp & Dohme Corp. Substituted triazolo bicyclic compounds as pde2 inhibitors
US10023575B2 (en) 2015-10-13 2018-07-17 Boehringer Ingelheim International Gmbh Cyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxyamide
US10479794B2 (en) 2015-10-13 2019-11-19 Boehringer Ingelheim International Gmbh Cyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxyamide
EP3156405A1 (en) 2015-10-13 2017-04-19 Boehringer Ingelheim International GmbH Spirocyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxamide
US10875867B2 (en) 2015-10-13 2020-12-29 Boehringer Ingelheim International Gmbh Cyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxyamide
US11691977B2 (en) 2015-10-13 2023-07-04 Boehringer Ingelheim International Gmbh Cyclic ether derivatives of pyrazolo[1,5-A]pyrimidine-3-carboxyamide
US12351584B2 (en) 2015-10-13 2025-07-08 Boehringer Ingelheim International Gmbh Cyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxyamide
WO2019101970A1 (en) 2017-11-23 2019-05-31 Oslo University Hospital Hf Treatment of tachycardia
US11419874B2 (en) 2017-11-23 2022-08-23 Oslo University Hospital Hf Treatment of tachycardia
AU2018371216B2 (en) * 2017-11-23 2024-09-19 Oslo University Hospital Hf Treatment of tachycardia

Also Published As

Publication number Publication date
AU2005279221A1 (en) 2006-03-09
US20100286140A1 (en) 2010-11-11
AU2005279221C1 (en) 2012-05-24
KR20070047834A (ko) 2007-05-07
JP5140427B2 (ja) 2013-02-06
ATE471324T1 (de) 2010-07-15
WO2006024640A3 (en) 2007-06-07
CA2578368C (en) 2013-07-02
JP2008511586A (ja) 2008-04-17
DE602005021894D1 (de) 2010-07-29
EA014324B1 (ru) 2010-10-29
US20090005372A1 (en) 2009-01-01
AU2005279221C9 (en) 2012-08-23
CA2578368A1 (en) 2006-03-09
EA200700537A1 (ru) 2007-10-26
NO20071127L (no) 2007-02-28
ZA200701137B (en) 2008-11-26
BRPI0514586A (pt) 2008-06-17
CN101133057B (zh) 2011-03-09
HK1115590A1 (en) 2008-12-05
KR101368093B1 (ko) 2014-03-14
EP1791543A2 (en) 2007-06-06
US7851472B2 (en) 2010-12-14
AU2005279221B2 (en) 2011-10-13
IL181271A0 (en) 2007-07-04
IL181271A (en) 2013-11-28
NZ553160A (en) 2010-08-27
EP1791543B1 (en) 2010-06-16
CN101133057A (zh) 2008-02-27
ES2347337T3 (es) 2010-10-28

Similar Documents

Publication Publication Date Title
US20100286140A1 (en) Triazolophthalazines
EP1836207B1 (en) Triazolophthalazines as pde2-inhibitors
US20110136803A1 (en) Triazolophthalazines
US20060106037A1 (en) Purin-6-one-derivatives
HK1115590B (en) Triazolophthalazines

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 553160

Country of ref document: NZ

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 200701137

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 181271

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2578368

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2007528875

Country of ref document: JP

Ref document number: MX/a/2007/002266

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2005784647

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 434/MUMNP/2007

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 11660748

Country of ref document: US

Ref document number: 2005279221

Country of ref document: AU

Ref document number: 1020077006869

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 200700537

Country of ref document: EA

ENP Entry into the national phase

Ref document number: 2005279221

Country of ref document: AU

Date of ref document: 20050831

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2005279221

Country of ref document: AU

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 200580038057.X

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005784647

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0514586

Country of ref document: BR