WO2006024041A2 - Variantes de proteines fluorescentes monomeriques et dimeriques et procedes de production desdites variantes - Google Patents

Variantes de proteines fluorescentes monomeriques et dimeriques et procedes de production desdites variantes Download PDF

Info

Publication number
WO2006024041A2
WO2006024041A2 PCT/US2005/030793 US2005030793W WO2006024041A2 WO 2006024041 A2 WO2006024041 A2 WO 2006024041A2 US 2005030793 W US2005030793 W US 2005030793W WO 2006024041 A2 WO2006024041 A2 WO 2006024041A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polynucleotide sequence
dsred
protein
variant
Prior art date
Application number
PCT/US2005/030793
Other languages
English (en)
Other versions
WO2006024041A3 (fr
Inventor
Roger Y. Tsien
Robert E. Campbell
Nathan C. Shaner
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/931,304 external-priority patent/US7687614B2/en
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO2006024041A2 publication Critical patent/WO2006024041A2/fr
Publication of WO2006024041A3 publication Critical patent/WO2006024041A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae

Definitions

  • the present invention relates generally to variant fluorescent proteins, and more specifically to Anthozoan fluorescent proteins that have a reduced propensity to oligomerize, where such proteins form monomelic and/or dimeric structures.
  • the invention also relates to methods of making and using such fluorescent protein monomers and dimers.
  • the present invention relates generally to variant red fluorescent proteins (RFPs), and more specifically to Anthozoan fluorescent proteins (AnFP), having at least one amino acid alteration that results in more efficient maturation than the corresponding wild- type protein or another variant RFP from which such variants derive.
  • the invention further concerns RFP variants that additionally have reduced propensity tetramerize, and thus form predominantly monomelic and/or dimeric structures.
  • the invention also relates to methods of making and using such RFP variants.
  • the gre,en fluorescent protein (GFP) of the jellyfish Aequorea victoria has become a commonly used reporter molecule for examining various cellular processes, including the regulation of gene expression, the localization and interactions of cellular proteins, the pH of intracellular compartments, and the activities of enzymes.
  • Aequorea GFP has led to the identification of numerous other fluorescent proteins in an effort to obtain proteins having different useful fluorescence characteristics, hi addition, spectral variants of Aequorea GFP have been engineered, thus providing proteins that are excited or fluoresce at different wavelengths, for different periods of time, and under different conditions.
  • DsRed red fluorescent protein from Discosoma coral
  • DsRed While the weak dimerization of Aequore ⁇ GFP has not impeded its acceptance as an indispensable tool of cell biology, the obligate tetramerization of DsRed has greatly hindered its development from a scientific curiosity to a generally applicable and robust tool, most notably as genetically encoded fusion tag. Thus, one problem with DsRed is its tendency to oligomerize.
  • DsRed tetramerization presents an obstacle for the researcher who wishes to image the subcellular localization of a red fluorescent chimera, as the question exists as to what extent will fusing tetrameric DsRed to the protein of interest affect the location and function of the latter. Furthermore, it can be difficult in some cases to confirm whether a result is due, for example, to a specific interaction of two proteins under investigation, or whether a perceived interaction is an artifact caused by the oligomerization of fluorescent proteins linked to each of the two proteins under investigation.
  • a methionine at position 66 of a tetrameric nonfluorescent chromoprotein from Ammonia sulcata was converted to a fluorescent protein through the introduction of two mutations (Lukyanov, K. A., Fradkov, A. F., Gurskaya, N. G., Mate, M. V., Labas, Y. A., Savitsky, A. P., Markelov, M. L., Zaraisky, A. G., Zhao, X., Fang, Y. et al (2000) J. Biol. Chem. 275, 25879-25882).
  • RFPs that additionally have reduced propensity for oligomerization, s ⁇ ch aS, e.g- teirainerizatlon: Tne ⁇ e also exists a need for RFP variants with improved efficiency of maturation that demonstrate useful fluorescence in a monomelic state in experimental systems.
  • methods to produce fluorescent proteins that demonstrate useful fluorescence in a monomelic state in experimental systems The present invention satisfies these needs and provides additional advantages.
  • variants of red fluorescent proteins that have a reduced propensity to oligomerize are disclosed herein.
  • the variant RFPs disclosed in the persent application have a propensity to form monomers and dimers, where the native form of the RFP has a propensity to form tetrameric structures.
  • aspects of the present invention concern variants of red fluorescent proteins (RFPs) comprising at least one amino acid alteration resulting in more efficient chromophore maturation than a corresponding wild-type or variant RFP.
  • RFPs red fluorescent proteins
  • the present invention concerns RFP variants that have a reduced propensity to form tetramers as compared to a corresponding wild-type or variant RF.
  • certain RFP variants of the invention have a propensity to form monomers and dimers, although the native form of the RFP has a propensity to form tetrameric structures.
  • the present invention concerns RFP variants that, in addition to showing more efficient chromophore maturation, also have a reduced propensity to form tetramers. Ih some aspects, the present invention further concerns RFP variants that show have improved quantum yield, improved extinction coefficient, or improvements in other measurable characteristics of a fluorescent protein as compared to a corresponding wild-type or variant RF. Some aspects of the present invention concern RFP variants that show more efficient maturation, have a reduced propensity to form tetramers, and in addition have improved . quantum yield, improved extinction coefficient, or improvements in other measurable characteristics of a fluorescent protein as compared to a corresponding wild-type or variant RF.
  • the invention concerns an Anthozoan fluorescent protein (AnFP) having a reduced propensity to oligomeriz ⁇ j comprising at least one mutation within tfr ⁇ iriliM ⁇ that reduces or eliminates the ability of the fluorescent protein to tetramerize and/or dimerize, as the case may be.
  • the AnFP preferably is the red fluorescent protein of Discosoma (DsRed) of SEQ K) NO: 1, but is by no means so limited.
  • the invention concerns an Anthozoan fluorescent protein (AnFP), e.g., DsRed, comprising at least one amino acid substitution within the AB and/or AC interface of said fluorescent protein ⁇ e.g., DsRed) that reduces or eliminates the degree of oligomerization of said fluorescent protein.
  • AnFP Anthozoan fluorescent protein
  • DsRed an Anthozoan fluorescent protein
  • the variant AnFP (e.g. , DsRed) having a reduced propensity to oligomerize is a monomer in which the interfaces between the oligomeric subunits are disrupted by introducing mutationSi e.g., substitutions, which interfere with oligomerization (including dimerization), and, if necessary, introducing further mutations needed to restore or improve fluorescence which might have been partially or completely lost as a result of disrupting the interaction of the subunits.
  • mutationSi e.g., substitutions, which interfere with oligomerization (including dimerization)
  • introducing further mutations needed to restore or improve fluorescence which might have been partially or completely lost as a result of disrupting the interaction of the subunits.
  • aspects of the invention specifically include dimeric and mon ⁇ jneric variants of other fluorescent proteins in addition to DsRed, such as fluorescent proteins from other species and fluorescent proteins that have fluorescence emission spectra in wavelengths other than red.
  • fluorescent proteins from other species such as green fluorescent proteins and fluorescent proteins from Renilla sp.find equal use with the invention.
  • fluorescent proteins that normally have the propensity to form tetramers and/or dimers find equal use with the invention.
  • the fluorescent protein is DsRed
  • a DsRed variant having a reduced propensity to oligomerize is prepared by first replacing at least one key residue in the AC and/or AB interface of the wild-type protein, thereby creating a dimer or monomer form, followed by the introduction of further mutation(s) to restore or improve red fluorescence properties.
  • the invention provides variant fluorescent proteins, including but not limited to DsRed, comprising amino acid substitutions relative to the respective wild-type sequences, where the substitutions impart the advantageous properties
  • Theie Smino acid substitutions can reside at any position within the polypeptide, and are not particularly limited to any type of substitution (conservative or non-conservative).
  • the mutations restoring or improving fluorescence are amino acid substitutions within the plane of the chromophore and/or just above the plane of the chromophore and/or just below the plane of the chromophore of the fluorescent protein.
  • the invention provides a polynucleotide sequence encoding ⁇ Discosoma red fluorescent protein (DsRed) variant having a reduced propensity to oligomerize, comprising one or more amino acid substitutions at the AB interface, at the AC interface, or at the AB and AC interfaces of the wild-type DsRed amino acid sequence of SEQ ID NO: 1, where the substitutions result in reduced propensity of the DsRed variant to form tetramers, wherein said variant displays detectable fluorescence of at least one red wavelength.
  • this protein sequence has at least about 80% sequence identity with the amino acid sequence of SEQ ID NO: 1.
  • the fluorescent protein has detectable fluorescence that matures at a rate at least about 80% as fast as the rate of fluorescence maturation of wild-type DsRed of SEQ ID NO: 1, while in another embodiment the protein has improved fluorescence maturation relative to DsRed of SEQ ID NO: 1. In still another embodiment, the protein substantially retains the fluorescence properties of DsRed of SEQ ID NO: 1.
  • the fluorescent protein variant has a propensity to form dimers.
  • Some proteins contain substitutions in the AB interface and form an AC dimer.
  • the fluorescent protein variant comprises amino acid substitutions that are at one or more of the residues 2, 5, 6, 21, 41, 42, 44, 117, 125, and 217 ofSEQ ID NO: L
  • the fluorescent protein variant comprises at least nine amino acid substitutions that are at residues 2, 5, 6, 21, 41, 42, 44, 117, and 217, and additionally at least one more substitution including substitution at residue 125 of SEQ ID NO:
  • the pirotem can optionally further comprise at least one additional amino acid substitution that is at residue 71, 118, 163, 179, 197, 127, or 131 ofSEQ ID NO: 1.
  • any one or more of said substitutions is optionally selected from R2A, K5E, N6D, T21S, H41T, N42Q, V44A, V71A, C117T, F118L, 1125R 1 V127T, S131P, K163Q/M, S179T, S197T, and T217A/S.
  • the invention provides fluorescent protein variants that can be the proteins dimerl, dimerl .02, dimerl.25, dimerl.26, dimer 1.28, dimerl.34, dimerl.56, dimerl .61, or dimerl .76, as provided in FIGS. 20ArD.
  • the protein variant is dimer2 (SEQ ID NO: 6), or dimer 2.2MMM (also termed dimer3 or dTomato) (SEQ ID NO: 81), or tdTomato (SEQ ID NO: 106).
  • the invention also provides fluorescent protein variants that can be variants of the protein dimer2 (SEQ JD NO: 6).
  • a variant of dimer2 (SEQ ID NO:6) may have about 80% sequence identity, or about 90%, or about 95% sequence identity with SEQ ID NO:6, and may comprise one or more amino acid substitutions selected from amino acid substitutions at positions 22, 66, 105, and 124, and may also include terminal amino acid additions or substitutions comprising one or more amino acids homologous to the N- and/or C-terminal amino acids of GFP (e.g., SEQ ID NO:14 at the N-terminus and/or SEQ ID NO: 91 or SEQ ID NO:110 at the C- terminus).
  • the substitutions in the dimeric protein is optionally selected from one or more of V22M, Q66M, V104L, and F124M.
  • the protein variant is dimer2.2MMM (dimer3) (dTomato) (SEQ ID NO: 81).
  • the fluorescent dimeric protein variant has at least about 90% sequence identity with the amino acid sequence of SEQ ID NO: 1, while in other embodiments, the protein has at least about 95% sequence identity with the amino acid sequence of SEQ ID NO: 1.
  • the fluorescent protein variant is a monomer.
  • the amino acid substitutions are in the AB interface and the AC interface.
  • the monomelic protein variant comprises at least 14 amino acid substitutions that are at residues 2, 5, 6, 21, 41, 42, 44, 71, 117, 127, 163, 179, 197, and 217, and additionally at least one more substitution that is at residue 125 of SEQ ID NO: 1.
  • the monomelic protein optionally further comprises at least one additional amino acid substitution at residue 83, 124, 125, 150, 153, 156, 162, 164, 174, 175, 177, 180, 192, 194, 195, 222, 223, 224, and 225 of SEQ ID NO: 1.
  • the substitutions in the monomelic protein is optionally selected from R2A, K5E, N6D, T21S, H41T, N42Q, V44A, V71A, K83L, C117E/T, F124L, I125R, V127T, L150M, R153E, V156A, H162K, K163Q/M, L174D, V175A, F177V, S179T, I180T, Y192A, Y194K, V195T, S197A/T/L T217A/S, H222S, L223T, F224G, L225A.
  • the monomeric protein variant is selected from mRFPO.l, mRFP0.2, mRFP0.3, mRFP0.4a, mRFP0.4b, mPll, mP17, ml.01, ml.02, mRFP0.5a, ml.12, mRFP0.5b, ml.15, ml.19, mRFPO.6, ml24, ml31, ml41, ml63, ml73, ml 87, ml 93, m200, m205 and m220, as provided in FIGS. 20A-20D.
  • the monomeric variant is mRFPl (SEQ ID NO: 8), or is mRFPl.5 (SEQ ID NO: 83) or is another monomeric variant.
  • the monomeric variant is a variant of mRFPl (SEQ ID NO: 8) or related fluorescent proteins.
  • a variant of mRFPl (SEQ ID NO: 8) may have 80%, or 90%, or 95% sequence identity with SEQ ID NO: 8, and may comprise one or more amino acid substitutions selected from amino acid substitutions at positions 7, 17, 21, 32, 66, 77, 78, 83, 108, 125, 147, 150, 161, 163, 174, 177, 182, 194, 195, 196, 197, 199 and 213, and may also include terminal amino acid additions or substitutions selected from one or more amino acids homologous to the amino acids at the GFP terminus (e.g., SEQ DD NO: 14, SEQ ID NO: 91 and SEQ ID NO:91), the amino acids DNMA, and the amino acids NNMA.
  • substitutions in the monomeric protein is optionally selected from one or more of V7I, R17H, T21S, E32K, Q66T/M, A77T/P, D78G, L83F/M, T108A, R125H, T147S, M150L, I161V, M163Q, D174S, V177T, M182K, K194I, T195V/A/L, D195A, D196G, I197E/Y, Ll 991, and Q213L.
  • the protein variant is selected from mRFPl.5 (SEQ ID NO: 83), OrS4-9 (SEQ ID NO: 85), Y1.3 (mYOFPl.3) (mBanana) (SEQ ID NO: ' (MQ ED NO: 89), , mRFP2 (mCheiry) (SEQ ID NO: 92), mOFP (74-11) (SEQ ID NO: 94), mROFP (A2/6-6) (SEQ ID NO: 96), mStrawberry (SEQ ID NO:98), mTangerine (SEQ ID NO:100), mOrange (mOFPl) (SEQ ID NO:102), mHoneydew (SEQ ID NO:104), and mGrapel (SEQ JD NO: 108),
  • the monomelic variant has at least about 90% sequence identity with the amino acid sequence of SEQ ID NO: 1, while in other embodiments, the protein has at least about 95% sequence identity with the amino acid sequence of SEQ ID NO: 1.
  • the present invention also provides tandem dimer forms of DsRed, comprising two DsRed protein variants operatively linked by a peptide linker.
  • the peptide linker can be of variable length, where, for example, the peptide linker is about 10 to about 25 amino acids long, or about 12 to about 22 amino acids long.
  • the peptide linker is selected from GHGTGSTGSGSS (SEQ ID NO: 17), RMGSTSGSTKGQL (SEQ LD NO: 18), and RMGSTSGSGKPGSGEGSTKGQL (SEQ ID NO: 19).
  • the tandem dimer subunit is selected from dimerl, dimerl.02, dimerl .25, dimerl .26, dimer 1.28, dimerl .34, dimerl.56, dimerl .61, dimerl .76, dimer2, dimer 2.2MMM (dimer 3) (dTomato) SEQ ID NO: 81) and tdTomato (SEQ ID NO: 106), as provided in FIGS.20A-20D and FIGS. 32-33.
  • the tandem dimer can be a homodimer or a heterodimer.
  • the tandem dimer comprises at least one copy of dimer2 (SEQ ID NO: 6), dimer 2.2MMM (dimer 3) (dTomato) (SEQ ID NO: 81), or may be tdTomato (SEQ ID NO: 106).
  • the present application also provides fusion proteins between any protein of interest operatively joined to at least one fluorescent protein variant of the invention.
  • This fusion protein can optionally contain a peptide tag, and this tag can optionally be a polyhistidine peptide tag.
  • the present application also provides polynucleotides that encode each of the fluorescent protein variants described or taught herein. Furthermore, the present invention provides the fluorescent protein variants encoded by any corresponding polynucleotide described of taligHt Herein. Such polypeptides can include dimeric variants, tandem dimer variants, or monomelic variants.
  • kits comprising at least one polynucleotide sequence encoding a fluorescent protein variant of the invention.
  • the kits can provide the fluorescent protein variant itself.
  • the present invention provides vectors that encode the fluorescent protein variants described or taught herein. Such vectors can encode dimeric variants, tandem dimer variants, or monomelic variants, or fusion proteins comprising these variants.
  • the invention also provides suitable expression vectors.
  • the invention provides host cells comprising any of these vectors.
  • the invention provides a method for the generation of a dimeric or monomelic variant of a fluorescent protein which has propensity to tetramerize or dimerize, comprising the steps of mutagenizing at least one amino acid residue in the fluorescent protein to produce a dimeric variant, if the protein had the propensity to tetramerize, and a monomelic variant, if the protein had the propensity to dimerize; and mutagenizing at least one additional amino acid residue to yield a dimeric or monomelic variant, which retains the qualitative ability to fluoresce in the same wavelength region as the non-mutagenized fluorescent protein.
  • an additional step can be added, essentially introducing a further mutation into a dimeric variant produced from a fluorescent protein that had the propensity to form tetramers to produce a monomelic variant.
  • this additional step can come after the first mutagenizing step.
  • this method can result in dimeric or monomelic variants having improved fluorescence intensity or fluorescence maturation relative to the non-mutagenized fluorescent protein.
  • the mutagenesis used in the present method can be by multiple overlap extension with semidegenerate primers, error-prone PCR, site directed mutagenesis, or by a combination of these.
  • the results of this mutagenesis can produce protein variants that have a propensity to form dimers or monomers.
  • the fluorescent protein is an Anthozoan fluorescent protein, and optionally, the Anthozoan fluorescent protein fluoresces at a red wavelength.
  • the Anthozoan fluorescent protein can be Discosoma DsRed.
  • the fluorescent protein variants of the invention can be used in various applications.
  • the invention provides a method for the detection transcriptional activity, where the method uses a host cell comprising a vector encoding a variant DsRed fluorescent protein operably linked to at least one expression control sequence, and a means to assay said variant fluorescent protein fluorescence. In this method, assaying the fluorescence of the variant fluorescent protein produced by the host cell is indicative of transcriptional activity.
  • the invention also provides a a polypeptide probe suitable for use in fluorescence resonance energy transfer (FRET), comprising at least one fluorescent protein variant of the invention.
  • FRET fluorescence resonance energy transfer
  • the invention provides a method for the analysis of in vivo localization or trafficking of a polypeptide of interest, where the method uses a fluorescent fusion protein of the invention in a host cell or tissue, and where the rus ⁇ n protein can be visualized in the host cell or tissue.
  • the invention concerns further improved variants of red fluorescent proteins (RFPs) that have reduced propensity to oligomerize.
  • RFPs red fluorescent proteins
  • the invention concerns RFP variants that not only have a propensity to form monomers and dimers, where the native form of the RFP has a propensity to form tetrameric structures, but are additionally characterized by more efficient maturation than the corresponding non- oligomerizing variants from which they derive.
  • Such variants are typically brighter than the corresponding non-oligomerizing variants, where bightness is typically expressed as the product of the extinction coefficient (EC) and the quantum yield (QY) at the desired red wavelength.
  • EC extinction coefficient
  • QY quantum yield
  • the invention fur ⁇ ner provides a polynucleotide encoding a variant of a red fluorescent protein (RFP) having a propensity to form tetrameric structures, comprising at least one amino acid alteration resulting in more efficient maturation into the desired red species from the immature green species, and at least one further amino acid alteration resulting in a reduced propensity to tetramerize.
  • RFP red fluorescent protein
  • the amino acid alteration may be substitution, insertion and/or deletion, and preferably is substitution.
  • the invention concerns a polynucleotide encoding a variant of a red fluorescent protein (RFP) having a propensity to form tetrameric structures, comprising at least one amino acid alteration resulting in higher fluorescence intensity at red wavelength, arid at least one further amino acid alteration resulting in a reduced propensity to tetramerize.
  • RFP red fluorescent protein
  • the polynucleotide encodes a Discosoma red fluorescent protein (DsRed) variant.
  • DsRed Discosoma red fluorescent protein
  • the polynucleotide encodes a DsRed variant, in which the amino acid substitution resulting in more efficient maturation is at position 66 of wild-type DsRed of SEQ ID NO: 1.
  • a particular substitution is a Q66M substitution within SEQ ID NO: 1.
  • the polynucleotide encodes a DsRed variant, in which the amino acid substitution resulting in more efficient maturation is at position 147 of wild-type DsRed of SEQ ID NO: 1.
  • the substitution at position 147 preferably is a T147S substitution, but other substitutions are also possible at this position and are specifically included within the scope of the present invention.
  • the polynucleotide of the invention encodes a DsRed variant comprising a substitution at both position 66 and position 147 within SEQ ID NO: 1.
  • the polynucleotide of the invention encodes a DsRed variant comprising a Q66M and a T147S substitution.
  • the polynucleotides of the invention encoding DsRed variants comprising at least one amino acid alteration resulting in improved efficiency , of chr ⁇ mophore maturation into the desired red form, such as, for example, a Q66M
  • such polynucleotides may encode DsRed variants further comprising one or more substitutions at the AB interface, at the AC interface, or at the AB and AC interfaces of the wild-type DsRed amino acid sequence of SEQ ID NO: 1, where the substitutions result in reduced propensity of the DsRed variant to form tetramers.
  • such polynucleotides encode DsRed variants additionally comprising one or more substitutions at an amino acid position selected from the group consisting of 42, 44, 71, 83, 124, 150, 163, 175, 177, 179, 195, 197, 217, 2, 5, 6, 125, 127, 180, 153, 162, 164, 174, 192, 194, 222, 223, 224, 225, 21, 41, 117, and 156 within the wild-type DsRed amino acid sequence of SEQ ID NO: 1.
  • Possible substitutions at the indicated positions include, without limitation, one or more substitutions selected from the group consisting of N42Q, V44A, V71A, K83L, F124L, L150M, K163M, V175A, F177V, S179T, V195T, S197I,.T217A, R2A, K5E, N6D. I125R, V127T, I180T, R153E, H162K, Al 64R, L174D, Y192A, Y194K, H222Si L223T, F224G, L225A, T21S, H41T, C117E, and V156A within the wild-type DsRed amino acid sequence of SEQ ID NO: 1.
  • polynucleotides encoding DsRed variants comprising the following substitutions: N42Q, V44A, V71A, K83L, F124L, L150M, K163M, V175A, F177V, S179T, V195T, S197I, T217A, R2A, K5E, N6D, I125R, V127T, I180T, R153E, H162K, A164R, L174D, Y192A, Y194K, H222S, L223T, F224G, L225A, T21S, H41T, Cl 17E, and V156A within the wild-type DsRed amino acid sequence of SEQ ID NO: 1, are specifically within the scope of the invention.
  • Preferred dimeric embodiments of the invention include a polynucleotide encoding a dimer2 (SEQ ID NO:6), a polynucleotide encoding a dimer2.2MMM (dimer3) (dTomato) (peptide SEQ ID NO: 81, DNA SEQ ID NO: 82), and a polynucleotide encoding a tdTomato (peptide SEQ ID NO: 106, DNA SEQ ID NO: 107).
  • SEQ ID NO: 6 dimer2
  • dimer3 dimer2.2MMM
  • dTomato dimer2.2MMM
  • tdTomato peptide SEQ ID NO: 106, DNA SEQ ID NO: 107
  • embodiments of the invention include a polynucleotide encoding a mRFPl.l shown in FigWre-30 (SE(2 ; » ⁇ f ⁇ : 7 ⁇ iS)Piib ⁇ f ⁇ Icleotide encoding amRFPl.5 (SEQ ID NO: 83), a polynucleotide encoding a QrS4-9 (SEQ ID NO: 85), a polynucleotide encoding a Yl.3 (SEQ ID NO: 87), a polynucleotide encoding a F2Q6 (SEQ ID NO: 89), a polynucleotide encoding a mRFP2 (mCherry) (SEQ ID NO: 92), a polynucleotide encoding a mOFP (74- 11) (SEQ ID NO: 94), a polynucleotide encoding a mROFP (A2/6-6) (S
  • the invention concerns a polynucleotide encoding a fusion protein, comprising at least one DsRed protein variant encoded by the polynucleotides discussed above, operatively joined to at least one other polypeptide of interest.
  • fusion proteins may comprising either the Q66M or T147S substitution, or both, as a tandem dimer.
  • the invention further concerns polypeptides encoded by the polynucleotides discussed above, vectors containing such polynucleotides (including expression vectors), and recombinant host cells transformed with such polynucleotides or vectors.
  • the invention in a different aspect, concerns a kit comprising at least one polynucleotide or polypeptide discussed above.
  • the invention concerns a method for the detection transcriptional activity, comprising:
  • a host cell comprising a vector, wherein said vector comprises nucleotide sequence encoding a DsRed fluorescent protein variant comprising at least one amino acid alteration resulting in higher fluorescence intensity at red wavelength, and at least one further amino acid alteration resulting in a reduced propensity to tetramerize operably linked to at least one expression control sequence, and a means to assay said variant fluorescent protein fluorescence, and (b) assaying flii ⁇ reSicgnce of said variant fluorescent protein produced by said host cell, where variant fluorescent protein fluorescence is indicative of transcriptional activity.
  • the invention concerns a method for the detection of protein-protein interactions, comprising detection of energy transfer from a fluorescent or bioluminescent protein fusion to a fusion protein as disc ⁇ ssed above.
  • the invention concerns a method for the analysis of in vivo localization or trafficking of a polypeptide of interest, comprising the steps of:
  • FIG. 1 illustrates the tetrameric form of DsRed (PDB identification code 1G7K).
  • the A-C and B-D interfaces are equivalent, as are the A-B and C-D interfaces.
  • FIGS.2A-2C show graphical representations of the tetramer, dimer and monomer forms of DsRed, respectively, based on the x-ray crystal structure of DsRed. Residues 1-5 were not observed in the crystal structure but have been arbitrarily appended for the sake of completeness.
  • the DsRed chromophore is represented in red and the four chains of the tetramer are labeled following the convention of Yarbrough et al (Yarbrough et al, Proc. Natl. Acad. ScL USA 98:462-467 [2001]).
  • FIG. 2A shows the tetramer of DsRed with the residues mutated in Tl indicated in blue for external residues and green for those internal to the ⁇ -barrel.
  • FIG. 2B shows the AC dimer of DsRed with all mutations present in dimer2 represented as in FIG. 2A and the intersubunit linker present in tdimer2(12) shown as a dotted line.
  • FIG. 2C shows the mRFPl monomer of DsRed with all mutations present in mRFPl represented as in FIG. 2A.
  • FIGS. 5 ⁇ U6C sHow the results of an analytical ultracentrifugation analysis of DsRed, dimer2, and mRFP0.5a polypeptides, respectively.
  • the equilibrium radial absorbance profiles at 20,000 rpm were modeled with a theoretical curve that allowed only the molecular weight to vary.
  • the DsRed absorbance profile (FIG. 3A) was best fit with an apparent molecular weight of 120 kDa, consistent with a tetramer.
  • the dimer2 absorbance profile (FIG. 3B) was best fit with an apparent molecular weight of 60 kDa, consistent with a dimer.
  • the rnRFPO.Sa absorbance profile (FIG. 3C) was best fit with an apparent molecular weight of 32 kDa, consistent with a monomer containing an N-terminal polyhistidine affinity tag.
  • FIGS. 4A-4D show fluorescence and absorption spectra of DsRed, Tl, dimer2 and tdimer2(12) and mRFPl, respectively.
  • the absorbance spectrum is shown with a solid line, the excitation with a dotted line and the emission with a dashed line.
  • FIG. 5 shows a maturation time course of red fluorescence for DsRed, Tl, dimer2, tdimer2(12) and mRFPl.
  • the profiles are color coded, as indicated in the key.
  • Log phase cultures of E. coli expressing the construct of interest were rapidly purified at 4 0 C.
  • Maturation at 37 0 C was monitored beginning at 2 hours post-harvest.
  • the initial decrease in mRFPl fluorescence is attributed to a slight quenching on warming from 4 to 37 0 C.
  • FIGS. 6A-6F show light and fluorescence microscopic images of HeLa cells expressing Cx43 fused with Tl, dimer2 or mRFPl. Images 6A, 6C and 6E were acquired with excitation at 568 nm (55 nm bandwidth) and emission at 653 nm (95 nm bandwidth) with additional transmitted light. Lucifer yellow fluorescence (images 6B, 6D and 6F) was acquired with excitation at 425 nm (45 nm bandpass) and emission at 535 nm (55 nm bandpass).
  • FIG. 6A shows two contacting cells transfected with Cx43-mRFPl and connected by a single large gap junction.
  • FIG. 6B shows one cell microinjected with lucifer yellow at the point indicated by an asterisk and the dye quickly passing (1-2 sec) to the adjacent cell.
  • FIG. 6C shows four neighboring cells transfected with Cx43-dimer2. The bright line between the two right-most cells is the result of having two fluorescent membranes in contact and is not a gap junction.
  • FIG. 6D shows microinjected dye slowly passing to an adjacent cell (observed approximately one third of the time).
  • FIG. 6E shows two adjacent cells tfiansfected w ⁇ thfCx43-Tl and displaying the typical perinuclear localized aggregation.
  • FIG. 6F shows no dye passed between neighboring cells.
  • FIG. 7 shows a schematic representation of the directed evolution strategy of the present invention. Randomization at two positions is shown but the technique has been used with up to five fragments.
  • FIGS. 8A and 8B show SDS-PAGE analysis of DsRed, Tl , dimer2, tdimer2(12), and mRFPl polypeptides.
  • the oligomeric state of each protein is demonstrated by running each protein (20 ⁇ g) both not boiled and boiled on a 12% SDS-PAGE Tris-HCl precast gel (BioRad).
  • FIG. 8A shows the gel prior to Coomasie staining, which was imaged with excitation at 560 nm and emission at 610 nm.
  • the tandem dimer tdimer2(12) has a small tetrameric component due a fraction of the covalent tandem pairs participating in intermolecular dimer pairs.
  • FIG. 8B shows the same gel as in FIG. 8A after Coomasie staining.
  • the band at ⁇ 20 kDa results from partial hydrolysis of the mainchain acylimine linkage in protein containing a red chromophore.
  • FIGS. 9A-9D show fluorescent images of red fluorescent proteins expressed in E. coli.
  • E. coli strain JM109(DE3) was transformed with either DsRed, Tl, dimer2 or mRFPl, plated on LB/agar supplemented with ampicillin, and incubated 12 hours at 37 0 C then 8 hours at 20 0 C before the plate was imaged with a digital camera.
  • the quadrants corresponding to T 1 , dimer2, and mRFP 1 all appear of similar brightness when excited at 540 nm and imaged with a 575 nm (long pass) emission filter. Almost no fluorescence is visible for identically treated E. coli transformed with DsRed. Ih FIG.
  • FIGS. 1OA and 1OB show a table describing the protocols and multiple libraries created during evolution of dimerl and mRFPl, as well as other intermediate forms. The templates, method of mutagenesis, targeted positions within the DsRed polypeptide, and resulting clones are indicated.
  • FIGS. 1 IA - 11C show a table providing a key to the primer pairs used in the mutagenesis protocols, as well as the target codon positions.
  • FIGS. 12A and 12B provide the PCR primer sequences listed in FIGS. 1 IA-11C.
  • FIG. 13 shows a table describing the results of a series of experiments testing the functionality of various DsRed chimeric molecules.
  • the chimeric molecules comprise a DsRed sequence and the Cx43 polypeptide.
  • the plasmids encoding the fusion polypeptides were transfected into HeLa cells, and the ability of the expressed fusion polypeptides to form functional gap junctions was assayed by the microinjection of lucifer yellow dye. Passage of the dye from one HeLa cell to an adjacent HeLa cell indicates the presence of a functional gap junction, and thus, a functional fusion polypeptide.
  • FIG. 14 shows various biophysical properties of wild-type DsRed, Tl, dimer2, tdimer2(12), and mRFPl polypeptides.
  • FIG. 15 shows a table providing excitation/emission wavelength values, relative maturation speed and red/green ratio values of red and green fluorescent protein species.
  • FIG. 16 provides the nucleotide sequence of the Discosoma sp. wild-type red fluorescent protein open reading frame (DsRed).
  • FIG. 17 provides the amino acid sequence of the Discosoma sp. wild-type red fluorescent protein (DsRed).
  • FIG. 18 provides the nucleotide sequence of the Discosoma sp. variant fast Tl red fluorescent protein.
  • FIG: 19 'jpifr ⁇ ifidig'sthe amino acid sequence of the Discosoma sp. variant fast Tl red fluorescent protein.
  • FIGS. 2OA - 2OD provide a table showing the amino acid substitutions identified during the construction of variant DsRed proteins. Also shown are the substitutions originally contained in the fast Tl DsRed variant.
  • FIG. 21 provides the nucleotide sequence of the Discosoma variant red fluorescent protein dimer2 open reading frame.
  • FIG. 22A provides the amino acid sequence of the Discosoma variant red fluorescent protein dimer2.
  • FIG. 22B provides the amino acid sequence of the GFP termini and illustrates their locations at the N-terminal (SEQ ID NO: 14) and C-te ⁇ ninal (SEQ ID NO: 91) ends of a fluorescent protein.
  • FIG. 23 provides the nucleotide sequence of the Discosoma variant red fluorescent protein mRFPl open reading frame.
  • FIG. 24 provides the amino acid sequence of the Discosoma variant red fluorescent protein mRFPl .
  • FIG. 25 provides the nucleotide sequence of a modified Discosoma wild- type red fluorescent protein open reading frame with humanized codon usage.
  • FIG. 26 illustrates the maturation of Q66M DsRed relative to the wild- type DsRed protein.
  • FIG. 27 shows the excitation and emission spectra of wild-type DsRed (dsRed w.t.) and Q66M DsRed (dsRED Q66M), plotting relative intensity as a function of wavelength.
  • FIG 28 shows Coomassie-stained bands on SDS-polyacrylamide gel, representative of wild-type DsRed, Q66M DsRed and K83DsRed after hydrolysis at pH 1.
  • the abso ⁇ tion spectrum is normalized to the 280 nm peak which should approximate the total protein concentration.
  • the emission spectrum (measured with excitation at 550 nm) is normalized to its respective absorption maximum for sake of representation.
  • FIG. 30 provides the amino acid sequence of mRFPl .1.
  • FIG. 31 provides the nucleotide sequence of mRFPl .1.
  • FIG. 32 shows a table of properties of DsRed variants, providing excitation wavelengths and emission wavelengths (as ex/em in nm) extinction coefficients (as M 4 Cm '1 ), quantum yield, listing of mutations with respect to the parent sequence, and comments on the properties of the listed DsRed variants.
  • FIG. 33 provides the amino acid and DNA sequence of dimer2.2MMM (dimer3) (dTomato) (SEQ ID NO: 81 and SEQ ID NO: 82)
  • FIG. 34 provides the amino acid and DNA sequence of mRFPl .5 (SEQ ID NO: 83 and SEQ ID NO: 84).
  • FIG. 35 provides the amino acid and DNA sequence of OrS4-9 (SEQ ID NO: 85 and SEQ ID NO: 86).
  • FIG. 36 provides the amino acid and DNA sequence of Yl .3 (mY0FP1.3) (mBanana) (SEQ ID NO. 87 and SEQ ID NO: 88).
  • FIG. 37 provides the amino acid and DNA sequence of mFRFP (F2Q6) (mGrape2) (SEQ ID NO: 89 and SEQ ID NO: 90).
  • FIG. 38 provides the amino acid and DNA sequence of mRFP2 (mCherry) (SEQ ID NO: 92 and SEQ ID NO: 93). .
  • FIG. 39 provides the amino acid and DNA sequence of mOFP (74-11) (SEQ ID NO: 94) and (SEQ ID NO: 95). l ⁇ 01) ' FIO 1 .40 pMdeS ffte amino acid and DNA sequence of mROFP (A2/6-6) (SEQ ID NO: 96 and SEQ ID NO: 97).
  • FIG. 41 provides the amino acid and DNA sequence of mStrawberry (SEQ ID NO: 98 and SEQ ID NO: 99).
  • FIG. 42 provides the amino acid and DNA sequence of mTangerine (SEQ ID NO: 100 and SEQ ID NO: 101).
  • FIG. 43 provides the amino acid and DNA sequence of mOrange (MOFPl) (SEQ ID NO: 102 and SEQ ID NO: 103).
  • FIG. 44 provides the amino acid and DNA sequence of mHoneydew (SEQ ID NO: 104 and SEQ ID NO: 105).
  • FIG. 45 provides the amino acid and DNA sequence of tdTomato (SEQ ID NO: 106 and SEQ ID NO: 107).
  • FIG. 46 provides the amino acid and DNA sequence of mGrapel (SEQ ID NO: 108 and SEQ ID NO: 109).
  • FIG. 47A provides excitation spectra for new RFP variants. Spectra are normalized to the excitation and emission peak for each protein. Excitation curves are shown as solid or dashed lines for mRFPl variants and as a dotted line for dTomato and tdTomato, with colors corresponding to the color of each variant.
  • FIG. 47B provides emission spectra for new RFP variants. Spectra are normalized to the excitation and emission peak for each protein. Emission curves are shown as solid or dashed lines for mRFPl variants and as a dotted line for dTomato and tdTomato, with colors corresponding to the color of each variant.
  • FIG. 48A provides sequence alignment of new mRFP variants with wild- type DsRed and mRFPl. Internal residues are shaded. mRFPl mutations are shown in blue, and critical mutations in mCherry, mStrawberry, mTangerine, mOrange, mBanana, and mHi> ⁇ eydew ' ' MSh'oMn M a ⁇ Sr ⁇ ' ⁇ iif fsponding to the color of each variant. GFP-type termini on new mRFP variants are shown in green.
  • FIG. 48B provides genealogy of DsRed-derived variants, with mutations critical to the phenotype of each new variant.
  • FIG. 49 provides emission spectra for 400 nm excitation for a zinc-finger fused with mOrange on its N-terminus and T-Sapphire on its C-terminus.
  • FIG. 50 provides mRFPl and mCherry C-/N-terminal 6xHis tag absorbance spectra, illustrating sensitivity to N- and C-te ⁇ ninal fusions.
  • FIG. 51 provides photobleaching curves for new RFP variants.
  • FIG. 52 illustrates discrimination of E. coli transfected with six different fluorescent proteins (FPs).
  • nucleic acid molecule refers to a deoxyribonucleotide or ribonucleotide polymer in either single-stranded or double-stranded form, and, unless specifically indicated otherwise, encompasses polynucleotides containing known analogs of naturally occurring nucleotides that can function in a similar manner as naturally occurring nucleotides. It will be understood that when a nucleic acid molecule is represented by a DNA sequence, this also includes RNA molecules having the corresponding RNA sequence in which "U" (uridine) replaces "T" (thymidine).
  • recombinant nucleic acid molecule refers to a non-naturally occurring nucleic acid molecule containing two or more linked polynucleotide sequences.
  • a recombinant nucleic acid molecule can be produced by recombination methods, particularly genetic engineering techniques, or can be produced by a chemical synthesis method.
  • a recombinant nucleic acid molecule can encode a fusion protein, for example, a fluorescent protein variant of the invention linked to a polypeptide of interest.
  • recombinant host cell refers to a cell that contains a recombinant nucleic acid molecule. As such, a recombinant host cell can express a polypeptide from a "gene” that is not found within the native (non-recombinant) form of the cell.
  • Reference to a polynucleotide "encoding" a polypeptide means that, upon transcription of the polynucleotide and translation of the mRNA produced therefrom, a polypeptide is produced.
  • the encoding polynucleotide is considered to include both the coding strand, whose nucleotide sequence is identical to an mRNA, as well as its complementary strand. It will be recognized that such an encoding polynucleotide is considered to include degenerate nucleotide sequences, which encode the same amino acid residues.
  • Nucleotide sequences encoding a polypeptide can include polynucleotides containing introns as well as the encoding exons.
  • expression control sequence refers to a nucleotide sequence that regulates the transcription or translation of a polynucleotide or the localization of a polypeptide to which to which it is operatively linked. Expression control sequences are "operatively linked” when the expression control sequence controls or regulates the transcription and, as appropriate, translation of the nucleotide sequence (i.e., a transcription or translation regulatory element, respectively), or localization of an encoded polypeptide to a specific compartment of a cell.
  • an expression control sequence can be a promoter, enhancer, transcription terminator, a start codon (ATG), a splicing signal for intron excision and maintenance of the correct reading frame, a STOP codon, a ribosome binding site, or a sequence that targets a polypeptide to a particular location, for example, a cell compartmentalization signal, which can target a polypeptide to the cytosol, nucleus, plasma membrane, endoplasmic reticulum, mitochondrial membrane or matrix, chloroplast membrane or lumen, medial trans-Golgi cisternae, or a lysosome or endosor ⁇ e.
  • Cell art include, for example, a peptide containing amino acid residues 1 to 81 of human type II membrane-anchored protein galactosyltransferase, or amino acid residues 1 to 12 of the presequence of subunit IV of cytochrome c oxidase (see, also, Hancock et al., EMBO J, 10:4033-4039, 1991; Buss et al., MoI. Cell. Biol. 8:3960-3963, 1988; U.S. Patent No. 5,776,689, each of which is incorporated herein by reference).
  • operatively linked or “operably linked” or “operatively joined” or the like, when used to describe chimeric proteins, refer to polypeptide sequences that are placed in a physical and functional relationship to each other. Ih a most preferred embodiment, the functions of the polypeptide components of the chimeric molecule are unchanged compared to the functional activities of the parts in isolation.
  • a fluorescent protein of the present invention can be fused to a polypeptide of interest. In this case, it is preferable that the fusion molecule retains its fluorescence, and the polypeptide of interest retains its original biological activity. In some embodiments of the present invention, the activities of either the fluorescent protein or the protein of interest can be reduced relative to their activities in isolation. Such fusions can also find use with the present invention.
  • the chimeric fusion molecules of the invention can be in a monomelic state, or in a multimeric state (e.g., dimeric).
  • the tandem dimer fluorescent protein variant of the invention comprises two "operatively linked" fluorescent protein units.
  • the two units are linked in such a way that each maintains its fluorescence activity.
  • the first and second units in the tandem dimer need not be identical.
  • a third polypeptide of interest can be operatively linked to the tandem dimer, thereby forming a three part fusion protein.
  • oligomer refers to a complex formed by the specific interaction of two or more polypeptides.
  • a "specific interaction” or “specific association” is one that is relatively stable under specified conditions, for example, physiologic conditions.
  • Reference to a "propensity" of proteins to oligomerize indicates that the proteins can form dimers, trimers, tetramers, or the like under specified conditions.
  • fluorescent proteins such as GFPs and DsRed have a propensity to oligomerize under physiologic conditions although, as disclosed herein, fluorescent proteins also can oligomerize, for example, under pH conditions other than physiologic conditions.
  • the conditions under which fluorescent proteins oligomerize or have a propensity to oligomerize can be determined using well known methods as disclosed herein or otherwise known in the art.
  • a molecule that has a "reduced propensity to oligomerize” is a molecule that shows a reduced propensity to form structures with multiple subun ⁇ ts in favor of forming structures with fewer subunits.
  • a molecule that would normally form tetrameric structures under physiological conditions shows a reduced propensity to oligomerize if the molecule is changed in such a way that it now has a preference to form monomers, dimers or trimers.
  • a molecule that would normally form dimeric structures under physiological conditions shows a reduced propensity to oligomerize if the molecule is changed in such a way that it now has a preference to form monomers.
  • "reduced propensity to oligomerize” applies equally to proteins that are normally dimers and to proteins that are normally tetrameric.
  • non-tetramerizing refers to protein forms that produce trimers, dimers and monomers, but not tetramers.
  • npn-dimerizing refers to protein forms that remain monomeric.
  • the term "efficiency of (chromophore) maturation” with reference to a red fluorescent protein (RFP) indicates the percentage of the protein that has matured from a species with a green fluorescent protein (GFP)-like absorbance spectrum to the final RFP absorbance spectrum. Accordingly, efficiency of maturation is determined after allowing sufficient time for the maturation process to be practically (e.g.>95%) complete.
  • the resultant RFP e.g. DsRed
  • the resultant RFP e.g. DsRed
  • term "brightness,” with reference to a fluorescent protein, is measured as the product of the extinction coefficient (EC) at a given wavelength and the fluorescence quantum yield (QY).
  • probe refers to a substance that specifically binds to another substance (a "target”).
  • Probes include, for example, antibodies, polynucleotides, receptors and their ligands, and generally can be labeled so as to provide a means to identify or isolate a molecule to which the probe has specifically bound.
  • label refers to a composition that is detectable with or without the instrumentation* for example, by visual inspection, spectroscopy, or a photochemical, biochemical, immunochemical or chemical reaction.
  • Useful labels include, for example, phosphorus-32, a fluorescent dye, a fluorescent protein, an electron-dense reagent, an enzymes (such as is commonly used in an ELISA), a small molecule such as biotin, digoxigenin, or other haptens or peptide for which an antiserum or antibody, which can be a monoclonal antibody, is available.
  • a fluorescent protein variant of the invention which is itself a detectable protein, can nevertheless be labeled so as to be detectable by a means other than its own fluorescence, for example, by incorporating a radionuclide label or a peptide tag into the protein so as to facilitate, for example, identification of the protein during its expression and isolation of the expressed protein, respectively.
  • a label useful for purposes of the present invention generally generates a measurable signal such as a radioactive signal, fluorescent light, enzyme activity, and the like, either of which can be used, for example, to quantitate the amount of the fluorescent protein variant in a sample.
  • nucleic acid probe refers to a polynucleotide that binds to a specific nucleotide sequence or sub-sequence of a second (target) nucleic acid molecule.
  • a nucleic acid probe generally is a polynucleotide that binds to the target nucleic acid molecule through complementary base pairing. It will be understood that a nucleic acid probe can specifically bind a target sequence that has less than complete complementarity with the probe sequence, and that the specificity of binding will depend, in part, upon the stringency of the hybridization conditions.
  • a nucleic acid probes can be labeled as with a radionuclide, a chromophore, a lumiphore, a chromogen, a fluorescent protein, or a small molecule such as biotin, which itself can be bound, for example, by a streptavidin complex, thus providing a means to isolate the probe, including a target nucleic acid molecule specifically bound by the probe. By assaying for the presence or absence of the probe, one can detect the presence or absence of the target sequence or sub-sequence.
  • labeled nucleic acid probe refers to a nucleic acid probe that is bound, either directly or through a linker molecule, and covalently or through a stable non-covalent bond such as an ionic, van der Waals or hydrogen bond, to a label such that the presence of the probe can be identified by detecting the presence of the label bound to the probe.
  • polypeptide or "protein” refers to a polymer of two or more amino acid residues.
  • the terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • recombinant protein refers to a protein that is produced by expression of a nucleotide sequence encoding the amino acid sequence of the protein from a recombinant DNA molecule.
  • isolated refers to a material that is substantially or essentially free from components that normally accompany the material in its native state in nature. Purity or homogeneity generally are determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis, high performance liquid chromatography, and the like. A polynucleotide or a polypeptide is considered to be isolated when it is the predominant species present in a preparation.
  • an isolated protein or nucleic acid molecule represents greater than 80% of the macromolecular species present in a preparation, often represents greater than 90% of all macromolecular species present, usually represents greater than 95%, of the macromolecular species, and, in particular, is a polypeptide or polynucleotide that purified to essential homogeneity such that it is the only species detected when examined using conventional methods for determining purity of such a molecule.
  • Naturally-occurring is used to refer to a protein, nucleic acid molecule, cell, or other material that occurs in nature.
  • a polypeptide or polynucleotide sequence that is present in an organism, including in a virus.
  • a naturally occurring material can be in its form as it exists in nature, and can be modified by the hand of man such that, for example, is in an isolated form.
  • antibody refers to a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes, or antigen-binding fragments thereof, which specifically bind and recognize an analyte (antigen).
  • the recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as the myriad immunoglobulin variable region genes.
  • Antibodies exist as intact immunoglobulins and as well characterized antigen-binding fragments of an antibody, which can be produced by digestion with a peptidase or can using recombinant DNA methods.
  • antigen-binding fragments of an antibody include, for example, Fv, Fab' and F(ab)' 2 fragments.
  • antibody includes antibody fragments either produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA methodologies.
  • immunoassay refers to an assay that utilizes an antibody to specifically bind an analyte.
  • An immiuiioassay is characterized by the use of specific binding properties of a particular antibody to isolate, target, and/or quantify the analyte.
  • sequence identity when used in reference to two or more polynucleotide sequences or two or more polypeptide sequences, refers to the residues in the sequences that are the same when aligned for maximum correspondence.
  • percentage of sequence identity when used in reference to a polypeptide, it is recognized that one or more residue positions that are not otherwise identical can differ by a conservative amino acid substitution, in which a first amino acid residue is substituted for another amino acid residue having similar chemical properties such as a similar charge or hydrophobic or hydrophilic character and, therefore, does not change the functional properties of the polypeptide.
  • the percent sequence identity can be adjusted upwards to correct for the conservative nature of the substitution.
  • Such an adjustment can be made using well known methods, for example, scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity.
  • scoring a conservative substitution is given a score between zero and 1.
  • the scoring of conservative substitutions can be calculated using any well known algorithm (see, for example, Meyers and Miller, Comp. Appl. Biol. Sci.4:11-17, 1988; Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. MoI. Biol. 48:443 T 1970; Pearson and Lipman, Proc. Natl. Acad. Sci..
  • each polynucleotide sequence disclosed herein as encoding a fluorescent protein variant also describes every possible silent variation. It will also be recognized that each codon in a polynucleotide, except AUG, which is ordinarily the only codon for methionine, and UUG, which is ordinarily the only codon for tryptophan, can be modified to yield a functionally identical molecule by standard techniques.
  • each silent variation of a polynucleotide that does not change the sequence of the encoded polypeptide is implicitly described herein.
  • individual substitutions, deletions or additions ' that alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 5%, and generally less than 1%) in an encoded sequence can be considered conservatively modified variations, provided alteration results in the substitution of an amino acid with a chemically similar amino acid.
  • Conservative amino acid substitutions providing functionally similar amino acids are well known in the art, including the following six groups, each of which contains amino acids that are considered conservative substitutes for each another:
  • Phenylalanine (Phe, F), Tyrosine (Tyr, Y), Tryptophan (Tip, W).
  • Two or more amino acid sequences or two or more nucleotide sequences are considered to be “substantially identical” or “substantially similar” if the amino acid sequences or the nucleotide sequences share at least 80% sequence identity with each other, or with a reference sequence over a given comparison window.
  • substantially similar sequences include those having, for example, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or at least 99% sequence identity.
  • a subject nucleotide sequence is considered “substantially complementary” to a reference nucleotide sequence if the complement of the subject nucleotide sequence is substantially identical to the reference nucleotide sequence.
  • the term “stringent conditions” refers to a temperature and ionic conditions used in a nucleic acid hybridization reaction. Stringent conditions are sequence dependent and are different under different environmental parameters. Generally, stringent conditions are selected to be about 5°C to 20 0 C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature, under defined ionic strength and pH, at which 50% of the target sequence hybridizes to a perfectly matched probe.
  • allelic variants refers to polymorphic forms of a gene at a particular genetic locus, as well as cDNAs derived from mRNA transcripts of the genes, and the polypeptides encoded by them.
  • preferred mammalian eodon refers to the subset, of codons from among the set of codons encoding an amino acid that are most frequently used in proteins expressed in mammalian cells as chosen from the following list: GIy (GGC, GGG); Gl ⁇ (GXG); As ⁇ (GAC); VaI (GUG, GUC); Ala (GCC, GCU); Ser (AGC, UCC); Lys (AAG); Asn (AAC); Met (AUG); He (AUC); Thr (ACC); Tip (UGG); Cys (UGC); Tyr (UAU, UAC); Leu (CUG); Phe (UUC); Arg (CGC, AGG, AGA); GIn (CAG); His (CAC); and Pro
  • Fluorescent molecules are useful in fluorescence resonance energy transfer, FRET, which involves a donor molecule and an acceptor molecule.
  • FRET fluorescence resonance energy transfer
  • the emission spectrum of the donor should overlap as much as possible with the excitation spectrum of the acceptor to maximize the overlap integral.
  • the quantum yield of the donor moiety and the extinction coefficient of the acceptor should be as high as possible to maximize Ro, which represents the distance at which energy transfer efficiency is 50%.
  • the excitation spectra of the donor and acceptor should overlap as little as possible so that a wavelength region can be found at which the donor can be excited efficiently without directly exciting the acceptor because fluorescence arising from direct excitation of the acceptor can be difficult to distinguish from fluorescence arising from FRET.
  • the emission spectra of the donor and acceptor should overlap as little as possible so that the two emissions can be clearly distinguished.
  • High fluorescence quantum yield of the acceptor moiety is desirable if the emission from the acceptor is to be measured either as the sole readout or as part of an emission ratio.
  • One factor to be considered in choosing the donor and acceptor pair is the efficiency of fluorescence resonance energy transfer between them.
  • the efficiency of FRET between the donor and acceptor is at least 10%, more preferably at least 50% and even more preferably at least 80%.
  • fluorescent property refers to the molar extinction coefficient at an appropriate excitation wavelength, the fluorescence quantum efficiency, the shape of the excitation spectrum or emission spectrum, the excitation wavelength maximum and emission wavelength maximum, the ratio of excitation amplitudes at two different wavelengths, the ratio of emission amplitudes at two different wavelengths, the excited state lifetime, or the fluorescence anisotropy.
  • a measurable difference in any one of these properties between wild type Aequorea GFP and a spectral variant, or a mutant thereof, is useful.
  • a measurable difference can be determined by determining the amount of any quantitative fluorescent property, e.g., the amount of fluorescence at a particular wavelength, or the integral of fluorescence over the emission spectrum.
  • excitation amplitude ratioing and “emission amplitude ratioing”, respectively
  • emission amplitude ratioing are particularly advantageous because the ratioing process provides an internal reference and cancels out variations in the absolute brightness of the excitation source, the sensitivity of the detector, and light scattering or quenching by the sample.
  • fluorescent protein refers to any protein that can fluoresce when excited with an appropriate electromagnetic radiation, except that chemically tagged proteins, wherein the fluorescence is due to the chemical tag, and polypeptides that fluoresce only due to the presence of certain amino acids such as tryptophan or tyrosine, whose emission peaks at ultraviolet wavelengths (Le., less that about 400 run) are not considered fluorescent proteins for purposes of the present invention
  • a fluorescent protein useful for preparing a composition of the invention or for use in a method of the invention is a protein that derives its fluorescence from autocatalytically forming a chromophore.
  • a fluorescent protein can contain amino acid sequences that are naturally occurring or that have been engineered (i.e., variants or mutants).
  • mutant or “variant” refers to a protein that is different from a reference protein.
  • a spectral variant of Aequorea GFP can be derived from the naturally occurring GFP by engineering mutations such as amino acid substitutions into the reference GFP protein.
  • ECFP is a spectral variant of GFP that contains substitutions with respect to GFP (compare SEQ ID NOs: 10 and 11).
  • green fluorescent protein is used broadly herein to refer to a protein that fluoresces green light, for example, Aequorea GFP (SEQ ID NO: 10). GFPs have been isolated from the Pacific Northwest jellyfish, Aequorea victoria, the sea pansy, Renilla reniformis, and Phialidium gregarium (Ward et al., Photochem. Photobiol. 35:803-808, 1982; Levine et al., Comp. Biochem. Phvsiol. 72B:77-85, 1982, each of which is incorporated herein by reference).
  • red fluorescent proteins which fluoresce red
  • cyan fluorescent proteins which fluoresce cyan
  • RFPs have been isolated from the corallimo ⁇ h2) « r mro/»tf (Matz et al, Nature Biotechnology 17:969-973 [1999]).
  • red fluorescent protein or “RFP” is used in the broadest sense and specifically covers the Discosoma RFP (DsRed), and red fluorescent proteins from any other species, such as coral and sea anemone, as well as variants thereof, as long as they retain the ability to fluoresce red light.
  • a variety o ⁇ Aequorea GFP-related fluorescent proteins having useful excitation and emission spectra have been engineered by modifying the amino acid sequence of a naturally occurring GFP from A. victoria (see Prasher et al, Gene 111 :229-233, 1992; Heim et al, Proc. Natl Acad. ScL USA 91:12501-12504, 1994; U.S. Patent No. 5,625,048; International application PCT/US95/14692, now published as PCt WO96/23810, each of which is incorporated herein by reference).
  • reference to a "related fluorescent protein” refers to a fluorescent protein that has a substantially identical amino acid sequence when compared to a reference fluorescent protein.
  • a related fluorescent protein when compared to the reference fluorescent protein sequence, has a contiguous sequence of at least about 150 amino acids that shares at least about 85% sequence identity with the reference fluorescent protein, and particularly has a contiguous sequence of at least about 200 amino acids mat shares at least about 95% sequence identity with the reference fluorescent protein.
  • an "Aequorea- related fluorescent protein” or to a "GFP-related fluorescent protein” which is exemplified by the various spectral variants and GFP mutants that have amino acid sequences that are substantially identical to A.
  • victoria GFP SEQ ID NO: 10
  • a "Discosoma- ⁇ elated fluorescent protein” or a "DsRed-related fluorescent related protein” which is exemplified by the various mutants that have amino acid sequences substantially identical to that of DsRed (SEQ ID NO: 1), and the like, for example, a Renilla-related fluorescent protein or a Phialidiurn-re ⁇ ated fluorescent protein.
  • ;:;ii i ⁇ H ⁇ t ⁇ i '"m ⁇ tant ⁇ or "variant” also is used herein in reference to a fluorescent protein that contains a mutation with respect to a corresponding wild type fluorescent protein.
  • spectral variant or “spectral mutant” of a fluorescent protein to indicate a mutant fluorescent protein that has a different fluorescence characteristic with respect to the corresponding wild type fluorescent protein.
  • CFP, YFP, ECFP (SEQ ID NO: 11), EYFP-V68L/Q69K (SEQ ID NO: 12), and the like are GFP spectral variants.
  • Aequorea GFP-related fluorescent proteins include, for example, wild type (native) Aequorea victoria GFP (Prasher et al., supra, 1992; see, also, SEQ ID NO: 10), allelic variants of SEQ ID NO: 10, for example, a variant having a Q80R substitution (Chalfie et al., Science 263:802-805, 1994, which is incorporated herein by reference); and spectral variants of GFP such as CFP, YFP, and enhanced and otherwise modified forms thereof (U.S. Pat. Nos.
  • GFP-related fluorescent proteins having one or more folding mutations, and fragments of the proteins that are fluorescent, for example, an A. victoria GFP from which the two N-terminal amino acid residues have been removed.
  • GFP-related fluorescent proteins having one or more folding mutations
  • fragments of the proteins that are fluorescent for example, an A. victoria GFP from which the two N-terminal amino acid residues have been removed.
  • these fluorescent proteins contain different aromatic amino acids within the central chromophore and fluoresce at a distinctly shorter wavelength than the wild type GFP species.
  • the engineered GFP proteins designated P4 and P4-3 contain, in addition to other mutations, the substitution Y66H; and the engineered GFP proteins designated W2 and W7 contain, in addition to other mutations, Y66W.
  • non-tetramerizing fluorescent protein is used broadly herein to refer to normally tetrameric fluorescent proteins that have been modified such that they have a reduced propensity to tetramerize as compared to a corresponding unmodified fluorescent protein.
  • non-. tetramerizing fluorescent protein encompasses dimeric fluorescent proteins, tandem dimer fluorescent proteins, as well as fluorescent proteinsLthat remain monomelic.
  • aggregation refers to the tendency of an expressed protein to form insoluble precipitates or visible punctae and is to be distinguished from “oligomerization”. In particular, mutations that reduce aggregation, e.g., increase the solubility of the protein, do not necessarily reduce oligomerization, i.e., convert tetramers to dimers or monomers.
  • the present invention provides fluorescent protein variants that can be derived from fluorescent proteins that have a propensity to dimerize or tetramerize.
  • a fluorescent protein variant of the invention can be derived from a naturally occurring fluorescent protein or from a spectral variant or mutant thereof, and contains at least one mutation that reduces or eliminates the propensity of the fluorescent protein to oligomerize.
  • the present invention provides dimeric and monomelic red fluorescent proteins (RFP) and RFP variants with reduced propensity to oligomerize.
  • RFP monomelic red fluorescent proteins
  • a fluorescent protein is provided having improved efficacy of maturation.
  • the present invention provides dimeric and monomeric red fluorescent proteins (RFP) and RFP variants with improved efficacy of maturation.
  • fluorescent protein variants are provided which contain at least one mutation that reduces or eliminates the propensity of the fluorescent protein to oligomerize and which contain at least one mutation that improves the efficacy of maturation of fluorescence in the protein variant as compared to other variants including the parent protein.
  • DsRed is an obligate tetramer both in vitro and in vivo. For numerous reasons, the oligomeric state of DsRed is problematic for applications in which it is rased to a protein of interest in order to monitor trafficking or interactions of the latter. Using purified protein, it was shown that DsRed requires greater than 48 hours to reach >90 % of its maximal red fluorescence (see below). During the maturation process, a green intermediate initially accumulates and is slowly converted to the final red form. However, the conversion of the green component does not proceed to completion and thus a fraction of aged DsRed remains green.
  • the primary disadvantage of the incomplete maturation is an excitation spectrum that extends well into the green wavelengths due to energy transfer between the green and red species within the tetramer. This is a particularly serious problem due to overlap with the excitation spectra of potential FRET partners such as GFP.
  • DsRed has been characterized with respect to the time the red fluorescence takes to appear, the pH sensitivity of the chromophore, how strongly the chromophbre absorbs light and fluoresces, how readily the protein photobleaches, and whether the protein normally exists as a monomer or an oligomer in solution. The results demonstrate that DsRed provides a useful complement to or alternative for GFP and its spectral mutants.
  • DsRed mutants that are non- fluorescent or that are blocked or slowed in converting from green to red emission were characterized, including mutants in which the eventual fluorescence is substantially red- shifted from wild type DsRed (see, Baird et al., Proc. Natl. Acad. ScL USA 97:11984- 11989, 2000; Gross et a!.. Proe. Natl. Acad. ScL USA 97:11990-11995, 2000, each of which is incorporated herein by reference).
  • the present invention provides RFP variants that show more efficient chomophore maturation than a reference wild-type or variant RFP, as a result of at least one amino acid alteration within the reference (wild-type or variant) sequence.
  • the wild-type RFP protein typically consists of about 70% red protein with about 30% contamination by the green, immature form of the protein.
  • the Ca-N bond of Q66 in DsRed is oxidized as the protein matures into its red form, which, in turn, led to a further investigation of the role of the amino acid at position 66 as it relates to chromophore maturation.
  • site-directed mutagenesis it was determined that the substitution of methionine (M) for the native glutamine (Q) at amino acid position 66 yielded a protein that showed a deeper pink color than the wild-type protein, and contained less of the immature green form than wild-type DsRed.
  • an RFP variant of the invention can be derived from a naturally occurring (wild-type) RFP or from a spectral variant or mutant thereof, and contains at least one mutation that makes chromophore maturation more efficient.
  • wild-type RFP sequence are specifically within the scope of the invention.
  • an additionall exemplary amino acid alteration that is believed to improve maturation of both the wild-type DsRed protein and DsRed variants, including Q66M DsRed is a substitution at amino acid position 147 of wild-type DsRed.
  • a preferred substitution at this position is T147S, but other substitutions resulting in similar improvements in spectral properties and, in particular, in the efficiency and potentially speed of maturation, are also possible.
  • substitution of amino acids with similar properties of threonine (T) are expected to yield such variants.
  • the invention concerns RFP variants with improved maturation efficiency that have a reduced propensity to tetramerize, as a result of one or more further mutations within the RFP molecule.
  • the invention concerns non-tetramerizing, such as dimeric or monomeric, DsRed variants that show enhanced maturation efficiency relative to the corresponding non-tetramerizing DsRed variant. Further details about the design and preparation of such variants are provided below. .
  • the RFP variants of the invention can be derived from RFPs that have a propensity to dimerize or tetramerize.
  • an RFP variant of the invention can be derived from a naturally occurring RFP or from a spectral variant or mutant thereof, and contains at least one mutation that enhances maturation efficiency, and optionally at least one additional mutation that reduces or eliminates the propensity of the RFP to oligomerize.
  • a fluorescent protein variant of the invention can be derived from any fluorescent protein that is known to oligomerize, including, for example, a green fluorescent proteiri.(GFP) such as anAequorea victoria GFP (SEQ ID NO: 10), a Renilla reniformis GFP, a Phialidium gregarium GFP; a red fluorescent protein (RFP) such as a Discosoma RFP (SEQ ID NO: 1); or a fluorescent protein related to a GFP or an RFP.
  • GFP green fluorescent proteiri.
  • the fluorescent protein can be a cyan fluorescent protein (CFP), a yellow fluorescent protein (YFP), an enhanced GFP (EGFP; SEQ ID NO: 13), an enhanced CFP (ECFP; SEQ ID NO: 11), an enhanced YFP (EYFP; SEQ ID NO: 15), a DsRed fluorescent protein (SEQ ID NO! 1), a hom ⁇ lo'gue ii mf bthiSar'i ⁇ ci ⁇ , or a mutant or variant of such fluorescent proteins.
  • CFP cyan fluorescent protein
  • YFP yellow fluorescent protein
  • EGFP GFP
  • ECFP enhanced CFP
  • EYFP enhanced YFP
  • SEQ ID NO: 15 an enhanced YFP
  • DsRed fluorescent protein SEQ ID NO! 1
  • a hom ⁇ lo'gue ii mf bthiSar'i ⁇ ci ⁇ or a mutant or variant of such fluorescent proteins.
  • the propensity of the fluorescent protein variant of the invention to oligomerize is reduced or eliminated.
  • RFP such as DsRed
  • oligomerization can be reduced or eliminated by introducing mutations into appropriate regions of the fluorescent protein, e.g., an RFP molecule, and (2) two subunits of the fluorescent protein can operatively link, e.g., link RFP to each other by a linker, such as a peptide linker.
  • linker such as a peptide linker
  • the present invention provides fluorescent protein variants where the degree of oligomerization of the fluorescent protein is reduced or eliminated by the introduction of amino acid substitutions to reduce or abolish the propensity of the constituent monomers to tetramerize.
  • the resulting structures have a propensity to dimerize. In other embodiments, the resulting structures have a propensity to remain monomelic.
  • Various dimer forms can be created.
  • an AB orientation dimer can be formed, or alternatively, an AC orientation dimer can be formed.
  • fluorescence or the rate of maturation of fluorescence can be lost.
  • the present invention provides methods for the generation of dimeric forms that display detectable fluorescence, and furthermore, fluorescence that has advantageous rates of maturation.
  • the dimer is an intermolecular dimer.
  • the dimer can be a homodimer (comprising two molecules of the identical species) or a heterodimer (comprising two molecules of different species).
  • conditions As used herein, the molecules that form such types of structures are said to have a reduced tendency to oligomerize, as the monomeric units have reduced or non-existent ability to form tetrameric intermolecular oligomers.
  • dimer2 A non-limiting, illustrative example of such a dimeric red fluorescent protein variant is described herein, and is termed "dimer2."
  • the dimer2 nucleotide sequence is provided in SEQ ID NO: 7 and FIG. 21.
  • the dimer2 polypeptide is provided in SEQ ID NO: 6 and FIG. 22.
  • tandem red fluorescent protein variant dimers include, without limitation, two monomeric units of the dimer2 species (SEQ ID NO: 6) operably covalently linked by a peptide linker, preferably about 9 to about 25, more preferably about 9 to 20 amino acid residues in length.
  • linkers finding use with the invention include, but are not limted to, for example, the 9 residue linker RMGTGSGQL (SEQ ID NO: 16), the 12 residue linker GHGTGSTGSGSS (SEQ ID NO: 17), the 13 residue linker RMGSTSGSTKGQL (SEQ ID NO: 18), or the 22 residue linker RMGSTSGSGKPGSGEGSTKGQL (SEQ ID NO: 19).
  • tandem red fluorescent protein dimers preferably contain mutations relative to the wild-type DsRed sequence of SEQ ID NO: 1, in order to preserve/restore fluorescent properties.
  • An illustrative example of the tandem red fluorescent protein dimers herein is a dimer composed of two monomers, wherein at least one of the monomers is a variant DsRed, which has an amino acid sequence of SEQ ID NO: 6, operatively linked by a peptide linker, preferably about 9 to about 25, more preferably about 10 to about 20 amino acid residues in length, including any of the 9, 12, 13, and 22 residue linkers above.
  • tandem red fluorescent protein dimer herein is a tandem dimer composed of two identical or different DsRed variant monomelic subu ⁇ its at least one of which contains, for example, the following substitutions within the DsRed polypeptide of SEQ ID NO: 1 : N42Q, V44A, V71A, Fl 18L, K163Q, S179T, S197T, T217S (mutations internal to the ⁇ -barrel); R2A, K5E and N6D (aggregation reducing mutations); I125R and V127T (AB interface mutations); and T21S, H41T, Cl 17T and S131P (miscellaneous surface mutations).
  • the two monomelic subunits may be fused by a peptide linker, preferably about 9 to about 25, more preferably about .10 to about 25 amino acid residues in length, such as any of the 9, 12, 13, and 22 residue linkers above; Shorter linkers are generally preferable to longer linkers, as long as they do not significantly slow affinity maturation or otherwise interfere with the fluorescent and spectral properties of the dimer.
  • the two monomeric subunits within a dimer may be identical or different.
  • one subunit may be the wild-type DsRed monomer of SEQ ID NO: 1 operatively linked to a variant DsRed polypeptide, such as any of the DsRed variants listed above or otherwise disclosed herein.
  • the monomers should be linked such that the critical dimer interactions are satisfied through intramolecular contacts with the tandem partner.
  • the peptide linkers are preferably protease resistant.
  • the peptide linkers specifically disclosed herein are only illustrative. One skilled in the art will understand that other peptide linkers, preferably protease resistant linkers, are also suitable for the purpose of the present invention. See, e.g., Whitlow et al, Protein Eng 6:989-995 (1993).
  • a novel approach was used to overcome the inte ⁇ nolecular oligomerization propensity of wild-type DsRed by linking the C-terminus of the A subunit to the N-terminus of the B subunit through a flexible linker to produce tandem dimers.
  • a 10 to 20 residue linkers such as an 18 residue linker (Whitlow et al., Prot. Eng.
  • this strategy can be generally applied to any protein system in which the distance between the N-terminus of one protein and the C- terminus of a dimer partner is known, such that a linker having the appropriate length can be used to operatively link the monomers. Jh particular, this strategy can be useful for other modifying other fluorescent proteins that have interesting spectral properties, but form obligate dimers that are difficult to disrupt using the targeted mutagenesis method disclosed herein.
  • the present invention provides variant fluorescent proteins that have a reduced propensity to form tetrameric oligomers (i.e., the propensity to form tetramers is reduced or eliminated) due to the presence of one or more mutations in the fluorescent protein.
  • mutations were introduced into DsRed, and DsRed mutants having reduced oligomerization activity were identified, including, for example, a DsRed-I125R mutant of DsRed of SEQ ID NO: 20.
  • the strategy for producing the DsRed mutants involved introducing mutations in DsRed that were predicted to interfere with the dimer interfaces (A-B or A-C, see FIGS. 1 and 2) and thus prevent formation of the tetramer.
  • Illustrative examples of mutations (amino acid substitutions) which can further improve the fluorescent properties of I125R include mutations in at least one of amino acid positions 163, 179 an 217 within SEQ ID NO: 1.
  • the I125R variant comprises at least one of the K163Q/M, S179T and T217S substitutions.
  • Further illustrative variants may contain additional mutations at position N42 and/or C44 within SEQ ID NO: 1.
  • Yet another group of illustrative DsRed dimers comprise additional mutations at at least one of residues 1161 and S197 within SEQ ID NO: 1.
  • DsRed variants obtained by this mutagenesis approach include DsRed-I125R, S179T, T217A, and DsRed-I125R, K163Q, T217A, and others (see, e.g., the Examples below).
  • dimer2 an optimal dimeric variant was produced, which was designated dimer2 (illustrated in FIG. 2B).
  • This variant contains 17 mutations, of which eight are internal to the ⁇ -barrel (N42Q, V44A, V71A, F118L, K163Q, S179T, S197T and T217S), three are the aggregation reducing mutations found in Tl (R2A, K5E and N6D and see Bevis and Glick, Nat. Biotechnol.
  • the dimer2 nucleotide sequence is provided in SEQ ID NO: 7 and FIG. 21.
  • the dimer2 polypeptide is provided in SEQ ID NO: 6 and FIG. 22.
  • a product of the mutagenesis approach described above is a monomelic red fluorescent protein, designated mRFPl, which contains the following mutations within the wild-type DsRed sequence of SEQ ID NO: 1: N42Q, V44A, V71A, K83L, F124 ⁇ ., L150M, K163M, V175A, F177V, S179T, V195T, S197I, T217A, R2A, K5E, N6D, I125R, V127T, I180T, R153E, ffl62K, A164R, L174D; Y192A, Y194K, H222S, L223T, F224G, L225A, T21S, H41T, Cl 17E, and V156A.
  • the first 13 mutations are internal to the ⁇ -barrel. Of the remaining 20 external mutations, 3 are aggregation reducing mutations (R2A, K5E, and N6D), 3 are AB interface mutations (I125R, V127T, and I180T), 10 are AC interface mutations (R153E, H162K, A164R, L174D, Y192A, Y194K, H222S, L223T, F224G, and L225A), and 4 are additional beneficial mutations (T21S, H41T, Cl 17E, and V156A).
  • the mRFPl nucleotide sequence is provided in SEQ ID NO: 9 and FIG. 23.
  • the mRFPl polypeptide is provided in SEQ ID NO: 8 and FIG. 24.
  • variants including variants related to mRFPl, may also be produced by such methods (see, e.g., the Examples below).
  • mRFPl is bell eVe'd to b ⁇ bplM&b ⁇ m lr my[y fsj ⁇ ects
  • SEQ DD NO: 1 wild-type DsRed amino acid sequence
  • mRFPl serves merely as an illustration, and embodiments of the invention are by no means intended to be limited to this particular monomer.
  • the monomelic DsRed variants herein can be further modified to alter the spectral and/or fluorescent properties of DsRed.
  • DsRed spectral and/or fluorescent properties
  • GFP GFP-electron emission protein
  • Amino acids with charged (ionized D, E, K, and R), dipolar (H, N, Q, S, T, and uncharged D, E and K), and polarizable side groups are useful for altering the ability of fluorescent proteins, to oligomerize, especially when they substitute an amino acid with an uncharged, nonpolar or non-polarizable side chain.
  • monomers of other oligomerizing fluorescent proteins can also be prepared following a similar mutagenesis strategy, as illustrated in the Examples below, and these and other fluorescent protein monomers are intended to be within the scope of the present invention.
  • the mutagenesis methods provided by the present invention can be used to generate advantageous fluorescent protein variants that have reduced ability to oligomerize (i.e., tetramerize), and also find uses analogous to the uses of the Discosoma DsRed variant proteins.
  • the DsRed protein is a member of a family of highly related homologous proteins sharing high degrees of amino acid identity and protein structure (see, e.g., Labas et al., Proc. Natl . Acad. Sci. USA 99:4256-4261 [2002]; and Yanushevich e* al., FEBS Letters 511:11-14 [2002]).
  • These alternative fluorescent proteins are additionally advantageous since they have the ability to fluoresce at different wavelengths than does Discosoma DsRed. If dimeric or monomelic forms of these proteins can be produced, they will have great experimental potential as fluorescent markers.
  • Anthozoan species from which related fluorescent proteins have been identified include, but are not limited to, Anemonia sp., Clavularia sp., Condylactis sp., Heteractis sp., Renilla sp., Pt ⁇ losarcus sp., Zoonthus sp., Scolymia sp., Montastraea sp., Ricordea sp., Goniopara sp., and others.
  • Fluorescent proteins fused to target proteins can be prepared, for example using recombinant DNA methods, and used as markers to identify the location and amount of the target protein produced. Accordingly, the present invention provides fusion proteins comprising a fluorescent protein variant moiety and a polypeptide of interest.
  • the polypeptide of interest can be of any length, for example, about 15 amino acid residues, about 50 residues, about 150 residues, or up to about 1000 amino acid residues or more, provided that the fluorescent protein component of the fusion protein can fluoresce or can be induced to fluoresce when exposed to electromagnetic radiation of the appropriate wavelength.
  • the polypeptide of interest can be, for example, a peptide tag such as a polyhistidine sequence, a c-myc epitope, a FLAG epitope, and the like; can be an enzyme, which can be used to effect a function in a cell expressing a fusion protein comprising the enzyme or to identify a cell containing the fusion protein; can be a protein to be examined for an ability to interact with one or more other proteins in a cell, or any other protein as disclosed herein or otherwise desired.
  • a peptide tag such as a polyhistidine sequence, a c-myc epitope, a FLAG epitope, and the like
  • an enzyme which can be used to effect a function in a cell expressing a fusion protein comprising the enzyme or to identify a cell containing the fusion protein
  • the Discosoma (coral) red fluorescent protein, DsRed can be used as a complement to or alternative for a GFP or spectral variant thereof.
  • the invention encompasses fusion proteins of any of the tandem dimeric and monomelic DsRed fluorescent proteins discussed above, and variants thereof, which has altered spectral and/or fluorescent characteristics.
  • a fusion protein which includes a fluorescent protein variant operatively linked to one or more polypeptides of interest also is provided.
  • the polypeptides of the fusion protein can be linked through peptide bonds, or the fluorescent protein variant can be linked to the polypeptide of interest through a linker molecule.
  • the fusion protein is expressed from a recombinant nucleic acid molecule containing a polynucleotide encoding a fluorescent protein variant operatively linked to one or more polynucleotides encoding one or more polypeptides of interest.
  • a polypeptide of interest can be any polypeptide, including, for example, a peptide tag such as a polyhistidine peptide, or a cellular polypeptide such as an enzyme, a G-protein, a growth factor receptor, or a transcription factor; and can be one of two or more proteins that can associate to form a complex.
  • a peptide tag such as a polyhistidine peptide
  • a cellular polypeptide such as an enzyme, a G-protein, a growth factor receptor, or a transcription factor
  • the fusion protein is a tandem fluorescent protein variant construct, which includes a donor fluorescent protein variant, an acceptor fluorescent protein variant, and a peptide linker moiety coupling said donor and said acceptor, wherein cyelized amino acids of the donor emit light characteristic of said donor, and wherein the donor and the acceptor exhibit fluorescence resonance energy transfer when the donor is excited, and the linker moiety does not substantially emit light to exci ⁇ e the donor.
  • a fusion protein of the invention can include two or more operatively linked fluorescent protein variants, which can be linked directly or indirectly, and can further comprise one or more polypeptides of interest.
  • the present invention also provides polynucleotides encoding fluorescent protein variants, where the protein can be a dimeric fluorescent protein, a tandem dimerie fluorescent protein, a monomelic protein, or a fusion protein comprising a fluorescent protein operatively linked to one or more polypeptides of interest.
  • the tandem dimer the entire dimer may be encoded by one polynucleotide molecule. If the linker is a non : peptide linker, the two S ⁇ Biihifi' will be encoded by separate polynucleotide molecules, produced separately, and subsequently linked by methods known in the art.
  • the invention further concerns vectors containing such polynucleotides, and host cell containing a polynucleotide or vector.
  • a recombinant nucleic acid molecule which includes at least one polynucleotide encoding a fluorescent protein variant operatively linked to one or more other polynucleotides.
  • the one or more other polynucleotides can be, for example, a transcription regulatory element such as a promoter or polyadenylation signal sequence, or a translation regulatory element such as a ribosome binding site.
  • a recombinant nucleic acid molecule can be contained in a vector, which can be an expression vector, and the nucleic acid molecule or the vector can be contained in a host cell.
  • the vector generally contains elements required for replication in a prokaryotic or eukaryotic host system or both, as desired.
  • Such vectors which include plasmid vectors and viral vectors such as bacteriophage, baculovirus, retrovirus, lentivirus, adenovirus, vaccinia virus, semliki forest virus and adeno-associated virus vectors, are well known and can be purchased from a commercial source (Promega, Madison WI; Stratagene, La Jolla CA; GIBCO/BRL, Gaithersburg MD) or can be constructed by one skilled in the art (see, for example, Meth. Enzvmol.. Vol. 185, Goeddel, ed.
  • a vector for containing a polynucleotide encoding a fluorescent protein variant can be a cloning vector or an expression vector, and can be a plasmid vector, viral vector, and the like.
  • the vector contains a selectable marker independent of that encoded by a polynucleotide of the invention, and further can contain transcription or translation regulatory elements, including a promoter sequence, which can provide tissue specific expression of a polynucleotide operatively linked thereto, which can, but need not, be the polynucleotide encoding the fluorescent protein variant, for example, a tandem dimer fluorescent protein, thus providing a means to select a particular cell type from among a mixed population of cells ccMt'afnirigihe introduced vector and recombinant nucleic acid molecule contained therein.
  • the vector is a viral vector
  • it can be selected based on its ability to infect one or few specific cell types with relatively high efficiency.
  • the viral vector also can be derived from a virus that infects particular cells of an organism of interest, for example, vertebrate host cells such as mammalian host cells.
  • Viral vectors have been developed for use in particular host systems, particularly mammalian systems and include, for example, retroviral vectors, other le ⁇ tivirus vectors such as those based on the human immunodeficiency virus (HIV), adenovirus vectors, adeno-associated virus vectors, herpesvirus vectors, vaccinia virus vectors, and the like (see Miller and Rosman, BioTechniques 7:980-990, 1992; Anderson et al., Nature 392:25-30 Suppl, 1998; Verma and Somia, Nature 389:239-242, 1997; Wilson, New Engl. J. Med. 334:1185-1187 (1996), each of which is incorporated herein by reference).
  • retroviral vectors such as those based on the human immunodeficiency virus (HIV)
  • adenovirus vectors such as those based on the human immunodeficiency virus (HIV)
  • adeno-associated virus vectors such as those based on the human immunodefic
  • a fluorescent protein variant which can be a component of a fusion protein, involves expressing a polypeptide encoded by a polynucleotide.
  • a polynucleotide encoding the fluorescent protein variant is a useful starting material.
  • Polynucleotides encoding fluorescent protein are disclosed herein or otherwise known in the art, and can be obtained using routine methods, then can be modified such that the encoded fluorescent protein lacks a propensity to oligomerize.
  • a polynucleotide encoding a GFP can be isolated by PGR of cDNA from A. victoria using primers based on the DNA sequence of Aequorea GFP (SEQ ID NO: 21).
  • a polynucleotide encoding the red fluorescent protein from Discosoma can be similarly isolated by PCR of CDNA of the Discosoma coral, or obtained from the commercially available DsRed2 or HcRedl (CLONTECH). PCR methods are well known and routine in the art (see, for example, U.S. Pat. No. 4,683,195; Mullis et al., Cold Spring Harbor Svmp. Quant. Biol. 51:263, 1987; Erlich, ed., "PCR Technology” (Stockton Press, NY, 1989)).
  • a variant form of the fluorescent protein then can be made by site-specific mutagenesis of the polynucleotide encoding the fluorescent protein.
  • tandem dimer fluorescent protein can be expressed from a polynucleotide prepared by PCR or obtained otherwise, eM ;;i ericote
  • expression vectors and the expression of a polynucleotide in transfected cells involves the use of molecular cloning techniques also well known in the art (see Sambrook et al., In “Molecular Cloning: A Laboratory Manual” (Cold Spring Harbor Laboratory Press 1989); “Current Protocols in Molecular Biology” (eds., Ausubel et al.; Greene Publishing Associates, Inc., and John Wiley & Sons, Inc. 1990 and supplements).
  • Expression vectors contain expression control sequences operatively linked to a polynucleotide sequence of interest, for example, that encodes a fluorescent protein variant, as indicated above.
  • the expression vector can be adapted for function in prokaryotes or eukaryotes by inclusion of appropriate promoters, replication sequences, markers, and the like.
  • An expression vector can be transfected into a recombinant host cell for expression of a fluorescent protein variant, and host cells can be selected, for example, for high levels of expression in order to obtain a large amount of isolated protein.
  • a host cell can be maintained in cell culture, or can be a cell in vivo in an organism.
  • a fluorescent protein variant can be produced by expression from a polynucleotide encoding the protein in a host cell such as E. coli.
  • Aequorea GFP-related fluorescent proteins for example, are best expressed by cells cultured between about 15 0 C. and 30 0 C, although higher temperatures such as 37°C can be used. After synthesis, the fluorescent proteins are stable at higher temperatures and can be used in assays at such temperatures.
  • An expressed fluorescent protein variant which can be a tandem dimer fluorescent protein or a non-oligomerizing monomer, can be operatively linked to a first polypeptide of interest, further can be linked to a second polypeptide of interest, for example, a peptide tag, which can be used to facilitate isolation of the fluorescent protein variant, including any other polypeptides linked thereto.
  • a polyhistidine tag containing, for example, six histidine residues, can be incorporated at the N-terminus or C- terminus of the fluorescent protein variant, which then can be isolated in a single step using nickel-chelate chromatography.
  • Additional peptide tags including a c-myc peptide, a FLAG epitope, or any ligand (or cognate receptor), including any peptide epitope (or antibody, or antigen binding fragment thereof, that specifically binds the epitope are well kndwn in ttie art ana smuiafiycan-Delised. (see, for example, Hopp et al., Biotechnology 6:1204 (1988); U.S. Pat. No. 5,011,912, each of which is incorporated herein by reference).
  • kits to facilitate and/or standardize use of compositions provided by the present invention, as well as facilitate the methods of the present invention.
  • Materials and reagents to carry out these various methods can be provided in kits to facilitate execution of the methods.
  • kit is used in reference to a combination of articles that facilitate a process, assay, analysis or manipulation.
  • Kits can contain chemical reagents (e.g., polypeptides or polynucleotides) as well as other components.
  • kits of the present invention can also include, for example but not limited to, apparatus and reagents for sample collection and/or purification, apparatus and reagents for product collection and/or purification, reagents for bacterial cell transformation, reagents for eukaryotic cell transfection, previously transformed or transfected host cells, sample tubes, holders, trays, racks, dishes, plates, instructions to the kit user, solutions, buffers or other chemical reagents, suitable samples to be used for standardization, normalization, and/or control samples. Kits of the present invention can also be packaged for convenient storage and safe shipping, for example, in a box having a Hd.
  • kits of the present invention can provide a fluorescent protein of the invention, a polynucleotide vector (e.g., a plasmid) encoding a fluorescent protein of the invention, bacterial cell strains suitable for propagating the vector, and reagents for purification of expressed, fusion proteins.
  • a kit of the present invention can provide the reagents necessary to conduct mutagenesis of ah Anthozoan fluorescent protein in order to generate a protein variant having a redued propensity to oligomerize.
  • kits can contain one or more compositions of the invention, for example, one or a plurality of fluorescent protein variants, which can be a portion of a fusion protein,
  • the fluorescent protein variant can be a mutated fluorescent protein having a reduced propensity to oligomerize, such as a non-oligomerizing monomer, or can be a tandem dimer fluorescent protein and, where the kit comprises a plurality of fluorescent protein variants, the plurality can be a plurality of the mutated fluorescent protein variants, or of the tandem dimer fluorescent proteins, or a combination thereof.
  • a kit having features of the invention also can contain one or a plurality of recombinant nucleic acid molecules, which encode, in part, fluorescent protein variants, which can be the same or different, and can further include, for example, an operatively linked second polynucleotide containing or encoding a restriction endonuclease recognition site or a recombinase recognition site, or any polypeptide of interest.
  • the kit can contain instructions for using the components of the kit, particularly the compositions of the invention that are contained in the kit.
  • kits can be particularly useful where they provide a plurality of different fluorescent protein variants because the artisan can conveniently select one or more proteins having the fluorescent properties desired for a particular application.
  • a kit containing a plurality of polynucleotides encoding different fluorescent protein variants provides numerous advantages.
  • the polynucleotides can be engineered to contain convenient restriction endonuclease or recombinase recognition sites, thus facilitating operative linkage of the polynucleotide to a regulatory element or to a polynucleotide encoding a polypeptide of interest or, if desired, for operatively linking two or more the polynucleotides encoding the fluorescent protein variants to each other.
  • a fluorescent protein variant having features of the invention is useful in any method that employs a fluorescent protein.
  • the fluorescent protein variants including the monomelic, dimeric, and tandem dimer fluorescent proteins, are useful as fluorescent markers in the many ways fluorescent markers already are used, including, for example, coupling fluorescent protein variants to antibodies, polynucleotides or other receptors for use in detection assays such as immunoassays or hybridization assays, or to
  • a first (or other) polynucleotide encoding the fluorescent protein variant is fused to a second (or other) polynucleotide encoding a protein of interest and the construct, if desired, can be inserted into an expression vector.
  • the protein of interest can be localized based on fluorescence, without concern that localization of the protein is an artifact caused by oligomerization of the fluorescent protein component of the fusion protein.
  • two proteins of interest independently are fused with two fluorescent protein variants that have different fluorescent characteristics.
  • Fluorescent protein variants having features of the invention are useful in systems to detect induction of transcription.
  • a nucleotide sequence encoding a non-oligomerizing monomelic, dimeric or tandem dimeric fluorescent protein can be fused to a promoter or other expression control sequence of interest, which can be contained in an expression vector, the construct can be transfected into a cell, and induction of the promoter (or other regulatory element) can be measured by detecting the presence or amount of fluorescence, thereby allowing a means to observe the responsiveness of a signaling pathway from receptor to promoter.
  • a fluorescent protein variant of the invention also is useful in applications involving FRET, which can detect events as, a function of the movement of fluorescent donors and acceptors towards or away from each other.
  • One or both of the donor/acceptor pair can be a fluorescent protein variant.
  • Such a donor/acceptor pair provides a wide separation between the excitation and emission peaks of the donor, and provides good overlap between the donor emission spectrum and the acceptor excitation spectrum.
  • Variant red fluorescent proteins or red-shifted mutants as disclosed herein are specifically disclosed as the acceptor in such a pair.
  • FRET can be used to detect cleavage of a substrate having the donor and acceptor coupled to the substrate on opposite sides of the cleavage site. Upon cleavage of the substrate, the donor/acceptor pair physically separate, eliminating FRET.
  • Such an assay can be performed, for example, by contacting the substrate with a sample, and determining a qualitative or quantitative change in FRET (see, for example, U.S. Pat. No. 5,741,657, whic ⁇ is incorporated heVein fcy reference).
  • a fluorescent protein variant donor/acceptor pair also can be part of a fusion protein coupled by a peptide having a proteolytic cleavage site (see, for example, U.S. Pat. No.
  • FRET also can be used to detect changes in potential across a membrane.
  • a donor and acceptor can be placed on opposite sides of a membrane such that one translates across the membrane in response to a voltage change, thereby producing a measurable FRET (see, for example, U.S. Pat. No. 5,661,035, which is incorporated herein by reference).
  • a fluorescent protein of the invention is useful for making fluorescent sensors for protein kinase and phosphatase activities or indicators for small ions and molecules such as Ca 2+ , Zn 2+ , cyclic 3', 5'-adenosine monophosphate, and cyclic 3', 5' -guanosine monophosphate.
  • Fluorescence in a sample generally is measured using a fluorimeter, wherein excitation radiation from an excitation source having a first wavelength, passes through excitation optics, which cause the excitation radiation to excite the sample. Ih response, a fluorescent protein variant in the sample emits radiation having a wavelength that is different from the excitation wavelength. Collection optics then collect the emission from the sample.
  • the device can include a temperature controller to maintain the sample at a specific temperature while it is being scanned, and can have a multi-axis translation stage, which moves a microtiter plate holding a plurality of samples in order to position different wells to be exposed.
  • the multi-axis translation stage, temperature controller, auto-focusing feature, and electronics associated with imaging and data collection can be managed by an appropriately programmed digital computer, which also can transform the data collected during the assay into another format for presentation. This process can be miniaturized and automated to enable screening many thousands of compounds in a high throughput format
  • These and other methods of performing assays on fluorescent materials are well known in the art (see, for example, Lakowicz, "Principles of Fluorescence Spectroscopy” (Plenum Press 1983); Herman, “Resonance energy transfer microscopy” In “Fluorescence Microscopy of Living Cells in Culture” Part B, Meth. Cell Biol. 30:219-243 (ed. Taylor and Wang; Academic Press 1989); Turro, "Modern Molecular Photochemistry” (Benjamin/ Cummings P ⁇ bl. CoJ, jfric. 1978), pp. 296-361, each of which is incorporated herein by reference).
  • the present invention provides a method for identifying the presence of a molecule in a sample.
  • a method can be performed, for example, by linking a fluorescent protein variant of the invention to the molecule, arid detecting fluorescence due to the fluorescent protein variant in a sample suspected of containing the molecule.
  • the molecule to be detected can be a polypeptide, a polynucleotide, or any other molecule, including, for example, an antibody, an enzyme, or a receptor, and the fluorescent protein variant can be a tandem dimer fluorescent protein.
  • the sample to be examined can be any sample, including a biological sample, an environmental sample, or any other sample for which it is desired to determine whether a particular molecule is present therein.
  • the sample includes a cell or an extract thereof.
  • the cell can be obtained from a vertebrate, including a mammal such as a human, or from an invertebrate, and can be a cell from a plant or an animal.
  • the cell can be obtained from a culture of such cells, for example, a cell line, or can be isolated from an organism.
  • the cell can be contained in a tissue sample, which can be obtained from an organism by any means commonly used to obtain a tissue sample, for example, by biopsy of a human.
  • the presence of a molecule of interest in living cells can be identified, thus providing a means to determine, for example, the intracellular compartmentalizati ⁇ n of the molecule.
  • the use of the fluorescent protein variants of the invention for such a purpose provides a substantial advantage in that the likelihood of aberrant identification or localization due to oligomerization the fluorescent protein is greatly minimized.
  • a fluorescent protein variant can be linked to the molecule directly or indirectly, using any linkage that is stable under the conditions to which the protein- molecule complex is to be exposed.
  • the fluorescent protein and molecule can be linked via a chemical reaction between reactive groups present on the protein and molecule, or the linkage can be mediated by linker moiety, which contains reactive groups specific for theifiii ⁇ rise ⁇ i ⁇ # ⁇ e&a ⁇ Jtti SdIcMe. It will be recognized that the appropriate conditions for linking the fluorescent protein variant and the molecule are selected . depending, for example, on the chemical nature of the molecule and the type of linkage desired.
  • the molecule of interest is a polypeptide
  • a convenient means for Unking a fluorescent protein variant and the molecule is by expressing them as a fusion protein from a recombinant nucleic acid molecule, which comprises a polynucleotide encoding, for example, a tandem dimer fluorescent protein operatively linked to a polynucleotide encoding the polypeptide molecule.
  • a method of identifying an agent or condition that regulates the activity of an expression control sequence also is provided. Such a method can be performed, for example, by exposing a recombinant nucleic acid molecule, which includes a polynucleotide encoding a fluorescent protein variant operatively linked to an expression control sequence, to an agent or condition suspected of being able to regulate expression of a polynucleotide from the expression control sequence, and detecting fluorescence of the fluorescent protein variant due to such exposure.
  • a method is useful, for example, for identifying chemical or biological agents, including cellular proteins, that can regulate expression from the expression control sequence, including cellular factors involved in the tissue specific expression from the regulatory element.
  • the expression control sequence can be a transcription regulatory element such as a promoter, enhancer, silencer, intron splicing recognition site, polyadenylation site, or the like; or a translation regulatory element such as a ribosome binding site.
  • Fluorescent protein variants having features the invention also are useful in a method of identifying a specific interaction of a first molecule and a second molecule.
  • a method can be performed, for example, by contacting the first molecule, which is linked to a donor first fluorescent protein variant, and the second molecule, which is linked to an acceptor second fluorescent protein variant, under conditions that allow a specific interaction of the first molecule and second molecule; exciting the donor; and detecting fluorescence or luminescence resonance energy transfer from the donor to the acceptor, thereby identifying a specific interaction of the first molecule and the second molecule.
  • the conditions for such an interaction can be any conditions under which is expected or suspected that me rnolebules 1 ' bMsped ⁇ cally interact.
  • the conditions generally are physiological conditions.
  • the method can be performed in vitro using conditions of buffer, pH, ionic strength, and the like, that mimic physiological conditions, or the method can be performed in a cell or using a cell extract.
  • Luminescence resonance energy transfer entails energy transfer from a chemiluminescent, bioluminescent, lanthanide, or transition metal donor to the red fluorescent protein moiety.
  • the longer wavelengths of excitation of red fluorescent proteins permit energy transfer from a greater variety of donors and over greater distances than possible with green fluorescent protein variants. Also, the longer wavelengths of emission is more efficiently detected by solid-state photodetectors and is particularly valuable for in vivo applications where red light penetrates tissue far better than shorter wavelengths.
  • Chemiluminescent donors include but are not limited to luminol derivatives and peroxyoxalate systems.
  • Bioluminescent donors include but are not limted to aequorin, obelin, firefly luciferase, Renilla luciferase, bacterial luciferase, and variants thereof.
  • Lanthanide donors include but are not limited to terbium chelates containing ultraviolet- absorbing sensitizer chromophores linked to multiple liganding groups to shield the metal ion from solvent water.
  • Transition metal donors include but are not limited to ruthenium and osmium chelates of oligopyridine ligands.
  • Chemiluminescent and bioluminescent donors need no excitation light but are energized by addition of substrates, whereas the metal-based systems need excitation light but offer longer excited state lifetimes, facilitating time-gated detection to discriminate against unwanted background fluorescence and scattering.
  • the first and second molecules can be cellular proteins that are being investigated to determine whether the proteins specifically interact, or to confirm such an interaction. Such first and second cellular proteins can be the same, where they are being examined, for example, for an ability to oligomerize, or they can be different where the proteins are being examined as specific binding partners involved, for example, in an intracellular pathway.
  • the first and second molecules also can be a polynucleotide and a polypeptide, for example, a polynucleotide known or to be examined for transcription regufatofyfelemMf ac'fivify anPa ⁇ o ⁇ ypeptide known or-being tested for transcription factor activity.
  • the first molecule can comprise a plurality of nucleotide sequences, which can be random or can be variants of a known sequence, that are to be tested for transcription regulatory element activity, and the second molecule can be a transcription factor, such a method being useful for identifying novel transcription regulatory elements having desirable activities.
  • the present invention also provides a method for determining whether a sample contains an enzyme. Such a method can be performed, for example, by contacting a sample with a tandem fluorescent protein variant of the invention; exciting the donor, and determining a fluorescence property in the sample, wherein the presence of an enzyme in the sample results in a change in the degree of fluorescence resonance energy transfer. Similarly, the present invention relates to a method for determining the activity of an enzyme in a cell.
  • Such a method can be performed, for example, providing a cell that expresses a tandem fluorescent protein variant construct, wherein the peptide linker moiety comprises a cleavage recognition amino acid sequence specific for the enzyme coupling the donor and the acceptor; exciting said donor, and determining the degree of fluorescence resonance energy transfer in the cell, wherein the presence of enzyme activity in the cell results in a change in the degree of fluorescence resonance energy transfer.
  • a method for determining the pH of a sample can be performed, for example, by contacting the sample with a first fluorescent protein variant, which can be a tandem dimer fluorescent protein, wherein the emission intensity of the first fluorescent protein variant changes as pH varies between pH 5 and pH 10; exciting the indicator; and determining the intensity of light emitted by the first fluorescent protein variant at a first wavelength, wherein the emission intensity of the first fluorescent protein variant indicates the pH of the sample.
  • the first fluorescent protein variant useful in this method, or in any method of the invention can comprise two DsRed monomers as set forth in SEQ E) NO: 8. It will be recognized that such fluorescent protein variants similarly are useful, either alone or in combination, for the variously disclosed methods of the invention.
  • the sample used in a method for determining the pH of a sample can be any sample, including, for example, a biological tissue sample, or a cell or a fraction thereof.
  • the method can further include contacting me sample with a second fluorescent protein variant, wherein the emission intensity of the second fluorescent protein variant changes as pH varies from 5 to 10, and wherein the second fluorescent protein variant emits at a second wavelength that is distinct from the first wavelength; exciting the second fluorescent protein variant; determining the intensity of light emitted by the second fluorescent protein variant at the second wavelength; and comparing the fluorescence at the second wavelength to the fluorescence at the first wavelength.
  • the first (or second) fluorescent protein variant can include a targeting sequence, for example, a cell compartmentalization domain such a domain that targets the fluorescent protein variant in a cell to the cytosol, the endoplasmic reticulum, the mitochondrial matrix, the chloroplast lumen, the medial trans-Golgi cisternae, a lumen of a lysosome, or a lumen of an endosome.
  • a cell compartmentalization domain can include amino acid residues 1 to 81 of human type II membrane-anchored protein galactosyltransferase, or amino acid residues 1 to 12 of the presequence of subunit IV of cytochrome c oxidase.
  • the DsRed gene was amplified from vector ⁇ DsRed-Nl (CLONTECH, Palo Alto, CA) or the Tl variant (provided by B.S. Glick, University of Chicago) and subcloned into pRSET B (InvitrogenTM; see Baird et al, Proc. Natl . Acad. ScL USA 97:11984-11989 [2000]).
  • the ⁇ RSET B vector produces 6xHis tagged fusion proteins, where an N-terminal polyhistidine tag having the following sequence is coupled to the suitably subcloned sequence:
  • the DsRed Tl variant cDNA nucleotide sequence is provided in FIG. 18 and SEQ ID NO: 5.
  • the corresponding polypeptide is provided in FIG. 19 and SEQ ID NO: 4.
  • the numbering of amino acids in DsRed or mRFPl variants conforms to the wild-type sequence of DsRed, in which residues 66-68 of wild-type DsRed (Gln-Tyr-Gly) are homologous to the chromophore-forming residues 65-67 of GFP (Ser-Tyr-Gly).
  • the ammo-terminal polyhistidine tag is numbered -33 to -1.
  • amino acid residues When amino acid residues are inserted at or near position 6, they are numbered to preserve the DsRed numbering for the rest of the protein; for example, where NNMA or DNMA are inserted at position 6, residues NNMA (or DNMA) are numbered as residues 6a, 6b, 6c, and 6d.
  • PCR reactions 38 cycles with annealing at 55 0 C were run in four 100 ⁇ L batches, each containing 10 ⁇ L of 10x PCR buffer with Mg 2+ (Roche Molecular Biochemicals), 150 ⁇ M Mh 2+ , 250 ⁇ M of three nucleotides, 50 ⁇ M of the remaining nucleotide, and 5 ng of template DNA.
  • J Mutagenized PCR products were combined, purified by agarose gel electrophoresis, digested with BamKL and Ec ⁇ Bl, and isolated by QIAGEN ® QIAquickTM DNA purification spin column following the manufacturer's instructions. The resulting fragments were ligated into pRSET ⁇ , and the crude ligation mixture was transformed into E. coli BL21 (DE3) Gold (Stratagene ® ) by electroporation.
  • Bacterial Fluorescence Screening Bacterial Fluorescence Screening - Bacteria plated on LB/agar plates were screened essentially as described in Baird et al, Proc. Natl. Acad. ScU USA 96:11241- 11246 (1999). Briefly, the bacterial plates were illuminated with a 150-W Xe lamp using 470 nm (40 nm bandwidth), 540 nm (30 nm bandwidth), or 560 nm (40 nm bandwidth) excitation filters and 530 nm (40 nm bandwidth), 575 nm (long pass), or 610 nm (long pass) emission filters.
  • DNA was purified from the remaining pellet by QIAGEN ® QIAprep ® plasmid isolation spin column according to the manufacturer's instructions and submitted for DNA sequencing.
  • QIAGEN ® QIAprep ® plasmid isolation spin column according to the manufacturer's instructions and submitted for DNA sequencing.
  • a single colony of E. coli was restreaked on LB/agar and allowed to mature at room temperature. After 2 days to 2 weeks the bacteria were scraped from the plate, extracted with B-per II, analyzed (not boiled) by SDS-PAGE (BioRad), and the gel imaged with a digital camera.
  • Ligation mixtures were transformed into Escherichia coli BL21 (DE3) Gold (Stratagene) by electroporation in 10% glycerol with a ligation mixture (0.1 cm cuvette, 12.5 kV/cm, 200Q , 25 ⁇ F).
  • Protein was expressed and purified essentially as described in Baird et al. , Proc. Natl. Acad. ScL USA 96:11241-11246 (1999). Briefly, when cultured for protein expression, transformed bacteria were grown to an ODm of 0.6 in LB containing 100 mg/liter ampicillin, at which time they were induced with 1 mM isopropyl ⁇ -D- thiogalactoside. Bacteria were allowed to express recombinant protein for 6 hr at room temperature and then overnight at 4 0 C. The bacteria then were pelleted by centrifugation, resuspended in 50 mM Tris-HCl/300 mM NaCl, and lysed by a French press. The bacterial lysates were centriruged at 30,000 x g for 30 min, and the proteins were purified from the supernatants using Ni-NTA resin (QIAGEN ® ).
  • Spectroscopy of purified protein was typically performed in 100 mM KCl, 10 mM MOPS, pH 7.25, in a fluorescence spectrometer (Fluorolog-2, Spex Industries). All DNA sequencing was performed by the Molecular Pathology Shared Resource, University of California, San Diego, Cancer Center. including Chimeric Constructs
  • dimer2 in pRSET ⁇ was amplified in two separate PCR reactions. In the first reaction, the 5' Bam ⁇ S. and a 3 1 Sphl site were introduced while in the second reaction a 5' Sad and a 3' Ec ⁇ Bl site were introduced. The construct was assembled in a 4-part ligation containing the digested dimer2 genes, a synthetic linker with phosphorylated sticky ends, and digested pRSET B . Four different linkers were used, which encoded polypeptides of various lengths. These were:
  • DsRed variants were amplified from pRSET ⁇ with a 5' primer that encoded a Kp ⁇ i restriction site and a Kozak sequence. The PCR product was digested, ligated into pcDNA3, and used to transform E. coli DH5 ⁇ .
  • Cx43 chimeric fusion polypeptide comprising DsRed and connexin43
  • DsRed variants were expressed essentially as described in Bakd etal., Proc. Natl. Acad. ScL USA 96: 11241-11246 (1999). All proteins were purified by Ni-NTA ace ⁇ diig to the manufacturer's instructions and dialyzetf into 10 mM Tris, pH 7.5 or phosphate buffered saline supplemented with 1 mM EDTA. All biochemical characterization experiments were performed essentially as described in Baird et aU Proc. Natl. Acad. ScL USA 97:11984-11989 (2000).
  • the maturation time courses were determined on a Safire 96 well plate reader with monochromators (TECAN, Austria). Aqueous droplets of purified, protein in phosphate-buffered saline were formed under mineral oil in a chamber on the fluorescence microscope stage. For reproducible results it proved essential to pre-extract the oil with aqueous buffer, which would remove any traces of autdxidized or acidic contaminants. The droplets were small enough (5 - 10 ⁇ m diameter) so that all the molecules would see the same incident intensity.
  • the absolute excitation irradiance in photons/(cm 2 *s-nm) as a function of wavelength was computed from the spectra of a xenon lamp, the transmission of , the excitation filter, the reflectance of the dichroic mirror, the manufacturer-supplied absolute spectral sensitivity of a miniature integrating-sphere detector (SPD024 head and ILC1700 meter, International Light Corp., Newburyport, MA), and the measured detector current.
  • the predicted rate of initial photon emission was calculated from the excitation irradiance and absorbance spectrum (both as functions of wavelength), and the quantum yield.
  • the data were analyzed globally at 10K, 14K, and 2OK rpm by nonlinear least-squares analysis using the ORIGIN software package supplied by Beckman. Th ⁇ " g ⁇ t>dness" ⁇ f fit was evaluated on the basis of the magnitude and randomness of the residuals, expressed as the difference between the experimental data and the theoretical curve and also by checking each of the fit parameters for physical reasonability.
  • HeLa cells were transfected with DsRed variants or Cx43-DsRed fusions in ⁇ cDNA3 through the use of Fugene 6 transfection reagent (Roche). Transfected cells were grown for 12 hours to 2 days in DMEM at 37°C before imaging using a Zeiss Axiovert 35 fluorescence microscope with cells in glucose-supplemented HBSS at room temperature. Individual cells expressing Cx43 fused to a DsRed variant, or contacting non-transfected cells for control experiments, were microinjected with a 2;5% solution of lueifer yellow (Molecular Probes, Eugene, OR). Images were acquired and processed with the Metafluor software package (Universal Imaging, West Chester, PA).
  • the present invention provides methods for the stepwise evolution of tetrameric DsRed to a dimer and then either to a genetic fusion of two copies of the protein, i.e., a tandem dimer, or to a true monomer designated mRFPl .
  • Each subunit interface was disrupted by insertion of arginines, which initially crippled the resulting protein, but red fluorescence could be rescued by random and directed mutagenesis totaling 17 substitutions in the duner and 33 substitutions in ffiRFPl. Fusions of the gap junction protein connexin43 to raRFPl formed fully functional junctions, whereas analogous fusions to the tetramer and dimer failed.
  • mRFPl has somewhat lower extinction coefficient, quantum yield, and photostability than DsRed, mRFPl matures >10x faster, so that it shows similar brightness in living cells. Ih addition, the excitation and emission peaks of mRFPl, 584 and 60.7 nm, are ⁇ 25 nm red shifted from DsRed, which should confer greater tissue penetration and spectral separation from autofluorescence and other fluorescent proteins.
  • the consensus view is that a monomelic form of DsRed will be essential if it is to ever reach its full potential as a genetically encoded red fluorescent tag (Remington, Nat. Biotechnol, 20:28-29 [2002]).
  • the present invention provides a directed evolution and preliminary characterization of the first monomelic red fluorescent protein.
  • the present invention provides an independent alternative to GFP in the consumption of fluorescently tagged fusion proteins.
  • mutant red fluorescent proteins were screened in colonies of E. coli and were evaluated on both the magnitude of their red fluorescence under direct excitation at 540 nm and the ratio of emission intensities at 540 nm over 470 nm excitation. While the former constraint selected for very bright or fast maturing mutants, the latter constraint selected for mutants with decreased 470 nm excitation or red-shifted excitation spectra. Multiple cycles of random mutagenesis were used to find sequence locations that affected the maturation and brightness of the protein, and then expanded libraries of mutations at those positions were created and recombined to find optimal permutations.
  • dimer2 (illustrated in FIG. 2B).
  • This variant contains 17 mutations, of which eight are internal to the ⁇ -barrel (N42Q, V44A, V71A, Fl 18L, K163Q, S179T, S197T and T217S), three are the aggregation reducing mutations found in Tl (R2A, K5E and N6D and see Bevis and Glick, Nat Biotechnol, 20:83-87 [2002]; and Yanushevich et al, FEBS Lett., 511:11-14 [2002]), two are AB interface mutations (I125R and V127T), and 4 are miscellaneous surface mutations (T21S, H41T, Cl 17T and S131P).
  • the dimer2 nucleotide sequence is provided in SEQ ID NO: 7 and FIG. 21.
  • the dimer2 polypeptide is provided in SEQ ID NO: 6 and FIG. 22A.
  • a variant of difher2 may comprise one or more amino acid substitutions selected from amino acid substitutions at positions 22, 66, 105, and 124; and may also include terminal amino acids at the GEP terminus.
  • a variant of dimer2 may have about 80%, or 85%, or 90%, or 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence of SEQ ID NO:6.
  • substitutions in the dimeric protein may be selected from one or more of V22M, Q66M, V104L, and F124M.
  • the protein variant is dimer2.2MMM (dimer3) (dTomato) (SEQ ID NO: 81) having substitutions V22M, Q66M, V104L, and F124M with respect to SEQ ID NO: 6 and having GFP termini of MVSKGEE (SEQ ID NO: 14) (at the N-terminus)and GMDELYK (SEQ ID NO: 91) or YGMDELYK (SEQ ID NO: 110) at the C-terminus.
  • the underlined residues were copied from the N- and C-termini of EGFP (containing mutations F64L, S65T; SEQ JD NO: 13) and replace the corresponding amino acids in DsRed and rnRFPl, as illustrated in Fig. 22B. Also shown in FIG.22B are the N-terminal amino acid sequences of DsRed (SEQ ID NO: 1) and mRFPl (SEQ ID NO: 8).
  • dimer2.2MMM dimer3 (dTomato) has an excitation wavelength peak at 554 nm and an emission wavelength peak at 581 nm, with an extinction coefficient of 70,000 MT 1 Cm '1 and a quantum yield of 0.72.
  • Dimer2.2MMM dimer3 (dTomato) has the highest extinction coefficient of the variants that have been made, and has improved quantum yield as compared to dimer2. Its excitation and emission wavelengths are most similar to the wild type DsRed, with has very little green component (having less green component than either wt DsRed or dimer2).
  • tandem dimer construct with the 12 residue linker designated tdimer2(12)
  • dimer2 and tdimer2(12) have identical excitation and emission maximum and quantum yields (see FIG. 14).
  • the extinction coefficient of tdimer2(12) is twice that of dimer2 due to the presence of two equally absorbing chromophores per polypeptide chain.
  • HF2Ga and HF2Gb were very similar in sequence to dimerl with the primary differences being the mutations F124L present in both clones, K163H in HF2Gb and the H222G and F224G replacements. Both HF2Ga and HF2Gb migrated as fluorescent dimers when loaded unboiled onto a 12% SDS-PAGE gel so they must maintain a stable dimer interface. [0252] Simultaneously, a more direct approach to breaking up the AC interface through introduction of dimer-breaking mutations was undertaken. Dimerl was the template for the first such library (FIG.
  • a template mixture including mRFPO.2, dimerl.56, HF2Ga and HG2Gb was subjected to a combination of PGR-based template shuffling and directed mutagenesis (FIG. 1OA, library M3).
  • the top clone identified in this library, mRFP0.3 was relatively bright and had a greatly diminished green fluorescent component.
  • mRFPO.3 was approximately 10 nm red shifted from DsRed and was primarily derived from dimerl.56.
  • the goal of the next directed library was to investigate the effect of mutations at K83, which have previously been shown to cause a red shift in DsRed (Wall et al, Nature Struct. Biol, 7:1133-1138 [2000]).
  • the top two clones designated mRFP0.4a and mRFP0.4b, contained the K83I or L mutation respectively, were 25 nm red shifted relative to DsRed and were very similar in terms of maturation rate and brightness.
  • colonies of E. coli transformed with mRFP0.4a were red fluorescent within 12 h after transformation when excited with 540 nm light and viewed through a red filter.
  • a template mixture of mRFP0.4a and mRFP0.4b was subjected to random mutagenesis (FIG. 1OB, library M5) and the resulting library was thoroughly screened.
  • the 5 fastest maturing clones from this library were derived from mRFP0.4a and contained individual mutations L174P, V175A (two clones), F177C and F177S.
  • the F177S clone or mRFP0.5a appeared to mature slightly faster and had the smallest green peak in the absorbance spectra.
  • One colony isolated from this library was exceptionally bright when grown on LB/agar but expressed very poorly when grown in liquid culture.
  • This clone, designated mRFP0.5b was derived from mRFP0.4b and contained two new mutations; Ll 5OM inside the barrel and V156A outside.
  • the next library (FIG. 1OB, library M6) was intended to optimize the region around residues V175 and F177 in both mRFP0.5a and the increasingly divergent mRFP0.5b.
  • the top clone in this library designated mRFPO.6, was derived from mRFP0.5b, though of three other top clones, one was derived from mRFP0.5b, one from mRFP0.5a, and one appeared to have resulted from multiple crossovers between the two templates.
  • the final library (FIG. IOB, library M7) targeted residues in the vicinity of L150 because this was the one remaining critical mutation that was derived from random mutagenesis and had not been reoptimized.
  • Top clones had combinations of mutations at all targeted positions though the clone with the single mutation R153E was found to express slightly better in culture. This clone was further modified through deletion of the unnecessary Via insertion and replacement of the cysteine at position 222 with a serine.
  • the final clone in this series contained a total of 33 mutations (see FIG. 1C) relative to wild-type DsRed. Of these mutations, 13 are internal to the ⁇ -barrel (N42Q, V44A, V71A, K83L, F124L, L150M, K163M, V175A, F177V, S179T, Vl 95T, S 1971 and T217A).
  • Tl aggregation reducing mutations from Tl (R2A, K5E and N6D)
  • three are AB interface mutations (I125R, V127T and I180T)
  • ten are AC interface mutations (R153E, H162K, A164R, L174D, Y192A, Y194K, H222S, L223T, F224G and L225A)
  • four additional mutations T21S, H41T, C117E and V156A.
  • the mRFPl nucleotide and polypeptide sequences are provided in SEQ ID NOS: 9 and 8, respectively.
  • the monomeric variant is a variant of mRFPl (SEQ ID NO: 8). Based on indications that substitution of methionine at the first position in the chromophore had beneficial effects on maturation of the I125R dimeric variant of DsRed (Baird, G. S. (2001) Ph.D. thesis, University of California, San Diego), a directed library of residues near the chromophore was constructed, including randomization at position 66 in mRFPl .
  • the Q66M substitution was found to have a large impact on the amount of protein that assumed the mature chromophore conformation relative to mRFPl, and the additional mutation T147S, present due to a PCR error in the Q66M mutant, was also found to be beneficial. Ih addition to allowing more complete maturation, the Q66M mutation also provides an additional red-shift of the excitation and emission spectra of approximately 5nm relative to mRFPl.
  • the Q66M. T147S mutant was designated mRFPl.1.
  • mRFPl .5 An additional directed library of mRFPl .5 was constructed that partially randomized positions 194, 195, 196, 197, and 199, based on evidence from wavelength- shifted mRFP variants that this region could influence solvent accessibility of the chromophore. From this library, the clone containing the mutations K194N, Tl 95 V, and D196N was found to have an enhanced extinction coefficient, while retaining the nearly complete lack of a 510nm absorbance peak. This clone was designated mRFPl.5.4 (also termed mRFP2, or mCherry). Dimer3 -
  • the dimer2 variant previously described possesses quite desirable properties, such as much faster maturation than wild-type DsRed and nearly complete maturation, as well as a high extinction coefficient and quantum yield relative to the fast- maturing mutant Tl .
  • randomly mutagenized libraries of dimer2 were constructed.
  • the V104L mutation was identified as improving the brightness of the dimer, and subsequent analysis showed that the effect of this mutation was to significantly increase the quantum yield of the protein to a level comparable to wild-type DsRed.
  • this mutation alone was not clearly beneficial, as it also increased the proportion of protein trapped in an immature, green fluorescent state.
  • dimer2.2 As with mRFP, a decrease in the dimer RFP's sensitivity to N- and C- terminal fusions was desired, and so, as with mRFP, its first and last seven amino acids were replaced with the corresponding GFP residues. The resulting protein was found to have more consistent brightness regardless of the N-terminal sequence attached to it.
  • the V104L dimer variant with the GFP-type termini was designated dimer2.2.
  • Randomly mutagenized libraries of Q66C/S/T libraries identified the Tl 951 mutation as important in reducing pH sensitivity and favoring the more blue-shifted form of the mOFP chromophore. Additional directed libraries at this and surrounding positions identified T 195V as the optimal mutation for reducing pH sensitivity, and Q66T as having the highest quantum yield of the mOFP chromophores. This clone was designated mOFP.T.12, and, in addition to the modified N- and C- termini present in mRFPl.4, has the additional mutations Q66T, K194M, T195V, D196S relative to mRFPl.4.
  • this variant contains the mutations V7I, E32K, A77P, L83M, R125H, T147S, M150L, 1161 V, T195L, and I197Y relative to mRFPl .3.
  • a variant of mRFPl may have about 80%, or 85%, or 90%, or 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence of SEQ DD NO:8.
  • a variant of mRFPl may comprise more than one amino acid substitution as compared to the wtDsRed sequence (SEQ ID NO: 1) or mRFPl (SEQ ID NO: 8) and may also include terminal amino acid additions or substitutions selected from the insertions comprising one or more amino acids homologous to the amino acids at the GFP terminus, the amino acids DNMA, and the amino acids NNMA.
  • Fig. 32 Amino acid substitutions found in the protein variants dimer 2.2MMM (dimer 3) (dTomato), mRFPl.5, OrS4-9, Yl .3 (mY0FP1.3) (mBanana), and mFRFP (F2Q6) (mGrape2) are indicated in Fig. 32, which also includes excitation/emission wavelength values, extinction coefficient values, quantum yield values, and comments on the properties of the variants. Characterization of dimer2. tdimer2(12) and mRFPl
  • dimer2(12) and mRFPl in Mammalian Cells [0277] The fluorescence of the dimer2, tdimer2(12) and mRFPl proteins in the context of mammalian cells was tested. Mammalian expression vectors encoding dimer2, tdimer2(12) and mRFPl were expressed in transiently transfected HeLa cells. Within 12 hours the cells displayed strong red fluorescence evenly distributed throughout the nucleus and cytoplasm (data not shown).
  • FIGS. 6A, 6C and 6E The results of this experiment are shown in FIGS. 6A, 6C and 6E.
  • the Cx43-GFP fusion protein was properly trafficked to the membrane and was assembled into functional gap junctions (data not shown), whereas the Cx43-DsRed tetramer (i.e., the Tl tetramer) consistently formed perinuclear localized red fluorescent aggregates (FIG. 6E).
  • Both Cx43- tdimer2(12) (not shown) and Cx43-dimer2 (FIG. 6C) were properly trafficked to the membrane though neither construct formed visible gap junctions.
  • the Cx43- mRFPl construct behaved identically to Cx43-GFP and many red gap junctions were observed (FIG. 6A).
  • the transfected cells were microinjected with lucifer yellow to assess the functionality of the gap junctions (see FIGS. 6B, 6D and 6F; and FIG. 13).
  • the Cx43-mRFPl gap junctions rapidly and reliably passed dye (FIG. 6B), while neither Cx43-Tl transfected cells (FIG. 6E) nor non-transfected cells (not shown) passed dye.
  • Variant RFP polypeptides of the present invention for example tdimer2(12), also find use as FRET based sensors. This species is sufficiently bright, and displays FRET with all variants of Aequorea GFP.
  • the present invention provides methods for the generation of still further advantageous RFP species. These methods use multistep evolutionary strategies involving one or multiple rounds of evolution with few mutational steps per cycle. These methods also find use in the converting of other oligomeric fluorescent proteins into advantageous monomeric or dimeric forms.
  • ECFP (SEQ ID NO: 11) and EYFP-V68L/Q69K (SEQ ID NO: 12) at the dimer interface were subcloned into the bacterial expression vector pRSET ⁇ (Ihvitrogen Corp., La Jolla CA), creating an N-terminal His 6 tag on the of ECFP (SEQ ID NO: 11) and EYFP-V68L/Q69K (SEQ ID NO: 12), which allowed purification of the bacterially expressed proteins on a nickel-agarose (Qiagen) affinity column. All dimer-related mutations in the cDNAs were created by site-directed mutagenesis using the QuickChange mutagenesis kit (Stratagene), then expressed and purified in the same manner.
  • EWP-V68L/Q69K (SEQ ID NO: 12) was mutagenized using the QuickChange kit (Stratagene). The overlapping mutagenic primers were designated “top” for the 5' primer and “bottom” for the 3' primer and are designated according to the particular mutation introduced (see TABLE 1). All primers had a melting temperature greater than 7O 0 C. The mutations were made as close to the center of the primers as possible and all primers were purified by polyacrylamide gel electrophoresis. The primers are shown in a 5' to 3' orientation, with mutagenized codons underlined (TABLE 1).
  • plasmids containing cDNAs for the various EYFP-V68L/Q69K (SEQ ID NO: 12) mutants were transformed into E. coli strain JM109 and grown to an OD ⁇ oo of 0.6 in LB containing 100 ⁇ g/ml ampicillin at which time they were induced with 1 mM isopropyl /3-D-thiogalactoside.
  • the bacteria were allowed to express the protein at room temperature for 6 to 12 hr, then overnight at 4 0 C, then were pelleted by centrifugation, resuspended in phosphate buffered saline (pH 7A), and lysed in a French press.
  • Bacterial lysates were cleared by centrifugation at 30,000 x g for 30 min. The proteins in the cleared lysates were affinity-purified on Ni-NTA-agarose (Qiagen).
  • the His ⁇ tag was removed using EKMax (Invitrogen) to determine if the associative properties measured for the GFPs were affected by the presence of the N- terminal His6-tag, A dilution series of the enzyme and His 6 -tagged GFP was made to determine the conditions necessary for complete removal of the His 6 -tag.
  • the purity of all expressed and purified proteins was analyzed by SDS-PAGE. In all cases, the expressed proteins were very pure, with no significant detectable contaminating proteins, and all were of the proper molecular weight.
  • removal of the His ⁇ tag was very efficient, as determined by the presence of a single band migrating at the lower molecular weight than the His 6 -EYFP-V68L/Q69K.
  • Spectrophotometric analysis of the purified proteins determined that there was no significant change in either the extinction coefficient as measured by chromophore denaturation (Ward et ah, In Green Fluorescent Protein: Properties, Applications and Protocols," eds. Chalfie and Kain, Wiley-Liss [1998]) or quantum yield (the standard used for EYFP- V68L/Q69K and the mutants derived therefrom was fluorescein) of these proteins with respect to EYFP-V68L/Q69K (SEQ ID NO: 12; "wtEYFP"; Table 2). Fluorescence spectra were taken with a Fluorolog spectrofluorimeter.
  • ECFP SEQ ID NO: 11 ; "wtECFP”
  • EYFP-V68L/Q69K SEQ ID NO: 12; “wtEYFP”
  • PM plasma membrane
  • the cDNAs of the PM targeted GFP variants were transfected and expressed in either HeLa cells or MDCK cells, and the expression pattern and degree of association were determined using fluorescent microscopy. FRET efficiency was measured to determine the degree of interaction of the PM-ECFP and PM-EYFP- V68L/Q69K. Analysis of the interactions by the FRET donor-dequench method (Miyawaki and Tsien, supra, 2000) demonstrated that the wtECFP and wtEYFP interacted in a manner that was dependent upon the association of the wtECFP and wtEYFP, and that this interaction was effectively eliminated by changing the amino acids in the hydrophobic interface to any one or a combination of the mutations A206K, L221K and F223R.
  • the Renilla GFP and the Disc ⁇ s ⁇ m ⁇ " red fluorescent protein are obligate oligomers in solution. Because it was generally believed that Aequorea GFP could also dimerize in solution, and because GFP crystallizes as a dimer, the present investigation was designed to characterize the oligomeric state of GFP.
  • the crystallographic interface between the two monomers included many hydrophilic contacts as well as several hydrophobic contacts (Yang et al., supra, 1996). It was not immediately clear, however, to what degree each type of interaction contributed to the formation of the dimer in solution.
  • This example describes the initial biochemical and biological characterization of DsRed and DsRed mutants.
  • the coding sequence for DsRed was amplified from pDsRed-Nl (Clontech Laboratories) with PCR primers that added an N terminal BamHI recognition site upstream of the initiator Met codon and a C terminal Eco RI site downstream of the STOP codon. After restriction digestion, the PCR product was cloned between the Bam HI and Eco RI sites of pRSET ⁇ (Invitrogen), and the resulting vector was amplified in DH5 ⁇ bacteria. The resulting plasmid was used as a template for error-prone PCR (Heim and Tsien, Curr. Biol.
  • the mutagenized plasmid library was electroporated into JMl 09 bacteria, plated on LB plates containing ampicillin, and screened on a digital imaging device (Baird et al., Proc. Natl. Acad. Sci., USA 96:11242-11246, 1999, which is incorporated herein by reference).
  • This device illuminated plates with light from a 150 Watt xenon arc lamp, filtered through bandpass excitation filters and directed onto the plates with two fiber optic bundles. Fluorescence emission from the plates was imaged through interference filters with a cooled CCD camera.
  • DsRed and its mutants were purified using the N-terminal polyhistidine tag (SEQ ID NO: 22; see Example 1) provided by the pRSET ⁇ expression vector (see Baird et al., supra, 1999).
  • the proteins were microconcentrated and buffer exchanged into 10 mM Tris (pH 8.5) using a Microcon-30 (Amicon) for spectroscopic characterization.
  • the protein was dialyzed against 10 mM Tris (pH 7.5) for oligomerization studies because microconcentration resulted in the production of large protein aggregates.
  • the pH sensitivity of DsRed was determined in a 96 well format by adding 100 ⁇ L of dilute DsRed in a weakly buffered solution to 100 ⁇ L of strongly buffered pH solutions in triplicate (total 200 ⁇ L per well) for pH 3 to pH 12.
  • the fluorescence of each well was measured using a 525-555 nm bandpass excitation filter and a 575 nm long pass emission filter.
  • 100 ⁇ l of each pH buffered DsRed solution was analyzed on the spectrofluorimeter to observe pH- ; dependent spectral shape changes.
  • Quantum yields for photodestruction were measured separately on a microscope stage or in a spectrofluorimeter. Microdroplets of aqueous DsRed solution were created under oil on a microscope slide and bleached with 1.2 W/cm 2 of light through a 525- 555 nm bandpass filter. Fluorescence over time was monitored using the same filter and a 563-617 nm emission filter.
  • EGFP containing mutations F64L, S65T; SEQ ⁇ D NO: 13
  • EYFP-V68L/Q69K also containing mutations S65G, S72A, T203Y; SEQ ID NO: 12
  • a solution of DsRed was prepared in a rectangular microcuvette and overlaid with oil so that the entire 50 ⁇ L of protein solution resided in the 0.25 cm x 0.2 cm x 1 cm illumination volume.
  • the protein solution was illuminated with 0.02 W/cm 2 light from the monochromator centered at 558 nm (5 nm bandwidth). Fluorescence over time was measured at 558 nm excitation (1.25 nm bandwidth) and 583 nm emission. Quantum yields ( ⁇ ) for photobleaching were deduced . from the equation where ⁇ is the extinction coefficient in cnAnol "1 , 1 is the intensity of incident light in einsteins' cm ' V 1 and t9o% is the time in seconds for the fluorophore to be 90% bleached (Adams et al., J. Am. Chem. Soc. 110:3312-3320, 1988, which is incorporated herein by reference).
  • Polyhistidine-tagged DsRed, DsRed K83M and wild type Aequorea GFP were run on a 15% polyacrylamide gel without denaturation.
  • protein solutions in 1OmM TrisHCl, pH 7.5
  • 2x SDS- PAGE sample buffer containing 200 mM dithiothreitol
  • a broad range pre-stained molecular weight marker set BioRad was used as a size standard. The gel was then imaged ori an Epson 1200 Perfection flatbed scanner.
  • DsRed in the vector pcDNA3 was transfected into HeLa cells using Lipofectin, and 24 hr later the cells were imaged on a fluorescence microscope.
  • the fluorescences of the immature green, species (excitation 465-495 nm, 505 nm dichroic, emission 523-548 nm) arid of mature red protein (excitation 529-552 nm, 570 nm dichroie, emission 563-618 nm) were measured with a cooled CCD camera.
  • Yeast two hybrid assays were also performed.
  • the DsRed coding region was cloned in-frame downstream of the Gal4 activation domains (the "bait”; amino acid residues 768-881) and DNA binding domains (the “prey”; amino acid residues 1-147) in the pGAD GH and pGBT9 vectors, respectively (Clontech).
  • These DsRed two hybrid plasmids were transformed into the HF7C strain of S. cerevisiae, which cannot synthesize histidine in the absence of interaction between the proteins fused to the Gal4 fragments.
  • Yeast containing both DsRed-bait and DsRed-prey plasmids were streaked on medium lacking histidine and assayed for growth by visually inspecting the plates.
  • the yeast were grown on filters placed on plates lacking tryptophan and leucine to select for the bait and prey plasmids. After overnight growth, the filters were removed from the plates, frozen in liquid nitrogen, thawed, and incubated in X-gal overnight at 30 0 C and two days at 4°C to test for j8-galactosidase activity (assayed by blue color development).
  • negative controls consisted of yeast containing bait and prey plasmids, but only the bait or the prey was fused to DsRed
  • DsRed was also relatively resistant to photobleaching.
  • microdroplets of DsRed under oil took 1 hr to bleach 90%, whereas 20 mW/cm 2 of 558 nm light in a spectrofluorimeter microcuvette required 83 hr to bleach 90%.
  • the microscope and fi ⁇ orimeter measurements, respectively, gave photobleach quantum efficiencies of 1.06 x 10 "6 and 4.8 x 10 "7 (mean of 7.7 x 10 "7 ).
  • DsRed was mutagem ' zed randomly and at specific sites predicted by sequence alignment with GFP to be near the chromophore. Many mutants that matured more slowly or not at all were identified, but none were identified that matured faster than DsRed. Screening of random mutants identified mutants that appeared green or yellow, which was found to be due to substitutions K83E, K83R, S197T, and Y120H.
  • the green fluorescence was due to a mutant species with excitation and emission maxima at 475 and 500 nm, respectively, whereas the yellow was due to a mixture of this green species with DsRed-like material, rather than to a single species at intermediate wavelengths.
  • the DsRed K83R mutant had the lowest percentage conversion to red in this series of experiments, and proved very useful as a stable version of the immature green- fluorescing form of DsRed (see Baird et al., supra, 2000). Further directed mutagenesis of K83 yielded more green and yellow mutants that were impaired in chromophore maturation. In many of the K83 mutants that matured slowly and incompletely, the red peak was at longer wavelengths than DsRed. K83M was particularly interesting because its final red- fluorescing species showed a 602 nm emission maximum, with relatively little residual green fluorescence and a respectable quantum yield, 0.44. However, its maturation was slower than that of the wild type DsRed. Y120H had a red shift similar to that of K83M and appeared to produce brighter bacterial colonies, but also maintained much more residual green fluorescence.
  • FIG. 15 Spectroscopic data of the DsRed mutants are shown in FIG. 15.
  • “maturation” of protein refers to the rate of appearance of the red fluorescence over the two days after protein synthesis. Because some maturation occurs during the synthesis and purification (which take 1-2 days), numerical quantification is not accurate. A simple +/- rating system was used, wherein (--) means very little change, (-) means a 2-5 fold increase in red fluorescence, (+) means 5-20 fold increase, and (++) indicates the wild type increase (approximately 40 fold).
  • the red/green ratio was determined two months after protein synthesis by dividing the peak emission fluorescence obtained at 558 nm excitation by the 499 nm fluorescence obtained at 475 nm excitation from the same sample. This does not represent a molar ratio of the two species because the ratio does not correct for differences in extinction coefficient or quantum yields between the two species, or the possibility of FRET between the two species if they are in a macromolecular complex.
  • DsRed has many desirable properties, as well as some nonoptimal properties, with respect to its being useful to complement or as an alternative to GFPs.
  • One of the most important favorable properties identified was that DsRed has a much higher extinction coefficient and fluorescence quantum yield (0.7) than was previously reported, such that the fluorescence brightness of the mature well-folded protein is comparable to rhodamine dyes and to the best GFPs.
  • DsRed also is quite resistant to photobleaching by intensities typical of spectrofiuori ⁇ ieters (mW/cm 2 ) or microscopes with arc lamp illumination and interference filters (W/cm 2 ), showing a photobleaching quantum yield on the order of 7 x lO '7 in both regimes. This value is significantly better than those for two of the most popular green and yellow GFP mutants, EGFP (3 x 1(T 6 ) and EYFP-V68L/Q69K (5 x 1(T 5 ).
  • the mean number of photons that a single molecule can emit before photobleaching is the ratio of the fluorescence and photobleaching quantum yields, or 1 x 10 6 , 2 x 10 5 , and 1.5 x 10 4 for DsRed, EGFP, and EYFP-V68L/Q69K, respectively.
  • the apparent photobleaching quantum yield might well increase at higher light intensities and shorter times if the molecule can be driven into dark states such as triplets or tautomers from which it can recover its fluorescence.
  • GFPs usually show a range of such dark states (Dickson et al., Nature 388:355-358, 1997; Schwille et al., Proc. Natl. Acad.
  • DsRed mutants such as K83M demonstrate that DsRed can be pushed to longer wavelengths (564 and 602 ran excitation and emission maxima), while retaining adequate quantum efficiency (0.44).
  • the 6 nm and 19 nm bathochromic shifts correspond to 191 cm "1 and 541 cm '1 in energy, which are of respectable magnitude for a single amino acid change that does not modify the chromophore.
  • a homolog of DsRed recently cloned from a sea anemone has an absorbance maximum at 572 nm and extremely weak emission at 595 nm with quantum yield ⁇ 0.001; one mutant had an emission peak at 610 nm but was very dim and slow to mature (Lukyanov et al., J. Biol. Chem. 275:25879-25882, 2000, which is incorporated herein by reference).
  • DsRed Less desirable features include its slow and incomplete maturation, and its capacity to oligomerize. A maturation time on the order of days precludes a use of DsRed as a reporter for short term gene expression studies and for applications directed to tracking fusion proteins in organisms that have short generation times or fast development. Since maturation of GFPs was considerably accelerated by mutagenesis (Heim et al., Nature 373:663-664, 1995, which is incorporated herein by reference), DsRed similarly can be mutagenized and variants having faster maturation times can be isolated.
  • Lys83 mutants all permitted at least some maturation, it is unlikely that the primary amine plays a direct catalytic role for this residue, a suggestion supported by the observation that the most chemically conservative replacement, Lys to Arg, impeded red development to the greatest extent.
  • Ser 197 provided a similar result, in that the most conservative possible substitution, Ser to Thr, also significantly slowed maturation. Mutations at the Lys83 and Ser 197 sites appeared several times independently in separate random mutagenesis experiments and, interestingly, Lys83 and Serl97 are replaced by Leu and Thr, respectively, in the highly homologous cyan fluorescent protein dsFP483 from the same Discosoma species. Either of the latter two mutations could explain why dsFP483 never turns red. Residues other than Lys83 and Serl97 also affected maturation to the red.
  • oligomerization of DsRed does not preclude its use as a reporter of gene expression, it can result in artifactual results in applications where DsRed is fused to a host protein, for example, to report on the trafficking or interactions of the host protein in a cell.
  • fusion with DsRed can result in the formation of a complex of at least 4(M+26 kDa).
  • fusion to DsRed and consequent association can result in constitutive signaling.
  • red cameleons i.e., fusions of cyan fluorescent protein, calmodulin, and cahnodulin-binding peptide, and DsRed
  • red cameleons are far more prone to form visible punctae in mammalian cells than the corresponding yellow cameleons with yellow fluorescent protein in place of DsRed (Miyawaki et al., Proc. Natl. Acad. Sri.. USA 96:2135-2140, 1999).
  • DsRed variants can be produced such that the propensity of the fluorescent protein to oligomerize is reduced or eliminated.
  • DsRed variants can be constructed and examined, for example, using a yeast two hybrid or other similar assay to identify and isolate non-aggregating mutants.
  • the X-ray crystallographic structure of DsRed can be examined to confirm that optimal amino acid residues are modified to produce a form of DsRed having a reduced propensity to oligomerize.
  • Example 4 DsRed Variants Having Reduced Propensity To Oligomerize [0328] This example demonstrates that mutations corresponding to those introduced into GFP variants to reduce or eliminate oligomerization also can be made in DsRed to reduce the propensity of DsRed to form tetramers.
  • amino acid residues were identified as potentially being involved in DsRed oligomerization.
  • One of these amino acids, isoleucine-125 (1125) was selected because, in the oligomer, the 1125 residues of the subunits were close to each other in a pairwise fashion; i.e., the side chain of 1125 of the A subunit was about 4 Angstroms from the side chain of 1125 of the C subunit, and the 1125 residues in the B and D subunits were similarly positioned.
  • DsRed I125K and I125R were prepared with the QuickChange Mutagenesis Kit using the DsRed cDNA (SEQ ID NO: 23; Clontech) subcloned into the expression vector pRSETB (Invitrogen) as the template for mutagenesis.
  • the primers for mutagenesis, with the mutated codons underlined, were as follows:
  • mutant proteins were prepared following standard methodology and analyzed with polyacrylamide gel electrophoresis as described (Baird et al., supra, 2000).
  • DsRed I125R was dialyzed extensively in PBS, then diluted in PBS until the absorbance of the solution at 558nm was 0.1. This solution was centrifuged in a Beckman XL-I analytical ultracentrifuge in PBS at 10,000 rpm, 12,000 rpm, 14,000 rpm, and 20,000 rpm. Absorbance at 558nm versus radius was determined and compared to a wild type tetrameric DsRed control (Baird et al., supra, 2000).
  • the DsRed I125K yielded a protein that became red fluorescent and was a mixture of dimer and tetramer as analyzed by non-denaturing polyacrylamide gel electrophoresis of the native protein.
  • the same analysis of Ds Red I125R revealed that the protein was entirely dimeric.
  • the dimeric status of DsRed I125R was confirmed by analytical ultracentrifugation; no residual tetramer was detected.
  • tandem DsRed protein can be formed by linking two DsRed monomers, and that such tandem DsRed proteins maintain emission and excitation spectra characteristic of DsRed, but do not oligomerize.
  • a new 3 ' primer 5'-CCGGATCCCCCTTGGTGCTGCCCTCCCCGCTGCCGGGCTTCCCGCTCCCGCTG GTGCTGCCCAGGAACAGGTGGTGGCGGCCCTCG-S' (SEQ ID NO: 39), also was used.
  • PCR amplification of DsRed and of DsRed-I125R with the new linker was accomplished with Taq DNA polymerase (Roche) and an annealing protocol that included 2 cycles at 40 0 C, 5 cycles at 43 0 C, 5 cycles at 45°C, and 15 cycles at 52 0 C.
  • the resulting PCR product was purified by agarose gel-electrophoresis and digested with Bam HI (New England Biolabs).
  • Bam HI and calf intestinal phosphatase (New England Biolabs) treated vector was prepared from pRSET ⁇ with DsRed or DsRed-I125R inserted in frame with the His-6 tag and between the 5' Bam HI and 3' Eco RI restriction sites.
  • the isolated and sequenced vectors were used to transform competent E. coli JM109(DE3). Single colonies grown on LB agar/ampicillin were used to inoculate 1 liter cultures of LB/ampicillin, then were grown with shaking at 225 rpm and 37°C until the broth reached an OD 6 oo of 0.5-1.0. IPTG was added to a final concentration of 100 mg/1 and the culture was grown for either 5 hr at 37 0 C (tDsRed) or 24 hr at room temperature (RT; tDsRed-I125R).
  • tDsRed developed visible fluorescence within approximately 12 hr at room temperature, while tDsRed-I125R required several days before significant red color developed.
  • the maturation of tDsRed-I125R continued for up to approximately 10 days.
  • the excitation and emission maxima were unchanged at 558 nm and 583 nm, respectively.
  • DsRed-I125R and tDsRed-I125R both migrated as dimers with an apparent molecular mass of about 50 kDa.
  • DsRed-I125R that was not boiled also had a large component that appeared to be denatured, though the fluorescent band for the dimer (50 kDa) was clearly visible.
  • tDsRed-I125R also had a denatured component that migrated slower (65 kDa vs. 50 kDa) than the intact fluorescent species.
  • tDsRed-I125R migrated at approximately the same mass as two monomers (65 kDa), while DsRed-I125R migrated at the monomer molecular mass of 32 kDa.
  • Wild-type DsRed, Q66M DsRed, and another DsRed variant, K83R DsRed were subjected to brief boiling in pH 1 HCl, and then run on an SDS polyactylamide gel.' Since red chromophore formation makes the protein acid labile at redicue 66, the relative amount of hydrolysis products versus full-length protein is indicative of the completeness of maturation.
  • the gel was Coomassie stained and imaged with a flat-bed scanner, and the relative intensity of all of the bands was then quantified using the software NlH Image.
  • V71A to GYC V or A
  • This library contains a genetic diversity of 262, 144 cDNAs which encode for 64,000 different amino acid sequences.
  • This library was transformed into E. coli JM109(DE3) and bacterial colonies were manually screened ( ⁇ 50,000 independent colonies) as described in the previous examples. Colonies that exhibited improved brightness or were a different color were picked and the gene was sequenced to determine the amino acid substitution. Top clones identified from this library fell into several different categories including:
  • the top mutant isolated from this library is mRFPl + Q66M/T147S, which has been designated mRFPl .1.
  • mRFPl.1 is -30% brighter than rriRFPl due to an improved EC. This improvement is due to an apparent increase in the fraction of the protein that forms the mature red chromophore at the expense of the non-fluorescent species that absorbs at 502 nm (see Figure 29, presenting the absorption and emission spectrum of mRFPl.1).
  • the beneficial T147S mutant arose from an error during PCR amplification of the cDNA due to the use of Taq polymerase.
  • the Q66M mutation has previously been shown to improve the fluorescence of the dimeric I125R variant of DsRed (Baird, G. S. (2001) Ph.D. Thesis, University of California, San Diego).
  • the amino acid sequence of mRFPl.1 is shown in Figure 30 (SEQ ID NO: 79), while the nucleotide sequence of mRFPl.1 is provided in Figure 31 (SEQ ID NO: 80).
  • Example 8 Further Red Fluorescent Protein Variants
  • Fig. 32 and TABLE 6 list some of these further variants. GFP termini are illustrated in Fig. 22B (SEQ ID NO: 14 represents the N-terminus and SEQ ID NO: 91 represents the C-terminus). An alternate variation of the C-terminal GFP sequence is provided in SEQ ID NO: 110.
  • dimer variant dimer2.2MMM (dimer3) (dTomato) (SEQ ID NO:81) is listed in Table 6. It has the highest extinction coefficient, and improved quantum yield compared to dimer2 (SEQ ID NO: 6). Dimer2.2MMM (dimer3) (dTomato) (SEQ ID NO:81) was also the dimer variant that had the extinction/emission ratio that was the most similar to the wild type DsRed, and had less green component than either wild-type DsRed or dimer2 (SEQ ID NO: 6). However, it does still have a residual green component.
  • the monomer variant mRFPl.5 (SEQ ID NO: 83), had an emission peak that was red-shifted by about 5 run, and significantly reduced green component, as compared with mRFPl .0. It also showed nearly complete maturation. However, its quantum yield is not extremely high.
  • the monomer variant OrS4-9 (SEQ ID NO: 85) was blue-shifted relative to mRFP and to wild- type DsRed, with a higher quantum yield than mRFPl .0 or mRFPl .5, and had reduced pH sensitivity as compared with the original orange mRFP variants. However, its extinction coefficient is low, possibly due to difficulty in folding or incomplete maturation.
  • the monomer variant Y1.3 (mYOFP1.3) (mBanana) (SEQ ID NO:87) had the largest blue-shift of any mRFP variant. It also had the highest quantum yield and a reduced pH sensitivity as compared with the original yellow mRFP variants, although its extinction coefficient is also low, possibly due to incomplete maturation.
  • the monomer variant rnFRFP (F2Q6) (mGra ⁇ e2) (SEQ ID NO: 89) had the largest red-shift of any mRFP variant, and seems to have nearly complete maturation, although its quantum yield and its extinction coefficient are not extremely high.
  • a useful protein variant is selected from the group of variants including mRFP1.5 (SEQ ID NO: 83), OrS4-9 (SEQ ID NO: 85), Y1.3 (mYOFP1.3) (mBanana) (SEQ ID NO: 87), mFRFP (F2Q6) (mGrape2) (SEQ ID NO: 89), , mRFP2 (mCherry) (SEQ ID NO: 92), mOFP (74-11) (SEQ ID NO: 94), mROFP (A2/6-6) (SEQ ID NO: 96), mStrawberry (SEQ ID NO:98), mTangerine (SEQ ID NO:100), mOrange (mOFPl) (SEQ ID NO:102), mHoneydew (SEQ ID NO:104), and mGrapel (SEQ ID NO:108).
  • mRFP1.5 SEQ ID NO: 83
  • OrS4-9 SEQ ID NO: 85
  • Y1.3 mBan
  • dimeric variants may also be useful, and may include dimers including one or more of the monomers indicated above.
  • Dimeric variants may also include a dimer subunit that is selected from, for example, dimerl, dimerl.02, dimerl.25, . dimerl .26, dimer 1.28, dimerl.34, dimerl.56, dimerl.61, dimerl.76, dimer2, dimer 2.2MMM (dimer 3) (dTomato) SEQ ID NO: 81) and tdTomato (SEQ ID NO: 106).
  • This example provides further discussion relating to the monomer variants. For example, one of the latest red versions matures more completely, is more tolerant of N-terminal fusions, and is over tenfold more photostable than mRFPl. Three new monomers with distinguishable hues from yellow-orange to red-orange have higher quantum efficiencies and suitability as re-emitting energy transfer acceptors.
  • mRFPl.l contains the mutation Q66M (along with the complementary T 147S), which, in addition to promoting more complete maturation, provides an additional 5 nm red-shift of both the excitation and emission spectra relative to mRFPl.
  • Q66M long with the complementary T 147S
  • This variant designated mRFPl.5, had excitation and emission 3 nm red-shifted from mRFPl and exhibited nearly complete maturation with kinetics as fast or faster than mRFPl.
  • an additional directed library constructed by partially randomizing positions 194, 195, 196, 197, and 199, resulted in the identification of a clone containing the mutations K194N, T195V, and D196N, which was found to have an enhanced extinction coefficient, while retaining the nearly complete lack of a 510 nm absorbance peak.
  • This final clone was designated fnCherry (See Table 7, Figures 47A and B, Figures 48A and B, and Figure 50). [0361 ] dTomato and tdTomato.
  • the dimer2 variant previously described 7 possesses many desirable properties such as a faster and more complete maturation than wild-type DsRed and a greater fluorescent brightness than the fast-maturing mutant Tl 6 (DsRed-Express).
  • DsRed-Express the fast-maturing mutant Tl 6
  • the final clone designated dTomato (see Table 7 and Figures 47A and 47B), additionally contains the GFP-type termini as described for mCherry (without the NNMA insertion), which result in a higher tolerance of N- and C-terminal fusions (data not shown).
  • Ih order to construct a nonaggregating tag from the extremely bright dTomato we genetically fused two copies of the gene to create a tandem dimer as previously reported 7 .
  • GFP-type termini were included at the N-terminus of the first copy of dTomato and at the C- terminUs of the second copy of dTomato.
  • the N-terminus of the second copy of dTomato consists of amino acids 2 through 6 of dimer2 followed by the NNMA insertion. This arrangement, designated tdTomato, provided the highest level of expression in E. coli while maintaining all of the desirable properties of the dimeric dTomato.
  • mRFP 1.1 Starting with mRFP 1.1 , we replaced Tyr67 with either Phe, His, or Trp. The most promising clone contained the Tyr67Trp substitution, homologous to the main wavelength-shifting mutation in the cyan GFP mutant, CFP. Two further rounds of directed mutagenesis yielded our most blue-shifted mRFP variant, named "mHoneydew" which contains four additional substitutions (see Figure 48A and Figure 48B), but does not have optimized N- and C-teimini. Like CFP, mHoneydew has relatively broad, double-peaked excitation and emission spectra, with excitation peaks at 487 and 504 nm, and emission peaks at 537 and 562 nm.
  • mOrange has excitation and emission maxima very close to a newly discovered tetrameric orange FP from Cerianthus 14 and a monomer evolved from aFulgia concinna FP 15 .
  • mOrange is the brightest true monomer in the present series, it does exhibit significant acid sensitivity, with a pKa of 6.5, arid so is not yet optimal when pH insensitivity is required.
  • the popular Aequorea GFP variant EYFP with a pKa of 7.1 16 , has been used successfully as a qualitative fusion tag by many researchers.
  • the Q66S/T/C variants of mRFPl all exhibit emission around 580 nm at neutral pH, but become brighter and more blue-shifted at high pH.
  • the blue-shifted (mOrange) species is stabilized by T41F and L83F mutations, where the red-shifted (mStrawberry) form is favored by S62T, Q64N,, and Q213L.
  • the I197E mutation may contribute a hydrogen bond between the glutamate side chain and phenolate oxygen in the chromophore, resulting in a further redistribution of electron density.
  • bacteria separately transfected with EGFP, Citrine, mBanana, mOrange, mStrawberry, or mCherry were mixed and analyzed by flow cytometry, with excitation at 514 nm and emission simultaneously measured through three bandpass filters, 540-560 nm, 564-606 nm, and 595-635 nm respectively. Transformation of the three signals to polar coordinates, enabled easy discrimination of the six constituent populations and the relative amounts of FP per cell (Figure 52). Thus three simple emission measurements are sufficient.
  • the mutation M163Q When the mutation M163Q is introduced into other variants, such as mOrange and mStrawberry, it also provides a significant increase in photostability, though other properties of these variants, such as the maturation rate and quantum yield, are adversely affected by this mutation.
  • mCherry's quantum efficiency is slightly lower (0.22 vs. 0.25 for mRFPl), its increased extinction coefficient (due to near-complete maturation), tolerance of N-terminal fusions, and photostability make mRFPl obsolete.
  • mOrange is the current favorite (e.g. Fig. 49), though its maturation time, pH sensitivity, and photostability are currently far from optimal. Additional colors for multiwavelength tracking of distinct cells or substructures are available from mStrawberry, mTangerine, mBanana, and mHoneydew in descending order of wavelengths and brightnesses.
  • mRFPl and dimer2 7 were used as the initial templates for construction of genetic libraries by a combination of saturation or partial saturation mutagenesis at particular residues and random mutagenesis of the whole gene. Random mutagenesis was performed by error-prone PCR as described 18 or by using the GeneMorph I or GeneMorph II kit (Stratagene). Mutations at specific residues were introduced as described 7 , or by sequential QuikChange (Stratagene), or by QuikChange Multi (Stratagene), or by a ligation-based method (description follows).
  • oligonucleotide primers containing the degenerate codons of interest at their 5' ends preceded by a Sapl resitriction site were used to amplify the RFP in two separate PCR reactions using PfuTurbo polymerase (Stratagene). Each PCR fragment was cut with Sapl (New England Biolabs) to produce a 3-base overhang compatible with the other digested fragment, and purified digested fragments were ligated with T4 DNA ligase (New England Biolabs). Full length ligation products inserts were gel purified and cut with EcoRI/BamHL (New England Biolabs) and inserted into pRSET B or a modified pBAD vector (Invitrogen).
  • LMGl 94 colonies of interest were cultured for 8 hours in 2 ml RM supplemented with ampicillin and 0.2% D-glucose, and then culture volume was increased to 4 ml with LB/ampicillin and RFP expression was induced by adding L-arabinose to a final concentration of 0.2% and cultures were allowed to continue growing overnight.
  • JM109(DE3) and LMG194 a fraction of the cell pellet was extracted with B-PER ⁇ (Pierce), and spectra were obtained using a Satire 96- well plate reader with monochromators (TECAN, Mannendorf, Switzerland). DNA was purified from the remaining pellet by QIAprep spin column (Qiagen) and submitted for sequencing.
  • dRFP3 was amplified in two separate PCR reactions, the first retaining the 7-residue GFP-type N-terminus (MVSKGEE) but deleting the 7-residue GFP-type C-terminus and adding the first half of the 12-residue linker followed by a Sapl restriction site, and the second adding the remaining half of the 12-residue linker followed by the sequence ASSEDNNMA before residue 7 of dRFP3, and ending with the 7-residue GFP-type C-terminus (GMDELYK).
  • RFPs were expressed from pBAD vectors in E. coli LMGl 94 by growing single colonies in 40 ml RM/Amp supplemented with 0.2% D-glucose for 8 hours, adding 40 ml LB/Amp and adding L- arabinose to a final concentration of 0.2%, and incubating overnight at 37 0 C.
  • flasks were sealed with parafilm upon induction to restrict oxygen availability.
  • AU proteins were purified by Ni-NTA chromatography (Qiagen) and dialyzed into PBS. Biochemical and fluorescence characterization experiments were performed as described 5 .
  • purified Zn 2+ sensor proteins were diluted in 10 mM MOPS, 100 mM KCl, pH 7.4 with either 1 mM EDTA or 1 mM ZnCl 2 and fluorescence emission spectra were collected with excitation near the peak donor excitation wavelength.
  • Fluorescence Activated Cell Sorting A modified version of the protocol described by Daugherty et al. was used for FACS screening of large libraries of FP mutants 28 . Briefly, E. coli LMG194 were electroporated with a modified pBAD vector containing the gene library and the transformed cells were grown in 30 ml RM supplemented with ampicillin and 0.2% D-glucose. After 8 hours, RFP expression was induced by adding L-arabinose to a final concentration of 0.2%. Overnight induced cultures were diluted 1:100 into DPBS supplemented with ampicillin prior to FACS sorting.
  • the absolute excitation irradiance in ⁇ hotons/(cm 2 -s;nm) as a function of wavelength was computed from the spectra of a xenon lamp, the transmission of the excitation filter, the reflectance of the dichroic mirror, the manufacturer-supplied absolute spectral sensitivity of a miniature integrating-sphere detector (SPD024 head and ILC 1700 meter, International Light Corp., Newburyport, MA), and the measured detector current.
  • the predicted rate of initial photon emission was calculated from the excitation irradiance and absorbanee spectrum (both as functions of wavelength), and the quantum yield.
  • Extinction coefficients were measured by the alkali denaturation method and are believed to be more accurate than the previously reported values for DsRed, Tl, dimer2, and mRFPl 7 "Time (s) to bleach to 50% emission intensity, at an illumination level that causes each molecule to emit 1000 photons/sec initially, i.e. before any bleaching has occurred. See Materials and Methods for more details. For comparison, the value for EGFP is 115 sec, assuming an extinction coefficient of 56,000 and quantum efficiency of 0.60. Figure legends referred to in Example 9
  • Figures 47A and 47B Excitation and emission spectra for new RFP variants. Spectra are normalized to the excitation and emission peak for each protein. Excitation (a) and emission (b) curves are shown as solid or dashed lines for mRFPl variants and as a dotted line for dTomato and tdTomato, with colors corresponding to the color of each variant.
  • Figures 48A and 48B Sequences and genealogy, (a) Sequence alignment of new mRFP variants with wild-type DsRed and mRFPl . Internal residues are shaded. mRFPl mutations are shown in blue, and critical mutations in mCherry, mStrawberry, mTangerine, mOrange, mBanana, and mHoneydew are shown in colors corresponding to the color of each variant. GFP-type termini on new mRFP variants are shown in green, (b) A genealogy of DsRed-derived variants, with mutations critical to the phenotype of each new variant.
  • FIG. 49 T-S apphire-mOrange FRET. Emission spectra for 400 run excitation for a zinc-finger fused with mOrange on its N-terminus and T-Sapphire on its C- terminus. Emission in the presence of ImM EDTA in zinc-free buffer is represented by the green line, and emission in the presence of ImM ZnCl 2 is represented by the orange line.
  • Figure 50 Sensitivity to N- and C-terminal fusions.
  • mRFPl and mCherry C-/N-terminal 6xHis tag absorbance spectra.
  • mRFPl and mCherry with N- terminal leader sequence containing a 6xHis tag (derived from pRSET ⁇ ) or C-terminal tail with Myc-tag and 6xHis tag (derived from pBAD-Myc-His-A (Invitrogen)) were purified on Ni-NTA Agarose beads in parallel with extensive washes. Absorbance spectra were taken and normalized to the 280 nm peak for each.
  • Absorbance curves for mRFPl are plotted in red, and those from mCherry are plotted in blue. Solid lines correspond to N-terminal 6xHis-tagged protein, and dotted lines correspond to C-terminal ⁇ xHis-tagged protein. While mRFPl exhibited greatly reduced expression and apparent extinction coefficient (approximately 4-fold lower) when expressed with the C-terminal tag, mCherry produced nearly identical results with either N-terminal or C-terminal tags.
  • Figure 52 Discrimination of E. coli transfected with six different FPs.

Abstract

La présente invention concerne, de manière générale, des protéines fluorescentes et des variantes de protéines fluorescentes et, de manière plus spécifique, des formes monomériques et dimériques de protéines fluorescentes d'anthozoaires. Selon un aspect, cette invention concerne des variantes de protéines fluorescentes, lesdites variantes ayant une propension réduite à se tétramériser et formant des structures monomériques ou dimériques. Selon un autre aspect, ladite invention concerne des variantes de protéines fluorescentes, lesdites variantes étant caractérisées par une maturation plus efficace que celle des protéines fluorescentes correspondantes dont ces variantes sont dérivées. Cette invention concerne également des procédés de production et d'utilisation desdites protéines fluorescentes et variantes de protéines fluorescentes, y compris de monomères et dimères de protéines fluorescentes.
PCT/US2005/030793 2004-08-27 2005-08-26 Variantes de proteines fluorescentes monomeriques et dimeriques et procedes de production desdites variantes WO2006024041A2 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US92936204A 2004-08-27 2004-08-27
US10/929,362 2004-08-27
US10/931,304 US7687614B2 (en) 2001-02-26 2004-08-30 Monomeric and dimeric fluorescent protein variants and methods for making same
US10/931,304 2004-08-30

Publications (2)

Publication Number Publication Date
WO2006024041A2 true WO2006024041A2 (fr) 2006-03-02
WO2006024041A3 WO2006024041A3 (fr) 2007-07-26

Family

ID=35968346

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/030793 WO2006024041A2 (fr) 2004-08-27 2005-08-26 Variantes de proteines fluorescentes monomeriques et dimeriques et procedes de production desdites variantes

Country Status (1)

Country Link
WO (1) WO2006024041A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102008024567A1 (de) * 2008-05-21 2009-12-03 Georg-August-Universität Göttingen Stiftung Öffentlichen Rechts Universitätsmedizin Verfahren zur Messung einer Konzentration einer Messsubstanz in einer biologischen Probe
US8647887B2 (en) 2009-01-29 2014-02-11 Commonwealth Scientific And Industrial Research Organisation Measuring G protein coupled receptor activation
WO2015021143A1 (fr) * 2013-08-06 2015-02-12 Georgia State University Research Foundation, Inc. Capteurs d'ions métalliques et procédés de détection d'ions métalliques
CN109239037A (zh) * 2018-09-28 2019-01-18 长沙理工大学 基于MOFs作为能量受体的生物传感器及其制备方法和应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000034326A1 (fr) * 1998-12-11 2000-06-15 Clontech Laboratories, Inc. Proteines fluorescentes non bioluminescentes d'especes anthozoaires, genes codant ces proteines et leurs utilisations
US6852489B2 (en) * 2000-09-21 2005-02-08 National Food Research Institute Simple and quick method for determining the nucleotide sequence of a mitochondrial 21S ribosomal RNA gene of yeast belonging to Saccharomyces cerevisiae
US7005511B2 (en) * 2001-02-26 2006-02-28 The Regents Of The University Of California Fluorescent protein variants and methods for making same

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000034326A1 (fr) * 1998-12-11 2000-06-15 Clontech Laboratories, Inc. Proteines fluorescentes non bioluminescentes d'especes anthozoaires, genes codant ces proteines et leurs utilisations
US6852489B2 (en) * 2000-09-21 2005-02-08 National Food Research Institute Simple and quick method for determining the nucleotide sequence of a mitochondrial 21S ribosomal RNA gene of yeast belonging to Saccharomyces cerevisiae
US7005511B2 (en) * 2001-02-26 2006-02-28 The Regents Of The University Of California Fluorescent protein variants and methods for making same

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102008024567A1 (de) * 2008-05-21 2009-12-03 Georg-August-Universität Göttingen Stiftung Öffentlichen Rechts Universitätsmedizin Verfahren zur Messung einer Konzentration einer Messsubstanz in einer biologischen Probe
US8647887B2 (en) 2009-01-29 2014-02-11 Commonwealth Scientific And Industrial Research Organisation Measuring G protein coupled receptor activation
WO2015021143A1 (fr) * 2013-08-06 2015-02-12 Georgia State University Research Foundation, Inc. Capteurs d'ions métalliques et procédés de détection d'ions métalliques
US10371708B2 (en) 2013-08-06 2019-08-06 Georgia State University Research Foundation, Inc. Metal ion sensors and methods of detecting metal ions
CN109239037A (zh) * 2018-09-28 2019-01-18 长沙理工大学 基于MOFs作为能量受体的生物传感器及其制备方法和应用
CN109239037B (zh) * 2018-09-28 2021-03-26 长沙理工大学 基于MOFs作为能量受体的生物传感器及其制备方法和应用

Also Published As

Publication number Publication date
WO2006024041A3 (fr) 2007-07-26

Similar Documents

Publication Publication Date Title
US7906636B2 (en) Monomeric and dimeric fluorescent protein variants and methods for making same
US7329735B2 (en) Fluorescent protein variants and methods for making same
US7157566B2 (en) Monomeric and dimeric fluorescent protein variants and methods for making same
EP1994149B1 (fr) Nouvelles protéines fluorescentes et procédés d'utilisation de celles-ci
JP2005501525A (ja) リン酸化の蛍光比測定インディケーター
US6852849B2 (en) Non-oligomerizing tandem fluorescent proteins
US8481307B2 (en) Modified fluorescent proteins and methods for using same
EP1565559B1 (fr) Proteines fluorescentes et chormoproteines provenant d'especes autres que l'espece aequorea hydrozoa et procedes d'utilisation de ces proteines
EP1576157B1 (fr) Proteines fluorescentes fabriquees a partir de copepodes et procedes d'utilisation correspondants
EP1997885A1 (fr) Protéines flourescentes et leurs utilisations
WO2006024041A2 (fr) Variantes de proteines fluorescentes monomeriques et dimeriques et procedes de production desdites variantes
JP5265491B2 (ja) モノマーおよびダイマー蛍光タンパク質変異体および上記変異体を作製する方法
US8563703B2 (en) Fluorescent proteins and methods for using same
Shaner Engineering novel fluorescent proteins

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase