WO2006012906A1 - Systeme d'expression vegetale derive du virus a arn - Google Patents

Systeme d'expression vegetale derive du virus a arn Download PDF

Info

Publication number
WO2006012906A1
WO2006012906A1 PCT/EP2003/012530 EP0312530W WO2006012906A1 WO 2006012906 A1 WO2006012906 A1 WO 2006012906A1 EP 0312530 W EP0312530 W EP 0312530W WO 2006012906 A1 WO2006012906 A1 WO 2006012906A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
replicon
rna
sequence
sequences
Prior art date
Application number
PCT/EP2003/012530
Other languages
English (en)
Inventor
Sylvestre Marillonnet
Carola Thoeringer
Victor Klimyuk
Yuri Gleba
Original Assignee
Icon Genetics Ag
Icon Genetics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icon Genetics Ag, Icon Genetics, Inc. filed Critical Icon Genetics Ag
Priority to PCT/EP2003/012530 priority Critical patent/WO2006012906A1/fr
Priority to DK04797791.3T priority patent/DK1682667T3/da
Priority to EP04797791A priority patent/EP1682667B1/fr
Priority to AU2004291658A priority patent/AU2004291658B2/en
Priority to DE602004027403T priority patent/DE602004027403D1/de
Priority to EP10000553.7A priority patent/EP2184363B1/fr
Priority to MXPA06003715A priority patent/MXPA06003715A/es
Priority to ES04797791T priority patent/ES2346224T4/es
Priority to CA2541294A priority patent/CA2541294C/fr
Priority to AT04797791T priority patent/ATE469231T1/de
Priority to PCT/EP2004/012743 priority patent/WO2005049839A2/fr
Priority to JP2006538788A priority patent/JP5096743B2/ja
Priority to US10/578,962 priority patent/US9267143B2/en
Publication of WO2006012906A1 publication Critical patent/WO2006012906A1/fr
Priority to IL173859A priority patent/IL173859A/en
Priority to JP2010211319A priority patent/JP2011024591A/ja
Priority to US14/988,092 priority patent/US10287602B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8203—Virus mediated transformation

Definitions

  • the present invention relates to the plant, plant parts or plant cell cultures having a heterologous DNA encoding an RNA replicon for expressing a sequence of interest.
  • the invention also provides a process of expressing a sequence of interest in the plants, plant parts or plant cell cultures of the invention.
  • the process and vectors provide the plant cells with an increased frequency of RNA virus-derived RNA replicon formation.
  • Said heterologous DNA or part(s) thereof can be stably incorporated into the plant nuclear chromosomal or episomal DNA or transiently delivered as DNA molecule(s).
  • the system that is based on stable incorporation of said precursor vector into plant chromosomal DNA is tightly controllable and allows for leakage-proof (zero expression level in non-induced state) control over the expression of gene of interest.
  • virus-based expression systems can be used for rapid protein production in plants (for review see: Porta & Lomonossoff, 1996, MoI. Biotechnol., EL 209-221 ; Yusibov et al., 1999, Curr.Top. Microbiol. Immunol., 240.
  • transient plant virus-based expression systems are generally restricted to specific hosts, which may not be suitable for large scale cultivation due to their susceptibility to environmental factors. Moreover, they are generally restricted to certain parts of a plant host, thus excluding most of the plant biomass from the production process and as a result minimizes the relative yield of recombinant product per unit of plant biomass down to a level comparable to that achievable by a conventional transcription promoter in a transgenic plant;
  • expression of the protein or product of interest should be switchable such that expression can be switched on at a desired point in time.
  • the switching should be such that expression can be switched on simultaneously or nearly simultaneously in all tissues or cells of a plant and, at the same time, in all plants of a selected group of plants, e.g. in all plants of a selected lot of plants.
  • the protein or product of interest accumulates in each cell producing said product or protein up to a certain point.
  • degradative processes frequently set on that tend to reduce the yield or quality of the protein or product of interest. Therefore, there is an optimal point in time after switching on expression, where the product or protein of interest should be harvested. This optimal point in time should be reached in all tissues or cells of a plant and in all plants of a selected lot at the same time to make the overall process efficient and profitable.
  • a stably transformed plant, plant part, or plant cell culture containing in cell nuclei a heterologous DNA having a sequence encoding an RNA replicon operably linked or linkable to a transcription promoter, wherein said sequence encoding an RNA replicon contains (i) sequences for replicon function of said RNA replicon, said sequences being derived from a sequence of a plant RNA virus, and (ii) a sequence of interest to be expressed from said RNA replicon, whereby said sequences for replicon function correspond to sequences of said plant RNA virus and exhibit at selected localities of said sequence of said plant RNA virus function- conservative differences from said sequence of said plant RNA virus, said differences causing an increased frequency of replicon formation compared to an RNA replicon not exhibiting said differences.
  • a process of expressing a sequence of interest in a plant, plant part, or plant cell culture comprising:
  • the invention further provides a nucleic acid molecule for producing said plant, plant part, or plant cell culture of the invention or for carrying out the process of the invention.
  • Said nucleic acid molecule is as defined in the claims and as further defined as described below with reference to the plant, plant part of plant cell culture of the invention.
  • RNA-viral replicons in nuclear chromosomes of plants or plant parts for expressing a protein of interest encoded in said RNA replicon
  • the frequency with which RNA replicons appeared in the cytosol was very low and occurred only in a small fraction of cells containing the heterologous DNA. Accordingly, the expression level of the protein of interest was also very low.
  • Many possible reasons for this problem were considered including positional effects of the chromosome, unsuitable transcription regulatory elements, gene silencing, defective transport of the replicon from the nucleus to the cytosol, a deleterious effect of the sequence of interest on transcription, RNA processing or replicon function etc.
  • the efficiency of the present invention is such that a new dimension in plant expression systems is attained.
  • the expression levels achievable with the present invention are such that expenditures for downstream processing (including separation and purification of the protein of interest) are low enough to make the process of the invention competitive with other large-scale expression systems.
  • the expression level is low even if virus-based vectors are used, since replicons are produced in a small fraction of the cells. Replicons that spread in the plant cannot remedy this problem, as spreading is slow, notably over long distances. Therefore, expression does not proceed uniformly in the plant and degradation of the protein of interest will already take place in some parts of the plant while in others protein expression has not even started.
  • the invention allows to trigger expression uniformly throughout the plant.
  • the small fraction of cells that do not produce a replicon can be quickly infected by replicons from neighbouring cells.
  • the invention provides the first high- yield plant expression system that can be used on large scale. The invention even allows to produce two or more replicons in the same cell, whereby probability of having both replicons in the same cells is still very high. Further, the efficiency of the expression system of the invention is such that the otherwise limited plant specificity of RNA viruses is reduced.
  • the stably transformed plant, plant part, or plant cell culture and said nucleic acid molecule have a heterologous DNA encoding an RNA replicon.
  • Said sequence encoding an RNA replicon contains (i) sequences for replicon function of said RNA replicon, said sequences being derived from a sequence of a plant RNA virus, and (ii) a sequence of interest to be expressed from said RNA replicon.
  • Said sequences for replicon function contain a sequence of interest to be expressed from said RNA replicon (ii).
  • Said sequence of interest to be expressed may lead to formation of an RNA of interest, like an RNA for RNA interference for suppressing a function of said plant.
  • said sequence of interest codes for a protein of interest and contains regulatory sequences for translating said protein of interest from said RNA replicon or from subgenomic RNA or said RNA replicon.
  • Said sequences for replicon function of said RNA replicon correspond to sequences of said plant RNA virus inter alia in that the former are a DNA copy of the latter.
  • Said sequences for replicon function provide the RNA replicon with the function to replicate in the cytosol.
  • Said sequences for replicon function typically code for one or more proteins involved in replication like an RNA-dependent RNA polymerase (replicase).
  • Said sequences for replicon function may further code for functions of an RNA replicon like one or more proteins involved in cell-to-cell or systemic spreading of an RNA virus in a plant like a movement protein or a coat protein.
  • Said sequences for replicon function are preferably derived from a sequence of a plant RNA virus, since plant RNA viruses are an easily accessible source for replicon functions.
  • "Being derived” means that said sequences for replicon function are a DNA copy of the corresponding sequences of said RNA virus and said DNA copy makes up a part of said heterologous DNA contained in cell nuclei.
  • "Being derived” further means that said sequences for replicon function are not an exact DNA copy of the corresponding RNA sequence of said RNA virus, but exhibit function-conservative differences as described below. Since said differences are function- conservative, said sequences for replicon function preferably code for proteins capable of carrying out replicon functions similarly as they do for said RNA virus.
  • Said sequences for replicon function exhibit at selected localities of said sequence of said plant RNA virus function-conservative differences relative to said sequence of said plant RNA virus, said differences causing an increased frequency of replicon formation compared to an RNA replicon not exhibiting said differences.
  • Said differences are causal for said increased frequency of replicon formation in plant cells, once the overall process has been switched on (see below).
  • the causal connection between the increased frequency of replicon formation and said differences can be tested experimentally by comparing the frequency of replicon formation between sequences for replicon function having said differences and sequences for replicon function not having said differences.
  • Such an experimental comparison can be made e.g. by counting protoplasts expressing said sequence of interest as described in the examples.
  • a sequence of interest coding for an easily detectable reporter protein like green fluorescent protein (GFP) is used for this purpose.
  • GFP green fluorescent protein
  • Said function-conservative differences are introduced into said sequences for replicon function at selected localities of said sequence of said plant RNA virus.
  • Said selected localities are localities in sequences for replicon function of said plant RNA virus that are responsible for a low probability of an RNA replicon transcribed in the nucleus to appear in the cytosol as a functional replicon.
  • such selected localities have a high A/T(U)-content, i.e. a high A-content and/or a high T-content (a high U-content on RNA level), or have cryptic splicing sites, i.e. sequence portions that are recognized by the nuclear splicing machinery as splicing sites.
  • Said selected localities may be identified in an RNA virus on which an RNA replicon is based by analyzing the RNA profile of the RNA virus as exemplified below. Further, selected localities may be identified experimentally by analyzing the RNA formed in a plant cell after transformation with a heterologous DNA encoding an RNA replicon that does not exhibit the differences according to the invention. This experimental analysis may be done by RT-PCR, preferably together with sequencing of the RT-PCR products. In this way, undesired splicing products that indicate splicing events destroying the RNA replicon may be identified. Further, the exact sites of undesired splicing may be identified and then remedied by introducing said function-conservative differences at said selected localities.
  • Said function-conservative differences cause an increased frequency of RNA replicon formation by suppressing the deleterious effect of said selected localities on said frequency of RNA replicon formation.
  • Said function-conservative differences may comprise a reduction of a high A/U-content in said RNA replicon by reducing a high A/T content in said sequences for replicon function of said sequence encoding said RNA replicon.
  • Said high A/U content may be reduced by at least partial deletion or at least partial replacement by G/C bases (e.g. using the degeneracy of the genetic code), provided said differences are function-conservative.
  • cryptic splicing sites flanking A/U-rich regions of said sequences derived from a plant RNA virus may be removed.
  • Such function-conserved differences may be introduced at one or at, preferably, several selected localities.
  • Preferred function-conservative differences comprise the insertion of one or more introns, most preferably nuclear introns, or one or more sequences capable of forming nuclear introns near or within A/U-rich localities of said sequences being derived from sequences of said plant RNA virus. It has surprisingly been found that the introduction of introns at or near A/U-rich localities results in an increased frequency of RNA replicon formation.
  • introns may be introduced and examples are given herein for various numbers of introduced introns. The effects of more than one intron are cumulative. Further, intron insertion may be combined with other function-conservative differences at other selected localities. Fig.
  • the intron is formed from two intron halfs upon recombinase-catalyzed flipping of a part of said heterologous DNA.
  • This principle may also be applied to sequences for replicon function of said RNA replicon.
  • recombination between said two different replicons may result in the formation of an intron from two intron halfs present on different replicons.
  • an RNA replicon may be formed by recombination between two precursors, neither of which is a replicon.
  • an intron may be assembled from two intron halfs derived from different precursor molecules.
  • Said plant, said plant part, or said plant cell culture of the invention are stably transformed with said heterologous DNA.
  • Stably transformed means that they contain said heterologous DNA in cell nuclei such that said heterologous DNA is maintained in said cell nuclei as nuclear chromosomes are maintained.
  • Said heterologous DNA may be contained in or may be an episomal element.
  • said heterologous DNA is stably incorporated in a nuclear chromosome such that it can be inherited to progeny cells or progeny plants.
  • all cells of said plant, said plant part or said cell culture contain in their nuclei said heterologous DNA for giving a high yield of a protein of interest. More preferably, said cells contain said heterologous DNA stably integrated in a nuclear chromosome. In the case of a plant, this means that the plant is a transgenic plant.
  • Said heterologous DNA having said sequence encoding said RNA replicon is operably linked or linkable to a transcription promoter.
  • the transcription promoter is preferably a regulated promoter, like an inducible, tissue-specific or developmentally regulated promoter in order to make expression of said sequence of interest regulatable. More preferably, said promoter is inducible or developmentally regulated, which allows that expression is induced at a desired time or that expression is switched on when the plant reaches a defined developmental stage, respectively. For example, expression of said sequence of interest can be switched on in plant seeds if said promoter is a seed-specific promoter.
  • the invention is of high value for providing specific tissues (e.g.
  • RNA replicons whereby said tissues may be less suited for cell-to-cell spread of said replicon than e.g. leaf tissue.
  • RNA replicons Most preferred are chemically regulated promoters, since they allow to switch on expression at will in all or in most tissues of a plant.
  • chemically inducible promoters are the promoters of choice for large scale applications, since the chemical inducer can be applied to a large number of plants at the same time. Examples of regulated promoters are known in the art.
  • Said sequence encoding an RNA replicon may alternatively be operably linkable to a transcription promoter, which allows to switch on expression of said sequence of interest by operably linking said sequence encoding an RNA replicon with a promoter.
  • a transcription promoter which allows to switch on expression of said sequence of interest by operably linking said sequence encoding an RNA replicon with a promoter.
  • Said sequence block may be flanked by recombination sites such that said block can be cut out by a recombinase recognizing said recombination sites.
  • operable linkage for transcription of said sequence encoding an RNA replicon can be established and expression may be switched on.
  • Another option is to have a portion of a sequence necessary for transcription (e.g. a promoter or promoter portion) in flipped orientation and flanked by recombination sites. Providing a suitable recombinase may flip said sequence portion back in correct orientation, whereby an operable linkage can be established.
  • said sequence encoding an RNA replicon has one or more segments that code together for said RNA replicon, i.e. said RNA replicon is not encoded by one continuous DNA. Instead, said RNA replicon is encoded discontinuously by two or more segments, whereby said segments may be present on the same chromosome preferably contiguous to each other. Formation of said RNA replicon may then require rearrangement of said segments, e.g. by recombination. As an example, a part of a sequence for replicon function (e.g.
  • a part of a sequence coding for a replicase may be present in said heterologous DNA in a flipped orientation relative to other parts of such a sequence.
  • the flipped part may be flanked by recombination sites.
  • the transcript of the heterologous DNA will not be a replicon, since said replicon function cannot be provided (e.g. because the transcript does not code for a functional replicase).
  • Providing a site-specific recombinase recognizing the recombination sites can flip one of said segments back such that a replicon function is encoded continuously.
  • providing the recombinase may function as a switch for switching on replicon formation and expression of a sequence of interest (see further below).
  • said segments may be present on different chromosomes. Formation of an RNA replicon will then require transcription of both segments and trans-splicing of both transcripts for assembling said RNA replicon.
  • This embodiment may be used for quickly segregating the segments that encode together said RNA replicon in progeny plants or cells as described in detail in PCT/EP03/02986.
  • the process of the invention comprises said steps (a) and (b).
  • Step (a) may comprises stable or transient transformation of a plant, plant part or plant cell culture with said nucleic acid of the invention.
  • stable transformation of a nuclear chromosome is preferred.
  • the process of the invention is a process of expressing a protein of interest encoded by said sequence of interest.
  • Step (b) comprises causing expression of said sequence of interest, e.g. switching on said expressing.
  • Various methods of causing or switching on expression have already been mentioned.
  • Examples include inducing an inducible promoter operably linked to said heterologous DNA; bringing said heterologous DNA under operable linkage to a promoter using recombination; establishing continuous coding of a sequence for replicon formation using recombination etc.
  • said recombinase may be provided to said plant, plant part or plant cell culture transiently, whereby said providing would act as a switch for step (b).
  • said recombinase may be stably encoded in cells, and expressing of the recombinase under control of a regulated, preferably inducible, promoter. Inducing recombinase expression by inducing said promoter may then cause expression in step (b).
  • the process of the invention is performed with many plants in parallel by providing many plants according to (a) and causing expression of said sequence of interest according to (b) with all plants in one step, e.g. by applying a chemical inducer for a chemically inducible promoter to all plants for example by spraying.
  • the present invention may in principal be applied to any plants for which infectious RNA viruses exist. Suitable plant/RNA virus pairs may be derived from the list of RNA viruses given below. Due to the very high efficiency of replicon formation according to the invention, the plant species specificity of plant viruses is far less pronounced when this invention is practiced. Similarly, the present invention may be used with RNA replicons based on any RNA virus. RNA viruses have generally evolved outside the cell nuclei of their host plants and will have selected localities that make a replicon based on such a virus inefficient when the replicon is produced inside cell nuclei, notably if the replicon is stably encoded in a nuclear chromosome.
  • the invention can be applied to all RNA viruses, although the level of improvement may vary between different plant RNA viruses.
  • the most preferred plant RNA viruses the invention may be based on are tobamoviruses, notably tobacco mosaic virus, and Potexviruses such as potato virus X.
  • tobacco mosaic virus it will generally be the coat protein that is replaced by said sequence to be expressed.
  • the movment protein may be removed or replaced by a sequence to be expressed.
  • an RNA replicon derived from tobacco mosaic virus should code for the movement protein and have the coat protein be replaced by said sequence to be expressed.
  • the major application of the present invention is the production of a protein of interest in plants, plant parts or plant cell cultures. If the process of the invention is performed in plants, plants that do not enter the human or animal food chain are preferred, like Nicotiana species. Plant parts are e.g. plants organs or specific tissues of plants like leaves or seeds. Herein, seeds are considered as plant parts if the process of invention is done in seeds growing or being attached to a parent plant. Seeds are, however, also considered to be plants, albeit in a certain developmental stage of a plant. Most preferably, the plants of the invention are sold or distributed as seeds, the seeds are grown to plants, and expression of said sequence of interest is induced or switched on at a desired point in said plants.
  • Fig. 1 depicts the general principle of the invention, based on increased frequency of
  • RNA virus-based replicon formation RNA virus-based replicon formation.
  • Fig. 2 shows the intron prediction profile of transcribed region of vector plCH8543.
  • Nucleotide numbers are given on the horizontal axis.
  • the vertical axis shows the probability for corresponding sequence/sequence region to be a coding sequence
  • Fig. 3 shows the intron prediction profile of transcribed region of vector plCH15466, first half of the transcribed region.
  • the circled regions were modified (compare Fig. 2A) as described in this invention.
  • Fig. 4 shows the intron prediction profile of transcribed region of plCH1590, second half of said region.
  • the circled regions were modified (compare with Fig. 2B) as described in this invention.
  • Fig. 5 shows the intron prediction profile of transcribed region of plCH15499.
  • the circled regions correspond to six inserted plant nuclear introns.
  • Fig. 6 depicts schematic representations of viral constructs vectors unmodified and modified according to the scope of said invention.
  • Fig. 7 shows GFP expression after agroinfiltration of the viral constructs in Nicotiana benthamiana and Nicotiana tabacum leaves. The vector identification number for each infiltrated area is indicated.
  • Fig. 8 depicts the schematic presentation of RNA virus-based replicon precursor designed according to the present invention, which gives zero expression level of the gene of interest (GFP, indicated by G) in the non-induced state.
  • P - transcription promoter P - transcription promoter; T - transcription termination region; SM - selectable marker gene; Ac2 - promoter of Arabidopsis ACTIN2 gene; RdRP viral RNA-dependent RNA polymerase; MP - viral movement protein; NTR - viral 3' non-translated region.
  • Fig. 9 shows the intron prediction profile for Arabidopsis thaliana meiosis-specific gene
  • AtDMCI GenBank Acc.No U76670
  • the intron-coding regions are circled.
  • Fig. 10 shows the prediction of potential problematic regions (circled) within the direct strand (+ strand) of Potato Virus X (PVX) genome (GenBank Ace. No. AF172259).
  • Fig. 11 shows in A, B, and C the prediction of potential problematic regions (circled) of the direct strand (+ strand) of alfalfa mosaic virus genomes of RNA1 (GenBank Ace. No
  • RNA2 GenBank Ace. No K02702
  • RNA3 GenBank Ace. No L00163
  • intron inclusion can increase the frequency of replicon formation from a viral cDNA clone.
  • intron-less, intron-containing cDNA and wild type lettuce mosaic virus (LMV) (Yang ef al., 1998, Arch. Virol., 143, 2443-2451 ).
  • LMV lettuce mosaic virus
  • the present invention provides a method for increasing fundamentally the frequency of RNA virus-derived replicon formation, said replicons are derived upon transcription of DNA precursor and designed for the expression of sequences of interest.
  • Said method overcomes the limitations of existing viral vector-based expression systems, such as size limitation for heterologous sequences to be expressed and high instability of said vectors. Further, said method offers better biosafety characteristics, allows to design leakage-proof control over the transgene expression (zero expression level in non- induced state), as such design can be an integrated part of the strategy for said RNA virus-derived replicon design.
  • RNA virus-derived replicon formation By providing high frequency of RNA virus-derived replicon formation, the approach described herein allows for a rapid initiation of the expression of a sequence of interest in a whole plant, part of plant or plant cell culture containing in cell nuclei a heterologous DNA encoding said RNA replicon.
  • the performance of practically any plant RNA virus-derived replicon designed for the expression of a heterologous sequence of interest can be improved significantly through dramatic increase of the frequency of replicon formation.
  • RNA viruses belonging to different taxonomic groups are suitable for constructing RNA replicons according to this invention.
  • a list of RNA viruses to which this invention can be applied, is presented below. Taxa names in quotes (and not in italic script) indicate that this taxon does not have an ICTV international approved name. Species (vernacular) names are given in regular script. Viruses with no formal assignment to genus or family are indicated):
  • RNA Viruses Family: Bromovihdae, Genus: Alfamovirus, Type species: alfalfa mosaic virus, Genus: llarvirus, Type species; tobacco streak virus, Genus: Bromovirus, Type species: brome mosaic virus, Genus: Cucumovirus, Type species: cucumber mosaic virus;
  • Rymovirus Type species: ryegrass mosaic virus, Genus: Bymovirus, Type species: barley yellow mosaic virus;
  • Genus Carlavirus, Type species: carnation latent virus; Genus: Enamovirus, Type species: pea enation mosaic virus,
  • Genus Furovirus, Type species: soil-borne wheat mosaic virus, Genus: Hordeivirus, Type species: barley stripe mosaic virus, Genus: Idaeovirus, Type species: raspberry bushy dwarf virus;
  • Genus Luteovirus, Type species: barley yellow dwarf virus; Genus: Marafivirus, Type species: maize rayado fino virus; Genus: Potexvirus, Type species: potato virus X;Genus: Sobemovirus, Type species: Southern bean mosaic virus, Genus: Tenuivirus, Type species: rice stripe virus,
  • Genus Tobamovirus, Type species: tobacco mosaic virus,
  • Genus Tobravirus, Type species: tobacco rattle virus,
  • Genus Trichovirus, Type species: apple chlorotic leaf spot virus; Genus: Tymovirus, Type species: turnip yellow mosaic virus; Genus: Umbravirus, Type species: carrot mottle virus; Negative ssRNA Viruses: Order: Mononegavirales, Family: Rhabdoviridae, Genus: Cytorhabdovirus, Type Species: lettuce necrotic yellows virus, Genus: Nucleorhabdovirus, Type species: potato yellow dwarf virus;
  • Negative ssRNA Viruses Family: Bunyaviridae, Genus: Tospovirus, Type species: tomato spotted wilt virus; dsRNA Viruses: Family: Partitiviridae, Genus: Alphacryptovirus, Type species: white clover cryptic virus 1 , Genus: Betacryptovirus, Type species: white clover cryptic virus 2, Family: Reoviridae, Genus: Fijivirus, Type species: Fiji disease virus, Genus: Phytoreovirus, Type species: wound tumor virus, Genus: Oryzavirus,Type species: rice ragged stunt virus;
  • Unassigned Viruses Genome: ssRNA, Species Garlic viruses A 1 B 1 C 1 D, Species grapevine fleck virus, Species maize white line mosaic virus, Species olive latent virus 2, Species: ourmia melon virus, Species Pelargonium zonate spot virus.
  • RNA viruses (an exception are viroids - small non-coding RNAs amplifying in plant cell nuclei - for a review see Diener, T.O., 1999, Arch. Virol. Suppl., 15, 203-220; Flores, R., 2001 , CR Acad. Sci. Ill, 324, 943-952) never occur in the plant nucleus, but in the cytoplasm. Therefore, the sequences of RNA viruses might not be adapted to withstand nuclear RNA processing events due to the presence of motifs that might be involved in complex series of processing steps including transport of processed RNA in cytoplasm, in which pre-mRNAs, rRNA and tRNA precursors are involved.
  • the splicesome carries out the splicing reaction in two consecutive steps: the first one - cleavage at the 5' splice site of upstream exon/intron junction leading to lariat formation, and second step - cleavage at the 3' splice site of intron/downstream exon junction followed by upstream and downstream exons ligation (for review see: Kramer, A., 1996, Annu.Rew. Biochem., 65, 367-409; Simpson.GG. & Filipowicz, W. 1996, Plant. MoI. Biol., 3JL 1-41 ).
  • the 5' and 3' splice site dinucleotides (5'/GU; AG/3') flanking the intron sequences are highly conserved in higher plants and single G replacement might abandon the splicing activity at the site concerned.
  • heterologous introns in plants are usually not spliced or spliced incorrectly (van Santen, VL. et al., 1987, Gene, 5JL 253-265; Wiebauer, K., Herrero, JJ., Filipowicz, W. 1988, MoI. CeI. Biol., 8, 2042-2051).
  • RNA transcripts encoded by nuclear genes are evolutionary adapted to preserve their functionality, despite of series of RNA modifications taking place in the nucleus.
  • modifications can have dramatic consequences for viral RNA replicon formation.
  • Re-engineering of the plant virus in order to make expression vectors for heterologous genes might further add to the instability of RNA virus-based replicons, as it would add further elements that might interact with RNA sequences of viral origin, producing defective RNA that is unable to replicate.
  • RNA virus-derived sequences shall be the most profound solution for increasing the efficiency of RNA virus-based replicons.
  • the modifications might be direct (e.g. within said RNA virus-derived sequences) or indirect (e.g. within the sequences of non-viral origin), but said indirect modifications may have a stabilizing effect on the sequences of viral origin.
  • modifications within the RNA virus derived sequences as they are crucial for increasing the efficiency of RNA replicon formation.
  • RNA profile for example by replacing intron-like sequences with exon-like ones, e.g.
  • introns unlike exons, are usually A/U rich (Csank, C. et ai, 1990, Nucl. Acid Res., 18, 5133- 5141 ;Goodall & Filipowicz, 1989, Ce//, 58, 473-483), but there are exceptions, for example when in monocotyledonous plants G/C rich introns were found (G ⁇ odall & Filipowicz, 1989, Ce//, 58, 473-483; Goodall & Filipowicz, 1991 , EMBO J., 10, 2635-2644).
  • the A/U rich regions include not only prolonged stretches of the sequences of at least 20 nucleotides in length with at least 55% or more of A/U content, but also shorter stretches ("islands") of 6-19 nucleotides in a row of purely A/U-containing sequences.
  • the A/U content within this invention means that all sequences which are more A- than U-rich, or only A-rich and vice-versa are covered by this definition.
  • EXAMPLE 2 we demonstrate that the modification of A/U rich region increases the number of GFP expressing cells at least 10-folds.
  • Such a high efficiency of replicon formation opens the door for expressing two or more different genes from two different RNA replicons within the same plant cell, e.g. co- expressing different genes by using plant RNA virus based vectors.
  • the achievement of synchronized release of two or more replicons at same time in the same cell is crucial for such co-expression, as the principle "first come, first served" is especially true for viral vectors. Systemic or cell-to-cell movement does not help, as different viral vectors do normally not overlap in their areas of spread or such overlap is insignificant. Simple calculations demonstrate the importance of the technology described in this invention for achieving co-expression of two sequences of interest in the same plant cell from two replicons.
  • the proportion of cells having the functional replicon reaches ca. 90% (Fig. 7C, top right).
  • RNA replicon function-conserative differences in a heterologous sequences of interest to be expressed from said RNA replicon might also be used to increase the frequency of RNA replicon formation, notably in combination with differences in sequences for replicon function. For example, modifications within said sequences of interest can be introduced that are necessary for formation and/or processing of said replicon.
  • the frequency of replicon formation was improved by inserting nuclear introns in said sequences for replicon function (EXAMPLE 4).
  • the incorporation of introns into the coding region of viral RNA-dependent RNA polymerase (RdRP) resulted in a significant (at least 50-fold) increase in the frequency of replicon formation from (Fig. 7A,B) modified vectors (plCH15034, plCH15025, plCH15499 in Fig. 6 A 1 B).
  • the RNA profile for a vector containing 6 inserted introns from Arabidopsis is shown in Figure 5.
  • insertion of introns in MP sequences increases the frequency of replicon formation at least 100 times.
  • introns can be used to practice this invention.
  • examples of such introns include but are not limited to the introns from rice tpi Act1,and salT genes (Rethmeier et al., 1997, Plant J., 12. 895-899; Xu et al, 1994, Plant Physiol., 100, 459- 467; McElroy et al., 1990, Plant Cell, 2, 163-171); from the maize Adh1 , GapA1 , actin and Bz1 genes (Callis et al., 1987, Genes De v., 1, 1183-11200; Donath et al., 1995, Plant MoI.
  • Synthetic introns can also be used for this invention.
  • the smallest usable introns or their parts may be limited to splice donor and acceptor sites which usually flank the internal intron sequences.
  • the introns should have a size of at least 50 nt, more preferably a size of 100 to 200 nt, but actually there are no limitations regarding the size of the introns.
  • the size of the construct should be kept suitable for manipulations.
  • the origin of the intron, its structure and size may be selected individually depending on the nature of the vector. Transient expression experiments may be used for testing the efficiency of a chosen intron or the corresponding intron parts.
  • Said vectors may be transformed into plant cells by a Ti-plasmid vector carried by Agrobacte ⁇ um (US 5,591 ,616; US 4,940,838; US 5,464,763) or particle or microprojectile bombardment (US 05100792; EP 00444882B1 ; EP 00434616B1).
  • Other plant transformation methods can also be used like microinjection (WO 09209696; WO 09400583A1 ; EP 175966B1), electroporation (EP00564595B1 ; EP00290395B1 ; WO 08706614A1) or PEG-mediated transformation of protoplasts etc.
  • the choice of the method for vector delivery may depend on the plant species to be transformed. For example, microprojectile bombardment is generally preferred for monocot transformation, while for dicots, i4grobacte/7um-mediated transformation gives better results in general.
  • Agrobacterium-mediated delivery of vectors into Nicotiana cells.
  • said vectors may be introduced into the plants in accordance with any of the standard techniques suitable for stable or transient transformation of the plant species of interest. Transformation techniques for dicotyledonous are well known in the art and include Agrobacterium-based techniques and techniques which do not require Agrobacte ⁇ um.
  • Non-Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. These techniques include PEG or electroporation mediated uptake, particle bombardment-mediated delivery and microinjection.
  • /Agrabactera//77-rnediated transformation is a preferred technique for the transformation of dicotyledons because of its high transformation efficiency and its broad utility with many different species.
  • the many crop species which may be routinely transformed by Agrobacte ⁇ um include tobacco, tomato, sunflower, cotton, oilseed rape, potato, soybean, alfalfa and poplar (EP 0 317 511 (cotton), EP 0 249 432 (tomato), WO 87/07299 (Brassica), U.S. Patent 4,795,855 (poplar)).
  • agro-inoculation in parallel with stable agro-transformation we used agro-inoculation, method of Agrobacterium-medMed delivery of T-DNA for transient expression of gene(s) of interest (Vaquero et al., 1999, Proc. Natl. Acad. ScL USA, .96, 11128-11133).
  • Said agro-inoculation is an extremely useful tool not only for small-to- middle scale recombinant protein production systems, but as one of the elements of vectors optimisation system, allowing to obtain fast results with different variants of constructs.
  • a DNA precursor of an inactivated viral RNA- based replicon is stably incorporated into chromosomal DNA.
  • Said replicon is optimised according to the invention.
  • the replicon contains a structure preventing expression of the sequence of interest. Expression as well as formation of the functional RNA replicon can be triggered by flipping one part of the construct with the help of site- specific recombination. Said flipping can lead to the formation of two introns as well as to the assembly of a functional sequence of interest.
  • EXAMPLE 9 shows not only the optimisation of a viral vector but also the solution for avoiding "leakiness” of constructs stably integrated into chromosomal DNA, including the "leaky” expression of the gene of interest from said construct. In many applications, it is crucial to have zero level expression in the uninduced state, especially for cytotoxic proteins or for achieving high biosafety standards with plant expression systems for expressing technical or pharmaceutical proteins.
  • Transcription of the heterologous DNA and/or of said recombinase can be under the control of an inducible or any other regulated (e.g. developmentally regulated) promoter.
  • Inducible promoters can be divided into two categories according to their induction conditions: those induced by abiotic factors (temperature, light, chemical substances) and those that can be induced by biotic factors, for example, pathogen or pest attack. Examples of the first category are heat-inducible (US 05187287) and cold- inducible (US05847102) promoters, a copper-inducible system (Mett et al., 1993, Proc. Natl. Acad.
  • promoters can be induced by treatment of a plant with salicylic acid, an important component of plant signaling pathways in response to pathogen attack, or other chemical compounds (benzo-1 ,2,3-thiadiazole or isonicotinic acid) which are capable of triggering PR gene expression (US05942662).
  • This invention is not limited to TMV-based vectors described in examples 1 - 9, but can be extended to replicons based on other plant RNA viruses.
  • the analysis of other plant viral RNA sequences shows selected localities very similar to those described for TMV and the sequences of pre-mRNA of plant nuclear genes (Fig. 9). This is strong evidence supporting the suggestion that, using the approaches described in this invention, practically any plant RNA virus-derived replicon can be improved fundamentally by removing/replacing problematic regions and/or inserting nuclear introns.
  • Genes of interest, their fragments (functional or non-functional) and their artificial derivatives that can be expressed in plants or plants cells using the present invention include, but are not limited to: starch modifying enzymes (starch synthase, starch phosphorylation enzyme, debranching enzyme, starch branching enzyme, starch branching enzyme II, granule bound starch synthase), sucrose phosphate synthase, sucrose phosphorylase, polygalacturonase, polyfructan sucrase, ADP glucose pyrophosphorylase, cyclodextrin glycosyltransferase, fructosyl transferase, glycogen synthase, pectin esterase, aprotinin, avidin, bacterial levansucrase, E.coli glgA protein, MAPK4 and orthologues, nitrogen assimilation/methabolism enzyme, glutamine synthase, plant osmotin, 2S albumin, thaumatin,
  • coli inorganic pyrophosphatase seed storage protein, Erwinia herbicola lycopen synthase, ACC oxidase, pTOM36 encoded protein, phytase, ketohydrolase, acetoacetyl CoA reductase, PHB (polyhydroxybutanoate) synthase, enzymes involved in the synthesis of polyhydroxylalkanoates (PHA), acyl carrier protein, napin, EA9, non- higher plant phytoene synthase, pTOM5 encoded protein, ETR (ethylene receptor), plastidic pyruvate phosphate dikinase, nematode-inducible transmembrane pore protein, trait enhancing photosynthetic or plastid function of the plant cell, stilbene synthase, an enzyme capable of hydroxylating phenols, catechol dioxygenase, catechol 2,3- dioxygenase, chloromuconate cyclo
  • acyl-CoA oxidase 3-ketoacyl-CoA thiolase, lipase, maize acetyl-CoA-carboxylase, etc.
  • 5-enolpyruvylshikimate-3-phosphate synthase EPP
  • phosphinothricin acetyl transferase BAR, PAT
  • CP4 protein ACC deaminase, protein having posttranslational cleavage site, DHPS gene conferring sulfonamide resistance, bacterial nitrilase, 2,4-D monooxygenase, acetolactate synthase or acetohydroxyacid synthase (ALS, AHAS), polygalacturonase, Taq polymerase, bacterial nitrilase, many other enzymes of bacterial or phage origin including restriction endonucleases, methylases, DNA and RNA
  • the present invention can be used for the purpose of molecular farming and purification of commercially valuable and pharmaceutically important proteins including industrial enzymes (cellulases, lipases, proteases, phytases etc.) and fibrous proteins (collagen, spider silk protein, etc.).
  • industrial enzymes cellulases, lipases, proteases, phytases etc.
  • fibrous proteins collagen, spider silk protein, etc.
  • Human or animal health protein may be expressed and purified using described in our invention approach.
  • proteins of interest include inter alia immune response proteins (monoclonal antibodies, single chain antibodies, T cell receptors etc.), antigens including those derived from pathogenic microorganisms, colony stimulating factors, relaxins, polypeptide hormones including somatotropin (HGH) and proinsulin, cytokines and their receptors, interferons, growth factors and coagulation factors, enzymatically active lysosomal enzyme, fibrinolytic polypeptides, blood clotting factors, trypsinogen, a1 -antitrypsin (AAT), human serum albumin, glucocerebrosidases, native cholera toxin B as well as function-conservative proteins like fusions, mutant versions and synthetic derivatives of the above proteins.
  • HGH somatotropin
  • AAT a1 -antitrypsin
  • human serum albumin glucocerebrosidases
  • native cholera toxin B as well as function-conservative proteins
  • 6A contains in sequential order: a 787 bp fragment from the Arabidopsis actin 2 promoter ⁇ ACT2, ref An et al, 1996, GenBank accession AB026654, bp 57962 to 58748), the 5 1 end of TVCV (GenBank accession BRU03387, bp 1 to 5455), a fragment of cr-TMV (GenBank accession Z29370, bp 5457 to 5677, with thymine 5606 changed to cytosine to remove the start codon of the coat protein, CP), sequences "taa teg ata act cga g", a synthetic GFP (sGFP) gene, cr- TMV 3 1 nontranslated region (3' NTR; GenBank accession Z29370, bp 6078 to 6312), and finally the nopaline synthase (Nos) terminator.
  • sGFP synthetic GFP
  • plCH8543 was transformed into Agrobacterium strain GV3101 and infiltrated into a Nicotiana benthamiana leaf. Foci of GFP fluoresence that appeared at 3 dpi grew and became confluent. Surprisingly, even though most cells in the infiltrated area finally expressed GFP due to viral replication and movement, only a fraction of the cells initiated viral replication, as detected by a number of independent GFP expressing foci. It becamce clear that the limiting factor is not DNA delivery to plant cells, since infiltration of Nicotiana benthamiana leaves with a GFP gene under control of the 35S promoter leads to GFP expression in almost every cell in the infiltrated area (not shown).
  • plCH14833 is similar to plCH8543 but differs by a deletion of 389 bp in the MP gene, upstream of the EcoRI site present in the MP.
  • the sequence of the Ncol to EcoRI fragment that includes this deletion is given in the annex as SEQ ID No. 1.
  • the entire viral construct (from the ACT2 promoter to the Nos terminator) was cloned between the T-DNA left and right borders of plCBV49, a pBIN19- derived Kan R binary vector. Due to the deletion in the MP, replicons produced from this construct cannot move from cell to cell but are able to replicate autonomously within a cell. Cell to cell movement can be restored when MP is provided in trans, e.g. from a constitutive promoter such as the cauliflower mosaic virus 35S promoter.
  • the TVCV MP gene was amplified by PCR from cloned TVCV cDNA (GenBank accession Z29370, bp 4802 to 5628) and subcloned in a binary vector under control of the 35S promoter.
  • the resulting construct called plCH 10745 (not shown), and plCH 14833 were transformed into Agrobacterium strain GV3101 and were infiltrated in Nicotiana benthamiana leaves. Infiltration of plCH14833 alone led to the appearance of a few GFP expressing cells within the infiltrated area. By counting protoplasts prepared from the infiltrated area, we found that only one to three protoplasts expressed GFP from a total of 500 protoplasts (0.2 to 0.6%).
  • RNA viruses such as tobamoviruses replicate in the cytoplasm and never enter the nucleus. Therefore, they have evolved in an environment where they are not exposed to the nuclear pre-mRNA processing machinery.
  • RNA replicon transcripts generated in the nucleus from artificial viral constructs may not be recognized and processed properly by the RNA processing machinery.
  • RNA replicons from viral vectors are very large: approximately 7,000 nt in the case of the replicon based on TMV. Very few plant genes have such a large size and the majority of such genes contains intr ⁇ ns that facilitate processing of the pre-mRNAs, export from the nucleus, and that improve the stability of the processed transcripts.
  • RNA virus-based vectors that can more efficiently initiate viral replication after DNA delivery to the nucleus: (1 ) one approach is the removal of sequence features that might induce unwanted processing events (such as alternative splicing events using cryptic splice sites, or premature termination events); (2) a second approach is the addition of introns to increase the amount of properly processed transcripts, to improve export of the RNA from the nucleus to the cytoplasm, and/or to improve stability of the transcripts.
  • RNA replicon from plCH4351 using the Netgenell server program (http://www.cbs.dtu.dk/services/NetGene2/) and noticed several intron-like sequence features that might induce alternative splicing events.
  • One such feature is a 0.6 kb uridine-rich region (corresponding to nt 827 to 1462 in GenBank accession BRU03387) at the beginning of the RdRP (Fig. 2A). This region was replaced in plCH 14833 by a PCR-mutagenized sequence that differs from the original sequence by a 54 nucleotide substitution (sequence given in annex as SEQ ID No. 2, Fig. 3).
  • the 52 nucleotide substitutions were made to replace T-rich sequences by more GC-rich sequences. All nucleotide substitutions were made silent so as not to change the RdRP protein sequence.
  • This mutagenized fragment also contains two nucleotide substitutions (at position 829 and 1459; coordinates relative to GenBank accession BRU03387) that were introduced to remove putative cryptic splice donor and acceptor sites, respectively.
  • the resulting clone plCH15466 (Fig. 6A) was agroinfiltrated in N. benthamiana leaves with or without plCH 10745 (movement protein in trans).
  • plCH15466 Eight days after infiltration, a 10-fold increase in the number of GFP expressing cells was observed in the area infiltrated with plCH15466 (compared to plCH14833, Fig. 7). This suggests that removal of intron-like sequences from the viral amplicon prevents unwanted alternative splicing events and results in more efficient initiation of viral replication.
  • Coinfiltration of plCH15466 and plCH10745 leads to cell-to-cell movement of the modified replicon at a similar speed as a non-modified replicon. This shows that the modification of the RNA sequence did not affect cell to cell movement of the viral vector.
  • a second potentially problematic region corresponds to the MP subgenomic promoter (Fig. 2B).
  • This region is very T-rich and resembles intron sequences very closely.
  • many cryptic splice donor and acceptor sites are predicted in nearby sequences by intron prediction programs.
  • modifications cannot be made easily to this region without affecting subgenomic promoter function.
  • plCH14833 3' sequences that contain the CP subgenomic promoter which is required to drive expression of the gene of interest.
  • plCH14833 383 bp fragment in plCH14833 (bp 4584 to 5455 in GenBank accession BRU03387)
  • the resulting construct plCH15900 (Fig. 6A) was agroinfiltrated in Nicotiana benthamiana leaves with or without pICH 10745.
  • a huge increase in the number of cells initiating replication was detected in comparison to leaf areas infiltrated by plCH14833.
  • plCH15900 was coinfiltrated with plCH10745 (p35S-MP expression cassette) and an increase in GFP fluorescence was detected due to cell to cell movement. This increase was however very limited because so many cells already expressed GFP even in the absence of cell-to-cell movement.
  • a 1000 fold dilution of the agrobacterium suspension containing plCH15900 coinfiltrated with an undiluted suspsension of agrobacteria containing plCH10745 gave rise to separate GFP expression foci.
  • plCH15025 and plCH15034 (Fig. 6A), each containing three different Arabidopsis thaliana introns in two different regions of the RdRP.
  • plCH15025 was designed to contain introns in the middle of the RdRP, while plCH15034 contains introns in the 3' end of the RdRP, upstream of the MP subgenomic promoter.
  • the introns were amplified by PCR from arabidopsis genomic DNA and incorporated into viral sequences using PCR with primers overlapping the planned intron/exon junctions.
  • the fragments containing the introns were subcloned into plCH14833 as an Aval Hindlll fragment (SEQ ID No. 4 in the annex) to make plCH15025 or as a Pst1 Ncol fragment (SEQ ID No. 5 in the annexe) to make plCH15034.
  • plCH15499 which contained all 6 introns (Fig. 5, 6B, 7A, 7B). This construct was tested in N. benthamiana and N. tabacum. This construct was more efficient than each individual construct with 3 introns, but the improvement was however less than additive.
  • Insertion of introns into a MP containing vector improves the frequency of initiation of viral replication of autonomous functional clones
  • a Kpn1 EcoRI fragment was subcloned from plCH15499 into plCH8543.
  • the resulting clone, 16700 (Fig. 6B) contained a complete viral vector with 6 introns in the RdRP. This clone was infiltrated in N. benthamiana leaf and efficiently initiated replication. This clone was also able to move cell to cell without the need to provide additional MP in trans.
  • intron-containing viral vector constructs it is also possible to stably transform intron-containing viral vector constructs in transgenic plants.
  • an inactive clone can be made by having part of the vector present in antisense orientation (Fig. 8). Incorporation of recombination sites and of introns sequences at the extremities of the inverted fragment allow for this fragment to be 'flipped' in the correct orientation by using an appropriate recombinase. Recombination sites will be completely eliminated from the replicon by splicing. Introns in the pro-replicon allow efficient initiation of replication after recombination and transcription. In one specific example, the recombination sites are located within the gene of interest and downstream of the pro-replicon.
  • Such configuration prevents any gene expression before recombination.
  • Other configurations can be considered where the recombination sites are located in other areas of the pro-replicon such as the RdRP and upstream of the promoter, lntron sequences at the recombination site have the advantage of allowing to completely remove the recombination site from the replicon, but also increases the efficiency of viral replication, as described before.
  • Plant viral RNA sequences contain potentially unstable regions
  • RNA profile of selected plant RNA viruses as well as one well characterised plant gene was performed by using the Netgenell server program (http://www.cbs.dtu.dk/services/NetGene2/).
  • the RNA profile shown in Fig. 9 for AtDMCI clearly reflects the presence of 14 introns (circled), previously identified by comparing the cDNA and genomic DNA sequences. It is evident that RNA profiles of two plant viruses have regions (see the Figures 10, 11) which might cause problems for the stability of said RNA, if they are placed in plant nuclear environment.
  • We have analysed the RNA profiles of several other representatives of plant RNA viruses (not shown), such as Brome mosaic Virus, different strains of TMV, and many others. All of them have potential problematic regions that might compromise the efficiency of plant RNA virus-based replicon formation if delivered into the plant cell as DNA precursors.
  • SEQ ID No. 3 (part of plCH15900): gcggacgatacgtgatccaccatgatagaggagccattgtgtattacgatccgcttaaactaatatctaagctcggctgcaag cacatcagagacgtcgtgcacttagaagagttacgcgagtctttgtgcgacgtagctagtaacttgaacaactgcgcctacttc tcacagttagatgaggccgttgctgaggtccacaagactgcggtcggaggctccttcgcgttctgtagcatcatcaaatacttgt cagacaagaggctgttcagggacctgtcttcgtctgagttgacg

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

L'invention concerne une plante transformée de manière stable, une partie de la plante, ou une culture cellulaire végétale contenant dans les noyaux cellulaires un ADN hétérologue dont une séquence code un réplicon d'ARN lié ou pouvant être lié de manière fonctionnelle à un promoteur de transcription. Cette séquence qui code un réplicon d'ARN contient i) des séquences dérivées d'une séquence d'un virus à ARN végétal et destinées à la fonction de réplicon dudit réplicon d'ARN; et ii) une séquence d'intérêt à exprimer à partir dudit réplicon d'ARN lesdites séquences destinées à la fonction de réplicon présentant, à des emplacements choisis de ladite séquence dudit virus à ARN végétal des différences de conservation de la fonction émanant de ladite séquence dudit virus à ARN végétal, lesquelles différences sont à l'origine d'une fréquence accrue de formation de réplicon par comparaison avec un réplicon d'ARN qui ne présente pas ces différences.
PCT/EP2003/012530 2003-11-10 2003-11-10 Systeme d'expression vegetale derive du virus a arn WO2006012906A1 (fr)

Priority Applications (16)

Application Number Priority Date Filing Date Title
PCT/EP2003/012530 WO2006012906A1 (fr) 2003-11-10 2003-11-10 Systeme d'expression vegetale derive du virus a arn
ES04797791T ES2346224T4 (es) 2003-11-10 2004-11-10 Sistema de expresión de planta derivado de virus de arn.
CA2541294A CA2541294C (fr) 2003-11-10 2004-11-10 Systeme d'expression de vegetaux derive du virus arn
AU2004291658A AU2004291658B2 (en) 2003-11-10 2004-11-10 RNA virus-derived plant expression system
DE602004027403T DE602004027403D1 (de) 2003-11-10 2004-11-10 Von rna-virus abgeleitetes pflanzenexpressionssystem
EP10000553.7A EP2184363B1 (fr) 2003-11-10 2004-11-10 Système d'expression dans les plantes dérivé d'un virus a ARN
MXPA06003715A MXPA06003715A (es) 2003-11-10 2004-11-10 Sistema de expresion de planta derivado de virus de arn.
DK04797791.3T DK1682667T3 (da) 2003-11-10 2004-11-10 RNA-virus afledt plantekspressionssystem
EP04797791A EP1682667B1 (fr) 2003-11-10 2004-11-10 Systeme d'expression dans les vegetaux derive d'un virus à arn
AT04797791T ATE469231T1 (de) 2003-11-10 2004-11-10 Von rna-virus abgeleitetes pflanzenexpressionssystem
PCT/EP2004/012743 WO2005049839A2 (fr) 2003-11-10 2004-11-10 Systeme d'expression de vegetaux derive du virus arn
JP2006538788A JP5096743B2 (ja) 2003-11-10 2004-11-10 Ｒｎａウイルス由来植物発現システム
US10/578,962 US9267143B2 (en) 2003-11-10 2004-11-10 RNA virus-derived plant expression system
IL173859A IL173859A (en) 2003-11-10 2006-02-21 A method for expressing plants derived from RNA virus
JP2010211319A JP2011024591A (ja) 2003-11-10 2010-09-21 Ｒｎａウイルス由来植物発現システム
US14/988,092 US10287602B2 (en) 2003-11-10 2016-01-05 RNA virus-derived plant expression system

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2003/012530 WO2006012906A1 (fr) 2003-11-10 2003-11-10 Systeme d'expression vegetale derive du virus a arn

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US10/578,962 Continuation-In-Part US9267143B2 (en) 2003-11-10 2004-11-10 RNA virus-derived plant expression system
US10/578,962 Continuation US9267143B2 (en) 2003-11-10 2004-11-10 RNA virus-derived plant expression system
PCT/EP2004/012743 Continuation-In-Part WO2005049839A2 (fr) 2003-11-10 2004-11-10 Systeme d'expression de vegetaux derive du virus arn

Publications (1)

Publication Number Publication Date
WO2006012906A1 true WO2006012906A1 (fr) 2006-02-09

Family

ID=34956980

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/012530 WO2006012906A1 (fr) 2003-11-10 2003-11-10 Systeme d'expression vegetale derive du virus a arn

Country Status (2)

Country Link
AU (1) AU2004291658B2 (fr)
WO (1) WO2006012906A1 (fr)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010145846A1 (fr) 2009-06-15 2010-12-23 Bayer Bioscience N.V. Plants de nicotinia benthamiana à activité xylosyltransférase déficiente
EP2551348A2 (fr) 2011-07-29 2013-01-30 Icon Genetics GmbH Production de N-glycanes galactosylatées dans des plantes
WO2013050155A1 (fr) 2011-10-04 2013-04-11 Icon Genetics Gmbh Plantes nicotiana benthamiana déficientes dans l'activité fucosyltransférase
EP2584042A1 (fr) 2011-10-17 2013-04-24 Nomad Bioscience GmbH Production, stockage et utilisation d'enzymes dégradant la paroi cellulaire
WO2014187571A1 (fr) 2013-05-23 2014-11-27 Nomad Bioscience Gmbh Procédé de production de plantes à résistance au stress abiotique
EP3097783A1 (fr) 2015-05-26 2016-11-30 Nomad Bioscience GmbH Colicine m pour la commande de ehec
EP3178313A1 (fr) 2015-12-09 2017-06-14 Leibniz-Institut für Pflanzenbiochemie Gène et protéine pour la synthèse de dérivés de zingibérène oxydé
EP3372091A1 (fr) 2017-03-07 2018-09-12 Nomad Bioscience GmbH Procédé de réduction de la contamination d'un objet par clostridium
EP3378485A1 (fr) 2017-03-24 2018-09-26 Nomad Bioscience GmbH Bactériocines pour le contrôle de salmonella enterica
WO2019158653A1 (fr) 2018-02-15 2019-08-22 Icon Genetics Gmbh Composition immunogène et vaccin pour générer une réponse immunitaire à un norovirus
WO2020182860A1 (fr) 2019-03-12 2020-09-17 Icon Genetics Gmbh Pseudo-particules de norovirus à stabilité améliorée
WO2020245376A1 (fr) 2019-06-06 2020-12-10 Nomad Bioscience Gmbh Klebicines pour la lutte contre klebsiella
WO2022012926A1 (fr) 2020-07-16 2022-01-20 Nomad Bioscience Gmbh Produits pour consommation orale à teneur réduite en sucre
EP4248987A1 (fr) 2022-03-21 2023-09-27 Nomad Bioscience GmbH Bactériocines chimériques et procédé de lutte contre les pseudomonas

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1616959A1 (fr) * 2004-07-07 2006-01-18 Icon Genetics AG Procédé d'expression transitoire de protéines dans les plantes biologiquement sur

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5965794A (en) * 1992-12-30 1999-10-12 Biosource Technologies, Inc. Viral amplification of recombinant messenger RNA in transgenic plants
WO2001040492A2 (fr) * 1999-11-12 2001-06-07 The Rockefeller University Recombinaison dirigee inductible destinee a l'activation et a l'elimination de transgenes de plantes transgeniques

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6632980B1 (en) * 1997-10-24 2003-10-14 E. I. Du Pont De Nemours And Company Binary viral expression system in plants

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5965794A (en) * 1992-12-30 1999-10-12 Biosource Technologies, Inc. Viral amplification of recombinant messenger RNA in transgenic plants
WO2001040492A2 (fr) * 1999-11-12 2001-06-07 The Rockefeller University Recombinaison dirigee inductible destinee a l'activation et a l'elimination de transgenes de plantes transgeniques

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
KOZIEL M G ET AL: "OPTIMIZING EXPRESSION OF TRANSGENES WITH EMPHASIS ON POST-TRANSCRIPTIONAL EVENTS", PLANT MOLECULAR BIOLOGY, NIJHOFF PUBLISHERS, DORDRECHT, NL, vol. 32, 1996, pages 393 - 405, XP002936764, ISSN: 0167-4412 *
LOPEZ-MOYA J J ET AL: "Construction of a stable and highly infectious intron-containing cDNA clone of plum pox potyvirus and its use to infect plants by particle bombardment", VIRUS RESEARCH, AMSTERDAM, NL, vol. 68, no. 2, July 2000 (2000-07-01), pages 99 - 107, XP002190623, ISSN: 0168-1702 *
MALLORY A C ET AL: "THE AMPLICON-PLUS SYSTEM FOR HIGH-LEVEL EXPRESSION OF TRANSGENES IN PLANTS", NATURE BIOTECHNOLOGY, NATURE PUBLISHING, US, vol. 20, no. 6, June 2002 (2002-06-01), pages 622 - 625, XP001187595, ISSN: 1087-0156 *
MASUTA CHIKARA ET AL: "Development of clover yellow vein virus as an efficient, stable gene-expression system for legume species", PLANT JOURNAL, vol. 23, no. 4, August 2000 (2000-08-01), pages 539 - 546, XP002286329, ISSN: 0960-7412 *
MOR TSAFRIR S ET AL: "Geminivirus vectors for high-level expression of foreign proteins in plant cells.", BIOTECHNOLOGY AND BIOENGINEERING, vol. 81, no. 4, 20 February 2003 (2003-02-20), pages 430 - 437, XP002286327, ISSN: 0006-3592 *
MORI MASASHI ET AL: "Inducible high-level mRNA amplification system by viral replicase in transgenic plants", PLANT JOURNAL, vol. 27, no. 1, July 2001 (2001-07-01), pages 79 - 86, XP002286325, ISSN: 0960-7412 *
TOTH RACHEL L ET AL: "Improvement of the movement and host range properties of a plant virus vector through DNA shuffling", PLANT JOURNAL, vol. 30, no. 5, June 2002 (2002-06-01), pages 593 - 600, XP002286330, ISSN: 0960-7412 *
ZHAO YAN ET AL: "Use of a vector based on Potato virus X in a whole plant assay to demonstrate nuclear targeting of Potato spindle tuber viroid", JOURNAL OF GENERAL VIROLOGY, vol. 82, no. 6, June 2001 (2001-06-01), pages 1491 - 1497, XP002286326, ISSN: 0022-1317 *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010145846A1 (fr) 2009-06-15 2010-12-23 Bayer Bioscience N.V. Plants de nicotinia benthamiana à activité xylosyltransférase déficiente
US8933297B2 (en) 2009-06-15 2015-01-13 Icon Genetics Gmbh Nicotiana benthamiana plants deficient in xylosyltransferase activity
EP2551348A2 (fr) 2011-07-29 2013-01-30 Icon Genetics GmbH Production de N-glycanes galactosylatées dans des plantes
WO2013050155A1 (fr) 2011-10-04 2013-04-11 Icon Genetics Gmbh Plantes nicotiana benthamiana déficientes dans l'activité fucosyltransférase
EP2584042A1 (fr) 2011-10-17 2013-04-24 Nomad Bioscience GmbH Production, stockage et utilisation d'enzymes dégradant la paroi cellulaire
WO2014187571A1 (fr) 2013-05-23 2014-11-27 Nomad Bioscience Gmbh Procédé de production de plantes à résistance au stress abiotique
EP3097783A1 (fr) 2015-05-26 2016-11-30 Nomad Bioscience GmbH Colicine m pour la commande de ehec
EP3178313A1 (fr) 2015-12-09 2017-06-14 Leibniz-Institut für Pflanzenbiochemie Gène et protéine pour la synthèse de dérivés de zingibérène oxydé
EP3372091A1 (fr) 2017-03-07 2018-09-12 Nomad Bioscience GmbH Procédé de réduction de la contamination d'un objet par clostridium
WO2018162570A1 (fr) 2017-03-07 2018-09-13 Nomad Bioscience Gmbh Méthode de réduction de la contamination d'un objet par clostridium
EP3378485A1 (fr) 2017-03-24 2018-09-26 Nomad Bioscience GmbH Bactériocines pour le contrôle de salmonella enterica
WO2018172065A1 (fr) 2017-03-24 2018-09-27 Nomad Bioscience Gmbh Bactériocines pour la lutte contre salmonella enterica
WO2021053242A2 (fr) 2017-03-24 2021-03-25 Nomad Bioscience Gmbh Bactériocines pour la lutte contre salmonella enterica
WO2019158653A1 (fr) 2018-02-15 2019-08-22 Icon Genetics Gmbh Composition immunogène et vaccin pour générer une réponse immunitaire à un norovirus
WO2020182860A1 (fr) 2019-03-12 2020-09-17 Icon Genetics Gmbh Pseudo-particules de norovirus à stabilité améliorée
WO2020245376A1 (fr) 2019-06-06 2020-12-10 Nomad Bioscience Gmbh Klebicines pour la lutte contre klebsiella
WO2022012926A1 (fr) 2020-07-16 2022-01-20 Nomad Bioscience Gmbh Produits pour consommation orale à teneur réduite en sucre
EP4248987A1 (fr) 2022-03-21 2023-09-27 Nomad Bioscience GmbH Bactériocines chimériques et procédé de lutte contre les pseudomonas
WO2023180197A1 (fr) 2022-03-21 2023-09-28 Nomad Bioscience Gmbh Bactériocines chimériques et procédé de lutte contre pseudomonas

Also Published As

Publication number Publication date
AU2004291658B2 (en) 2009-09-03
AU2004291658A1 (en) 2005-06-02

Similar Documents

Publication Publication Date Title
US10287602B2 (en) RNA virus-derived plant expression system
EP1763581B1 (fr) Procédé d'expression transitoire de protéines dans les plantes biologiquement sur.
AU2005206283B2 (en) Two-component RNA virus-derived plant expression system
JP5172828B2 (ja) 植物ウイルスに基づいた誘導性発現システム
AU2004291658B2 (en) RNA virus-derived plant expression system
US9267143B2 (en) RNA virus-derived plant expression system
JP2008505622A (ja) 植物における生物学的に安全な一過性のタンパク質発現

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): US