WO2006024283A2 - Verbindungen und methoden zur behandlung, diagnose und prognose bei pankreaserkrankungen - Google Patents

Verbindungen und methoden zur behandlung, diagnose und prognose bei pankreaserkrankungen Download PDF

Info

Publication number
WO2006024283A2
WO2006024283A2 PCT/DE2005/001527 DE2005001527W WO2006024283A2 WO 2006024283 A2 WO2006024283 A2 WO 2006024283A2 DE 2005001527 W DE2005001527 W DE 2005001527W WO 2006024283 A2 WO2006024283 A2 WO 2006024283A2
Authority
WO
WIPO (PCT)
Prior art keywords
chr
protein
gene
gene product
pancreatic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/DE2005/001527
Other languages
English (en)
French (fr)
Other versions
WO2006024283A3 (de
Inventor
Günter KLÖPPEL
Jutta Lüttges
Holger Kalthoff
Ole Ammerpohl
Robert Grützmann
Christian Pilarsky
Hans-Detlev Saeger
Ingo Alldinger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Technische Universitaet Dresden
Original Assignee
Technische Universitaet Dresden
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Technische Universitaet Dresden filed Critical Technische Universitaet Dresden
Priority to DE112005002742T priority Critical patent/DE112005002742B4/de
Publication of WO2006024283A2 publication Critical patent/WO2006024283A2/de
Publication of WO2006024283A3 publication Critical patent/WO2006024283A3/de
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the invention relates to nucleic acid sequences and peptides or proteins encoded thereby, as well as the use of sequences derived therefrom for screening substances that bind thereto and the use of substances binding to the nucleic acids and peptides or proteins derived therefrom for diagnosis, prognosis, and for the therapeutic treatment of pancreatic tumors, in particular of the ductal adenocarcinoma of the pancreas.
  • Ductal adenocarcinoma of the pancreas is one of the most common causes of cancer death. In the US, it causes approximately 30,000 deaths each year, and pancreatic cancer ranks 5th among cancer-related causes of death.
  • the diagnosis of pancreatic carcinoma in a patient represents an infertile prognosis.
  • the survival time of all patients with ductal pancreatic carcinoma is on average only 1 year, and only about 4% of the patients survive a period of 5 years.
  • the late diagnosis of these tumors is one reason for the poor survival rate.
  • pancreatic tumors The histological differential diagnosis of pancreatic tumors is often difficult. There are various antibodies used in the pathological routine (eg against cytokeratin 18), but with which it is not always possible to predict the course of the disease. In the investigation of dislocations (metastases) of various carcinomas of the pancreas, biliary tract and gallbladder, as well as the papilla vateri histological assignment to the primary tumor is usually not possible. An assignment of these metastases to the primary tumor is important for the selection of an adapted palliative chemotherapy.
  • pancreatic tumor marker For the early detection, the laboratory differential diagnosis of pancreatic tumors to other pancreatic diseases and the follow-up after surgery, there is so far only one marker, the CA19-9.
  • this tumor marker to be determined in the blood is not very specific and sensitive, i. there are patients with chronic pancreatitis (pancreatitis) who have a high Ca19-9 value and patients with normal Ca19-9 who have a pancreatic tumor.
  • ductal pancreatic cancer The treatment of ductal pancreatic cancer is currently limited to surgery and chemotherapy.
  • the surgical removal of the tumor offers the only option a chance of recovery.
  • Chemotherapy with the most commonly used chemotherapy Only in a few cases does a life improvement, but no cure. At present, only less than 40% of patients can be treated with curative treatment, and a large proportion of them die on average after 2 years.
  • the typical symptoms of end-stage pancreatic cancer are body wasting and severe pain. Both factors significantly affect the quality of life of patients.
  • pancreatic carcinoma adenocarcinoma .
  • K-ras, DPC4, p53 and p16 seem to play an important role in the development of pancreatic carcinoma (1-4).
  • microarray techniques have also been used to study tumor-specific gene expression in various types of cancers, i.a. also used in pancreatic carcinoma (5-20).
  • Previous studies of tumor-specific gene expression in pancreatic carcinoma were performed with whole tissue samples or with cell lines. In cell lines, however, changes in gene expression can be induced by in vitro conditions that are not present in vivo.
  • Tissue samples from the ductal adenocarcinoma of the pancreas therefore contain various cell types, such as ductal cells, acinar cells, islet cells, inflammatory and nerve cells, as well as fibrocystic elements.
  • the expression profile obtained may represent both the tumor tissue and the adjacent non-neoplastic tissue, making the data obtained questionable.
  • the object of the invention is to provide new methods for the diagnosis and prognosis as well as novel compounds for the treatment of pancreatic carcinoma, in particular of the ductal adenocarcinoma of the pancreas.
  • the object is achieved by a method for in vitro diagnosis of a pancreatic carcinoma, in particular of the ductal adenocarcinoma of the pancreas, wherein the amount of gene product of at least one of the genes listed in Table 1 and / or Table 2 in a sample of biological origin of an individual is determined , The amount of gene product in the sample of biological origin of an individual is compared to the amount of the corresponding gene product commonly present in normal pancreatic epithelial tissue. If it is a gene listed in Table 1, an increased amount of the gene product is an indication of the presence of a gene Pankreaskarzioms. If it is a gene listed in Table 2, a decreased amount of the gene product is an indication of the presence of a pancreatic carcinoma.
  • the invention is based on a study in which it was determined which genes in pancreatic carcinoma undergo an altered expression level compared to the normal pancreatic epithelial tissue. For this purpose, a microdissection of human pancreatic tissue and normal ductal pancreatic epithelial tissue was performed and then a comparative study of gene expression using the U 133 set of Affymetrix (Affymetrix Human Genome U133 Set, Santa Clara, Calif. CA, USA, Order Number: 900444) performed 45,000 Fragments corresponding to 33,000 known genes and 6,000 expressed sequence tags (ESTs).
  • Affymetrix Affymetrix Human Genome U133 Set, Santa Clara, Calif. CA, USA, Order Number: 900444
  • nucleic acid sequences and proteins were identified which undergo an altered expression level in pancreatic carcinoma compared to normal pancreatic epithelial tissue.
  • the altered expression of these genes is causally linked to the pancreatic tumor.
  • pancreatic tumor tissue samples used were homogeneous and do not contain non-neoplastic tissue. Due to the reduced heterogeneity of the microdissected tissue, even the smallest changes in gene expression can be observed.
  • the identification number of the Affymetrix sample set For characterization, the identification number of the Affymetrix sample set, the gene symbol, the gene name, the chromosomal localization, the representative identification number (ID), the identification number of the transcript and that of the corresponding protein are specified (publication numbers in the Entrez database of the National Center for Biotechnology Information (NCBI), Bethesda, USA (http://www.ncbi.nih.gov/entrez/)
  • the q value (in percent) indicates the statistical error with which the evaluation program used predicts differential gene expression.
  • PAK1 interacting protein 1 NM 017906 g8923576 NP 060376 Chr: 6p24.1 4.23644 3.612633
  • Nr Affymetrix Gene Symbol Gene Name Representative Transcript ID Representative Chromosomal FoId q-valve
  • Proteaseome (prosome, NMJ3Q2818 g4506236 NPJ302809 Chr: 14q11.2 2.31359 0.095261 'macropain) activator with 2 (PA28 beta) /// proteasome (prosome, macropain ⁇ activator subunit 2 (PA28 beta) ⁇ >
  • triosephosphate isomerase 1 NM 000365 g4507644 NP 000356 Chr: 12p13 2.12957 1.578435
  • conjuggase folylpoiygammaglutamyl hydrolase
  • gamma-glutamyl hydrolase conjuggase, folylpoiygammaglutamyl hydrolase
  • Table 2 lists genes whose expression in the ductal adenocarcinoma of the pancreas is on average at most half as high as the expression in normal pancreatic epithelial tissue. Ie. the fold change from the expression levels in the microdissected ductal adenocarcinoma of the pancreas (mean over 14 patients) and the expression values in the healthy microdissected ductal pancreas epithelium (mean over 11 persons) is ⁇ 0.5 for these genes the quotient ("fold change") indicated 1000, this means that the gene could be detected only in normal tissue, but not in tumor tissue. The genes are consecutively numbered from the number 541.
  • the identification number of the Affymetrix sample set For characterization, the identification number of the Affymetrix sample set, the gene symbol, the gene name, the chromosomal localization, the representative identification number (ID), the identification number of the transcript and that of the corresponding protein are specified (publication numbers in the Entrez database of the National Center for Biotechnology Information (NCBI), Bethesda, USA (http://www.ncbi.nih.gov/entrez/)
  • the q value (in percent) indicates the statistical error with which the evaluation program used predicts differential gene expression.
  • Oxidase, copper containing 3 vascular adhesion protein 1
  • beta A2 /// NM_005209 g7019356 NP_005200 Chr: 2q34-q36 0.41707 0.095261 crystailin, beta A2

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Die Erfindung betrifft Verfahren für die Diagnose und Prognose des Pankreaskarzinoms, insbesondere des duktalen Adenomakarzinoms des Pankreas, Verfahren zum Screenen nach Wirkstoffen zur Therapie des Pankreaskarzinoms, sowie die Verwendung von Antisense-Konstrukten bzw. siRNA-Molekülen für die Herstellung einer pharmazeutischen Zusammensetzung zur Behandlung des Pankreaskarzinoms. Durch die vergleichende Untersuchung der Genexpression im Pankreaskarzinom und im normalen Pankreasepithelgewebe wurden insgesamt 1419 differentiell exprimierte Gene gefunden (650 hochregulierte und 769 herunterregulierte Gene). Von 1267 der gefundenen 1419 Gene war bisher nicht bekannt, dass sie im Zusammenhang mit Pankreastumor stehen. Durch die Bestimmung der Menge an Genprodukt eines solchen differentiell exprim.ierten Gens in einer Probe biologischen Ursprungs eines Individuums und den Vergleich mit der Menge an üblicherweise im Pankreasgewebe vorliegenden Genprodukt kann ermittelt werden, ob ein Pankreaskarzinom vorliegt.

Description

Verbindungen und Methoden zur Behandlung, Diagnose und Prognose bei Pankreaserkrankungen
Die Erfindung betrifft Nukleinsäuresequenzen sowie hierdurch kodierte Peptide bzw. Proteine, als auch die Verwendung von hieraus abgeleitenden Sequenzen zum Screenen nach daran bindenden Substanzen als auch die Verwendung von an den Nukleinsäuren und der daraus abgeleiteten Peptide bzw. Proteine bindenden Substanzen zur Diagnose, Prognose, sowie zur therapeutischen Behandlung bei Pankreastumoren, insbesondere beim duktalen Adenokarzinom des Pankreas.
Das duktale Adenokarzinom des Pankreas ist eine der häufigsten krebsbedingten Todesursachen. In den USA werden jährlich ca. 30 000 Todesfälle dadurch verursacht und das Pankreaskarzinom rangiert auf Platz 5 unter den krebsbedingten Todesursachen. Die Diagnose eines Pankreaskarzinoms bei einem Patienten stellt eine infauste Prognose dar. Die Überlebenszeit aller Patienten mit einem duktalen Pankreaskarzinom beträgt im Mittel nur 1 Jahr, und nur etwa 4% der Patienten überleben einen Zeitraum von 5 Jahren. Neben der speziellen Biologie des Pankreaskarzinoms ist auch die späte Diagnose dieser Tumore ein Grund für die schlechte Überlebensrate.
Die histologische Differentialdiagnose von Pankreastumoren ist oft schwierig. Es existieren verschiedene in der pathologischen Routine angewendete Antikörper (z. B. gegen Zytokeratin 18), mit welchen aber nicht immer eine Prognose zum Krankheitsverlauf möglich ist. Bei der Untersuchung von Absiedelungen (Metastasen) von verschiedenen Karzinomen des Pankreas, der Gallenwege und der Gallenblase, wie auch der Papilla vateri ist meist die histologische Zuordnung zum Primärtumor nicht möglich. Eine Zuordnung dieser Metastasen zum Primärtumor ist zur Wahl einer angepassten palliativen Chemotherapie wichtig.
Für die Früherkennung, die laborchemische Differentialdiagnose von Pankreastumoren zu anderen Bauchspeicheldrüsenerkrankungen und der Verlaufskontrolle nach Operation gibt es bisher nur einen Marker, das CA19-9. Dieser im Blut zu bestimmende Tumormarker ist allerdings nicht sehr spezifisch und sensitiv, d.h. es gibt Patienten mit chronischer Pankreatitis (Bauchspeicheldrüsenentzündung), welche einen stark erhöhten Ca19-9 Wert haben und Patienten mit normalem Ca19-9, welche einen Pankreastumor haben.
Die Behandlung des duktalen Pankreaskarzinoms ist derzeit auf die Operation und Chemotherapie begrenzt. Die operative Entferung des Tumors bietet als einzige Option eine Heilungschance. Die Chemotherapie mit dem meist eingesetzten Chemotherapeutikum bietet nur in wenigen Fällen eine Lebensverbesserung, aber keine Heilung. Es können zur Zeit nur weniger als 40% der Patienten kurativ behandelt werden und von diesen stirbt ein großer Teil im Durchschnitt nach 2 Jahren. Die typischen Symptome im Endstadium des Pankreaskarzinoms sind eine Auszehrung des Körpers und starke Schmerzen. Beide Faktoren beeinträchtigen die Lebensqualtität der Patienten erheblich.
In den letzten Jahren wurden einige mit der Krebsentstehung in Verbindung stehende Gene im duktalen Adenokarzinom des Pankreas identifiziert. K-ras, DPC4, p53 und p16 scheinen dabei eine wichtige Rolle bei der Entstehung des Pankreaskarzinoms zu spielen (1-4). Seit kurzem werden auch Microarray-Techniken zur Untersuchung der tumorspezifischen Genexpression bei verschiedenen Krebsarten, u.a. auch beim Pankreaskarzinom, angewendet (5-20). Bisherige Untersuchungen der tumorspezifischen Genexpression beim Pankreaskarzinom wurden mit ganzen Gewebeproben oder mit Zelllinien durchgeführt. In Zelllinien können aber durch die Bedingungen in vitro Veränderungen in der Genexpression induziert werden, die so in vivo nicht vorliegen.
Sowohl der Tumor als auch das Pankreasnormalgewebe verfügen über eine heterogene Struktur. Gewebeproben aus dem duktalen Adenokarzinom des Pankreas enthalten daher verschiedene Zelltypen, wie duktale Zellen, azinöse Zellen, Inselzellen, Entzündungs- und Nervenzellen, sowie fibrozystische Elemente. Wenn ganze Gewebeproben in Microarray- Untersuchungen eingesetzt werden, kann das erhaltene Expressionsprofil sowohl das Tumorgewebe als auch das benachbarte nicht-neoplastische Gewebe repräsentieren, was die erhaltenden Daten fragwürdig erscheinen läßt.
Aufgabe der Erfindung ist es, neue Verfahren für die Diagnose und Prognose sowie neue Verbindungen für die Behandlung des Pankreaskarzinoms, insbesondere des duktalen Adenokarzinoms des Pankreas, bereitzustellen.
Erfindungsgemäß wird die Aufgabe gelöst durch ein Verfahren zur in vitro Diagnose eines Pankreaskarzinoms, insbesondere des duktalen Adenokarzinoms des Pankreas, wobei die Menge an Genprodukt von mindestens einem der in Tabelle 1 und/oder Tabelle 2 aufgeführten Gene in einer Probe biologischen Ursprungs eines Individuums bestimmt wird. Die Menge an Genprodukt in der Probe biologischen Ursprungs eines Individuums wird mit der Menge des entsprechenden Genprodukts, die in normalem Pankreasepithelgewebe üblicherweise vorliegt, verglichen. Falls es sich um ein in der Tabelle 1 aufgeführtes Gen handelt, ist eine erhöhte Menge des Genprodukts ein Indiz für das Vorliegen eines Pankreaskarzioms. Falls es sich um ein in der Tabelle 2 aufgeführtes Gen handelt, ist eine erniedrigte Menge des Genprodukts ein Indiz für das Vorliegen eines Pankreaskarzinoms.
Der Erfindung liegt eine Untersuchung zugrunde, in der ermittelt wurde, welche Gene im Pankreaskarzinom eine veränderte Expressionshöhe gegenüber dem normalen Pankreasephithelgewebe erfahren. Dazu wurde eine Mikrodissektion von humanem Pankreastumorgewebe und von normalem duktalem Pankreasepithelgewebe durchgeführt und anschließend eine vergleichende Untersuchung der Genexpression mittels des U 133 Sets von Affymetrix (Affymetrix Human Genome U133 Set, Santa Clara, CA, USA, Bestellnummer: 900444) durchgeführt, das 45 000 Fragmente, die zu 33 000 bekannten Genen und 6 000 expressed sequence tags (ESTs) korrespondieren, enthält.
Auf diese Weise wurden Nukleinsäuresequenzen und Proteine identifiziert, die im Pankreaskarzinom eine veränderte Expressionshöhe gegenüber dem normalen Pankreasepithelgewebe erfahren. Die veränderte Expression dieser Gene ist ursächlich mit dem Pankreastumor verbunden.
Bei der der Erfindung zugrunde liegenden wissenschaftlichen Untersuchung wurde das Verfahren der Mikrodissektion zur Probengewinnung angewandt, um sicherzustellen, dass die verwendeten Pankreastumorgewebeproben homogen sind und kein nicht-neoplastisches Gewebe enthalten. Aufgrund der reduzierten Heterogenität des mikrodissektierten Gewebes können auch kleinste Veränderungen in der Genexpression beobachtet werden.
Zudem wurde in den bisherigen Untersuchungen nur ein kleiner Teil des menschlichen Transkriptoms untersucht. Damit war es bisher nicht möglich, alle Gene, deren Expression beim duktalen Adenokarzinom des Pankreas verändert ist, zu identifizieren. Bei der zugrundelegenden Untersuchung mit dem Affymetrix U 133 Chip wurde hingegen das komplette Genom untersucht.
Beim Vergleich der erhaltenen Genexpressionsprofile wurden insgesamt 1419 differentiell exprimierte Gene gefunden (650 hochregulierte und 769 herunterregulierte Gene). Überraschenderweise war nur ein Bruchteil dieser Gene bereits zuvor von anderen Gruppen als mit Pankreastumor in Verbindung stehend beschrieben worden. Von 1267 der gefundenen 1419 Gene war hingegen nicht bekannt, dass sie im Zusammenhang mit Pankreastumor stehen. In Tabelle 1 sind Gene aufgeführt, deren Expression im duktalen Adenokarzinom des Pankreas im Mittel mindestens doppelt so hoch ist wie die Expression in normalem Pankreasepithelgewebe. D. h. der Quotient („Fold Change") aus den Expressionswerten im mikrodissektierten duktalen Adenomakarzinom des Pankreas (Mittel über 14 Patienten) und den Expressionswerten im gesunden mikrodissektierten duktalen Pankreasepithelgewebe (Mittel über 11 Personen) ist für diese Gene > 2. Wird für ein Gen der Quotient („Fold Change") 1000 angegeben, bedeutet dies, dass das Gen nur in dem Tumor-, aber nicht in dem Normalgewebe nachgewiesen werden konnte. Die Gene sind fortlaufend nummeriert. Zur Charakterisierung werden jeweils die Identifikationsnummer des Affymetrix-Probensets, das Gensymbol, der Gen-Name, die chromosomale Lokalisation, die repräsentative Identifikationsnummer (ID), die Identifikationsnummer des Transkriptes und die des zugehörigen Proteins angegeben (Veröffentlichungsnummern in der Entrez-Datenbank des National Center for Biotechnology Information (NCBI), Bethesda, USA (http://www.ncbi.nih.gov/entrez/). Der q-Wert (in Prozent) gibt an, mit welchem statistischen Fehler das verwendete Auswerteprogramm eine differentielle Genexpression voraussagt.
Tabelle 1:
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID ProteinJD Lokalisierung Change /0/-
1 243329 at Clone 1MAGE:121662 mRNA A1074450 Hs.18106.0 1000 9.266777 sequence
2 236621 at Transcribed sequence with AV683684 Hs.40838.0 — 1000 strong similarity to protein pir:A48045 (H.sapiens) A48045 ribosomal protein S27, cytosolic - human
3 230619_at ARNT aryl hydrocarbon receptor AI768497 Hs.166172.2 NP_001659 Chr:1q21 1000 13.5285 nuciear translocator
4 228505 s at LOC124491 LOC124491 N49836 Hs.236456.0 NP 660297 Chr:16q22.3 1000 9.266777
5 227227 at AI344332 Hs.190488.4 1000 9.266777
6 222191_s_at B4GALT7 xylosylprotein beta 1,4- AK022566 Hs.54702.1 NP_009186 Chr:5q35.2- 1000 galactosyltransferase, q35.3 Polypeptide 7 (galactosyltransferase I)
7 221352_at HUMBINDC DNA binding protein for NM_013288 g7019420 1000 12.53374 °" Surfactant protein B /// DNA binding protein for Surfactant protein B
8 219510_at POLQ Polymerase (DNA directed), NM_006596 g5729983 NP_006587 Chr:3q13.33 1000 theta /// Polymerase (DNA directed), theta
9 219182_at CHST5 carbohydrate (N- NM_024533 gl 3375685 NP_036258 Chr:16q22.3 1000 1.578435 acetylglucosamine 6-O) sulfotransferase 5
10 218663_at HCAP-G chromosome condensation NM_022346 gl 1641252 NP_071741 Chr:4p16-p15 1000 4.149813 protein G
11 218355_at KIF4A kinesin family member 4A /// NM_012310 g7305204 NPJD36442 Chr:xq13.1 1000 3.612633 kinesin family member 4A
12 217770_at PlGT phosphatidylinositol glycan, NM_015937 g7706257 NPJD57021 Chr:20q12- 1000 class T /// phosphatidylinositol q13.12 giycan, class T
13 217466_x_at RPS2 ribosomal protein S2 L48784 Hs.182426.4 NP_002943 Chr:16p13.3 1000
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
14 213599 at OIP5 Opa-interacting protein 5 BE045993 Hs.116206.0 NP 009211 Chr:15q14 1000 12.53374
15 212680 x at LIMK2 LIM domain kinase 2 BE305165 Hs.100623.2 NP 005560 Chr:22q12.2 1000 6.991358
16 212376 s at EP400 E1A binding protein p400 BE880591 Hs.306094.0 NP_056224 Chr:12q24.33 1000 13.40329
17 211585_at NPAT nuclear protein, ataxia- U58852 gl 381666 NP_002510 Chr:11q22-q23 1000 13.40329 telangiectasia locus
18 208803_s_at SRP72 Signal recognition particle AF069765 g3243032 NP_008878 Chr:4q11 1000 6.991358 72kDa
19 208369_s_at GCDH glutaryl-Coenzyme A NM_013976 g7669493 NP_000150 Chr:19p13.2 1000 dehydrogenase /// glutaryl- Coenzyme A dehydrogenase
20 206558_at SIM2 single-minded homolog 2 NM_005069 g7108363 NP_005060 Chr:21q22.13 1000 (Drosophila) /// single-minded homolog 2 (Drosophila)
21 206043 s at KIAA0703 KIAA0703 gene product NM 014861 g7662255 — Chr:16q24.1 1000
22 205653 at CTSG cathepsin G /// cathepsin G NM 001911 g4503148 NP 001902 Chr:14q11.2 1000 1.578435
23 204948 s at FST follistatin NM 013409 g7242221 NP 006341 Chr:5q11.2 1000 3.612633
24 203870 at USP46 ubiquitin specific protease 46 BE856374 Hs.109268.0 NP 073743 Chr:4q12 1000 4.436744 c
Figure imgf000007_0001
\
25 203596_s_at IFIT5 interferon-induced protein with NM_012420 g6912629 NP_036552 Chr:10q23.32 1000 4.830969 tetratricopeptide repeats 5
26 203580_s_at SLC7A6 solute carrier family 7 (cationic NM_003983 g4507052 Chr:16q22.1 1000 8.779357 amino acid transporter, y+ System), member 6
27 203233_at IL4R interleukin 4 receptor /// NM_000418 g4557668 NP_000409 Chr:16p11.2- 1000 interleukin 4 receptor 12.1
28 203089 s at PRSS25 Protease, serine, 25 NM_013247 g7019476 NP_037379 Chr:2p12 1000
29 203035_s_at PIAS3 protein inhibitor of activated NM_006099 g5174628 NP_006090 Chr:1q21 1000 8.153992 STAT3 /// protein inhibitor of activated STAT3
30 91826 at EPS8L1 EPS8-like 1 AI219073 4919761 RC NP 060199 Chr:19q13.42 1000 1.702877
31 34063_at RECQL5 RecQ protein-like 5 AB006533 4822898 NPJD04250 Chr:17q25.2- 1000 2.08989 q25.3
32 243670_at — Transcribed sequences BE670161 Hs.253652.0 — — 1000 1.901012
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change ( o7/o.
33 243075 at Transcribed sequence with AW292940 Hs.290115.0 1000 1.051298 moderate similarity to protein sp:P39194 (H.sapiens) ALU7_HUMAN AIu subfamily SQ sequence contamination warning entry
34 239733_at MGC16186 hypothetical protein MGC16186 AI185136 Hs.48650.0 NP 115748 Chr:10q23.1 1000 1.702877
35 236174_at — Transcribed sequences A1808830 Hs.43938.0 — — 1000 0.518167
36 235548_at FLJ90166 hypothetical protein FLJ90166 BG326592 Hs.119286.0 NP 699191 Chr:20q13.32 1000 0.149911
37 232897 at FLJ20444 hypothetical protein FLJ20444 AK000451 Hs.285336.0 NP 982274 Chr:9q21 1000 0.149911
38 231286_at EDG3 endothelial differentiation, AW452080 Hs.160623.0 NP_005217 Chr:9q22.1- 1000 1.380569 sphingolipid G-protein-coupled q22.2 receptor, 3
39 229608_at LOC284465 hypothetical protein BF246946 Hs.26000.0 — Chr:1 p13.2 1000 1.051298 LOC284465
40 229389 at — Transcribed sequences AA741058 Hs.20065.0 — — 1000 2.08989
41 228558_at C14orf80 chromosome 14 open reading AL518291 Hs.72363.0 NP_775879 Chr:14q32.33 1000 3.62324 frame 80
42 223719 s at RTBDN retbindin BC005063 gl 3477198 NP 113617 Chr:19p12 1000 0.095261
43 223642_at ZIC2 Zic family member 2 (odd- AF193855 gl 1065969 NP_009060 Chr:13q32 1000 3.306454 paired homolog, Drosophila)
44 223389 s at ZNF581 zinc finger protein 581 AF151023 g7239106 NP 057619 Chr:19q 13.43 1000 2.489117
45 222083_at GLYAT glycine-N-acyltransferase AW024233 Hs.18508.1 NP 005829 Chr:11q12.2 1000 0.353669
46 218695_at EXOSC4 exosome component 4 NM 019037 g9506688 NP 061910 Chr:8q24.3 1000 4.174189
47 214478_at SPP2 secreted phosphoprotein 2, NM_006944 Hs.12230.0 NP_008875 Chr:2q37-qter 1000 1.901012 24kDa /// secreted phosphoprotein 2, 24kDa
48 213559_s_at EZI likely ortholog of mouse zinc BF223401 Hs.112158.0 NP_997219 Chr:7q36.1 1000 1.051298 finger protein EZI
49 213201_s_at TNNT1 troponin T1, skeletal, slow AJ011712 Hs.73980.1 NP 003274 Chr:19q13.4 1000 2.489117
50 213013_at MAPK8IP1 mitogen-activated protein BG164295 Hs.234249.0 NPJD05447 Chr:11p12- 1000 0.095261 kinase 8 interacting protein 1 p11.2
51 212318 at TNPO3 transportin 3 /// transportin 3 NM 012470 Hs.69235.0 NP_036602 Chr:7q32.3 1000 0.625663
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change ( /o)
52 208097_s_at TXNDC thioredoxin domain containing NM_030755 gl 3559515 NPJ 10382 Chr:14q22.1 1000 0.095261 /// thioredoxin domain containing /// thioredoxin domain containing
53 207980_s_at CITED2 Cbp/p300-interacting NM_006079 g5174416 NP_006070 Chr.6q23.3 1000 0.095261 transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
54 207322_at ITSN1 intersectin 1 (SH3 domain NM_003024 g4504796 NP_001001132 Chr:21q22.1- 1000 2.489117 protein) q22.2
55 206899_at NTSR2 neurotensin receptor 2 /// NM_012344 g6912537 NP_036476 Chr:2p25.1 1000 0.518167 neurotensin receptor 2
56 206696_at GPR143 G protein-coupled receptor 143 NM_000273 g4557806 NPJD00264 Chr:xp22.3 1000 0.095261 /// G protein-coupled receptor 143
57 204832_s_at BMPR1A bone morphogenetic protein NM_004329 g4757853 NP_004320 Chr:10q22.3 1000 0.095261 receptor, type IA
58 204656_at MCART1 mitochondrial carrier triple AL138752 Hs.244542.0 NP_219480 Chr:9p13.3-p12 1000 1.702877 repeat 1
59 202937_x_at CGI-96 CGI-96 protein AL022316 Hs.239934.0 NP_056518 Chr:22q13.2- 1000 0.625663 q13.31
60 201459_at RUVBL2 RuvB-like 2 (E. coli) /// RuvB- NM_006666 g5730022 NPJ)06657 Chr:19q13.3 1000 1.901012 like 2 (E. coli)
61 207301 at EFNA5 ephrin-A5 /// ephrin-A5 NM_001962 g4503486 NP 001953 Chr:5q21 44.02956 0.353669
62 221579_s_at NUDT3 nudix (nucleoside diphosphate AF062530 g3978225 NP_006694 Chr:6p21.2 . 27.3708 0.353669 linked moiety X)-type motif 3 /// nudix (nucleoside diphosphate linked moiety X)-type motif 3
63 237923 at — Transcribed sequences AI733801 Hs.146186.0 — — 26.281 2.489117
64 237411 at LOC345667 similar to ADAMTS-10 N71063 Hs.38173.0 NP_922932 Chr:5q12.3 25.15901 0.518167 precursor (A disintegrin and metalloproteinase with thrombospondin motifs 10) (ADAM-TS 10) (ADAM-TS10)
65 222854_s_at FLJ20514 hypothetical protein FLJ20514 AA044921 Hs.44423.0 NP_060326 Chr:xp22.31 20.84851 3.62324
66 223229 at HSPC150 HSPC150 protein similar to AB032931 g7416119 NP_054895 Chr.iq32.1 18.17979 0.201325 ubiquitin-conjugating eπzyme
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change
67 218741_at C22orfl8 chromosome 22 open reading NM_024053 gl 3129021 NP_076958 Chr:22q13.31 18.14555 1.578435 frame 18
68 213561_at ASF1A ASF1 anti-silencing function 1 BF062335 Hs.108110.1 NP_054753 Chr:6q22.31 12.20258 2.08989 homolog A (S. cerevisiae)
69 205278_at GAD1 glutamate decarboxylase 1 NM_0QQ817 g4503872 NP_000808 Chr:2q31 10.53315 4.640066 (brain, 67kDa) /// glutamate decarboxylase 1 {brain, 67kDa)
70 223274_at TCF19 traπscription factor 19 (SC1) BC002493 gl 2803348 NP 009040 Chr:6p21.3 10.3174 1.380569
71 214035_x_at LOC339047 hypothetica! protein AA308853 Hs.251928.2 — Chr:16p13.12 9.98884 1.901012 LOC339047
72 219650 at FLJ20105 hypothetical protein FLJ20105 NM 017669 g8923111 — Chr:xq13.1 9.23987 2.814919
73 204032_at BCAR3 breast cancer anti-estrogen NM_003567 g4502370 NPJD03558 Chr:1p22.1 9.08488 6.225758 resistance 3 /// breast cancer anti-estrogen resistance 3
74 202833_s_at SERPINA1 serine (or cysteine) Proteinase NMJ300295 g4505792 NP_000286 Chr:14q32.1 9.07322 10.20301 inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
75 219257_s_at SPHK1 sphingosine kinase 1 /// NMJ)21972 gl 1464966 NP_068807 Chr:17q25.2 9.02888 0.095261 sphingosine kinase 1
76 205403_at IL1R2 interleukin 1 receptor, type Il /// NM_004633 g4758597 NP_004624 Chr:2q12-q22 8.48697 4.174189 interleukin 1 receptor, type Il
77 208511_at PTTG2 pituitary tυmor-transforming 2 /// NMJ521OOO gl 0337606 NP_006598 Chr:4p12 8.39545 4.149813 pituitary tumor-transforming 2
78 229479 at — Transcribed sequences AI739132 Hs.152812.0 — — 8.30385 2.08989
79 203454_s_at ATOX1 ATX1 antioxidant protein 1 NM_004045 g4757803 NPJ0O4O36 Chr:5q32 8.13105 2.009521 homolog (yeast) /// ATX1 antioxidant protein 1 homolog (yeast)
80 204709_s_at KIF23 kinesin family member 23 /// NM_004856 gl 3699831 NP_004847 Chr:15q22.31 8.06008 2.814919 kinesin family member 23
81 222155_s_at FLJ 11856 putative G-protein coupled AK021918 Hs.6459.1 NP_078807 Chr:8q24.3 8.01605 9.625715 receptor GPCR41
82 225091_at C20orf99 chromosome 20 open reading AL034548 Hs.28608.0 NPJ 49080 Chr:20p13- 7.92124 0.518167 frame 99 p12.2
83 202478_at TRIB2 tribbles homolog 2 (Drosophila) NM_021643 gl 1056053 NP_067675 Chr:2p25.1 7.86235 3.612633
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
84 223381 at CDCA1 cell division cycle associated 1 AF326731 gl 2667400 NP 113611 Chr:1q23.2 7.18643 12.80219
85 221521_s_at Pfs2 DNA replication complex GINS BC003186 gl 3112024 NP_057179 Chr:16q24.1 6.96637 1.578435 protein PSF2 /// DNA replication complex GINS protein PSF2
86 200634 at PFN 1 profilin 1 /// profilin 1 NM 005022 g4826897 NP 005013 Chr:17p13.3 6.76391 13.40329
87 223452 s at Hs.27099.0 6.63353 2.489117
88 205909_at POLE2 Polymerase (DNA directed), NMJD02692 g4505934 NP_002683 Chr:14q21-q22 6.58509 1.578435 epsilon 2 (p59 subunit) /// Polymerase (DNA directed), epsilon 2 (p59 subunit)
89 235147_at — CDNA FLJ43167 fis, clone R56118 Hs.177788.0 — — 6.58167 3.306454 FCBBF3004041
90 232578 at Hs.16762.1 6.51591 4.174189
91 216228_s_at WDHD1 WD repeat and HMG-box DNA AK001538 Hs.72160.1 NP_009017 Chr:14q22.2 6.46661 8.779357 binding protein 1
92 206023 at NMU neuromedin U /// neuromedin U NM 006681 g5729946 NP 006672 Chr:4q12 5.87566 0.625663
93 231280 at — Transcribed sequences AW139091 Hs.161158.0 — — 5.81714 2.08989
94 229070_at C6orf105 chromosome 6 open reading AA470369 Hs.72115.0 NPJ 16133 Chr:6p24.1 5.8163 1.223189 frame 105
95 238808_at HOXA13 homeo box A13 R33750 Hs.68826.0 NP 000513 Chr:7p15-p14 5.77611 2.489117
96 236044_at PPAPDC1 phosphatidic acid Phosphatase BF130943 Hs.40479.0 — Chr:10q26.13 5.73324 2.814919 type 2 domain containing 1
97 235178 x at AL120674 Hs.265592.0 5.61632 2.489117
98 219364_at LGP2 likely ortholog of mouse NM_024119 g13129141 NP_077024 Chr:17q21.31 5.56982 2.489117 D11lgp2
99 200755 s at CALU calumenin BF939365 Hs.7753.0 NP 001210 Chr:7q32 5.52713 4.436744
100 206452_x_at PPP2R4 protein Phosphatase 2A, NM_021131 gl 0880986 NP_066954 Chr:9q34 5.36719 3.62324 regulatory subunit B' (PR 53)
101 228033 at E2F7 E2F transcription factor 7 AI341146 Hs.144687.0 NP 976328 Chr:12q21.1 5.34918 1.702877
102 212398 at Hs.263671.0 5.24146 4.830969
103 204822_at TTK TTK protein kinase /// TTK NM_003318 g4507718 NP_003309 Chr:6q13-q21 5.18259 3.612633 protein kinase
104 239108 at H16791 Hs.31445.0 4.92619 1.901012
105 219555_s_at BM039 uncharacterized bone marrow NM_018455 g8922096 NP_060925 Chr:16q23.2 4.92008 1.223189 protein BM039
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
106 210052 s at TPX2 TPX2, microtubule-associated AF098158 g6073830 NP_036244 Chr:20q11.2 4.89931 3.612633 protein homolog (Xenopus laevis) /// TPX2, microtubule- associated protein homolog (Xenopus laevis)
107 202107 s at MCM2 MCM2 minichromosome NM_004526 g4758705 NP_004517 Chr:3q21 4.83182 1.578435 maintenance deficient 2, mitotin (S. cerevisiae) /// MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)
108 209172_s_at CENPF centromere protein F, U30872 gl 000093 NP_057427 Chr:1q32-q41 4.77099 4.436744 350/400ka (mitosin) /// centromere protein F1 350/400ka (mitosin)
109 221922_at GPSM2 G-protein signalling modulator 2 AW195581 Hs.93121.1 NP_037428 Chr.ip13.3 4.73028 13.40329 (AGS3-Iike, C. elegans)
110 203256_at CDH3 Cadherin 3, type 1 , P-cadherin NM_001793 g4502722 NP_001784 Chr:16q22.1 4.6955 0.625663 (placental) /// Cadherin 3, type 1 , P-cadherin (placental)
111 218960_at TMPRSS4 transmembrane protease, NM_016425 g7705976 NP_063947 Chr:11q23.3 4.64396 4.830969 serine 4 /// transmembrane protease, serine 4
112 222958 s at DEPDC1 DEP domain containing 1 AK000490 Hs.133260.0 NP 060249 Chr:1p31.2 4.63101 4.640066
113 204891_s_at LCK iymphocyte-specific protein NM_005356 g4885448 NP_005347 Chr:1p34.3 4.55951 14.22309 tyrosine kinase /// Iymphocyte- specific protein tyrosine kinase
114 205044_at GABRP gamma-aminobutyric acid NM_014211 g7657105 NP_055026 Chr:5q33-q34 4.54226 1.901012 (GABA) A receptor, pi /// gamma-aminobutyric acid (GABA) A receptor, pi
115 208932_at PPP4C protein Phosphatase 4 (formerly BC001416 gl 2655126 NP_002711 Chr:16p12- 4.53699 3.612633 X), catalytic subunit /// protein 16p11 Phosphatase 4 (formerly X), catalytic subunit
116 221122_at HRASLS2 HRAS-like suppressor 2 NM_017878 g8923525 NP_060348 Chr:11q13.1 4.45192 1.380569
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
117 212992_at C14orf78 chromosome 14 open reading AI935123 Hs.57548.0 — Chr:14q32.33 4.41878 4.149813 frame 78
118 232434__at — CDNA FLJ 14199 fis, clone AA160945 Hs.14479.0 — — 4.4086 1.223189 NT2RP3002713
119 243854_at — Transcribed sequences AI094222 Hs.166572.0 — — 4.35379 3.62324
120 206560_s_at MlA melanoma inhibitory activity /// NM_006533 g5729924 NP_006524 Chr:19q13.32- 4.34766 3.62324 melanoma inhibitory activity q13.33
121 214135 at Hs.16762.0 4.30049 1.702877
122 208002_s_at BACH brain acyl-CoA hydrolase /// NM_007274 g6857796 NP_009205 Chr:1p36.31- 4.26931 3.612633 brain acyl-CoA hydrolase p36.11
123 222848_at FKSG14 leucine zipper protein FKSG14 BC005400 gl 3529292 NPJD71428 Chr:5p15.2- 4.25637 0.779487 q12.3
124 201890_at RRM2 ribonucleotide reductase M2 BE966236 Hs.75319.0 NPJ)OI 025 Chr:2p25-p24 4.23756 1.578435 Polypeptide
125 218886_at PAK1 IP1 PAK1 interacting protein 1 NM 017906 g8923576 NP 060376 Chr:6p24.1 4.23644 3.612633
126 217777 s at HSPC121 butyrate-induced transcript 1 NM 016395 g7705458 NP 057479 Chr:15q22.2 4.21403 6.991358
127 204653_at TFAP2A transcription factor AP-2 alpha BF343007 Hs.18387.0 NP_003211 Chr:6p24 4.20146 4.640066 (activating enhancer binding protein 2 alpha)
128 218925_s_at C11orf1 chromosome 11 open reading NM_022761 gl 2232430 NP_073598 Chr:11q13-q22 4.04932 7.646445 frame 1
129 203764_at DLG7 discs, large homolog 7 NM_014750 g7661851 NP_055565 Chr:14q22.2 4.00966 2.571322 (Drosophila)
130 206482_at PTK6 PTK6 protein tyrosine kinase 6 NM_005975 g5174646 NP_005966 Chr:20q13.3 3.99446 2.08989 /// PTK6 protein tyrosine kinase 6
131 216397 s at BOP1 block of proliferation 1 AK024840 Hs.30736.1 NP 056016 Chr:8q24.3 3.95948 13.40329
132 23071 O_at — CDNA FLJ41489 fis, clone W05495 Hs.218710.0 — — 3.9591 0.518167 BRTHA2004582
133 218308_at TACC3 transforming, acidic coiled-coil NM_006342 g5454101 NP_006333 Chr:4p16.3 3.94462 1.702877 containing protein 3 /// transforming, acidic coiled-coil containing protein 3
134 234412_at Hs.274565.0 3.93128 1.702877
135 238022_at — LOC388279 (LOC388279), AA954994 Hs.237396.1 — Chr:16q12.2 3.91553 2.08989 mRNA
Nr. Affymetrϊx Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
136 219836_at ZBED2 zinc finger, BED domain NM_024508 gl 3375643 NP_078784 Chr:3q13.13 3.89015 13.40329 containing 2
137 204507_s_at PPP3R1 protein Phosphatase 3 (formerly NM_000945 g4506024 NP_000936 Chr:2p15 3.86121 3.612633 2B), regulatory subunit B, 19kDa, alpha isoform (calcineurin B, type I)
138 218585_s_at RAMP RA-regulated nuclear matrix- NM_016448 g7705575 NP_057532 Chr:1q32.1- 3.78703 2.571322 associated protein q32.2
139 205449_at HSU79266 protein predicted by cione NMJD13299 g9558738 NPJ337431 Chr:11q13.1 3.78561 8.779357 23627
140 201564 s at FSCN1 fascin homolog 1 , actin- NM 003088 g4507114 NP__003079 Chr:7p22 3.78146 2.08989 bundling protein (Strongylocentrotus purpuratus) /// fascin homolog 1 , actin- bundling protein (Strongylocentrotus purpuratus)
141 218795_at ACP6 lysophosphatidic acid NM_016361 g7705954 NP. _057445 Chr:1q21 3.76905 0.149911 Phosphatase /// W lysophosphatidic acid Phosphatase
142 209132 s at COMMD4 COMM domain containing 4 BE313890 Hs.18490.1 NP 060298 Chr:15q23 3.76573 0.353669
143 213906_at MYBL1 v-myb myeloblastosis viral AW592266 Hs.300592.0 Chr:8q22 3.75595 12.53374 oncogene homolog (avian)-like 1
144 224753 at CDCA5 cell division cycle associated 5 BE614410 Hs.23044.2 NP 542399 Chr:11q12.1 3.7321 1.223189
145 208209_s_at C4BPB complement component 4 NM_000716 g4502504 NP. _000707 Chr:1q32 3.72496 3.62324 binding protein, beta /// complement component 4 binding protein, beta
146 219148 at g8923876 3.67803 2.571322
147 225362_at LOC159090 similar to hypothetical protein AI341165 Hs.288550.0 NP. _660327 Chr:xq26.3 3.66805 13.5285 MGC17347
148 202589_at TYMS thymidylate synthetase /// NM_001071 g4507750 NP. _001062 Chr:18p11.32 3.6482 1.578435 thymidylate synthetase
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
149 209715_at CBX5 chromobox homolog 5 (HP1 L07515 gl 84310 NP_036249 Chr:12q13.13 3.64483 8.153992 alpha homolog, Drosophila) /// chromobox homolog 5 (HP1 alpha homolog, Drosophila)
150 211430_s_at IGHG1 Immunoglobulin heavy constant M87789 gl 85361 — Chr:14q32.33 3.64005 12.53374 gamma 1 (G 1m marker)
151 238017_at RDH-E2 retinal Short chain AI440266 Hs.170673.0 NP_620419 Chr:8q12.1 3.63987 9.266777 dehydrogenase reductase
152 209405_s_at FAM3A family with sequence similarity BC002934 gl 2804156 NP_068578 Chr:xq28 3.60742 4.149813 3, member A
153 226545_at Hs.94030.0 3.58626 4.174189
154 243106_at MICL myeloid inhibitory C-type lectin- AA916861 Hs.190519.0 NP_612210 Chr:12p13.31 3.57836 2.08989 like receptor
155 229555_at GALNT5 UDP-N-acetyl-alpha-D- AI633503 Hs.55968.0 NP_055383 Chr:2q24.2 3.57656 2.08989 galactosamine:polypeptide N- acetylgalactosaminyltransferase 5 (GalNAc-T5)
156 227342_s_at AA621983 Hs.116051.0 3.56448 1.901012
157 230795_at HIST2H4 histone 2, H4 AI828075 Hs.55468.0 NP 003539 Chr:1q21 3.55684 1.702877
158 206858_s_at HOXC6 homeo box C6 /// homeo box NM_004503 g4758553 NP_004494 Chr:12q13.3 3.55228 3.612633 C6
159 205372_at PLAG1 pleiomorphic adenoma gene 1 NM_002655 g4505854 NP_002646 Chr:8q12 3.55106 10.20301 /// pleiomorphic adenoma gene 1
160 222740_at ATAD2 ATPase family, AAA domain AI925583 Hs.46677.0 NP_054828 Chr:8q24.13 3.53755 13.5285 containing 2
161 205180_s_at ADAM8 a disintegrin and NM_001109 g4557252 NP_001100 Chr:10q26.3 3.50386 1.702877 metalloproteinase domain 8 /// a disintegrin and metalloproteinase domain 8
162 201933_at PCOLN3 procollagen (type III) N- NM_002768 g4506138 NP_002759 Chr:16q24.3 3.49136 7.646445 endopeptidase /// procollagen (type III) N-endopeptidase
163 212147_at EST1B Est1p-Iike protein B AB029012 Hs.4990.0 NP 056142 Chr:1q21.2 3.48783 3.62324
164 220060_s_at FLJ20641 hypothetical protein FLJ20641 NM_017915 g8923595 NP 060385 Chr:12q23.3 3.47902 1.578435
165 243409_at — Transcribed sequences AI005407 Hs.130645.0 — — 3.47284 13.64212
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
166 202784_s_at NNT nicotinamide nucieotide NM_012343 g6912535 NP_036475 Chr:5p13.1- 3.43463 1.578435 transhydrogenase 5cen
167 242881_x_at BG285837 Hs.317584.1 3.43265 4.640066
168 221690_s_at NALP2 NACHT, leucine rieh repeat and AF298547 gl 0198206 NP_060322 Chr:19q13.42 3.38239 11.06357 PYD containing 2
169 241726_at HLCS holocarboxylase synthetase AI682088 Hs.223368.0 NP_000402 Chr:21q22.1 3.36768 2.814919 (biotin-[proprionyl-Coenzyme A- carboxylase (ATP-hydrolysing)] ligase)
170 205167_s_at CDC25C cell division eyele 25C /// cell NMJ)01790 gl 2408659 NP_001781 Chr:5q31 3.36325 4.149813 division eyele 25C
171 231964_at Hs.137206.0 3.35534 9.266777
172 204026_s_at ZWlNT ZW10 interactor /// ZW10 NM_007057 g6857828 NP_008988 Chr:10q21-q22 3.34393 1.578435 interactor
173 206364_at KIF14 kinesin family member 14 NM 014875 g7661877 — Chr:1pter-q31.3 3.34244 6.991358
174 237690 at GPR115 G protein-coupled receptor 115 W67511 Hs.57887.0 NP_722580 Chr:6p12.3 3.33512 2.08989
175 222847_s_at EGLN3 egl niπe homolog 3 (C. elegans) AI378406 Hs.18878.0 NP_071356 Chr:14q13.1 3.3307 1.051298
176 203234_at UPP1 uridine Phosphorylase 1 /// NM_003364 g4507838 NP_003355 Chr:7p12.3 3.3101 3.61384 °" uridine Phosphorylase 1
177 223278_at GJB2 gap junction protein, beta 2, M86849 g4481752 NP_003995 Chr:13q11-q12 3.29647 0.625663 26kDa (connexin 26)
178 204875_s_at GMDS GDP-mannose 4,6-dehydratase NM_001500 g4504030 NP_001491 Chr:6p25 3.29477 7.646445 /// GDP-mannose 4,6- dehydratase
179 239579_at ABHD7 abhydrolase domain containing AI807532 Hs.201555.0 NP_775838 Chr:1p22.1 3.29122 4.640066 7
180 40472_at LOC254531 PISC domain containing AF007155 4884817_RC NP_705841 Chr:15q13.2 3.29069 3.306454 hypothetical protein
181 207556_s_at DGKZ diaeylglycerol kinase, zeta NM_003646 g4503316 NP_003637 Chr:11p11.2 3.28637 4.174189 104kDa
182 229927 at LOC93273 hypothetical protein LOC93273 BE222220 Hs.104830.0 — Chr:1q32.1 3.28619 1.380569
183 202311_s_at COL1A1 collagen, type I, alpha 1 AI743621 Hs.172928.0 NP_000079 Chr:17q21.3- 3.28338 14.22309 q22.1
184 202998_s_at LOXL2 lysyl oxidase-like 2 /// lysyl NM_002318 g4505010 NP_002309 Chr.8p21.3- 3.28288 2.571322 oxidase-like 2 P21.2
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
185 204962_s_at CENPA centromere protein A, 17kDa /// NM_001809 g4585861 NP_001800 Chr:2p24-p21 3.25273 2.571322 centromere protein A, 17kDa
186 202668_at EFNB2 ephrin-B2 BF001670 Hs.30942.0 NP_004084 Chr:13q33 3.24909 1.578435
187 232164_s_at Hs.200412.0 3.22572 12.80219
188 212921_at SMYD2 SET and MYND domain AF070592 Hs.66170.1 NP_064582 Chr:1q32.3 3.21488 13.40329 containing 2
189 219918_s_at ASPM asp (abnormal spindle)-like, NM_018123 g8922484 NP_060593 Chr:1q31 3.21184 11.70204 microcephaly associated (Drosophila)
190 218280_x_at HIST2H2AA histone 2, H2aa NM_003516 g4504250 NP_003507 Chr:1q21.3 3.21072 6.991358
191 214455_at HIST1H2BC histone 1 , H2bc /// histone 1 , NM_003526 Hs.239884.0 NP_003517 Chr:6p21.3 3.19049 13.40329 H2bc
192 204401 at KCNN4 potassium intermediate/small NM_002250 g4504858 NP_002241 Chr:19q13.2 3.16939 4.174189 conductance calcium-activated Channel, subfamily N, member 4 /// potassium intermediate/small conductance calcium-activated Channel, subfamily N, member 4
193 226789_at CDNA FLJ46881 fis, clone W84421 Hs.83992.0 Chr:1q21.1 3.16803 0.353669 UTERU3015647, moderately similar to Embigin precursor
194 218451_at CDCP1 CUB domain-containing protein NM_022842 gl 2383093 NP. _073753 Chr:3p21.32 3.16611 6.225758 1
195 228307 at Hs.25897.0 3.1578 1.051298
196 203145_at SPAG5 sperm associated antigen 5 /// NM_006461 g5453631 NP_ _006452 Chr:17q11.2 3.15023 5.685182 sperm associated antigen 5
197 232165 at Hs.200412.0 3.1376 2.814919
198 238632_at — Füll length insert cDNA clone AI631657 Hs.103159.0 — — 3.11543 4.174189 ZD51F08
199 227449_at EPHA4 EphA4 AI799018 Hs.314784.0 NP 004429 Chr:2q36.1 3.1037 2.489117
200 240943 at — Transcribed sequences AA678195 Hs.180037.0 — — 3.09992 3.62324
201 218755_at KIF20A kinesin family member 2OA /// NM_005733 g5032012 NP_ _005724 Chr:5q31 3.07849 4.640066 kinesin family member 2OA
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer JD Protein ID Lokalisierung Change (%)
202 219061 s at DXS9879E DNA segment on chromosome NM_006014 g5174432 NP_006005 Chr:xq28 3.07829 6.991358 X (unique) 9879 expressed sequence /// DNA segment on chromosome X (unique) 9879 expressed sequence
203 202705 at CCNB2 cyclin B2 /// cyclin B2 NM 004701 gl 0938017 NP 004692 Chr:15q21.3 3.07247 3.612633
204 229097. .at Similar to diaphanous homolog AI813331 Hs.283127.0 3.05738 1.702877 3 (Drosophila), clone IMAGE:5277415, mRNA
205 223307 at CDCA3 cell division cycle associated 3 BC002551 gl 2803452 NP 112589 Chr:12p13 3.04801 11.55252
206 231167. at CDW92 CDW92 antigen AW444881 Hs.77829.0 NP 071392 Chr:9q31.2 3.04541 1.223189
207 205072 s at XRCC4 X-ray repair complementing NM_022406 gl 2408646 NPJ303392 Chr:5q13-q14 3.03445 2.814919 defective repair in Chinese hamster cells 4 /// X-ray repair complementing defective repair in Chinese hamster cells 4
208 222036 s at MCM4 MCM4 minichromosome AI859865 Hs.154443.1 NPJM35905 Chr:8q11.2 3.02816 3.62324 maintenance deficient 4 (S. cerevisiae)
209 200085 s at TCEB2 transcription elongation factor B NM_007108 Hs.172772.2 NP_009039 Chr:16p12.3 3.01714 2.009521 (SlII), Polypeptide 2 (18kDa, elongin B) /// transcription elongation factor B (SIII), Polypeptide 2 (18kDa, elongin B) /// transcription elongation factor B (SIII), Polypeptide 2 (18kDa, elongin B)
210 204825. _at MELK maternal embryonic leucine NM_014791 g7661973 NP. .055606 Chr:9p13.1 3.00383 4.436744 zipper kinase
211 235609. _at BRIP1 BRCA1 interacting protein C- BF056791 Hs.87507.0 NP. .114432 Chr:17q22-q24 2.99293 1.702877 terminal helicase 1
212 203755 at BUB1B BUB1 budding uninhibited by NM 001211 g5729749 NP_001202 Chr:15q15 2.97627 4.830969 benzimidazoles 1 homolog beta (yeast) /// BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
213 223556 at HELLS helicase, lymphoid-specific AF155827 g8980659 NP 060533 Chr:10q24.2 2.96642 3.306454
214 219493_at SHCBP1 likely ortholog of mouse Shc NM_024745 gl 3376069 NP_079021 Chr:1βq11.2 2.94762 9.625715 SH2-domain binding protein 1
215 202503 s at KIAA0101 KIAA0101 gene product NM 014736 g7661905 NP 055551 Chr:15q22.1 2.94751 1.578435
216 205730_s_at ABLIM3 actin binding LIM protein family, NM_014945 g7662329 NP_055760 Chr:5q33.1 2.94559 2.814919 member 3
217 235670 at — Transcribed sequences AI916948 Hs.28788.0 — — 2.91213 0.779487
218 218009_s_at PRC1 protein regulator of cytokinesis NM_003981 g4506038 NP_003972 Chr:15q26.1 2.89253 5.685182 1 /// protein regulator of cytokinesis 1
219 218883_s_at KLIP1 KSHV latent nuclear antigen NM_024629 gl 3375855 NP_078905 Chr:4q35.1 2.8918 6.991358 interacting protein 1
220 208613_s_at FLNB filamin B, beta (actin binding AV712733 Hs.81008.0 NP_001448 Chr:3p14.3 2.88915 14.22309 protein 278)
221 232200_at HSPA9B heat shock 7OkDa protein 9B AK023317 Hs.254467.0 NP_004125 Chr:5q31.1 2.88381 2.814919 (mortalin-2)
222 204675 at SRD5A1 steroid-5-alpha-reductase, NM_001047 g4507200 NP_001038 Chr:5p15 2.87979 6.991358 alpha Polypeptide 1 (3-oxo-5 ∞ alpha-steroid delta A- dehydrogenase alpha 1 ) /// steroid-5-alpha-reductase, alpha Polypeptide 1 (3-oxo-5 alpha-steroid delta 4- dehydrogenase alpha 1 )
223 223514, _at CARD11 caspase recruitment domain AF322641 gl 2382772 NP. _115791 Chr:7p22 2.87743 0.625663 family, member 11
224 213523 at CCNE1 cyclin E1 AI671049 Hs.9700.0 NP 001229 Chr:19q12 2.87434 6.225758
225 201014_ _s_at PAICS phosphoribosylaminoimidazole NM_006452 g5453538 NP. _006443 Chr:4pter-q21 2.86854 3.612633 carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase
226 226777_ _at ADAM12 a disintegrin and AA147933 Hs.8895.0 NP. _003465 Chr:10q26.3 2.84381 4.174189 metalloproteinase domain 12 (meltrin alpha)
227 211926. _s_at MYH9 myosin, heavy Polypeptide 9, AI827941 Hs.146550.0 NP. 002464 Chr:22q13.1 2.80242 11.70204 non-muscle
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
228 210115_at RPL39L ribosomal protein L39-Iike L05096 g388035 NP 443201 Chr:3q27 2.80058 2.489117
229 203358_s_at EZH2 enhancer of zeste homolog 2 NM_004456 g4758323 NP_004447 Chr:7q35-q36 2.80041 2.08989 (Drosophila) /// enhancer of zeste homolog 2 (Drosophila)
230 229538_s_at IQGAP3 IQ motif containing GTPase AW271106 Hs.133294.1 NP_839943 Chr:1q23.1 2.77931 0.149911 activating protein 3
231 217004_s_at MCF2 MCF.2 cell line derived X13230 Hs.89543.3 NP_005360 Chr:xq27 2.77539 1.578435 transforming sequence /// MCF.2 cell line derived transforming sequence
232 214875_x_at APLP2 amyloid beta (A4) precursor-like AW001847 Hs.279518.4 NP_001633 Chr:11q24 2.77101 8.779357 protein 2
233 209714 s at CDKW3 cyclin-dependent kinase AF213033 g12734643 NP_005183 Chr:14q22 2.74067 7.646445 inhibitor 3 (CDK2-associated dual specificity Phosphatase) /// cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity Phosphatase)
234 205174 s at QPCT glutaminyl-peptide NM_012413 g9257235 NP_036545 Chr:2p22.3 2.74008 4.436744 cyclotransferase (glutaminyl cyclase) /// glutaminyl-peptide cyclotransferase (glutaminyl cyclase)
235 221539 at EIF4EBP1 eukaryotic translation Initiation AB044548 gl 1527778 NPJ304086 Chr.8p12 2.73954 12.53374 factor 4E binding protein 1 /// eukaryotic translation initiation factor 4E binding protein 1
236 211048 s at ERP70 protein disulfide isomerase BC006344 gl 3623480 NP_004902 Chr:7q35 2.73784 0.625663 related protein (calcium-binding protein, intestinal-related) /// protein disulfide isomerase related protein (calcium-binding protein, intestinal-related)
237 209627_ s at OSBPL3 oxysterol binding protein-like 3 AY008372 gl 0880972 NP 056365 Chr:7p15 2 .73648 5.685182
238 225655. .at UHRF1 ubiquitin-like, containing PHD AK025578 Hs.108106.0 NP_ _037414 Chr:19p13 .3 2 .73224 2.08989 and RING finger domains, 1
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
239 203007_x_at LYPLA1 lysophospholipase I AF077198 g4679009 NP 006321 Chr:8q 11.23 2.73114 6.991358
240 230173_at Hs.65736.2 2.73028 4.174189
241 206102_at K1AA0186 KIAA0186 gene product NM_021067 gl 0800147 — Chr:20p11.21 2.72808 11.06357
242 212624 s at CHN1 chimerin (chimaerin) 1 BF339445 Hs.169965.1 NP 001813 Chr:2q31-q32.1 2.7246 14.22309
243 205455 at MST1R macrophage stimulating 1 NMJD02447 g4505264 NP_002438 Chr:3p21.3 2.72337 1.702877 receptor (c-met-related tyrosine kinase) /// macrophage stimulating 1 receptor (c-met- related tyrosine kinase)
244 225436_at LOC58489 hypothetical protein from AI339710 Hs.26765.0 — Chr:15q24.3 2.71839 2.08989 EUROIMAGE 588495
245 205214_at STK17B serine/threonine kinase 17b NM_004226 g4758193 NP_004217 Chr:2q33.1 2.70435 8.153992 (apoptosis-inducing) /// serine/threonine kinase 17b (apoptosis-inducing)
246 219990_at FLJ23311 FLJ23311 protein NM_024680 gl 3375949 NP 078956 Chr:11p15.1 2.70342 4.149813
247 209398 at HIST1H1C histone 1, H1c /// histone 1 , H1c BC002649 gl 2803628 NP 005310 Chr:6p21.3 2.70038 3.306454 g
248 200747_s_at NUMA1 nuclear mitotic apparatus NM_006185 g5453819 NP_006176 Chr:11q13 2.69411 1.223189 protein 1 /// nuclear mitotic apparatus protein 1
249 219014_at PLAC8 placenta-specific 8 NM_016619 g7706157 NP 057703 Chr:4q21.3 2.68216 3.612633
250 229645_at Similar to hypothetical protein H14197 Hs.227699.0 Chr:18q22.3 2.66618 0.149911 B230399E16 (LOC125704), mRNA
251 214590_s_at UBE2D1 ubiquitin-conjugating enzyme AL545760 Hs.318435.0 NP_003329 Chr:10q11.2- 2.66479 6.991358 E2D 1 (UBC4/5 homolog, q21 yeast)
252 65438_at KIAA1609 KIAA1609 protein AA195124 4863696 RC NP_065998 Chr:16q24.1 2.66437 7.646445
253 229500_at SLC30A9 solute carrierfamily 30 (zinc AI609256 Hs.270956.1 NP_006336 Chr:4p13-p12 2.65646 12.80219 transporter), member 9
254 218468_s_at GREM1 gremiin 1 homolog, cysteine AF154054 gl 0863087 NP_037504 Chr:15q13-q15 2.63581 9.625715 knot superfamily (Xenopus laevis)
255 227350_at — CDNA FLJ11381 fis, clone AI889959 Hs.127797.0 — — 2.63429 12.80219 HEMBA1000501
Nr. Affymetrix Gensymbol Genπame Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
256 204641_at NEK2 NIMA (never in mitosis gene a)- NM_002497 g4505372 NP_002488 Chr:1q32.2-q41 2.6329 13.40329 related kinase 2 /// NIMA (never in mitosis gene a)-related kinase 2
257 221666_s_at ASC apoptosis-associated speck-like BC004470 gl 3325315 NP_037390 Chr:16p12- 2.62721 6.225758 protein containing a CARD /// p11.2 apoptosis-associated speck-like protein containing a CARD
258 202708_s_at HIST2H2BE histone 2, H2be /// histone 2, NM_003528 g4504276 NP_003519 Chr:1q21-q23 2.6179 11.06357 H2be
259 209546_s_at APOL1 apolipoprotein L, 1 /// AF323540 g12408012 NP_003652 Chr:22q13.1 2.61762 4.174189 apolipoprotein L, 1
260 218644 at PLEK2 pleckstrin 2 /// pleckstrin 2 NM 016445 g7706642 NP 057529 Chr:14q24.1 2.61324 3.612633
261 214096_s_at SHMT2 serine AW190316 Hs.2186.4 NP_005403 Chr:12q12-q14 2.61188 8.779357 hydroxymethyltransferase 2 (mitochondrial)
262 221701_s_at FLJ 12541 stimulated by retinoic acid gene AF352728 gl 3560965 NP_071764 Chr:15q22.33 2.60779 2.571322 6 /// stimuiated by retinoic acid gene 6
263 218706_s_at NS3TP2 HCV NS3-transactivated protein AW575493 Hs.235445.0 NP_076416 Chr:5q23.3 2.59546 10.20301 2
264 214463_x_at HIST1H4A histone 1 , H4a /// histone 1 , NM_003541 Hs.91031.0 NP_003529 Chr:6p21.3 2.59156 1.223189 H4a
265 204033_at TRIP13 thyroid hormone receptor NM_004237 gl 1321606 NP_004228 Chr.5p15.33 2.59023 9.625715 interactor 13 /// thyroid hormone receptor interactor 13
266 200736_s_at GPX1 glutathione peroxidase 1 /// NM_000581 gl 0834975 NP_000572 Chr:3p21.3 2.58836 4.149813 glutathione peroxidase 1
267 225605 at LOC90313 hypothetical protein BC004507 AL540867 Hs.97871.0 NP 612358 Chr:17q11.2 2.58466 3.306454
268 204347 at AK3 adenylate kinase 3 AI653169 Hs.274691.0 NP 037542 Chr:1p31.3 2.58387 0.779487
269 214068_at BEAN brain expressed, associated AF070610 Hs.100543.0 — Chr:16q22.1 2.57926 11.06357 with Nedd4
270 208583_x_at HIST1H2AJ histone 1 , H2aj /// histone 1 , NM_021066 gl 0800143 NP_066544 Chr:6p22-p21.3 2.57869 3.62324 H2aj
271 206307_s_at FOXD1 forkhead box D1 NMJ004472 g4758391 NP_004463 Chr:5q12-q13 2.56922 4.640066
272 236535 at AW069285 Hs.159452.0 2.56884 4.640066
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
273 223631 _s_at C19orf33 chromosome 19 open reading AF213678 gl 2003430 NP_277055 Chr:19q13.13 2.56782 3.62324 frame 33
274 209581_at HRASLS3 HRAS-like suppressor 3 /// BC001387 gl 2655072 NP_009000 Chr:11q13.1 2.56741 8.779357 HRAS-like suppressor 3
275 236669_at — CDNA FLJ31431 fis, clone AI038054 Hs.132890.0 — — 2.56492 2.08989 NT2NE2000548
276 209478_at STRA13 stimulated by retinoic acid 13 U95006 g2071992 NP 659435 Chr:17q25.3 2.54406 6.991358
277 201136_at PLP2 proteoüpid protein 2 (colonic NMJ302668 g4505892 NP_002659 Chr:xp11.23 2.5406 2.571322 epithelium-enriched) /// proteolipid protein 2 (colonic epithelium-enriched)
278 214522_x__at HIST1H3D histone 1 , H3d /// histone 1 , NM_021065 Hs.239458.0 NP_003521 Chr:6p21.3 2.53255 3.62324 H3d
279 227998_at S100A16 S 100 calcium binding protein AA045184 Hs.738.3 NP_525127 — 2.52659 9.840216 A16
280 215629_s__at DLEU2 deleted in lymphocytic AA905286 Hs.306636.0 NP_006012 Chr:13q14.3 2.51998 6.225758 leukemia, 2
281 204444_at KIF11 kinesin family member 11 /// NMJD04523 gl 3699823 NP_004514 Chr:10q24.1 2.51811 4.436744 kinesin family member 11
282 204240_s_at SMC2L1 SMC2 structural maintenance NM_006444 g5453590 NP_006435 Chr:9q31.2 2.49867 8.153992 of chromosomes 2-like 1 (yeast)
283 206247_at MICB MHC class I polypeptide-related NM_005931 g5174564 NP_005922 Chr:6p21.3 2.49468 3.612633 sequence B /// MHC class I polypeptide-related sequence B
284 209806_at HIST1H2BE histone 1 , H2be /// histone 1 , BC000893 gl 2654150 NP_003514 Chr:6p21.3 2.48301 0.779487 H2be
285 219559_at C20orf59 chromosome 20 open reading NM_022082 gl 1545794 NP_071365 Chr:20q13.33 2.47821 3.306454 frame 59
286 205339_at SIL TAL1 (SCL) interrupting locus NM_003035 g4506958 NP_003026 Chr:1p32 2.47667 1.223189 /// TAL1 (SCL) interrupting locus
287 209507_at RPA3 replication protein A3, 14kDa /// BC005264 gl 3528944 NP_002938 Chr:7p22 2.4764 1.578435 replication protein A3, 14kDa
288 225799_at MGC4677 hypothetical protein MGC4677 BF209337 Hs.50724.0 NP 443103 Chr:2p11.2 2.47527 13.64212
289 241872_at — Transcribed sequences AI149963 Hs.132121.0 — — 2.46984 3.306454
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-valυe Probennummer ID Protein ID Lokalisierung Change {%)
290 207202_s_at NR1I2 nuclear receptor subfamiiy 1, NM_003889 gl 1863133 NP_003880 Chr:3q12-q13.3 2.46766 12.53374 group I, member 2 /// nuclear receptor subfamiiy 1, group I1 member 2
291 224428_s_at CDCA7 cell division cycle associated 7 AY029179 gl 3641303 NPJ 14148 Chr:2q31 2.46745 11.55252 /// cell division cycle associated 7
292 229860 x at — Clone IMAGE-.5200861, mRNA AI341602 Hs.152932.0 — Chr:4p16.3 2.46209 12.80219
293 239049 at — — BF514509 Hs.262571.0 — — 2.46107 0.518167
294 209891 at Spc25 kinetochore protein Spc25 AF225416 g9963834 NP 065726 Chr:2q31.1 2.44983 3.612633
295 222750 s at FU13352 hypothetica! protein FLJ13352 BC002480 gl 2803324 NP 078868 Chr:4q12 2.44845 12.80219
296 2Q4702_s_at NFE2L3 nuclear factor (erythroid-derived NM_004289 g5731346 NP__004280 Chr:7p15-p14 2.44496 3.612633 2)-like 3 /// nuclear factor (erythroid-derived 2)-like 3
297 208688_x_at EIF3S9 eukaryotic translation initiation U78525 g2558667 NP_003742 Chr:7p22.3 2.44332 4.149813 factor 3, subunit 9 eta, 116kDa
298 202483_s_at RANBP1 RAN binding protein 1 /// RAN NM_002882 g6382077 NPJ302873 Chr:22q11.21 2.44314 1.223189 binding protein 1 UJ
299 204769 s at TAP2 transporter 2, ATP-binding M74447 gl 88505 NP_000535 Chr:6p21.3 2.44046 10.20301 cassette, sub-family B (MDR/TAP) /// transporter 2, ATP-binding cassette, sub- family B (MDR/TAP)
300 226452. _at PDK1 pyruvate dehydrogenase AU146532 Hs.61712.1 NP. 002601 Chr.2q31.1 2.43867 1.702877 kinase, isoenzyme 1
301 221730. _at COL5A2 Collagen, type V, alpha 2 NM_000393 Hs.82985.0 NP. _000384 Chr:2q14-q32 2.43679 8.153992
302 200619. _at SF3B2 splicing factor 3b, subunit 2, NM_006842 g5803154 Chr:11q13.1 2.43447 3.612633 145kDa /// splicing factor 3b, subunit 2, 145kDa
303 203744. _at HMGB3 high-mobility group box 3 /// NM_005342 g4885420 NP. .005333 Chr:xq28 2.43432 12.53374 high-mobiüty group box 3
304 204971. _at CSTA cystatin A (stefin A) /// cystatin NMJD05213 g4885164 NP. .005204 Chr:3q21 2.43141 4.640066 A (stefin A)
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
305 205590_at RASGRP1 RAS guanyl releasing protein 1 NM_005739 g6382080 NPJ305730 Chr:15q15 2.42477 14.22309 (calcium and DAG-regulated) /// RAS guanyl releasing protein 1 (calcium and DAG-regulated)
306 218840 s at NADSYN 1 NAD synthetase 1 NM 018161 g8922560 NP 060631 Chr:11q13.2 2.42354 11.70204
307 221648 s at PNAS-4 CGI-146 protein AK025651 Hs.42409.1 NP 057160 Chr:1q44 2.42293 3.62324
308 216237_s_at MCM5 MCM5 minichromosome AA807529 Hs.77171.1 NP_006730 Chr:22q13.1 2.42147 2.571322 maintenance deficient 5, cell division cycle 46 (S. cerevisiae)
309 203892_at g5174454 2.41334 4.436744
310 214542_x_at HIST1H3H histone 1 , H3h /// histone 1 , NM_003509 Hs.137592.0 NPJ303527 Chr:6p22-p21.3 2.4095 2.814919 H3h
311 218951 s at FLJ11323 hypothetical protein FLJ11323 NM 018390 g8922994 Chr:xp22.33 2.40548 13.40329
312 202307_s_at TAP1 transporter 1 , ATP-binding NM_000593 g9665247 NP_000584 Chr:6p21.3 2.40488 1.578435 cassette, sub-family B (MDR/TAP)
313 202934 at HK2 hexokinase 2 AI761561 Hs.198427.0 NP 000180 Chr:2p13 2.40302 0.353669
314 238021_s_at — LOC388279 (LOC388279), AA954994 Hs.237396.1 — Chr:16q12.2 2.40174 0.779487 mRNA
315 214061 at MGC21654 unknown MGC21654 product AI017564 Hs .95631.0 ^NP_663622 Chr:8q24.13 2.39907 8.153992
316 219773_at NOX4 NADPH oxidase 4 /// NADPH NM_016931 g8393842 NPJD58627 Chr:11q14.2- 2.39385 11.70204 oxidase 4 q21
317 207222_at PLA2G10 phospholipase A2, group X /// NM_003561 g4505844 NP_003552~ Chr:16p13.1~ 2.39346 8.779357 phospholipase A2, group X p12
318 218039_at NUSAP1 nucleolar and spindle NM_016359 g7705950 NP_057443 Chr:15q14 2.3908 8.153992 associated protein 1 /// nucleolar and spindle associated protein 1
319 230398_at CTEN C-terminal tensin-like AA158731 Hs.165544.0 NP 116254 Chr:17q21.2 2.3895 0.625663
320 37424_at C6orf18 chromosome 6 open reading AB029343 4850640 NPJ361925 Chr:6p21.3 2.38743 3.61384 frame 18
321 223779_at MGC10981 hypothetical protein MGC10981 BC004397 gl 3325159 — Chr:4p16.1 2.38604 1.380569
322 239384_at SFRS1 splicing factor, arginine/serine- R18746 Hs.36747.0 NP_008855 Chr:17q21.3- 2.38021 0.353669 rich 1 (splicing factor 2, q22 alternate splicing factor)
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
323 210830_s_at PON2 paraoxonase 2 AF001602 g2228776 NP 000296 Chr:7q21.3 2.37738 4.830969
324 235113_at PPIL5 peptidylprolyl isomerase AA742244 Hs.179805.0 NP_689542 Chr:14q21.3 2.37718 1.380569 (cyclophilin) like 5
325 214806_at BICD1 Bicaudal D homolog 1 U90030 Hs.164975.2 NP_001705 Chr:12p11.2- 2.37514 4.436744 (Drosophila) /// Bicaudal D p11.1 homolog 1 (Drosophila)
326 226630_at C14orf106 chromosome 14 open reading BF062175 Hs.89278.1 NP_060823 Chr:14q21.3 2.37019 4.640066 frame 106
327 223484_at NMES1 normal mucosa of esophagus AF228422 gl 2656020 NP_115789 Chr:15q15.1 2.36662 2.814919 specific 1
328 228143 at CP ceruloplasmin (ferroxidase) AI684991 Hs.282804.0 NP 000087 Chr:3q23-q25 2.36183 2.08989
329 201671_x_at USP14 ubiquitin specific protease 14 BC003556 gl 3097695 NP_005142 Chr:18p11.32 2.35987 8.779357 (tRNA-guanine transglycosylase)
330 201201_at CSTB cystatin B (stefin B) /// cystatin NM_000100 g4503116 NP_000091 Chr:21q22.3 2.35349 12.53374 B (stefin B)
331 230252 at GPR92 G protein-coupled receptor 92 AW183080 Hs.155538.0 NP 065133 Chr:12p13.31 2.35144 4.640066
332 217728_at S100A6 S100 calcium binding protein NM_014624 g9845517 NP_055439 Chr:1q21 2.34487 1.901012 w A6 (calcyclin) /// S100 calcium binding protein A6 (calcyclin)
333 219901_at FGD6 FYVE, RhoGEF and PH domain NM_018351 g8922920 — Chr:12q23.1 2.33964 3.306454 containing 6
334 202737_s_at LSM4 LSM4 homolog, U6 small NM_012321 g6912485 NP_036453 Chr:19p13.11 2.33857 3.612633 nuclear RNA associated (S. cerevisiae)
335 222646_s_at ERO1L ERO1-Iike (S. cerevisiae) AW268365 Hs.25740.0 NP 055399 Chr:14q22.1 2.33385 1.380569
336 203064_s_at FOXK2 forkhead box K2 /// forkhead NM_004514 g4758599 NP_004505 Chr:17q25 2.33331 3.61384 box K2
337 213288_at LOC129642 hypothetical protein BC016005 AI761250 Hs.90797.0 NP 620154 Chr:2p25.2 2.33183 11.70204
338 47105_at FLJ20399 hypothetical protein FLJ20399 AA886893 4859973 RC NP 060273 Chr:16q22.1 2.33175 0.095261
339 210201_x_at BIN1 bridging integrator 1 AF001383 g2199534 NP 004296 Chr:2q14 2.33163 9.625715
340 230940_at TCEB3BP1 transcription elongation factor B AI653385 Hs.98190.0 NP_065746 Chr:19p13.3 2.3307 2.814919 Polypeptide 3 binding protein 1
Nr, Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-valυe
Probennummer ID Protein !D Lokalisierung Change (%)
341 207543 s at P4HA1 procollagen-proiine, 2- NM 000917 g4505564 NP 000908 Chr:10q21.3- 2.3304 4.830969 oxoglutarate 4-dioxygenase q23.1 (proline 4-hydroxylase), alpha Polypeptide I /// procoüagen- proline, 2-oxoglutarate 4- dioxygenase (proline 4- hydroxylase), alpha Polypeptide
I
342 238807, _at LOC157567 hypothetical protein AW973964 Hs.291531.0 NP. _940683 Chr:8q22.3 2.31789 1.901012 LOC157567
343 209604. _s_at GATA3 GATA binding protein 3 /// BC003070 gl 3111765 NP. J3Q2042 Chr.10p15 2.31774 13.40329 GATA binding protein 3
344 201762 s at PSME2 proteasome (prosome, NMJ3Q2818 g4506236 NPJ302809 Chr:14q11.2 2.31359 0.095261 ' macropain) activator sυbυnit 2 (PA28 beta) /// proteasome (prosome, macropain} activator subunit 2 (PA28 beta) κ>
345 218986 s at NM 017631 g8923037 2.31258 1.702877
346 210933_s_at MGC4655 hypothetical protein MGC4655 BC004908 g13436196 NPJ 71608 Chr:16q22.1 2.30895 2.814919
347 208758 at ATIC 5-aminoimidazole-4- D89976 g2317691 NP_004035 Chr:2q35 2.30776 1.578435 carboxarnide riboπucleotide formyltransferase/IMP cyclohydrolase /// 5- aminoimidazoie-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
348 205266 at LlF leukemia inhibitory factor NM_002309 g6006018 NP002300 Chr:22q12.2 2.30602 14.22309 (cholinergic differentiation factor) /// leukemia inhibitory factor (cholinergic differentiation factor)
349 204162 at KNTC2 kinetochore associated 2 /// NM 006101 g5174456 NP_006092 Chr:18p11.31 2.30491 7.646445 kinetochore associated 2
Nr. Affymetrix Gensymbol Geπname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change '0/-
350 200640 at YWHAZ tyrosine 3- NM 003406 g4507952 NP_003397 Chr:8q23.1 2.30049 3.612633 monooxygenase/tryptophan 5 monooxygenase activation protein, zeta Polypeptide /// tyrosine 3- monooxygenase/tryptophan 5 monooxygenase activation protein, zeta Polypeptide
351 218961_s_at PNKP polynucleotide kinase 3'- NM_007254 g6005835 NP_009185 Chr:19q13.3- 2.2928 12.53374 phosphatase /// polynucleotide q13.4 kinase 3'-phosphatase
352 210766_s_at CSE1L CSE1 chromosome segregation AF053640 g3560554 NP_001307 Chr:20q13 2.29189 3.612633 I-Iike (yeast)
353 240531 _at — — AW268727 Hs.112805.0 — — 2.29057 2.814919
354 229432_at NAGS N-acetylglutamate synthase AV696264 Hs.8876.0 NP 694551 Chr:17q21.31 2.28831 2.08989
355 221653_x_at APOL2 apolipoprotein L, 2 BC004395 gl 3325155 NP 112092 Chr:22q12 2.28719 4.640066
356 224327_s_at DGAT2 diacylglycerol O-acyltransferase AB048286 gl 3537296 NPJ 15953 Chr:11q13.3 2.28711 1.051298 homolog 2 (mouse) /// diacylglycerol O-acyltransferase homolog 2 (mouse)
357 202619_s_at PLOD2 procollagen-lysine, 2- AI754404 Hs.41270.0 NP_000926 Chr:3q23-q24 2.28553 3.61384 oxoglutarate 5-dioxygenase (lysine hydroxylase) 2
358 203789_s_at SEMA3C sema domain, Immunoglobulin NM_006379 g5454047 NP_006370 Chr:7q21-q31 2.28491 3.612633 domain (Ig), short basic domain, secreted, (semaphorin) 3C
359 213007_at FLJ10719 hypothetical protein FLJ 10719 W74442 Hs.80961.1 NP_060663 Chr:15q25-q26 2.28448 1.578435
360 219546_at BMP2K BMP2 inducible kinase NM_017593 g9055205 NP 060063 Chr:4q21.23 2.27648 9.625715
361 225777_at C9orf140 chromosome 9 open reading AW250904 Hs.19322.0 NP_848543 Chr:9q34.3 2.27646 1.901012 frame 140
362 244749_at — CDNA FLJ42484 fis, clone AA806349 Hs.44698.0 — -— 2.27526 11.55252 BRACE2032182
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
363 201577_at NME1 noπ-metastatic cells 1 , protein NM_000269 g4557796 NPJ300260 Chr:17q21.3 2.26917 1.578435 (NM23A) expressed in /// non- metastatic cells 1 , protein (NM23A) expressed in
364 225944_at NLN neurolysin (metallopeptidase AW006938 Hs.22151.1 NP_065777 Chr:5q12.3 2.26733 11.55252 M3 family)
365 230165 at N31731 Hs.44269.0 2.26719 3.62324
366 204023_at RFC4 replicatioπ factor C (activator 1 ) NM_002916 g4506490 NPJ302907 Chr:3q27 2.26351 1.380569 4, 37kDa /// replication factor C (activator 1) 4, 37kDa
367 209173_at AGR2 anterior gradient 2 homolog AF088867 g6652811 NPJ306399 Chr:7p21.3 2.26177 11.06357 (Xenopus laevis) /// anterior gradient 2 homolog (Xenopus laevis)
368 221903_s_at CYLD cyündromatosis (turban tumor BE046443 Hs.18827.0 NP_056062 Chr:16q12.1 2.26132 6.991358 Syndrome)
369 213355_at SIAT10 sialyltransferase 10 (alpha-2,3- AI989567 Hs.34578.2 NP_006091 Chr:3q12.2 2.26038 14.22309 sialyltransferase VI)
370 201587_s_at 1RAK1 interleukin-1 receptor- NM_001569 g4755143 NP_001560 Chr:xq28 2.2541 4.830969 » associated kinase 1 /// interleukin-1 receptor- associated kinase 1
371 201417_at SOX4 SRY (sex determining region AL136179 Hs.83484.0 NP_003098 Chr:6p22.3 2.25311 3.612633 Y)-box 4
372 238843 at NPHP1 nephroπophthisis 1 (juvenile) BF216535 Hs.211782.0 NP 000263 Chr:2q13 2.25157 1.380569
373 207966 s at GLG1 golgi apparatus protein 1 NM 012201 g6912389 NP 036333 Chr:16q22-q23 2.24967 9.625715
374 215071 s at HIST1 H2AC histone 1 , H2ac AL353759 Hs.28777.3 NP 003503 Chr:6p21.3 2.24876 6.225758
375 222843_at FIGNL1 fidgetin-like 1 AK023411 Hs.137516.0 NP_071399 Chr:7p12.2 2.24831 3.306454
376 221582_at HIST3H2A histone 3, H2a BC001193 gl 2654706 NP 254280 Chr.iq42.13 2.24661 1.702877
377 217983_s_at RNASET2 ribonuclease T2 /// ribonuclease NM_003730 g5231227 NP_003721 Chr:6q27 2.24551 6.991358 T2
378 212200_at KIAA0692 KIAA0692 protein AK025933 Hs.100729.0 — Chr:12q24.33 2.24452 10.20301
379 218115_at ASF1B ASF1 aπti-silencing function 1 NM_018154 g8922548 NP_060624 Chr:19p13.13 2.24271 1.578435 homolog B (S. cerevisiae)
380 228955_at — Clone IMAGE-.4753714, mRNA AL041761 Hs.27379.0 — — 2.23903 3.62324
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
381 213226_at PMSCL1 polymyositis/scleroderma AI346350 Hs.91728.1 NP_005024 Chr:4q27 2.23729 4.640066 autoantigeπ 1 , 75kDa
382 203409_at DDB2 damage-specific DNA binding NM_000107 g4557514 NP_000098 Chr:11 p12-p11 2.23442 4.640066 protein 2, 48kDa /// damage- specific DNA binding protein 2, 48kDa
383 221558_s_at LEF1 lymphoid enhancer-binding AF288571 g9858157 NP_057353 Chr:4q23-q25 2.22916 1.578435 factor 1 /// lymphoid enhancer- binding factor 1
384 218543_s_at ZC3HDC1 zinc finger CCCH type domain NM_022750 gl 2232412 NP_073587 Chr:7q34 2.22804 0.518167 containing 1
385 202023 at EFNA1 ephrin-A1 /// ephrin-A1 NM 004428 g4758245 NP 004419 Chr:1q21-q22 2.22355 4.640066
386 226961_at LOC222171 hypothetical protein AI347918 Hs.91109.0 NP_787083 Chr:7p15.1 2.22251 13.5285 LOC222171
387 217925_s_at C6orf106 chromosome 6 open reading NM_022758 gl 2232426 NP_073595 Chr:6p21.31 2.22005 13.40329 frame 106
388 224577 at KIAA1181 KIAA1181 protein AB033007 Hs.180428.1 NP 065195 Chr:5q35.2 2.21917 0.625663
389 240336_at — CDNA clone IMAGE:30337302, AI242749 Hs.146994.0 — — 2.21749 1.901012 S with apparent retained intron
390 218875_s_at FBXO5 F-box only protein 5 /// F-box NM_012177 g6912365 NPJD36309 Chr:6q25-q26 2.21632 11.06357 only proteiri 5
391 209165_at AATF apoptosis antagonizing AF083208 g5813798 NP_036270 Chr:17q11.2- 2.21548 9.625715 transcription factor /// apoptosis q12 antagonizing transcription factor
392 221884 at EVH ecotropic viral integration Site 1 BE466525 Hs.234773.0 NP 005232 Chr:3q24-q28 2.21326 10.20301
393 238462_at AI418293 Hs.163714.0 2.21087 4.174189
394 216194_s_at CKAP1 cytoskeleton associated protein AD001527 Hs.31053.1 NP_001272 Chr.19q13.11- 2.21032 9.625715 1 q13.12
395 208795_s_at MCM7 MCM7 minichromosome D55716 gl 255616 NP_005907 Chr:7q21.3- 2.20844 3.61384 maintenance deficient 7 (S. q22.1 cerevisiae)
396 219911_s_at SLCO4A1 soiute carrier organic anion NM_016354 g7706516 NP_057438 Chr:20q13.33 2.20818 4.174189 transporter family, member 4A1 /// soiute carrier organic anion transporter family, member 4A1
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
397 225687_at C20orf129 chromosome 20 open reading BCOO 1068 Hs.70704.0 NP_112181 Chr:20q11.22- 2.2016 2.814919 frame 129 q12
398 216270_at 7h3 hypothetical protein FLJ13511 AF209931 Hs.9291.1 NPJ49014 Chr:19p13.13 2.20112 2.814919
399 217871 s at MIF macrophage migration inhibitory NM_002415 g4505184 NP_002406 Chr:22q11.23 2.19656 4.149813 factor (glycosylation-inhibiting factor) /// macrophage migration inhibitory factor (glycosylation- inhibiting factor)
400 200837_at BCAP31 B-cell receptor-associated NM_005745 gl 0047078 NP. ,005736 Chr:xq28 2.19625 2.009521 protein 31 /// B-cell receptor- associated protein 31
401 33304_at ISG20 interferon stimulated gene U88964 4866504 NP. J302192 Chr:15q26 2.19586 4.174189 2OkDa
402 201126 s at MGAT1 mannosyl (alpha-1,3-)- NM_002406 g6031182 NP_002397 Chr:5q35 2.19508 8.779357 glycoprotein beta-1 ,2-N- acetylglucosaminyltransferase /// mannosyl (alpha-1 ,3-)- glycoprotein beta-1, 2-N- o acetylglucosaminyltransferase
403 204146_at PIR51 RAD51-interacting protein BE966146 Hs.24596.0 NP_006470 Chr:12p13.2- 2.1934 4.149813 p13.1
404 229099_at — Clone DNA64903 DSLR655 AW051379 Hs.9061.2 — — 2.19282 1.702877 (UNQ655) mRNA, complete cds
405 200996_at ACTR3 ARP3 actin-related protein 3 NM_005721 g7262289 NP_005712 Chr:2q14.1 2.19252 3.61384 homolog (yeast) /// ARP3 actin- related protein 3 homolog (yeast)
406 213485_s_at ABCC10 ATP-binding cassette, sub- AK000002 Hs.55879.1 NP_258261 Chr:6p21.1 2.19212 3.62324 family C (CFTR/MRP), member 10
407 202188_at NUP93 nucleoporin 93kDa NM_014669 g7661901 NP_055484 Chr:16q13 2.19137 4.174189
408 222077_s_at RACGAP1 Rac GTPase activating protein AU 153848 Hs.23900.1 NP_037409 Chr:12q13.12 2.18831 12.53374 1
409 200949_x_at RPS20 ribosomal protein S20 NM_001023 g4506696 NP 001014 Chr:8q12 2.18386 3.61384
410 201521_s_at NCBP2 nuclear cap binding protein NM_007362 g6679063 NP_031388 Chr:3q29 2.18076 6.991358 subunit 2, 2OkDa
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein IO Lokalisierung Change (%)
411 200650_s_at LDHA lactate dehydrogenase A /// NM_005566 g5031856 NP_005557 Chr:11p15.4 2.17641 1.578435 lactate dehydrogenase A
412 225084_at SEC10L1 SEC10-like 1 (S. cerevisiae) BG 170743 Hs.29494.2 NP 006535 Chr:14q22.3 2.17373 13.5285
413 215474_at — CDNA FLJ 12032 fis, clone AK022094 Hs.151194.0 — — 2.17232 4.174189 HEMBB1001880
414 225562 at RASA3 RAS p21 protein activator 3 AI684746 Hs.119274.1 NP 031394 Chr:13q34 2.17137 11.55252
415 222701_s_at CHCHD7 coiled-coii-helix-coiled-coil-helix AA570393 Hs.323164.0 NPJ377276 Chr:8q11.23 2.17097 1.702877 domain containing 7
416 218788_s_at SMYD3 SET and MYND domain NM_022743 gl 2232400 NP_073580 Chr:1q44 2.16846 0.353669 containing 3
417 226121 at MGC23280 hypothetical protein MGC23280 AI076793 Hs.5163.0 NP 653284 Chr:17q11.2 2.16657 4.174189
418 232946 s at Hs.307073.0 2.16498 0.625663
419 214772_at G2 G2 protein H08993 Hs.30660.0 — Chr:11p13 2.16277 3.306454
420 207414_s_at PACE4 paired basic amino acid NM_002570 g4505576 NP_002561 Chr:15q26 2.15958 2.571322 cieaving System 4 /// paired basic amino acid cieaving system 4 W
421 205394_at CHEK1 CHK1 Checkpoint homolog (S. NM_001274 g4502802 NP_001265 Chr:11q24-q24 2.15766 6.225758 pombe)
422 213695 at PON3 paraoxonase 3 L48516 Hs.296259.0 NP 000931 Chr:7q21.3 2.15709 14.22309
423 209408_at KIF2C kinesin family member 2C U63743 gl 695881 NP_006836 Chr:1p34.1 2.15608 8.153992
424 204318_s_at GTSE1 G-2 and S-phase expressed 1 NM_016426 g7705291 NP_057510 Chr:22q13.2- 2.15525 3.306454 q13.3
425 226594_at COQ6 coenzyme Q6 homolog (yeast) AA528157 Hs.285290.1 NP_057024 Chr:14q24.2 2.15491 3.306454
426 228037_at RARA retinoic acid receptor, alpha AA404273 Hs.12974.0 NP_000955 Chr:17q21 2.1548 9.840216
427 203559 s at ABP1 amiloride binding protein 1 NM_001091 g4501850 NP_001082 Chr:7q34-q36 2.15469 11.70204
(amine oxidase (copper- containing)) /// amiioride binding protein 1 (amine oxidase (copper-containiπg))
428 218586. .at C20orf20 chromosome 20 open reading NM_018270 g8922763 NP. _060740 Chr:20q13.33 2.15349 4.640066 frame 20
429 214359. _s_at HSPCB heat shock 9OkDa protein 1 , A1218219 Hs.74335.1 NP. _031381 Chr:6p12 2.15194 8.779357 beta
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
430 205376_at INPP4B inositol polyphosphate-4- NM_003866 g4504706 NP_003857 Chr:4q31.1 2.14919 5.685182 phosphatase, type II, 105kDa /// inositol polyphosphate-4- phosphatase, type II, 105kDa
431 224025_s_at APG7L APG7 autophagy 7-like (S. BC000091 gl 2652684 NP_006386 Chr:3p25.3- 2.14635 1.702877 cerevisiae) P25.2
432 225154_at SYAP1 Synapse associated protein 1 , BG029566 Hs.47334.0 NPJ 16185 Chr:xp22.22 2.14033 12.80219 SAP47 homolog (Drosophila)
433 217755_at HN1 hematological and neurological NM_016185 g7705876 NP_057269 Chr:17q25.2 2.13979 7.646445 expressed 1 /// hematological and neurological expressed 1
434 219959_at MOCOS molybdenum cofactor sulfurase NM 017947 g8923660 NP_060417 Chr:18q12 2.13654 3.612633
435 236291_at RDH5 retinol dehydrogenase 5 (11-cis AI887702 Hs.222853.0 NP_002896 Chr:12q13-q14 2.13563 0.095261 and 9-cis)
436 226997_at — CDNA FLJ 10196 fis, clone W74476 Hs.12680.0 — 2.13549 1.223189 HEMBA1004776
437 218681_s_at SDF2L1 stromal cell-derived factor 2-like NM_022044 gl 1545742 NP_071327 Chr:22q11.21 2.13478 3.612633 1 /// stromal cell-derived factor 2-like 1
438 208734_x_at RAB2 RAB2, member RAS oncogene M28213 g550061 NP_002856 Chr:8q12.1 2.13437 4.149813 family
439 204328_at EVER1 epidermodysplasia NM__007267 g7305226 NP_009198 Chr:17q25.3 2.13283 2.489117 verruciformis 1 /// epidermodysplasia verruciformis 1
440 200697_at HK1 hexokinase 1 /// hexokinase 1 NM 000188 g4504390 NP 000179 Chr:10q22 2.13279 6.225758
441 200822 x at TPH triosephosphate isomerase 1 NM 000365 g4507644 NP 000356 Chr:12p13 2.12957 1.578435
442 209739 s at DXS1283E GS2 gene AI814551 Hs.264.0 NP 004641 Chr:xp22.3 2.12857 3.612633
443 219306_at KNSL7 kinesin-like 7 /// kinesin-like 7 NM_020242 g9910265 NP 064627 Chr:3p21.32 2.12819 3.612633
444 201263_at TARS threonyl-tRNA synthetase /// NM_003191 g4507366 NP_003182 Chr:5p13.2 2.12564 9.625715 threonyl-tRNA synthetase
445 214352_s_at KRAS2 v-Ki-ras2 Kirsten rat sarcoma 2 BF673699 Hs.184050.1 NP_004976 Chr:12p12.1 2.1234 8.153992 viral oncogene homolog
446 201731_s_at TPR translocated promoter region (to NM_003292 g4507658 NP_003283 Chr:1q25 2.12301 2.814919 activated MET oncogene)
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
447 212568_s_at DLAT dihydrolipoamide S- BF978872 Hs.115285.1 NP_001922 Chr:11q23.1 2.12192 2.009521 acetyltransferase (E2 component of pyruvate dehydrogeπase complex)
448 218252_at CKAP2 cytoskeleton associated protein NM_018204 g8922641 NP_060674 Chr:13q14 2.12172 1.578435 2
449 201463_s_at TALDO1 transaldolase 1 /// transaldolase NM_006755 g5803186 NP_006746 Chr:11p15.5- 2.11804 1.578435 1 p15.4
450 208918_s_at FLJ 13052 NAD kinase AI334128 Hs.220324.2 NP_075394 Chr:1p36.33- 2.11496 12.53374 p36.21
451 210951_x_at RAB27A RAB27A, member RAS AF125393 g5410356 NP_004571 Chr:15q15- 2.11397 6.991358 oncogene family q21.1
452 219402 s at MGC3067 hypothetical protein MGC3067 NM_024295 gl 3236515 NP_061100 Chr:8q24.13 2.11338 3.61384
453 205241 _at SCO2 SCO cytochrome oxidase NM_005138 g4826991 NP_005129 Chr:22q13.33 2.11333 0.201325 deficient homolog 2 (yeast) /// SCO cytochrome oxidase deficient homolog 2 (yeast)
454 207717 s at PKP2 plakophilin 2 /// plakophilin 2 NM 004572 g4758931 NP 004563 Chr:12p11 2.10945 11.70204 w
455 224594 x at DCTN4 dynactin 4 (p62) AK025873 Hs.180952.1 NP 057305 Chr:5q31-q32 2.10916 9.266777
456 233266 at — — AU159087 Hs.301408.0 — — 2.10912 4.174189
457 201618_x_at GPAA1 GPAA1P anchor attachment NM_003801 g6031166 NP_003792 Chr:8q24.3 2.1071 5.685182 protein 1 homolog (yeast)
458 231154_x_at TINAG tubulointerstitial nephritis BF000045 Hs.127011.1 NP_055279 Chr:6p11.2-p12 2.1052 9.266777 antigen
459 221133 s at CLDN18 claudin 18 /// claudin 18 NM 016369 g7705960 NP 057453 Chr:3q22.3 2.10455 4.640066
460 200615_s_at AP2B1 adaptor-related protein complex AL567295 Hs.74626.0 NP_001273 Chr.17q11.2- 2.10448 3.612633 2, beta 1 subunit q12
461 205542__at STEAP six transmembrane epithelial NMJD 12449 g9558758 NP_036581 Chr:7q21 2.104 0.779487 antigen of the prostate /// six transmembrane epithelial antigen of the prostate
462 217962_at NOLA3 nucleolar protein family A1 NM_018648 g8923941 NP_061118 Chr:15q14-q15 2.09683 9.625715 member 3 (H/ACA small nucleolar RNPs)
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
463 205084_at BCAP29 B-celi receptor-associated NM_018844 g9994198 NP_061332 Chr:7q22-q31 2.09674 4.830969 protein 29 /// B-cell receptor- associated protein 29
464 205260_s_at ACYP1 acylphosphatase 1 , erythrocyte NM_001107 g4557244 NPJD01098 Chr:14q24.3 2.09558 4.640066 (common) type /// acylphosphatase 1 , erythrocyte (common) type
465 200916_at TAGLN2 transgelin 2 NM_003564 g4507356 NP 003555 Chr:1q21-q25 2.09474 0.518167
466 219233_s_at GSDML gasdermin-like NM 018530 g8924175 NP 061000 Chr:17q21.2 2.09432 3.62324
467 219646_at FLJ20186 hypothetical protein FLJ20186 NM_017702 g8923176 NP 060172 Chr:16q24.3 2.08819 0.353669
468 232260_at ZBTB11 zinc finger and BTB domain T56840 Hs.301956.1 NP_055230 Chr:3q12.3 2.08724 2.814919 containing 11
469 218193 s at CGM 41 CGI-141 protein NM 016072 g7705635 NP 057156 Chr:12p12.3 2.08617 9.625715
470 202404_s_at COL1A2 collagen, type I, alpha 2 NM 000089 g4502946 NP 000080 Chr:7q22.1 2.08575 0.625663
471 206026_s_at TNFAIP6 tumor necrosis factor, alpha- NM_007115 g6005905 NPJ309046 Chr:2q24.1 2.08232 12.53374 induced protein 6 /// tumor necrosis factor, alpha-induced protein 6
472 200658_s_at ZNF607 zinc finger protein 607 AL560017 Hs.75323.0 NP 116078 Chr:19q13.1 2.08161 6.225758
473 228846_at AW071793 Hs.109012.1 2.08118 1.380569
474 220240_s_at C13orf11 chromosome 13 open reading NM_017905 g8923574 NP_060375 Chr:13q34 2.07978 8.779357 frame 11
475 213647_at DNA2L DNA2 DNA replication helicase D42046 Hs.194665.0 — Chr:10q21.3- 2.07889 11.70204 2-like (yeast) q22.1
476 209950 s at VILL villin-like /// villin-Iike BC004300 gl 3279166 NP 056957 Chr:3p21.3 2.07747 4.640066
477 219010_at FLJ 10901 hypothetical protein FLJ10901 NM 018265 g8922753 NP 060735 Chr:1q32.1 2.07709 8.779357
478 204779 s at HOXB7 homeo box B7 NM 004502 g4758551 NP 004493 Chr:17q21.3 2.07398 1.223189
479 218399_s_at CDCA4 cell division cycle associated 4 NM_017955 g8923673 NP 060425 Chr:14q32.33 2.07163 12.53374
480 223035_s_at FARSLB phenylalanine-tRNA AF161521 g6841565 NP_005678 Chr.2q36.1- 2.0715 11.55252 synthetase-like, beta subunit q36.2
481 218130_at MGC4368 hypothetical protein MGC4368 NM_024510 gl 3375647 NP_078786 Chr:17q25.3 2.07116 4.436744
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
482 203560 at GGH gamma-glutamyl hydrolase NM 003878 g4503986 NP 003869 Chr:8q12.2 2.06852 1.380569
(conjugase, folylpoiygammaglutamyl hydrolase) /// gamma-glutamyl hydrolase (conjugase, folylpoiygammaglutamyl hydrolase)
483 206550_ _s_at NUP155 nucleoporin 155kDa /// NM_004298 g4758843 NP_ _004289 Chr:5p13.1 2.0655 8.153992 nucleoporin 155kDa
484 208394_ x_a\ ESM 1 endothelial cell-specific NM_007036 gl 3259505 NP. .008967 Chr:5q11.2 2.06522 6.991358 molecule 1 /// endothelial cell- specific molecule 1
485 216088_ A_at PSMA7 proteasome (prosome, AL078633 Hs.233952.3 NP_ _002783 Chr;20q 13.33 2.06269 4.174189 macropain) subunit, alpha type, 7
486 223029_ ^s_at RFWD1 ring finger and WD repeat AI806564 Hs.181077.0 NP. J 15647 Chr:16p13.3 2.06115 3.306454 domain 1
487 201930 at MCM6 MCM6 minichromosome NM_005915 g7427518 NP_005906 Chr:2q21 2.06009 0.518167 maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae) /// MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)
488 45633 at FLJ 13912 hypothetical protein FLJ13912 AI421812 4858291_RC NP_073607 Chr:16q13 2.05674 14.22309
489 201634 s at CYB5-M cytochrome b5 outer NM_030579 gl 3385593 NP_085056 Chr:16q22.1 2.05625 10.20301 mitochondrial membrane precursor /// cytochrome b5 outer mitochondrial membrane precursor
490 204117 .at PREP prolyl endopeptidase NM. 002726 g4506042 NP 002717 Chr:6q22 2.05588 4.436744
491 201675_ _at AKAP1 A kinase (PRKA) anchor protein NM. _003488 g4502014 NP. _003479 Chr:17q21-q23 2.05464 1.901012 1 /// A kinase (PRKA) anchor protein 1
492 218414_ _s_at NDE1 πudE nuclear distribution gene NM. J)17668 g8923109 NP. _060138 Chr:16p13.11 2.05248 3.306454 E homolog 1 (A. nidulans)
Nr. Aflymetrix Geπsymbol Gβnname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
493 223839_s_at SCD stearoyl-CoA desaturase (delta- AF132203 gl 1493551 NPJ305054 Chr:10q23-q24 2.05218 4.640066 9-desaturase)
494 200041 _s_at BAT1 HLA-B associated transcript 1 NM_004640 g4758111 NP_004631 Chr:6p21.3 2.0514 3.62324 /// HLA-B associated transcript 1 /// HLA-B associated transcript 1
495 219588_s_at MTB more than blood homolog NM 017760 g8923292 NP 060230 Chr:7q36.3 2.05122 8.153992
496 208816_x_at ANXA2P1 annexin A2 pseudogene 1 M62898 g187147 — Chr:4q21-q31 2.05011 3.612633
497 222992_s_at NDUFB9 NADH dehydrogenase AF261090 g9802311 NP_004996 Chr:8q13.3 2.04865 12.80219 (ubiquinone) 1 beta subcomplex, 9, 22kDa
498 218424 s at TSAP6 dudulin 2 NM 018234 g8922696 NP 060704 Chr:2q14.2 2.048 8.153992
499 204070_at RARRES3 retinoic acid receptor responder NM_004585 g8051633 NP_004576 Chr:11q23 2.04735 5.685182 (tazarotene induced) 3 /// retinoic acid receptor responder (tazarotene induced) 3
500 200750_s_at RAN RAN, member RAS oncogene AF054183 g4092053 NP_006316 Chr:12q24.3 2.04589 4.149813 family /// RAN, member RAS oncogene family
501 219544 at FLJ22624 FLJ22624 protein NM 024808 gl 3376190 NP 079084 Chr:13q21.33 2.04568 13.40329
502 238617_at — CDNA FLJ38181 fis, clone AW207243 Hs.143134.0 — — 2.0449 4.174189 FCBBF1000125
503 221664_s_at F11R F11 receptor /// F11 receptor AF154005 g5457118 NP_058642 Chr.1q21.2- 2.04432 12.53374 q21.3
504 204126__s_at CDC45L CDC45 cell division cycle 45- NM_003504 g4502712 NPJD03495 Chr:22q11.21 2.0441 2.814919 like (S. cerevisiae) /// CDC45 cell division cycle 45-like (S. cerevisiae)
505 212116 at RFP ret finger protein NM 006510 Hs.142653.1 NP 006501 Chr:6p22 2.0439 5.685182
506 219787_s_at ECT2 epithelial cell transforming NMJ318098 g8922431 NPJ360568 Chr:3q26.1- 2.043 4.436744 sequeπce 2 oncogene q26.2
507 233380_s_at RUFY1 RUN and FYVE domain AA429145 Hs.306769.0 NP_079434 Chr:5q35.3 2.04084 2.08989 containing 1
508 218856_at TNFRSF21 tumor necrosis factor receptor NM_016629 g7706171 NP_055267 Chr:6p21.1-12.2 2.04038 5.685182 superfamily, member 21
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
509 217428_s_at COL10A1 Collagen, type X, alpha X98568 Hs.179729. 1 NPJD00484 Chr:6q21-q22 2.03775 13.40329 1(Schmid metaphyseal chondrodysplasia)
510 205601_s_at HOXB5 homeo box B5 /// homeo box NM_002147 g4504468 NP_002138 Chr:17q21.3 2.0364 2.489117 B5
511 203557 s at PCBD 6-pyruvoyl-tetrahydropterin NM_000281 g4557830 NP_000272 Chr:10q22 2.03304 1.051298 synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) /// 6-pyruvoyl- tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1)
512 213681 at CYHR1 cysteine and histidine rieh 1 AW512817 Hs.173884.1 — Chr:8 2.03199 5.685182
513 218186_at RAB25 RAB25, member RAS NM_020387 g9966860 NP_065120 Chr:1q22 2.03064 9.625715 oncogene family
514 214431_at GMPS guanine monphosphate NM_003875 Hs.5398.0 NP_003866 Chr:3q24 2.03056 1.901012 synthetase /// guanine monphosphate synthetase
515 223082_at SH3KBP1 SH3-domain kinase binding AF230904 g7188748 NP_114098 Chr:xp22.1- 2.02671 13.5285 protein 1 p21.3
516 215227 x at ACP1 aeid Phosphatase 1 , soluble BG035989 Hs.75393.2 NP 004291 Chr:2p25 2.02577 3.61384
517 201584_s_at DDX39 DEAD (Asp-Glu-Ala-Asp) box NM_005804 g5031658 NP_005795 Chr:19p13.13 2.02563 3.612633 Polypeptide 39 /// DEAD (Asp- Glu-Ala-Asp) box Polypeptide 39
518 232602_at WFDC3 WAP four-disulfide core domain AL050348 Hs.149018.0 NP_542181 Chr:20q13.12 2.02116 1.901012 3
519 213789_at EBP emopamil binding protein (sterol N58493 Hs.75105.1 NP_006570 Chr:Xp11.23- 2.02051 3.306454 isomerase) P11.22
520 234372 at — — AL034403 Hs.247900.0 — — 2.02045 11.55252
521 201613 s at RUVBL1 RuvB-like 1 (E. coli) BC000519 gl 2653494 NP 003698 Chr:3q21 2.01994 0.353669
522 200744_s_at GNB1 guanine nucleotide binding AI741124 Hs.215595.0 NPJD02065 Chr:1p36.33 2.01985 11.06357 protein (G protein), beta Polypeptide 1
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
523 213892_s_at APRT adeπine AA927724 Hs.28914.1 NP_000476 Chr:16q24 2.0181 3.612633 phosphoribosyltransferase
524 208689_s_at RPN2 ribophorin Il /// ribophorin Il BC003560 gl 3097707 NP_002942 Chr:20q12- 2.01751 6.991358 q13.1
525 212401_s_at CDC2L1 cell division cycle 2-like 1 AI767436 Hs.183418.19 NP_001778 Chr:1p36 2.01552 2.489117 (PITSLRE proteins)
526 210563_x_at CFLAR CASP8 and FADD-like U97075 g2253680 NPJ)03870 Chr:2q33-q34 2.01547 6.991358 apoptosis regυlator
527 220248_x_at NSFL1C NSFL1 (p97) cofactor (p47) /// NM_018839 gl 0047113 NP_057227 Chr:20p13 2.01267 10.20301 NSFL1 (p97) cofactor (p47)
528 200998_s_at CKAP4 cytoskeleton-associated protein AW029619 Hs.74368.0 NPJ306816 Chr:12q24.11 2.01238 8.153992 4
529 212647_at RRAS related RAS viral (r-ras) NM_006270 Hs.9651.0 NP_006261 Chr:19q13.3- 2.01183 12.53374 oncogene homolog /// related qter RAS viral (r-ras) oncogene homolog
530 214316 x at MNT MAX binding protein AI378706 Hs.16488.3 NP 064706 Chr:17p13.3 2.0106 0.625663
531 205807 s at TUFT1 tuftelin 1 /// tuftelin 1 NM_020127 g9910595 NP 064512 Chr:1q21 2.00955 3.306454
532 222245 s at AF218012 Hs.72222.1 2.00634 6.225758
533 201590 x at ANXA2 annexin A2 /// annexin A2 NM 004039 g4757755 NP 004030 Chr:15q21-q22 2.00539 3.612633
534 225300_at FLJ 14502 TRAF4 associated factor 1 BF792864 Hs.181466.0 — Chr:15q14 2.00517 1.702877
535 216942_s_at CD58 CD58 antigen, (iymphocyte D28586 Hs.75626.2 NPJ3O177O Chr:1p13 2.00461 3.306454 function-associated antigen 3) /// CD58 antigen, (Iymphocyte function-associated antigen 3)
536 213571_s_at EIF4EL3 eukaryotic translation initiation BF516289 Hs.19122.1 NP_004837 Chr:2q37.1 2.00426 7.646445 factor 4E-like 3
537 201157_s_at NMT1 N-myristoyltransferase 1 /// N- AF020500 Hs.111039.0 NP_066565 Chr:17q21.31 2.00319 6.991358 myristoyltransferase 1
538 221058 s at CKLF chemokine-like factor NM 016326 gl 0092611 NP_057410 Chr:16q22.1 2.00273 5.685182
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change
539 212378 at GART phosphoribosylglycinamide NM 000819 Hs.82285.1 NP_000810 Chr:21q22.11 2.00253 6.991358 formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase /// phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
540 200910 at CCT3 chaperonin containing TCP1 , NM 005998 g5174726 NP_005989 Chr.ϊq23 2.00023 1.578435 sυbunit 3 (gamma) /// chaperonin containing TCP1 , subunit 3 (gamma)
In Tabelle 2 sind Gene aufgeführt, deren Expression im duktalen Adenokarzinom des Pankreas im Mittel maximal halb so hoch ist wie die Expression in normalem Pankreasepithelgewebe. D. h. der Quotient („Fold Change") aus den Expressionswerten im mikrodissektierten duktalen Adenokarzinom des Pankreas (Mittel über 14 Patienten) und den Expressionswerten im gesunden mikrodissektierten duktalen Pankreasepithelgewebe (Mittel über 11 Personen) ist für diese Gene < 0,5. Wird für ein Gen der Quotient („Fold Change") 1000 angegeben, bedeutet dies, dass das Gen nur im Normalgewebe, aber nicht im Tumorgewebe nachgewiesen werden konnte. Die Gene sind ab der Nummer 541 fortlaufend nummeriert. Zur Charakterisierung werden jeweils die Identifikationsnummer des Affymetrix- Probensets, das Gensymbol, der Gen-Name, die chromosomale Lokalisation, die repräsentative Identifikationsnummer (ID), die Identifikationsnummer des Transkriptes und die des zugehörigen Proteins angegeben (Veröffentlichungsnummern in der Entrez- Datenbank des National Center for Biotechnology Information (NCBI), Bethesda, USA (http://www.ncbi.nih.gov/entrez/). Der q-Wert (in Prozent) gibt an, mit welchem statistischen Fehler das verwendete Auswerteprogramm eine differentielle Genexpression voraussagt.
Tabelle 2
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change
541 235872 at Transcribed sequence BE408975 Hs.63335.0 1000 12.80219 with moderate simüarity to protein pdb:1 LBG (E. coli) B Chain B, Lactose Operon Repressor Bound To 21 -Base Pair Symmetrie Operator Dna, Alpha Carbons OnIy
542 235132_at LOC254128 hypothetical protein BF939830 Hs.260848.0 — Chr:2q14.2 1000 4.75532 LOC254128
543 232014_at ZNF30 zinc finger protein 30 AI700188 Hs.107444.0 NP. _919306 Chr:19q13.13 1000 9.266777 (KOX 28)
544 228323 at AF15Q14 AF15q 14 protein BF248364 Hs.283099.1 NP 065113 Chr:15q14 1000 9.266777
545 228095 at PHF14 PHD finger protein 14 AA608749 Hs.156276.1 — Chr:7p21.3 1000 6.023405
546 214373_at Clone AI582773 Hs.125682.1 1000 3.612633 IMAGE-.5171739, mRNA
547 212552 at HPCAL1 hippocalcin-like 1 BE617588 Hs.3618.1 NP. 002140 Chr:2p25.1 1000 6.991358
548 209773 s at RRM2 ribonucleotide BC001886 gl 2804874 NPJ)OI 025 Chr:2p25-p24 1000 3.612633 reduetase M2 Polypeptide /// ribonucleotide reduetase M2 Polypeptide
549 208741 _at SAP18 sin3-associated AW274856 Hs.23964.0 NP. _005861 Chr:13q12.11 1000 3.612633 Polypeptide, 18kDa
550 203177 _x_at TFAM transcription factor A, NM_003201 g4507400 NP. _003192 Chr:10q21 1000 6.991358 mitochondrial
551 63009_ at FLJ10539 hypothetical protein A1188402 4860453JRC NP. _060600 Chr:3p14.2 1000 0.095261 FLJ 10539
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probenπummer ID Protein ID Lokalisierung Change (%)
552 244573_at MRNA füll length insert R05505 Hs.193000.0 1000 0.095261 cDNA clone EUROIMAGE 200247
553 243374_x_at — Transcribed sequeπces AW452674 Hs.202083.0 — — 1000 0.095261
554 242330_at — Transcribed sequences AW195774 Hs.253199.0 — — 1000 0.149911
555 241196 at — Transcribed sequences BE857611 Hs.157791.0 — — 1000 0.149911
556 241192_at — Transcribed sequences BE327666 Hs.279637.0 — — 1000 0.095261
557 240474_x_at — — AI631676 Hs.194984.0 — — 1000 0.518167
558 239241 at — Transcribed sequences AI015709 Hs.270552.0 — — 1000 2.08989
559 234499_at Hs.306311.0 1000 0.095261
560 234341_x_at LOC91548 hypothetical protein AK026812 Hs.210844.0 — Chr:1q32.3 1000 0.095261 LOC91548
561 230114_at HOXB8 homeo box B8 AI492162 Hs.183274.1 NP 076921 Chr:17q21.3 1000 0.095261
562 227951_s_at LOC147965 hypothetical protein AW338561 Hs.283656.0 NP_777565 Chr:19q13.2 1000 0.625663 LOC147965
563 220809_at FLJ 14327 hypothetical protein NMJ024912 gl 3376375 — Chr:16q23.2 1000 0.095261 FLJ 14327
564 216749_at — CDNA: FLJ21198 fis, AK024851 Hs.306707.0 — — 1000 0.095261 clone COL00220
565 214569_at IFNA5 interferon, alpha 5 /// NM_002169 Hs.37113.0 NP_002160 Chr:9p22 1000 0.095261 Interferon, alpha 5
566 209959_at NR4A3 nuclear receptor U 12767 g924281 NP_008912 Chr:9q22 1000 0.095261 subfamily 4, group A, member 3
567 206913 at BAAT bile acid Coenzyme A: NM_001701 g4502350 NP_001692 Chr:9q22.3 1000 0.095261 amino acid N- acyltransferase (glycine N-choloyltransferase) /// bile acid Coenzyme A: amino acid N- acyltransferase (glycine N-choloyltransferase)
568 205563 at KISS1 KiSS-1 metastasis- NM_002256 g4504872 NPJ302247 Chr:1q32 1000 0.353669 suppressor/// KiSS-1 metastasis-suppressor
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change
569 205290 s at BMP2 bone morphogeπetic NM_001200 g4557368 NP_0Q1191 Chr:20p12 1000 1.051298 protein 2
570 206702 at TEK TEK tyrosine kinase, NM_000459 g4557868 NP_000450 Chr:9p21 0.49991 0.779487 endothelial (venous malformations, multiple cutaneoυs and mucosal) /// TEK tyrosine kinase, endothelial (venous malformations, multiple cutaneous and mucosal)
571 232122. _s_ at Hs.126485.2 0.49987 0.201325
572 219503. _s_ at FLJ 11036 hypothetical protein NM_018306 g8922834 NP. _060776 Chr:3p25.2 0.49963 6.991358 FLJ11036
573 204271. _s_ at EDNRB endothelin receptor M74921 gl 82275 NP. _000106 Chr:13q22 0.49946 10.20301 type B /// endothelin receptor type B
574 232392 at BE927772 Hs.167460.2 0.49943 0.353669
575 223217 s at MAIL molecule possessing BE646573 Hs.301183.0 NP_113607 Chr:3p12-q12 0.49943 0.779487 ankyrin repeats induced by iipopolysaccharide (MAIL), homolog of mouse
576 219871. _at FLJ13197 hypothetical protein NM_024614 gl 3375829 NP. .078890 Chr:4p14 0.4994 0.201325 FLJ13197
577 212423. jat Hs.28264.0 0.49853 1.223189
578 204660. GFER growth factor, NMJD05262 ' g4885264 NP. .005253 Chr:16p13.3- 0.49836 0.625663 augmenter of liver p13.12 regeneration (ERV1 homolog, S. cerevisiae)
579 221974. _at MRNA AW770748 Hs.5022.0 0.49835 0.518167
580 213547 at TIP120B TBP-interacting protein AB014567 Hs.154740.0 — Chr:3p25.2 0.49811 0.149911
581 236225_ _at FLJ90165 hypothetical protein AI697028 Hs.130749.0 NP. _699169 Chr:17p13.3 0.49764 1.223189 FLJ90165
Nr. Affymetrix Gensymbσl Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change
582 224379 at FTHL17 ferritin, heavy AF285592 gl 3603866 NP_114100 Chr:xp21 0.49679 0.095261 polypeptide-like 17 /// ferritin, heavy polypeptide-like 17
583 205513 at TCN1 transcobalamin I NM_001062 g4507406 NP_001053 Chr:11q11-q12 0.49659 2.08989 (vitamin B12 binding protein, R binder family) /// transcobalamin I (vitamin B12 binding protein, R binder family)
584 228214 at Transcribed sequences AW242286 Hs.34145.0 0.49641 0.095261
585 207643 s at TNFRSF1A tumor necrosis factor NM 001065 g4507574 NP_001056 Chr:12p13.2 0.49617 0.201325 receptor superfamily, member 1 A /// tumor necrosis factor receptor superfamily, member 1A
586 238868 at Transcribed sequence AW264269 Hs.98312.0 0.49572 0.201325 with weak similarity to protein ref:NP_060312.1 (H.sapiens) hypothetical protein FLJ20489 [Homo sapiens]
587 209309_at AZGP1 alpha-2-glycoprotein 1 , D90427 g220150 NP_001176 Chr:7q22.1 0.49566 3.306454 zinc /// aIpha-2- glycoprotein 1 , zinc
588 213283_s_at SALL2 sal-like 2 (Drosophila) BG285616 Hs.79971.0 — Chr:14q11.1- 0.49493 0.149911 q12
589 227839_at MBD5 methyl-CpG binding AI911379 Hs.94125.1 NP_060798 Chr:2q23.3 0.49476 1.380569 domain protein 5
590 229201 _at — CDNA FLJ42712 fis, AW044658 Hs.13326.0 — — _ 0.49466 2.489117 clone BRAMY3008044
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
591 230258 at ZNF515 zinc finger protein 515 AI277316 Hs.107924.0 NP 689842 Chr:9p24.2 0.49454 0.095261
592 205280 at GLRB glycine receptor, beta NM 000824 g4504022 NP 000815 Chr:4q31.3 0.49437 1.702877
593 225118_at SET8 PR/SET domain AI813938 Hs.111988.2 NP_065115 Chr:12q24.31 0.49415 0.095261 containing protein 8
594 217604 at Transcribed sequence AI086530 Hs.255883.0 0.49404 0.095261 with moderate similarity to protein sp:P39195
(H.sapiens)
ALU8_HUMAN Alu subfamily SX sequence contamination warning entry
595 219250 s at FLRT3 fibronectin leucine rieh NM_013281 g7019382 NP_037413 Chr:20p11 0.49373 3.612633 transmembrane protein 3 /// fibronectin leucine rieh transmembrane protein 3
596 221112. _at IL1RAPL2 interleukin 1 receptor NM_017416 gl 1225606 NPJ359112 Chr:xq22.2- 0.49364 0.095261 accessory protein-like 2 q22.3 /// interleukin 1 receptor accessory protein-like 2
597 233749_ _at CDNA clone AW139915 Hs.302098.0 — 0.49277 2.08989 IMAGE:30330955, partial eds
598 216446, .at — CDNA: FLJ20915 fis, AK024568 Hs.306691.0 — — 0.4926 0.095261 clone ADSE00692
599 226022_ .at SASH1 SAM and SH3 domain AU 144882 Hs.10299.0 NP_056093 Chr:6q24.3 0.492 0.779487 containing 1
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript (D Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
600 209617 s at CTNND2 cateπin (cadherin- AF035302 g2661061 NPJKM 323 Chr:5p15.2 0.49185 1.380569 associated protein), delta 2 (neural plakophilin-reiated arm- repeat protein) /// catenin (cadherin- associated protein), delta 2 (neural plakophilin-reiated arm- repeat protein)
601 234389 x at — — AF017336 Hs.248064.0 — — 0.49172 6.023405
602 207072_at IL18RAP interleukin 18 receptor NM_003853 g4504656 NP_003844 Chr:2p24.3- 0.49117 8.153992 accessory protein /// p24.1 interleukin 18 receptor accessory protein
603 207720 at LOR loricrin /// loricrin NM 000427 g4557724 NP 000418 Chr.iq21 0.49076 0.095261
604 236600_at SPG20 spastic paraplegia 20, AI651603 Hs.46988.0 NP_055902 Chr:13q13.2 0.49066 0.095261 spartin (Troyer Syndrome)
605 204042_at WASF3 WAS protein family, AB020707 Hs.82318.0 NPJ306637 Chr:13q12 0.49011 0.149911 member 3 /// WAS protein family, member 3
606 206541_at KLKB1 kallikrein B, plasma NMJ)00892 g9257226 NP_000883 Chr:4q34-q35 0.48986 4.830969 (Fletcher factor) 1 /// kallikrein B, plasma (Fletcher factor) 1
607 206167_s_at ARHGAP6 Rho GTPase activating NMJ)O1174 g7382476 NP_001165 Chr:xp22.3 0.48983 0.353669 protein 6 /// Rho GTPase activating protein 6
608 213939_s_at RIPX rap2 interacting protein AI871641 Hs.306623.0 NPJD55776 Chr:4q21.1 0.4895 1.380569
X
609 234223_at — CDNA: FLJ21341 fis, AK024994 Hs .306738.0 — — 0.48853 0.201325 clone COL02653
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
610 220341_s_at LOC51149 truncated calcium NM_016175 g7705864 NP_057259 Chr:5q35.3 0.48802 0.095261 binding protein
611 244069 at — — BE220584 Hs.88372.0 — — 0.48783 0.353669
612 232113 at Hs.50150.0 0.48775 2.08989
613 225728_at — CDNA FU37284 fis, AI659533 Hs.278626.2 — 0.48747 0.095261 c!one BRAMY2013590
614 217273_at LOC343071 hypothetical protein AL022101 Hs.251419.0 — Chr:1p36.21 0.48742 0.095261 LOC343071
615 242434_at — CDNA FLJ31093 fis, AW771952 Hs.191581.0 — 0.4872 0.625663 elone IMR321000161
616 203752s_at JUND jun D proto-oncogene NM_005354 gl 0938013 NPJD05345 Chr:19p13.2 0.48718 0.095261 /// jun D proto- oncogene
617 203574_at NFIL3 nuclear factor, NM_005384 g4885516 NP_005375 Chr:9q22 0.48583 0.095261 interleukin 3 regulated /// nuclear factor, interleukin 3 regulated
618 216863_s_at ZCWCC1 zinc finger, CW-type AC004542 Hs.35276.1 Chr:22q12.2 0.48582 3.612633 with coiled-coil domain 1
619 227892_at CDNA clone AA855042 Hs.127301.0 0.48522 2.489117 IMAGE:5288757, partiai cds
620 224940__s_at PAPPA pregnancy-associated BF107618 Hs.250655.4 NP_002572 Chr:9q33.2 0.48521 2.814919 plasma protein A
621 228905 at Transcribed sequence BE672700 Hs.155272.0 -- 0.48519 0.149911 with weak similarity to protein sp:P39195 (H. sapiens) ALU8_HUMAN AIu sυbfamiiy SX sequence contamination warning entry
622 219448, _at FLJ20533 hypothetical protein BC002748 gl 2803814 NP. _060336 Chr:8q13.3 0.48501 0.095261 FLJ20533
623 233000, _x_at DESR1 DESR1 protein AL035669 Hs.313498.0 NP. _996662 Chr:3p25.1 0.48433 1.380569
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
624 206959_s_at UPF3A UPF3 regulator of NM_023011 gl 2711675 NP_075387 Chr:13q34 0.48405 0.095261 nonsense transcripts homolog A (yeast)
625 227174_at FLJ38736 hypothetical protein Z98443 Hs.86366.0 NP_877435 Chr:15q21.1 0.48385 1.380569 FLJ38736
626 43427_at LOC283445 hypothetical protein AI970898 4811882_RC — Chr:12q24.12 0.48353 3.612633 LOC283445
627 216483_s_at C19orf10 chromosome 19 open AC005339 Hs.296443.0 NP_061980 Chr:19p13.3 0.48326 0.201325 reading frame 10
628 227030_at — CDNA FU46579 fis, BG231773 Hs.318893.0 — — 0.48301 0.095261 clone THYMU3042758
629 208437 at CLCN1 Chloride Channel 1 , NM_000083 g4502866 NPJ300074 Chr:7q35 0.48278 0.095261 skeletal muscle (Thomsen disease, autosomal dominant) /// Chloride Channel 1 , skeletal muscle (Thomsen disease, autosomal dominant)
630 226344 _at KIAA1789 KIAA1789 protein A1741051 Hs.296317.0 — Chr:xq21 0.4818 0.518167
631 222663 at RIOK2 RIO kinase 2 (yeast) AK001697 Hs.27021.0 NP 060813 Chr:5q15 0.48119 0.353669
632 214319_ _at W58342 Hs.181304.1 0.48088 3.612633
633 205259 at NR3C2 nuclear receptor NM_000901 g4505198 NP_000892 Chr:4q31.1 0.48084 9.625715 subfamily 3, group C, member 2 /// nuclear receptor subfamily 3, group C, member 2
634 203973 s at CEBPD CCAAT/enhancer NM_005195 g4885130 NP_005186 Chr:8p11.2- 0.48026 0.095261 binding protein p11.1 (C/EBP), delta /// CCAAT/enhancer binding protein
Figure imgf000049_0001
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer JD Protein ID Lokalisierung Change
635 241368 at Transcribed sequence AH 90693 Hs.131034.0 0.47977 9.266777 with weak similarity to protein ref:NP_060312.1
(H.sapieπs) hypothetical protein
FLJ20489 [Homo sapiens]
636 216894_x_at CDKN 1 C cyclin-dependent D64137 Hs.106070.3 NP_000067 Chr.i 1p15.5 0.47941 2.814919 kinase inhibitor 1C (p57, Kip2)
637 235424_at PIP5K1B phosphatidylinositol-4- N66727 Hs.10957.0 NP_003549 Chr:9q13 0.47937 0.149911 phosphate 5-kinase, type I, beta
638 200732_s_at PTP4A1 protein tyrosine AL578310 Hs.227777.0 NP_003454 Chr:6q12 0.4782 0.095261 Phosphatase type IVA, member 1
639 234557_at Sirnilar to hypothetical AK000806 Hs.306408.0 Chr:15q24.1 0.47815 0.095261 protein FLJ20452 (LOC390611 ), mRNA
640 233155_at UPP2 uridine Phosphorylase AC005539 Hs.128427.1 NP_775491 Chr:2q24.2 0.47762 0.095261 2
641 201427_s_at SEPP1 selenoprotein P, NM_005410 g4885590 NP_005401 Chr:5q31 0.47747 0.095261 plasma, 1 /// selenoprotein P, plasma, 1
642 228063_s_at NAP1L5 nucleosome assembiy AW025330 Hs.12554.1 NP_715638 Chr:4q22.1 0.47741 0.149911 protein 1-Iike 5
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ITJ Protein ID Lokalisierung Change (%)
643 206008 at TGM1 transglutaminase 1 (K NM_000359 g4507474 NP_000350 Chr:14q11.2 0.47734 0.095261 Polypeptide epidermal type I, protein- glutamine-gamma- glutamyltransferase) /// transglutaminase 1 (K Polypeptide epidermal type I, protein- glutamine-gamma- glutamyltransferase)
644 228782_at SCGB3A2 secretoglobin, family BG540454 Hs.54795.0 NP_473364 Chr:5q32 0.4772 0.518167 3A, member 2
645 206417_at CNGA1 cyclic nucleotide gated NM_000087 g4502914 NP_000078 Chr:4p12-cen 0.47717 1.380569 Channel alpha 1 /// cyclic nucleotide gated Channel alpha 1
646 221099_at C9orf63 chromosome 9 open NM_017960 g8923683 — Chr:9q21.2 0.47706 0.095261 reading frame 63
647 244584_at — Transcribed sequences AW904533 Hs.101657.0 — — 0.47704 0.353669
648 234986_at GCLM glutamate-cysteine AA630626 Hs.315562.0 NP_002052 Chr:1p22.1 0.47685 0.625663 ligase, modifier subunit
649 230561_s_at FLJ23861 hypothetical protein AA252512 Hs.125845.1 NP_689732 Chr:2q34 0.47672 0.518167 FLJ23861
650 228496_s_at CRIM1 cysteine-rich motor AW243081 Hs.19280.1 NP_057525 Chr:2p21 0.47622 0.095261 neuron 1
651 218656_s_at LHFP lipoma HMGIC fusion NM_005780 g5031864 NP_005771 Chr:13q12 0.4762 0.625663 partner /// lipoma HMGIC fusion partner
652 212713_at MFAP4 microfibrillar-associated R72286 Hs.296049.0 NP_002395 Chr:17p11.2 0.47601 0.518167 protein 4
653 229145_at C10orf104 chromosome 10 open AA541762 Hs.122586.0 NP_775744 Chr:10q22.2 0.47577 0.353669 reading frame 104
654 223366_at Clone BC004287 gl 3279127 0.47573 0.095261 IMAGE:3618365, mRNA
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
655 231993_at — CDNA: FLJ23131 fis, AK026784 Hs.301296.1 — — 0.47494 1.380569 clone LNG08502
656 234265_at LENG3 leukocyte receptor AF211968 Hs.306229.0 Chr:19q13.4 0.47458 1.380569 Cluster (LRC) member 3
657 206278_at PTAFR platelet-activating D10202 g219975 NPJ300943 Chr:1p35-p34.3 0.47421 0.095261 factor receptor /// platelet-activating factor receptor
658 217338 at LOC160313 keratiπ 19 pseudogene AB041269 Hs.272263.0 — Chr:12q22 0.47419 0.095261
659 231944_at TM7SF1 transmembrane 7 AL045717 Hs.188228.0 NP_003263 Chr:1q42-q43 0.47395 1.051298 superfamily member 1 (upregulated in kidney)
660 228806 at AI218580 Hs.81295.0 0.47391 0.353669
661 211653 x at M33376 gl 87444 0.47386 1.223189
662 218901_at PLSCR4 phospholipid NM_020353 g9966818 NP_065086 Chr:3q24 0.47382 0.095261 scramblase 4 /// phospholipid Ul scramblase 4
663 232640 at Hs.238928.2 0.47367 0.518167
664 215880_at NAGLU N- AI364950 Hs.50727.1 NP_000254 Chr:17q21 0.47322 0.149911 acetylglucosaminidase, alpha- (Sanfilippo disease HIB)
665 204135_at DOC1 downregulated in NM_014890 g7657036 NP_055705 Chr:3q12.3 0.47293 0.095261 ovarian Cancer 1 /// downregulated in ovarian Cancer 1
666 224000_at gl 2053292 0.47274 13.64212
667 218573_at MAGEH1 melanoma antigen, NM_014061 g7661529 NP_054780 Chr:xp11.22 0.47271 0.095261 family H, 1
668 229738_at DNAH10 dynein, axonemal, AI700446 Hs.136245.0 — Chr:12q24.31 0.47242 2.814919 heavy Polypeptide 10
669 229435 at ZNF515 zinc finger protein 515 AW025602 Hs.293854.0 NP 689842 Chr:9p24.2 0.47241 13.5285
670 56829_at T1 Tularik gene 1 H61826 4850333 RC NP 113654 Chr:8q24.3 0.47169 0.095261
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
671 240414 at — Transcribed sequences AI963959 Hs.223825.0 — — 0.47161 0.095261
672 232183_at SERAC1 serine active Site AA128978 Hs.154706.0 NP_116250 Chr:6q25.3 0.47092 0.353669 containing 1
673 227235_at — CDNA FLJ42250 fis, AI758408 Hs.22247.0 — — 0.47047 0.095261 clone TKIDN2007828
674 212845_at SAMD4 sterile alpha motif AB028976 Hs.173571.0 NP_056404 Chr:14q22.2 0.4704 0.095261 domain containing 4
675 239262_at — CDNA FLJ26242 fis, AI498395 Hs.25930.0 — — 0.47039 4.174189 clone DMC00770
676 236335_at Clone AW298375 Hs.24477.0 0.47004 12.80219 IMAGE-.5274212, mRNA
677 209550_at NDN necdin homolog U35139 gl 754970 NP_002478 Chr:15q11.2- 0.46981 0.518167 (mouse) /// necdin q12 homolog (mouse)
678 234319 at Hs.159200.1 0.46926 0.518167
679 59999_at H1F1AN hypoxia-inducible factor W37897 4852641 _RC NPJ360372 Chr:10q24 0.46903 12.53374 1 , alpha subunit inhibitor
680 242033 at BE672684 Hs.109843.0 0.46874 1.380569
681 238983_at FLJ14001 hypothetical protein AI538394 Hs.293514.0 NP_078953 Chr:4p14 0.4687 2.814919 FLJ14001
682 206844_at FBP2 fructose-1,6- NM_003837 g4503670 NP_003828 Chr:9q22.3 0.46836 0.518167 bisphosphatase 2 /// fructose-1 ,6- bisphosphatase 2
683 216818_s_at OR2J2 olfactory receptor, AJ302559 Hs.307110.0 NPJ 12167 Chr:6p21.31- 0.46832 0.353669 family 2, subfamily J, 22.2 member 2
684 202350 s at MATN2 matrilin 2 /// matrilin 2 NM 002380 gl 3518036 NP 002371 Chr:8q22 0.46826 3.612633
685 204557_s_at DZIP1 DAZ interacting protein NM_014934 g7662435 NP_055749 Chr:13q32.1 0.46823 2.489117 1
686 232536 at Hs.222909.0 0.46812 0.095261
687 213832_at — Clone 24405 mRNA AA530995 Hs.23729.0 — - — 0.46801 0.095261 sequence
688 225816_at PHF17 PHD finger protein 17 AW138134 Hs.12420.0 NPJD79176 Chr:4q26-q27 0.4676 0.095261
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
689 210990 s at LAMA4 iaminin, alpha 4 U77706 gl 684836 NP 002281 Chr:6q21 0.46718 0.353669
690 213800_at HF1 H factor 1 X04697 Hs.250651.2 NPJ)O0177 Chr:1q32 0.46717 0.095261 (compiement) /// H factor 1 (compiement)
691 209305_s_at GADD45B growth arrest and DNA- AF078077 g3978391 NP_056490 Chr:19p13.3 0.46631 11.06357 damage-inducible, beta
692 226841 _at MPEG1 macrophage expressed BF590697 Hs.288581.0 — Chr:11q12.2 0.46621 0.518167 gene 1
693 213771_at IRF2BP1 interferon regulatory A1401612 Hs.154680.0 NP_056464 Chr:19q13.32 0.46595 0.095261 factor 2 biπding protein 1
694 205074 at SLC22A5 solute carrier family 22 NM_003060 g4507004 NP_003051 Chr:5q31 0.46568 0.095261
(organic cation transporter), member 5 /// solute carrier family 22 (organic cation 'Jl transporter), member 5
695 205857_at SLC18A2 solute carrier family 18 AI269290 Hs.1813.0 NP_003045 Chr:10q25 0.46561 3.62324 (vesicular monoamine), member 2
696 216535 at Hs.274514.0 0.46554 0.095261
697 210328_at GNMT glycine N- AF101477 g8671583 NP_061833 Chr.βp12 0.46521 4.436744 methyltransferase /// glycine N- methyitransferase
698 228229 at ZNF526 zinc finger protein 526 BF512165 Hs.137282.0 NP 597701 Chr:19q13.31 0.46518 0.095261
699 240771_at MGC33370 hypothetical protein AH 39906 Hs.104926.0 NP_776168 Chr:1q44 0.46459 3.306454 MGC33370
700 201694_s_at EGR1 early growth response NM_001964 g4503492 NP_001955 Chr:5q31.1 0.46322 0.095261 1 /// early growth response 1
701 203419_at MLL4 myeloid/iymphoid or NMJD14727 g7662045 NP_055542 Chr:19q13.1 0.46311 0.149911 mtxed-lineage leukemia 4
702 217154_s_at EDN3 endothelin 3 AL035250 Hs.1408.2 NP_000105 Chr:20q13.2- 0.46217 0.095261 q13.3
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
703 210158 at ERCC4 excision repair cross- U64315 gl 524410 NP_005227 Chr:16p13.3- 0.46214 0.149911 complementing rodent p13.11 repair deficiency, complemeπtation group 4 /// excision repair cross-complementing rodent repair deficiency, complementation group 4
704 228943 at MAP6 microtubule-associated AW003666 Hs.239444.0 Chr:11q13.3 0.46211 0.095261 protein 6
705 221366 at NKX6-1 NK6 transcription factor NM_006168 g5453787 NP_006159 Chr:4q21.2-q22 0.46195 0.201325 related, locus 1 (Drosophila) /// NK6 transcription factor related, locus 1 (Drosophila)
706 207281. _x_at VCX2 variable Charge, X- NM_ _016378 g7706758 NP_ _057462 Chr:xp22.32 0.46162 0.518167 linked 2 /// variable Charge, X-linked 2
707 225946 at Hs.44787.0 0.46111 0.095261
708 206197 at NME5 non-metastatic cells 5, NM_003551 g4505412 NP_003542 Chr:5q31 0.46104 0.095261 protein expressed in (nucleoside- diphosphate kinase) /// non-metastatic cells 5, protein expressed in (nucleoside- diphosphate kinase)
709 239799. _at — CDNA FLJ34826 fis, BF592774 Hs.179153.0 — — 0.46074 0.095261 clone NT2NE2008803
710 203197. _s_at FLJ20580 hypothetical protein AW157077 Hs.146861.0 NP. ,060357 Chr:1p32.3 0.46023 12.53374 FLJ20580
711 212279. _at MAC30 hypothetical protein BE779865 Hs.199695.0 NP. ,055388 Chr:17q11.2 0.46015 0.625663 MAC30
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
712 226682 at AW006185 Hs.293968.0 0.46006 0.095261
713 202388_at RGS2 regulator of G-protein NM_002923 g4506516 NP_002914 Chr:1q31 0.45998 0.095261 signalling 2, 24kDa /// regulator of G-protein signalling 2, 24kDa
714 228469_at PPID peptidylprolyl BF431902 Hs.143482.1 NP_005029 Chr:4q31.3 0.45996 0.149911 isomerase D (cyclophilin D)
715 229449_at — CDNA FLJ36553 fis, BE348404 Hs.24740.0 — — 0.45986 0.149911 clone TRACH2008478
716 231460 at Transcribed sequence AI702438 Hs.145533.0 — 0.45981 0.149911 with moderate similarity to protein pdb:1LBG (E. coli) B Chain B,
Lactose Operon
Repressor Bound To
21-Base Pair
Symmetrie Operator Ul Ul
Dna, Alpha Carbons
OnIy
717 233263_at — CDNA FLJ12236 fis, AU147635 Hs.296708.0 — — 0.4597 1.901012 clone MAMMA1001244
718 225662_at 2AK sterile alpha motif and H28667 Hs.16930.0 NP057737 Chr:2q24.2 0.45955 1.380569 leucine zipper containing kinase AZK
719 225975 at PCDH18 protocadherin 18 AW189885 Hs.97266.0 NP 061908 Chr:4q31 0.4595 0.095261
720 204814_at CADPS Ca2+-dependent NM_003716 g4502540 NP_003707 Chr:3p21.1 0.45933 7.646445 secretion activator /// Ca2+-dependent secretion activator
721 229623_at CDNA clone BF508344 Hs.112742.0 — Chr:4q21.3 0.45925 1.702877 IMAGE:6301163, containing frame-shift errors
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
722 205203_at PLD1 phospholipase DI, NM_002662 g4505872 NPJ302653 Chr:3q26 0.45919 4.149813 phophatidylcholine- specific
723 207542_s_at AQP1 aquaporin 1 (channel- NM_000385 g4755121 NP_000376 Chr:7p14 0.45902 0.095261 forming integral protein, 28kDa)
724 240043 at — Transcribed sequences A1130988 Hs.130370.0 — — 0.45865 0.095261
725 228974_at MGC48625 hypothetical protein AI816281 Hs.293690.0 NP_872415 Chr:19q 13.42 0.45843 0.353669 MGC48625
726 210294_at TAPBP TAP binding protein AF067286 gl 0803729 NP_003181 Chr:6p21.3 0.45809 0.095261 (tapasin)
727 230403_at — CDNA FLJ45905 fis, AV723984 Hs.7154.0 — 0.45743 0.779487 clone OCBBF3026576
728 227705_at MGC23947 hypothetical protein BF591534 Hs.21861.0 NP_689491 Chr:xq22.1 0.45633 1.051298 MGC23947
729 211735_x_at SFTPC Surfactant, pulmonary- BC005913 gl 3543508 NP003009 Chr:8p21 0.4563 0.095261 associated protein C /// Surfactant, pulmoπary- associated protein C
730 228766_at CD36 CD36 antigen (collagen AW299226 Hs.325823.0 NP_000063 Chr:7q11.2 0.45628 0.625663 Ol type I receptor, thrombospondin receptor)
731 220161 s at EPB41L4B erythrocyte membrane NM_019114 g9506568 NP_060894 Chr:9q31-q32 0.4562 1.901012 protein band 4.1 like 4B /// erythrocyte membrane protein band 4.1 like 4B
732 227188. _at C21orf63 chromosome 21 open AI744591 Hs.30156.0 NP. _478067 Chr:21q22.11 0.45578 0.095261 reading frame 63
733 200962 at RPL31 ribosomal protein L31 AI348010 Hs.184014.0 NP 000984 Chr:2q12.1 0.45568 0.095261
734 229084 at CNTN4 contactin 4 R42166 Hs.94000.0 NP 783200 Chr:3p26-p25 0.45549 12.80219
735 224822_ _at DLC1 deleted in liver Cancer AA524250 Hs.8700.1 NP. _006085 Chr:8p22 0.4553 0.095261 1
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
736 210390_s_at CCL15 chemokine (C-C motif) AF031587 g2739163 NP_004158 Chr:17q11.2 0.45525 2.489117 ligand 15 /// chemokine (C-C motif) ligand 15
737 239297 at Transcribed sequence BE932011 Hs.121518.0 0.45414 9.266777 with strong similarity to protein sp:P00722 (E. coli) BGALJ≡COLI Beta-galactosidase
738 209543_s_at CD34 CD34 antigen /// CD34 M81104 g180108 NP. _001764 Chr:1q32 0.45302 0.095261 antigen
739 202242_at TM4SF2 transmembrane 4 NM_004615 g4759235 NP. _004606 Chr:xp11.4 0.453 9.625715 superfamily member 2 /// transmembrane 4 superfamily member 2
740 208514 at KCNE1 potassium voltage- NM 000219 g4557686 NP 000210 Chr:21q22.12 0.45256 0.095261 gated Channel, Isk- related family, member 1 /// potassium voltage- uι
-4 gated Channel, Isk- related family, member 1
741 225232 at PIP3AP phosphatidylinositol-3- AA524700 Hs.93872.1 NP_061934 Chr:5p13.3 0.45251 0.095261 phosphate associated protein
742 205422 s at ITGBL1 integrin, beta-like 1 NM 004791 g4758613 NP_004782 Chr:13q33 0.45231 1.380569 (with EGF-like repeat domains) /// integrin, beta-like 1 (with EGF- like repeat domains)
743 228224. _at PRELP proline arginine-rich AA573140 Hs.183860.1 NP. _002716 Chr:1q32 0.45228 1.380569 end leucine-rich repeat protein
744 204175. _at ZNF593 zinc finger protein 593 NM_015871 g7705661 NP_ .056955 Chr:1p35.3 0.45227 0.095261 /// zinc finger protein 593
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change ""-
145 203140 at BCL6 B-cell CLL/lymphoma 6 NM_001706 g4502382 NP_001697 Chr:3q27 0.45204 0.149911 (zinc finger protein 51 ) /// B-cell
CLL/lymphoma 6 (zinc finger protein 51)
746 209834_ _at CHST3 carbohydrate AB017915 g4115403 NP_ _004264 Chr:10q22.2 0.45201 1.051298 (chondroitin 6) sulfotransferase 3
747 227662 at AA541622 Hs.47447.0 0.45173 3.62324
748 228971 at Transcribed sequence AI357655 Hs.292931.0 — 0.45163 0.149911 with weak similarity to protein sp:P39192
(H.sapiens)
ALU5_HUMAN AIu subfamily SC sequence contamination waming entry
749 213309 at Hs.54886.0 0.45156 0.201325
750 209894_at LEPR leptin receptor /// leptin U50748 g3236285 NP_002294 Chr:1p31 0.45048 0.201325 00 receptor
751 239806_at ARFIP1 ADP-ribosylation factor BF508641 Hs.136017.0 NP_055262 Chr:4q31.3 0.45032 9.266777 interacting protein 1 (arfaptin 1 )
752 227197_at SGEF Src homology 3 A1989530 Hs.12891.0 NPJ)56410 Chr:3q25.2 0.44989 13.5285 domain-containing gυanine nucleotide exchange factor
753 219115_s_at IL20RA interleukin 20 receptor, NMJ) 14432 g7657690 NP_055247 Chr:6q22.33- 0.44975 2.08989 alpha /// interleukin 20 q23.1 receptor, alpha
754 226322 at ARG99 ARG99 protein BF109231 Hs.10683.0 NP 114126 Chr:12p11.23 0.44945 0.353669
755 215054_at EPOR erythropoietin receptor H16758 Hs.89548.1 NP_000112 Chr:19p13.3- 0.44932 12.53374 P13.2
756 229659_s_at PIGR Polymerie BE501712 Hs.205126.1 NPJ302635 Chr.iq31-q41 0.44924 0.518167 immunoglobulin receptor
Nr. Aflymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
757 229797_at MCOLN3 mucolipin 3 AI636080 Hs.49344.1 NP 060768 Chr:1 p22.3 0.44923 4.75532
758 205638_at BAI3 brain-specific NM_001704 g4502358 NP_001695 Chr:6q12 0.44834 11.06357 angiogenesis inhibitor 3 /// brain-specific angiogenesis inhibitor 3
759 221507_at BG258639 Hs.278378.1 0.44821 0.095261
760 223938_at gl 2052909 0.44816 0.095261
761 213415_at CLIC2 chloride intracellular AI768628 Hs.54570.0 NP_001280 Chr:xq28 0.44789 1.702877 Channel 2
762 236296_x_at PDLIM2 PDZ and LIM domain 2 AW295176 Hs.197445.0 NP_067643 Chr:8p21.2 0.44731 0.095261 (mystique)
763 213285 at Hs.85335.0 0.44703 0.095261
764 228528_at — CDNA FLJ41270 fis, AI927692 Hs.290825.0 — — 0.44694 4.75532 clone BRAMY2036387
765 241544_at — Transcribed sequences R43301 Hs.22930.0 — — 0.44693 0.095261
766 241866_at SLC16A7 solute carrier family 16 AW975728 Hs.170504.0 NP_004722 Chr:12q13 0.4469 0.625663 (monocarboxyüc acid transporters), member 7
767 224461 s at AMID apoptosis-inducing BC006121 gl 3543963 NP_116186 Chr:10q22.2 0.44669 0.095261 factor (AIF)-Iike mitochondrion- associated inducer of death /// apoptosis- inducing factor (AIF)- like mitochondrion- associated inducer of
Figure imgf000060_0001
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change <0/-
768 239252 at Transcribed sequence AA911561 Hs.123679.0 0.44611 0.518167 with weak similarity to protein sp:P39194 (H.sapiens) ALU7_HUMAN AIu subfamily SQ sequence contamination warning entry
769 219213_at JAM2 junctional adhesion NM_021219 gl 0864028 NP_067042 Chr:21q21.2 0.44592 1.702877 moiecule 2 /// junctional adhesion moiecule 2
770 216912_at ARHGEF4 Rho guanine nucleotide AB029035 Hs.6066.2 NP_056135 Chr:2q22 0.44541 0.095261 exchange factor (GEF) 4
771 220835 s at ZNF407 zinc finger protein 407 NM_017757 g8923288 NP 060227 Chr:18q23 0.4452 1.051298
772 201041_s_at DUSP1 dual specificity NM_004417 g7108342 NP_004408 Chr:5q34 0.44502 0.095261 Phosphatase 1 /// dual O specificity Phosphatase 1
773 227551_at C9orf77 chromosome 9 open BE856596 Hs.91052.0 NP_057098 Chr:9q21.2 0.445 0.095261 reading frame 77
774 214638_s_at CCNT2 cyclin T2 AV681875 Hs.155478.2 NP 001232 Chr:2q21.3 0.44431 8.153992
775 222784_at SMOC1 SPARC related AJ249900 Hs.14144.0 NP_071420 Chr:14q24.1 0.44418 1.223189 modular calcium binding 1
776 227099_s_at LOC387763 hypothetical AW276078 Hs.127824.0 — Chr:11p11.2 0.44412 0.095261 LOC387763
777 217534_at BM-009 hypothetical protein AA845825 Hs.282721.0 NP_057707 Chr:8q24.21 0.44317 0.625663 BM-009
778 221246_x_at TNS tensin /// tensin /// NM_018274 gl 3775159 NP_072174 Chr.2q35-q36 0.44309 0.353669 tensin
779 232606_at — CDNA FLJ11832 fis, AK021894 Hs.146014.0 — — 0.44308 0.353669 clone HEMBA1006566
780 230958_s_at MRNA BE670797 Hs.12482.3 0.44302 0.095261
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
781 211598_x_at VIPR2 vasoactive intestinal U18810 gl 684934 NP_003373 Chr:7q36.3 0.44297 0.518167 peptide receptor 2 /// vasoactive intestinal peptide receptor 2
782 212730 at DMN desmuslin AK026420 Hs.10587.0 NP 056101 Chr:15q26.3 0.44291 2.08989
783 224832_at DUSP16 dual specificity AB051487 Hs.20281.0 NP_085143 Chr:12p13 0.44264 0.095261 Phosphatase 16
784 207761_s_at DKFZP586A0522 DKFZP586A0522 NM_014033 gl 3378140 NP_054752 Chr:12q13.13 0.44258 6.225758 protein
785 235979_at C7 complement AI697588 Hs.126528.0 NP_000578 Chr:5p13 0.44234 9.266777 component 7
786 225575_at AI680541 Hs.23767.2 0.44215 1.051298
787 226303_at Hs.46531.0 0.44199 1.380569
788 215008_at TLL2 tolloid-like 2 AA582404 Hs.154296.0 NP_036597 Chr:10q23-q24 0.44152 0.095261
789 244864 at Transcribed sequence W19283 Hs.169977.0 — 0.44118 11.55252 with weak similarity to protein sp:P39193 ON (H.sapiens) ALU6_HUMAN AIu subfamily SP sequence contamination warπing entry
790 243141_at D31421 Hs.62666.0 0.44077 2.08989
791 220398 at MGC4170 MGC4170 protein NM 024312 gl 3236550 NP 077288 Chr:12q23.3 0.44071 0.095261
792 221886_at KIAA1277 KIAA1277 AL037701 Hs.6385.0 — Chr:7q34 0.44032 3.612633
793 228098_s_at MYLIP myosin regulatory light AW292746 Hs.20072.2 NP. _037394 Chr:6p23-p22.3 0.43989 0.095261 chain interacting protein
794 230511_at CREM cAMP responsive AI800640 Hs.167916.0 NP. ,001872 Chr:10p11.21 0.43984 2.08989 element modulator
795 243278 at — Transcribed sequences AW291402 Hs.149057.0 — — 0.43975 3.306454
796 215726_s_at CYB5 cytochrome b-5 /// M22976 Hs.83834.2 NP. _001905 Chr:18q23 0.43923 0.095261 cytochrome b-5
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
797 20561 O_at MYOM1 myomesin 1 (skelemin) NM_003803 g4505312 NP_003794 Chr:18p11.32- 0.43923 4.436744 185kDa /// myomesin 1 p11.31 (skelemin) 185kDa
798 202746_at - ITM2A integral membrane AL021786 Hs.17109.0 NP_004858 Chr:xq13.3- 0.43858 1.380569 protein 2A xq21.2
799 208323_s_at ANXA13 annexin A13 /// annexin NMJD04306 g4757753 NP_004297 Chr:8q24.1- 0.43775 9.625715 A13 q24.2
800 201348_at GPX3 glutathione peroxidase NM_002084 g6006000 NP_002075 Chr:5q23 0.43775 2.489117 3 (plasma) /// glutathione peroxidase 3 (plasma)
801 23971 O_at — Transcribed sequences AA993515 Hs.99283.0 — — 0.43764 0.201325
802 239757_at Clone AA741493 Hs.143842.0 0.43687 0.095261 IMAGE:4716331 , mRNA
803 209335_at DCN decorin AI281593 Hs.76152.1 NP_001911 Chr:12q13.2 0.43665 1.380569
804 228376_at a1/3GTP alpha-1 ,3- AI972498 Hs.97469.0 Chr:9q34.11 0.43647 0.201325 galactosyltransferase pseudogene
805 236396_at — Transcribed sequences AW051952 Hs.136591.0 — — 0.43642 0.518167
806 202063_s_at SEL1L sel-1 suppressor of lin- AB020335 g6518494 NP_005056 Chr:14q24.3- 0.43601 0.095261 12-like (C. elegans) q31
807 241337_at Hypothetical AI498602 Hs.157864.0 Chr:10q11.21 0.43587 0.095261 LOC283034 (LOC283034), mRNA
808 217442_at Hs.274514.0 0.43578 0.353669
809 205357_s_at AGTR1 angiotensin Il receptor, NMJJ00685 g6715581 NP_000676 Chr:3q21-q25 0.43559 0.353669 type 1 /// angiotensin Il receptor, type 1
810 213992_at COL4A6 Collagen, type IV, alpha AI889941 Hs.408.2 NP_001838 Chr:xq22 0.43555 0.518167 6
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
811 203408„s_at SATB1 special AT-rich NM002971 g4506790 NP_002962 Chr:3p23 0.4354 0.095261 sequence binding protein 1 (binds to nuciear matrix/scaffold- associating DNA's) /// special AT-rich sequence binding protein 1 (binds to nuciear matrix/scaffold- associating DNA's)
812 223395_at TARSH target of Nesh-SH3 AB056106 gl 3111479 NP 056244 Chr:3q12 0.43473 11.55252
813 229485_x_at LOC152573 hypothetical protein AI735586 Hs.103819.0 — Chr:4p14 0.43456 2.489117 BC012029
814 225817_at Hs.10119.0 0.43372 0.095261
815 220832_at TLR8 toil-like receptor 8 /// NM_016610 g7706147 NP_057694 Chr:xp22 0.43345 1.051298 σ
Figure imgf000064_0001
\ toll-like receptor 8
816 204497_at ADCY9 adenylate cydase 9 /// AB011092 Hs.20196.0 NP_001107 Chr:16p13.3 0.43344 0.095261 adenylate cyclase 9
817 240379_at — Transcribed sequences AA845608 Hs.132860.0 — — 0.4332 0.095261
818 213541_s_at ERG v-ets erythroblastosis AI351043 Hs.279477.0 NP_004440 Chr:21q22.3 0.43295 0.149911 virus E26 oncogene like (avian)
819 221667_s_at g5901654 0.43247 2.489117
820 223315 at NTN4 netrin 4 AF278532 gl 1120047 NP 067052 Chr:12q22-q23 0.4321 0.095261
821 209708_at MOXD1 monooxygenase, DBH- AY007239 g9988949 NP_056344 Chr:6q23.1-23.3 0.43172 1.380569 iϊke 1
822 210692_s_at SLC43A3 solute carrier family 43, BC003163 gl 3111980 NPJ554815 Chr:11q11 0.43168 0.353669 member 3
823 204381_at LRP3 low density lipoprotein NM_002333 g4505014 NP_002324 Chr:19q13.12 0.43086 11.70204 receptor-related protein 3 /// low density lipoprotein receptor- related protein 3
824 234497_s_at CDNA FLJ12051 fis, AK022113 Hs.301858.1 0.43078 0.095261 clone HEMBB1002005
-• Affymetrix Gensymbol Genname Repräsentative Transkrtpt ID Repräsentative Chromosomale FoId q-value Probennummer IO Protein ID Lokalisierung Change
825 232449_at BCDO2 beta-caroteπe AV710838 Hs.181795.0 NPJ 14144 Chr:11q22.3- 0.43064 0.779487 dioxygenase 2 q23.1
826 204796at EML1 echinoderm AI825937 Hs.12451.0 NPJ504425 Chr:14q32 0.43063 0.353669 microtubuie associated protein üke 1
827 227702_at CYP4X1 cytochrorne P450, M557324 Hs.26040.0 NP_828847 Chr:1p33 0.42887 0.518167 family 4, subfamily X, Polypeptide 1
828 229649_at NRXN3 neurexirt 3 AH 29949 Hs.22269.1 NP 004787 Chr;14q31 0.42851 1.901012
829 217044_s_at KIAA0599 KIAA0599 BC004298 Hs.198037.2 — Chr:14q23.3 0.42798 0.095261
830 211039 at CHRNA1 choünergic receptor, BC006314 gl 3623428 NP_000070 Chr:2q24-q32 0.42767 0.095261 nicotinic, alpha Polypeptide 1 (muscle) /// choünergic receptor, nicotinic, alpha Polypeptide 1 (muscle)
831 217022_s_at MGC27165 hypothetical protein S55735 Hs.293441.3 — Chr:14q32.33 0.42742 2.814919 MGC27165
832 228218 at Hs.26409.0 0.427 0.353669
833 226145 s at Hs.15420.1 0.4262 9.266777
834 235494_at Clone AA702209 Hs.288405.0 -- 0.42595 13.5285 IMAGE:5278074, mRNA
835 234978_at SLC36A4 solυte carrier famüy 36 AL542358 Hs.292653.0 NP_689526 Chr:11q14.3 0.42564 0.095261 (proton/amino acid symporter), rnember 4
836 220446 s at CHST4 carbohydrate (N- NMJ305769 g5031734 NP_005760 Chr:16q22.2 0.42547 3.612633 acetylglucosamine 6-0) sulfotransferase 4 /// carbohydrate (N- acetylglυcosamine 6-0) sulfotransferase 4
837 241365„at — CDNA FLJ42259 fis, AA002140 Hs.33024.0 — — 0.42543 0.518167 clone TKIDN2011289
838 224703__at WDR22 WD repeat domain 22 AI814644 Hs.284294.0 — Cnr:14q23~ 0.42512 0.095261 q24.1
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
839 224973_at C6orf37 chromosome 6 open AL078599 Hs.10784.3 NP_060103 Chr:6q14 0.42454 0.779487 reading frame 37
840 234488_s_at GMCL1L germ cell-less homolog AF198534 Hs.302032.0 NP_071916 Chr:5q35.3 0.42396 1.051298 1 (Drosophila)-Iike
841 204688_at SGCE sarcoglycan, epsilon /// NM_003919 gl 0835046 NP_003910 Chr:7q21-q22 0.42325 0.095261 sarcoglycan, epsilon
842 227669_at — Transcribed sequences AI654636 Hs.5794.0 — — 0.42286 0.149911
843 219873_at COLEC11 collectin sub-family NM_024027 gl 3128971 NP_076932 Chr:2p25.3 0.42255 8.779357 member 11
844 206876_at AL121948 Hs.105925.0 0.4224 2.571322
845 202967_at GSTA4 glutathione S- NM_001512 g4504172 NP_001503 Chr:6p12.1 0.42234 0.095261 transferase A4 /// glutathione S- transferase A4
846 207220_at DO Dombrock blood group NM_021071 gl 2711661 NP_066549 Chr:12q13.2- 0.42215 0.518167 /// Dombrock blood q13.3 group
847 207367 at ATP12A ATPase, H+/K+ NM_001676 gl 0280617 NPJ301667 Chr.13q11- 0.42202 0.353669 Ul transporting, q12.1 nongastric, alpha Polypeptide /// ATPase, H+/K+ transporting, nongastric, alpha Polypeptide
848 201914_s_at SEC63 SEC63-Iike (S. AK001465 Hs.31575.0 NP. _009145 Chr:6q21 0.42141 0.095261 cerevisiae)
849 225539_at PRDM15 PR domain containing AP001745 Hs.157079.0 NP_ _071398 Chr:21q22.3 0.4214 0.149911 15
850 215440_s_at BEXL1 brain expressed X- AL523320 Hs.184736.1 — Chr:xq22.1- 0.42099 4.830969 linked-like 1 q22.3
851 210613 s at SYNGR1 synaptogyrin 1 BC000731 gl 2653878 NP 004702 Chr.22q13.1 0.42089 3.612633
852 216209 at Hs.39337.0 0.42084 0.353669
853 206068_s_at ACADL acyl-Coenzyme A AI367275 Hs.1209.0 NP_ JD01599 Chr:2q34-q35 0.42073 11.06357 dehydrogenase, long chain
854 238778_at AI244661 Hs.103296.0 0.42036 0.201325
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change
855 242358_at CDNA FLJ35666 fis, AW024656 Hs.233382.0 — — 0.41986 0.095261 clone SPLEN2017781
856 239218_at Clone AI800515 Hs.12024.0 0.41979 2.489117 IMAGE:5288238, mRNA
857 226806 s at MRNA AW022607 Hs.12482.1 0.41976 0.095261
858 204894 s at AOC3 amine oxidase, copper NM_003734 g6806883 NP_003725 Chr:17q21 0.41945 3.62324 containing 3 (vascular adhesion protein 1) /// amine oxidase, copper containing 3 (vascular adhesion protein 1)
859 241386 at — — AW270845 Hs.133459.0 — — 0.41943 1.051298
860 211734_s_at gl 3543505 0.41886 6.225758
861 232090_at — CDNA FLJ11481 fis, . AI761578 Hs.135159.0 — — 0.41842 1.901012 clone HEMBA1001803
862 205898_at CX3CR1 chemokine (C-X3-C U20350 g665580 NP_001328 Chr:3p21.3 0.41833 1.901012 motif) receptor 1 /// chemokine (C-X3-C motif) receptor 1
863 223475 at LOC83690 CocoaCrisp AF142573 gl 2002310 NP 113649 Chr:8q13.3 0.41826 0.779487
864 233051_at SLITRK2 SLIT and NTRK-Iike AL109653 Hs.21527.0 NPJ 15928 Chr:xq27.3 0.41823 0.095261 family, member 2
865 235019_at CPM carboxypeptidase M BE878495 Hs.267158.0 NP 001865 Chr:12q14.3 0.4178 1.223189
866 220136_s_at CRYBA2 crystallin, beta A2 /// NM_005209 g7019356 NP_005200 Chr:2q34-q36 0.41707 0.095261 crystailin, beta A2
867 214983_at Hs.45068.0 0.41676 0.518167
868 213317_at Hs.21103.0 0.41654 0.149911
869 238066_at RBP7 retinoi binding protein AI733027 Hs.292718.0 NP_443192 Chr:1p36.22 0.41652 2.489117 7, cellular
870 51226_at LOC389677 simiiar to RIKEN cDNA N53536 4871749_RC NP_976324 Chr:8q22.1 0.416 0.149911 3000004N20
871 205414_s_at KIAA0672 KIAA0672 gene NM_014859 g7662241 — Chr:17p12 0.41542 8.153992 product
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change
872 219718_at FLJ 10986 hypothetical protein NMJD18291 g8922805 NP_060761 Chr:1 p32.1 0.41507 4.436744 FLJ10986
873 221627_at gl 2407414 0.41497 0.518167
874 215369_at — CDNA FLJ11396 fis, AU145354 Hs.287411.0 — — 0.41483 0.095261 clone HEMBA1000604
875 229544_at Clone AI690169 Hs.132882.0 0.41357 0.095261 IMAGE-.5315196, mRNA
876 207179_at TLX1 T-cell leukemia, NM_005521 g5031756 NP__005512 Chr:10q24 0.41323 0.201325 homeobox 1 /// T-cell leukemia, homeobox 1
877 203697_at FRZB frizzled-related protein U91903 gl 917006 NP_001454 Chr:2qter 0.41314 3.306454 /// frizzled-related protein
878 207468_s_at SFRP5 secreted frizzled- NM_003015 g8400734 NP_003006 Chr:10q24.1 0.41279 0.095261 related protein 5 /// secreted frizzled- related protein 5 9\ -4
879 241934 at HNT neurotrimin BF378300 Hs.318494.0 NP 057606 Chr:11q25 0.41248 0.095261
880 203088_at FBLN5 fibulin 5 /// fibulin 5 NM_006329 g5453649 NP_006320 Chr:14q32.1 0.41243 0.779487
881 226492 at SEMA6D sema domaiπ, AL036088 Hs.191098.0 NPJ)65909 Chr:15q15.2 0.41123 13.5285 transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
882 207051 at SLC17A4 solute carrier family 17 NM_005495 g4885440 NPJ305486 Chr.6p22-p21.3 0.41121 3.612633
(sodium phosphate), member 4 /// solute carrier family 17 (sodium phosphate), member 4
883 235761. _at — CDNA FLJ36553 fis, BG111808 Hs.167167.0 — — 0.41066 0.353669 clone TRACH2008478
884 205328. .at CLDMO claudin 10 /// claudin 10 NM 006984 g5921464 NP_008915 Chr:13q31-q34 0.41062 0.095261
885 229691. _at CDNA FLJ43013 fis, BF221887 Hs.170853.0 — Chr:14q32.33 0.41042 13.5285 clone BRTHA2016215
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change
886 214321_at NOV nephroblastoma BF440025 Hs.235935.1 NP_002505 Chr:8q24.1 0.41027 11.70204 overexpressed gene
887 229530 at — Transcribed sequences BF002625 Hs.143691.0 — — 0.41012 0.779487
888 207067_s_at HDC histidine decarboxylase NM_002112 g4504364 NP_002103 Chr:15q21-q22 0.40954 0.518167 /// histidine decarboxylase
889 221287 at RNASEL ribonuclease L (2',5'- NM_021133 gl 0863928 NP_066956 Chr:1q25 0.40937 0.095261 oügoisoadenylate synthetase-dependent)
/// ribonuclease L (2',5'- oligoisoadenylate synthetase-dependent)
890 225990 at BOC brother of CDO W72626 Hs.153961.2 NP. 150279 Chr:3q13.2 0.40844 1.380569
891 239113 at — Transcribed sequences AV749665 Hs.130531.0 — — 0.40826 0.353669
892 203799. _at DCL-1 type I transmembrane NM_014880 g7661867 NP. J355695 Chr:2q24.2 0.40795 0.095261 C-type lectin receptor DCL-1
893 207869. _s_at CACNA1G calcium Channel, NM_018896 g9256522 NP. .061496 Chr:17q22 0.40751 0.149911 voltage-dependent, alpha IG subunit
894 202732 at PKIG protein kinase (cAMP- NM_007066 . g5902019 NP_008997 Chr:20q12- 0.40694 0.095261 dependent, catalytic) q13.1 inhibitor gamma /// protein kinase (cAMP- dependent, catalytic) inhibitor gamma
895 229661. jat SALL4 sal-like 4 (Drosophila) NM. 020436 Hs.189095.0 NP. .065169 Chr:20q13.13- 0.40678 0.625663 q13.2
896 201236. _s_at BTG2 BTG family, member 2 NM. .006763 g5802987 NP. J306754 Chr:1q32 0.40402 0.625663 /// BTG family, member 2
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
897 207391 s at PIP5K1A phosphatidylinositol-4- NM_003557 g4505814 NP_003548 Chr:1q22-q24 0.4039 2.571322 phosphate 5-kinase, type I, alpha /// phosphatidylinositol-4- phosphate 5-kinase, type I, alpha
898 204134 at PDE2A Phosphodiesterase 2A, NM_002599 g4505656 NP_002590 Chr:11q13.3 0.40378 0.095261 cGMP-stimulated /// Phosphodiesterase 2A, cGMP-stimulated
899 236016 at SMARCE1 SWI/SNF reiated, AI702962 Hs.127211.0 NP_003070 Chr:17q21.2 0.40366 0.095261 matrix associated, actin dependent regulator of chromatin, subfamily e, member 1
900 227478_ _at BF739885 Hs.128052.0 0.40337 0.149911
901 219948. _x_at FLJ21934 hypothetical protein NM_024743 gl 3376065 NP. _079019 Chr:4q13.3 0.40312 1.380569 FLJ21934
902 225557. _at Hs.6607.0 0.40255 0.095261
903 201061. s_at STOM stomatin M81635 g181183 NP. _004090 Chr:9q34.1 0.40207 0.095261
904 230786 at Transcribed sequence AI424786 Hs.99298.0 0.40173 0.353669 with moderate similarity to protein sp:P39188
(H.sapiens)
ALU1_HUMAN AIu subfamily J sequence contamination warning entry
905 230624_ .at SLC25A27 solute carrier family 25, AW779950 Hs.145008.0 NP_004268 Chr:6p11.2-q12 0.40159 9.266777 member 27
906 203129_ _s_at KIF5C kinesin family member BF059313 Hs.6641.0 Chr:2q23.3 0.40149 1.380569 5C
907 209612 _s_at ADH1 B alcohol dehydrogenase M24317 gl 78097 NP_000659 Chr:4q21-q23 0.40139 8.153992 IB (class I), beta Polypeptide
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
908 236235_at ITCH itchy homolog E3 AA868238 Hs.128713.0 NP_113671 Chr:20q11.22- 0.40115 0.779487 ubiquitin protein ligase q11.23 (mouse)
909 216594_x_at Hs.306098.1 0.40108 0.149911
910 213872_at C6orf62 chromosome 6 open BE465032 Hs.173685.1 NPJ 12201 Chr:6p22.1 0.40089 0.625663 reading frame 62
911 214416_at — — AA654415 Hs.322808.0 — — 0.40067 3.612633
912 236222 at AAT1 AAT1 -alpha N62817 Hs.48643.0 NP 203528 Chr:3q12-q13.3 0.40051 6.023405
913 230867 at AI742521 Hs.120388.0 0.40046 1.380569
914 244455_at SLICK sodium- and chloride- AI732637 Hs.277901.0 NP_940905 Chr:1q31.2 0.40029 0.518167 activated ATP-sensitive potassium Channel
915 201842_s_at EFEMP1 EGF-containing fibulin- AI826799 Hs.76224.0 NPJD04096 Chr:2p16 0.40016 0.149911 like extracellular matrix protein 1
916 240253 at — Transcribed sequences BF508634 Hs.210775.0 — — 0.39999 11.55252
917 209170_s_at GPM6B glycoprotein M6B AF016004 g3387766 NP 005269 Chr:xp22.2 0.39961 4.174189
918 229228_at — CDNA FLJ32589 fis, AI819043 Hs.21342.0 — — 0.39931 0.149911 clone SPLEN2000443
919 225207_at PDK4 pyruvate AV707102 Hs.8364.0 NPJD02603 Chr:7q21.3- 0.39816 11.55252 dehydrogenase kinase, q22.1 isoenzyme 4
920 217525_at UNQ564 MVAL564 AW305097 Hs.47974.0 NP 940876 Chr:11p15.4 0.39735 0.201325
921 219832_s_at HOXC13 homeo box C13 /// NM_017410 g8393553 NP_059106 Chr:12q13.3 0.39708 0.095261 homeo box C13
922 218312_s_at FLJ 12895 hypothetical protein NMJ323926 gl 2965194 NP_076415 Chr:19q13.43 0.39693 8.779357 FLJ12895
923 232855_at MRNA füll length insert AL360204 Hs.283853.0 0.39647 0.095261 cDNA clone EUROIMAGE 980547
924 239911_at — Transcribed sequences H49805 Hs.246005.0 — — 0.39607 1.051298
925 214844_s_at Hs.78006.0 0.39516 6.991358
926 244592_at — Transcribed sequences BE675040 Hs.208603.0 — — 0.39403 1.051298
927 205407_at NM_021111 gl 1863155 0.39347 1.051298
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-vaiue Probennummer ID Protein ID Lokalisierung Change (%)
928 228370_at SNRPN small nuclear BF114870 Hs.58606.1 NP_003088 Chr:15q12 0.39335 0.095261 ribonucleoprotein Polypeptide N
929 206002_at GPR64 G protein-coupled NMJ)05756 g5031732 NP_005747 Chr:xp22.22 0.39296 0.353669 receptor 64 /// G protein-coupled receptor 64
930 211590_x_at TBXA2R thromboxaπe A2 U11271 g511793 NPJ)OI 051 Chr:19p13.3 0.39263 0.095261 receptor
931 225987 at AA650281 Hs.11177.0 0.39224 0.095261
932 212230_at PPAP2B phosphatidic acid AV725664 Hs.173717.0 NP_003704 Chr:1pter-p22.1 0.39217 0.095261 Phosphatase type 2B
933 235438_at AW162011 Hs.146226.0 0.39152 0.353669
934 210198 s at PLP1 proteolipid protein 1 BC002665 gl 2803660 NP_000524 Chr:xq22 0.39085 2.814919 (Pelizaeus-Merzbacher disease, spastic paraplegia 2, uncomplicated) /// proteolipid protein 1 (Pelizaeus-Merzbacher disease, spastic paraplegia 2, uncomplicated)
935 227762 at ZNF145 zinc finger protein 145 AW244016 Hs.22971.0 NP_005997 Chr:11q23.1 0.39014 0.779487 (Kruppel-like, expressed in promyelocytic leukemia)
936 230271. _at — CDNA FLJ42567 fis, BG150301 Hs.127039.0 — — 0.38948 0.095261 clone BRACE3007559
937 206406. _at MCSP mitochondrial capsule NM_030663 gl 3489057 NP_109588 Chr:1q21.3 0.38937 0.095261 selenoprotein /// mitochondrial capsule
Figure imgf000072_0001
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer IP Protein ID Lokalisierung Change
938 206410 at NR0B2 nuclear receptor NM_021969 gl 3259502 NP_068804 Chr:1p36.1 0.38927 8.153992 sυbfamily 0, group B, member 2 /// nuclear receptor subfamily 0, group B, member 2
939 224215 s at DLL1 delta-like 1 AF196571 g6180181 NP_005609 Chr:6q27 0.38906 1.051298 (Drosophila)
940 203543 s at BTEB1 basic transcriptioπ NM_001206 g4557374 NP_001197 Chr:9q13 0.38896 0.518167 element binding protein 1 /// basic transcription element binding protein 1
941 218532. _s_at FLJ20152 hypothetical protein NM_019000 g9506660 NP. .061873 Chr:5p15.1 0.3885 0.095261 FLJ20152
942 232267 _at Hs.158258.0 0.38839 0.518167
943 237628. _at — Transcribed sequences BF196209 Hs.245842.0 — — 0.38831 0.095261
944 235561 _at — Transcribed sequences T16544 Hs.291005.0 — — 0.38822 9.266777
945 222071. _s_at SLCO4C1 solute carrier organic BE552428 Hs.127648.1 NP. .060985 Chr:5q21.2 0.38795 4.436744 κ1 anion transporter family, member 4C1
946 238747_ _at Clone R45692 Hs.90242.0 0.3876 0.095261 IMAGE:4796172, mRNA
947 238329. _at M-RIP myosin phosphatase- BE545235 Hs.159336.0 NP. .055949 Chr:17p11.2 0.38675 0.095261 Rho interacting protein
948 205609. _at ANGPT1 angiopoietin 1 NM 001146 g4502086 NP 001137 Chr:8q22.3-q23 0.38673 0.095261
949 208853. _s_at CANX calnexin L18887 g306480 NP. .001737 Chr:5q35 0.38477 0.095261
950 237400 at ATP5S ATP synthase, H+ AI308101 Hs.22978.0 NP_056499 Chr:14q22.1 0.38473 0.149911 transporting, mitochondrial FO complex, subunit s (factor B)
951 211479 s at HTR2C 5-hydroxytryptamine M81778 g338027 NP_000859 Chr:xq24 0.38471 5.685182 (Serotonin) receptor 2C /// 5-hydroxytryptamine (Serotonin) receptor 2C
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change
952 210299_s_at FHL1 four and a half LIM AF063002 g3859848 NP_001440 Chr:xq26 0.38428 1.380569 domains 1
953 212372_at MYH10 myosin, heavy AK026977 Hs.296842.0 NP_005955 Chr:17p13 0.38427 1.051298 Polypeptide 10, non- muscle
954 222885_at EMCN endomucin AF205940 g8547214 NP 057326 Chr:4q23 0.38355 0.095261
955 202054 s at ALDH3A2 aldehyde NM_000382 g4557302 NP_000373 Chr:17p11.2 0.38315 0.095261 dehydrogenase 3 family, member A2 /// aldehyde dehydrogenase 3 family, member A2
956 205979_at SCGB2A1 secretoglobin, family NM_002407 g4505170 NP_002398 Chr:11q13 0.38241 1.901012 2A, member 1 /// secretoglobin, family 2A, member 1
957 227497_at CDNA FLJ 11723 fis, BE326808 Hs.196008.0 0.38213 11.55252 clone HEMBA1005314 -4
958 221541 at gl 2053226 0.38167 0.149911
959 221031_s_at DKFZP434F0318 hypothetical protein NM_030817 gl 3540611 NPJ 10444 Chr:12p13.2 0.38133 0.095261 DKFZp434F0318 /// hypothetical protein DKFZp434F0318
960 204621_s_at NR4A2 nuclear receptor AI935096 Hs.82120.0 NP_006177 Chr:2q22-q23 0.38005 0.518167 subfamily 4, group A, member 2
961 241505 at — BF513468 Hs.196779.0 — — 0.37953 0.353669
962 32502_at PP1665 hypothetical protein AL041124 4922580_RC NPJ 10419 Chr:11q13.3 0.37813 0.095261 PP1665
963 216675_at — AK000834 Hs.306409.0 — — 0.37809 0.095261
964 204115 at GNG11 guanine nucleotide NM_004126 g4758447 NP_004117 Chr:7q31-q32 0.37604 0.095261 binding protein (G protein), gamma 11 /// guanine nucleotide binding protein (G protein), gamma 11
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
965 204151_x_at g5453542 0.37405 0.201325
966 39248_at AQP3 aquaporin 3 N74607 4855867 RC NP 004916 Chr:9p13 0.37169 0.095261
967 239349_at BE856929 Hs.50636.0 0.37048 0.095261
968 238919 at R49295 Hs.24886.0 0.37036 0.353669
969 238481_at MGP matrix GIa protein AW512787 Hs.313944.0 NP_000891 Chr:12p13.1- 0.3699 4.640066 P12.3
970 241302 at — Traπscribed sequences AI654048 Hs.196556.0 — — 0.36984 1.702877
971 221463_at CCL24 chemokine (C-C motif) NMJD02991 g4506838 NP_002982 Chr:7q11.23 0.36944 1.702877 ligaπd 24 /// chemokine (C-C motif) ligand 24
972 219440_at RAI2 retinoic acid induced 2 NM_021785 gl 2056469 NP_068557 Chr:xp22 0.36869 0.095261 /// retinoic acid induced 2
973 216728_at Hs.306520.0 0.36825 0.095261
974 217533 x at Transcribed sequence AW268081 Hs.193408.0 0.36792 0.149911 with moderate similarity to protein -4
4- ref:NP_060312.1
(H.sapiens) hypothetical protein
FLJ20489 [Homo sapiens]
975 220971_at IL17E interleukin 17E /// NM_022789 gl 2232484 NP. _073626 Chr:14q11.2 0.36763 0.095261 interleukin 17E
976 231511_at FRAS1 Fräser Syndrome 1 AI681772 Hs.15420.0 NP 065926 Chr:4q21.21 0.36693 0.095261
977 235774_at — CDNA FLJ42409 fis, AV699047 Hs.94946.0 — — 0.3668 9.266777 clone BLADE2000866
978 209687_at CXCL12 chemokine (C-X-C U 19495 gl 754834 NP. _000600 Chr:10q11.1 0.36648 11.06357 motif) ligand 12 (stromal cell-derived factor 1 )
979 214761_at ZNF423 zinc finger protein 423 AW149417 Hs.137168.0 NP. 055884 Chr:16q12 0.36637 3.62324
980 205907_s_at OMD osteomodulin AI765819 Hs.94070.0 NP. 005005 Chr:9q22.32 0.36637 3.62324
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
981 209815_at CDNA FLJ42602 fis, BG054916 Hs.159526.0 0.3656 0.353669 clone BRACE3011271 , moderately similar to Patched protein
982 204955_at SRPX sυshi-repeat-containing NM_006307 g5454085 NP_006298 Chr:xp21.1 0.36484 0.353669 protein, X-linked /// sushi-repeat-containing protein, X-linked
983 232593_at LOC93082 hypothetical protein AL389981 Hs.149219.0 NP_612406 Chr:2q11.2 0.36414 1.380569 BC012317
984 207859 s at CHRNB3 cholinergic receptor, NM_000749 g4502834 NP_000740 Chr:8p11.2 0.36377 3.612633 nicotinic, beta Polypeptide 3 /// cholinergic receptor, nicotinic, beta Polypeptide 3
985 203016_s_at SSX2IP synovial sarcoma, X AK001710 Hs.22587.0 NP. _054740 Chr:1p22.3 0.36292 13.40329 breakpoint 2 interacting -4 protein
986 239657_x_at . FOXO6 forkhead box protein AI341823 Hs.133066.0 — Chr:1 p34.1 0.3626 0.353669 06
987 210751_s_at RGN regucalcin (senescence D31815 gl 072311 NP_ .004674 Chr:xp11.3 0.3626 0.095261 marker protein-30) /// regucalcin (senescence marker protein-30)
988 203498_at DSCR1L1 Down Syndrome critical NM_005822 g5032234 NP_ .005813 Chr:6p21.1 0.3626 8.779357 region gene 1-like 1 /// Down Syndrome critical region gene 1-like 1
989 230560 at N21096 Hs.22588.0 0.36177 6.023405
990 228694_at Clone BE670036 Hs.16886.0 0.36177 0.095261 IMAGE:3352913, mRNA
991 211143_x_at NR4A1 nuclear receptor D49728 gl 813881 NP_ _002126 Chr:12q13 0.36113 0.518167 subfamily 4, group A, member 1
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
992 228692_at — CDNA FLJ41396 fis, N63377 Hs.169943.0 — — 0.36084 0.201325 clone BRCOC2019255
993 219230_at FLJ10970 hypothetical protein NM_018286 g8922795 NP_060756 Chr:17q23.1 0.36058 3.612633 FLJ10970
994 202173_s_at ZNF161 zinc finger protein 161 NM_007146 g6005967 NP 009077 Chr:17q23.2 0.36026 0.625663
995 226495_at KIAA1271 KIAA1271 protein BE727883 Hs.183669.0 NP 065797 Chr:20p13 0.36014 0.095261
996206726 at PGDS Prostaglandin D2 NMJD14485 g7657456 NP_055300 Chr:4q22.3 0.36012 11.70204 synthase, hematopoietic /// Prostaglandin D2 synthase, hematopoietic
997 236277 at H23551 Hs.30974.0 0.36011 0.353669
998 204560_at FKBP5 FK506 binding protein NM_004117 g4758383 NP_004108 Chr:6p21.3-21.2 0.35973 0.095261 5 /// FK506 binding protein 5
999 238527_at CDNA clone BG106878 Hs.204724.0 0.35962 0.095261 -4 IMAGE:4779711 , partial cds
1000 209699_x_at g531159 0.35825 0.353669
1001 224355 s at MS4A8B membrane-spanning 4- AF237905 g13649389 NP_113645 Chr:11q12.2 0.35802 0.201325 domains, subfamily A, member 8B ///
3 1
Figure imgf000077_0001
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
1004 206336 at CXCL6 chemokine (C-X-C NM_002993 g4506850 NP_002984 Chr:4q21 0.35674 0.625663 motif) ligand 6 (granulocyte chemotactic protein 2) /// chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2)
1005 228724_at Clone N49237 Hs.22542.0 0.35659 6.023405 IMAGE-.5312516, mRNA
1006 227758_at RERG RAS-like, estrogen- AW294092 Hs.21594.0 NP_116307 Chr:12p13.1 0.35548 0.095261 regulated, growth inhibitor
1007 205498_at GHR growth hormone NM_000163 g4503992 NP_000154 Chr:5p13-p12 0.3554 0.353669 receptor /// growth hormone receptor
1008 242342_at — CDNA FLJ40823 fis, BE645219 Hs.134863.0 — — 0.35536 0.095261 clone TRACH2011093
1009 229465_s_at PTPRS protein tyrosine BF433071 Hs.294141.1 NP_002841 Chr:19p13.3 0.35433 4.75532 Phosphatase, receptor type, S
1010 203881 s at DMD dystrophin (muscular NM_004010 g5032314 NP_000100 Chr:xp21.2 0.35415 0.149911 dystrophy, Duchenne and Becker types) /// dystrophin (muscular dystrophy, Duchenne and Becker types)
1011 229199 at Transcribed sequence BE856807 Hs.13132.0 0.3537 0.353669 with weak similarity to protein sp:P39188 (H.sapiens) ALUIJHUMAN AIU subfamily J sequence contamination waming entry
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change /0/
1012 221293 s at DEF6 differentially expressed NMJ022047 gl 1545748 NP_071330 Chr:6p21.33- 0.35342 0.095261 in FDCP 6 homolog p21.1 (mouse) /// differentially expressed in FDCP 6 homolog (mouse)
1013 215237, _at DOCK9 dedicator of cytokinesis AW450751 Hs.8021.1 NP. J056111 Chr:13q32.3 0.35316 0 .149911 9
1014 227182, _at SUSD3 sushi domain AW966474 Hs.88417.0 NP. _659443 Chr:9q22.32 0.35279 1 .051298 containing 3
1015 207210 at GABRA3 gamma-aminobutyric NM_000808 g4557602 NP_000799 Chr:xq28 0.35258 0.149911 acid (GABA) A receptor, alpha 3 /// gamma-am inobutyric acid (GABA) A receptor, alpha 3
1016 213156_at Hs.16193.0 0.35249 0.518167
1017 230003_at Transcribed sequences AW779917 Hs.88156.0 0.35197 0.095261 -4
1018 225996_at Hs.21380.0 0.3507 6.023405
1019 204697 s at CHGA chromogranin A NM_001275 g10800418 NP_001266 Chr:14q32 0.34944 2.08989 (parathyroid secretory protein 1) /// chromogranin A (parathyroid secretory protein 1 )
1020 226992. _at NOSTRIN nitric oxide synthase AK002203 Hs.10260.0 NP 443178 Chr:2q31.1 0.34873 0.095261 trafficking
1021 231308. _at ANKFY1 ankyrin repeat and BG055427 Hs.301721.0 NP_057460 Chr:17p13.3 0.34793 0.095261 FYVE domain containing 1
1022 231925. _at CDNA: FLJ23006 fis, AK026659 Hs.79881.0 — 0.34529 9.266777 clone LNG00414
1023 227088. _at CDNA FLJ42757 fis, BF221547 Hs.16578.0 — Chr:4q27 0.34501 0.095261 clone BRAWH3001712
1024 220084. _at C14orf105 chromosome 14 open NM_018168 g8922570 NP_060638 Chr:14q22.3 0.34467 1.051298 reading frame 105
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
1025 226974 at Transcribed sequence AL536553 Hs.3731.0 0.34446 0.095261 with weak similarity to protein sp:P39193
(H. sapiens)
ALU6_HUMAN AIu subfamily SP sequence contamination warning entry
1026 235183_at Clone A1479277 Hs.151275.0 0.34115 1.702877 IMAGE:5312689, mRNA
1027 221874_at KIAA1324 mabal AB037745 Hs.104696.0 NP. _065826 Chr:1p13.3- 0.34005 0.095261 p13.2
1028 242496_at — CDNA FLJ23728 fis, T57776 Hs.191094.0 — — 0.34001 0.779487 clone HEP14243
1029 231015 at KLF15 Kruppel-like factor 15 AW014734 Hs.157969.0 NP 054798 Chr:3q13-q21 0.33982 0.353669
1030 232277_at SLC28A3 solute carrier family 28 AA643687 Hs.149425.0 NP. .071410 Chr:9q22.2 0.33924 1.901012 (sodium-coupled -4 nucleoside transporter), member 3
1031 229222 at FLJ21963 FLJ21963 protein AI123815 Hs.16602.0 NP 078836 Chr:12q21.31 0.33908 0.149911
1032 211682 x at UGT2B28 UDP AF177272 gl 3603475 NP_444267 Chr:4q13.3 0.33886 6.991358 glycosyltransferase 2 family, Polypeptide B28 /// UDP glycosyltransferase 2 family, Polypeptide B28
1033 230130_at SLIT2 slit homolog 2 AI692523 Hs.110373.1 NP. _004778 Chr:4p15.2 0.33729 0.625663 (Drosophila)
1034 232136_s_at CORTBP2 cortactin binding AB051545 Hs.293539.0 NP. ,219499 Chr:7q31 0.33673 1.051298 protein 2
1035 221172_at FLJ21075 hypothetica! protein NM_025031 gl 3376555 NP. _079307 Chr:7p12.3 0.3367 0.095261 FLJ21075
1036 206070 s at EPHA3 EphA3 /// EphA3 AF213459 gl 2003434 NP 005224 Chr:3p11.2 0.33646 0.353669
1037 242346_x_at — — BF222929 Hs.290585.0 — — 0.33563 0.201325
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-vaiue Probennummer ID Protein ID Lokalisierung Change (%)
1038 209291_at ID4 inhibitor of DNA binding AW157094 Hs.34853.0 NPJ301537 Chr:6p22-p21 0.33561 0.095261 4, dominant negative helix-ioop-helix protein
1039 209960_at Hs.809.0 0.33552 0.095261
1040 231031 at Similar to keratinocyte AI761573 Hs.164568.1 — Chr:9q21.11 0.33452 1.223189 growth factor-like protein, group IiI - human (LOC401517), mRNA
1041 220334_at RGS17 regulator of G-protein NM_012419 g8394185 NP_036551 Chr:6q25-q26 0.3318 10.20301 signalling 17 /// regulator of G-protein signailing 17
1042 201739_at SGK serum/glucocorticoid NM_005627 g5032090 NP_005618 Chr:6q23 0.3307 0.095261 regulated kinase /// serum/glucocorticoid regulated kinase
1043 207820 at ADH1A alcohol dehydrogenase NM_000667 gl 1496886 NPJ000658 Chr:4q21-q23 0.33061 0.149911 1A (class I), alpha Polypeptide /// alcohol § dehydrogenase 1A (class I), alpha Polypeptide
1044 238750 at Transcribed sequence AW083576 Hs.218707.0 0.33046 0.353669 with weak similarity to protein sp:P39190 (H.sapiens) ALU3_HUMAN AIu subfamily SB1
Figure imgf000081_0001
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
1045 207048 at SLC6A11 solute carrier family 6 NM_014229 g7657586 NP_055044 Chr:3p25.3 0.32955 0.625663 (neurotransmitter transporter, GABA), member 11 /// solute carrier family 6 (neurotransmitter transporter, GABA), member 11
1046 227498_at — CDNA FLJ11723 fis, AI480314 Hs.196008.0 — — 0.32903 0.095261 clone HEMBA1005314
1047 229170_s_at TTC18 tetratricopeptide repeat AW024437 Hs.110667.0 NP_660153 Chr:10q22.3 0.3289 0.353669 domain 18
1048 234834_at — — AF233648 Hs.272403.0 — — 0.32861 0.095261
1049 233446_at — CDNA FLJ11655 fis, AU 145336 Hs.287436.0 — — 0.32841 0.149911 clone HEMBAI 004554
1050 213933 at Hs.27860.0 0.32796 2.489117
1051 232235 at NCAG1 NCAG1 AK021539 Hs.124673.1 NP 115536 Chr:18q22.1 0.32741 13.5285
1052 212840_at KIAA0794 KIAA0794 protein BG339560 Hs.127287.0 — 00
Chr:3q29 0.32739 0.149911
1053 237263_at — Füll length insert cDNA BF590253 Hs.259664.0 — 0.32605 0.095261 clone YI54D04
1054 208269_s_at ADAM28 a disintegrin and NM_021777 gl 1496993 NP_055080 Chr:8p21.2 0.32532 0.095261 metalloproteinase domain 28
1055 234192_s_at GKAP1 G kinase anchoring AK026487 Hs.306855.0 NP_079487 Chr:9q22.1 0.3252 11.55252 protein 1
1056 207919_at ART1 ADP-ribosyltransferase NM_004314 g4757783 NP_004305 Chr.11p15 0.32406 0.095261 1 /// ADP- ribosyltransferase 1
1057 232570_s_at ADAM33 a disintegrin and AL356755 Hs.173716.0 NPJD79496 Chr:20p13 0.32335 2.08989 metalloproteinase domain 33
1058 228885_at MAMDC2 MAM domain AI862120 Hs.131987.0 NP_694999 Chr.9q21.13- 0.32232 1.380569 containing 2 q21.2
1059 205433_at BCHE butyrylcholinesterase /// NM_000055 g4557350 NP_000046 Chr:3q26.1- 0.32111 0.201325 butyrylcholinesterase q26.2
1060 236141 at — Transcribed sequences AA156933 Hs.177532.0 — — 0.32079 0.779487
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1061 234062_at — CDNA FLJ12400 fis, AK022462 Hs.296721.0 — — 0.31743 0.779487 clone MAMMAI 002782
1062 219093_at FLJ20701 hypothetical protein NM_017933 g8923631 NP_060403 Chr:2q37.1 0.316 0.095261 FLJ20701
1063 228507_at PDE3A Phosphodiesterase 3A, AI742043 Hs.24305.0 NP_000912 Chr:12p12 0.31515 6.023405 cGMP-inhibited
1064 208335_s_at FY Duffy blood group /// NM_002036 g4503818 NP_002027 Chr:1q21-q22 0.3139 1.380569 Duffy blood group
1065 212865_s_at COL14A1 Collagen, type XIV, BF449063 Hs.36131.0 — Chr:8q23 0.31389 1.380569 alpha 1 (undulin)
1066 235666 at Transcribed sequence AA903473 Hs.153717.0 0.31252 0.149911 with moderate similarity to protein sp:P39194
(H.sapiens)
ALU7_HUMAN AIu subfamily SQ sequence 00 contamination warning entry
1067 222102 at GSTA3 glutathione S- NM_000847 Hs.102484.0 NP_000838 Chr:6p12.1 0.31072 0.095261 transferase A3 /// glutathione S- transferase A3
1068 202768 at FOSB FBJ murine NM_006732 g5803016 NP_006723 Chr:19q13.32 0.31054 2.814919 osteosarcoma viral oncogene homolog B /// FBJ murine osteosarcoma viral oncogene homolog B
1069 225516_ at Hs.93961.0 0.30931 1.702877
1070 228739. _at Cilia-associated protein AH 39413 Hs.27092.0 0.30902 11.55252 (CYSI) mRNA, complete cds
1071 229160. _at FLJ33516 hypothetical protein AI967987 Hs.10653.0 NP_689636 Chr:xq22.3 0.30874 0.095261 FLJ33516
1072 239829. _at — — BE221351 Hs.49727.0 — — 0.30863 0.095261
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1073 244402_at KIAA0436 putative L-type neutral AW605424 Hs.130056.0 — Chr:2p22.1 0.30562 4.75532 amino acid transporter
1074 237151_s_at — CDNA FLJ44327 fis, BF433885 Hs.128245.0 — Chr:2q14.2 0.30488 0.095261 clone TRACH3002866
1075 229580_at — Transcribed sequences R71596 Hs.7413.0 — — 0.30208 4.174189
1076 219937 at TRHDE thyrotropin-releasing NM_013381 g7019560 NP_037513 Chr:12q15-q21 0.30148 12.53374 hormone degrading ectoenzyme /// thyrotropin-releasing hormone degrading ectoenzyme
1077 227559 at Transcribed sequence AL521129 Hs.5232.1 0.30137 0.095261 with strong similarity to protein ref:NP_054884.1
(H.sapiens) HSPC125 protein [Homo sapiens] 90
1078 231038 s at Transcribed sequence AI309438 Hs.108689.1 0.3009 0.353669 with strong similarity to protein ref:NP_078795.1 (H.sapiens) hypothetical protein FLJ 13725
1079 222112. _at EPS15L1 epidermal growth factor AV710549 Hs.147176.1 NP_067058 Chr:19p13.12 0.30078 0.095261 receptor pathway Substrate 15-like 1
1080 204689_ _at HHEX hematopoietically NM_001529 gl 0835016 NP_001520 Chr:10q23.33 0.30061 0.095261 expressed homeobox /// hematopoietically expressed homeobox
1081 236038. _at — — N50714 Hs.42746.0 — — 0.30045 1.901012
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
1082 229641 at Transcribed sequence BG252802 Hs.49943.0 0.30036 2.08989 with moderate similarity to protein sp:P39192 (H.sapiens) ALU5_HUMAN AIu subfamily SC sequence contamination warning entry
1083 232878_ _at — CDNA FLJ46792 fis, AU 143891 Hs.274227.0 — Chr:15q26.2 0.29998 0.095261 clone TRACH3029520
1084 228728_ _at FLJ21986 hypothetical protein BF724137 Hs.24144.0 NP. .079189 Chr:7q31.32 0.29931 0.095261 FLJ21986
1085 223784, _at NX17 kidney-specific AF229179 g9957753 NP. _065716 Chr:xp22 0.29744 0.353669 membrane protein
1086 228293_ at LOC91614 novel 58.3 KDA protein AJ245600 Hs.180545.0 NP 631899 Chr:11p13 0.29507 0.201325
1087 223646_ _s_at CYorf15B chromosome Y open AF332225 gl 3161083 NP. .115965 Chryqi 1.222 0.29462 0.095261 reading frame 15B
1088 210197. ≠ ITPK1 inositol 1 ,3,4- BC003622 gl 3177675 NP. _055031 Chr:14q31 0.29259 0.095261 triphosphate 5/6 kinase
1089 239539_ _at AI291210 Hs.149795.0 0.29236 0.201325
1090 225491. _at Hs.4774.0 0.29187 0.518167
1091 205380. .at PDZK1 PDZ domain containing NM_002614 g4505702 NP. _002605 Chr:1q21 0.29103 3.612633 1 /// PDZ domain 1 1 1
Figure imgf000085_0001
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1095 206204_at GRB14 growth factor receptor- NM_004490 g4758477 NP_004481 Chr:2q22-q24 0.2871 4.436744 bound protein 14 /// growth factor receptor- bound protein 14
1096 236952_at — Transcribed sequences AI309861 Hs.150896.0 — — 0.28686 9.266777
1097 204931_at TCF21 transcription factor 21 NM_003206 g4507394 NPJ303197 Chr:6pter-qter 0.28566 0.095261 /// transcription factor 21
1098 208096_s_at COL21A1 collagen, type XXI, NM_030820 gl 3540617 NPJ 10447 Chr:6p12.3- 0.28495 0.353669 alpha 1 /// collagen, p11.2 type XXI, alpha 1
1099 238658_at — CDNA FLJ34787 fis, AA832474 Hs.25851.0 — — 0.2839 0.095261 clone NT2NE2004740
1100 205103_at CROC4 transcriptional activator NM_006365 g5453624 NP_006356 Chr:1q23.1 0.28165 0.095261 of the c-fos promoter /// transcriptional activator of the c-fos promoter 00
1101 209469_at GPM6A glycoprotein M6A BF939489 Hs.75819.0 NP_005268 Chr:4q34 0.28104 0.149911 Ul
1102 209074 s at g4886486 0.27968 0.779487
1103 222353_at LIMD1 LIM domains AV720842 Hs.282435.1 NP_055055 Chr:3p21.3 0.27777 0.149911 containing 1
1104 207016 s at ALDH 1A2 aldehyde AB015228 g3970845 NP_003879 Chr:15q21.2 0.27736 8.153992 dehydrogenase 1 family, member A2 /// aldehyde dehydrogenase 1 family, member A2
1105 220829 s at B3GALT1 UDP-Gal:betaGlcNAc NM_020981 gl 0304986 NP_066191 Chr:2q31.1 0.27697 0.095261 beta 1,3- galactosyltransferase, Polypeptide 1 /// UDP- Gal:betaGlcNAc beta 1 ,3- galactosyltransferase, Polypeptide 1
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1106 223467_at RASD1 RAS, dexamethasone- AF069506 g4959037 NP_057168 Chr:17p11.2 0.27636 0.095261 induced 1
1107 226388_at TCEA3 transcription elongation AI675780 Hs.94952.0 NP_003187 Chr:1p36.11 0.27633 6.023405 factor A (SII), 3
1108 221584 s at KCNMA1 potassium large U11058 g7914977 NP_002238 Chr:10q22-q23 0.27586 0.353669 conductance calcium- activated Channel, subfamily M, alpha member 1 /// potassium large conductance calcium-activated Channel, subfamily M, alpha member 1
1109 236261 _at OSBPL6 oxysterol binding AI949389 Hs.18067.0 NP_115912 Chr:2q31-q32.1 0.27579 0.149911 protein-like 6
1110 222764 at ASRGL1 asparaginase like 1 AI928342 Hs.7331.0 NP 079356 Chr:11q12.3 0.27434 6.023405
1111 227202 at AW072790 Hs.143434.2 0.27402 0.779487
1112 226591 _at Hs.22543.0 0.27396 9.266777 c
Figure imgf000087_0001
\
1113 205922_at VNN2 vanin 2 /// vanin 2 NM_004665 g4759313 NP 004656 Chr:6q23-q24 0.27362 0.518167
1114 204754 at HLF hepatic leukemia factor W60800 Hs.250692.0 NP 002117 Chr:17q22 0.27304 0.095261
1115 206932_at CH25H cholesterol 25- NM_003956 g4502498 NPJD03947 Chr:10q23 0.27303 0.095261 hydroxylase /// cholesterol 25- hydroxylase
1116 241694_at PKHD1 polycystic kidney and AI770005 Hs.280977.0 NP_619639 Chr:6p12.2 0.27242 0.095261 hepatic disease 1 (autosomal recessive)
1117 228504_at SCN7A sodium Channel, AI828648 Hs.23804.0 NP_002967 Chr:2q21-q23 0.27232 0.095261 voltage-gated, type VII, alpha
1118 219949_at LRRC2 leucine rieh repeat NM_024512 gl 3378142 NP_078788 Chr:3p21.31 0.27211 6.991358 containing 2 /// leucine rieh repeat containing 2
1119 213436_at CNR1 cannabinoid reeeptor 1 U73304 Hs.75110.1 NP_001831 Chr:6q14-q15 0.26934 3.612633 (brain)
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1120 243951_at ABCB1 ATP-binding cassette, AA887211 Hs.129467.0 NP_000918 Chr:7q21.1 0.26915 9.266777 sub-family B (MDR/TAP), member 1
1121 242239_at NOPD1 nucleolar protein AW970888 Hs.293147.0 NP_872349 Chr:10p13 0.26839 6.023405 (NOL1/NOP2/sun) and PUA domains 1
1122 210258_at RGS 13 regulator of G-protein AF030107 g2598184 NP_002918 Chr:1q31.1 0.26762 11.06357 signalling 13
1123 244740_at MGC9913 hypothetical protein BE855713 Hs.23133.1 — Chr:19q13.43 0.26725 6.023405 MGC9913
1124 204719 at ABCA8 ATP-binding cassette, NM_007168 g6005700 NPJD09099 Chr:17q24 0.26719 0.095261 sub-family A (ABCI), member 8 /// ATP- binding cassette, sub- family A (ABCI), member 8
1125 237659_at FLJ40288 hypothetical protein AW134826 Hs.227092.0 NP_775953 Chr:7q32.3 0.26701 0.095261 FLJ40288 90 -4
1126 222257_s_at ACE2 angiotensin I AK026461 Hs.178098.1 NP_068576 Chr:xp22 0.26694 0.625663 Converting enzyme (peptidyl-dipeptidase A) 2
1127 211451_sat KCNJ4 potassium inwardly- U24056 g775226 NPJ304972 Chr:22q13.1 0.26663 0.095261 rectifying Channel, subfamily J, member 4
1128 211748_x_at PTGDS Prostaglandin D2 BC005939 gl 3543567 NP_000945 Chr:9q34.2- 0.26591 0.625663 synthase 21 kDa (brain) q34.3 /// Prostaglandin D2 synthase 21 kDa (brain)
1129 228750 at — Transcribed sequences AI693516 Hs.28625.0 — — 0.26364 1.051298
1130 207062_at IAPP islet amyloid NM_000415 g4557654 NP_000406 Chr:12p12.3- 0.26125 1.223189 Polypeptide /// islet p12.1 amyloid Polypeptide
1131 229376_at — Transcribed sequences BF223556 Hs.107987.0 — — 0.2611 4.640066
1132 207802_at g5174674 0.26046 7.646445
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1133 208292_at BMP10 boπe morphogenetic NM_014482 g7656927 NP_055297 Chr:2p13.3 0.26033 0.095261 protein 10 /// bone morphogenetic protein 10
1134 209763_at CHRDL1 chordin-like 1 AL049176 Hs.82223.0 NP 660277 Chr:xq23 0.25968 2.814919
1135 241703_at RPIB9 Rap2-binding protein 9 AI928037 Hs.158832.0 NP 612147 Chr:7q21.13 0.25922 0.095261
1136 232059_at DSCAML1 Down Syndrome cell AI433419 Hs.233023.0 NPJ365744 Chr:11q23 0.25909 6.023405 adhesion molecule like 1
1137 237328_at — Transcribed sequences AI927063 Hs.160711.0 — — 0.25678 11.55252
1138 206254_at EGF epidermal growth factor NM_001963 g6031163 NP_001954 Chr:4q25 0.25591 0.353669 (beta-urogastrone) /// epidermal growth factor (beta-urogastrone)
1139 222162 s at ADAMTS1 a disintegrin-like and AK023795 Hs.8230.1 NP_008919 Chr:21q21.2 0.25526 0.095261 metalloprotease (reprolysin type) with
00 thrombospondin type 1 90 motif, 1 /// a disintegrin- like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1
1140 234307. _s_at KIF26A kinesin family member AK026406 Hs.134970.1 — Chr:14q32.33 0.25204 0.353669 26A
1141 205620. „at F10 coagulation factor X /// NM_000504 g9961350 NPJD00495 Chr:13q34 0.25032 0.095261 coagulation factor X
1142 218949_ _s_at QRSL1 glutaminyl-tRNA NM_018292 g8922807 NP_060762 Chr:6q21 0.24966 7.646445 synthase (glutamine- hydrolyzing)-like 1
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
1143 240510 at Transcribed sequence H66741 Hs.38540.0 0.2485 0.095261 with weak similarlty to protein
Figure imgf000090_0001
(H. sapiens) neuronal thread protein [Homo sapiens]
1144 232639 at Hs.225108.0 0.24803 0.095261
1145 206030 at ASPA aspartoacylase NM_000049 g4557334 NP_000040 Chr:17pter-p13 0.24794 0.095261 (aminoacylase 2, Canavan disease) /// aspartoacylase (aminoacylase 2, Canavan disease)
1146 214876_s_at TUBGCP5 tubulin, gamma AI628925 Hs.31476.1 NP. _443135 Chr:15q11.2 0.24712 0.095261 complex associated protein 5
1147 207192_at DNASE1 L2 deoxyribonuclease I- NM_001374 g4503346 NP_ _001365 Chr:16p13.3 0.24621 0.095261
Figure imgf000090_0002
deoxyribonuclease I- iike 2
1148 205624_at CPA3 carboxypeptidase A3 NM_001870 g4503000 NP_ .001861 Chr:3q21-q25 0.24512 10.20301 (mast cell) /// carboxypeptidase A3 (mast cell)
1149 205083 at AOX1 aldehyde oxidase 1 NM 001159 g6598319 NP 001150 Chr:2q33 0.24494 0.095261
1150 242164_s_at LRIG2 leucine-rich repeats BF433654 Hs.309305.0 Chr:1p13.1 0.24492 0.095261 and immunoglobulin- like domains 2
1151 206350_at APCS amyloid P component, NM_001639 g4502132 NP. _001630 Chr.1q21-q23 0.24474 0.353669 serum /// amyloid P component, serum
1152 237364_at Clone BF432855 Hs.189885.0 0.24442 0.201325 IMAGE:5738452, mRNA
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
1153 204965 at GC group-specific NM_000583 g9845254 NP_000574 Chr:4q12-q13 0.24091 5.685182 component (vitamin D binding protein) /// group-specific component (vitamin D binding protein)
1154 205305 at FGL1 fibrinogen-like 1 NM 004467 g4758371 NP 004458 Chr:8p22-p21.3 0.24081 2.489117
1155 231785_ _at NTF5 neurotrophin 5 NM_006179 Hs.266902.0 NP_ _006170 Chr:19q13.3 0.23989 0.149911 (neurotrophin 4/5)
1156 202994 s at FBLN1 fibulin 1 Z95331 Hs.79732.0 NP 001987 Chr:22q13.31 0.23667 0.149911
1157 205363 at BBOX1 butyrobetaine NM_003986 g4502368 NP_003977 Chr:11p14.2 0.23298 3.612633 (gamma), 2- oxoglutarate dioxygenase (gamma- butyrobetaine hydroxylase) 1 /// butyrobetaine (gamma), 2- O oxogl utarate dioxygenase (gamma- butyrobetaine hydroxylase) 1
1158 211413 s at PADI4 peptidyl arginine AF229067 g8980666 NP_036519 Chr:1 p36.13 0.23278 0.095261 deiminase, type IV
1159 206610 s at F11 coagulation factor Xl NM_000128 g9961351 NP_000119 Chr:4q35 0.23267 3.612633 (plasma thromboplastin antecedent) /// coagulation factor Xl (plasma thromboplastin antecedent)
1160 227827_ _at Clone AW138143 Hs.71721.0 0.23239 1.702877 IMAGE:4791597, mRNA
1161 209869_ _at ADRA2A adrenergic, alpha-2A-, AF284095 gl 3447750 NP_000672 Chr:10q24-q26 0.2306 7.646445 receptor /// adrenergic, alpha-2A-, receptor
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change ""-
1162 235649 at ADAMTS8 a disintegrin-like and AW207389 Hs.126758.0 NP_008968 Chr:11q25 0.23039 6.023405 metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8
1163 243171 at LOC389556 AA570178 Hs.105944.0 Chr:7q32.3 0.22954 1.051298 (LOG389556), mRNA
1164 205886 at REG1B regenerating islet- NM_006507 gl 0835247 NP_006498 Chr:2p12 0.22862 3.62324 derived 1 beta (pancreatic stone protein, pancreatic thread protein) /// regenerating islet- derived 1 beta (pancreatic stone protein, pancreatic thread protein)
1165 209820_ _s_at TBL3 transduciπ (beta)-like 3 BC002361 gl 2803114 NP 006444 Chr:16p13.3 0.22647 1.223189
1166 201909_ _at RPS4Y1 ribosoma! protein S4, NM_001008 g4506726 NP. ,000999 Chr:yp11.3 0.22634 0.095261 Y-linked 1 /// ribosomal protein S4, Y-linked 1
1167 206262 at ADH1C alcohol dehydrogenase NM_000669 gl 1496888 NP_000660 Chr:4q21-q23 0.22627 3.612633 1 C (class I), gamma Polypeptide /// alcohol dehydrogenase 1 C (class I), gamma Polypeptide
1168 229729. _at C9orf127 chromosome 9 open BF507870 Hs.143669.0 NP_057530 Chr:9p13.1 0.22607 0.353669 reading frame 127
1169 232623. _at INM04 mRNA, AK024541 Hs.191945.0 — — 0.22585 0.095261 complete cds
1170 213661_ .at DKFZP586H2123 DKFZP586H2123 AI671186 Hs.55044.0 NP_056245 Chr:11p13 0.22568 8.779357 protein
1171 229687. _s_at CDNA FLJ14242 fis, AA621763 Hs.170434.0 — — 0.22407 0.779487 clone OVARCI 000678
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer JTJ Protein ID Lokalisierung Change (%)
1172 219019 at LRDD ieucine-rich repeats NM_018494 g8923912 NP_060964 Chr:11p15.5 0.22295 1.051298 and death domain containing /// Ieucine- rich repeats and death domain containinc
1173 208147 s at CYP2C8 cytochrome P450, NM_030878 gl 3787186 NP_000761 Chr:10q24.1 0.21996 6.991358 family 2, subfamily C, Polypeptide 8 /// cytochrome P450, family 2, subfamily C, Polypeptide 8 /// cytochrome P450, family 2, subfamily C, Polypeptide 8
1174 205923_ _at RELN reelin /// reelin NM_005045 g4826977 NP _005036 Chr:7q22 0.2191 2.571322
1175 237251. _at FLJ32884 hypothetical protein AI480252 Hs.137368.0 NP. _653303 Chr:1q23.1 0.21871 0.095261 FLJ32884
1176 201849 at BNIP3 BCL2/adenovirus E1 B NM_004052 g7669480 NP_004043 Chr:10q26.3 0.21788 0.095261 κ> 19kDa interacting protein 3 /// BCL2/adenovirus E1B 19kDa interacting protein 3
1177 212592. _at AV733266 Hs.76325.1 0.21763 0.095261
1178 228492. _at USP9Y ubiquitin specific AV681765 Hs.1870.1 NPJ304645 Chr:Yq11.2 0.21384 0.095261 Protease 9, Y-linked (fat facets-like, Drosophila)
1179 227826. _s_at Clone AW138143 Hs.71721.0 0.2128 2.814919 IMAGE:4791597, mRNA
1180 232765. _x_at Hs.272320.0 0.21117 0.095261
1181 211712. _s_at ANXA9 annexin A9 /// annexin BC005830 gl 3543331 NP_003559 Chr:1q21 0.21102 0.095261 A9
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change
1182 205799 s at SLC3A1 solute carrier family 3 M95548 g306441 NP_000332 Chr:2p16.3 0.20871 3.612633
(cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1 /// solute carrier family 3
(cystine, dibasic and neutral amino acid transporters, activator of cystin
1183 204437 s at FOLR1 folate receptor 1 (adult) NML.016725 g9257206 NP_000793 Chr:11q13.3- 0.20709 10.20301 /// folate receptor 1 q14.1 (adult)
1184 208473 s at GP2 glycoprotein 2 NM_016295 g7706490 NP_001493 Chr:9q21.11- 0.20347 1.380569 (zymogen granule q21.2 membrane) /// glycoprotein 2 (zymogen granule membrane)
1185 210497_x_at SSX2 synovial sarcoma, X BC002818 gl 2803942 NP. _003138 Chr:xp11.23- 0.2017 0.095261 breakpoint 2 P11.22
1186 222717_at SDPR serum deprivation BF982174 Hs.26530.0 NP. ,004648 Chr:2q32-q33 0.20109 0.353669 response (phosphatidylserine binding protein)
1187 219064_at ITIH5 inter-alpha (globulin) NM_030569 gl 3386477 NP. _085046 Chr:10p15.1 0.19975 0.095261 inhibitor H5
1188 244223 at — Transcribed sequences AW207574 Hs.179501.0 — — 0.19883 0.779487
1189 231584_s_at BCAS4 breast Carcinoma BE503623 Hs.56237.0 NP. ,060313 Chr:20q13.13 0.1973 9.266777 amplified sequence 4
1190 242400_at ZFP90 zinc finger protein 90 AI885183 Hs.173552.0 — Chr:16q22.1 0.19714 0.201325 homolog (mouse)
1191 240242_at — Transcribed sequences BE222843 Hs.124590.0 — — 0.19628 9.266777
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change <0'-
1192 227450 at FLJ32115 hypothetical protein AI051248 Hs.293902.0 NP_689534 Chr:12p13.1 0.19621 9.266777 FLJ32115
1193 208383 s at PCK1 phosphoenolpyruvate NM_002591 g4505638 NP_002582 Chr:20q13.31 0.19527 0.149911 carboxykinase 1 (soluble) /// phosphoenolpyruvate carboxykinase 1 (soluble)
1194 209266_s_at SLC39A8 solute carrier family 39 AW134794 Hs.284205.1 NP_071437 Chr:4q22-q24 0.19436 0.095261 (zinc transporter), member 8
1195 223316_at gl 3276630 0.19423 0.095261
1196 229963_at LOC340542 hypothetical protein AV726956 Hs.47209.0 — Chr:xq22.1 0.19287 4.75532 LOC340542
1197 238357_at — Transcribed sequences AW749121 Hs.282901.0 — — 0.19232 0.095261
1198 205912_at PNLIP pancreatic lipase /// NM_000936 gl 0834999 NP_000927 Chr:10q26.1 0.19063 3.612633 pancreatic lipase
1199 223629_at PCDHB5 protocadherin beta 5 BC001186 gl 2654692 NP_056484 Chr:5q31 0.19043 0.095261 4-
1200 213907_at EEF1 E1 eukaryotic translation N32257 Hs.298581.1 NP_004271 Chr:6p24.3- 0.18975 0.095261 elongation factor 1 p25.1 epsilon 1
1201 211766_s_at PNLIPRP2 pancreatic lipase- BC005989 gl 3543678 NP_005387 Chr:10q26.12 0.18805 3.612633 related protein 2 /// pancreatic lipase- related protein 2
1202 205509_at CPB1 carboxypeptidase B1 NM_001871 g4503002 NP_001862 Chr:3q24 0.18525 4.436744 (tissue) /// carboxypeptidase B1 (tissue)
1203 221796_at NTRK2 neurotrophic tyrosine AA707199 Hs.298998.1 NP_006171 Chr:9q22.1 0.18166 0.149911 kinase, receptor, type 2
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript (O Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
1204 203638 s at FGFR2 fibroblast growth factor NM_022969 g13186252 NP_000132 Chr:10q26 0.18165 6.991358 receptor 2 (bacteria- expressed kiπase, keratinocyte growth factor receptor, craniofacial dysostosis 1 , Crouzon Syndrome, Pfeiffer Syndrome, Jackson-Weiss Syndrome)
1205 206700 s at JARID1D Jumonji, AT rieh NM_004653 g4759149 NP_004644 Chr:yq11 0.17638 0.095261 interactive domain 1 D (RBP2-Iike) /// Jumonji, AT rieh interactive domain 1 D (RBP2-Iike)
1206 205771 s at AKAP7 A kinase (PRKA) AL137063 Hs.12835.0 NP 004833 Chr:6q23 0.1757 3.612633 anchor protein 7
1207 209752 at REG1A regenerating islet- AF172331 g5764554 NP_002900 . Chr:2p12 0.1729 0.095261 derived 1 alpha (pancreatic stone protein, pancreatic thread protein) /// regenerating islet- derived 1 alpha (pancreatic stone protein, pancreatic thread protein)
1208 223843. _at SCARA3 seavenger receptor AB007830 g6230378 NP. .057324 Chr:8p21 0.17173 0.095261 dass A, member 3
1209 209261. _s_ at NR2F6 nuclear receptor BF000629 Hs.239752.0 NP. .005225 Chr:19p13.1 0.16835 0.518167 subfamily 2, group F, member 6
1210 208498. A_ g4757749 0.16694 3.612633
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoW q-value
Probennummer ID Protein ID Lokalisierung Change (%)
1211 204081 at NRGN neurogranin (protein NM_006176 g5453799 NP_006167 Chr:11q24 0.16629 0.095261 kinase C Substrate, RC3) /// neurogranin (protein kinase C Substrate, RC3)
1212 215624 at TSC2 tuberous sclerosis 2 AU147962 Hs.301509.0 NP 000539 Chr:16p13.3 0.16367 11.70204
1213 219270_at MGC4504 hypothetical protein NM_024111 gl 3129125 NP. 077016 Chr:15q14 0.16307 1.380569 MGC4504
1214 231037_at — CDNA FLJ26031 fis, AA004300 Hs.166254.1 — 0.16295 6.023405 clone PNC08078
1215 211738_x_at ELA3A elastase 3A, pancreatic BC005918 gl 3543517 NP. _005738 Chr:1p36.12 0.15996 3.612633 (Protease E) /// elastase 3A, pancreatic (Protease E)
1216 233514_x_at TEX11 testis expressed AL139109 Hs.121776.1 NP_ J 12566 Chr:xq13.1 0.15817 9.266777 sequence 11
1217 206535 at SLC2A2 solute carrier family 2 NM 000340 g4557850 NP 000331 Chr:3q26.1- 0.15383 6.991358 (facilitated glucose q26.2 transporter), member 2 /// solute carrier family 2 (facilitated glucose transporter), member 2
1218 205477 s at AMBP alpha-1- NM_001633 g4502066 NP_001624 Chr:9q32-q33 0.15063 0.353669 microglobulin/bikunin precursor /// alpha-1 - microglobulin/bikunin precursor
1219 206784, _at AQP8 aquaporin 8 /// NM_001169 g4502188 NP_001160 Chr:16p12 0.14934 2.814919 aquaporin 8
1220 223623, _at ECRG4 esophageal cancer AF325503 gl 1991655 NP_115787 Chr:2q12.2 0.14859 0.095261 related gene 4 protein
1221 215563_ _s_at MSTP9 macrophage U28055 Hs.278657.3 — Chr:1p36.13 0.14797 4.149813 stimulattng,
Figure imgf000097_0001
Nr. Affyimetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1222 222722_at OGN osteoglycin AV700059 Hs.109439.0 NP_054776 Chr:9q22 0.14778 0.095261 (osteoinductive factor, mimecan)
1223 206681_x_at NM_001502 g4504074 0.1472 0.095261
1224 235737_at TSLP thymic stromal AW118681 Hs.128051.0 NP_149024 Chr:5q22.2 0.14708 0.095261 lymphopoietin
1225 221066 at g7706102 0.14576 0.095261
1226 210262_at CRISP2 cysteiπe-rich secretory M25532 g339882 NP_003287 Chr:6p21-qter 0.14408 4.436744 protein 2 /// cysteine- rich secretory protein 2
1227 209277_at TFP12 tissue factor pathway AL574096 Hs.295944.0 NP_006519 Chr:7q22 0.13882 0.095261 Inhibitor 2
1228 219564 at KCNJ16 potassium inwardly- NMJ318658 g8923822 NP_061128 Chr:17q23.1- 0.13757 3.612633 rectifying Channel, q24.2 subfamily J, member 16 /// potassium inwardly-rectifying Channel, subfamily J, member 16
1229 205000 at DDX3Y DEAD (Asp-Glu-Ala- NM_004660 gl 3514808 NP_004651 Chr:yq11 0.13637 0.095261 Asp) box Polypeptide 3, Y-Iinked /// DEAD (Asp- Glu-Ala-Asp) box Polypeptide 3, Y-Iinked
1230 224400 s at CHST9 carbohydrate (N- AF332473 gl 3561519 NP_113610 Chr:18q11.2 0.13533 0.095261 acetylgalactosamine 4- 0) sulfotransferase 9 /// carbohydrate (N- acetylgalactosamine 4- Q) sulfotransferase 9
1231 230736 at SVIL supervillin AW118878 Hs.110835.0 NP. 003165 Chr:10p11.2 0.13164 0.095261
1232 238018_at LOC285016 hypothetical protein BF449053 Hs.213923.0 — Chr:2p25.3 0.13038 0.095261 LOC285016
1233 231773 at ANGPTL1 angiopoietin-like 1 BF002046 Hs.241519.0 NP 004664 Chr:1q24.3 0.12641 0.095261
1234 240259_at — LOC400235 AI188161 Hs.144627.0 — Chr:14q31.3 0.12466 9.840216 (LOC388003), mRNA
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1235 213071 at DPT dermatopontin AL049798 Hs.80552.1 NP 001928 Chr:1q12-q23 0.12167 3.612633
1236 234316_x_at KLK12 kallikrein 12 AF135025 Hs.159679.1 NPJD62544 Chr:19q13.3- 0.12155 6.023405 q13.4
1237 235915 at Transcribed sequence R88990 Hs.34226.0 0.12054 6.023405 with weak similarity to protein ref:NP_004563.1 (H.sapiens) plakophilin 2 [Homo sapiens]
1238 207778 at REGL regenerating islet- NM_006508 gl 0835249 NP_006499 Chr:2p12 0.11887 0.095261 derived-like, pancreatic stone protein-like, pancreatic thread protein-like (rat) /// regenerating islet- derived-like, pancreatic stone protein-like, pancreatic thread protein-like (rat)
1239 214731_at DKFZp547A023 hypothetical protein AB037854 Hs.23921.1 NP_061174 Chr:1p13.2 0.11625 0.095261 DKFZp547A023
1240 230432_at — CDNA FLJ42409 fis, AI733124 Hs.14535.0 — 0.11211 9.266777 clone BLADE2000866
1241 206212_at CPA2 carboxypeptidase A2 NM_001869 g4502998 NP_001860 Chr:7q32 0.11123 4.149813 (pancreatic) /// carboxypeptidase A2 (pancreatic)
1242 215327_at — Transcribed sequences AI675458 Hs.206984.0 — — 0.10593 0.095261
1243 216597_at TRY2 trypsinogen-like U66059 Hs.303157.12 — Chr:7q34 0.10405 1.223189 pseudogene
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change ""-
1244 217452 s at B3GALT2 UDP-GaI rbetaGIcNAc Y15014 Hs.181353.1 NP_003774 Chr:1q31 0.10384 4.436744 bete 1,3- gaiactosyltransferase, Polypeptide 2 /// UDP- GahbetaGIcNAc beta 1.3- galactosyltransferase, Polypeptide 2
1245 235965 at BF513674 Hs.22627.0 0.10241 0.095261
1246 220275 at CUZD1 CUB and zona NM_022034 g11545736 NP_071317 Chr:10q26.13 0.10068 3.612633 pellucida-like domains 1 /// CUB and zona pellucida-like domains 1
1247 213967_at LOC138046 hypothetical protein AI634532 Hs.13423.0 NP. _776247 Chr:8q21.13 0.09925 0.095261 LOC138046
1248 206464_at BMX BMX non-receptor NM_001721 g4502434 NP_ _001712 Chr:xp22.2 0.09884 3.612633 tyrosine kinase /// BMX non-receptor tyrosine kinase
1249 225016_at APCDD1 adenomatosis N48299 Hs.20665.0 NP. _694545 Chr:18p11.21 0.0986 4.75532 Polyposis coli down- regulated 1
1250 207985_at ENO1B enolase alpha, lung- NM_014355 g7657061 0.09814 0.625663 specific /// enolase alpha, lung-specific
1251 240578 at — Transcribed sequences BF435290 Hs.132247.0 — — 0.09355 0.095261
1252 206297_at CTRC chymotrypsin C NM_007272 gl 1321627 NP. ,009203 Chr:1 p36.13 0.09328 3.61384 (caldecrin) /// chymotrypsin C (caldecrin)
1253 216687_x_at UGT2B15 UDP U06641 Hs.150207.1 NP. _001067 Chr:4q13 0.08879 1.578435 glycosyltransferase 2 family, Polypeptide B15
1254 236430_at MGC23911 hypothetical protein AA708152 Hs.119840.0 NP. ,653277 Chr:16q22.1 0.08763 0.095261 MGC23911
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1255 229995 at SYCN syncollin BE969669 Hs.124123.0 — Chr:19q13.2 0.08642 0.201325
1256 41512_at BRAP BRCA1 associated AL042733 4921950_RC NP_006759 Chr:12q24 0.08093 6.991358 protein
1257 220487_at SNTG2 syntrophin, gamma 2 /// NM_018968 g9507164 NP_061841 Chr:2p25 0.08015 0.095261 syntrophin, gamma 2
1258 205719_s_at PAH Phenylalanine NM_000277 g4557818 NP_000268 Chr:12q22- 0.07897 1.578435 hydroxylase /// q24.2 Phenylalanine hydroxylase
1259 228004_at C20orf56 chromosome 20 open AL121722 Hs.9842.0 — Chr:20p11.22 0.07039 1.223189 reading frame 56
1260 229975_at — Transcribed sequences AI826437 Hs.72472.0 — — 0.06921 0.095261
1261 209616 s at CES1 carboxylesterase 1 S73751 g688112 NP 001257 Chr:16q13- 0.06796 8.779357 (monocyte/macrophage q22.1 serine esterase 1 ) /// carboxylesterase 1 (monocyte/macrophage serine esterase 1 )
1262 224970. _at NFIA nuclear factor l/A AA419275 Hs.173933.0 NP. _005586 Chr:1 p31.3- 0.06238 0.095261 P31.2
1263 229778_ _at MGC10946 hypothetical protein BE326710 Hs.121773.0 NP. ,085049 Chr:12p12.3 0.05486 0.353669 MGC10946
1264 241390 at — Transcribed sequences AW117264 Hs.126252.0 — — 0.04071 0.149911
1265 206827 s at TRPV6 transient receptor NMJD14274 g7656846 NP_061116 Chr:7q33-q34 0.04018 3.612633 Potential cation Channel, subfamily V, member 6 /// transient receptor potential cation Channel, subfamily V, member 6
1266 214925. _s_at SPTAN 1 spectrin, alpha, non- AK026484 Hs.321666.0 NP. _003118 Chr:9q33-q34 0.03631 0.779487 erythrocytic 1 (alpha- fodrin)
1267 229177. _at MGC45438 hypothetical protein AI823572 Hs.11782.0 NP. ,689672 Chr:16p13.3 0.03437 0.353669 MGC45438
Die Probe biologischen Materials, die zur Diagnose des Pankreaskarzinoms einem Patienten entnommen wird, ist eine Gewebe- oder Blut- oder Serumprobe, die Proteine und/oder Nukleinsäuren enthält. Bevorzugt enthält die Probe Pankreasgewebe, das durch während der operativen Entfernung oder einer Feinnadelbiopsie oder einer ERCP einem Patienten entnommen wird. Das entnommene Gewebe wird in flüssigen Stickstoff eingefroren oder in andere Flüssigkeiten z.B: RNAIater eingebracht, welche die Integrität der RNA, der DNA und der Proteine gewährleistet. Alsdann werden von dem gefrorenen Gewebeblock in einem Kryostaten einzelne Schnitte mit der große von ca. 10 μm hergestellt. Diese Schnitte werden in Ethanol fixiert und mit Hematoxilin angefärbt. Unter dem Mikrospkop wird dann mittels eines spitzen Gegenstandes oder eines Laserstrahls das entsprechende interessierende Gewebe herausgelöst und in ein Behältnis gegeben. Dazu wird eine Flüssigkeit hinzugefügt, welche die in dem Gewebe enthaltene RNA, DNS, oder Protein- Moleküle konserviert.
Alternativ erfolgt die Bestimmung in einer Blutprobe oder Serum oder Plasma, das aus dem Blut des Patienten gewonnen wurde. Desweiteren erfolgt die Bestimmung in einer Probe des Stuhls, der Gallengangs- oder der Pankreasflüssigkeit die aus dem Patienten gewonnen wurde.
In bevorzugten Ausführungsformen des Verfahrens wird zusätzlich die Menge an entsprechendem Genprodukt in einer Kontrollprobe untersucht und mit der Menge an Genprodukt in der Patientenprobe verglichen. Bei der Kontrollprobe handelt es sich bevorzugt um die entsprechende Gewebeprobe eines Gesunden oder gesundes Pankreasgewebe eines an Pankreaskarzinom Erkrankten.
In weiteren bevorzugten Ausführungsformen des Verfahrens wird zusätzlich die Menge an Genprodukt mindestens eines Referenzgens bestimmt.
Bei dem Referenzgen handelt es sich vorzugsweise um ein Gen, das sowohl im Pankreaskarzinom als auch im normalen Pankreasepithelgewebe exprimiert wird und im Pankreaskarzinom keine veränderte Expressionshöhe gegenüber dem normalen Pankreasepithelgewebe erfährt. Bevorzugte Referenzgene sind konstitutiv exprimierte sog. household genes. Bevorzugte Referenzgene sind beta-Actin (NM_001101 ), Cyclophilin A (NM_021130) oder G6PD (NM_000402).
In den Tabellen 3 und 4 sind weitere Gene aufgeführt, die im Pankreaskarzinom eine veränderte Expressionshöhe gegenüber dem normalen Pankreasepithelgewebe erfahren. Von diesen Genen war bereits vor der der Erfindung zugrundeliegenden Untersuchung des kompletten Transkriptoms bekannt, dass sie mit Pankreaskarzinom in Verbindung stehen.
In Tabelle 3 sind dabei Gene aufgeführt, deren Expression im duktalen Adenokarzinom des Pankreas im Mittel mindestens doppelt so hoch ist wie die Expression in normalem Pankreasepithelgewebe. D. h. der Quotient („Fold Change") aus den Expressionswerten im mikrodissektierten duktalen Adenomakarzinom des Pankreas (Mittel über 14 Patienten) und den Expressionswerten im gesunden mikrodissektierten duktalen Pankreasepithelgewebe (Mittel über 11 Personen) ist für diese Gene > 2. Wird für ein Gen der Quotient („Fold Change") 1000 angegeben, bedeutet dies, dass, dass das Gen nur in dem Tumor-, aber nicht in dem Normalgewebe nachgewiesen werden konnte. Die Gene sind ab Nummer 1268 fortlaufend nummeriert. Zur Charakterisierung werden jeweils die Identifikationsnummer des Affymetrix-Probensets, das Gensymbol, der Gen-Name, die chromosomale Lokalisation, die repräsentative Identifikationsnummer (ID), die Identifikationsnummer des Transkriptes und die des zugehörigen Proteins angegeben (Veröffentlichungsnummern in der Entrez- Datenbank des National Center for Biotechnology Information (NCBI), Bethesda, USA (http://www.ncbi.nih.gov/entrez/). Der q-Wert (in Prozent) gibt an, mit welchem statistischen Fehler das verwendete Auswerteprogramm eine differentielle Genexpression voraussagt.
Tabelle 3:
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1268 213150_at HOXA10 homeo box A10 BF792917 Hs.110637.0 NP 061824 Chr:7p15-p14 1000
1269 210252_s_at MADD MAP-kinase activating AB002356 g2224656 NP_003673 Chr:11p11.2 1000 2.571322 death domain
1270 202870_s_at CDC20 CDC20 cell division cycle NM_001255 g4557436 NPJ)01246 Chr.ip34.1 1000 4.830969 20 homolog (S. cerevisiae) /// CDC20 cell division cycle 20 homolog (S. cerevisiae)
1271 208510_s_at PPARG peroxisome proliferative NM_015869 g7705548 NP_005028 Chr:3p25 14.21852 1.702877 activated receptor, gamma /// peroxisome proliferative activated receptor, gamma
1272 202580 x at FOXM1 forkhead box M1 NM 021953 g11386144 NP 068772 Chr:12p13 9.09999 10.20301
1273 218542_at C10orf3 chromosome 10 open NM_018131 g8922501 NP_060601 Chr:10q23.33 9.02927 1.578435 reading frame 3
1274 37892 at COL11A1 Collagen, type Xl, alpha 1 J04177 4876385 NP 001845 Chr:1p21 8.12914 12.53374
1275 203819_s_at tMP-3 IGF-II mRNA-binding AU160004 Hs.79440.0 NP_006538 Chr:7p11 7.41914 3.612633 protein 3
1276 202095_s_at B1RC5 baculoviral IAP repeat- NM_001168 g4502144 NP_001159 Chr:17q25 5.49224 6.225758 containing 5 (survivin) /// baculoviral IAP repeat- containing 5 (survivin)
1277 204170_s_at CKS2 CDC28 protein kinase NM_001827 g4502858 NPJ301818 Chr:9q22 5.44996 4.830969 regulatory subunit 2 /// CDC28 protein kinase regulatory subunit 2
1278 209642 at BUB1 BUB1 budding uninhibited AF043294 g6970210 NP_004327 Chr:2q14 5.17194 3.612633 by benzimidazoles 1 homolog (yeast) /// BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)
1279 209792 s at KLK10 kallikrein 10 /// kallikrein 10 BC002710 gl 2803744 NP_002767 Chr:19q13.3- 4.91941 6.225758 q13.4
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1280 204286_s_at PMAIP1 phorbol-12-myristate-13- NM_021127 gl 0863922 NP_066950 Chr:18q21.32 4.9169 8.153992 acetate-induced protein 1 /// phorbol-12-myristate-13- acetate-induced protein 1
1281 211924_s_at PLAUR Plasminogen activator, AY029180 .gl 3641308 NP_002650 Chr:19q13 4.88546 11.06357 Urokinase receptor /// Plasminogen activator, Urokinase receptor
1282 203108_at RAI3 retinoic acid induced 3 /// NM003979 gl 2056470 NP_003970 Chr:12p13- 4.7401 3.612633 retinoic acid induced 3 P12.3
1283 201467_s_at NQO1 NAD(P)H dehydrogenase, AI039874 Hs.80706.0 NP__000894 Chr:16q22.1 4.68911 2.571322 quinone 1
1284 204531_s_at BRCA1 breast cancer 1 , early onset NM_007295 g6552300 NP_009225 Chr:17q21 4.5618 0.353669 /// breast cancer 1 , eariy onset
1285 203726 s at LAMA3 laminin, alpha 3 NM 000227 g4557710 NP 000218 Chr:18q11.2 4.54591 7.646445
O
1286 225387_at TM4SF9 transmembrane 4 AA059445 Hs.8037.0 NP_005714 Chr:4q23 4.50432 9.266777 superfamily member 9
1287 214710 s at CCNB1 cyclin B1 BE407516 Hs.23960.2 NP 114172 Chr.5q12 4.45865 2.009521
1288 208079_s_at STK6 serine/threonine kinase 6 /// NM_003158 g4507278 NP_003149 Chr:20q13.2- 4.38175 4.149813 serine/threonine kinase 6 q13.3
1289 201884 at CEACAM5 carcinoembryonic antigen- NM_004363 gl 1386170 NP_004354 Chr:19q13.1- 4.21221 3.306454 related cell adhesion q13.2 molecule 5 /// carcinoembryonic antigen- related cell adhesion molecule 5
1290 206074_s_at HMGA1 high mobility group AT-hook NMJD02131 g4504432 NP_002122 Chr:6p21 4.11352 3.612633 1 /// high mobility group AT- hook 1
1291 225834_at MGC57827 Similar to RIKEN cDNA AL135396 Hs.18349.1 NP_997301 4.02836 12.80219 2700049P18 gene
1292 207165_at HMMR hyaluronan-mediated NM_012485 g7108350 NP_036616 Chr:5q33.2-qter 3.97806 4.149813 motility receptor (RHAMM)
1293 217109_at MUC4 mucin 4, tracheobronchial AJ242547 Hs.198267.2 NP 004523 Chr:3q29 3.89312 3.62324
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change
1294 222608_s_at ANLN anillin, actin binding protein AK023208 Hs.62180.0 NP_061155 Chr:7p15-p14 3.87492 13.64212 (scraps homolog, Drosophila)
1295 201292_at TOP2A topoisomerase (DNA) Il AL561834 Hs.156346.0 NP_001058 Chr:17q21-q22 3.67605 4.149813 alpha 17OkDa
1296 225295_at SLC39A10 solute carrier family 39 (zinc AB033091 Hs.24936.0 — Chr:2q33.1 3.56639 13.5285 transporter), member 10
1297 203213_at CDC2 cell division cycle 2, G1 to S AL524035 Hs.184572.0 NP_001777 Chr:10q21.1 3.52304 1.578435 and G2 to M
1298 212942 s at KIAA1199 KIAA1199 protein AB033025 Hs.50081.1 NP 061159 Chr:15q 3.41813 10.20301
1299 203939_at NT5E 5'-nucleotidase, ecto NM_002526 g4505466 NP_002517 Chr:6q14-q21 3.38103 1.578435 (CD73) /// 5'-nucleotidase, ecto (CD73)
1300 205479_s_at PLAU Plasminogen activator, NM_002658 g4505862 NP_002649 Chr:10q24 3.32176 13.40329 Urokinase /// Plasminogen activator, Urokinase
1301 220658 s at ARNTL2 aryl hydrocarbon receptor NM_020183 g9910367 NP_064568 Chr:12p12.2- 3.3148 1.578435 ^ nuclear translocator-like 2 p11.2 o
Ul /// aryl hydrocarbon receptor nuclear translocator-like 2
1302 202712_ _s_at CKMT1 creatine kinase, NM_020990 gl 1641403 NP_ _066270 Chr:15q15 3.31168 13.40329 mitochondrial 1 (ubiquitous) /// creatine kinase, mitochondrial 1 (ubiquitous)
1303 210809_ _s_at POSTN periostin, Osteoblast D13665 g393318 NP. _006466 Chr:13q13.3 3.30048 4.149813 specific factor /// periostin, Osteoblast specific factor
1304 203878_ _s_at MMP11 matrix metalloproteinase 11 NM_005940 gl 3027795 NP. _005931 Chr:22q11.23 3.27537 2.009521 (stromelysin 3) /// matrix metalloproteinase 11 (stromelysin 3)
1305 212022_ _s_at MKI67 antigen identified by BF001806 Hs.80976.1 NP. _002408 Chr:10q25-qter 3.18835 13.40329 monoclonal antibody Ki-67
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
1306 201195 s at SLC7A5 solute carrier family 7 AB018009 g5926731 NP_003477 Chr:16q24.3 3.13152 3.61384 (cationic amino acid transporter, y+ system), member 5 /// solute carrier family 7 (cationic amino acid transporter, y+ system), member 5
1307 205483_s_at G1 P2 interferon, alpha-inducible NM_005101 g4826773 NP_005092 Chr:1p36.33 3.12086 12.53374 protein (clone IFI-15K) /// interferon, alpha-inducible protein (clone IFI-15K)
1308 204351_at S100P S100 calcium binding NM_005980 g5174662 NP_005971 Chr:4p16 3.11871 4.149813 protein P /// S 100 calcium binding protein P
1309 201850_at CAPG capping protein (actin NM_001747 g4502560 NP_001738 Chr:2cen-q24 3.05331 1.578435 filament), gelsolin-like /// capping protein (actin filament), gelsolin-like O
1310 204602_at DKK1 dickkopf homolog 1 NMJ)12242 g7110718 NP_036374 Chr: 10q 11.2 3.046 7.646445 (Xenopus laevis) /// dickkopf homolog 1 (Xenopus laevis)
1311 205499_at SRPUL sushi-repeat protein /// NMJ)14467 g7657618 NP_055282 Chr.xq21.33- 3.04048 6.991358 sushi-repeat protein q23
1312 204855 at SERPINB5 serine (or cysteine) NM_002639 g4505788 NP_002630 Chr:18q21.3 3.02744 10.20301 Proteinase iπhibitor, clade B (ovalbumin), member 5 /// serine (or cysteine) Proteinase inhibitor, clade B (ovalbumin), member 5
1313 205081, CRIP1 cysteine-rich protein 1 NMJ)OI 311 g4503046 NP. _001302 Chr:7q11.23 3.02177 2.571322 (intestinal) /// cysteine-rich protein 1 (intestinal)
1314 214830, _at SLC38A6 solute carrier family 38, AI537540 Hs.71168.0 NP. _722518 Chr:14q23.1 2.99801 5.685182 member 6
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1315 203554_x_at PTTG1 pituitary tumor-transforming NM_004219 gl 1038651 NP_004210 Chr:5q35.1 2.98209 3.61384 1 /// pituitary tumor- transforming 1
1316 205927 s at CTSE cathepsin E /// cathepsin E NM 001910 g4503144 NP 001901 Chr:1q31 2.89469 3.61384
1317 205534_at PCDH7 BH-protocadherin (brain- NM_002589 g4505634 NPJ302580 Chr:4p15 2.86035 3.612633 heart)
1318 202411_at IFI27 interferon, alpha-inducible NM__005532 g5031780 NP_005523 Chr:14q32 2.84206 11.06357 protein 27 /// interferon, alpha-inducible protein 27
1319 208711_s_at CCND1 cyclin D1 (PRAD1 : BC000076 gl 2652656 NP_001749 Chr:11q13 2.82367 8.779357 parathyroid adenomatosis D
1320 200737 at PGK1 phosphoglycerate kinase 1 NM 000291 g4505762 NP 000282 Chr:xq13 2.79459 9.625715
1321 204767_s_at FEN1 flap structure-specific BC000323 gl 2653112 NP_004102 Chr:11q12 2.77031 1.578435 endonuclease 1 /// flap structure-specific endonuclease 1
1322 212464 s at FN1 fibronectin 1 X02761 Hs.287820.1 NP 002017 Chr:2q34 2.71039 1.578435 O -4
1323 213453_x_at GAPD glyceraldehyde-3- BF689355 Hs.169476.4 NP_002037 Chr:12p13 2.69085 3.612633 phosphate dehydrogenase
1324 209016 s at KRT7 keratin 7 /// keratin 7 BC002700 gl 2803726 NP 005547 Chr:12q12-q13 2.68087 11.06357
1325 227062_at TncRNA trophoblast-derived AU155361 Hs.79706.1 — Chr:11q13.1 2.67851 13.5285 noncoding RNA
1326 225265 at Hs.239870.1 2.53063 11.55252
1327 33323 r at SFN stratifin X57348 4866611 NP 006133 Chr:1p35.3 2.52179 1.578435
1328 201250 s at SLC2A1 solute carrier family 2 NM_006516 g5730050 NP_006507 Chr:1p35-p31.3 2.47262 10.20301 (facilitated glucose transporter), member 1 /// solute carrier family 2 (facilitated glucose transporter), member 1
1329 203362 s at MAD2L1 MAD2 mitotic arrest NM_002358 g6466452 NP_002349 Chr:4q27 2.46834 0.095261 deficient-like 1 (yeast) /// MAD2 mitotic arrest deficient-like 1 (yeast)
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-valυe Probennummer ID Protein ID Lokalisierung Change (%)
1330 214974_x_at CXCL5 chemokine (C-X-C motif) AK026546 Hs.287716.0 NP_002985 Chr:4q12-q13 2.4528 9.625715 ligand 5
1331 201231_s_at ENO1 enolase 1 , (alpha) /// NM_001428 g4503570 NPJ301419 Chr:1p36.3- 2.44226 1.578435 enolase l, (alpha) p36.2
1332 201105_at LGALS1 lectin, galactoside-binding, NM_002305 g6006015 NPJ)02296 Chr:22q13.1 2.44057 6.225758 solubie, 1 (galectin 1) /// lectin, galactoside-binding, solubie, 1 (galectin 1)
1333 202338_at TK1 thymidine kinase 1 , solubie NM_003258 g4507518 NP_003249 Chr:17q23.2- 2.43793 4.436744 /// thymidine kinase 1 , q25.3 solubie
1334 201456_s_at BUB3 BUB3 budding uninhibited AU160695 Hs.40323.0 NP_004716 Chr:10q26 2.43565 5.685182 by benzimidazoles 3 homolog (yeast)
1335 217733_s_at TMSB10 thymosin, beta 10 /// NMJD21103 gl 0863894 NP_066926 Chr:2p11.2 2.43233 1.578435 thymosin, beta 10
1336 201663_s_at SMC4L1 SMC4 structural NM_005496 g4885112 NP__005487 Chr:3q26.1 2.40184 6.991358 maintenance of chromosomes 4-like 1 (yeast)
1337 219026_s_at RASAL2 RAS protein activator like 2 NMJD04841 g4758807 NP_004832 Chr:1q24 2.39773 7.646445 § /// RAS protein activator like 2
1338 206994 at CST1 cystatin SN /// cystatin SN NM 001899 g4503108 NP 001889 Chr:20p11.21 2.39487 5.685182
1339 200820 at PSMD8 proteasome (prosome, NM_002812 g4506232 NP_002803 Chr:19q13.13 2.38736 3.612633 macropain) 26S subunit, πon-ATPase, 8 /// proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
1340 211864_ _s_at FER1L3 fer-1-like 3, myoferlin (C. AF207990 gl 0834586 NP. _038479 Chr:10q24 2.3862 6.225758 elegans)
1341 212242. _at TUBA1 tubulin, alpha 1 (testis AL565074 Hs.75318.0 NP. .005991 Chr:2q36.1 2.37786 5.685182 specific)
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1342 201926_s_at DAF decay accelerating factor BC001288 gl 2654888 NP_000565 Chr:1q32 2.34643 4.436744 for complement (CD55, Cromer blood group System)
1343 206284_x_at CLTB clathrin, light Polypeptide NM_001834 g4502900 NP_001825 Chr:5q35 2.3376 5.685182 (Leb)
1344 210715_s_at SPINT2 serine protease inhibitor, AF027205 g2598967 NP_066925 Chr:19q13.1 2.31815 4.830969 Kunitz type, 2 /// serine Protease inhibitor, Kunitz type, 2
1345 209233_at C2F C2f protein U72514 g2276395 NP 006322 Chr:12p13 2.31448 10.20301
1346 201853_s_at CDC25B cell division eyele 25B /// NM_021873 g11641412 NP_004349 Chr:20p13 2.28393 6.225758 cell division eyele 25B
1347 218322_s_at ACSL5 acyl-CoA synthetase long- NM_016234 gl 2669912 NP_057318 Chr:10q25.1- 2.26919 3.612633 chain family member 5 /// q25.2 acyl-CoA synthetase long- chain family member 5
O
1348 210538_s_at BIRC3 baculoviral IAP repeat- U37546 gl 145290 NP_001156 Chr:11q22 2.26863 8.779357 containing 3 /// baculoviral IAP repeat-containing 3
1349 200660_at S100A11 S100 calcium binding NM_005620 g5032056 NP_005611 Chr:1q21 2.21304 1.578435 protein A11 (calgizzarin) /// S100 calcium binding protein A11 (calgizzarin)
1350 212353 at SULF1 sulfatase 1 AI479175 Hs.70823.0 NP 055985 Chr:8q13.2 2.20207 11.06357
1351 222555_s_at MRPL44 mitochondrial ribosomal AI338045 Hs.203559.0 NP_075066 Chr:2q36.3 2.20156 11.55252 protein L44
1352 217691_x_at SLC16A3 solute carrier family 16 AA853175 Hs.333049.0 NP_004198 Chr:17q25 2.17864 11.70204 (monocarboxylic acid transporters), member 3
1353 202806 at DBN1 drebrin 1 /// drebrin 1 NM 004395 g4758123 NP 004386 Chr:5q35.3 2.17682 13.40329
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value
Probennummer ID Protein ID Lokalisierung Change (%)
1354 212296 at PSMD14 proteasome (prosome, NM_005805 Hs.178761.0 NP_005796 Chr:2q24.3 2.17639 1.578435 macropain) 26S subunit, non-ATPase, 14 /// proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
1355 204620 s at CSPG2 chondroitin sulfate NM_004385 g4758081 NP_004376 Chr:5q14.3 2.16998 10.20301 proteoglycan 2 (versican) /// chondroitin sulfate proteoglycan 2 (versican)
1356 206571 s at MAP4K4 mitogen-activated protein NM_004834 g4758523 NP_004825 Chr:2q11.2-q12 2.15075 7.646445 kinase kinase kinase kinase 4 /// mitogen-activated protein kinase kinase kinase kinase 4
1357 211297 s at CDK7 cyclin-dependent kinase 7 L20320 g348242 NP_001790 Chr:5q12.1 2.15059 11.70204 (MO15 homolog, Xenopus laevis, cdk-activating kinase) /// cyclin-dependent kinase 7 (MO15 homolog, Xenopus laevis, cdk- activating kinase)
1358 200966. _x_at ALDOA aldolase A, fructose- NM_000034 g4557304 NP. .000025 Chr:16q22-q24 2.14844 1.578435 bisphosphate /// aldolase A, fructose-bisphosphate
1359 201189. _s_at ITPR3 inositol 1,4,5-triphosphate NM_002224 g4504794 NP. JD02215 Chr:6p21 2.1244 13.40329 receptor, type 3 /// inositol 1 ,4,5-triphosphate receptor, type 3
1360 201251. _at PKM2 pyruvate kinase, muscle /// NM_002654 g4505838 NP. .002645 Chr:15q22 2.10284 6.225758 pyruvate kinase, muscle
1361 212312. _at COX4I2 cytochrome c oxidase AL117381 Hs.305890.1 NP. .115998 Chr.20q11.21 2.09715 3.61384 subunit IV isoform 2
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1362 201037_at PFKP phosphofructokinase, NM_002627 gl 1321600 NPJD02618 Chr:10p15.3- 2.09187 7.646445 platelet /// p15.2 phosphofructokinase, platelet
1363 213741_s_at KPNA1 karyopherin alpha 1 BF575685 Hs.169149.1 NP_002255 Chr:3q21 2.07961 4.436744 (importin alpha 5)
1364 201650 at KRT19 keratin 19 /// keratin 19 NM 002276 g4504916 NP 002267 Chr:17q21.2 2.07469 8.153992
1365 200923_at LGALS3BP lectin, galactoside-binding, NM_005567 g6006016 NP_005558 Chr:17q25 2.0567 2.009521 soluble, 3 binding protein /// lectin, galactoside-binding, soluble, 3 binding protein
1366 201202_at PCNA proliferating cell nuclear NM_002592 g4505640 NP_002583 Chr:20pter-p12 2.04802 2.571322 antigen /// proliferating cell nuclear antigen
1367 202655_at ARMET arginine-rich, mutated in NM_006010 g5174392 NP_006001 Chr:3p21.1 2.04687 3.61384 early stage tumors /// arginine-rich, mutated in early stage tumors
1368 204489_s_at CD44 CD44 antigen (homing NM_000610 gl 0835162 NP_000601 Chr:11p13 2.0327 11.70204 function and Indian blood group System)
1369 209969_s_at STAT1 Signal transducer and BC002704 gl 2803734 NP_009330 Chr:2q32.2 2.0275 7.646445 activator of transcription 1 , 91 kDa
1370 201897_s_at CKS 1 B CDC28 protein kinase NM_001826 g4502856 NP_001817 Chr:1q21.2 2.02532 3.612633 regulatory subunit 1 B /// CDC28 protein kinase regulatory subunit 1 B
1371 203083_at THBS2 thrombospondin 2 /// NM_003247 g4507486 NP_003238 Chr:6q27 2.0243 7.646445 thrombospondin 2
1372 218677_at S100A14 S100 calcium binding NM_020672 gl 0190711 NP_065723 Chr:1q21.1 2.02382 14.22309 protein A14 /// S100 calcium binding protein A14
1373 212481_s_at TPM4 tropomyosin 4 AI214061 Hs.250641.1 NP 003281 Chr:19p13.1 2.02019 9.625715
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript ID Repräsentative Chromosomale FoId q-value Probennummer ID Protein ID Lokalisierung Change (%)
1374 218084_x_at FXYD5 FXYD domain containing NM_014164 gl 1612664 NP__054883 Chr:19q12- 2.01401 6.991358 ion transport regulator 5 /// q13.1 FXYD domain containing ion transport regulator 5
1375 202488_s_at FXYD3 FXYD domain containing NM_005971 gl 1612675 NP_005962 Chr:19q13.13 2.0118 4.830969 ion transport regulator 3 /// FXYD domain containing ion transport regulator 3
1376 20971 O_at GATA2 GATA binding protein 2 AL563460 Hs.760.1 NP 002041 Chr:3q21.3 0.48758 4.436744
1377 203131 at PDGFRA platelet-derived growth NM 006206 g5453869 NP 006197 Chr:4q11-q13 0.40793 0.201325 factor receptor, alpha Polypeptide /// platelet- derived growth factor receptor, alpha Polypeptide
In Tabelle 4 sind Gene aufgeführt, deren Expression im duktalen Adenokarzinom des Pankreas im Mittel maximal halb so hoch ist wie die Expression in normalem Pankreasepithelgewebe. D. h. der Quotient („Fold Change") aus den Expressionswerten im mikrodissektierten duktalen Adenomakarzinom des Pankreas (Mittel über 14 Patienten) und den Expressionswerten im gesunden mikrodissektierten duktalen Pankreasepithelgewebe (Mittel über 11 Personen) ist für diese Gene < 0,5. Wird für ein Gen der Quotient („Fold Change") 1000 angegeben, bedeutet dies, dass das Gen nur im Normalgewebe, aber nicht im Tumorgewebe nachgewiesen werden konnte. Die Gene sind ab der Nummer 1378 fortlaufend nummeriert. Zur Charakterisierung werden jeweils die Identifikationsnummer des Affymetrix-Probensets, das Gensymbol, der Gen-Name, die chromosomale Lokalisation, die repräsentative Identifikationsnummer (ID), die Identifikationsnummer des Transkriptes und die des zugehörigen Proteins angegeben (Veröffentlichungsnummern in der Entrez- Datenbank des National Center for Biotechnology Information (NCBI), Bethesda, USA (http://www.ncbi.nih.gov/entrez/). Der q-Wert (in Prozent) gibt an, mit welchem statistischen Fehler das verwendete Auswerteprogramm eine differentielle Genexpression voraussagt.
Tabelle 4:
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript Repräsentative Chromosomale FoId q-value Probennummer ID ID Protein ID Lokalisierung Change (%)
1378 203084_at TGFB1 transforming growth NM_000660 gl 0863872 NP_000651 Chr:19q13.1 1000 2.814919 factor, beta 1 (Camurati-Engelmann disease)
1379 1729_at TRADD TNFRSF1 A-associated L41690 L41690 NP_003780 Chr:16q22 2.559 0.095261 via death domain
1380 219304_s_at PDGFD platelet derived growth NM_025208 gl 3376807 NP_079484 Chr:11q22.3 0.49126 6.991358 factor D /// platelet derived growth factor D
1381 203675_at NUCB2 nucleobindin 2 /// NMJ3O5O13 g4826869 NP_005004 Chr:11p15.1-p14 0.47306 6.991358 nucleobindin 2
1382 226705_at FGFR1 fibroblast growth factor BE467261 Hs.748.8 NPJ300595 Chr:8p11.2-p11.1 0.46829 0.095261 receptor 1 (fms-related tyrosine kinase 2, Pfeiffer Syndrome)
1383 226625_at TGFBR3 transforming growth AW193698 Hs.79059.1 NP_003234 Chr:1p33-p32 0.45978 0.095261 factor, beta receptor III (betaglycan, 30OkDa)
1384 205051 s at KIT v-kit Hardy-Zuckerman NM_000222 g4557694 NPJ300213 Chr:4q11-q12 0.45787 4.830969 4 feline sarcoma viral oncogene homolog Ul v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
1385 203685 at BCL2 B-cell CLL/lymphoma NM_000633 g4557354 NP_000624 Chr:18q21.3 0.44313 0.095261 2 /// B-cell CLL/lymphoma 2
1386 210174 at NR5A2 nuclear receptor AF228413 Hs.183123.1 NP_003813 Chr:1q32.1 0.41209 3.612633 subfamily 5, groυp A, member 2 /// nuclear receptor subfamily 5, group A, member 2
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript Repräsentative Chromosomale FoId q-value Probennummer ID ID Protein ID Lokalisierung Change (%)
1387 205207_at IL6 interleukiπ 6 NM_000600 gl 0834983 NP_000591 Chr:7p21 0.40071 1.702877 (interferon, beta 2) /// interleukin 6 (interferon, beta 2)
1388 210397_at DEFB1 defensin, beta 1 /// U73945 gl 755147 NP_005209 Chr:8p23.2-p23.1 0.39972 11.06357 defensin, beta 1
1389 226333_at IL6R interleukin 6 receptor AV700030 Hs.17998.0 NP 000556 Chr:1q21 0.3997 1.051298
1390 203178_at GATM glycine NM_001482 g4503932 NP_001473 Chr:15q15.1 0.382 5.685182 amidinotransferase (L- arginine:glycine amidinotransferase)
1391 222043 at CLU clusterin (complement AI982754 Hs.75106.1 NP 001822 Chr:8p21-p12 0.35018 2.571322 lysis inhibitor, SP- 40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)
1392 215395_x_at PRSS3 Protease, serine, 3 U66061 Hs.302180.0 NP_002762 Chr:9p11.2 0.33276 11.06357 (mesotrypsin)
1393 206010_at HABP2 hyaluronaπ binding NM_004132 g4758501 NP_004123 Chr:10q26.11 0.32304 3.612633 protein 2 /// hyaluronan binding protein 2
1394 204705_x_at ALDOB aldolase B, fructose- NM_000035 g4557306 NP_000026 Chr:9q21.3-q22.2 0.31788 1.901012 bisphosphate
1395 206492_at FHIT fragile histidine triad NM_002012 g4503718 NP_002003 Chr:3p14.2 0.30534 6.991358 gene /// fragile histidine triad gene
1396 207463_x_at PRSS2 Protease, serine, 2 NM_002771 g4506148 NP_002761 Chr:7q34 0.29963 7.646445 (trypsin 2) /// protease, serine, 2 (trypsin 2)
1397 41657_at STK11 serine/threonine AF035625 4862706_RC NP_000446 Chr:19p13.3 0.26727 0.095261 kinase 11 (Peutz- Jeghers Syndrome)
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript Repräsentative Chromosomale FoId q-value
Probennummer ID ID Protein ID Lokalisierung Change >0'-
1398 205043 at CFTR cystic fibrosis NM_000492 g6995995 NP_000483 Chr:7q31.2 0.26656 5.685182 transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7) /// cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member J)
1399 204359 at FLRT2 fibronectin leucine rieh NM_013231 g7019380 NP_037363 Chr:14q24-q32 0.25466 4.436744 transmembrane protein 2 /// fibronectin leucine rieh transmembrane protein 2
1400 203908 at SLC4A4 solute carrier family 4, NM_003759 g4507024 NP_003750 Chr:4q21 0.24611 3.612633 £ c
Figure imgf000117_0001
\ sodium bicarbonate cotransporter, member 4 /// solute carrier family 4, sodium bicarbonate cotransporter, member 4
1401 213706 at GPD1 glycerol-3-phosphate AI368018 Hs.9739.1 NP_005267 Chr:12q12-q13 0.20425 0.095261 dehydrogenase 1 (soluble)
1402 207434 s at FXYD2 FXYD domain NM_021603 gl 1125763 NP_001671 Chr:11q23 0.19347 3.612633 containing ion transport regulator 2 /// FXYD domain containing ion transport regulator 2
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript Repräsentative Chromosomale FoId q-value
Probennummer ID ID Protein ID Lokalisierung Change (%)
1403 208450 at LGALS2 lectin, galactoside- NM_006498 g5729902 NP_006489 Chr:22q13.1 0.19141 4.436744 binding, soluble, 2 (galectin 2) /// lectin, galactoside-binding, soluble, 2 (galectin 2)
1404 214324 at BF222483 Hs.274454.0 0.15667 3.612633
1405 202888 s at ANPEP alanyl (membrane) NM_001150 g4502094 NP_001141 Chr:15q25-q26 0.15368 11.70204 aminopeptidase (aminopeptidase N, aminopeptidase M, microsomal aminopeptidase, CD13, p150) /// alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase M, microsomal aminopeptidase, CD13, p150)
1406 216699 s at KLK1 kallikrein 1, L10038 Hs.123107.1 NP 002248 Chr:19q13.3 0.14433 4.149813 renal/pancreas/salivary
1407 207636 at SERPIN12 serine (or cysteine) NM_006217 gl 0947029 NP_006208 Chr:3q26.1-q26.2 0.14425 4.830969 Proteinase inhibitor, clade I (neuroserpin), member 2 /// serine (or cysteine) Proteinase inhibitor, clade I (neuroserpin), member 2
1408 206311_s. _at PLA2G1B phospholipase A2, NM. ,000928 g4505846 NP. _000919 Chr:12q23-q24.1 0.13114 3.612633 group IB (pancreas) /// phospholipase A2, group IB (pancreas)
1409 206446_s. jat ELA2A elastase 2A /// NM. _001971 g4503546 NP. .254275 Chr:1p36.13 0.11261 3.612633 elastase 2A
Nr. Affymetrix Gensymbol Genname Repräsentative Transkript Repräsentative Chromosomale FoId q-value Probennummer ID ID Protein ID Lokalisierung Change (%)
1410 206151_x_at ELA3B elastase 3B, NM_007352 g6679624 NP_031378 Chr:1p36.12 0.1018 0.095261 pancreatic /// elastase 3B, pancreatic
1411 203924_at GSTA1 glutathione S- NM_000846 g4504170 NP_665683 Chr:6p12.1 0.09258 3.612633 transferase A1 /// glutathione S- transferase A1
1412 206694_at PNLIPRP1 pancreatic lipase- NM_006229 g5453919 NP_006220 Chr:10q26.12 0.0795 3.612633 related protein 1 /// pancreatic lipase- related protein 1
1413 214377_s_at CTRL chymotrypsin-like BF508685 Hs.150601.2 NP 001898 Chr:16q22.1 0.06878 8.779357
1414 205971 _s_at CTRB1 chymotrypsinogen B1 NM_001906 g4503134 NP_001897 Chr:16q23-q24.1 0.06862 4.436744 /// chymotrypsinogen B1
1415 205615_at CPA1 carboxypeptidase A1 NM_001868 g4502996 NP_001859 Chr:7q32 0.06354 6.225758 (pancreatic) /// carboxypeptidase A1 (pancreatic)
1416 227238_at MUC15 mucin 15 W93847 Hs.24139.0 NP 663625 Chr:11p14.3 0.06055 9.266777
1417 210168_at C6 complement J05064 gl 79703 NP_000056 Chr:5p13 0.04412 1.578435 component 6 /// complement component 6
1418 206131_at CLPS colipase, pancreatic /// NM_001832 gl 1496883 NP_001823 Chr:6pter-p21.1 0.0371 4.830969 colipase, pancreatic
1419 205910 s at CEL carboxyl ester lipase NM_001807 g4502770 NP_001798 Chr:9q34.3 0.03629 3.612633 (bile salt-stimulated lipase) /// carboxyl ester lipase (bile salt- stimulated lipase)
In einer bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens erfolgt zusätzlich zur Bestimmung der Menge an Genprodukt von mindestens einem der in Tabelle 1 und / oder Tabelle 2 aufgeführten Gene in einer Probe biologischen Ursprungs eines Individuums noch die Bestimmung der Menge an Genprodukt von mindestens einem der in Tabelle 3 und/oder Tabelle 4 aufgeführten Gene. Die Menge an Genprodukt in der Probe biologischen Ursprungs eines Individuums wird mit der Menge des entsprechenden Genprodukts, die in normalem Pankreasepithelgewebe üblicherweise vorliegt, verglichen. Falls es sich um ein in der Tabelle 3 aufgeführtes Gen handelt, ist eine erhöhte Menge des Genprodukt ein Indiz für das Vorliegen eines Pankreaskarzioms. Falls es sich um ein in der Tabelle 4 aufgeführtes Gen handelt, ist eine erniedrigte Menge des Genprodukts ein Indiz für das Vorliegen eines Pankreaskarzinoms.
Durch die Messung eines solchen zusätzlichen Markers (Gene aus Tabelle 3 und/oder Tabelle 4) wird die Aussagekraft des erfindungsgemäßen Verfahrens noch weiter erhöht.
Ein Genprodukt ist eine mRNA, die daraus durch reverse Transkription erhältliche cDNA, das kodierte Protein oder Fragmente davon. Die Quantifizierung der Genprodukte erfolgt dabei jeweils mit den gängigen Verfahren.
Die Genprodukte mRNA bzw. die durch reverse Transkription der mRNA erhältliche cDNA werden bevorzugt durch den Einsatz von Hybridisierungstechniken quantifiziert, beispielsweise durch einen Northern Blot, in situ Hybridisierung mit antisense-RNA, quantitative PCR (Polymerase chain reactiori) oder mit Hilfe eines Oligonukleotid- oder eines cDNA-Mikroarrays (z.B. DNA-Chip).
Die Oligonukleotide, die für die verschiedenen Nachweistechniken mittels Hybridisierung eingesetzt werden, haben Sequenzen, die komplementär zu Teilsequenzen des zu detektierenden Genprodukts sind, und sind vorzugsweise mit einem chromogenen, radioaktiven, fluoreszierenden oder durch andere gängige Methoden detektierbaren Markermolekül markiert. Beispiele für solche Markermoleküle sind Digoxygenin, Biotin, Fluorescein, 32P, 33P, usw.
Bevorzugt erfolgt die quantitative Messung der Expression des Genprodukts mRNA mittels quantitativer RT-PCR. In dem bekannten Prozess der RT-PCR wird zunächst mit Hilfe des Enzyms Reverse Transkriptase (RT) basierend auf der isolierten RNA komplementäre DNA (cDNA) synthetisiert. Als Primer für die RT kann grundsätzlich ein Oligo-dT verwendet werden. Die Verwendung von Random-Hexamer-Primern für die RT führt jedoch zu einer deutlichen Erhöhung der Sensitivität. Das Random-Hexamer-Oligonukleotid enthält jeweils eine Mischung von A, G, T, C an allen sechs Positionen und hybridisiert unspezifisch mit mRNA-Sequenzen.
Einzelne cDNAs werden in der anschließenden PCR mit einem sequenzspezifischen Primerpaar amplifiziert. Die Primer für die PCR haben bevorzugt eine Länge von 15 bis 30 Basenpaaren und werden Intron-überlappend konzipiert, um im Falle einer Verunreinigung der RNA mit genomischer DNA nur cDNA zu amplifizieren.
Besonders bevorzugt wird die PCR als Real-time-PCR durchgeführt. Bekannte Real-time PCR Verfahren sind z. B. die TaqMan®, FRET (Fluoreszenz-Resonanz-Energie-Transfer), LightCycler® und Beacon-Verfahren. Durch die Verwendung von Fluoreszenz-markierten Primern oder den Einsatz von genspezifischen Oligonukleotiden als Hybridisierungsproben mit unterschiedlicher Farbstoff- oder Fluoreszenzmarker-Anbindung (TaqMan®, FRET, Beacon) kann bei diesen Verfahren vorteilhaft das PCR-Produkt während der PCR spezifisch quantifiziert werden.
Die PCR-Verfahren eignen sich auch zur Durchführung als Multiplex-PCR. Bei einer Multiplex-PCR unterscheiden sich die Fluoreszenzfarbstoffe, mit denen die Primer bzw. Hybridisierungssonden markiert sind, in ihren Absorptions- und/oder Emissionsspektren. Dies ermöglicht beispielsweise eine parallele Quantifizierung der amplifizierten cDNAs verschiedener pankreastumorspezifischen Gene bzw. die parallele Quantifizierung der cDNA eines Referenzgens bzw. einer Referenzprobe.
Zur Durchführung des erfindungsgemäßen Verfahrens zur Diagnose mittels RT-PCR wird bevorzugt ein diagnostischer Kit verwendet, der jeweils folgende Bestandteile enthält:
1 ) für die cDNA-Synthese: a) Random-Hexamer-Primer, b) Reverse Transkriptase;
2) für die PCR: a) mindestens zwei Primer, die mit der cDNA eines der Gene, ausgewählt aus den Gruppen der tumorspezifischen Gene aus den Tabellen Nr. 1 und/oder Nr. 2 hybridisieren; b) eine über 80°C beständige DNA-Polymerase, wie z. B. Taq-Polymerase; sowie dNTP-Mix (bevorzugt 10mmol/l), DDT, RNase-Inhibitor und entsprechende Reaktionspuffer.
In einer weniger bevorzugten Ausführungsform enthält der Kit für die cDNA-Synthese oligo- dT anstelle des Random-Hexamers.
In einer alternativen Ausführungsform enthält das Kit zusätzlich mindestens zwei Primer, die mit der cDNA eines der Gene, ausgewählt aus den Gruppen der tumorspezifischen Gene aus den Tabellen 3 und 4 hybridisieren.
In einer Ausführungsform des Kits ist jeweils einer der Primer für das tumorspezifische Gen Fluoreszenz-markiert.
In einer besonders bevorzugten Ausführungsform enthält der diagnostische Kit zur Durchführung einer Real-Time PCR bevorzugt als zusätzliche Bestandteile: c) eine Fluoreszenz-markierte Hybridisierungssonde oder ein Paar Fluoreszenz¬ markierter Hybridisierungssonden, die spezifisch mit einem tumorspezifischen Gen aus Tabelle 1 und/oder Tabelle 2 hybridisieren, und d) eine Fluoreszenz-markierte Hybridisierungssonde oder ein Paar Fluoreszenz¬ markierter Hybridisierungssonden, die spezifisch mit dem Referenzgen hybridisieren.
Sowohl als Primer, als auch als Hybridisierungssonden werden bevorzugt DNA- Oligonukleotide mit einer Länge von 10 bis 30 Nukleotiden gewählt.
In einer Ausführungsform enthält die Hybridisierungssonde neben dem Fluoreszenzfarbstoff einen weiteren Farbstoff, der durch einen Fluoreszenz-Resonanz-Energie-Transfer (FRET) die Fluoreszenz quencht, solange die Probe nicht mit der amplifizierten cDNA hybridisiert.
In einer alternativen Ausführungsform des Kits werden zwei Hybridisierungssonden eingesetzt, bei denen jeweils eine Sonde mit einem Farbstoff markiert ist. Ein solches Sondenpaar wird so gewählt, dass sie in einem geringen Abstand, bevorzugt im Abstand von 1-5 bp, auf der amplifizierten cDNA hybridisieren. Durch die Hybridisierung werden die Fluoreszenzfarbstoffe so nahe zueinander gebracht, dass FRET stattfindet und die cDNA quantifiziert werden kann. Anschließend werden (in der Extensionsphase der PCR), durch die Exonuklease-Aktivität der Polymerase, die Sonden von der cDNA abgetrennt. In einer bevorzugten Variante ist in einem Sondenpaar, die erste Sonde am 3'-Ende mit Fluorescein (FL) und die andere an ihrem 5'-Ende mit LightCycler-Red-640 markiert. Fluoreszenz-markierte Hybridisierungssonden sind z. B. als LightCycler®, TaqMan® oder „molecular beacons" auf dem Markt und ermöglichen eine Quantifizierung während der PCR.
Der Nachweis über Hybridisierung erfolgt in einer alternativen Ausführung des Verfahrens unter Verwendung eines Nukleinsäure-Arrays, z.B. eines DNA-Chips.
DNA-Chips, auch als DNA-Mikroarrays bekannt, sind miniaturisierte Träger, meist aus Glas oder Silizium, auf deren Oberfläche DNA-Moleküle bekannter Sequenz in einem geordneten Raster in hoher Dichte immobilisiert werden. Die oberflächengebundenen DNA-Moleküle werden mit komplementären, eventuell markierten Nukleinsäuren hybridisiert. Die Markierung ist vorzugsweise ein Fluoreszenzfarbstoff.
Bei Oligonukleotid-Chips stellen die Oligonukleotide, die auf einem erfindungsgemäßen DNA-Chip gebunden sein können, Teilsequenzen der Genprodukte (mRNA, bzw. daraus abgeleitete cDNA) in der sense- oder antisense-Richtung dar. Es können ein oder mehrere Oligonukleotide pro Gen auf dem DNA-Chip gebunden sein. Bevorzugt sind 25 Nukleotid lange Oligonukleotide, die aus dem nicht kodierenden Strang abgeleitet sind. Diese werden bevorzugt aus dem jeweiligen 3' untranslatierten Ende des Gens ausgewählt. Zur Detektion können Oligonukleotide von einem Gen, mehreren Genen oder allen Genen ausgewählt werden.
Die Erfindung betrifft daher weiterhin die Verwendung mindestens eines Oligonukleotids, das der vollständigen cDNA-Sequenz oder einer Teilsequenz bzw. komplementären Sequenz eines der in Tabelle 1 und/oder 2 aufgeführten Gene entspricht, zur Diagnoses des Pankreaskarzinoms, insbesondere des duktalen Adenomakarzinoms des Pankreas. Das Oligonukleotid kann dazu als Primer in einer PCR oder als Hybridisierungssonde eingesetzt werden. Das verwendete Oligonukleotid bzw. die verwendeten Oligonukleotide sind dabei vorzugsweise auf einem festen Träger (DNA-Chip) immobilisiert.
In einer alternativen Ausführungsform wird zusätzlich mindestens ein Oligonukleotid, das der vollständigen cDNA-Sequenz oder einer Teilsequenz bzw. komplementären Sequenz eines der in Tabelle 3 und/oder 4 aufgeführten Gene entspricht, zur Diagnoses des Pankreaskarzinoms, insbesondere des duktalen Adenomakarzinoms des Pankreas verwendet. Das verwendete Oligonukleotid bzw. die verwendeten Oligonukleotide sind dabei vorzugsweise auf einem Chip immobilisiert. Ist das zu quantifizierende Genprodukt ein Protein oder ein Proteinfragment, erfolgt die Bestimmung der Menge an Genprodukt vorzugsweise durch Antikörper-basierte Nachweismethoden.
Dazu werden spezifische Antikörper gegen eines oder mehrere Proteine, die von den in Tabelle 1 und/oder Tabelle 2 aufgeführten Genen kodiert werden, hergestellt. In einer alternativen Ausführungsform werden zusätzlich Antikörper gegen eines oder mehrere Proteine, die von den in Tabelle 3 und/oder Tabelle 4 aufgeführten Genen kodiert werden, eingesetzt.
Bei den Antikörpern handelt es sich beispielsweise um monoklonale Antikörper, polyklonale Antikörper, Single chain Antikörper oder Fragmente davon. Sie sind spezifisch für das gesamte Protein oder nur gegen Fragmente davon. Die Gewinnung eines solchen Antikörpers erfolgt nach Standardmethoden beispielsweise durch Immunisierung von Versuchstieren. Die Antikörper werden dann z.B. in einem ELISA (enzyme linked immunsorbent assay), in einem RIA (radio-immunoassay) oder in der Immunhistochemie zur Quantifizierung des Genprodukts verwendet.
Ein Antikörper-Array bzw. Antikörperchip, auf dessen Oberfläche mindestens ein Antikörper, der spezifisch für ein von den in Tabelle 1 und/oder Tabelle 2 aufgeführten Genen kodiertes Protein ist, in einem geordneten Rahmen in hoher Dichte immobilisiert ist, eignet sich ebenfalls zur erfindungsgemäßen Diagnose des Pankreaskarzinoms. Die Dektektion der Protein-Protein-Interaktion erfolgt vorzugsweise durch Massenspektrometrie, Fluoreszenz oder surface plasmon resonance.
Die Erfindung betrifft ferner die Verwendung eines erfindungsgemäßen Antikörper-Chips zur Diagnose des Pankreaskarzinoms.
Das erfindungsgemäße Verfahren eignet sich auch zur Beurteilung des Krankheitsverlaufs, um z.B. den Erfolg einer Therapie zu bestimmen. In diesem Fall wird die Patientenprobe mit einer älteren Probe des Patienten verglichen.
Ein anderer Aspekt der Erfindung betrifft ein Verfahren zum Screenen nach Wirkstoffen, die zur Therapie des Pankreaskarzinoms, insbesondere des duktalen Adenomakarzinoms des Pankreas, geeignet sind. Dabei wird beispielsweise eine Zelllinie eines pankreatischen duktalen Adenokarzinoms mit einer zu testenden Substanz kontaktiert. Anschließend wird die Menge an Genprodukt von mindestens einem der in Tabelle 1 und/oder Tabelle 2 aufgeführten Gene bestimmt. Die Menge an Genprodukt wird dann mit der Menge des entsprechenden Genprodukts, die in einer entsprechenden nicht mit der Testsubstanz kontaktierten Zelllinie vorliegt, verglichen.
Falls es sich um ein in Tabelle 1 aufgeführtes Genprodukt handelt, ist eine gegenüber der unbehandelten Zelllinie erniedrigte Menge des Genprodukts ein Hinweis darauf, dass die Testsubstanz ein potenzieller Wirkstoff für die Therapie des Pankreaskarzinoms ist. Falls es sich um ein in Tabelle 2 aufgeführtes Genprodukt handelt, ist eine gegenüber der unbehandelten Zelllinie erhöhte Menge des Genprodukts ein Hinweis darauf, dass die Testsubstanz ein potenzieller Wirkstoff für die Therapie des Pankreaskarzinoms ist.
In einer alternativen Ausführungsform des Screeningverfahrens werden zusätzlich zur Expression von mindestens einem der in Tabelle 1 und/oder Tabelle 2 aufgeführten Gene die Menge an Genprodukt von mindestens einem der in Tabelle 3 und/oder Tabelle 4 aufgeführten Gene bestimmt.
Falls es sich um ein in Tabelle 3 aufgeführtes Genprodukt handelt, ist eine gegenüber der unbehandelten Zelllinie erniedrigte Menge des Genprodukts ein Hinweis darauf, dass die Testsubstanz ein potenzieller Wirkstoff für die Therapie des Pankreaskarzinoms ist. Falls es sich um ein in Tabelle 4 aufgeführtes Genprodukt handelt, ist eine gegenüber der unbehandelten Zelllinie erhöhte Menge des Genprodukts ein Hinweis darauf, dass die Testsubstanz ein potenzieller Wirkstoff für die Therapie des Pankreaskarzinoms ist.
Die Erfindung betrifft zudem die Verwendung mindestens eines Antisense-Konstrukts, das mindestens 12 Nukleotide einer Sequenz eines Gens umfasst, das in Tabelle 1 aufgeführt ist, wobei die Sequenz bezüglich des Promotors, der ihre Expression kontrolliert, in 3' zu 5' Orientierung vorliegt, für die Herstellung einer pharmazeutischen Zusammensetzung zur Behandlung des Pankreaskarzinoms beim Menschen, wobei das Antisense-Produkt den Krebszellen verabreicht wird, so dass das Antisense-Konstrukt in den Krebszellen exprimiert wird.
Unter Antisense-Konstrukt wird dabei eine Sequenz verstanden, die zu der Sequenz oder einer Teilsequenz der Sequenz komplementär ist, d. h. in der Lage ist mit der Sequenz über Basenpaarung einen Nukleinsäuredoppelstrang zu bilden. In einer alternativen Ausführungsform wird zusätzlich mindestens ein Antisense-Konstrukt, das mindestens 12 Nukleotide einer Sequenz eines Gens umfasst, das in Tabelle 3 aufgeführt ist, wobei die Sequenz bezüglich des Promotors, der ihre Expression kontrolliert, in 3' zu 5' Orientierung vorliegt, für die Herstellung einer pharmazeutischen Zusammensetzung zur Behandlung des Pankreaskarzinoms beim Menschen verwendet, wobei das Antisense-Produkt den Krebszellen verabreicht wird, so dass das Antisense- Konstrukt in den Krebszellen exprimiert wird.
Das Antisense-Konstrukt wird vorzugsweise durch chemische Synthese, auch unter Verwendung von stabilisierenden Nukleotidanaloga, gewonnen.
Teil der Erfindung ist ebenfalls die Verwendung mindestens eines doppelsträngigen RNA- Konstrukts (siRNA - small interfering RNA), das mindestens 19 Basenpaare, besonders bevorzugt 21 oder 22 Basenpaare, maximal 29 Basenpaare, einer Sequenz eines Gens umfasst, das in Tabelle 1 aufgeführt ist, für die Herstellung eines Arzneimittels zur Behandlung des Pankreaskarzinoms beim Menschen. Die doppelsträngige RNA wird z.B. chemisch hergestellt oder mit bekannten biologische Verfahren, beispielsweise in vitro Transkription, den Einsatz von siRNA-Expressionvektoren oder PCR-Expressionskassetten.
In einem bevorzugten Verfahren wird dazu beispielsweise ein cDNA Klon verwendet. Aus diesem wird mittels PCR ein in Tabelle 1 aufgeführtes Gen vervielfältigt und dann durch eine in vitro Transkription doppelsträngige RNA (dsRNA) hergestellt. Diese dsRNA wird dann mit dem Enzym Dicer verdaut. Dabei entstehen die für die Wirkung notwendigen kleinen Stücke in einer Länge von z.B. 21 bp. Das entstandene Gemisch wird dann zur Therapie eingesetzt. Dabei werden die siRNA Moleküle beispielsweise intravenös dem Patienten zugeführt. Die siRNA wirken hierbei gegen die Expression der im Pankreaskarzinom spezifisch überexprimierten Gene.
In einer besonders bevorzugten Ausführungsform der Erfindung werden doppelsträngige
RNA-Konstrukte für die Herstellung eines Arzneimittels zur Behandlung des
Pankreaskarzinoms eingesetzt, die eine Sequenz ausgewählt aus einem der folgenden
Gene umfassen:
APLP2(Nr. 232, Tabelle 1 , Affymetrix-Probennummer 214875_x_at, Genname amyloid beta
(A4) precursor-like protein 2),
ECT2 (Nr. 506, Tabelle 1 , Affymetrix-Probennummer 219787_s_at, Genname epithelial cell transforming sequence 2 oncogene), FLJ11323 (Nr. 311 , Tabelle 1 , Affymetrix-Probennummer 218951_s_at, Genname hypothetical protein FLJ11323 NM_018390),
TTK (Nr. 103, Tabelle 1 , Affymetrix-Probennummer 204822_at, Genname TTK protein kinase /// TTK protein kinase).
In einer alternativen Ausführungsform wird zusätzlich mindestens ein doppelsträngiges RNA- Konstrukt, das mindestens 19 Basenpaare, besonders bevorzugt 21 oder 22 Basenpaare, maximal 29 Basenpaare, einer Sequenz eines Gens umfasst, das in Tabelle 3 aufgeführt ist, für die Herstellung eines Arzneimittels zur Behandlung des Pankreaskarzioms beim Menschen verwendet. Die doppelsträngige RNA ist dabei z.B. chemisch herstellbar oder über bekannte biologische Verfahren. Dazu wird beispielsweise ein cDNA Klon verwendet. Aus diesem wird mittels PCR ein in Tabelle 3 aufgeführtes Gen vervielfältigt und dann durch eine in vitro Transkription dsRNA hergestellt. Diese dsRNA wird dann mit dem Enzym Dicer verdaut. Dabei entstehen die für die Wirkung notwendigen kleinen Stücke in einer Länge von z.B. 21 bp. Das entstandene Gemisch wird dann zur Therapie eingesetzt.
In einer besonders bevorzugten Ausführungsform der Erfindung werden zusätzlich doppelsträngige RNA-Konstrukte für die Herstellung eines Arzneimittels zur Behandlung des
Pankreaskarzinoms eingesetzt, die eine Sequenz ausgewählt aus einem der folgenden
Gene umfassen:
CXCL5 (Nr. 1330, Tabelle 3, Affymetrix-Nr. 214974_x_at, Genname chemokine (C-X-C motif) ligand 5),
FOXM 1 (Nr. 1272, Tabelle 3, Affymetrix-Nr. 202580_x_at, Genname forkhead box M1).
Die Erfindung betrifft weiterhin die Verwendung mindestens eines Polynukleotids, das eine Sequenz eines Gens umfasst, das in Tabelle 2 aufgeführt ist, zur Herstellung einer pharmazeutischen Zusammensetzung zur Behandlung des Pankreaskarzinoms beim Menschen, wobei das Polynukleotid den Krebszellen verabreicht wird, so dass das Gen in den Krebszellen exprimiert wird.
In einer alternativen Ausführungsform wird zusätzlich mindestens ein Polynukleotid, das eine Sequenz eines Gens umfasst, das in Tabelle 4 aufgeführt ist, zur Herstellung einer pharmazeutischen Zusammensetzung zur Behandlung des Pankreaskarzinoms beim Menschen verwendet, wobei das Polynukleotid den Krebszellen verabreicht wird, so dass das Gen in den Krebszellen exprimiert wird. Das Polynukleotid wird dazu in einen viralen Vektor eingebracht und den Patienten direkt in den Tumor oder intravenös appliziert. Das Polynukleotid, in Verbindung mit einem Promotor für die Transkription, kann auch als freie DNA dem Patienten in einem Komplex mit Lipiden oder ohne eine Lipid-Komplex dem Patienten intratumoral oder intra-venös zugeführt werden.
Durch nachfolgende Figuren und Ausführungsbeispiele werden die Erfindung und die der Erfindung zugrunde liegende wissenschaftliche Erkenntnis näher erläutert. Dabei zeigen
Figur 1 :
Fig. 1 zeigt photographische Aufnahmen einer manuellen Mikrodissektion von Pankreasgewebe. Dabei sind in der linken Spalte die Gewebeschnitte vor der Mikrodissektion und in der rechten Spalte nach der Mikrodissektion abgebildet. Die obere Zeile zeigt Gewebe aus duktalem Adenomakarzinom des Pankreas, die untere Zeile normales duktales Epithelgewebe.
Figur 2:
Fig. 2 zeigt photographische Aufnahmen präparierter Gewebeschnitte nach immunhistochemischer Analyse.
Fig. 2 A, B zeigt eine Aufnahme eine CENPF-Proteinexpression in duktalen
Adenokarzinomen des Pankreas (PDAC), während Fig. 2 C die nicht vorhandene
Expression des CENPF Proteins in normalem Pankreasgewebe zeigt.
Fig. 2 D, E zeigt eine Aufnahme eine MCM7-Proteinexpression in duktalen
Adenokarzinomen des Pankreas (PDAC), während Fig. 2 F die nicht vorhandene Expression des MCM7 Proteins in normalem Pankreasgewebe zeigt.
Fig. 2 G, H zeigt eine Aufnahme eine MCM2-Proteinexpression in duktalen
Adenokarzinomen des Pankreas (PDAC), während Fig. 2 I die nicht vorhandene Expression des MCM2 Proteins in normalem Pankreasgewebe zeigt.
Figur 3:
Fig. 3 zeigt die Validierung der differentiellen Expression mittels RT-PCR.
Fig. 3 A: RT-PCR Analyse von 5 Genen in vier Tumor und korrespondierendem
Normalgewebe. Die entstandenen PCR Produkte wurden mittels einem Agarosegel separiert und mit Ethidiumbromidanfärbung sichtbar gemacht.
Fig. 3 B: Überblick über die RT-PCR Ergebnisse von Tumor- und Normalgewebe (oben), als auch Pankreaszellinien (unten). Weiss: nicht untersucht; Hellgrau: kein verwertbares PCR Signal; Mittelgrau: schwaches PCR Signal nachweisbar; Dunkelgrau: mittelstarkes PCR- Signal und Schwarz: Starkes PCR Signal nachweisbar. Die Housekeepinggene GAPDH und G6PD dienten als Vergleichskontrolle.
Ausführungsbeispiel 1 : Identifizierung von Pankreaskarzinom-assoziierten Genen
Es wurde nach der Entnahme in flüssigem Stickstoff frisch eingefrorenes Gewebe aus duktalem Pankreaskarziom (N=14) und aus normalem Pankreasgewebe (N=11) verwendet. Das Normalgewebe entstammte aus Proben des Hauptganges, die keine sichtbaren dysplastischen Veränderungen enthielten.
Von den Gewebestücken wurden dann wenige 10 μm dicke Schnitte geschnitten und sofort in 70% Ethanol fixiert. Diese Schnitte wurden mit Hämatoxylin und Eosin angefärbt und eingedeckt. Diese Probeschnitte dienten als Vorlage für die Mikrodissektion, da an ihnen die Areale eingezeichnet wurden, welche für die Mikrodissektion geeignet schienen. Von dem Gewebeblock wurden dann 5 μm dicke Serienschnitte angefertigt. Diese Schnitte wurden in RNase freiem 70% Ethanol fixiert und auch kurz mit Hämatoxylin und Eosin angefärbt. Tumor- und Normale Zellen wurden aus diesen Gewebeschnitten mit einer sterilen Kanüle aus den Schnitten herausgekratzt. Pro Gewebestück wurden ca. 10000 bis 11000 Zellen isoliert, wobei darauf geachtet wurde, dass ca. 95% des mikrodisseziierten Gewebes aus Tumor bzw. normalen Epitheizellen bestand (Fig. 1). Die Zellen wurden dann in eiskaltem GTC-Puffer (Guanidin-Thiocyanat-Puffer, Promege, Heidelberg) gesammelt. Aus den Zellen wurde dann die Poly-A+-RNA mittels eines Reaktionssystems (PolyAttract 1000, Promega, Heidelberg), gemäß der Anleitung, isoliert. Mit jeder Probe wurde dann dreimalig cDNA- Synthese mit anschliessender repetitiver /n-v/ϊ/O-Transkription durchgeführt (21 ). Zusammenfassend wird die cDNA-Synthese durch das Hybridisieren mit dem Affymetrix T7- oligo-dT Promoter-Primer in einer Konzentration von 0.1 mmol/l initiiert. Die Zweitstrang- Synthese geschieht durch internes Primen. Anschliessend wird eine /n-w'f/O-Transkription unter Verwendung des Ambion Megascript T7 Reaktionssystem (Ambion, Huntington, UK) nach Herstellerangaben durchgeführt. Die so hergestellte aRNA wird dazu verwendet, um erneut eine cDNA-Synthese zu initiieren, bei der die Zweitstrangsynthese durch Random- Hexamer Primer initiiert wird. Bei der dritten //7-wf/O-Transkription wird erneut so verfahren, allerdings werden dabei Biotin-markierte Nukleotide nach den Affymetrix-Herstellerangaben zugegeben. Die weitere Vorbereitung der Proben und die Hybridisierung verläuft nach den Angaben von Affymetrix.
Das Affymetrix U 133 Gene Chip Set besteht aus zwei GeneChips, auf welchen mehr als 44000 Probesets aufgetragen worden sind. Dadurch werden ca. 33.000 humane Gene und ca. 6000 humane ESTs repräsentiert. Nach der Hybridisierung werden die Signalintensitäten durch die Affymetrix MAS 5.0 Software ausgelesen und in der sogenannten Cel-Datei gespeichert. Diese 'wird dann zur weiteren Daten-Analyse verwendet. Zur Analyse werden die Dateien aller Experimente in das Programm dChip 1.3 (http://www.dchip.org) geladen, normalisiert und die Expressions-Werte, als auch die Werte für den Nachweis (Absolute CaIIs) werden mit dem PM/MM Modell bestimmt. Diese Werte werden dann in Excel und in SAM (http://www-stat.stanford.edu/ftibs/SAM/) eingelesen. Eine differentielle Expression wurde dann nachgewiesen, wenn folgende Kriterien erfüllt waren: Ein Quotient > 2 und ein q- Wert < 15% oder ein Presence call in wenigstens 60% eines Probentyps ohne einen Presence CaII in dem anderen Probentyp (Tabellen 1 bis A).
Von den 616 differentiell exprimierten Gene wurden folgende zur Validierung mittels RT-PCR ausgewählt (Fig. 3):
PLAG1 (Gen-Nr. 159, Tabelle 1 ), PTTG1 (Gen-Nr. 1315, Tabelle 3), osf-2/POSTN (Gen-Nr. 1303, Tabelle 3), RAMP (Gen-Nr. 138, Tabelle 1), ECT2 (Gen-Nr. 506, Tabelle 1), CFLAR (Gen-Nr. 526, Tabelle 1), CCNB1 (Gen-Nr. 1287, Tabelle 3), CCNB2 (Gen-Nr. 203, Tabelle 1), UP/UPP1 (Gen-Nr. 176, Tabelle 1), MADD (Gen-Nr. 1269, Tabelle 3), LOXL2 (Gen-Nr. 184, Tabelle 1), HOXC6 (Gen-Nr. 158, Tabelle 1), EFNB2 (Gen-Nr. 186, Tabelle 1), IRAK1 (Gen-Nr. 370, Tabelle 1 ) und CENPF (Gen-Nr. 108, Tabelle 1). Die Housekeepinggene GAPDH und G6PD dienten als Vergleichskontrolle.
Für die RT-PCR Analyse wurden 9 Proben von Normalgewebe und 13 von PDAC-(duktales adenokarzinom des Pankreas) Gewebe auf die Expression der ausgewählten Gene untersucht. Dazu wurde die RNA aus normalem pankreatischen Gewebe und von pankreatischem Tumorgewebe mit Hilfe des „Micro to Mini Total RNA Purification Kit" (Invitrogen) nach Herstellerangaben isoliert. Nach der reversen Transkription mit random Hexamer-Primem und der „Superscript" Reversen Transkriptase (Invitrogen) folgte eine PCR Amplifikation (580C Annealing Temperatur, 27 Zyklen) unter Standardbedingungen. Die Primer für die PCR-Amplifikation wurden von MWG-Biotech, Ebersberg, synthetisiert. Es wurden folgende Primer eingesetzt:
GAPDH δ'-CCAGCCGAGCCACATCGCTC-S' (SEQ-ID 1) δ'-ATGAGCCCCAGCCTTCTCCAT-S' (SEQ-ID 2)
G6PD δ'-ACGTGATGCAGAACCACCTACTG-S' (SEQ-ID3)
5ΑCGACGGCTGCAAAAGTGGCG-3' (SEQ-ID4)
CCNB1 ö'-GATATCTATCAGTATCTCAGGCAGCTG-S' (SEQ-ID 5) δ'-ATACTTGGAAGCCAAGAGCAGAGC-S' (SEQ-ID 6)
CCNB2
Ö'-GATATCTATCAGTATCTCAGGCAGCTG-S' (SEQ-ID 7) δ'-ATACTTGGAAGCCAAGAGCAGAGC-S' (SEQ-ID 8)
CENPF
5'-GCGGCAGAAAAGAAACAGAC-3I (SEQ-ID 9) δ'-TCTTCTGTGTCGATGCCAAG-S' (SEQ-ID 10)
CFLAR δ'-ATGGACAGAAAAGCTGTGGAG-S' (SEQ-ID 11) δ'-CTTCAGGTCTATTCTGTGGATG-S' (SEQ-ID 12)
EFNB2 δ'-CTGCTGGATCAACCAGGAAT-S' (SEQ-ID 13)
5'-CTGTTGCCGTCTGTGCTAGA-3' (SEQ-ID 14)
H0XC6 δ'-ACAGACCTCAATCGCTCAGG-S' (SEQ-ID 15) δ'-GGTACCGCGAGTAGATCTGG-S' (SEQ-ID 16)
L0XL2 δ'-CAGACCACCTACCTGGAGGA-S' (SEQ-ID 17) δ'-GTTGTGGATCTGGGAGGAGA-S' (SEQ-ID 18)
MADD δ'-TGTGCAGGACCTGAAGACTG-S' (SEQ-ID 19)
5'-ACAAAGACGCCTCGAACTGT-3' (SEQ-ID 20) osf-2 δ'-TGCATTATTCACAGGTGCCAG-S' (SEQ-ID 21) δ'-ACTCTCCAGTGTTCTGAGTC-S' (SEQ-ID 22)
PTTG1 ö'-AAGGAAAATGGAGAACCAGGC-S' (SEQ-ID 23) δ'-GCTTGGCTGTTTTTGTTTGAGG-S' (SEQ-ID 24)
RAMP
5ΑCAGCAGCAGGTGATCAAACAGC-3' (SEQ-ID 25)
5'-GAAGGAGCAGAGTCCTTTTGAATTCTG-S' (SEQ-ID 26)
PLAG1 δ'-TTTCCTTGCCAACTGTGTGAC-S' (SEQ-ID 27) δ'-CTTTGTTAGGGTCGTGTGTATG-S' (SEQ-ID 28)
ECT2 δ'-ACTAGCTTGGCAGACTCTTC-S' (SEQ-ID 29) δ'-ATCCTGAAAGTCCGTGACTAC-S' (SEQ-ID 30)
UP δ'-CGGAAAACGGACCTTAACAA-S' (SEQ-ID 31) δ'-GATACGCCTGCTTGTCCTTC-S' (SEQ-ID 32) Die PCR-Produkte wurden mittels Agarosegelelektrophorese separiert und mit Ethidiumbromid angefärbt.
Die Gesamt-RNA aus pankreatischen Zelllinien wurde mit dem RNAeasy RNA isolation kit (Qiagen, Hilden) isoliert und wie oben in cDNA transkribiert. Zur quantitativen PCR-Detektion wurde ein ABI Sequence Detection System 7700 und der Sybr Green Master Mix (ABI, Weiterstadt) nach Herstellerangaben eingesetzt.
Ausführungsbeispiel 2: Immunhistochemie zum Nachweis der MCM2, der MCM7 oder der CENPF Proteinexpression in Pankreastumoren zur Diagnose:
Figur 2 zeigt die Ergebnisse einer immunohistochemischen Analyse der MCM2 (Gen-Nr.
107, Tabelle 1 ), MCM7 (Gen-Nr. 395, Tabelle 1) und der CENPF-Proteinexpression (Gen-Nr.
108, Tabelle 1 ) in Pankreasgewebeschnitten. Zur Herstellung dieser Schnitte wird Pankreasgewebe in einem operativen Eingriff entnommen und zur Fixierung in gepuffertem 4% Formalin eingelegt. Nach der Fixierung wird das Gewebe nach einer gängigen Methode in Paraffin eingebettet (22). Von diesem in Paraffin eingebetteten Gewebe werden Schnitte mit einer Dicke von 4 μm mit einem Mikrotom (Leica, Nussloch) angefertigt und auf speziell vorbereitete Objektträger (Superfrost; Menzel Gläser, Braunschweig) aufgezogen. Danach werden die Schnitte durch eine Inkubation in XyIoI von dem Paraffin befreit. Danach werden die Schnitte durch die Inkubation in einer absteigenden Alkoholreihe (100% Ethanol bis 0% Ethanol) rehydriert.
Danach werden die Schnitte für 2 min in einem Schnellkochtopf gekocht während sie in einem Tris-EDTA-Citrat Puffer verbleiben und anschließend mit destilliertem Wasser gewaschen. Danach werden die Schnitte mit einer Lösung eines MCM2, MCM7 oder CENPF spezifischen primären Antikörper versetzt. Dieser Antikörper, wie z. B. ein mit humanem CENPF (Klon D8; Abcam Ltd., Cambridge, UK), humanem MCM2 (Klon CRCT2; Novocastra, Newcastle, UK), oder humanem MCM7 (Klon CRCT7; Novocastra), werden dazu in definierten Konzentration in einer Lösung aus PBS welcher 2% Pferdeserum (erhältlich von Vector Laboratories, Alexis, Grünberg) enthält gelöst. Nach einer Inkubation der Schnitte mit der Antikörperlösung für 45 min bei Raumtemperatur, werden die Schnitte 2 mal mit PBS für jeweils 5 min gewaschen.
Die Bindung dieser Antikörper an die jeweiliegen Zielmoleküle wird mit der folgenden Reaktion nachgewiesen:
Die Schnitte werden mit einem biotinylierten anti-Ziegen-lgG Antikörper (erhältlich als fertiges Reagenziensystem bei Vector Laboratories) in einer Konzentration von 5μg/ml inkubiert. Danach werden die Schnitte mit dem Reagenziensystem Avidin-Biotin Peroxidase (ABC ELITE, Vector Laboratories) inkubiert. Dabei wird nach der Beschreibung in den
Reagenzienssystemen verfahren. Zum Schluss werden die Schnitte mit einer Lösung von
Diaminobenzidin (Sigma, Taufkirchen) in 0,05 mol/l Tris-HCI pH7,0 bei Raumtemperatur inkubiert. Danach werden die Schnitte mit einem Standardverfahren mit Hematoxylin gefärbt und eingedeckt.
Die Färbung wird dann mikroskopisch beurteilt. Dabei steht eine positive Färbung für eine
Proteinexpression.
Ein Tumor äußert sich dabei in der Anfärbung der Zellen für eines der drei Proteine, während nichtmalignes Gewebe keine oder nur vernachlässigbare geringe Anfärbung zeigt.
Photographische Aufnahmen derart präparierter Gewebeschnitte werden in Fig. 2 dargestellt:
Ausführungsbeispiel 3: Nachweis CENPF-mRNA-Expression
Die Analyse der CENPF-mRNA-Expression (Gen-Nr. 108, Tabelle 1) erfolgt in isolierter RNA aus Gewebestücken des Pankreas zum Nachweis eines Tumors.
Dazu wird die RNA mit Standardverfahren und Reagenziensystemen aus Gewebestücken des Pankreas isoliert (RNeasy der Fa. Qiagen, Hilden, Deutschland). Dabei wird nach dem Protokoll des Reagenziensystems verfahren. Danach wird die RNA mit dem Enzym Reverse Transkriptase in cDNA umgeschrieben. Die dazu notwendige Transkriptionsinitiierung wird hierbei von „Random Hexameren" (Oligonucleotide bestehend aus je 6 Nukleotiden mit variabler Sequenz) übernommen (Invitrogen, Karlsruhe). Es werden zu dem Ansatz 100 pg der „Random Hexamere" gegeben. Die Synthese wird ansonsten gemäss der Beschreibung des Herstellers durchgeführt. Nach dieser Reaktion wird die cDNA in eine quantitative PCR eingesetzt. Dazu wird 1 μl der cDNA-Lösung verwendet. Die cDNA wird zu einem Ansatz von 24 μl aus einem Mastermix bestehend aus Puffer, Taq-DNA-Polymerase (Sybr Green PCR Mastermix der Fa. Applied Biosystems, Weiterstadt) und den genspezifischen Primern 5'~ GTCAGCGACAAAATGCAGAA-S' (SEQ-ID 33) und δ'-ACTCCTGGTCCAGTGTTTGG-S' (SEQ-ID 34) gegeben. Dabei liegen in dem Mix die Primer in einer Konzentration von 300 nmol/l vor. Zur Herstellung dieses Mixes werden für jede Bestimmung 12,5 μl des Sybr Green PCR Mastermix jeweils 1 μl der Primer aus einer Lösung mit einer Konzentration von 3 μmol/l und 9,5 μl destilliertes Wasser gemischt. Danach wird eine PCR unter Standardbedingungen im ABI Prism Sequence Detection System durchgeführt und die Werte für die enthaltene RNA Menge werden nach der Durchführung der PCR errechnet. Dabei wird die Fluoreszenz des in die entstehenden DNA Fragmente eingelagerten Sybr Greens während der PCR gemessen und die RNA-Menge analog zum TaqMan Verfahren errechnet.
Analog Ausführungsbeispiel 3 werden auch das Gen FOXM 1 (Gen-Nr. 1272, Tabelle 3) mit den Primern δ'-ATCCAACATCCAGTGGCTTC-S' (SEQ-ID 35) und 5'- TCGAAGGCTCCTCAACCTTA3' (SEQ-ID 36), das Gen AATF (Gen-Nr. 391 , Tabelle 1) mit den Primern 5'-CTTGGACACGGACAAAAGGT-3' (SEQ-ID 37) und 5'- CACACTCCTGTTCCTCAGCA-3' (SEQ-ID 38) und das Gen BCAR3 (Gen-Nr. 73, Tabelle 1) mit den Primern 5'-AAGTTCCTTCCCCCTGAGÄA-3' (SEQ-ID 39) und 5'- CCTGCAGTCCATGCTCAGTA-S' (SEQ-ID 40) bestimmt.
Ausführungsbeispief 4: Bestimmung der CKLF Menge im Serum zur Diagnose eines Pankreas-Karzinoms
Die Bestimmung der CKLF-Menge (Gen-Nr. 538, Tabelle 1) im Serum erfolgt nach Standardverfahren zum Nachweis von Proteinen im Serum. Das Serum wird von Patienten aus dem venösen Blut gewonnen und nach der Gerinnung verwendet. In einen mit Antikörpern gegen CKLF beschichtete Napf wird dann das Serum eingefüllt und 60 min gewartet, damit das Protein an die Antikörper binden kann. Danach wird der Napf mit PBS für dreimal gewaschen um überflüssiges Protein abzuwaschen. Diese Bindung wird dann mit einem zweiten gegen CKLF gerichteten Antikörper nachgewiesen. Dazu wird dieser Antikörper zu dem Napf gegeben und 60 min bei RT gewartet. Erneut wird der Napf dreimal mit PBS gewaschen. Die Bindung des zweiten Antikörpers wird durch die Zugabe eines dritten Antikörpers nachgewiesen. Dieser dritte Antikörper wird in den Napf gefüllt und es wird erneut 60 min abgewartet um die Bindung zu ermöglichen. Danach wird Peroxidase verbunden. Durch die Zugabe eines Substrates wird die gebundene Menge bestimmt.
Analog Ausführungsbeispiel 4 wird auch die KLK10 (Gen-Nr. 1279, Tabelle 3) im Serum bestimmt. Dazu wird in einen mit Antikörpern gegen KLK10 beschichteten Napf das Serum eingefüllt und 60 min gewartet, damit das Protein an den Antikörper binden kann. Danach wird der Napf dreimal mit PBS gewaschen, um überschüssiges Protein abzuwaschen. Diese Bindung wird dann mit einem zweiten gegen KLK10 gerichteten Antikörper nachgewiesen Dazu wird dieser Antikörper zu dem Napf gegeben und 60 min bei RT gewartet. Erneut wird der Napf dreimal mit PBS gewaschen. Die Bindung des zweiten Antikörpers wird durch die Zugabe eines dritten Antikörpers nachgewiesen. Dieser dritte Antikörper wird in den Napf gefüllt und es wird erneut 60 min abgewartet um die Bindung zu ermöglichen. Danach wird Peroxidase verbunden. Durch die Zugabe eines Substrates wird die gebundene Menge bestimmt.
Bei einer Untersuchung von acht Patienten mit Pankreaskarziom wurde im Mittel eine
Menge von 1,62 μg/L nachgewiesen, während bei Patienten mit einer gutartigen
Pankreaserkrankung im Mittel nur 0,81 μg/L nachgewiesen werden konnten.
Ausführungsbeispiel 5: Therapie des Pankreaskarzioms mittels siRNA-Molekülen
Zu der Therapie des Pankreaskarzioms werden Patienten die siRNA Moleküle 5'- CCUUCUCUAGUGUCAAAGU-S" (SEQ-ID 41), δ'-CGAUAAGACCAAACUGGCU-S' (SEQ-ID 42), δ'-UGGACAAAGAGAGAUUACU-S' (SEQ-ID 43) und 5'-
UGGAUGACCUUGGGAGCAG-3' (SEQ-ID 44) bzw. 5'-CAUGCCGGUGAAUCACCAG-3' (SEQ-ID 45), δ'-GCACGUACUGAGCAUGGAC-S' (SEQ-ID 46), 5'-
CCAUUUGGCAACAGCGCGA-S1 (SEQ-ID 47) und 5'-GAGCUACCUGCCGAUUGGC-3' (SEQ-ID 48) intravenös zugeführt. Die siRNAs der SEQ-Ids 41 bis 44 wirken hierbei gegen die Expression des Proteins AATF (Gen-Nr. 391 , Tabelle 1) und die der SEQ-Ids 45 bis 48 gegen die Expression des Proteins BCAR3 (Gen-Nr. 73, Tabelle 1 ). Dieses Protein spielt bei der Signaltransduktion eine wichtige Rolle und ist im Pankreaskarzinom überexprimiert. Die siRNA wird chemisch synthetisiert. Dabei werden zunächst die komplementären Stränge des Moleküls einzeln gemäß Standardverfahren für die Synthese von Nukleinsäuren synthetisiert und dann in einem zweiten Schritt hybridisiert, damit so doppelsträngige siRNA-Moleküle entstehen.
Ausführungsbeispiel 6: Therapie des Pankreaskarzioms mittels Antisense- Konstrukten
Als Antisense-Konstrukte für das Gen BCAR3 (Gen-Nr. 73, Tabelle 1 ) wird die Sequenz 5'- CATGCCGGTGAATCACCAG-3' (SEQ-ID 49), für das Gen AATF (Gen-Nr. 391 , Tabelle 1) 5'-CCTTCTCTAGTGTCAAAGT-3' (SEQ-ID 50) eingesetzt. Ausführungsbeispiel 7: knock-down Experimente mittels enzymatisch hergestellter siRNA
Von den Genen Nr. 232 (Tabelle 1, Gensymbol APLP2, Affymetrix-Probennummer 214875_x_at), Nr. 1330 (Tabelle 3, Gensymbol CXCL5, Affymetrix-Probennummer 214974_x_at), Nr. 506 (Tabelle 1 , Gensymbol ECT2, Affymetrix-Probennummer 219787_s_at), Nr. 311 (Tabelle 1, Gensymbol FLJ11323, Affymetrix-Probennummer 218951_s_at), Nr. 1272 (Tabelle 3, Gensymbol FOXM1 , Affymetrix-Probennummer 202580_x_at), und Nr. 103 (Tabelle 1 , Gensymbol TTK, Affymetrix-Probennummer 204822_at) werden cDNA-Klone hergestellt, wobei an beide Enden der Gene eine T7 Promotor-Sequenz mittels PCR angefügt wird. Mittels in vitro Transkription unter Verwendung des Megascript T7-Kits (Ambion) wird die cDNA in RNA überführt. Dazu werden nach Herstellerangaben 1 μg der cDNA mit 2 μl Transkriptionspuffer, jeweils 2 μl Ribonukleotiden (ATP, GTP, CTP und UTP) und 1 μl Enzymmix versetzt und bei 37°C über Nacht inkubiert. Die RNA wird unter Verwendung des RNeasy Mini Kits (Qiagen) gereinigt und die erhaltene Menge an RNA wird durch Messung der optischen Dichte bestimmt. 8 μg der RNA werden dann mit dem Enzym Dicer und Reaktionspuffer versetzt und über Nacht bei 37°C inkubiert. Nach Beendigung der Inkubation wird die Reaktion mittels G25 Säulen und Ultrafiltrationssäulen (Microcon YM-100, Firma Millipore) gereinigt. Die erhaltene siRNA befindet sich nach der Zentrifugati on durch den Ultrafiltrationsfilter im Durchlauf. Die erhaltene siRNA wird durch Vakuumzentrifugation konzentriert und die Menge wird mittels einer Gelelektrophorese im Vergleich zu einem bekannten Mengenstandard bestimmt.
Die siRNA wird auf eine Konzentration von 10 ng/μl eingestellt und dann zur Transfektion der Pankreaskarzinomzelllinien Panc89 und MiaPaCa-2 verwendet. Dazu werden ca. 5.000 Zellen in eine Vertiefung einer 96-Loch-Platte ausgesät und einen Tag später transfiziert. Für die Panc89-Zellen werden jeweils 30 ng siRNA mit 0,15 μl Oligofectamine Reagenz gemäß Herstellerprotokoll (Invitrogen) versetzt und auf die Zellen gegeben. Für die MiaPaCa-2- Zellen werden je 50 ng siRNA mit 0,3 μl Oligofectamine Reagenz gemäß Herstellerprotokoll (Invitrogen) versetzt und auf die Zellen gegeben. Nach 72 Stunden wird das Ausmaß an Apoptose gemessen. Dazu werden die Zellen mit FITC markiertem Annexin V und Draqδ gefärbt und die Färbeintensität wird gemessen. Aus dem Verhältnis der Annexin V Färbung zur Draqδ Färbung ergibt sich der sog. Annexin-Index, der ein Maß für die Apoptoseinduktion darstellt. In Tabelle 5 sind die für die Gene Nr. 232, 1330, 506, 311 , 1272 und 103 ermittelten Annexin-Indizes im Vergleich zum Annexin-Index einer Positiv-Kontrolle und einer Negativ- Kontrolle aufgeführt (jeweils als Log2 des Mittelwerts aus sechs Experimenten).
Die durch den Einsatz der siRNA verminderte Expression der im Pankreaskarziom spezifisch überexprimierten Gene Nr. 232, 1330, 506, 311 , 1272 und 103 löst in den untersuchten Pankreaskarzinomzelllinien MiaPaCa2 bzw. Panc89 Apoptose aus.
Tabelle 5:
Figure imgf000137_0001
Literatur:
1 Almoguera C, Shibata D, Forrester K, Martin J, Arnheim N, and Perucho M (1988). Most human carcinomas of the exocrine pancreas contain mutant c-K-ras genes. Cell 53, 549 - 554.
2 Hahn SA, Schutte M, Hoque AT, Moskaluk CA, da Costa LT, Rozenblum E, Weinstein CL, Fischer A, Yeo CJ, Hruban RH, and Kern SE (1996).
DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1. Science 271 , 350 - 353.
3 Hruban RH, Offerhaus GJ, Kern SE, Goggins M, Wilentz RE, and Yeo CJ (1998). Tumor-suppressor genes in pancreatic Cancer.
J Hepatobiliary Pancr Surg 5, 383 - 391.
4 Slebos RJ, Hoppin JA, Tolbert PE, HoIIy EA, Brock JW, Zhang RH1 Bracci PM, Foley J, Stockton P, McGregor LM, Flake GP, and Taylor JA (2000).
K-ras and p53 in pancreatic cancer: association with medical history, histopathology, and environmental exposures in a populationbased study. Cancer Epidemiol Biomark Prev 9, 1223 - 1232.
5 Friess H, Ding J, Kleeff J, Liao Q, Berberat PO, Hammer J, and Buchler MW (2001). Identification of disease-specific genes in chronic pancreatitis using DNA array technology.
Ann Surg 234, 769 - 778 discussion 778 - 769.
6 Crnogorac-Jurcevic T, Missiaglia E, Blaveri E, Gangeswaran R, Jones M, Terris B, Costello E, Neoptolemos JP, and Lemoine NR (2003).
Molecular alterations in pancreatic Carcinoma: expression profiling shows that dysregulated expression of S100 genes is highly prevalent. J Pathol 201 , 63 - 74.
7 lacobuzio-Donahue CA, Maitra A, Olsen M, Lowe AW, Van Heek NT, Rosty C, Walter K, Sato N, Parker A, Ashfaq R, Jaffee E, Ryu B, Jones J, Eshleman JR, Yeo CJ, Cameron JL, Kern SE, Hruban RH, Brown PO, and Goggins M (2003). Exploration of global gene expression patterns in pancreatic adenocarcinoma using cDNA microarrays.
Am J Pathol 162, 1151 - 1162.
8 Grutzmann R, Foerder M, Alldinger I, Staub E, Brummendorf T, Ropcke S, Li X, Kristiansen G, Jesnowski R, Sipos B, Lohr M, Luttges J, Ockert D, Klöppel G, Saeger HD, and Pilarsky C (2003).
Gene expression profiles of microdissected pancreatic ductal adenocarcinoma. Virchows Arch 443, 508 - 517.
9 lacobuzio-Donahue CA, Ashfaq R, Maitra A, Adsay NV, Shen-Ong GL, 'Berg K, Hollingsworth MA, Cameron JL, Yeo CJ, Kern SE, Goggins M, and Hruban RH (2003). Highly expressed genes in pancreatic ductal adenocarcinomas: a comprehensive characterization and comparison of the transcription profiles obtained from three major technologies.
Cancer Res 63, 8614 - 8622.
10 Nakamura T, Furukawa Y, Nakagawa H, Tsunoda T, Ohigashi H, Murata K, Ishikawa O, Ohgaki K, Kashimura N, Miyamoto M, Hirano S, Kondo S, Katoh H, Nakamura Y, and Katagiri T (2004). Genomewide cDNA microarray analysis of gene expression profiles in pancreatic Cancers using populations of tumor cells and normal ductal epithelial cells selected for purity by laser microdissection. Oncogene, (23), 2385 - 2400. Grutzmann R, Pilarsky C, Staub E, Schmitt AO, Foerder M, Specht T, Hinzmann B, Dahl E, Alldinger I1 Rosenthal A, Ockert D, and Saeger HD (2003).
Systematic isolation of genes differentially expressed in normal and cancerous tissue of the pancreas. Pancreatology 3, 169 - 178. Ryu B, Jones J, Blades NJ, Parmigiani G, Hollingsworth MA, Hruban RH, and Kern SE (2002).
Relationships and differentially expressed genes among pancreatic Cancers examined by large-scale serial analysis of gene expression. Cancer Res 62, 819 - 826. lacobuzio-Donahue CA, Maitra A, Shen-Ong GL, van Heek T, Ashfaq R, Meyer R, Walter K, Berg K, Hollingsworth MA, Cameron JL, Yeo CJ, Kern SE, Goggins M, and Hruban RH (2002).
Discovery of novel tumor markers of pancreatic Cancer using global gene expression technology.
Am J PathoM60, 1239 - 1249. Han H, Bearss DJ, Browne LW, Calaluce R, Nagle RB, and Von Hoff DD (2002). Identification of differentially expressed genes in pancreatic Cancer cells using cDNA microarray.
Cancer Res 62, 2890 - 2896. Cmogorac-Jurcevic T, Efthimiou E, Nielsen T, Loader J, Terris B, Stamp G, Baron A, Scarpa A, and Lemoine NR (2002).
Expression profiling of microdissected pancreatic adenocarcinomas. Oncogene 21 , 4587 - 4594. Cmogorac-Jurcevic T, Efthimiou E, Capelli P, Blaveri E, Baron A, Terris B, Jones M, Tyson K, Bassi C, Scarpa A, and Lemoine NR (2001).
Gene expression profiles of pancreatic Cancer and stromal desmoplasia. Oncogene 20, 7437 - 7446. Argani P, Rosty C, Reiter RE, Wilentz RE, Murugesan SR1 Leach SD, Ryu B, Skinner HG, Goggins M, Jaffee EM, Yeo CJ, Cameron JL1 Kern SE, and Hruban RH (2001 ). Discovery of new markers of Cancer through serial analysis of gene expression: prostate stem cell antigen is overexpressed in pancreatic adenocarcinoma. Cancer Res 61 , 4320 - 4324. Gress TM, Wallrapp C, Frohme M, Muller-Pillasch F1 Lacher U1 Friess H1 Buchler M1 Adler G, and Hoheisel JD (1997).
Identification of genes with specific expression in pancreatic Cancer by cDNA representational difference analysis. Genes Chromosomes Cancer 19, 97 - 103. Friess H, Ding J, Kleeff J, Fenkell L1 Rosinski JA1 Guweidhi A1 Reidhaar-Olson JF, Korc M1 Hammer J, and Buchler MW (2003).
Microarray-based "Identification of differentially expressed growth- and metastasis- associated genes in pancreatic Cancer. Cell Mol Life Sei 60, 1180 - 1199. Logsdon CD, Simeone DM, Binkley C, Arumugam T, Greenson JK1 Giordano TJ, Misek DE, and Hanash S (2003).
Molecular profiling of pancreatic adenocarcinoma and chronic pancreatitis identifies multiple genes differentially regulated in pancreatic cancer. Cancer Res 63, 2649 - 2657. Tan ZJ, Hu XG, Cao GS, and Tang Y (2003).
Analysis of gene expression profile of pancreatic Carcinoma using cDNA microarray. World J Gastroenterol 9, 818 - 823. Grutzmann R, Foerder M, Alldinger I, Staub E, Brummendorf T, Ropcke S, Li X, Kristiansen G, Jesnowski R, Sipos B, Lohr M, Luttges J1 Ockert D, Klöppel G, Saeger HD, Pilarsky C.
Gene expression profiles of microdissected pancreatic ductal adenocarcinoma. Virchows Arch. 2003 Oct;443(4):508-17. Carlos Thomas,
Pathologie. Histopathologie. Lehrbuch und Atlas zur allgemeinen und speziellen Pathologie, Schattauer Verlag

Claims

Patentansprüche
1. Ein Verfahren zur in vitro Diagnose eines Pankreaskarzioms, bei dem
1 ) die Menge an Genprodukt von mindestens einem der in Tabelle 1 und/oder Tabelle 2 aufgeführten Gene in einer Probe biologischen Materials eines Individuums bestimmt wird,
2) die Menge an Genprodukt in der Probe biologischen Materials mit der Menge des entsprechenden Genprodukts, die in normalem Pankreasepithelgewebe üblicherweise vorliegt, verglichen wird und
3) wobei, falls es sich um ein in der Tabelle 1 aufgeführtes Gen handelt, eine erhöhte Menge des
Genprodukts, falls es sich um ein in der Tabelle 2 aufgeführtes Gen handelt, eine erniedrigte Menge des Genprodukts ein Indiz für das Vorliegen eines Pankreaskarzinoms ist.
2. Verfahren nach Anspruch 1 , dadurch gekennzeichnet, dass zusätzlich die Menge an Genprodukt von mindestens einem der in der Probe biologischen Materials eines Individuums untersuchten Gene in einer Kontrollprobe bestimmt wird.
3. Verfahren nach Anspruch 1 , dadurch gekennzeichnet, dass zusätzlich die Menge an Genprodukt mindestens eines Referenzgens in der Probe biologischen Materials eines Individuums bestimmt wird.
4. Verfahren nach Anspruch 1 , dadurch gekennzeichnet, dass zusätzlich
4) die Menge an Genprodukt von mindestens einem der in Tabelle 3 und/oder Tabelle 4 aufgeführten Gene in der Probe biologischen Materials eines Individuums bestimmt wird,
5) die Menge an Genprodukt in der Probe biologischen Materials eines Individuums mit der Menge des entsprechenden Genprodukts, die in normalem Pankreasepithelgewebe üblicherweise vorliegt, verglichen wird und
6) wobei, falls es sich um ein in der Tabelle 3 aufgeführtes Gen handelt, eine erhöhte Menge des
Genprodukts, falls es sich um ein in der Tabelle 4 aufgeführtes Gen handelt, eine erniedrigte Menge des Genprodukts ein Indiz für das Vorliegen eines Pankreaskarzinoms ist. 5. Verfahren zum Screenen nach Wirkstoffen zur Therapie des Pankreaskarzioms, bei dem
1) eine Zelllinie eines pankreatischen duktalen Adenomakarzinoms mit einer zu testenden Substanz kontaktiert wird,
2) anschließend die Menge an Genprodukt von mindestens einem der in Tabelle 1 und/oder Tabelle 2 aufgeführten Gene bestimmt
3) und die Menge an Genprodukt dann mit der Menge des entsprechenden Genprodukts, die in einer entsprechenden nicht mit der Testsubstanz kontaktierten Zelllinie vorliegt, verglichen wird,
4) wobei, falls es sich um ein in Tabelle 1 aufgeführtes Genprodukt handelt, eine gegenüber der unbehandelten Zelllinie erniedrigte Menge des Genprodukts, falls es sich um ein in Tabelle 2 aufgeführtes Genprodukt handelt, eine gegenüber der unbehandelten Zelllinie erhöhte Menge des Genprodukts ein Hinweis darauf ist, dass die Testsubstanz ein potenzieller Wirkstoff zur Therapie des Pankreaskarzinoms ist.
6. Verfahren nach Anspruch 5, dadurch gekennzeichnet, dass
5) zusätzlich die Menge an Genprodukt von mindestens einem der in Tabelle 3 und/oder Tabelle 4 aufgeführten Gene bestimmt
6) und die Menge an Genprodukt dann mit der Menge des entsprechenden Genprodukts, die in einer entsprechenden nicht mit der Testsubstanz kontaktierten Zelllinie vorliegt, verglichen wird,
7) wobei, falls es sich um ein in Tabelle 3 aufgeführtes Genprodukt handelt, eine gegenüber der unbehandelten Zelllinie erniedrigte Menge des Genprodukts, falls es sich um ein in Tabelle 4 aufgeführtes Genprodukt handelt, eine gegenüber der unbehandelten Zelllinie erhöhte Menge des Genprodukts ein Hinweis darauf ist, dass die Testsubstanz ein potenzieller Wirkstoff zur Therapie des
Pankreaskarzinoms ist. 7. Diagnostischer Kit zur Diagnose des Pankreaskarziom mittels RT-PCR, der mindestens folgende Bestandteile enthält: für die cDNA-Synthese: a) Random-Hexamer-Primer oder oligo dT, b) Reverse Transkriptase; für die PCR: a) mindestens zwei Primer, die. spezifisch mit der cDNA mindestens eines der Gene, ausgewählt aus den Gruppen der pankreastumorspezifischen Gene aus den Tabellen Nr. 1 und Nr.2 hybridisieren; b) eine über 8O0C beständige DNA-Polymerase, sowie entsprechende Reaktionspuffer.
8. Diagnostischer Kit nach Anspruch 7, dadurch gekennzeichnet, dass er als zusätzliche Bestandteile für die PCR enthält: c) eine Fluoreszenz-markierte Hybridisierungssonde oder ein Paar Fluoreszenz markierter Hybridisierungssonden, die spezifisch mit dem pankreas¬ tumorspezifischen Gen aus Tabelle Nr. 1 oder Nr.2 hybridisieren.
9. Verwendung mindestens eines Oligonukleotids, das eine Teilsequenz eines der in den Tabellen 1 und/oder 2 aufgeführten Gene oder deren komplementären Sequenz umfasst, zur Diagnose des Pankreaskarzinoms.
10. Verwendung mindestens eines Oligonukleotids nach Anspruch 9, dadurch gekennzeichnet, dass zusätzlich mindestens ein Oligonukleotid, das eine Teilsequenz eines der in den Tabellen 3 und/oder 4 aufgeführten Gene oder deren komplementären Sequenz umfasst, zur Diagnose des Pankreaskarzinoms eingesetzt wird.
11. Verwendung eines Gens aus Tabelle 1 oder Tabelle 2 als spezifischer Marker zur Diagnose von Pankreaskarzinom.
12. Verwendung mindestens eines Antisense-Konstrukts, das mindestens 12 Nukleotide einer Sequenz eines Gens umfasst, das in Tabelle 1 aufgeführt ist, wobei die Sequenz bezüglich des Promotors, der ihre Expression kontrolliert, in 3' zu 5' Orientierung vorliegt, für die Herstellung einer pharmazeutischen Zusammensetzung zur Behandlung des Pankreaskarzinoms beim Menschen, wobei das Antisense-Konstrukt den Krebszellen verabreicht wird, so dass das Antisense Konstrukt in den Krebszellen exprimiert wird.
13. Verwendung mindestens eines Antisense-Konstrukts nach Anspruch 12, dadurch gekennzeichnet, dass zusätzlich mindestens ein Antisense-Konstrukt, das mindestens 12 Nukleotide einer Sequenz eines Gens umfasst, das in Tabelle 3 aufgeführt ist, wobei die Sequenz bezüglich des Promotors, der ihre Expression kontrolliert, in 3' zu 5' Orientierung vorliegt, eingesetzt wird.
14. Verwendung mindestens eines doppelsträngigen RNA-Konstrukts (siRNA), das mindestens 19 Basenpaare, besonders bevorzugt 21 oder 22 Basenpaare, maximal 29 Basenpaare, einer Sequenz eines Gens umfasst, das in Tabelle 1 aufgeführt ist, für die Herstellung eines Arzneimittels zur Behandlung des Pankreaskarzinoms beim Menschen.
15. Verwendung mindestens eines doppelsträngigen RNA-Konstrukts (siRNA) nach Anspruch 14, dadurch gekennzeichnet, dass das doppelsträngigen RNA-Konstrukt eine Sequenz eines Gens umfasst, das ausgewählt ist aus den Genen Nr. 232, 506, 311 und 103.
16. Verwendung mindestens eines doppelsträngigen RNA-Konstrukts (siRNA) nach Anspruch 14, dadurch gekennzeichnet, dass zusätzlich mindestens ein doppelsträngiges RNA-Konstrukt, das mindestens 19 Basenpaare, besonders bevorzugt 21 oder 22 bp, maximal 29 Basenpaare, einer Sequenz eines Gens umfasst, das in Tabelle 3 aufgeführt ist, eingesetzt wird.
17. Verwendung mindestens eines doppelsträngigen RNA-Konstrukts (siRNA) nach Anspruch 16, dadurch gekennzeichnet, dass das zusätzlich eingesetzte doppelsträngige RNA-Konstrukt eine Sequenz eines Gens umfasst, das ausgewählt ist aus den Genen Nr. 1330 und 1272.
18. Verwendung mindestens eines Polynukleotids, das eine Sequenz eines Gens umfasst, das in Tabelle 2 aufgeführt ist, zur Herstellung einer pharmazeutischen Zusammensetzung zur Behandlung des Pankreaskarzinoms beim Menschen, wobei das Polynukleotid den Krebszellen verabreicht wird, so dass das Gen in den Krebszellen exprimiert wird.
19. Verwendung mindestens eines Polynukleotids nach Anspruch 18, dadurch gekennzeichnet, dass zusätzlich mindestens ein Polynukleotid, das eine Sequenz eines Gens umfasst, das in Tabelle 4 aufgeführt ist, eingesetzt wird.
PCT/DE2005/001527 2004-08-31 2005-08-26 Verbindungen und methoden zur behandlung, diagnose und prognose bei pankreaserkrankungen Ceased WO2006024283A2 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DE112005002742T DE112005002742B4 (de) 2004-08-31 2005-08-26 Verbindungen und Methoden zur Behandlung, Diagnose und Prognose bei Pankreaserkrankungen

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102004042822.0 2004-08-31
DE200410042822 DE102004042822A1 (de) 2004-08-31 2004-08-31 Verbindungen und Methoden zur Behandlung, Diagnose und Prognose bei Pankreaserkrankungen

Publications (2)

Publication Number Publication Date
WO2006024283A2 true WO2006024283A2 (de) 2006-03-09
WO2006024283A3 WO2006024283A3 (de) 2006-08-31

Family

ID=35853531

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2005/001527 Ceased WO2006024283A2 (de) 2004-08-31 2005-08-26 Verbindungen und methoden zur behandlung, diagnose und prognose bei pankreaserkrankungen

Country Status (2)

Country Link
DE (2) DE102004042822A1 (de)
WO (1) WO2006024283A2 (de)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008029601A1 (fr) * 2006-08-16 2008-03-13 Forerunner Pharma Research Co., Ltd. Agent thérapeutique cancéreux comprenant un ligand pour la molécule (fm4) du récepteur 2 de neuromédine u en tant qu'ingrédient actif
WO2008023840A3 (en) * 2006-08-25 2008-07-17 Oncotherapy Science Inc Prognostic markers and therapeutic targets for lung cancer
JP2010539973A (ja) * 2007-10-05 2010-12-24 パシフィック エッジ バイオテクノロジー リミティド 胃腸癌での増殖の徴候及び予後
WO2011151321A1 (en) * 2010-05-31 2011-12-08 Institut Curie Asf1b as a prognosis marker and therapeutic target in human cancer
EP2463657A1 (de) * 2010-12-13 2012-06-13 Université de Liège Biomarker, Verwendungen von Biomarkern und Verfahren zur Identifizierung von Biomarkern
JP2013514074A (ja) * 2009-12-17 2013-04-25 ユーシーエル ビジネス ピーエルシー 癌の診断および処置
WO2013016673A3 (en) * 2011-07-27 2013-05-10 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Use of dpep1 and tpx2 expression for evaluating treatment or survival time of patients with pancreatic ductal adenocarcinoma
KR20140124601A (ko) * 2013-04-17 2014-10-27 엘지전자 주식회사 췌장암 진단용 바이오마커, 이를 위한 컴퓨팅 장치 및 이의 제어 방법
US9212228B2 (en) 2005-11-24 2015-12-15 Ganymed Pharmaceuticals Ag Monoclonal antibodies against claudin-18 for treatment of cancer
JP2016525883A (ja) * 2013-05-17 2016-09-01 ナショナル ヘルス リサーチ インスティテュートス 腺癌を予後的に分類及び治療する方法
US9433675B2 (en) 2012-05-23 2016-09-06 Ganymed Pharmaceuticals Ag Combination therapy involving antibodies against claudin 18.2 for treatment of cancer
JP2016532856A (ja) * 2013-06-20 2016-10-20 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 膵臓がんを診断するための方法
US9512232B2 (en) 2012-05-09 2016-12-06 Ganymed Pharmaceuticals Ag Antibodies against Claudin 18.2 useful in cancer diagnosis
US9670244B2 (en) 2006-02-27 2017-06-06 The Regents Of The University Of California Oxysterol compounds and the hedgehog pathway
US9770487B2 (en) 2013-02-20 2017-09-26 Ganymed Pharmaceuticals Ag Combination therapy involving antibodies against claudin 18.2 for treatment of pancreatic adenocarcinoma
US9775785B2 (en) 2004-05-18 2017-10-03 Ganymed Pharmaceuticals Ag Antibody to genetic products differentially expressed in tumors and the use thereof
JP2018105790A (ja) * 2016-12-27 2018-07-05 株式会社キュービクス シスタチンaをマーカーとして用いる癌の検出
US10093736B2 (en) 2012-11-13 2018-10-09 Biontech Ag Agents for treatment of claudin expressing cancer diseases
US10137195B2 (en) 2013-03-18 2018-11-27 Ganymed Pharmaceuticals Gmbh Therapy involving antibodies against Claudin 18.2 for treatment of cancer
US10414824B2 (en) 2002-11-22 2019-09-17 Ganymed Pharmaceuticals Ag Genetic products differentially expressed in tumors and the use thereof
CN110702923A (zh) * 2019-11-05 2020-01-17 南通大学附属医院 Gpr115基因在制备抗肺癌药物及其诊断试剂盒中的应用
US10782301B2 (en) 2015-02-05 2020-09-22 Queen Mary University Of London Biomarkers for pancreatic cancer
WO2020225426A1 (en) * 2019-05-08 2020-11-12 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Colorectal cancer screening examination and early detection method
CN111973744A (zh) * 2020-07-15 2020-11-24 北京大学深圳医院 Plce1-as2在乳腺癌中的应用
CN114480399A (zh) * 2022-03-17 2022-05-13 江苏医药职业学院 降低CPB1基因表达的siRNA、重组载体及其应用
WO2023004460A1 (en) * 2021-07-28 2023-02-02 Hudson Institute of Medical Research Methods of detecting and/or diagnosing pancreatic cancer
WO2023133275A1 (en) * 2022-01-07 2023-07-13 Sanford Burnham Prebys Medical Discovery Institute Inhibition of glutaryl-coa dehydrogenase for the treatment of melanoma

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005020928A2 (en) 2003-08-29 2005-03-10 The Regents Of The University Of California Agents and methods for enhancing bone formation by oxysterols in combination with bone morphogenic proteins
JP2010133705A (ja) * 2007-03-16 2010-06-17 Perseus Proteomics Inc 癌の診断薬及び治療薬
CN101951915A (zh) 2007-12-03 2011-01-19 加利福尼亚大学董事会 用于刺猬蛋白信号、骨诱导、抗脂肪形成和wnt信号的激活的氧固醇
DE102010043541B4 (de) 2009-12-16 2012-01-26 Technische Universität Dresden Verfahren und Mittel zur Vorhersage der Überlebensdauer beim Pankreaskarzinom durch Analyse von Biomarkern
CA2872751A1 (en) 2012-05-07 2013-11-14 The Regents Of The University Of California Oxysterol analogue oxy133 induces osteogenesis and hedgehog signaling and inhibits adipogenesis
JP2016517888A (ja) 2013-05-02 2016-06-20 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア 骨選択的骨形成のオキシステロール骨標的薬剤

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6429302B1 (en) * 1999-02-02 2002-08-06 Chiron Corporation Polynucleotides related to pancreatic disease
ES2374311T3 (es) * 2002-03-13 2012-02-15 Genomic Health, Inc. Obtención de perfil de expresión génica en tejidos tumorales biopsiados.
JP4679149B2 (ja) * 2002-09-30 2011-04-27 オンコセラピー・サイエンス株式会社 ヒト膵癌に関連する遺伝子およびポリペプチド

Cited By (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10414824B2 (en) 2002-11-22 2019-09-17 Ganymed Pharmaceuticals Ag Genetic products differentially expressed in tumors and the use thereof
US9775785B2 (en) 2004-05-18 2017-10-03 Ganymed Pharmaceuticals Ag Antibody to genetic products differentially expressed in tumors and the use thereof
US9212228B2 (en) 2005-11-24 2015-12-15 Ganymed Pharmaceuticals Ag Monoclonal antibodies against claudin-18 for treatment of cancer
US9751934B2 (en) 2005-11-24 2017-09-05 Ganymed Pharmaceuticals Ag Monoclonal antibodies against claudin-18 for treatment of cancer
US9499609B2 (en) 2005-11-24 2016-11-22 Ganymed Pharmaceuticals Ag Monoclonal antibodies against claudin-18 for treatment of cancer
US10738108B2 (en) 2005-11-24 2020-08-11 Astellas Pharma Inc. Monoclonal antibodies against claudin-18 for treatment of cancer
US10017564B2 (en) 2005-11-24 2018-07-10 Ganymed Pharmaceuticals Gmbh Monoclonal antibodies against claudin-18 for treatment of cancer
US10174104B2 (en) 2005-11-24 2019-01-08 Ganymed Pharmaceuticals Gmbh Monoclonal antibodies against claudin-18 for treatment of cancer
US11739139B2 (en) 2005-11-24 2023-08-29 Astellas Pharma Inc. Monoclonal antibodies against Claudin-18 for treatment of cancer
US9670244B2 (en) 2006-02-27 2017-06-06 The Regents Of The University Of California Oxysterol compounds and the hedgehog pathway
WO2008029601A1 (fr) * 2006-08-16 2008-03-13 Forerunner Pharma Research Co., Ltd. Agent thérapeutique cancéreux comprenant un ligand pour la molécule (fm4) du récepteur 2 de neuromédine u en tant qu'ingrédient actif
JPWO2008029601A1 (ja) * 2006-08-16 2010-01-21 株式会社 未来創薬研究所 ニューロメジンu受容体2(fm4)分子に対するリガンドを有効成分として含む癌治療剤
WO2008023840A3 (en) * 2006-08-25 2008-07-17 Oncotherapy Science Inc Prognostic markers and therapeutic targets for lung cancer
JP2010539973A (ja) * 2007-10-05 2010-12-24 パシフィック エッジ バイオテクノロジー リミティド 胃腸癌での増殖の徴候及び予後
JP2013514074A (ja) * 2009-12-17 2013-04-25 ユーシーエル ビジネス ピーエルシー 癌の診断および処置
WO2011151321A1 (en) * 2010-05-31 2011-12-08 Institut Curie Asf1b as a prognosis marker and therapeutic target in human cancer
EP2463657A1 (de) * 2010-12-13 2012-06-13 Université de Liège Biomarker, Verwendungen von Biomarkern und Verfahren zur Identifizierung von Biomarkern
WO2012079977A1 (en) * 2010-12-13 2012-06-21 Universite De Liege Biomarkers, uses of biomarkers and a method of identifying biomarkers
WO2013016673A3 (en) * 2011-07-27 2013-05-10 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Use of dpep1 and tpx2 expression for evaluating treatment or survival time of patients with pancreatic ductal adenocarcinoma
US9512232B2 (en) 2012-05-09 2016-12-06 Ganymed Pharmaceuticals Ag Antibodies against Claudin 18.2 useful in cancer diagnosis
US11976130B2 (en) 2012-05-09 2024-05-07 Astellas Pharma Inc. Antibodies against claudin 18.2 useful in cancer diagnosis
US10053512B2 (en) 2012-05-09 2018-08-21 Ganymed Pharmaceuticals Ag Antibodies against claudin 18.2 useful in cancer diagnosis
US10813996B2 (en) 2012-05-23 2020-10-27 Astellas Pharma Inc. Combination therapy involving antibodies against Claudin 18.2 for treatment of cancer
US9433675B2 (en) 2012-05-23 2016-09-06 Ganymed Pharmaceuticals Ag Combination therapy involving antibodies against claudin 18.2 for treatment of cancer
US12059464B2 (en) 2012-05-23 2024-08-13 Astellas Pharma Inc. Combination therapy involving antibodies against Claudin 18.2 for treatment of cancer
US10022444B2 (en) 2012-05-23 2018-07-17 Ganymed Pharmaceuticals Ag Combination therapy involving antibodies against Claudin 18.2 for treatment of cancer
US10093736B2 (en) 2012-11-13 2018-10-09 Biontech Ag Agents for treatment of claudin expressing cancer diseases
US10314890B2 (en) 2013-02-20 2019-06-11 Astellas Pharma Inc. Combination therapy involving antibodies against claudin 18.2 for treatment of pancreatic cancer
US10946069B2 (en) 2013-02-20 2021-03-16 Astellas Pharma Inc. Combination therapy involving antibodies against claudin 18.2 for treatment of pancreatic cancer
US11826402B2 (en) 2013-02-20 2023-11-28 Astellas Pharma Inc. Combination therapy involving antibodies against claudin 18.2 for treatment of metastatic pancreatic adenocarcinoma
US9770487B2 (en) 2013-02-20 2017-09-26 Ganymed Pharmaceuticals Ag Combination therapy involving antibodies against claudin 18.2 for treatment of pancreatic adenocarcinoma
US11395852B2 (en) 2013-03-18 2022-07-26 Astellas Pharma Inc. Therapy involving antibodies against Claudin 18.2 for treatment of cancer
US10137195B2 (en) 2013-03-18 2018-11-27 Ganymed Pharmaceuticals Gmbh Therapy involving antibodies against Claudin 18.2 for treatment of cancer
KR102058996B1 (ko) 2013-04-17 2019-12-24 엘지전자 주식회사 췌장암 진단용 바이오마커, 이를 위한 컴퓨팅 장치 및 이의 제어 방법
KR20140124601A (ko) * 2013-04-17 2014-10-27 엘지전자 주식회사 췌장암 진단용 바이오마커, 이를 위한 컴퓨팅 장치 및 이의 제어 방법
JP2016525883A (ja) * 2013-05-17 2016-09-01 ナショナル ヘルス リサーチ インスティテュートス 腺癌を予後的に分類及び治療する方法
JP2016532856A (ja) * 2013-06-20 2016-10-20 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 膵臓がんを診断するための方法
US11977077B2 (en) 2015-02-05 2024-05-07 Queen Mary University Of London Biomarkers for pancreatic cancer
US10782301B2 (en) 2015-02-05 2020-09-22 Queen Mary University Of London Biomarkers for pancreatic cancer
JP2018105790A (ja) * 2016-12-27 2018-07-05 株式会社キュービクス シスタチンaをマーカーとして用いる癌の検出
WO2020225426A1 (en) * 2019-05-08 2020-11-12 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Colorectal cancer screening examination and early detection method
CN110702923A (zh) * 2019-11-05 2020-01-17 南通大学附属医院 Gpr115基因在制备抗肺癌药物及其诊断试剂盒中的应用
CN111973744A (zh) * 2020-07-15 2020-11-24 北京大学深圳医院 Plce1-as2在乳腺癌中的应用
CN111973744B (zh) * 2020-07-15 2022-07-01 北京大学深圳医院 Plce1-as2在乳腺癌中的应用
WO2023004460A1 (en) * 2021-07-28 2023-02-02 Hudson Institute of Medical Research Methods of detecting and/or diagnosing pancreatic cancer
WO2023133275A1 (en) * 2022-01-07 2023-07-13 Sanford Burnham Prebys Medical Discovery Institute Inhibition of glutaryl-coa dehydrogenase for the treatment of melanoma
CN114480399A (zh) * 2022-03-17 2022-05-13 江苏医药职业学院 降低CPB1基因表达的siRNA、重组载体及其应用

Also Published As

Publication number Publication date
WO2006024283A3 (de) 2006-08-31
DE112005002742A5 (de) 2007-08-09
DE102004042822A1 (de) 2006-03-16
DE112005002742B4 (de) 2008-05-21

Similar Documents

Publication Publication Date Title
WO2006024283A2 (de) Verbindungen und methoden zur behandlung, diagnose und prognose bei pankreaserkrankungen
Zaitseva et al. In vitro culture significantly alters gene expression profiles and reduces differences between myometrial and fibroid smooth muscle cells
US20130296185A1 (en) Tape stripping methods for analysis of skin disease and pathological skin state
US20050209181A1 (en) Compositions and methods for diagnosing and treating mental disorders
EP2504451B1 (de) Verfahren zur vorhersage des klinischen verlaufs von krebs
KR101287600B1 (ko) 초기유방암의 예후 예측용 유전자 및 이를 이용한 초기유방암의 예후예측 방법
US20070105105A1 (en) Surrogate cell gene expression signatures for evaluating the physical state of a subject
US11591655B2 (en) Diagnostic transcriptomic biomarkers in inflammatory cardiomyopathies
US20110190156A1 (en) Molecular signatures for diagnosing scleroderma
EP2427574A2 (de) miRNA-EXPRESSIONSANALYSE UND -TARGETING IN LUNGENGEWEBE BEI CHRONISCH-OBSTRUKTIVER LUNGENERKRANKUNG (COPD) SOWIE ANWENDUNGSVERFAHREN DAFÜR
US20120289418A1 (en) Diagnostic method and kit for the detection of a lymphocytic variant of hypereosinophilic syndrome
Saga et al. Glutathione peroxidase 3 is a candidate mechanism of anticancer drug resistance of ovarian clear cell adenocarcinoma
AU2004210986A1 (en) Methods for monitoring drug activities in vivo
US10106855B2 (en) Genetic assay to determine prognosis in Polycythemia Vera patients
Young et al. Microarray analysis of gene expression in human donor sclera
CN101180407A (zh) 白血病疾病基因和其用途
CA2531091A1 (en) Genes regulated in ovarian cancer as prognostic and therapeutic targets
CN101326290B (zh) 用于预测急性髓系白血病病人对抗癌药物应答的标记物
US20070134690A1 (en) Diagnosis of systemic onset juvenile idiopathic arthritis through blood leukocyte microarray analysis
KR101725985B1 (ko) 초기유방암의 예후 예측용 유전자 및 이를 이용한 초기유방암의 예후예측 방법
US7879548B2 (en) Detection of biomarkers for neuropsychiatric disorders
KR20180107013A (ko) 인슐린 저항성 진단용 조성물 및 이의 용도
US20040175743A1 (en) Methods for monitoring drug activities in vivo
CN106701761A (zh) 长链非编码rna nr‑027469.1及制剂或诊断剂或药物或试剂盒和应用
US20140066324A1 (en) Gene expression signature in skin predicts response to mycophenolate mofetil

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 1120050027422

Country of ref document: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application
REF Corresponds to

Ref document number: 112005002742

Country of ref document: DE

Date of ref document: 20070809

Kind code of ref document: P

122 Ep: pct application non-entry in european phase
REG Reference to national code

Ref country code: DE

Ref legal event code: 8607

REG Reference to national code

Ref country code: DE

Ref legal event code: 8607