WO2005118851A1 - Oligonucleotides for cancer diagnosis - Google Patents
Oligonucleotides for cancer diagnosis Download PDFInfo
- Publication number
- WO2005118851A1 WO2005118851A1 PCT/GB2005/002180 GB2005002180W WO2005118851A1 WO 2005118851 A1 WO2005118851 A1 WO 2005118851A1 GB 2005002180 W GB2005002180 W GB 2005002180W WO 2005118851 A1 WO2005118851 A1 WO 2005118851A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sample
- cancer
- organism
- genes
- probes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
- Y10T436/00—Chemistry: analytical and immunological testing
- Y10T436/10—Composition for standardization, calibration, simulation, stabilization, preparation or preservation; processes of use in preparation for chemical testing
Definitions
- the present invention relates to oligonucleotide probes, for use in assessing gene transcript levels in a cell, which may be used in analytical techniques, particularly diagnostic techniques.
- the probes are provided in kit form. Different sets of probes may be used in techniques to prepare gene expression patterns and identify, diagnose or monitor different cancers or stages thereof.
- the identification of quick and easy methods of sample analysis for, for example, diagnostic applications, remains the goal of many researchers. End users seek methods which are cost effective, produce statistically significant results and which may be implemented routinely without the need for highly skilled individuals.
- the analysis of gene expression within cells has been used to provide information on the state of those cells and importantly the state of the individual from which the cells are derived.
- the relative expression of various genes in a cell has been identified as reflecting a particular state within a body.
- cancer cells are known to exhibit altered expression of various proteins and the transcripts or the expressed proteins may therefore be used as markers of that disease state.
- biopsy tissue may be analysed for the presence of these markers and cells originating from the site of the disease may be identified in other tissues or fluids of the body by the presence of the markers.
- products of the altered expression may be released into the blood stream and these products may be analysed.
- cells which have contacted disease cells may be affected by their direct contact with those cells resulting in altered gene expression and their expression or products of expression may be similarly analysed.
- samples can not always be taken from the disease site, e.g. in diseases of the brain.
- the present inventors identified the previously untapped potential of all cells within a body to provide information relating to the state of the organism from which the cells were derived.
- WO98/49342 describes the analysis of the gene expression of cells distant from the site of disease, e.g. peripheral blood collected distant from a cancer site.
- PCT/GB03/005102 inco ⁇ orated herein by reference, describes specific probes for the diagnosis of breast cancer and Alzheimer's disease and discusses protocols for identifying other appropriate probes for that purpose and for diagnosing other diseases. This finding is based on the premise that the different parts of an organism's body exist in dynamic interaction with each other. When a disease affects one part of the body, other parts of the body are also affected. The interaction results from a wide spectrum of biochemical signals that are released from the diseased area, affecting other areas in the body.
- the nature of the biochemical and physiological changes induced by the released signals can vary in the different body parts, the changes can be measured at the level of gene expression and used for diagnostic purposes.
- the physiological state of a cell in an organism is determined by the pattern with which genes are expressed in it. The pattern depends upon the internal and external biological stimuli to which said cell is exposed, and any change either in the extent or in the nature of these stimuli can lead to a change in the pattern with which the different genes are expressed in the cell.
- tissue specimens which are obtained are often heterogeneous and may contain a mixture of both diseased and non-diseased cells, making the analysis of generated gene expression data both complex and difficult. It has been suggested that a pool of tumour tissues that appear to be pathogenetically homogeneous with respect to mo ⁇ hological appearances of the tumour may well be highly heterogeneous at the molecular level (Alizadeh, 2000, supra), and in fact might contain tumours representing essentially different diseases (Alizadeh, 2000, supra; Golub, 1999, supra).
- any method that does not require clinical samples to originate directly from diseased tissues or cells is highly desirable since clinical samples representing a homogeneous mixture of cell types can be obtained from an easily accessible region in the body.
- families of genes whose expression is altered in the cells of blood samples from cancer patients which may be used to generate probes for use in methods of identifying, diagnosing or monitoring cancer or stages thereof.
- the inventors examined the level of expression of a large number of genes in cancer patients relative to normal patients.
- genes encoding proteins involved in protein synthesis and/or stability genes encoding proteins involved in the regulation of defence and/or chromatin remodelling.
- Family (i) includes: (a) genes encoding ribosomal proteins and ribosomal activation proteins (ie. proteins comprising components of ribosomal proteins or involved in modification of their function and are found to be down-regulated in cancer patients).
- These encoded proteins include ribosomal proteins Ll- L56, L7A, L10A, L13A, L18A, L23A, L27A, L35A, L36A, L37A, PO, PI, P2, S2-S29, S31, S33-S36, S3A, S15A, S18A, S18B, S18C, S27A, 63, 115 (and pseudogenes), ribosomal protein kinases (e.g. S6 kinase), ribonucleases, putative SI RNA binding domain protein, eukaryotic translation initiation factors and guanine nucleotide binding protein G; (b) genes encoding translation inhibition and initiation factors (ie.
- proteins involved in the translation of mRNA to a protein product and are found to be down-regulated in cancer patients include eukaryotic translation elongation factors, tRNA synthetases, RNA binding proteins, polyadenylation element binding proteins, tyrosine phosphatases, eukaryotic translation initiation factors, and RNA polymerase I, III transcription factors; (c) genes encoding other modulators of transcription or translation such as cyclin D-type binding protein and guanine nucleotide binding protein.
- Immuno response related proteins ie. proteins which are up-regulated in response to immune stimulation, and which include proteins upregulated in response to inflammation or in generating an inflammatory response, and are found to be up- regulated in cancer patients.
- These encoded proteins include T-cell receptor and associated components, e.g. protein kinases, various cytokines, including the interleukins and their receptors (such as IL-1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 20, 22, 24), tumour necrosis factor and its receptor and its superfamily (e.g.
- TNF superfamily members 2 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15
- interferon regulatory factors oncostatin M
- Leukemia inhibitory factor e.g. numbers 1- 28
- complement components e.g. interferon stimulated factors such as transcription factors, MHC (e.g HLA) class I or II (or related components) (e.g. DQ, DR, DO, DP, DM alpha or beta), adhesion proteins (e.g.
- IgG, IgE or IgA or their superfamily defensin, oxytocin, Si 00 calcium binding protein, lectin and its receptor and superfamily, leptin, phospholipase and growth factors (such as endothelial cell growth factor or erythropoietin);
- TNF-induced proteins ie. proteins which are induced in an individual in response to exposure to TNF and are found to be up- regulated in cancer patients.
- TNF alpha-induced protein 8 integrin
- inhibitor of kappa light polypeptide gene enhancer in B-cells TNF-associated factor 2, 5, nuclear factor of kappa light polypeptide gene enhancer in B-cells
- MAP kinases protein kinase C, ubiquitous kinase, cadherin, caspase, cyclin Dl, superoxide dismutase and interleukins;
- hypoxia-induced proteins ie. proteins which are induced when the individual or a part thereof is in a state of hypoxia and are found to be up-regulated in cancer patients.
- hypoxia-induced proteins include sestrin, El A binding protein p300, endothelin, ataxia telangiectasia and Rad3 related protein, hexokinase 2, TEK tyrosine kinase, DNA fragmentation factor, caspase, plasminogen activator, hypoxia-inducible factor 1 and glucose phosphate isomerase;
- oxidative stress proteins ie. proteins which are induced in an individual or part thereof under oxidative stress and are found to be up-regulated in cancer patients. These encoded proteins include superoxide dismutase, glutathione synthetase, catalase, lactoperoxidase, thyroid peroxidase, myeloperoxidase, eosinophil peroxidase, oxidation resistance 1, peroxiredoxin, cytochrome P450, scavenger receptor, paraoxonase, glutathione reductase, NAD(P)H dehydrogenase, glutathione S-transferase, catenin, glutaredoxin, heat shock proteins (such as heat shock transcription factors), mitogen- activated protein kinases, enolase, thioredoxin reductase and peroxiredoxin; (e) genes encoding proteins involved in chromatin remodelling (ie.
- proteins which are instrumental in maintaining or modifying chromatin structure and may be essential for gene regulation include histone replacement proteins, e.g. H3.3A or H3.3B family.
- Appropriate gene sequences falling within the families described above may be identified by interrogation of appropriate databases using as keywords the family name, e.g. "immune response" on gene or protein databases at
- the expression of a particular gene sequence may be assessed in a test cancer patient versus a normal patient. Nariation in expression above or below control levels is indicative of the utility of the sequence for probe derivation.
- the genes encoding the above (i) families are down-regulated in cancer versus normal patients and in the case of (ii) families the encoding genes are up-regulated.
- T ⁇ F activation is also believed to be a route for the changes in the families of genes described above since T ⁇ F is known to up regulate expression of e.g. ferritin, defensin, MnSOD and calgranulin B. T ⁇ F also inhibits EPO production which can itself cause a low oxygen condition in the blood environment. Hypoxia is known to induce T ⁇ F levels. These changes may be triggered by angiogenic factors entering the bloodstream.
- the invention provides a set of oligonucleotide probes which correspond to genes in a cell whose expression is affected in a pattern characteristic of a particular cancer or stage of, wherem said genes are systemically affected by said cancer or stage thereof.
- said genes are constitutively moderately or highly expressed.
- the genes are moderately or highly expressed in the cells of the sample but not in cells from disease cells or in cells having contacted such disease cells.
- Such probes particularly when isolated from cells distant to the site of disease, do not rely on the development of disease to clinically recognizable levels and allow detection of a cancer or stage thereof very early after the onset of said cancer, even years before other subjective or objective symptoms appear.
- systemically affected genes refers to genes whose expression is affected in the body without direct contact with a disease cell or disease site and the cells under investigation are not disease cells.
- Contact refers to cells coming into close proximity with one another such that the direct effect of one cell on the other may be observed, e.g. an immune response, wherein these responses are not mediated by secondary molecules released from the first cell over a large distance to affect the second cell.
- contact refers to physical contact, or contact that is as close as is sterically possible, conveniently, cells which contact one another are found in the same unit volume, for example within 1cm 3 .
- a “disease cell” is a cell manifesting phenotypic changes and is present at the disease site at some time during its life-span, e.g. a tumour cell at the tumour site or which has disseminated from the tumour, or a brain cell in the case of cancer of the brain.
- “Moderately or highly” expressed genes refers to those present in resting cells in a copy number of more than 30-100 copies/cell (assuming an average 3xl0 5 mRNA molecules in a cell). Specific probes having the above described properties are provided herein.
- the present invention provides a set of oligonucleotide probes, wherein said set comprises at least 10 oligonucleotides selected from: an oligonucleotide correspondmg to a gene sequence from family (i) or (ii) as defined hereinbefore or derived from such a sequence, or an oligonucleotide with a complementary sequence, or a functionally equivalent oligonucleotide.
- the invention further provides a method of preparing a set of oligonucleotides for use in the methods described herein, comprising the step of selecting one or more oligonucleotides conesponding to a gene sequence from family (i) and one or more oligonucleotides conesponding to a gene sequence from family (ii).
- a method of preparing a set of oligonucleotides for use in the methods described herein comprising the step of selecting one or more oligonucleotides conesponding to a gene sequence from family (i) and one or more oligonucleotides conesponding to a gene sequence from family (ii).
- Preferably more than 1 oligonucleotides is selected from each family (e.g. from different sub- families) and the selected oligonucleotides are from preferred genes as described herein.
- the invention also provides one or more oligonucleotide probes, wherein each oligonucleotide probe is selected from the oligonucleotides listed in Table 2, 3 or 4 (e.g. from Table 2) or derived from a sequence described in Table 2, 3 or 4, or a complementary sequence thereof.
- Said derived oligonucleotides include oligonucleotides derived from the genes corresponding to the sequences provided in those tables, e.g. the genes set forth in Tables 2, 5 or 6 (see the
- an "oligonucleotide” is a nucleic acid molecule having at least 6 monomers in the polymeric structure, ie. nucleotides or modified forms thereof.
- the nucleic acid molecule may be DNA, RNA or PNA (peptide nucleic acid) or hybrids thereof or modified versions thereof, e.g. chemically modified forms, e.g. LNA (Locked Nucleic acid), by methylation or made up of modified or non-natural bases during synthesis, providing they retain their ability to bind to complementary sequences.
- oligonucleotides are used in accordance with the invention to probe target sequences and are thus referred to herein also as oligonucleotide probes or simply as probes.
- An oligonucleotide corresponding to a gene sequence from family (i) or (ii) refers to an oligonucleotide conesponding to all or a part of said gene sequence or its transcript.
- a part of the gene sequence it satisfies the requirements of the oligonucleotide probes as described herein, e.g. in length and function.
- Preferably said parts have the size described hereinafter.
- Said oligonucleotide is referred to hereinafter as the primary oligonucleotide.
- a derived oligonucleotide refers to an oligonucleotide which is a part of the primary oligonucleotide but satisfies the requirements for probes as described herein.
- the oligonucleotide probes forming said set are at least 15 bases in length to allow binding of target molecules.
- said oligonucleotide probes are from 20 to 200 bases in length, e.g. from 30 to 150 bases, preferably 50-100 bases in length.
- complementary sequences refers to sequences with consecutive complementary bases (ie. T:A, G:C) and which complementary sequences are therefore able to bind to one another through their complementarity.
- 10 oligonucleotides refers to 10 different oligonucleotides. Whilst an oligonucleotide from a gene sequence family as described herein, a derived oligonucleotide and their functional equivalent are considered different ohgonucleotides, complementary oligonucleotides are not considered different. Preferably however, the at least 10 oligonucleotides correspond to 10 different gene sequences within the described gene sequence families (or derived oligonucleotides or their functional equivalents). Thus said 10 different oligonucleotides are preferably able to bind to 10 different transcripts.
- the at least 10 oligonucleotides are made up of a combination of oligonucleotides from family (i) and (ii), e.g. 5 oligonucleotides from each family may be used, or 4 from one family and 6 from the other family.
- one or more oligonucleotides from different sub-families may be used, e.g. 2 probes each from (i)a, (i)b, (i)c, (ii)a and (ii)b.
- said set of oligonucleotides includes oligonucleotides from family (i)a, (ii)a and (ii)e.
- Preferred proteins encoded by family (i)a genes are ribosomal proteins and preferably each set includes an oligonucleotide from a gene encoding such a protein.
- Preferred immune response proteins encoded by family (ii)a genes include adhesion proteins, interleukins their receptors and superfamily, TNF its receptor and superfamily, immunoglobulin components and erythropoietin.
- Particularly preferably said set includes oligonucleotides from genes encoding one or more ribosomal proteins and optionally one or more histones and optionally ferritin.
- said ohgonucleotides are as described in Table 2 or 3 or are derived from a sequence described in Table 2 or 3, e.g. as described in Table 2.
- Said set may additionally comprise one or more oligonucleotide probes listed in Table 4, or derived from a sequence described in Table 4, or a complementary sequence thereof.
- Said derived oligonucleotides include oligonucleotides derived from the genes conesponding to the sequences provided in those tables, e.g. the genes set forth in Tables 2, 5 or 6 (see the Accession numbers), or the complementary sequences thereof.
- a "set" as described refers to a collection of unique oligonucleotide probes (ie.
- oligonucleotide probes especially less than 500 probes, e.g. preferably from 10 to 500, e.g. 10 to 100, 200 or 300, especially preferably 20 to 100, e.g. 30 to 100 probes. In some cases less than 10 probes may be used, e.g. from 2 to 9 probes, e.g. 5 to 9 probes. It will be appreciated that increasing the number of probes will prevent the possibility of poor analysis, e.g. misdiagnosis by comparison to other diseases which could similarly alter the expression of the particular genes in question.
- oligonucleotide probes not described herein may also be present, particularly if they aid the ultimate use of the set of oligonucleotide probes.
- said set consists only of the oligonucleotides described herein, or a sub-set thereof (e.g. of the size as described above). Multiple copies of each unique oligonucleotide probe, e.g. 10 or more copies, may be present in each set, but constitute only a single probe.
- a set of oligonucleotide probes which may preferably be immobilized on a solid support or have means for such immobihzation, comprises the at least 10 oligonucleotide probes selected from those described hereinbefore.
- oligonucleotide probes which are complementary to, and bind to distinct genes are preferred.
- a "functionally equivalent" or derived oligonucleotide refers to an oligonucleotide which is capable of identifying the same gene as an oligonucleotide from a sequence in the gene sequence families described herein ie. it can bind to the same mRNA molecule (or DNA) transcribed from a gene (target nucleic acid molecule) as the primary oligonucleotide or the derived oligonucleotide (or its complementary sequence).
- said derived or functionally equivalent oligonucleotide is apart of a gene sequence as defined in Table 2, 5 or 6, or the complementary sequence thereof.
- said functionally equivalent oligonucleotide is capable of recognizing, ie. binding to the same splicing product as a primary oligonucleotide or a derived oligonucleotide.
- said mRNA molecule is the full length mRNA molecule which corresponds to the primary oligonucleotide or the derived oligonucleotide.
- ohgonucleotides or complementary sequences have sequence identity or will hybridize, as described hereinafter, to a region of the target molecule to which molecule a primary oligonucleotide or a derived oligonucleotide or a complementary oligonucleotide binds.
- oligonucleotides hybridize to one of the mRNA sequences which corresponds to a primary oligonucleotide or a derived oligonucleotide under the conditions described hereinafter or has sequence identity to a art of one of the mRNA sequences which conesponds to a primary oligonucleotide or a derived oligonucleotide.
- a "part” in this context refers to a stretch of at least 5, e.g. at least 10 or 20 bases, such as from 5 to 100, e.g. 10 to 50 or 15 to 30 bases.
- the functionally equivalent oligonucleotide binds to all or a part of the region of a target nucleic acid molecule (mRNA or cDNA) to which the primary oligonucleotide or derived oligonucleotide binds.
- a "target” nucleic acid molecule is the gene transcript or related product e.g. mRNA, or cDNA, or amplified product thereof. Said "region" of said target molecule to which said primary oligonucleotide or derived oligonucleotide binds is the stretch over which complementarity exists.
- this region is the whole length of the primary oligonucleotide or derived oligonucleotide, but may be shorter if the entire primary sequence or derived oligonucleotide is not complementary to a region of the target sequence.
- said part of said region of said target molecule is a stretch of at least 5, e.g. at least 10 or 20 bases, such as from 5 to 100, e.g. 10 to 50 or 15 to 30 bases.
- said functionally equivalent oligonucleotide having several identical bases to the bases of the primary oligonucleotide or the derived oligonucleotide. These bases may be identical over consecutive stretches, e.g.
- said functionally equivalent oligonucleotide hybridizes under conditions of high stringency to a primary oligonucleotide or a derived oligonucleotide or the complementary sequence thereof.
- said functionally equivalent oligonucleotide exhibits high sequence identity to all or part of a primary oligonucleotide.
- said functionally equivalent oligonucleotide has at least 70% sequence identity, preferably at least 80%, e.g.
- a "part” refers to a stretch of at least 5, e.g. at least 10 or 20 bases, such as from 5 to 100, e.g. 10 to 50 or 15 to 30 bases, in said primary oligonucleotide.
- sequence identity is high, e.g. at least 80% as described above.
- oligonucleotides which satisfy the above stated functional requirements include those which are derived from the primary oligonucleotides and also those which have been modified by single or multiple nucleotide base (or equivalent) substitution, addition and/or deletion, but which nonetheless retain functional activity, e.g. bind to the same target molecule as the primary oligonucleotide or the derived oligonucleotide from which they are further derived or modified.
- said modification is offrom 1 to 50, e.g. from 10 to 30, preferably from 1 to 5 bases.
- Especially preferably only minor modifications are present, e.g. variations in less than 10 bases, e.g. less than 5 base changes.
- addition equivalents are included oligonucleotides containing additional sequences which are complementary to the consecutive stretch of bases on the target molecule to which the primary oligonucleotide or the derived oligonucleotide binds.
- the addition may comprise a different, unrelated sequence, which may for example confer a further property, e.g. to provide a means for immobilization such as a linker to bind the oligonucleotide probe to a solid support.
- Particularly prefened are naturally occurring equivalents such as biological variants, e.g. allelic, geographical or allotypic variants, e.g.
- oligonucleotides which conespond to a genetic variant for example as present in a different species.
- Functional equivalents include oligonucleotides with modified bases, e.g. using non-naturally occurring bases. Such derivatives may be prepared during synthesis or by post production modification.
- "Hybridizing" sequences which bind under conditions of low stringency are those which bind under non-stringent conditions (for example, 6x SSC/50% formamide at room temperature) and remain bound when washed under conditions of low stringency (2 X SSC, room temperature, more preferably 2 X SSC, 42°C).
- Sequence identity refers to the value obtained when assessed using ClustalW (Thompson et al., 1994, Nucl. Acids Res., 22, p4673-4680) with the following parameters:
- the invention also extends to polypeptides encoded by the mRNA sequence to which a Table 2, 3 or 4 oligonucleotide or a Table 2, 3 or 4 derived oligonucleotide (e.g. having a sequence as defined in Table 2, 5 or 6 or a complementary sequence thereto) binds.
- the invention further extends to antibodies which bind to any of said polypeptides .
- said set of oligonucleotide probes may be immobilized on one or more solid supports. Single or preferably multiple copies of each unique probe are attached to said solid supports, e.g. 10 or more, e.g. at least 100 copies of each unique probe are present.
- One or more unique oligonucleotide probes may be associated with separate solid supports which together form a set of probes immobilized on multiple solid support, e.g. one or more unique probes may be immobilized on multiple beads, membranes, filters, biochips etc. which together form a set of probes, which together form modules of the kit described hereinafter.
- solid support of the different modules are conveniently physically associated although the signals associated with each probe (generated as described hereinafter) must be separately determinable.
- the probes may be immobilized on discrete portions of the same solid support, e.g. each unique oligonucleotide probe, e.g. in multiple copies, may be immobilized to a distinct and discrete portion or region of a single filter or membrane, e.g. to generate an anay.
- a combination of such techniques may also be used, e.g. several solid supports may be used which each immobilize several unique probes.
- the expression "solid support” shall mean any solid material able to bind oligonucleotides by hydrophobic, ionic or covalent bridges.
- Immobilization refers to reversible or ineversible association of the probes to said solid support by virtue of such binding. If reversible, the probes remain associated with the solid support for a time sufficient for methods of the invention to be carried out.
- Numerous solid supports suitable as immobilizing moieties according to the invention are well known in the art and widely described in the literature and generally speaking, the solid support may be any of the well-known supports or matrices which are cunently widely used or proposed for immobilization, separation etc. in chemical or biochemical procedures.
- Such materials include, but are not limited to, any synthetic organic polymer such as polystyrene, polyvinylchloride, polyethylene; or nitrocellulose and cellulose acetate; or tosyl activated surfaces; or glass or nylon or any surface carrying a group suited for covalent coupling of nucleic acids.
- the immobilizing moieties may take the form of particles, sheets, gels, filters, membranes, microfibre strips, tubes or plates, fibres or capillaries, made for example of a polymeric material e.g. agarose, cellulose, alginate, teflon, latex or polystyrene or magnetic beads.
- Solid supports allowing the presentation of an anay, preferably in a single dimension are prefened, e.g. sheets, filters, membranes, plates or biochips. Attachment of the nucleic acid molecules to the solid support may be performed directly or indirectly. For example if a filter is used, attachment may be performed by UV-induced crosslinking. Alternatively, attachment may be performed indirectly by the use of an attachment moiety carried on the oligonucleotide probes and/or solid support. Thus for example, a pair of affinity binding partners may be used, such as avidin, streptavidin or biotin, DNA or DNA binding protein (e.g.
- the lac I repressor protein or the lac operator sequence to which it binds either the lac I repressor protein or the lac operator sequence to which it binds), antibodies (which may be mono- or polyclonal), antibody fragments or the epitopes or haptens of antibodies.
- one partner of the binding pair is attached to (or is inherently part of) the solid support and the other partner is attached to (or is inherently part of) the nucleic acid molecules.
- an ''affinity binding pair refers to two components which recognize and bind to one another specifically (ie. in preference to binding to other molecules). Such binding pairs when bound together form a complex.
- Attachment of appropriate functional groups to the solid support may be performed by methods well known in the art, which include for example, attachment through hydroxyl, carboxyl, aldehyde or amino groups which may be provided by treating the solid support to provide suitable surface coatings.
- Solid supports presenting appropriate moieties for attachment of the binding partner may be produced by routine methods known in the art.
- Attachment of appropriate functional groups to the oligonucleotide probes of the invention may be performed by ligation or introduced during synthesis or amplification, for example using primers carrying an appropriate moiety, such as biotin or a particular sequence for capture. Conveniently, the set of probes described hereinbefore is provided in kit form.
- the present invention provides a kit comprising a set of oligonucleotide probes as described hereinbefore immobilized on one or more solid supports.
- said probes are immobilized on a single solid support and each unique probe is attached to a different region of said solid support.
- said multiple solid supports form the modules which make up the kit.
- said solid support is a sheet, filter, membrane, plate or biochip.
- the kit may also contain information relating to the signals generated by normal or diseased samples (as discussed in more detail hereinafter in relation to the use of the kits), standardizing materials, e.g.
- kits may also contain a package insert describing how the method of the invention should be performed, optionally providing standard graphs, data or software for inte ⁇ retation of results obtained when performing the invention.
- the use of such kits to prepare a standard diagnostic gene transcript pattern as described hereinafter forms a further aspect of the invention.
- the set of probes as described herein have various uses.
- the invention provides the use of a set of oligonucleotide probes or a kit as described hereinbefore to determine the gene expression pattern of a cell which pattern reflects the level of gene expression of genes to which said oligonucleotide probes bind, comprising at least the steps of: a) isolating mRNA from said cell, which may optionally be reverse transcribed to cDNA; b) hybridizing the mRNA or cDNA of step (a) to a set of ol igonucleotide probes or a kit as defined herein; and c) assessing the amount of mRNA or cDNA hybridizing to each of said probes to produce said pattern.
- the mRNA and cDNA as refened to in this method, and the methods hereinafter, encompass derivatives or copies of said molecules, e.g. copies of such molecules such as those produced by amplification or the preparation of complementary strands, but which retain the identity of the mRNA sequence, ie. would hybridize to the direct transcript (or its complementary sequence) by virtue of precise complementarity, or sequence identity, over at least a region of said molecule. It will be appreciated that complementarity will not exist over the entire region where techniques have been used which may truncate the transcript or introduce new sequences, e.g. by primer amplification.
- said mRNA or cDNA is preferably amplified prior to step b).
- gene expression refers to transcription of a particular gene to produce a specific mRNA product (ie. a particular splicing product).
- the level of gene expression may be determined by assessing the level of transcribed mRNA molecules or cDNA molecules reverse transcribed from the mRNA molecules or products derived from those molecules, e.g. by amplification.
- the "pattern” created by this technique refers to information which, for example, may be represented in tabular or graphical form and conveys information about the signal associated with two or more oligonucleotides.
- said pattern is expressed as an anay of numbers relating to the expression level associated with each probe.
- PLSR partial Least Squares Regression
- the probes are thus used to generate a pattern which reflects the gene expression of a cell at the time of its isolation.
- the pattern of expression is characteristic of the circumstances under which that cells finds itself and depends on the influences to which the cell has been exposed.
- a characteristic gene transcript pattern standard or finge ⁇ rint for cells from an individual with a particular cancer may be prepared and used for comparison to transcript patterns of test cells. This has clear applications in diagnosing, monitoring or identifying whether an organism is suffering from a particular cancer or stage thereof.
- the standard pattern is prepared by determining the extent of binding of total mRNA (or cDNA or related product), from cells from a sample of one or more organisms with the cancer or stage thereof, to the probes.
- the present invention provides a method of preparing a standard gene transcript pattern characteristic of a cancer or stage thereof in an organism comprising at least the steps of: a) isolating mRNA from the cells of a sample of one or more organisms having the cancer or stage thereof, which may optionally be reverse transcribed to cDNA; b) hybridizing the mRNA or cDNA of step (a) to a set of oligonucleotides or a kit as described hereinbefore specific for said cancer or stage thereof in an organism and sample thereof corresponding to the organism and sample thereof under investigation; and c) assessing the amount of mRNA or cDNA hybridizing to each of said probes to produce a characteristic pattern reflecting the level of gene expression of genes to which said oligonucleotides bind, in the sample with the cancer or stage thereof.
- said oligonucleotides are preferably immobilized on one or more solid supports.
- the standard pattern for a great number of cancers and different stages thereof using particular probes may be accumulated in databases and be made available to laboratories on request.
- Disease samples and organisms or “cancer” samples and organisms as referred to herein refer to organisms (or samples from the same) with abnormal cell proliferation e.g. in a solid mass such as a tumour. Such organisms are known to have, or which exhibit, the cancer or stage thereof under study.
- Stages thereof refer to different stages of the cancer which may or may not exhibit particular physiological or metabolic changes, but do exhibit changes at the genetic level which may be detected as altered gene expression.
- these are “normal” in the sense that they do not exhibit any indication of, or are not believed to have, any disease or condition that would affect gene expression, particularly in respect of cancer for which they are to be used as the normal standard.
- the "normal” sample may conespond to the earlier stage of the cancer.
- a “sample” refers to any material obtained from the organism, e.g. human or non-human animal under investigation which contains cells and includes, tissues, body fluid or body waste or in the case of prokaryotic organisms, the organism itself.
- Body fluids include blood, saliva, spinal fluid, semen, lymph.
- tissue samples include tissue obtained by biopsy, by surgical interventions or by other means e.g. placenta.
- the samples which are examined are from areas of the body not apparently affected by the cancer.
- the cells in such samples are not disease cells, i.e. cancer cells, have not been in contact with such disease cells and do not originate from the site of the cancer.
- the "site of disease” is considered to be that area of the body which manifests the disease in away which may be objectively determined, e.g. a tumour.
- peripheral blood may be used for the diagnosis of non-haematopoietic cancers, and the blood does not require the presence of malignant or disseminated cells from the cancer in the blood.
- peripheral blood may still be used in the methods of the invention.
- the method of preparing the standard transcription pattern and other methods of the invention are also applicable for use on living parts of eukaryotic organisms such as cell lines and organ cultures and explants. As used herein, reference to "conesponding" sample etc.
- tissue refers to cells preferably from the same tissue, body fluid or body waste, but also includes cells from tissue, body fluid or body waste which are sufficiently similar for the pu ⁇ oses of preparing the standard or test pattern.
- tissue refers to cells which are related by sequence (which may be complementary) to the probes although the probes may reflect different splicing products of expression.
- Assessing refers to both quantitative and qualitative assessment which may be determined in absolute or relative terms. The invention may be put into practice as follows. To prepare a standard transcript pattern for a particular cancer or stage thereof, sample mRNA is extracted from the cells of tissues, body fluid or body waste according to known techniques (see for example Sambrook et. al.
- the R ⁇ A is preferably reverse transcribed at this stage to form first strand cD ⁇ A.
- Cloning of the cD ⁇ A or selection from, or using, a cD ⁇ A library is not however necessary in this or other methods of the invention.
- the complementary strands of the first strand cD ⁇ As are synthesized, ie. second strand cD ⁇ As, but this will depend on which relative strands are present in the oligonucleotide probes.
- the R ⁇ A may however alternatively be used directly without reverse transcription and may be labelled if so required.
- the cD ⁇ A strands are amplified by known amplification techniques such as the polymerase chain reaction (PCR) by the use of appropriate primers.
- the cD ⁇ A strands may be cloned with a vector, used to transform a bacteria such as E. coli which may then be grown to multiply the nucleic acid molecules.
- primers may be directed to regions of the nucleic acid molecules which have been introduced.
- adapters may be ligated to the cDNA molecules and primers directed to these portions for amplification of the cDNA molecules.
- advantage may be taken of the polyA tail and cap of the RNA to prepare appropriate primers.
- the above described oligonucleotide probes are used to probe mRNA or cDNA of the diseased sample to produce a signal for hybridization to each particular oligonucleotide probe species, ie. each unique probe.
- a standard control gene transcript pattern may also be prepared i f desired using mRNA or cDNA from a normal sample. Thus, mRNA or cDNA is brought into contact with the oligonucleotide probe under appropriate conditions to allow hybridization.
- this may be performed consecutively using the same probes, e.g. on one or more solid supports, ie. on probe kit modules, or by simultaneously hybridizing to corresponding probes, e.g. the modules of a conesponding probe kit.
- To identify when hybridization occurs and obtain an indication of the number of transcripts/cDNA molecules which become bound to the oligonucleotide probes it is necessary to identify a signal produced when the transcripts (or related molecules) hybridize (e.g. by detection of double stranded nucleic acid molecules or detection of the number of molecules which become bound, after removing unbound molecules, e.g. by washing). In order to achieve a signal, either or both components which hybridize (ie.
- This "signalling means” is any moiety capable of direct or indirect detection by the generation or presence of a signal.
- the signal may be any detectable physical characteristic such as confened by radiation emission, scattering or abso ⁇ tion properties, magnetic properties, or other physical properties such as charge, size or binding properties of existing molecules (e.g. labels) or molecules which may be generated (e.g. gas emission etc.).
- the signalling means may be a label which itself provides a detectable signal. Conveniently this may be achieved by the use of a radioactive or other label which may be inco ⁇ orated during cDNA production, the preparation of complementary cDNA strands, during amplification of the target m-RNA/cDNA or added directly to target nucleic acid molecules.
- Appropriate labels are those which directly or indirectly allow detection or measurement of the presence of the transcripts/cDNA.
- Such labels include for example radiolabels, chemical labels, for example chromophores or fluorophores (e.g. dyes such as fluorescein and rhodamine), or reagents of high electron density such as fenitin, haemocyanin or colloidal gold.
- the label may be an enzyme, for example peroxidase or alkaline phosphatase, wherein the presence of the enzyme is visualized by its interaction with a suitable entity, for example a substrate.
- the label may also form part of a signalling pair wherein the other member of the pair is found on, or in close proximity to, the oligonucleotide probe to which the transcript/cDNA binds, for example, a fluorescent compound and a quench fluorescent substrate may be used.
- a label may also be provided on a different entity, such as an antibody, which recognizes a peptide moiety attached to the transcripts/cDNA, for example attached to a base used during synthesis or amplification.
- a signal may be achieved by the introduction of a label before, during or after the hybridization step. Alternatively, the presence of hybridizing transcripts may be identified by other physical properties, such as their absorbance, and in which case the signalling means is the complex itself.
- the amount of signal associated with each oligonucleotide probe is then assessed.
- the assessment may be quantitative or qualitative and may be based on binding of a single transcript species (or related cDNA or other products) to each probe, or binding of multiple transcript species to multiple copies of each unique probe. It will be appreciated that quantitative results will provide further information for the transcript f ⁇ nge ⁇ rint of the cancer which is compiled. This data may be expressed as absolute values (in the case of macroanays) or may be determined relative to a particular standard or reference e.g. a normal control sample.
- the standard diagnostic gene pattern transcript may be prepared using one or more disease samples (and normal samples if used) to perform the hybridization step to obtain patterns not biased towards a particular individual's variations in gene expression.
- the use of the probes to prepare standard patterns and the standard diagnostic gene transcript patterns thus produced for the pu ⁇ ose of identification or diagnosis or monitoring of a particular cancer or stage thereof in a particular organism forms a further aspect of the invention.
- test sample of tissue, body fluid or body waste containing cells, conesponding to the sample used for the preparation of the standard pattern, is obtained from a patient or the organism to be studied.
- a test gene transcript pattern is then prepared as described hereinbefore as for the standard pattern.
- the present invention provides a method of preparing a test gene transcript pattern comprising at least the steps of: a) isolating mRNA from the cells of a sample of said test organism, which may optionally be reverse transcribed to cDNA; b) hybridizing the mRNA or cDNA of step (a) to a set of oligonucleotides or a kit as described hereinbefore specific for a cancer or stage thereof in an organism and sample thereof conesponding to the organism and sample thereof under investigation; and c) assessing the amount of mRNA or cDNA hybridizing to each of said probes to produce said pattem reflecting the level of gene expression of genes to which said oligonucleotides bind, in said test sample.
- the present invention provides a method of diagnosing or identifying or monitoring a cancer or stage thereof in an organism, comprising the steps of: a) isolating mRNA from the cells of a sample of said organism, which may optionally be reverse transcribed to cDNA; b) hybridizing the mRNA or cDNA of step (a) to a set of oligonucleotides or a kit as described hereinbefore specific for said cancer or stage thereof in an organism and sample thereof conesponding to the organism and sample thereof under investigation; c) assessing the amount of mRNA or cDNA hybridizing to each of said probes to produce a characteristic pattern reflecting the level of gene expression of genes to which said oligonucleotides bind, in said sample; and d) comparing said pattern to a standard diagnostic pattern prepared according to the method of the invention using a sample from an organism cones
- step c) is the preparation of a test pattern as described above.
- diagnosis refers to determination of the presence or existence of a cancer or stage thereof in an organism.
- Monitoring refers to establishing the extent of a cancer, particularly when an individual is known to be suffering from cancer, for example to monitor the effects of treatment or the development of a cancer, e.g. to determine the suitability of a treatment or provide a prognosis.
- the presence of the cancer or stage thereof may be determined by determining the degree of conelation between the standard and test samples' patterns. This necessarily takes into account the range of values which are obtained for normal and diseased samples.
- the presence, absence, or extent of a cancer or stage thereof in a test sample can be predicted by inserting the data relating to the expression level of informative probes in test sample into the standard diagnostic probe pattern established according to equation 1.
- Data generated using the above mentioned methods may be analysed using various techniques from the most basic visual representation (e.g. relating, to intensity) to more complex data manipulation to identify underlying patterns which reflect the intenelationship of the level of expression of each gene to which the various probes bind, which may be quantified and expressed mathematically.
- the raw data thus generated may be manipulated by the data processing and statistical methods described hereinafter, particularly normalizing and standardizing the data and fitting the data to a classification model to determine whether said test data reflects the pattern of a particular cancer or stage thereof.
- the methods described herein may be used to identify, monitor or diagnose a cancer or its stage or progression, for which the oligonucleotide probes are informative.
- "Informative" probes as described herein are those which reflect genes which have altered expression in the cancer in question, or particular stages thereof. Probes of the invention may not be sufficiently informative for diagnostic pu ⁇ oses when used alone, but are informative when used as one of several probes to provide a characteristic pattern, e.g. in a set as described hereinbefore.
- said probes conespond to genes which are systemically affected by said cancer or stage thereof.
- said genes, from which transcripts are derived which bind to probes of the invention are moderately or highly expressed.
- the advantage of using probes directed to moderately or highly expressed genes is that smaller clinical samples are required for generating the necessary gene expression data set, e.g. less than 1ml blood samples.
- transcripts are already being produced at levels which are generally detectable, small changes in those levels are readily detectable as for example, a certain detectable threshold does not need to be reached.
- the set of probes of the invention are informative for a variety of different cancers or stages thereof.
- a sub-set of the probes disclosed herein may be used for diagnosis, identification or monitoring a particular cancer or stage thereof.
- Cancers for which the probes may be used for diagnosis, identification and monitoring include stomach, lung, breast, prostate gland, bowel, skin, colon and ovary cancer.
- the probes are used for breast cancer analysis.
- the diagnostic method may be used alone as an alternative to other diagnostic techniques or in addition to such techniques.
- methods of the invention may be used as an alternative or additive diagnostic measure to diagnosis using imaging techniques such as Magnetic Resonance Imagine
- MRI magnetic resonance imaging
- nuclear imaging nuclear imaging
- X-ray imaging nuclear imaging or X-ray imaging
- the methods of the invention may be performed on cells from prokaryotic or eukaryotic organisms which may be any eukaryotic organisms such as human beings, other mammals and animals, birds, insects, fish and plants, and any prokaryotic organism such as a bacteria.
- Prefened non-human animals on which the methods of the invention may be conducted include, but are not limited to mammals, particularly primates, domestic animals, livestock and laboratory animals.
- prefened animals for diagnosis include mice, rats, guinea pigs, cats, dogs, pigs, cows, goats, sheep, horses.
- cancer of humans is diagnosed, identified or monitored.
- the sample under study may be any convenient sample which may be obtained from an organism.
- the sample is obtained from a site distant to the site of disease and the cells in such samples are not disease cells, have not been in contact with such cells and do not originate from the site of the disease.
- the sample may contain cells which do not fulfil these criteria.
- the probes of the invention are concerned with transcripts whose expression is altered in cells which do satisfy these criteria, the probes are specifically directed to detecting changes in transcript levels in those cells even if in the presence of other, background cells. It has been found that the cells from such samples show significant and informative variations in the gene expression of a large number of genes.
- the same probe may be found to be informative in determinations regarding two or more cancers, or stages thereof by virtue of the particular level of transcripts binding to that probe or the intenelationship of the extent of binding to that probe relative to other probes.
- the present invention also provides sets of probes for diagnosing, identifying or monitoring two or more cancers or stages thereof, wherein at least one of said probes is suitable for said diagnosing, identifying or monitoring at least two of said cancers or stages thereof, and kits and methods of using the same.
- the present invention provides a method of diagnosis or identification or monitoring as described hereinbefore for the diagnosis, identification or monitoring of two or more cancers or stages thereof in an organism, wherein said test pattern produced in step c) of the diagnostic method is compared in step d) to at least two standard diagnostic patterns prepared as described previously, wherein each standard diagnostic pattern is a pattem generated for a different cancer or stage thereof.
- the methods of assessment concern the development of a gene transcript pattern from a test sample and comparison of the same to a standard pattern, the elevation or depression of expression of certain markers may also be examined by examining the products of expression and the level of those products. Thus a standard pattern in relation to the expressed product may be generated.
- the levels of expression of a set of polypeptides encoded by the gene to which a primary oligonucleotide or a derived oligonucleotide, binds are analysed.
- Various diagnostic methods may be used to assess the amount of polypeptides (or fragments thereof) which are present.
- polypeptides may be examined, for example by the use of a binding partner to said polypeptide (e.g. an antibody), which may be immobilized, to separate said polypeptide from the sample and the amount of polypeptide may then be determined.
- a binding partner to said polypeptide e.g. an antibody
- “Fragments” of the polypeptides refers to a domain or region of said polypeptide, e.g. an antigenic fragment, which is recognizable as being derived from said polypeptide to allow binding of a specific binding partner.
- a fragment comprises a significant portion of said polypeptide and corcesponds to a product of normal post-synthesis processing.
- the present invention provides a method of preparing a standard gene transcript pattern characteristic of a cancer or stage thereof in an organism comprising at least the steps of: a) releasing target polypeptides from a sample of one or more organisms having the cancer or stage thereof; b) contacting said target polypeptides with one or more binding partners, wherein each binding partner is specific to a marker polypeptide (or a fragment thereof) encoded by the gene to which a primary oligonucleotide (or derived sequence) binds, to allow binding of said binding partners to said target polypeptides, wherein said marker polypeptides are specific for said cancer in an organism and sample thereof conesponding to the organism and sample thereof under investigation; and c) assessing the target polypeptide binding to said binding partners to produce a characteristic pattern reflecting the level of gene expression of genes which express said marker polypeptides, in the sample with the cancer or stage thereof.
- target polypeptides refer to those polypeptides present in a sample which are to be detected and "marker polypeptides” are polypeptides which are encoded by the genes to which primary oligonucleotides or derived oligonucleotides bind, ie. genes within the gene families.
- the target and marker polypeptides are identical or at least have areas of high similarity, e.g. epitopic regions to allow recognition and binding of the binding partner.
- Release of the target polypeptides refers to appropriate treatment of a sample to provide the polypeptides in a form accessible for binding of the binding partners, e.g. by lysis of cells where these are present.
- the samples used in this case need not necessarily comprise cells as the target polypeptides may be released from cells into the sunounding tissue or fluid, and this tissue or fluid may be analysed, e.g. urine or blood.
- tissue or fluid may be analysed, e.g. urine or blood.
- the prefened samples as described herein are used.
- Binding partners comprise the separate entities which together make an affinity binding pair as described above, wherein one partner of the binding pair is the target or marker polypeptide and the other partner binds specifically to that polypeptide, e.g. an antibody.
- a sandwich type assay e.g.
- an immunoassay such as an ELISA, may be used in which an antibody specific to the polypeptide and carrying a label (as described elsewhere herein) may be bound to the binding pair (e.g. the first antibody:polypeptide pair) and the amount of label detected.
- a label as described elsewhere herein
- Other methods as described herein may be similarly modified for analysis of the protein product of expression rather than the gene transcript and related nucleic acid molecules .
- a further aspect of the invention provides a method of preparing a test gene transcript pattern comprising at least the steps of: a) releasing target polypeptides from a sample of said test organism; b) contacting said target polypeptides with one or more binding partners, wherein each binding partner is specific to a marker polypeptide (or a fragment thereof) encoded by the gene to which a primary oligonucleotide (or derived sequence) binds, to allow binding of said binding partners to said target polypeptides, wherein said marker polypeptides are specific for said cancer in an organism and sample thereof conesponding to the organism and sample thereof under investigation; and c) assessing the target polypeptide binding to said binding partners to produce a characteristic pattern reflecting the level of gene expression of genes which express said marker polypeptides, in said test sample.
- a yet further aspect of the invention provides a method of diagnosing or identifying or monitoring a cancer or stage thereof in an organism comprising the steps of: a) releasing target polypeptides from a sample of said organism; b) contacting said target polypeptides with one or more binding partners, wherein each binding partner is specific to a marker polypeptide (or a fragment thereof) encoded by the gene to which a primary oligonucleotide (or derived sequence) binds, to allow binding of said binding partners to said target polypeptides, wherein said marker polypeptides are specific for said cancer in an organism and sample thereof conesponding to the organism and sample thereof under investigation; and c) assessing the target polypeptide binding to said binding partners to produce a characteristic pattern reflecting the level of gene expression of genes which express said marker polypeptides in said sample; and d) comparing said pattern to a standard diagnostic pattern prepared as described hereinbefore using a sample from an organism conesponding to the organism and sample under investigation to determine the degree of correlation indicative of
- the methods of generating standard and test patterns and diagnostic techniques rely on the use of informative oligonucleotide probes to generate the gene expression data. In some cases it will be necessary to select these informative probes for a particular method, e.g. to diagnose a particular cancer, from a selection of available probes, e.g. the Table 2 and/or 3 oligonucleotides, the Table 2 and or 3 derived oligonucleotides, their complementary sequences and functionally equivalent oligonucleotides and optionally the Table 4 oligonucleotides, their derived oligonucleotides, complementary sequences and functionally equivalent oligonucleotides.
- the Table 2 and/or 3 oligonucleotides e.g. the Table 2 and/or 3 oligonucleotides, the Table 2 and or 3 derived oligonucleotides, their complementary sequences and functionally equivalent oligonucleotides and optionally the Table 4 oligonu
- Said derived oligonucleotides include oligonucleotides derived from the genes conesponding to the sequences provided in those tables, e.g. the genes set forth in Tables 2, 5 or 6 (see the Accession numbers), or the complementary sequences thereof.
- the following methodology describes a convenient method for identifying such informative probes, or more particularly how to select a suitable sub-set of probes from the probes described herein.
- Probes for the analysis of a particular cancer or stage thereof may be identified in a number of ways known in the prior art, including by differential expression or by library subtraction (see for example WO98/49342).
- the immobilized probes can be derived from various unrelated or related organisms; the only requirement is that the immobilized probes should bind specifically to their homologous counte ⁇ arts in test organisms. Probes can also be derived from commercially available or public databases and immobilized on solid supports. The selected probes necessarily conespond to one of the genes in the gene sequence families described herein, but the probes of interest may be randomly selected from within that entire group of families. The length of the probes immobilised on the solid support should be long enough to allow for specific binding to the target sequences.
- the immobilised probes can be in the form of DNA, RNA or their modified products or PNAs
- the probes immobilised should bind specifically to their homologous counte ⁇ arts representing highly and moderately expressed genes in test organisms.
- the probes which are used are the probes described herein.
- the gene expression pattern of cells in biological samples can be generated using prior art techniques such as microarray or macroarray as described below or using methods described herein.
- oligoanays and cDNA microarrays hundreds and thousands of probe oligonucleotides or cDNAs, are spotted onto glass slides or nylon membranes, or synthesized on biochips.
- the mRNA isolated from the test and reference samples are labelled by reverse transcription with a red or green fluorescent dye, mixed, and hybridised to the microarray. After washing, the bound fluorescent dyes are detected by a laser, producing two images, one for each dye. The resulting ratio of the red and green spots on the two images provides the information about the changes in expression levels of genes in the test and reference samples.
- single channel or multiple channel microarray studies can also be performed.
- cDNA macroarray different cDNAs are spotted on a solid support such as nylon membranes in excess in relation to the amount of test mRNA that can hybridise to each spot.
- mRNA isolated from test samples is radio- labelled by reverse transcription and hybridised to the immobilised probe cDNA. After washing, the signals associated with labels hybridising specifically to immobilised probe cDNA are detected and quantified.
- the data obtained in macroanay contains information about the relative levels of transcripts present in the test samples. Whilst macroanays are only suitable to monitor the expression of a limited number of genes, microarrays can be used to monitor the expression of several thousand genes simultaneously and is, therefore, a prefened choice for large-scale gene expression studies.
- a macroarray technique for generating the gene expression data set has been used to illustrate the probe identification method described herein.
- mRNA is isolated from samples of interest and used to prepare labelled target molecules, e.g. mRNA or cDNA as described above.
- the labelled target molecules are then hybridised to probes immobilised on the solid support.
- Various solid supports can be used for the pu ⁇ ose, as described previously. Following hybridization, unbound target molecules are removed and signals from target molecules hybridizing to immobilised probes quantified. If radio labelling is performed, Phosphohnager can be used to generate an image file that can be used to generate a raw data set. Depending on the nature of label chosen for labelling the target molecules, other instruments can also be used, for example, when fluorescence is used for labelling, a Fluorolmager can be used to generate an image file from the hybridised target molecules. The raw data conesponding to mean intensity, median intensity, or volume of the signals in each spot can be acquired from the image file using commercially available software for image analysis.
- the acquired data needs to be corrected for background signals and normalized prior to analysis, since, several factors can affect the quality and quantity of the hybridising signals. For example, variations in the quality and quantity of mRNA isolated from sample to sample, subtle variations in the efficiency of labelling target molecules during each reaction, and variations in the amount of unspecific binding between different macroanays can all contribute to noise in the acquired data set that must be corrected for prior to analysis.
- Background conection can be performed in several ways. The lowest pixel intensity within a spot can be used for background subtraction or the mean or median of the line of pixels around the spots' outline can be used for the pu ⁇ ose. One can also define an area representing the background intensity based on the signals generated from negative controls and use the average intensity of this area for background subtraction.
- the background conected data can then be transformed for stabilizing the variance in the data structure and normalized for the differences in probe intensity.
- Normalization can be performed by dividing the intensity of each spot with the collective intensity, average intensity or median intensity of all the spots in a macroarray or a group of spots in a macroanay in order to obtain the relative intensity of signals hybridising to immobilised probes in a macroarray.
- Several- methods have been described for normalizing gene expression data (Richmond and Somerville, 2000, Cunent Opin.
- Cluster analysis is by far the most commonly used technique for gene expression analysis, and has been performed to identify genes that are regulated in a similar manner, and or identifying new/unknown tumour classes using gene expression profiles (Eisen et al., 1998, PNAS, 95, pl4863-14868, Alizadeh et al. 2000, supra, Perou et al.
- clustering genes are grouped into functional categories (clusters) based on their expression profile, satisfying two criteria: homogeneity - the genes in the same cluster are highly similar in expression to each other; and separation - genes in different clusters have low similarity in expression to each other.
- clustering techniques include hierarchical clustering (Eisen et al., 1998, supra; Alizadeh et al. 2000, supra; Perou et al. 2000, supra; Ross et al, 2000, supra), K-means clustering (Herwig et al., 1999, supra; Tavazoie et al, 1999, Nature
- discrimination methods examples include Support Vector Machines (Brown et al, 2000, PNAS, 97, p262-267), Nearest Neighbour (Dudoit et al., 2000, supra), Classification trees (Dudoit et al., 2000, supra), Voted classification (Dudoit et al., 2000, supra), Weighted Gene voting (Golub et al. 1999, supra), and Bayesian classification (Keller et al. 2000, Tec report Univ of Washington).
- PLSR is primarily a method used for regression analysis of continuous data (see Appendix A), it can also be utilized as a method for model building and discriminant analysis using a dummy response matrix based on a binary coding.
- the class assignment is based on a simple dichotomous distinction such as breast cancer (class 1) / healthy (class 2), or a multiple distinction based on multiple disease diagnosis such as breast cancer (class 1) / ovarian cancer (class 2) /healthy (class 3).
- the list of diseases for classification can be increased depending upon the samples available conesponding to other cancers or stages thereof.
- PLSR applied as a classification method is referred to as PLS-DA (DA standing for Discriminant analysis).
- PLS-DA is an extension of the PLSR algorithm in which the Y-matrix is a dummy matrix containing n rows (conesponding to the number of samples) and K columns (conesponding to the number of classes).
- the Y-matrix is constructed by inserting 1 in the kt column and -1 in all the other columns if the conesponding zth object of X belongs to class k.
- a prediction value below 0 means that the sample belongs to the class designated as -1, while a prediction value above 0 implies that the sample belongs to the class designated as 1.
- An advantage of PLSR-DA is that the results obtained can be easily represented in the form of two different plots, the score and loading plots. Score plots represent a projection of the samples onto the principal components and shows the distribution of the samples in the classification model and their relationship to one another.
- Loading plots display conelations between the variables present in the data set. It is usually recommended to use PLS-DA as a starting point for the classification problem due to its ability to handle collinear data, and the property of PLSR as a dimension reduction technique. Once this pu ⁇ ose has been satisfied, it is possible to use other methods such as Linear discriminant analysis, LDA, that has been shown to be effective in extracting further information, Indahl et al. (1999, Chem. and Intell. Lab. Syst, 49, pl9-31). This approach is based on first decomposing the data using PLS-DA, and then using the scores vectors (instead of the original variables) as input to LDA.
- LDA Linear discriminant analysis
- model validation is considered to be amongst the most important aspects of multivariate analysis, and tests the "goodness" of the calibration model which has been built.
- a cross validation approach has been used for validation. In this approach, one or a few samples are kept out in each segment while the model is built using a full cross-validation on the basis of the remaining data. The samples left out are then used for prediction/classification. Repeating the simple cross-validation process several times holding different samples out for each cross-validation leads to a so-called double cross-validation procedure.
- Jackknife has been implemented together with cross-validation. For each variable the difference between the B-coefficients Bi in a cross-validated sub-model and Btot for the total model is first calculated.
- the following approach can be used to select informative probes from a gene expression data set: a) keep out one unique sample (mcluding its repetitions if present in the data set) per cross validation segment; b) build a calibration model (cross validated segment) on the remaining samples using PLSR-DA; c) select the significant genes for the model in step b) using the Jackknife criterion; d) repeat the above 3 steps until all the unique samples in the data set are kept out once (as described in step a).
- the model is then trained k times, each time leaving out one of the subsets from training, but using only the omitted subset to compute enor criterion, RMSEP (Root Mean Square Enor of Prediction). If k equals the sample size, this is called “leave-one-out" cross-validation.
- RMSEP Root Mean Square Enor of Prediction
- the conect approach in this case will be to leave out all replicates of the same samples at a time since that would satisfy assumptions of zero covariance between the CN-segments.
- the second approach for model validation is to use a separate test-set for validating the calibration model. This requires running a separate set of experiments to be used as a test set. This is the preferred approach given that real test data are available.
- the final model is then used to identify a cancer or stage thereof in test samples. For this pu ⁇ ose, expression data of selected informative genes is generated from test samples and then the final model is used to determine whether a sample belongs to a diseased or non-diseased class or has a cancer or stage thereof.
- a model for classification pmposes is generated by using the data relating to the probes identified according to the above described method.
- the sample is as described previously.
- the oligonucleotides which are immobilized in step (a) are randomly selected from within the family described hereinbefore, but alternatively may be selected to represent the different families, e.g. by selecting one or more of the oligonucleotides corresponding to genes encoding proteins with common functions in different families.
- said selection is made to encompass oligonucleotides derived from genes of family (i) and (ii).
- Such oligonucleotides may be of considerable length, e.g.
- cD ⁇ A which is encompassed within the scope of the term "oligonucleotide”
- oligonucleotide which is encompassed within the scope of the term "oligonucleotide”
- the identification of such cD ⁇ A molecules as useful probes allows the development of shorter oligonucleotides which reflect the specificity of the cD ⁇ A molecules but are easier to manufacture and manipulate.
- the above described model may then be used to generate and analyse data of test samples and thus may be used for the diagnostic methods of the invention. In such methods the data generated from the test sample provides the gene expression data set and this is normalized and standardized as described above. This is then fitted to the calibration model described above to provide classification.
- the method described herein can also be used to simultaneously select informative probes for several cancers.
- informative probes can be selected for the said cancers.
- the informative probes selected for one cancer may or may not be similar to the informative probes selected for another cancer of interest. It is the pattem with which the selected genes are expressed in relation to each other during a cancer or stage thereof, that determines whether or not they are informative for the cancer or stage thereof.
- informative genes are selected based on how their expression correlates with the expression of other selected informative genes under the influence of responses generated by the cancer or stage thereof under investigation.
- the gene expression data set must contain the information on how genes are expressed when the subject has a particular cancer or stage thereof under investigation.
- the data set is generated from a set of healthy or diseased samples, where a particular sample may contain the information of only one cancer or stage thereof or may also contain information about multiple cancers or stages thereof.
- the method also teaches an efficient experimental design to reduce the number of samples required for isolating informative probes by selecting samples representing more than one cancer or stage thereof.
- the identification and selection of informative probes for use in diagnosing, monitoring or identifying a particular cancer or stage thereof may be dramatically simplified.
- the pool of genes from which a selection may be made to identify informative probes may be radically reduced.
- the informative probes are selected from a limited number of genes as described in the gene sequence families described hereinbefore. From within these families, probes of interest may be randomly selected. Thus in a prefened aspect, said set of oligonucleotides are randomly selected from the primary oligonucleotides as described hereinbefore.
- random refers to selection which is not biased based on the extent of information carried by the transcripts in relation to the cancer or organism under study, ie. without bias towards their likely utility as informative probes.
- Random selection may be made from a pool of transcripts (or related products) which have been biased, e.g. to highly or moderately expressed transcripts
- a random selection is made from a pool of transcripts not biased or selected by a sequence-based criterion.
- the larger set may therefore contain oligonucleotides conesponding to highly and moderately expressed genes, or alternatively, may be enriched for those corresponding to the highly and moderately express ed genes .
- Random selection from highly and moderately expressed genes can be achieved in a wide variety of ways. For example, by randomly picking a significant number of cDNA clones from a cDNA library constructed from a biological specimen under investigation containing clones corresponding to the gene sequence families described hereinbefore.
- a pool of cDNA enriched for those conesponding to highly and moderately expressed genes can be isolated by this approach.
- the information about the relative level of their transcripts in samples of interest can be generated using several prior art techniques.
- non-sequence based methods such as differential display or RNA f ⁇ nge ⁇ rinting
- sequence-based methods such as microanays or macroanays
- specific primer sequences for highly and moderately expressed genes can be designed and methods such as quantitative RT-PCR can be used to determine the levels of highly and moderately expressed genes.
- a skilled practitioner may use a variety of techniques which are known in the art for determining the relative level of mRNA in a biological sample.
- the sample for the isolation of mRNA in the above described method is as described previously and is preferably not from the site , of disease and the cells in said sample are not disease cells and have not contacted disease cells, for example the use of a peripheral blood sample for detection of non-haematopoietic cancer, e.g. breast cancer.
- Figure 1 shows the possible inte ⁇ lay of various factors responsible for changes in expression in an individual with breast cancer
- Figure 2 shows the projection of 102 normal (including benign) and breast cancer samples onto a classification model generated by PLSR-DA using the data of 35 informative genes, in which PC is the principal components and N and C are normal and breast cancer samples, respectively
- Figure 3 shows a prediction plot based on 3 principal components using the data of 35 cDNAs
- Figure 4 shows the mean level of expression of the 35 genes used for prediction of breast cancer.
- Blood samples were collected from donors with their informed consent under an approval from Regional Ethical Committee of Norway. All donors were treated anonymously during analysis. Blood was drawn from females with a suspect initial mammogram, which included both females with breast cancer and females with abnormal mammograms, prior to any knowledge of whether the abnormality observed during first screening was benign or malignant. In all cases, the blood samples were drawn between 8 a.m. and 4 p.m. From each female, 10 ml blood was drawn by skilled personnel either in vacutainer tubes containing EDTA as anticoagulant (Becton Dickinson, Baltimore, USA) or directly in PAXgeneTM tubes (PreAnalytiX, Hombrechtikon, Switzerland).
- cDNA arrays 1435 cDNA clones were randomly picked from a plasmid library constructed from whole blood of 550 healthy individuals (Clontech, Palo Alto, USA). About 20% of the randomly picked clones were redundant.
- bacterial clones were grown in microtiter plates containing 150 ⁇ l LB with 50 ⁇ g/ml carbenicillin, and incubated overnight with agitation at 37°C. To lyse the cells, 5 ⁇ l of each culture were diluted with 50 ⁇ l H 2 O and incubated for 12 min. at 95°C.
- PCR reactions were performed with the following cycling protocol: 4 min. at 95°C, followed by 25 cycles of 1 min. at 94°C, 1 min. at 60°C and 3 min. at 72°C either in a RoboCycler® Temperature Cycler (Stratagene, La Jolla, USA) or
- DNA Engine Dyad Peltier Thermal Cycler (MJ Research Inc., Waltham, USA).
- the amplified products were denatured with NaOH (0.2 M, final concentration) for 30 min and spotted onto Hybond-N 1" membranes (Amersham Pharmacia Biotech, Little Chalfont, UK), using a MicroGrid II workstation according to the manufacturer's instructions (BioRobotics Ltd, Cambridge England).
- the immobilized cDNAs were fixed using a UN cross-linker (Hoefer Scientific Instruments, San Francisco, USA).
- the printed arrays also contained controls for assessing background level, consistency and sensitivity of the assay. These were spotted at multiple positions and included controls such as PCR mix
- RNA extraction, probe synthesis and hybridization Blood collected in EDTA tubes was thawed at 37°C and transfened to PAX tubes, and total RNA was purified according to the supplier's instructions (PreAnalytiX, Hombrechtikon, Switzerland). From blood collected directly in PAX tubes total RNA was extracted in the tubes as above without any transfer to new tubes. Contaminating DNA was removed from the isolated RNA by DNAase I treatment using DNA-free kit (Ambion, Inc. Austin, USA). RNA quality was determined visually by inspecting the integrity of 28S and 18S ribosomal bands following agarose gel electrophoresis. Only samples from which good quality RNA was extracted were used in this study.
- RNA was isolated using Dynabeads according to the supplier's instructions (Dynal AS, Oslo, Norway). Labelling and hybridization experiments were performed in 16 batches .
- the number of samples assayed in each batch varied from six to nine. To minimize the noise due to batch-to-batch variation in printing, only the arrays manufactured during the same print run were used in each batch. When samples were assayed more than once (replicates), aliquots from the same mRNA pool were used for probe synthesis. For probe synthesis, aliquots of mRNA corresponding to 4-5 ⁇ g of total RNA were mixed together with oligodT 25N v (0.5 ⁇ g/ ⁇ l) and mRNA spikes of SpotReportTM 10 anay validation system (10 pg; Spike 2, 1 pg), heated to 70°C, and then chilled on ice.
- Probes were prepared in 35 ⁇ l reaction mixes by reverse transcription in the presence of 50 ⁇ Ci [ ⁇ 33 P] dATP, 3.5 ⁇ M dATP, 0.6 mM each of dCTP, dTTP, dGTP, 200 units of
- the membranes were equilibrated in 4 x SSC for 2 hr at room temperature and prehybridized overnight at 65° C in 10 ml prehybridization solution (4 x SSC, 0.1 M NaH 2 PO 4j 1 mM EDTA, 8% dextran sulphate, 10 x Denhardt's solution, 1% SDS). Freshly prepared probes were added to 5 ml of the same prehybridization solution, and hybridization continued overnight at 65°C. The membranes were washed at 65°C with increasing stringency (2 x 30 min. each in 2 x SSC, 0.1% SDS; 1 x SSC, 0.1% S DS; 0.1 x SSC, 0.1% SDS).
- the hybridized membranes were exposed to Phosphoscreen (super resolution) for two days and an image file generated using Phospholmager (Cyclone, Packard, Meriden, USA).
- Phospholmager Cyclone, Packard, Meriden, USA.
- Phoretix software Non Linear Dynamics, UK.
- the median of the line of pixels around each spot outline was subtracted from the intensity of the signals assessed in each spot.
- the pre-processed data was then used to isolate the informative probes by: a) building a crossvalidated PLSR model, where one unique sample (including all repetitions of the selected sample) was kept out per cross- validation segment.
- step b) selecting the set of significant genes for the model in step a) using the Jackknife criterion.
- step c) building a crossvalidated PLSR-DA model as in step a) using the gene selected in step b). d) selecting again the set of most significant genes for the model in step c) using the Jackknife criterion.
- Step b) resulted in 125 genes.
- Step d) resulted in selection of 35 significant genes. Based on these genes a final classification model was constructed.
- the selected informative probes based on occurrence criterion were used to constract a classification model.
- the result of the classification model based on 35 probes is shown in Figure 2 in which it is seen that the expression pattern of these genes was able to classify most women with breast cancer and women with no breast cancer into distinct groups.
- PCI and PC2 indicate the two principal components statistically derived from the data which best define the systemic variability present in the data. This allows each sample, and the data from each of the informative probes to which the sample's labelled first strand cDNA was bound, to be represented on the classification model as a single point which is a projection of the sample onto the principal components - the score plot.
- Figure 3 shows the prediction plot using the 35 significant genes.
- the cancer samples appear on the x axis at +1 and the non-cancer samples appear at -1.
- the y axis represents the predicted class membership.
- cancer samples should fall above zero and non-cancer samples should fall below zero. In each case almost all samples are correctly predicted.
- cross-validation 102 experimental samples were divided into 60 cross-validation segments where each segment represented one unique sample and included its replicates if present.
- Figure 4 shows the expression level of the 35 genes and it will be seen that some are over-expressed and others under-expressed relative to expression in normal patients.
- Example 2 Identification of further informative probes and use in diagnosis of breast cancer
- Example 2 The methods of identification and analysis used were essentially as described in Example 1 , except that instead of preparing a cDNA anay, samples were analysed using a commercially available platform for large-scale gene expression analysis (Agilent 22K chip).
- a larger number of samples comprising 122 in total (78 control and 44 with breast cancer) were analysed.
- the data was analysed using PLSR as described previously.
- the genes of interest were selected by a 10-fold cross validation approach.
- the data from 122 samples was divided into 10 sets, each set containing 12-13 samples.
- a calibration model was built on 9 sets leaving out one set.
- Significant genes were identified by the Jackknife technique on the built-in model. These steps were repeated for all 10 sets, in which each set was kept out at least once. Informative genes were then identified based on the frequency of occunence criterion. 109 genes were found to informative in all 10 calibration models.
- the 109 informative genes may be divided into three categories, namely those falling into families (i) and (ii) as described herein and other genes.
- Table 3 provides details of the informative probes whose corresponding genes fall into families (i) and (ii) and provides the number assigned by Agilent to that probe.
- Table 4 similarly provides details of the informative probes whose corresponding genes do not appear to fall within families (i) and (ii).
- Tables 5 and 6 provide details of the genes to which the probes in Tables 3 and 4, respectively, show sequence similarity, their putative biological function where known and the accession numbers for those genes. Appendix A
- Y (NxJ) being the Jpredicted variables.
- Y represents a matrix containing dummy variables
- F is a NxJ matrix of residuals.
- the structure of the PLSR model can be written as:
- T (NxA) is a matrix of score vectors which are linear combinations of the x-variables
- P (PxA) is a matrix with the x-loading vectors p a as columns
- Q (JxA) is a matrix with the y-loading vectors q a as columns
- E a (NxP) is the matrix for X after A factors
- F a (NxJ) is the matrix for Y after A factors.
- the criterion in PLSR is to maximize the explained covariance of [X,Y]. This is achieved by the loading weights vector w a+ ⁇ , which is the first eigenvector of
- E a T F a Fa T E a (E a and F a are the deflated X and Y after a factors or PLS components).
- a PLSR model with full rank, i.e. maximum number of components, is equivalent to the MLR solutions. Further details on PLSR can be found in
- GAATGTGACCCTTACTCTGGCCTCTTGAATGATACTGAGGAACAACTCTGAC AACCACAATCATGAGGATGATGTGTTGGGGTTTCCCAGCAATCAGGACTTGTAT TGGTCAGAGGACGATCAAGAGCTCATAATCCCATGCCTTGCGCTGGTGAGAGCA TCCAAAGCCTGCCTGAAGAAAATTCGGATGTTAGTGGCAGAGAATGGGAAGAAG GATCAGGTGGCACAGCTGGATGACATTGTGGATATTTCTGATGAAATCAGCCCT
- Stage 1 in situ carcinoma
- Stage II invasive carcinoma with tumour size > 20-50 mm
- Stage IE invasive carcinoma with tumour size >50 mm
- Stage IV cancer spread to distant parts.
- IDC invasive ductal carcinoma
- DCIS ductal carcinoma in situ
- TLC invasive lobular carcinoma.
- Subgroup A3 Women with no breast abnormality
- Table 2 Details of the 35 significant genes selected by Jackknife. Their position in the array, clone ID is shown as well as the accession number of sequences in public databases that match them, and their known or putative cellular function.
- Accession numbers 1 and 2 provide alternative accession numbers for the gene. The relevant sequence may be identified in the NCBI database (www.ncbi.nlm.nih.gov).
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| SI200531251T SI1766056T1 (sl) | 2004-06-02 | 2005-06-02 | Oligonukleotidi za diagnozo raka na prsih |
| AU2005250219A AU2005250219B2 (en) | 2004-06-02 | 2005-06-02 | Oligonucleotides for cancer diagnosis |
| CA002568889A CA2568889A1 (en) | 2004-06-02 | 2005-06-02 | Oligonucleotides for cancer diagnosis |
| AP2006003862A AP2006003862A0 (en) | 2004-06-02 | 2005-06-02 | Oligonucleotides for cancer diagnosis |
| DE602005025633T DE602005025633D1 (https=) | 2004-06-02 | 2005-06-02 | |
| AT05747218T ATE493511T1 (de) | 2004-06-02 | 2005-06-02 | Oligonukleotide zur brustkrebsdiagnose |
| JP2007514130A JP5060945B2 (ja) | 2004-06-02 | 2005-06-02 | 癌診断のためのオリゴヌクレオチド |
| US11/628,300 US8105773B2 (en) | 2004-06-02 | 2005-06-02 | Oligonucleotides for cancer diagnosis |
| DK05747218.5T DK1766056T3 (da) | 2004-06-02 | 2005-06-02 | Oligonukleotider til brystcancerdiagnose |
| EP05747218A EP1766056B1 (en) | 2004-06-02 | 2005-06-02 | Oligonucleotides for breast cancer diagnosis |
| NZ551797A NZ551797A (en) | 2004-06-02 | 2005-06-02 | Oligonucleotides for cancer diagnosis |
| NO20065939A NO20065939L (no) | 2004-06-02 | 2006-12-20 | Oligonukleotider for cancerdiagnose |
| US13/344,088 US20120295800A1 (en) | 2004-06-02 | 2012-01-05 | Oligonucleotides for cancer diagnosis |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB0412301.4 | 2004-06-02 | ||
| GBGB0412301.4A GB0412301D0 (en) | 2004-06-02 | 2004-06-02 | Product and method |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/344,088 Continuation US20120295800A1 (en) | 2004-06-02 | 2012-01-05 | Oligonucleotides for cancer diagnosis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2005118851A1 true WO2005118851A1 (en) | 2005-12-15 |
Family
ID=32696533
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2005/002180 Ceased WO2005118851A1 (en) | 2004-06-02 | 2005-06-02 | Oligonucleotides for cancer diagnosis |
Country Status (17)
| Country | Link |
|---|---|
| US (2) | US8105773B2 (https=) |
| EP (1) | EP1766056B1 (https=) |
| JP (1) | JP5060945B2 (https=) |
| CN (1) | CN101027410A (https=) |
| AP (1) | AP2006003862A0 (https=) |
| AT (1) | ATE493511T1 (https=) |
| AU (1) | AU2005250219B2 (https=) |
| CA (1) | CA2568889A1 (https=) |
| DE (1) | DE602005025633D1 (https=) |
| DK (1) | DK1766056T3 (https=) |
| ES (1) | ES2358910T3 (https=) |
| GB (1) | GB0412301D0 (https=) |
| NO (1) | NO20065939L (https=) |
| NZ (1) | NZ551797A (https=) |
| SI (1) | SI1766056T1 (https=) |
| WO (1) | WO2005118851A1 (https=) |
| ZA (1) | ZA200610644B (https=) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1852513A3 (en) * | 2006-04-12 | 2008-07-09 | FUJIFILM Corporation | Method for diagnosing cancer using cancer-associated deletion gene marker |
| JP2009089696A (ja) * | 2007-10-12 | 2009-04-30 | Seikagaku Kogyo Co Ltd | 遺伝子サブトラクション用の担体及びその利用 |
| EP1907857A4 (en) * | 2005-05-26 | 2009-08-05 | Univ Johns Hopkins | BIOMARKER FOR BREAST CANCER |
| WO2011086174A3 (en) * | 2010-01-15 | 2011-10-06 | Diagenic Asa | Diagnostic gene expression platform |
| WO2014081313A1 (en) * | 2012-11-20 | 2014-05-30 | University Of Tromsoe | Gene expression profile in diagnostics |
| WO2018007872A1 (en) * | 2016-07-05 | 2018-01-11 | Cambridge Enterprise Limited | Biomarkers for inflammatory bowel disease |
| US10961588B2 (en) | 2014-11-27 | 2021-03-30 | Université De Tours | Hemopathy prognosis method |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2501845A4 (en) * | 2009-11-20 | 2013-04-24 | Univ Louisville Res Found | KREBSBIOMARKER |
| EP3825693A1 (en) * | 2011-04-29 | 2021-05-26 | Cancer Prevention And Cure, Ltd. | Methods of identification and diagnosis of lung diseases using classification systems and kits thereof |
| WO2014055543A2 (en) * | 2012-10-01 | 2014-04-10 | Millennium Pharmaceuticals, Inc. | Biomarkers and methods to predict response to inhibitors and uses thereof |
| SG11201605316VA (en) * | 2013-12-29 | 2016-07-28 | Curelab Oncology Inc | Methods and compositions relating to p62/sqstm1 for the treatment and prevention of inflammation-associated diseases |
| CA3224457A1 (en) * | 2014-06-18 | 2015-12-23 | Toray Industries, Inc. | Esophageal cancer detection kit or device, and detection method |
| US10140708B2 (en) * | 2016-01-21 | 2018-11-27 | Riverside Research Institute | Method for gestational age estimation and embryonic mutant detection |
| EP3669325B1 (en) * | 2017-08-14 | 2023-09-27 | Raytheon Company | Subtraction algorithm for detection of tumors |
| CN109529018B (zh) * | 2019-01-10 | 2021-11-30 | 南方医科大学南方医院 | Atxn2l用于制备逆转胃癌奥沙利铂耐药的药物的用途 |
| CN109596611A (zh) * | 2019-01-21 | 2019-04-09 | 湖北紫荆生物技术有限公司 | 一种水体钙含量测试剂及水体钙含量测量方法 |
| US11475558B2 (en) | 2019-11-13 | 2022-10-18 | Raytheon Company | Organ isolation in scan data |
| US11282209B2 (en) | 2020-01-10 | 2022-03-22 | Raytheon Company | System and method for generating contours |
| US11893745B2 (en) | 2020-12-09 | 2024-02-06 | Raytheon Company | System and method for generating and displaying contours |
| US11562512B2 (en) | 2020-12-09 | 2023-01-24 | Raytheon Company | System and method for generating and displaying contours |
| CN113913436B (zh) * | 2021-11-18 | 2023-09-29 | 天津市肿瘤医院(天津医科大学肿瘤医院) | 逆转录转座基因l1-atp8b1及其作为肺鳞癌标志物的用途和治疗肺鳞癌的药物 |
| CN115976212B (zh) * | 2022-12-21 | 2024-06-11 | 四川大学华西医院 | 一种用于检测骨肿瘤诊断相关基因的探针库及试剂盒 |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0979308A1 (en) * | 1997-04-30 | 2000-02-16 | Forskningsparken I AS AS | Method of preparing a standard diagnostic gene transcript pattern |
| WO2002057787A2 (en) * | 2001-01-12 | 2002-07-25 | Yale University | Detection of survivin in the biological fluids of cancer patients |
| WO2002059271A2 (en) * | 2001-01-25 | 2002-08-01 | Gene Logic, Inc. | Gene expression profiles in breast tissue |
| US20030068642A1 (en) * | 2001-05-31 | 2003-04-10 | Chronix Biomedical | Methods for generating an mRNA expression profile from an acellular mRNA containing blood sample and using the same to identify functional state markers |
| US20030175736A1 (en) * | 2001-08-02 | 2003-09-18 | The Regents Of The University Of Michigan | Expression profile of prostate cancer |
| US20030219760A1 (en) * | 2001-09-05 | 2003-11-27 | The Brigham And Women's Hospital, Inc. | Diagnostic and prognostic tests |
| US20030232350A1 (en) * | 2001-11-13 | 2003-12-18 | Eos Biotechnology, Inc. | Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer |
| WO2004046382A2 (en) * | 2002-11-21 | 2004-06-03 | Diagenic As | Product and method |
Family Cites Families (69)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4981783A (en) | 1986-04-16 | 1991-01-01 | Montefiore Medical Center | Method for detecting pathological conditions |
| US6040138A (en) | 1995-09-15 | 2000-03-21 | Affymetrix, Inc. | Expression monitoring by hybridization to high density oligonucleotide arrays |
| US5800992A (en) | 1989-06-07 | 1998-09-01 | Fodor; Stephen P.A. | Method of detecting nucleic acids |
| US5925525A (en) | 1989-06-07 | 1999-07-20 | Affymetrix, Inc. | Method of identifying nucleotide differences |
| US5871928A (en) | 1989-06-07 | 1999-02-16 | Fodor; Stephen P. A. | Methods for nucleic acid analysis |
| JP2802125B2 (ja) | 1989-06-23 | 1998-09-24 | キヤノン株式会社 | 核酸の検出方法 |
| US5474796A (en) | 1991-09-04 | 1995-12-12 | Protogene Laboratories, Inc. | Method and apparatus for conducting an array of chemical reactions on a support surface |
| ATE143700T1 (de) | 1991-09-23 | 1996-10-15 | Pfizer | Verfahren für die detektion von spezifische mrns und dns in zellen |
| GB2260811B (en) | 1991-10-23 | 1995-07-05 | Yorkshire Cancer Research Camp | Detection of malignant tumours |
| CA2131444A1 (en) | 1992-03-04 | 1993-09-16 | Kelli E. Smith | Dna encoding taurine and gaba transporters and uses thereof |
| US6114114A (en) | 1992-07-17 | 2000-09-05 | Incyte Pharmaceuticals, Inc. | Comparative gene transcript analysis |
| US5633137A (en) | 1992-12-01 | 1997-05-27 | The University Of South Florida | Method for measuring specific gene expression: transcriptional activity per gene dose |
| US5677125A (en) | 1994-01-14 | 1997-10-14 | Vanderbilt University | Method of detection and diagnosis of pre-invasive cancer |
| US5830645A (en) | 1994-12-09 | 1998-11-03 | The Regents Of The University Of California | Comparative fluorescence hybridization to nucleic acid arrays |
| US5545531A (en) | 1995-06-07 | 1996-08-13 | Affymax Technologies N.V. | Methods for making a device for concurrently processing multiple biological chip assays |
| US6156502A (en) | 1995-12-21 | 2000-12-05 | Beattie; Kenneth Loren | Arbitrary sequence oligonucleotide fingerprinting |
| JP2002515738A (ja) | 1996-01-23 | 2002-05-28 | アフィメトリックス,インコーポレイティド | 核酸分析法 |
| EP0937159A4 (en) | 1996-02-08 | 2004-10-20 | Affymetrix Inc | SPECIATION OF MICROORGANISMS FROM MICROPLATES AND CHARACTERIZATION OF THE PHENOTYPES THEREOF |
| WO1998008083A1 (en) | 1996-08-20 | 1998-02-26 | Motorola Inc. | Method and apparatus for detecting predetermined molecular structures in a sample |
| US6235474B1 (en) | 1996-12-30 | 2001-05-22 | The Johns Hopkins University | Methods and kits for diagnosing and determination of the predisposition for diseases |
| US6190857B1 (en) | 1997-03-24 | 2001-02-20 | Urocor, Inc. | Diagnosis of disease state using MRNA profiles in peripheral leukocytes |
| US5994076A (en) | 1997-05-21 | 1999-11-30 | Clontech Laboratories, Inc. | Methods of assaying differential expression |
| WO1999006831A2 (en) | 1997-07-29 | 1999-02-11 | Dorssers Lambert C J | Breast cancer resistance genes, methods for their detection and uses thereof |
| US6607879B1 (en) | 1998-02-09 | 2003-08-19 | Incyte Corporation | Compositions for the detection of blood cell and immunological response gene expression |
| US6174680B1 (en) * | 1998-12-30 | 2001-01-16 | Dana-Farber Cancer Institute, Inc. | Method for identifying mismatch repair glycosylase reactive sites, compounds and uses thereof |
| JP2002505431A (ja) | 1998-02-25 | 2002-02-19 | アメリカ合衆国 | 迅速な分子プロファイリングのための細胞アッセイ法 |
| US6004755A (en) | 1998-04-07 | 1999-12-21 | Incyte Pharmaceuticals, Inc. | Quantitative microarray hybridizaton assays |
| US6696246B1 (en) | 1998-08-21 | 2004-02-24 | Naxcor, Inc. | Assays using crosslinkable immobilized nucleic acids |
| US20090233276A1 (en) * | 1998-09-22 | 2009-09-17 | Oncomedx, Inc. | Method Enabling the Use of Extracellular Ribonucleic Acid (RNA) Extracted from Plasma or Serum to Detect, Monitor or Evaluate Cancer or Premalignant Conditions |
| EP1121471A1 (en) | 1998-10-13 | 2001-08-08 | Clontech Laboratories, Inc. | Nucleic acid arrays |
| US6593084B2 (en) | 1998-10-13 | 2003-07-15 | Robert E. Bird | Carcinogen assay |
| WO2000024940A1 (en) | 1998-10-28 | 2000-05-04 | Vysis, Inc. | Cellular arrays and methods of detecting and using genetic disorder markers |
| WO2000026412A1 (en) | 1998-11-02 | 2000-05-11 | Kenneth Loren Beattie | Nucleic acid analysis using sequence-targeted tandem hybridization |
| US20050042630A1 (en) | 1999-01-06 | 2005-02-24 | Chondrogene Limited | Method for the detection of asthma related gene transcripts in blood |
| US20040265868A1 (en) | 1999-01-06 | 2004-12-30 | Chondrogene Limited | Method for the detection of depression related gene transcripts in blood |
| US20040241727A1 (en) | 1999-01-06 | 2004-12-02 | Chondrogene Limited | Method for the detection of schizophrenia related gene transcripts in blood |
| AU1853600A (en) | 1999-01-06 | 2000-07-24 | Choong-Chin Liew | Method for the detection of gene transcripts in blood and uses thereof |
| US20040248170A1 (en) | 1999-01-06 | 2004-12-09 | Chondrogene Limited | Method for the detection of hyperlipidemia related gene transcripts in blood |
| US20050123938A1 (en) | 1999-01-06 | 2005-06-09 | Chondrogene Limited | Method for the detection of osteoarthritis related gene transcripts in blood |
| US20040248169A1 (en) | 1999-01-06 | 2004-12-09 | Chondrogene Limited | Method for the detection of obesity related gene transcripts in blood |
| US20040241728A1 (en) | 1999-01-06 | 2004-12-02 | Chondrogene Limited | Method for the detection of lung disease related gene transcripts in blood |
| US20050003394A1 (en) | 1999-01-06 | 2005-01-06 | Chondrogene Limited | Method for the detection of rheumatoid arthritis related gene transcripts in blood |
| US20040265869A1 (en) | 1999-01-06 | 2004-12-30 | Chondrogene Limited | Method for the detection of type II diabetes related gene transcripts in blood |
| US20040241726A1 (en) | 1999-01-06 | 2004-12-02 | Chondrogene Limited | Method for the detection of allergies related gene transcripts in blood |
| US7473528B2 (en) | 1999-01-06 | 2009-01-06 | Genenews Inc. | Method for the detection of Chagas disease related gene transcripts in blood |
| DE19937187A1 (de) * | 1999-08-06 | 2001-03-01 | Qiagen Gmbh | Automatisierte Proteinreinigung im Multiwellformat durch Vakuumfiltration |
| AU2001277172A1 (en) * | 2000-07-26 | 2002-02-05 | Applied Genomics, Inc. | Bstp-trans protein and related reagents and methods of use thereof |
| US7108969B1 (en) * | 2000-09-08 | 2006-09-19 | Affymetrix, Inc. | Methods for detecting and diagnosing oral cancer |
| US6955876B2 (en) * | 2000-11-01 | 2005-10-18 | Kane Michael D | Compositions and systems for identifying and comparing expressed genes (mRNAs) in eukaryotic organisms |
| WO2002059367A2 (en) | 2000-11-30 | 2002-08-01 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Diagnostic microarray for inflammatory bowel disease, crohn's disease and ulcerative colitis |
| US20020132274A1 (en) * | 2001-01-17 | 2002-09-19 | Nevalainen Marja T. | Diagnostic and monitorings methods for cancer |
| JP2004536575A (ja) | 2001-02-28 | 2004-12-09 | コンドロジーン・インコーポレイテッド | 変形性関節症に関連する組成物および方法 |
| WO2002088750A2 (en) * | 2001-05-02 | 2002-11-07 | Oxford Glycosciences (Uk) Ltd | Proteins, genes and their use for diagnosis and treatment of breast cancer |
| US20020169560A1 (en) | 2001-05-12 | 2002-11-14 | X-Mine | Analysis mechanism for genetic data |
| US7335467B2 (en) * | 2001-05-15 | 2008-02-26 | Ludwig Institute For Cancer Research | Breast cancer antigens |
| AU2002346008A1 (en) * | 2001-06-28 | 2003-03-03 | Dermtech International | Method for detection of melanoma |
| US20030099973A1 (en) * | 2001-07-18 | 2003-05-29 | University Of Louisville Research Foundation, Inc. | E-GeneChip online web service for data mining bioinformatics |
| US7371736B2 (en) * | 2001-11-07 | 2008-05-13 | The Board Of Trustees Of The University Of Arkansas | Gene expression profiling based identification of DKK1 as a potential therapeutic targets for controlling bone loss |
| JP2005512557A (ja) * | 2001-11-07 | 2005-05-12 | ザ ボード オブ トラスティーズ オブ ザ ユニヴァーシティー オブ アーカンソー | 遺伝子発現プロファイリングに基づく多発性骨髄腫の診断、予後、および治療標的候補の同定 |
| US20030225526A1 (en) * | 2001-11-14 | 2003-12-04 | Golub Todd R. | Molecular cancer diagnosis using tumor gene expression signature |
| WO2003058201A2 (en) * | 2001-12-31 | 2003-07-17 | Quark Biotech, Inc. | Methods for identifying marker genes for cancer |
| US20030195431A1 (en) * | 2002-04-10 | 2003-10-16 | Sukhatme Vikas P. | Observation of effects of body fluids on indicator cells for disease diagnosis |
| US20040005615A1 (en) * | 2002-05-24 | 2004-01-08 | Jing Li | Amplification and overexpression of oncogenes |
| WO2004021010A2 (en) * | 2002-08-30 | 2004-03-11 | Oncotherapy Science, Inc. | Method of diagnosing colon and gastric cancers |
| WO2004024892A2 (en) | 2002-09-12 | 2004-03-25 | Chondrogene Inc. | Identification of sequences particularly useful for the diagnosis and identification of therapeutic targets for osteoarthritis |
| US20060024692A1 (en) * | 2002-09-30 | 2006-02-02 | Oncotherapy Science, Inc. | Method for diagnosing non-small cell lung cancers |
| US7910550B2 (en) * | 2004-04-16 | 2011-03-22 | Stc.Unm | Human kunitz-type inhibitor with enhanced antifibrinolytic activity |
| US20090118132A1 (en) * | 2004-11-04 | 2009-05-07 | Roche Molecular Systems, Inc. | Classification of Acute Myeloid Leukemia |
| US20070178503A1 (en) * | 2005-12-19 | 2007-08-02 | Feng Jiang | In-situ genomic DNA chip for detection of cancer |
-
2004
- 2004-06-02 GB GBGB0412301.4A patent/GB0412301D0/en not_active Ceased
-
2005
- 2005-06-02 WO PCT/GB2005/002180 patent/WO2005118851A1/en not_active Ceased
- 2005-06-02 AP AP2006003862A patent/AP2006003862A0/xx unknown
- 2005-06-02 DE DE602005025633T patent/DE602005025633D1/de not_active Expired - Lifetime
- 2005-06-02 US US11/628,300 patent/US8105773B2/en not_active Expired - Fee Related
- 2005-06-02 DK DK05747218.5T patent/DK1766056T3/da active
- 2005-06-02 JP JP2007514130A patent/JP5060945B2/ja not_active Expired - Fee Related
- 2005-06-02 CA CA002568889A patent/CA2568889A1/en not_active Abandoned
- 2005-06-02 ES ES05747218T patent/ES2358910T3/es not_active Expired - Lifetime
- 2005-06-02 ZA ZA200610644A patent/ZA200610644B/en unknown
- 2005-06-02 CN CN200580026265.8A patent/CN101027410A/zh active Pending
- 2005-06-02 SI SI200531251T patent/SI1766056T1/sl unknown
- 2005-06-02 AU AU2005250219A patent/AU2005250219B2/en not_active Ceased
- 2005-06-02 AT AT05747218T patent/ATE493511T1/de not_active IP Right Cessation
- 2005-06-02 NZ NZ551797A patent/NZ551797A/en not_active IP Right Cessation
- 2005-06-02 EP EP05747218A patent/EP1766056B1/en not_active Expired - Lifetime
-
2006
- 2006-12-20 NO NO20065939A patent/NO20065939L/no not_active Application Discontinuation
-
2012
- 2012-01-05 US US13/344,088 patent/US20120295800A1/en not_active Abandoned
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0979308A1 (en) * | 1997-04-30 | 2000-02-16 | Forskningsparken I AS AS | Method of preparing a standard diagnostic gene transcript pattern |
| WO2002057787A2 (en) * | 2001-01-12 | 2002-07-25 | Yale University | Detection of survivin in the biological fluids of cancer patients |
| WO2002059271A2 (en) * | 2001-01-25 | 2002-08-01 | Gene Logic, Inc. | Gene expression profiles in breast tissue |
| US20030068642A1 (en) * | 2001-05-31 | 2003-04-10 | Chronix Biomedical | Methods for generating an mRNA expression profile from an acellular mRNA containing blood sample and using the same to identify functional state markers |
| US20030175736A1 (en) * | 2001-08-02 | 2003-09-18 | The Regents Of The University Of Michigan | Expression profile of prostate cancer |
| US20030219760A1 (en) * | 2001-09-05 | 2003-11-27 | The Brigham And Women's Hospital, Inc. | Diagnostic and prognostic tests |
| US20030232350A1 (en) * | 2001-11-13 | 2003-12-18 | Eos Biotechnology, Inc. | Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer |
| WO2004046382A2 (en) * | 2002-11-21 | 2004-06-03 | Diagenic As | Product and method |
Non-Patent Citations (3)
| Title |
|---|
| ALIZADEH A A ET AL: "DISTINCT TYPES OF DIFFUSE LARGE B-CELL LYMPHOMA IDENTIFIED BY GENE EXPRESSION PROFILING", NATURE, NATURE PUBLISHING GROUP, LONDON, GB, vol. 403, 3 February 2000 (2000-02-03), pages 503 - 512, XP002943414, ISSN: 0028-0836 * |
| BROOKS ET AL: "Transcript Profiles of Microdissected Tissue in a Mouse Model of Idiopathic Parkinson's isease Using the Ribo-SPIATM Amplification Process", November 2003 (2003-11-01), pages 1, XP002353003, Retrieved from the Internet <URL:http://www.nugentechnologies.com/pdfs/ASofNEURO-Nov03_AA_Poster.pdf> [retrieved on 20051108] * |
| DATABASE GEO PROFILES [online] NCBI; 2 January 2004 (2004-01-02), "http://www.ncbi.nih.gov/projects/geo/query/acc.cgi?acc=GPL887", XP002353005, retrieved from NCBI Database accession no. GPL887 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1907857A4 (en) * | 2005-05-26 | 2009-08-05 | Univ Johns Hopkins | BIOMARKER FOR BREAST CANCER |
| EP1852513A3 (en) * | 2006-04-12 | 2008-07-09 | FUJIFILM Corporation | Method for diagnosing cancer using cancer-associated deletion gene marker |
| JP2009089696A (ja) * | 2007-10-12 | 2009-04-30 | Seikagaku Kogyo Co Ltd | 遺伝子サブトラクション用の担体及びその利用 |
| WO2011086174A3 (en) * | 2010-01-15 | 2011-10-06 | Diagenic Asa | Diagnostic gene expression platform |
| WO2014081313A1 (en) * | 2012-11-20 | 2014-05-30 | University Of Tromsoe | Gene expression profile in diagnostics |
| US10961588B2 (en) | 2014-11-27 | 2021-03-30 | Université De Tours | Hemopathy prognosis method |
| WO2018007872A1 (en) * | 2016-07-05 | 2018-01-11 | Cambridge Enterprise Limited | Biomarkers for inflammatory bowel disease |
| US10202651B2 (en) | 2016-07-05 | 2019-02-12 | Cambridge Enterprise Limited | Biomarkers for inflammatory bowel disease |
| CN109477145A (zh) * | 2016-07-05 | 2019-03-15 | 剑桥企业有限公司 | 炎症性肠病的生物标志物 |
| US10640829B2 (en) | 2016-07-05 | 2020-05-05 | Cambridge Enterprise Limited | Biomarkers for Inflammatory Bowel Disease |
| CN109477145B (zh) * | 2016-07-05 | 2021-04-09 | 剑桥企业有限公司 | 炎症性肠病的生物标志物 |
| US11041206B2 (en) | 2016-07-05 | 2021-06-22 | Cambridge Enterprise Limited | Biomarkers for inflammatory bowel disease |
Also Published As
| Publication number | Publication date |
|---|---|
| NZ551797A (en) | 2010-03-26 |
| DK1766056T3 (da) | 2011-03-14 |
| JP2008501332A (ja) | 2008-01-24 |
| CA2568889A1 (en) | 2005-12-15 |
| DE602005025633D1 (https=) | 2011-02-10 |
| ATE493511T1 (de) | 2011-01-15 |
| AP2006003862A0 (en) | 2006-12-31 |
| US8105773B2 (en) | 2012-01-31 |
| AU2005250219A1 (en) | 2005-12-15 |
| SI1766056T1 (sl) | 2011-05-31 |
| US20080026385A1 (en) | 2008-01-31 |
| EP1766056B1 (en) | 2010-12-29 |
| US20120295800A1 (en) | 2012-11-22 |
| ZA200610644B (en) | 2008-07-30 |
| GB0412301D0 (en) | 2004-07-07 |
| AU2005250219B2 (en) | 2011-01-20 |
| CN101027410A (zh) | 2007-08-29 |
| NO20065939L (no) | 2007-02-08 |
| ES2358910T3 (es) | 2011-05-16 |
| JP5060945B2 (ja) | 2012-10-31 |
| EP1766056A1 (en) | 2007-03-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2005118851A1 (en) | Oligonucleotides for cancer diagnosis | |
| WO2011086174A2 (en) | Diagnostic gene expression platform | |
| DK2158332T3 (en) | PROGRAM FORECAST FOR MELANANCANCES | |
| EP2121988B1 (en) | Prostate cancer survival and recurrence | |
| US20180172689A1 (en) | Methods for diagnosis of bladder cancer | |
| US8105777B1 (en) | Methods for diagnosis and/or prognosis of colon cancer | |
| EP1565574A2 (en) | Product and method | |
| NZ555353A (en) | TNF antagonists | |
| US20090117561A1 (en) | Differential expression gene profiles and applications in molecular staging of human gastric cancer | |
| JP2006505256A (ja) | ドセタキセルの化学感受性および化学耐性を予測するための異なる遺伝子発現パターン | |
| JP2012511323A (ja) | 腫瘍中のerbb2の変化を特定するための方法 | |
| US20100184065A1 (en) | Method of Predicting Non-Response to First Line Chemotherapy | |
| HK1145342B (en) | Prognosis prediction for melanoma cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2005250219 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2568889 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007514130 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 551797 Country of ref document: NZ |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006/10644 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: AP/P/2006/003862 Country of ref document: AP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005747218 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 7905/DELNP/2006 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2005250219 Country of ref document: AU Date of ref document: 20050602 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005250219 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200580026265.8 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005747218 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11628300 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 11628300 Country of ref document: US |