WO2005107793A2 - Ngal for reduction and amelioration of ischemic and nephrotoxic injuries - Google Patents
Ngal for reduction and amelioration of ischemic and nephrotoxic injuries Download PDFInfo
- Publication number
- WO2005107793A2 WO2005107793A2 PCT/US2005/015799 US2005015799W WO2005107793A2 WO 2005107793 A2 WO2005107793 A2 WO 2005107793A2 US 2005015799 W US2005015799 W US 2005015799W WO 2005107793 A2 WO2005107793 A2 WO 2005107793A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ngal
- kidney
- ischemic
- injury
- organ
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N1/00—Preservation of bodies of humans or animals, or parts thereof
- A01N1/10—Preservation of living parts
- A01N1/12—Chemical aspects of preservation
- A01N1/122—Preservation or perfusion media
- A01N1/126—Physiologically active agents, e.g. antioxidants or nutrients
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/025—Enterobacteriales, e.g. Enterobacter
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/10—Drugs for disorders of the urinary system of the bladder
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
- A61P39/02—Antidotes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/08—Vasodilators for multiple indications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/12—Antihypertensives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/34—Genitourinary disorders
- G01N2800/347—Renal failures; Glomerular diseases; Tubulointerstitial diseases, e.g. nephritic syndrome, glomerulonephritis; Renovascular diseases, e.g. renal artery occlusion, nephropathy
Definitions
- the present invention relates to methods of reducing or ameliorating ischemic and nephrotoxic injury in organs.
- the invention further relates to the treatment of patients suffering from various diseases that are associated with ischemic and toxin-induced injury or insult.
- the invention further relates to the treatment of patients suffering from acute or chronic kidney injury.
- a decrease in oxygen flow to an organ triggers a complex series of events that affect the structure and function of virtually every organelle and subcellular system of the affected cells.
- Ischemia-reperfusion restoration of blood flow
- ROS reactive oxygen species
- RNS reactive nitrogen species
- oxidative stress results in a series of events such as alterations in mitochondrial oxidative phosphorylation, depletion of ATP, an increase in intracellular calcium and activation of protein kinases, phosphatases, proteases, lipases and nucleases leading to loss of cellular function/integrity.
- DGF delayed graft function
- ATN acute tubular necrosis
- DGF Downlink fibroblast growth factor
- ischemic and nephrotoxic renal injury have shown that proximal tubule cells undergo a complex temporal sequence of events, including loss of cell polarity, cell death due to apoptosis and necrosis, de-differentiation and proliferation of viable cells, and re-establishment of the epithelial phenotype.
- ischemic or nephrotoxic damage cells may die through two different processes.
- Apoptosis or programmed cell death (“cell suicide”) is a physiological mechanism for removing senescent, damaged or abnormal cells that affects individual cells.
- Apoptosis is initiated by an endonuclease and is characterized by DNA fragmentation into multiples of 180 - 200 base pairs.
- Apoptotic cells are ingested by macrophages or neighboring cells without release of proteolytic enzymes or toxic oxygen species and the process is not accompanied by inflammation.
- necrosis is a pathological process that affects populations of cells and results in focal tissue destruction, inflammation and often serious systemic consequences.
- Apoptotic cell death has now been shown to play an important role in an increasing array of kidney diseases, including ischemia, ischemia-reperfusion, nephrotoxins, polycystic kidney disease, obstruction, and glomerular diseases.
- An individual is considered to have acute renal failure when the patient's serum creatinine value either (1) increased by at least 0.5 mg/dL when the baseline serum creatinine level was less than 2.0 mg/dL; (2) increased by at least 1.5 mg/dL when the baseline serum creatinine level was greater than or equal to 2.0 mg/dL; or (3) increased by at least 0.5 mg/dL, regardless of the baseline serum creatinine level, as a consequence of exposure to radiographic agents.
- cDNA microarray techniques have allowed the identification of neutrophil gelatinase-associated lipocalin (NGAL) as a highly induced transcript in the kidney early after ischemic and nephrotoxic injury.
- NGAL neutrophil gelatinase-associated lipocalin
- the role of NGAL in the kidney has yet to be elucidated.
- NGAL is a member of the lipocalin family of proteins and is characterized as a secreted 25 kDa glycoprotein found in granules of human neutrophils. (Kjeldsen et al, 1993, J. Biol. Chem. 268:10425-10432).
- Lipocalins which are able to bind small lipophilic substances, share a common three-dimensional ⁇ -barrel structure which functions, in at least some lipocalins, to bind lipophilic ligands, e.g., steroid, bilin, retinoid, or other lipid.
- Murine forms of NGAL (homologs) from mice and rats are known. In mice, NGAL has been designated as NGAL, 24p3 protein, SIP24, P25, lipocalin 2, and uterocalin. NGAL in rats is known as NGAL or alpha 2-microglobulin. A full-length cDNA encoding human NGAL protein has been cloned and sequenced.
- the human NGAL gene which includes seven exons and six introns, has also been cloned and sequenced, and its expression in various tissues has been analyzed.
- the human NGAL gene encodes a polypeptide of 197 amino acids, with a 19- or 20-amino acid signal sequence, and a mature NGAL polypeptide containing 178 amino acids.
- the motifs Gly-X-Trp (amino acids 48-50 in mature human NGAL) and Thr-Asp/Asn-Tyr (amino acids 132-134 in mature human NGAL) are present in all known lipocalins.
- Unbound iron can catalyze the conversion of H 2 O 2 to OH and OH ' (the Haber- Weiss reaction) or form reactive ferryl or perferryl species. These ions mutagenize many types of molecules including lipids, nucleotides and the DNA backbone. Catalytic iron, released from free hemoglobin and myoglobin into urine or blood, and peroxidized lipids have been documented in many forms of acute renal failure, including chemotherapy, ischemia-reperfusion, transplant ischemia, and in proteinuria-mediated tubular damage. Preloading animals with iron worsens the disease, and conversely chelating iron with deferoxamine or bacterial siderophores blunts the damage.
- Iron-catalyzed damage is thought to be one of the earliest events in kidney dysfunction and is likely to be important in other organs, including the heart and the liver (See Mori et al: Endocytic delivery of lipocalin-siderophore-iron complex rescues the kidney from ischemia-reperfusion injury. J Clin Invest 115:610-621, 2005).
- Cells acquire iron from carrier proteins (such as transferrin) and by cell surface iron transporters (such as divalent metal transporter I). Intracellular iron is controlled by the actions of the iron responsive proteins (such as LRP1, IRP2), the ferritin complex and heme oxygenase I.
- Ferritin is an iron-phosphorous-protein complex, comprising approximately 23% iron, formed in the intestinal mucosa. Ferritin is the storage form of iron in tissues such as liver, spleen, and bone marrow. Hemoglobin and myoglobin molecules in blood and muscle, respectively, require iron-binding to catalyze transfer of oxygen to cells.
- iron trafficking, storage or metabolism are known in ischemic cells or in other types of tissue damage, despite the primacy of catalytic iron in their pathogenesis.
- ischemic cells and tubular toxins such as free myoglobin and hemoglobin produce high concentrations of iron locally in the nephron. It is thought that this iron is catalytically active, and produces oxygen radicals.
- Evidence that iron catalyzed cell damage is pathogenic and leads to proximal tubular dysfunction includes the finding that tubular damage is blunted by infusions of iron chelators.
- NGAL is similar to other lipocalins, such as RBP and ⁇ -2u globulin lipocalin (see Borghoff et al., 1990, Annu Rev Pharmacol Toxicol. 30:349-67), which enter the cell by a megalin pathway and traffic to lysosomes for degradation.
- RBP lipocalin
- ⁇ -2u globulin lipocalin see Borghoff et al., 1990, Annu Rev Pharmacol Toxicol. 30:349-67
- transferrin is also degraded after delivery to lysosomes by a megalin-cubulin based pathway in the proximal tubule (see Kozyraki et al., 2001, Proc. Natl Acad Sci USA 98(22)12491-6), whereas it usually recycles in cell lines.
- NGAL is captured by megalin and degraded by the proximal tubule and is not recycled. This hypothesis is supported by the observation that full length NGAL does not reappear in the blood at delayed time points post-injection.
- compositions and methods suitable for preventing, reducing, or ameliorating ischemic injury e.g., cold ischemic injury, in organs such as the kidney.
- Such compositions would be useful both in treating a patient's original organs, as well as organs used for transplantation.
- new biomarkers that can be used to detect toxic damage to cells, for example nephrotoxicity, in patients following drug administration.
- New and improved methods of treating and reducing ischemic-reperfusion injury to tissues and organs caused by organ transplantation, and of treating and reducing structural and metabolic alterations of organ cells are clearly useful and important to practitioners and patients alike.
- the present invention relates to neutrophil gelatinase-associated lipocalin (NGAL) and its use in compositions and methods for treating, reducing, ameliorating, or preventing a condition, injury or disease, typically selected from an ischemic, an ischemia- reperfusion, or a toxin-induced injury in an organ.
- the invention also relates to a method of administering to a patient or subject NGAL in an amount effective to treat, reduce, ameliorate or prevent the condition, injury or disease.
- the injury can include a renal injury associated with conditions, treatments, therapies, or diseases that predispose a patient to ischemic renal injury, a renal tubule injury, or necrosis/apoptosis.
- the injury can include acute (including but not limited to shock, stroke, sepsis, trauma, infection, inflammation) or chronic (including but not limited to hypertension, diabetes, heart failure, lupus, infections, inflammations) kidney conditions.
- the present invention also provides a method of ameliorating reduction in kidney NGALfunction induced by ischemia-reperfusion injury in a patient by administering NGAL to the patient in an amount effective to ameliorate the reduction of kidney function.
- NGAL administration reduces high levels of serum or plasma creatinine following ischemia-reperfusion injury.
- the amount of NGAL administered is effective to prevent or ameliorate cell death.
- the invention further provides a method of enhancing renal re- epithelialization or tubular cell proliferation following an ischemic, ischemic-reperfusion, or toxin-induced injury, and in acute or chronic kidney disease, by administering NGAL to a patient in an amount effective to enhance renal re-epifhelialization or effect proliferation of tubular cells.
- An embodiment of the invention includes the use of NGAL in a method of treating, reducing, preventing or ameliorating acute renal failure (ARF). NGAL has been demonstrated to enhance tubule cell proliferation and reduce or ameliorate tubule cell apoptosis.
- the methods disclosed can ameliorate the reduction in kidney function in a patient that is induced by an ischemia-reperfusion or toxin-induced injury, and can further be used for treating, reducing, ameliorating or preventing acute renal failure secondary to ischemic injury in the patient.
- the invention further provides the use of NGAL in a method for reducing and/or treating delayed graft function (DGF) of a transplanted organ in a patient.
- DGF is caused by acute tubular necrosis (ATN).
- ATN acute tubular necrosis
- the invention also provides the use of NGAL in a method for transplanting and grafting of an organ into a patient.
- the use of the method can reduce or ameliorate organ graft or transplant loss or acute rejection by introducing NGAL into one or more of (i) the organ or (ii) a donor thereof, in an amount effective to reduce or ameliorate loss or acute rejection of the organ graft or transplant.
- the organ is selected from kidney, liver, heart, brain, lung, stomach, intestine, colon, pancreas, blood vessels, bladder, cervix, skin, or a portion or section thereof.
- the organ resides in a cadaverous or living organ donor.
- NGAL can be administered to the patient before, during and/or after the organ is transplanted or grafted into the patient.
- the organ can be a cadaverous organ, and in those instances in which the organ is obtained from a cadaverous donor, NGAL can be administered to either the cadaver or the extracted organ to prevent injury, insult, or failure of the organ following transplantation.
- the organ can be a living organ donation, and in those instances NGAL can be administered to the extracted organ to prevent injury, insult, or failure of the organ following transplantation.
- the organ can be a kidney, liver, heart, brain, lung, stomach, pancreas, blood vessels, bladder, cervix, skin, or a portion or section thereof. In a particular aspect of the present invention, the organ is a kidney.
- the present invention also provides the use of NGAL in association with cadaveric and living donor renal transplantation, where oxidant-mediated apoptosis is an important contributor to tubule cell death.
- oxidant-mediated apoptosis is an important contributor to tubule cell death.
- DGF delayed graft function
- NGAL is employed in methods for reducing or ameliorating the adverse ischemic effects associated with organ transplantation.
- NGAL can be added to an organ preservation solution, such as is used during cold storage of transplant organs, to ameliorate the DGF that is characteristic of cadaveric kidney transplantation.
- NGAL is at least partially effective even when administered after the ischemic insult.
- the method affords needed and novel therapeutic treatments of established ischemic conditions, such as ARF, which is an existing, clinically-relevant, adverse event that is commonly associated with a dismal prognosis for the patient.
- the method of retarding or ameliorating DGF associated with ischemic injury in an organ or graft transplant in a patient includes introducing an amount of NGAL into, or contacting NGAL with, (i) a transplanted organ or graft; (ii) a donor of a transplanted organ; or (iii) both (i) and (ii), in an amount effective to retard or ameliorate DGF, or the loss or acute rejection of the transplanted or grafted organ.
- the organ or graft for transplant is selected from kidney, liver, heart, brain, lung, stomach, intestine, colon, pancreas, blood vessels, bladder, cervix, skin, or a portion or section thereof.
- the organ is a kidney. More particularly, the kidney transplanted is a cadaveric or living donor kidney. Further, NGAL is a component of the organ preservation solution, e.g., an NGAL-containing organ preservation solution is used during cold storage of the organ transplant.
- the present invention further provides a method of reducing, ameliorating, preventing or protecting a patient from renal injury that is associated with conditions, treatments, therapies, or diseases that can predispose a patient to ischemic renal injury. The method comprises administering to the patient an amount of NGAL effective to reduce, ameliorate, prevent or protect the patient from renal injury associated with the patient's condition, treatment, therapy, or disease.
- Illustrative conditions, treatments, or therapies include without limitation, contrast agent treatment, antibody treatment, antibiotic treatment, organ transplant, kidney transplant, cadaveric kidney transplant, cardiac treatment, cardiac treatment after surgery, or central nervous system treatment.
- Illustrative diseases according to this aspect include, without limitation, infection, bacterial infection, acute kidney disease, chronic kidney disease, ischemic-reperfusion injury, shock, trauma, sepsis, stroke, cardiac reperfusion injury, cardiopulmonary bypass, open heart surgery, and abdominal surgery.
- the invention also provides a method of treating, reducing or ameliorating renal tubule injury or necrosis/apoptosis in a patient, which comprises administering a therapeutically effective amount of NGAL to the patient.
- the patient can be affected with acute kidney disease, chronic kidney disease, ischemic- reperfusion injury, organ transplant, toxin-induced injury, ischemia, kidney transplant, shock, trauma, sepsis, stroke, cardiac reperfusion injury, renal tubule injury following cardiopulmonary bypass, renal tubule injury following open heart surgery, renal tubule injury following abdominal surgery, infection, antibiotic treatment, antibody treatment, or contrast agent treatment, for example.
- NGAL can function to enhance proliferation of renal tubule cells, since NGAL also directly targets renal proximal tubule cells, resulting in reduction or amelioration of renal tubule injury or necrosis/apoptosis.
- the present invention also provides a method of treating, reducing, or ameliorating a toxin-induced injury, including a nephrotoxic injury, to an organ in a patient by administering NGAL to the patient in an amount effective to treat, reduce or ameliorate the toxin-induced injury to the organ.
- the method of reducing or ameliorating a toxin-induced injury includes co-administering both NGAL and a therapeutic compound that is toxic to the patient, the NGAL being administered in an amount effective to reduce or ameliorate the toxic effect of the therapeutic on the organ.
- the present invention also provides a method of treating, reducing, or ameliorating other acute (including but not limited to shock, stroke, sepsis, trauma, infection, inflammation) and chronic (including but not limited to hypertension, diabetes, heart failure, lupus, infections, inflammations) kidney injuries.
- NGAL can be administered in conjunction with one or more therapeutic agents, such as, for example, vasodilators or oxygen supplying agents.
- NGAL can be administered in a physiologically acceptable composition comprising a carrier, diluent, or excipient by various routes of administration, including, without limitation, intravenous or parenteral routes.
- NGAL can be administered prior to, during, or following ischemia or nephrotoxicity, organ transplant or grafting, or renal tubule insult, damage, or injury, as described herein.
- the present invention also provides a method of evaluating a therapeutic for its potential to induce nephrotoxicity by (a) administering a test substance to cause a nephrotoxic injury a mammalian model, such as a mouse; and (b) determining the presence of neutrophil gelatinase-associated lipocalin (NGAL) in a urine or plasma sample of the mammalian model following the administration of the test substance, as an indication that the substance can induce kidney damage.
- NGAL neutrophil gelatinase-associated lipocalin
- NGAL is detected in the urine or plasma within about three hours following administration of the test substance.
- the present invention also relates to a composition for use in the treating, reducing, ameliorating, or preventing an injury to an organ in a mammal, comprising a therapeutically-effective amount of NGAL, or a derivative or analog thereof.
- the composition can further a siderophore, typically in a 1:1 molar ratio, including a complex of the NGAL with the siderophore.
- the composition can be used in any of the methods disclosed herein.
- the present invention also relates to the use of siderophores in association with NGAL in a composition and a method for treating, reducing, ameliorating, or preventing an ischemic or toxin-induced condition and disease, including an ischemic, an ischemia- reperfusion, or a toxin-induced injury in an organ.
- NGAL and a siderophore are administered as a pharmaceutical composition in an amount effective to enhance the treatment, reduction, amelioration or prevention of an ischemic, an ischemia-reperfusion, or a toxin-induced injury in an organ.
- the present invention also relates to a pharmaceutical composition that comprises a siderophore, for use in administration to patients to enhance treatment prevention, amelioration, and reduction of injury in an organ by endogenous NGAL.
- a method is provided for co-administering, typically as a complexed compound, of NGAL and a siderophore.
- a siderophore is administered to a patient in an amount effective to enhance the renal re-epithelialization or positively affect the proliferation of tubular cells initiated by endogenous NGAL secretion.
- the invention provides a method of enhancing the reduction or amelioration of delayed graft function (DGF) and organ or graft transplant rejection in a patient by endogenous NGAL, comprising the step of introducing a siderophore into (i) a transplanted organ or graft; (ii) a donor of a transplanted organ; or (iii) both (i) and (ii), in an amount effective to enhance the reduction or amelioration of DGF, or the loss or acute rejection of the transplanted or grafted organ.
- the method includes administering a siderophore in an amount effective to treat, reduce, ameliorate or prevent the injury to the organ.
- NGAL siderophore complexes
- an organ preservation solution such as is used during cold storage of transplant organs
- siderophores alone in a buffer solution can be added to an organ preservation solution, such as is used during cold storage of transplant organs, to ameliorate the DGF that is characteristic of cadaveric kidney transplantation.
- the invention further provides a method for manipulating cellular and extracellular iron in an ischemic or toxin-damaged organ by administering NGAL, or a derivative or analog thereof.
- the present invention provides a therapeutic kit comprising a first container for containing a therapeutically-effective amount of NGAL.
- the first container can include at least one vial, at least one test tube, at least one flask, and at least one bottle.
- the kit can also include a second container into which at least one composition can be placed, and a means for securing the containers together for commercial sale.
- the kit can also include a third container for containing a sterile, pharmaceutically acceptable buffer or other diluent.
- the first container can be a syringe.
- the means for securing the containers can be an injection or blow-molded plastic container into which the containers are retained.
- the vials can be prepared in such a way as to permit direct introduction of the composition into an intravenous drug delivery system. Instructions for use are also typically included.
- FIGURE 1 shows Coomassie Blue (CB) and enhanced chemiluminescence (ECL, with polyclonal NGAL antibody) analysis of defined quantities (as shown) of recombinant purified NGAL.
- FIGURE 2 shows immunofluroescent staining of kidneys from control non- ischemic animals one hour after injection, or ischemic kidneys one or three hours after either injection, using polyclonal NGAL antibody.
- FIGURE 3 shows Western blot for NGAL detection in urine samples from non-ischemic (NI) and ischemic (I) animals within 1 hour of administration of NGAL.
- FIGURE 4 shows sections stained with hematoxylineosin of kidneys from control non-ischemic mice, saline pre-treated ischemic mice, or ischemic mice treated with NGAL one hour before, during, or one hour after ischemia.
- FIGURES 5A, 5B and 5C show scoring of histological sections of kidneys from ischemic mice that were saline pre-treated or treated with NGAL one hour before, during, or one hour after ischemia. The sections were analyzed and scored for tubule dilatation (FIG. 5A), tubule casts (FIG. 5B), and tubule cell necrosis (FIG. 5C) using an arbitrary scale of 0 to 4.
- FIGURE 6 shows serum creatinine measured in non-ischemic (Non Isch) control mice, or 24 hours following ischemia in mice pre-treated with saline (Pre Sal) or treated with NGAL one hour before (Pre NGAL), during (Dur NGAL) or one hour after (PostNGAL) ischemic injury.
- FIGURE 7 shows results of TUNEL staining of representative sections from non-ischemic control mice, or 24 hours following ischemia in mice pre-treated with saline or treated with NGAL one hour before, during, or one hour after ischemic injury.
- FIGURE 8 shows quantitation of apoptosis (upper panel) and proliferation (center panel) in kidneys from non-ischemic control mice, or 24 hours following ischemia in mice pre-treated with saline or treated with NGAL one hour before, during, or one hour after ischemic injury.
- FIGURE 9 shows a ratio of proliferation:apoptosis calculated in kidneys from non-ischemic control mice, or 24 hours following ischemia in mice pretreated with saline or treated with NGAL one hour before, during, or one hour after ischemic injury.
- FIGURE 10 shows binding of 55 Fe detected in urine alone, a urine and NGAL mixture (urine+Ngal), a urine and NGAL:siderophore mixture (urine+Ngal:Si), plasma alone, buffer alone, buffer and NGAL mixture (buffer+Ngal), a buffer and NGAL:siderophore mixture (buffer+Ngal:Sid(l)), a second buffer and NGAL:siderophore mixture (buffer+Ngal: Sid(2)), and a third buffer and NGAL: siderophore mixture in which the siderophore was saturated with iron (buffer+Ngal:Sid:Fe).
- FIGURE 11 A shows immunoblots of NGAL protein in human urine samples from healthy subjects (Normal), or subjects with Acute Tubular Necrosis (ATN) or chronic renal failure (CRF), or from subjects with liver cirrhosis, hemochromatosis, or pancreatic carcinoma but lacking a renal diagnosis (Others).
- ATN Acute Tubular Necrosis
- CRF chronic renal failure
- Monoclonal anti-human NGAL (Mo) and polyclonal anti-mouse NGAL (Po) antibodies recognizes recombinant and native human NGAL and NGAL Standards.
- FIGURE 11B shows immunoblots of NGAL protein in human serum samples from healthy subjects (Normal), or subjects with Acute Tubular Necrosis (ATN) or chronic renal failure (CRF), or from subjects with liver cirrhosis, hemochromatosis, or pancreatic carcinoma but lacking a renal diagnosis (Others), compared to NGAL Standards.
- FIGURE 11C shows a quantitative comparison of NGAL protein levels in urine from healthy subjects (Normal), or subjects with Acute Tubular Necrosis (ATN) or chronic renal failure (CRF). ATN is further subdivided into non-sepsis and sepsis groups.
- FIGURE 1 ID shows a quantitative comparison of NGAL protein levels in serum from healthy subjects (Normal), or subjects with Acute Tubular Necrosis (ATN) or chronic renal failure (CRF). ATN is further subdivided into non-sepsis and sepsis groups.
- FIGURE HE shows an immunoblot of NGAL in urine from ATN-injured and Sham-treated control mice, along with standards of 50, 5, and 1 ng NGAL protein.
- FIGURE 12A shows immunohistochemical staining for NGAL in a healthy human kidney (Normal).
- FIGURE 12B shows immunohistochemical staining for NGAL in a healthy human kidney.
- FIGURE 12C shows immunohistochemical staining for NGAL in a healthy human kidney.
- FIGURE 12D shows increased immunohistochemical staining for NGAL in a human kidney with ischemic ATN caused by sepsis (Ischemic ATN).
- FIGURE 12E shows increased immunohistochemical staining for NGAL in a human kidney with ischemic ATN caused by hypovolemia due to vomiting and diarrhea.
- FIGURE 12F shows increased immunohistochemical staining for NGAL in a human kidney with ischemic ATN caused by heart failure.
- FIGURE 12G shows increased immunohistochemical staining for NGAL in a human kidney with toxic ATN caused by nephrotoxicity due to bisphosphonate (Toxic ATN).
- FIGURE 12H shows increased immunohistochemical staining for NGAL in a human kidney with toxic ATN caused by nephrotoxicity due to cephalosporin toxicity.
- FIGURE 121 shows increased immunohistochemical staining for NGAL in a human kidney with toxic ATN caused by nephrotoxicity due to hemoglobinuria.
- FIGURE 12J shows immunohistochemical staining for NGAL in a human kidney with glomerular disease, with NGAL weakly expressed in cresents.
- FIGURE 12K shows immunohistochemical staining for NGAL in a human kidney with glomerular disease, with NGAL weakly expressed in the proximal tubules of nephrotics.
- FIGURE 13 A shows histological sections of sham-treated (Control), ischemic (ATN), and NGAL-treated ATN-injured (ATN+Ngal) kidneys. Loss of tubular nuclei is observed in ATN but not control or ATN+Ngal sections (upper panels), as well as cortical (center panels) and medullary (lower panels) intratubular casts.
- FIGURE 13B shows histological sections of ischemic (ATN), and NGAL- treated ATN-injured (ATN+Ngal) kidneys, with PAS staining highlighting the luminal casts and the rescue of cortical tubules by pre-treatment with NGAL.
- FIGURE 13C shows Jablonski scoring of sham-treated (Sham), ischemic (ATN), and NGAL-treated ATN-injured (ATN+Ngal) kidneys to demonstrate rescue of the ischemic cortex by NGAL.
- FIGURE 14A shows N-cadherin staimng in kidney sections is nearly abolished by ischemia reperfusion (ATN), but is rescued when NGAL is administered (ATN+Ngal).
- FIGURE 14B shows full length N-cadherin protein levels are rescued by NGAL treatment (ATN+Ngal), compared to ischemic (ATN), as indicated by the N-cadherin fragments (arrow) in ischemia-reperfusion and sham-treated animals, but their suppression in NGAL-treated animals.
- GAPDH is the loading control.
- FIGURE 14C shows tubules with TUNEL-positive apoptotic cells (fluorescence) in ischemic-reperfused mice (I/R) reduced by prefreatment with NGAL (IR+Ngal). Toprol is the nuclear counterstain.
- FIGURE 14D shows a quantitative analysis of the percentage of tubules containing an apoptotic nucleus in sham-treated controls (sham), ischemic-reperfused (I/R), and ischemic-reperfused mice treated with NGAL (+Ngal).
- FIGURE 14E shows an immunoblot of heme oxygenase-1 (HO-1) expression in sham-treated (Sham), ischemic-reperfused (ATN), or ischemic-reperfused NGAL-treated kidneys (ATN+Ngal). Recombinant HO-1 (HO-1) and rat cortex are included for comparison. GAPDH is the loading control.
- FIGURE 15 shows an immunoblot of clearance of NGAL protein in blood and urine of mice following intraperitoneal injection of 100 ⁇ g NGAL.
- FIGURE 16A shows fluorescent-labeled (Alexa568) NGAL localized to large vesicles in the proximal tubule (bottom panel) but not in the glomerulus or medulla (small top panels). Uncoupled fluorescent dye did not label the kidney.
- FIGURE 16B shows Alexa568-NGAL co-localized with FITC-dextran in SI and S2 segments of the proximal tubule.
- FIGURE 16C shows SDS-PAGE separation of 125 I-NGAL, with full length and a 14kDa fragment of NGAL found in the kidney 1 and 5 hours after injection.
- FIGURE 16D shows radioautograph of kidney one hour after intraperitoneal injection of 55 Fe loaded siderophore-NGAL. Radioactive decay is found in the cortex and is associated with the apical zones of proximal tubule cells
- FIGURE 16E show radioautograph of kidney one hour after intraperitoneal injection of 55 Fe loaded siderophore-NGAL, with no radioactivity was found in the medulla.
- FIGURE 17A shows plasma creatinine in mice subjected to 30 minutes of ischemia. The first panel shows that holo-NGAL (> l ⁇ g) from XL-1 bacteria (containing siderophore) rescues renal function when introduced 15 minutes prior to ischemia or within one hour after ischemia.
- NGAL is ineffective when administered later.
- the second panel shows that apo-NGAL from BL-21 bacteria (siderophore free) is minimally active, but when loaded with enterochelin, the protein is protective. Both iron-free (apo- NGAL:Sid) and iron-loaded siderophores (apo-NGAL:Sid:Fe) have protective effect.
- the gallium-loaded complex apo-NGAL:Sid:Ga was ineffective as was a single dose of DFO or the free siderophore (Sid).
- FIGURE 17B shows immunoprecipitate preparations of NGAL.
- NGAL: Sid contains enterochelin, but not iron.
- NGAL:Sid:Fe contains siderophore and iron.
- FIGURE 18A shows that an iron-binding cofactor is present in urine. Buffer is mixed with 55 Fe (no protein), with apo-NGAL, apo-NGAL+siderophore, or apo- NGAL+siderophore+unlabeled iron.
- FIGURE 18B shows that when urine ( ⁇ 3,000Da) is mixed with 55 Fe or with apo-NGAL, as indicated, and then washed three times on a lOKDa filter, apo-NGAL + urine retains 55 Fe. 55 Fe retention was blocked by the addition of excess iron-citrate (Fe). Activity was also blocked by iron saturated enterochelin (Sid:Fe).
- FIGURE 19 shows kidney biopsies obtained within 1 hour of transplantation from living related (panels 0 and 1) or cadaveric (panels 2 and 3) kidney transplants. Sections were stained with NGAL antibody. NGAL expression was significantly increased in the cadaveric group, which underwent a longer ischemic period.
- FIGURE 21 shows quantitation of urinary NGAL by Western blots in LRD versus CAD, showing a significantly increased expression in CAD.
- FIGURE 22 shows the correlation of urinary NGAL obtained 2 hours after CAD transplantation with cold ischemia time. The degree of urinary NGAL expression correlates with ischemia time.
- FIGURE 23 shows the correlation of urinary NGAL obtained 2 hours after CAD transplantation with peak serum creatinine measured 2-4 days after the operation. The degree of urinary NGAL expression correlates with peak serum creatinine.
- FIGURE 24 shows standard curves for NGAL ELISA with the linear relationships obtained from 10 independent standard curves.
- FIGURE 29 shows the correlation between urine NGAL levels 2 hours after CPB versus CPB time.
- organ means a differentiated biological structure comprised of cells and tissues that perform a certain function or functions in an organism, such as a mammal, including humans.
- Representative organs include, but are not limited to, the kidney, liver, heart, bone, cartilage, skin, lung, blood vessels, bladder, certix, stomach, intestine, pancreas, small intestine, colon, pancreas and brain, and portions or sections thereof.
- renal injury or "renal disease” shall include acute (including but not limited to ischemia, ischemia-reperfusion, nephrotoxic, shock, stroke, sepsis, trauma, infection, inflammation) or chronic (including but not limited to hypertension, diabetes, heart failure, lupus, infections, inflammations) kidney injuries or conditions.
- pharmaceutically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human.
- phrases "pharmaceutically acceptable carrier” as used herein means a material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the compounds of the invention from one organ, or portion of the body, to another organ, or portion of the body without affecting its biological effect.
- Each carrier should be “acceptable” in the sense of being compatible with other ingredients of the composition and not injurious to the subject.
- materials which can serve as pharmaceutically-acceptable carriers include, but are not limited to: any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art. Except insofar as any conventional carrier is incompatible with the NGAL, sideophore, or complex thereof, or other optional active agent or ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.
- preservatives e.g., antibacterial agents, antifungal agents
- isotonic agents e.g., absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients
- terapéuticaally effective amounts refers to those amounts of NGAL, siderophore, and mixtures thereof, or of other optional active agents or ingredients, that is effective to produce beneficial results, particularly with respect to the treatments described herein, in the recipient, such as an animal or patient. Such amounts can be initially determined by reviewing the published literature, by conducting in vitro tests or by conducting metabolic studies in healthy experimental animals. Before use in a clinical setting, it can be beneficial to conduct confirmatory studies in an animal model, typically a widely accepted animal model of the particular disease to be treated. Typical animal models for use in certain embodiments are rodent and murine models, which are economical to use and, particularly, because the results gained are widely accepted as predictive of clinical value.
- derivative(s) in reference to NGAL, refers to chemically modified NGAL compounds, substances, inhibitors, or stimulators that still retain the desired effects on propertyries) of ischemia, renal tubule necrosis, nephrotoxicity, ischemic-reperfusion injury, and the like.
- Such derivatives can include the addition, removal, or substitution of one or more chemical moieties on the parent molecule.
- moieties can include, but are not limited to, an element such as hydrogen, a halide, or a molecular group such as a methyl group.
- Such a derivative can be prepared by any method known to those of skill in the art.
- a "patient”, “recipient”, or “subject” means an animal or organism, such as a warm-blooded animal or organism.
- Illustrative animals include, without limitation, mammals, for example, humans, non-human primates, pigs, cats, dogs, rodents, horses, cattle, sheep, goats and cows. The invention is particularly suitable for human patients and subjects.
- an "inhibitor” means a compound, substance or agent that produces any measurable decrease in the activity, function, production, or secretion of a protein or biological compound, or in the translation of mRNA, in or from a cell.
- a "reduction" of ischemic injury or ischemic-reperfusion injury refers to any measurable decrease, diminution or reversal of damage to organs that (i) are stored, e.g., in preservation solution or in a cadaver, or (ii) are transplanted or grafted into a patient.
- the present invention provides neutrophil gelatinase-associated lipocalin, or NGAL, for use in methods of treating, reducing, or ameliorating ischemic injury, ischemic- reperfusion injury, and a toxin-induced injury, to an organ such as the kidney.
- NGAL neutrophil gelatinase-associated lipocalin
- the present invention also provides the use of NGAL in methods of treating, reducing, or ameliorating acute kidney injuries (including but not limited to shock, trauma, stroke, sepsis, infection, inflammation, stones, and surgeries) and chronic kidney injuries (including but not limited to hypertension, diabetes, heart failure, lupus, inflammation, glomerulonephritis and interstitial nephritis).
- NGAL administration has been found to affect tubule cell death so as to limit apoptotic tubule cell death, i.e., apoptosis, and to enhance re-epithelialization, i.e., the recovery of viable cells following ischemia in the kidney involving de-differentiation and proliferation of viable cells and re-establishment of the epithelial phenotype following ischemia-reperfusion injury.
- NGAL administration has also been shown to reduce increases in serum and plasma creatinine levels after ischemic injury.
- Human NGAL a 25 kDa protein that is covalently bound to gelatinase from human neutrophils, is expressed at very low levels in several human tissues, including kidney, trachea, lungs, stomach, and colon. NGAL expression is markedly induced in and secreted by stimulated epithelia. For example, NGAL concentrations are elevated in the serum of patients with acute bacterial infections, the sputum of subjects with asthma or chronic obstructive pulmonary disease, and the bronchial fluid from the emphysematous lung. NGAL is also one of the maximally-induced genes in the kidney following early ischemic injury.
- NGAL neuropeptide kinase kinase
- Other studies have shown that NGAL can be found at elevated levels in the serum of human patients with inflammatory diseases.
- NGAL is highly expressed in clinically defined ATN and appears in the proximal tubule in biopsied human kidney. Although less abundant, NGAL is also expressed in the kidney in several forms of chronic kidney disease.
- a mouse model of ischemia/reperfusion induced ATN also expresses NGAL at very high levels. Microgram quantities of injected NGAL provided dramatic protection against ATN as measured by plasma creatinine and by the histology of the kidney.
- NGAL nephrol
- the protection of the kidney was due to the delivery to the proximal tubule of NGAL protein containing the bacterial siderophore.
- the preparation of a pharmaceutical composition or formulation comprising NGAL is known to those of skill in the art in light of the present invention, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed., Mack Printing Company, 1990. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by the FDA Office of Biological Standards. [0105] Previously, the role of NGAL was unclear; however, NGAL has now been identified as an iron-transporting protein during nephrogenesis.
- NGAL can deliver iron to the cytoplasm.
- the likely mechanism for iron delivery from NGAL is by endocytosis. Fluorescent NGAL protein is endocytosed, and this trafficking is blocked by 4°C temperatures. Acidification of these vesicles can be necessary for iron release from NGAL because agents that inhibit acidification blocked iron uptake.
- addition of NGAL to cells expressing a fluorescent iron reporter in the cell cytoplasm stimulated iron-activated changes in reporter expression, confirming that NGAL can serve as an iron donor.
- the pathway for NGAL endocytosis differed from the pathway taken by holo-transferrin in cells in culture.
- NGAL can serve in an iron delivery pathway when it contains a siderophore.
- the actions of NGAL in vivo might differ from its pharmacological effects because the critical siderophore in vitro is a bacterial product.
- a number of analyses have indicated the possibility of endogenous low molecular weight co-factors for iron transport. These include citrate and related compounds, but also iron transport activities in the molecular weight range of 1000 Da.
- HO-1 heme oxygenase 1
- NGAL also facilitates the removal of excess intracellular iron, thereby limiting oxidant-mediated apoptosis of renal tubule cell death following ischemia-reperfusion injury.
- NGAL kidney diseases that are well known to be associated with increased apoptosis, including but not limited to ischemia, ischemia-reperfusion, nephrotoxins, polycystic kidney disease, obstruction, inflammation, and glomerular diseases.
- NGAL protein is composed of eight ⁇ strands which form a ⁇ -barrel or a calyx.
- the calyx binds and transports low molecular weight chemicals, including siderophores found in urine and/or produced by bacteria.
- the best evidence for NGAL's ligand-binding properties comes from crystallographic studies, which demonstrated a bacterial siderophore (enterochelin) in the ⁇ -barrel.
- NGAL binds the siderophore with high affinity (0.4nM) and the siderophore traps iron with high affinity (10 "49 M).
- the stoichiometry of protein:siderophore:iron is 1:1:1, as demonstrated by binding studies and x- ray crystallography.
- NGAL When the siderophore was loaded with iron, the NGAL complex donated iron to embryonic mesenchyme in vitro and to cell lines, and when the siderophore was iron-free, the NGAL complex chelated iron. NGAL was endocytosed by many cell types, and trafficked to a late endosomal compartment that differed from the transferrin compartment. Donation of iron took place in an endosomal compartment. Because NGAL is the first mammalian protein found to bind bacterial siderophores, it can also been called siderocalin. [0109] Siderophores are small protein molecules that scavenge iron from the environment, having a low molecular weight ranging from about 500 to about 1000 MW.
- Siderophores can chelate ferric iron. Iron-catalyzed damage is thought to be one of the earliest events in kidney dysfunction following an ischemic, ischemic-reperfusion, or toxin- induced injury, and is likely to be important in the early stages of damage to other organs, including the heart and the liver. Chelating iron with siderophores can blunt the damage to these organs. [0110] Siderophores can be synthetic or naturally-occurring products harvested from bacterial cultures, and are commercially available. Siderophores are avidly taken up by NGAL when mixed together under physiological conditions in a wide variety of commonly used buffers including 10 mM Tris or Phosphate-buffered Saline.
- siderophores can be added in excess to a known quantity of NGAL protein.
- NGAL molecules will bind to siderophore molecules such that each complex will contain one molecule of each species.
- the 1:1 complexes of NGAL: siderophore are washed to remove the excess unbound siderophore molecules, and can then be further processed for use in the practice of the invention.
- equimolar amounts of siderophore and NGAL molecules can be combined and incubated to allow binding.
- Exogenous siderophores contemplated for use in the invention include, but are not limited to enterochelin, carboxymycobactin, aminochelin, desferrioxamine, aerobactin, arthrobactin, schizokinen, foroxymithine, pseudobactins, neoenactin, photobactin, ferrichrome, hemin, achromobactin, achromobactin, rhizobactin, and other bacterial products, as well as citrate and synthetic analogs and moieties and others that can be produced using organic chemistry processes.
- Endogenous siderophores can also be complexed to NGAL in vivo, as will be described in examples of the methods for use.
- the methods of the present invention provide certain advantages for the patient.
- Acute renal failure secondary to ischemic injury remains a common problem, with limited and unsatisfactory therapeutic options.
- the identification of factors that inhibit, reduce, or oppose tubule cell death (necrosis/apoptosis) and/or enhance the recovery phase (involving de-differentiation and proliferation of viable renal rabule cells and re- establishment of the epithelial phenotype) can serve as novel therapeutic options.
- NGAL both alone and together with siderophores, advantageously exhibits the above-mentioned desirable and cytoprotective properties.
- the toxin and/or the therapeutic that is toxic can include an antibiotic, an anti-inflammatory agent, an antifungal agents, a radio-contrast agent, a pharmaceutical, a chemotherapeutic agent, a test drug, a medicament substance, or naturally-occuring, commercial and industrial chemicals and minerals.
- Specific toxins and nephrotoxins include, but not limited to, a cancer chemotherapeutic such as cisplatin, mitomycin, cyclophosphamide, isosfamide, and methotrexate, an antibiotic including gentamicin, vancomycin, and tobramycin, an antifungal agent, such as amphotericin, an anti- inflammatory agent, such as an NSATD, an immunosuppressant, such as cyclosporine and tacrolimus, other medicaments, commercial and industrial chemicals, such as hydrocarbons, chlorocarbons and fluorocarbons, and minerals such as arsenic, mercury, bismuth and lead.
- a cancer chemotherapeutic such as cisplatin, mitomycin, cyclophosphamide, isosfamide, and methotrexate
- an antibiotic including gentamicin, vancomycin, and tobramycin
- an antifungal agent such as amphotericin
- an anti- inflammatory agent such as an
- nephrotoxic compounds can include an aminoglycoside, foscarnet, pentamidine, vancomycin, neomycin, nitrous oxide, isoflurane, kanamycin, and cyclophosphamide.
- NGAL can be administered prior to, during (at the same time as), or following ischemia, ischemic-reperfusion injury, organ transplant, ATN, toxin admininstration, and the like, as described herein. More particularly, NGAL can be administered to the patient from about 30 minutes to about 90 minutes before an organ is transplanted. It is also contemplated that the compositions can be administered at times outside the range of 30 to 90 minutes.
- the invention also includes a method of administering from about 1 to about 200 mg/kg body weight of NGAL to a patient, more typically from about 1 to about 100 mg/kg body weight.
- the amount of NGAL administered to a patient can vary or fall out side of the ranges given above. As discussed herein, the amount of NGAL administered to the patient can vary.
- a composition of the present invention such as a medicament or pharmaceutical composition, can typically comprise a level of NGAL and/or sideophore of at least about 10 microgram/100 microliter of composition, and more typically at least about 100 microgram/100 microliter of composition.
- a composition of the present invention can include different types of pharmaceutically acceptable carriers, depending on whether they are to be administered in solid, liquid or aerosol form, and whether they need to be sterile for such routes of administration as injection.
- the present invention can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularally, orally, topically, locally, inhalation (e.g., aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., lipo
- compositions of the present invention administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of the condition being treated, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient, and the route of administration.
- the practitioner responsible for administration will, in any event, determine the concentration of the NGAL, siderophore and mixtures thereof, and of other optional active agents, in a composition and appropriate dose(s) for the individual subject.
- pharmaceutical compositions can comprise, for example, at least about 0.1% of another optional active agent or ingredient.
- the active agent or ingredient can comprise between about 2% to about 75% of the weight of the unit, more typically between about 25% to about 60%, and any range derivable therein.
- a dose amount of the active agent or ingredient can comprise from about 1 microgram/kg body weight about 500 milligram/kg body weight, more typically from about 5 mg/kg body weight to about 100 mg/kg body weight.
- the composition can comprise various antioxidants to retard oxidation of one or more ingredient.
- compositions can be formulated into a composition in a free base, neutral or salt form.
- Pharmaceutically acceptable salts include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, or such organic bases as isopropylamine, trimethylamine, histidine or procaine.
- inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid.
- Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, or such organic bases as isopropylamine, trimethylamine, hist
- a carrier can be a solvent or dispersion medium including, but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc), lipids (e.g., triglycerides, vegetable oils, liposomes), and combinations thereof.
- the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids, by the use of surfactants such as, for example, hydroxypropylcellulose, or combinations thereof such methods.
- nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays.
- Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained.
- the aqueous nasal solutions usually are isotonic or slightly buffered to maintain a pH of about 5.5 to about 6.5.
- compositions are prepared for administration by such routes as oral ingestion.
- the solid composition can comprise, for example, solutions, suspensions, emulsions, tablets, pills, capsules (e.g., hard or soft shelled gelatin capsules), sustained release formulations, buccal compositions, troches, elixirs, suspensions, syrups, wafers, or combinations thereof.
- Oral compositions can be incorporated directly with the food of the diet.
- Typical carriers for oral administration comprise inert diluents, assimilable edible carriers, or combinations thereof.
- an oral composition can be prepared as a syrup or elixir, and can comprise, for example, at least one optional active agent or ingredient, a sweetening agent, a preservative, a flavoring agent, a dye, a preservative, or combinations thereof.
- an oral composition can comprise one or more binders, excipients, disintegration agents, lubricants, flavoring agents, or combinations thereof.
- a composition can comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof, an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof, a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or combinations thereof, a lubricant, such as, for example, magnesium stearate, a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof, a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc., or combinations of the foregoing.
- a binder such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof
- an excipient such as
- the dosage unit form When the dosage unit form is a capsule, it can contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials can be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules can be coated with shellac, sugar or both.
- Additional formulations that are suitable for other modes of administration include suppositories. Suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum, vagina or urethra. After insertion, suppositories soften, melt or dissolve in the cavity fluids.
- suppositories can include, for example, polyalkylene glycols, triglycerides or combinations thereof.
- suppositories can be formed from mixtures containing, for example, the active agent or ingredient in the range of about 0.5% to about 10%, and typically about 1% to about 2%.
- Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the various sterilized active compounds into a sterile vehicle that contains the basic dispersion medium and/or the other ingredients.
- the typical methods of preparation are vacuum-drying or freeze-drying techniques that yield a powder of the active compound plus any additional desired ingredient from a previously sterile-filtered liquid medium thereof.
- the liquid medium should be suitably buffered if necessary and the liquid diluent first rendered isotonic prior to injection with sufficient saline or glucose.
- the preparation of highly concentrated compositions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active compounds to a small area.
- composition should be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that exotoxin contamination should be kept minimally at a safe level, for example, less that 0.5 ng/mg protein.
- EXPERIMENTAL PROTOCOLS [0128] The invention will be better understood through examples illustrating its use and efficacy. The experimental protocols described below will be referenced in the examples that follow. 1. Expression, purification, and radiolabeling of recombinant human and mouse NGAL: [0129] Full length mouse NGAL cDNA was cloned into the pGEX expression vector, expressed as a fusion protein with glutathione S-transferase (GST) in bacteria, and purified using glutathione-sepharose columns (Amersham) followed by thrombin cleavage as previously by Bundgaard J et al., Biochem Biophys Res Commun 202: 1468-1475, 1994; Yang J et al., Mol Cell 10: 1045-1056, 2002; and Del Rio M et al., J Am Soc Nephrol 15: 41-51, 2004.
- GST glutathione S-transferase
- NGAL was made endotoxin-free with using the Detoxi-Gel endotoxin removing column (Pierce) as recommended by the manufacturer. Proteins were analyzed by SDS-PAGE followed by Coomassie blue staining or by Western blotting with a polyclonal antibody to NGAL as described by Mishra et al., J Am Soc Nephrol 14: 2534-2543, 2003. Protein concentrations were determined using the Bradford assay. A single clean polypeptide of the predicted size was detected, as shown in FIGURE 1. 2. Expression and purification of recombinant human and mouse NGAL [0130] Recombinant human and mouse GST-NGAL were expressed in BL21 or XL1-
- NGAL Blue strains of E. coli (Stratagene) with additional ferric sulfate (50 Micro Molar, Sigma- Aldrich Co.).
- NGAL was isolated using Glutathione Sepharose 4B beads (Amersham Biosciences), eluted by thrombin cleavage (Sigma- Aldrich Co.; St. Louis, MO) and then further purified by gel filtration (Superdex75, SMART system, Amersham Biosciences) and examined by Coomassie gels (Biorad).
- BL-21 derived NGAL was loaded with iron free or iron saturated enterochelin, a siderophore (EMC Microcollections) using a 5 fold molar excess.
- Unbound siderophore (0.7 KD) was removed by washing (Microcon YM-10) with PBS.
- To produce 55 Fe or gallium (Ga) loaded NGAL we incubated the iron-free enterochelin NGAL complex with equimolar 55 Fe (18mCi) or Ga in NaCI (150mM) Hepes (20mM; pH 7.4) and the complex was washed 3 times (10K filter).
- Iodobeads Pierce
- PD-10 column gel filtration
- extensive dialysis (7kDa cut off membrane, Pierce
- NGAL injections [0131] Purified endotoxin-free NGAL was administered either intravenously into mice via tail vein injections, subcutaneously, or intraperitoneally. In preliminary studies, animals were treated with three different concentrations of NGAL (50, 100, or 250 ⁇ g of a 250 ⁇ g/100 ⁇ l solution), subjected to 30 minutes of bilateral renal artery clamping one hour later, and examined after 24 hours of reflow.
- Acute renal failure was diagnosed by a doubling of the serum creatinine in less than 5 days.
- the presumed etiology of ARF included sepsis which was defined by the presence of at least two of the following criteria: positive blood cultures or evidence of local infection in the lung, skin or urinary tract and fever or an elevated WBC count. Some of these patients required blood pressure support. Other etiologies of ARF included hypotension due to bleeding or heart failure, nephrotoxins, or post-transplant ischemia.
- CRF chronic renal failure
- the samples were centrifuged through a lOOKDa cut-off filter (YM-100, Amicon) and the flow-through used for immunoblot. In patients undergoing hemodialysis, samples were taken immediately before dialysis. Fresh urine samples were centrifuged at low speed and then used without further concentration. 6.
- Pathologic Specimens included ischemic ATN (10 cases), toxic ATN (11 cases- (5) antibiotics, (2) zoledronate, (1) carboplatinum, (2) non-steroidal anti-inflammatory agents, and (1) hemoglobinuria), and glomerulopathies (10 cases- including diabetic, anti- GBM, pauci-immune cresentic glomerulonephritis, IgA nephropathy, minimal change, focal segmental glomeruloscerosis), and also normal kidneys (3 cases).
- Formalin-fixed, paraffin- embedded tissues were sectioned (5 ⁇ m) and subjected to antigen retrieval using microwave in a citrate buffer (pH6.0) for 30 min.
- Endogenous peroxidase was blocked with 5% H 2 O 2 for 30 min, followed by blocking in 10% goat serum/1% BSA.
- Affinity purified anti-mouse NGAL (0.4 ⁇ g/ml) was applied overnight at 4C, followed by biotinylated goat anti-rabbit IgG (1:100, Vector) and avidin-HRP, each for 30 minutes. Slides were developed with DAB/0.3% H 2 O 2 for 2.5 minutes and counterstained with hematoxylin. Non-immune rabbit IgG (0.4 ⁇ g/ml; Vector) was used as a control. 7.
- NGAL Trafficking [0136] To detect delivery of NGAL to the kidney rNGAL (10 or 100 ⁇ g), Alexa 568- NGAL (100 ⁇ g), 125 I-NGAL (10 ⁇ g, 2X10 6 cpm), or 55 Fe loaded enterochelin-NGAL (10 ⁇ g, lX10 6 cpm) was injected into the peritoneum and blood, urine, kidney and liver samples were obtained. NGAL was detected by immunoblot. Alexa-568 NGAL was detected by confocal microscopy (LSM Meta Detector) and NGAL mediated iron trafficking was detected by scintillation counter and by light microscopic radioautography of Epon embedded kidneys.
- LSM Meta Detector confocal microscopy
- NGAL mediated iron trafficking was detected by scintillation counter and by light microscopic radioautography of Epon embedded kidneys.
- mice were injected with Fluorescein Dextran (46kD; 0.5 mg; Sigma) 24 hours before Alexa 568 NGAL injections.
- LAMPl (Santa Cruz) was detected in cryostat sections of 4% paraformaldehyde fixed kidneys. 8.
- mice Male C57BL/6 mice (20-25 gr; Charles River) were anesthetized with intraperitoneal pentobarbital (50mg/kg) and placed on a heating pad under a warming light to maintain 37 ⁇ core body temperature. Kidneys were exposed through an abdominal section and the right kidney was either removed or its vascular pedicle and ureter ligated. The vascular pedicle of the left kidney or both kidneys was clamped by a microaneurysm clip (Kent Scientific) for 30 minutes after right nephrectomy. This period of ischemia generated reproducible renal injury but minimized mortality. During the procedure, PBS (0.5ml) was used to dampen the peritoneum.
- PBS 0.5ml
- the animal was closed with 5-0 Nylon. Saline, NGAL, retinol-loaded retinol binding protein (RBP), enterochelin, or desferroxamine mesylate (DFO) were injected into the peritoneum or subcutaneously 15 min. prior to ischemia or 1-2 hr after reperfusion.
- Saline, NGAL, retinol-loaded retinol binding protein (RBP), enterochelin, or desferroxamine mesylate (DFO) were injected into the peritoneum or subcutaneously 15 min. prior to ischemia or 1-2 hr after reperfusion.
- heparinized plasma, urine and kidney samples were obtained to measure NGAL (polyclonal 1:500), Heme oxygenase-1 (Sfressgen, 1:2000), E-cadherin (BD Transduction Labs, 1:2000), N-cadherin (BD Transduction Labs, 1:3000) and GAPDH (Chemicon International, 1:3000) using immunoblots. Plasma was also used for creatinine and blood urea nitrogen colorimetric assays. Sagittal sections of the kidney were fixed in 4% formalin, or were snap frozen for mRNA and protein analysis.
- Paraffin- embedded sections (5 ⁇ m) were stained with hematoxylin-eosin or by an in situ kit (Fluorescein-TUNEL, Roche) for apoptotic nuclei or for total nuclei (Toprol, Molecular Probes).
- BrdU was injected into the peritoneum lhour before sacrifice, and cryostat sections were stained with anti-BrdU (Roche) according to the manufacturer.
- the mice were allowed to recover in a warmed cage, and timed urine collections were obtained.
- mice were killed, the kidneys perfusion fixed in situ with 4% paraformaldehyde in PBS, and both kidneys harvested. One half of each kidney was snap frozen in liquid nitrogen and stored at -70°C until further processing; a sample was fixed in formalin, paraffin-embedded, and sectioned (4 ⁇ m). Paraffin sections were stained with hematoxylin-eosin and examined histologically.
- mice NGAL mRNA (Genbank NM_008491) were CTCAGAACTTGATCCCTGCC (forward primer, positions 93-112) and TCCTTGAGGCCCAGAGACTT (reverse, 576-557).
- Sequences for mouse /3-actin mRNA (Genbank X03672) were CTAAGGCCAACCGTGAAAAG (forward, 415-434) and TCTCAGCTGTGGTGGTGAAG (reverse, 696-677). Each plate included a dilution series of standard sample, which was used to determine mRNA quantities.
- the NGAL mRNA content was normalized by ⁇ -actin mRNA. 10.
- Iron binding Co-factor [0141] Cofactor-dependent iron binding to NGAL was measured in 150mM NaCl- 20mM Hepes (pH7.4) buffer (lOO ⁇ l) with apo-NGAL (lO ⁇ M), 55 Fe (l ⁇ M), and a low molecular weight fraction ( ⁇ 3 Kd) of mouse urine (0-30 ⁇ l) and incubated 70 min. at room temperature. The urine fraction was obtained by passing fresh urine sequentially through 10 kDa and 3 kDa membranes (YM-10 and YM-3, Amicon). The mixture was then washed three times on 10 kDa membrane (YM-10, Amicon).
- NGAL Iron-free enterochelin-loaded NGAL (rather than NGAL without siderophore) served as a positive control for iron capture.
- NGAL immunohistochemistry [0142] For NGAL detection, frozen kidney sections were permeabilized with 0.2% Triton X-100 in PBS for 10 min, blocked with goat serum for 1 hr, and incubated with primary antibody to NGAL (1 :500 dilution) for 1 hr.
- Kidney sections of 4 microns were stained with hematoxylin-eosin and scored for histopathologic damage to the tubules in a blinded fashion, as previously described by Yokota N. et al., Am J Physiol Renal Physiol 285: F319-F325, 2003 and Kjeldsen L. et al., Biochim Biophys Acta 1482: 272-283, 2000.
- Each parameter was assessed in five high power fields (40X) in the inner cortex and outer medullary regions (where the tubular damage was most evident), and an average determined for each section.
- the parameters included tubule dilatation, tubule cast formation, and tubule cell necrosis.
- Each parameter was scored on a scale of 0 to 4, ranging from none (0), mild (1), moderate (2), severe (3), to very severe/extensive (4). 13 Apoptosis assays: [0144] For the TUNEL assay to detect apoptotic nuclei, we utilized the ApoAlert DNA Fragmentation Assay Kit (Clontech).
- Paraffin sections were deparaffinized through zylene and descending grades of ethanol, fixed with 4% formaldehyde/PBS for 30 min at 4°C, permeabilized with proteinase K at room temperature for 15 min and 0.2% triton X- 100/PBS for 15 min at 4 ⁇ C, and incubated with a mixture of nucleotides and TdT enzyme for 60 min at 37°C. The reaction was terminated with 2X SSC, the sections washed with PBS, and mounted with Crystal mount (Biomeda, Foster City, CA). TUNEL-positive apoptotic nuclei were detected by visualization with a fluorescent microscope.
- Proliferation assays [0145] For detection of proliferating cells, sections were incubated with a monoclonal antibody to Proliferating Cell Nuclear Antigen (PCNA, 1:500 dilution, Upstate Biotechnology), and detection accomplished by immunoperoxidase staining as recommended by the manufacturer (ImmunoCruz Staining System, Santa Cruz Biotechnology). Slides were examined in a blinded fashion, and proliferation was quantified by counting the number of PCNA positive cells per 100 cells counted in an average of five high power (40X) fields in each section. 15.
- PCNA Proliferating Cell Nuclear Antigen
- EXAMPLE 1 Intravenous NGAL is rapidly taken up by proximal tubule cells in vivo. Purified NGAL was delivered to its putative site of action, namely the proximal tubule. Mice received intravenous NGAL (250 ⁇ g in 100 ⁇ l saline) or an equal volume of saline alone, subjected to ischemia-reperfusion injury, and the kidneys and urine examined at various time periods, as shown in FIGURE 2. Non-ischemic saline control animals had no NGAL (upper left panel), while non-ischemic NGAL-treated animals had NGAL (lower left panel). Saline- injected animals were devoid of kidney NGAL at one hour (upper center panel).
- Endogenous NGAL was detected in saline-treated animals at 3 hours after ischemic-reperfusion injury (upper right panel). In contrast, within one hour of NGAL injection, it was easily detected in a punctate cytoplasmic distribution predominantly in the proximal tubules (lower center panel), and was still seen at 3 hours (lower right panel). Identification of proximal tubules in these sections was based on location and morphology. This represents uptake of injected NGAL following ischemic injury, since NGAL was not detected at the one hour reflow period in saline-injected animals. In addition, NGAL was detected in the urine within one hour of injection, as shown in FIGURE 3.
- EXAMPLE 2 Intravenous NGAL rapidly appears in the urine following administration and ischemic-reperfusion injury. Urine from the animals of Example 1 was examined at various time periods. Saline-injected animals were devoid of kidney or urinary NGAL at the 1 hour reflow period, and NGAL was just detectable at the 3-hour reflow period, as shown in FIGURE 3 (left panel). The 3 hour data represents the endogenous response of kidney tubule cells to ischemic injury. In contrast, in animals injected with NGAL and simultaneously subjected to ischemia-reperfusion injury, NGAL was easily detected in the kidney and urine with 1 hour of reflow, as shown in FIGURES 3 (right panel).
- NGAL ameliorates the histopathologic damage to tubules induced by ischemia-reperfusion injury.
- NGAL administered one hour before, during, or even one hour after ischemia resulted in a significant decrease in the histopathologic damage to tubules.
- Representative kidney sections obtained at 24 hours of reflow and stained with hematoxylin- eosin are shown in FIGURE 4. While the non-ischemic controls (Non-ischemic panel) displayed normal histology, animals pre-treated with saline alone (Saline Pre-treated panel) (100 ⁇ l, volume of diluent) displayed extensive features of acute tubular necrosis, including tubular dilatation, tubular cast formation, and necrotic cells.
- NGAL-treated kidneys displayed an attenuated histopathologic response. This was most evident in animals pre-treated with NGAL (NGAL Pre-treated panel), but was also evident when the NGAL was administered during (NGAL During Isch panel) or even one hour after (NGAL After Isch panel) the ischemic injury. In order to quantify this response, kidney sections were scored for histopathologic damage to the tubules in a blinded fashion. The results are illustrated in FIGURE 5A-5C.
- NGAL ameliorates the reduction in kidney function induced by ischemia- reperfusion injury.
- NGAL administered one hour before, during, or even one hour after ischemia resulted in a significant decrease in the serum creatinine measured at 24 hours of reflow, as shown in FIGURE 6.
- the non-ischemic controls displayed serum creatinine (0.65 + 0.13 mg/dl)
- animals pre-treated with saline alone (Pre Sal) displayed a significant increase in serum creatinine (2.6 + 0.28 mg/dl).
- Pre Sal 100 ⁇ l, volume of diluent
- NGAL-treated kidneys displayed an attenuated functional response.
- NGAL ameliorates the apoptotic tubule cell death induced by ischemia- reperfusion injury.
- the structural and functional protection observed with exogenous NGAL administration was a result of decreased apoptosis.
- FIGURE 7 Representative kidney sections obtained at 24 hours of reflow and subjected to TUNEL assay are shown in FIGURE 7 at low (left column) and high (center column) magnifications. While the non-ischemic controls displayed a minimal incidence of apoptosis (2.2 ⁇ 0.5 cells per hundred (%) cells examined), animals pre-treated with saline alone (100 ⁇ l, volume of diluent) displayed a significantly greater number of apoptotic tubule epithelial cells (12.6% + 2.2), as shown quantitatively in FIGURE 8 (left panel). In contrast, NGAL-treated kidneys displayed an attenuated apoptotic response.
- NGAL enhances tubule cell proliferation following ischemic injury.
- Representative kidney sections obtained at 24 hours of reflow and stained with an antibody to PCNA are shown in FIGURE 7 (right column). While the non-ischemic controls displayed a minimal incidence of proliferating cells (1.9% ⁇ 0.4 cells per hundred cells examined), animals pre-treated with saline alone (100 ⁇ l, volume of diluent) displayed a small but significant increase in the number of PCNA-positive tubule epithelial cells (4.4% ⁇ 1.2), as shown quantitatively in FIGURE 8 (right panel). In contrast, NGAL-treated kidneys displayed a marked increase in proliferating cells. This was most evident in animals pre- treated with NGAL (19.1% + 2.1), but was also evident when the NGAL was administered during (14.9% + 1.2) or even one hour after (14.5% + 1.2) the ischemic injury.
- EXAMPLE 7 tilts the balance of tubule cell fate towards survival following ischemic injury.
- the overall tubule cell fate following ischemic injury was estimated using a one-way ANOVA to compare means ⁇ SD of proliferation and apoptosis among the different treatment groups at 24 hours of reflow.
- a ratio of unity can be assumed to indicate equal rates of cell survival and death, as would be expected in the mature kidney at rest, illustrated in FIGURE 9.
- Non-ischemic control kidneys displayed a proliferatio apoptosis ratio of 0.86 + 0.1, close to the value of unity.
- NGAL-treated kidneys displayed a marked increase in the ratio of proliferating versus apoptotic tubule cells. This was most evident in animals pre-treated with NGAL (2.9% ⁇ 0.5), but was also evident when the NGAL was administered during (2.0% + 0.1) or even one hour after (1.7% ⁇ 0.1) the ischemic injury. This analysis indicates that NGAL tilts the overall balance of tubule cell fate towards cell survival following ischemic injury.
- NGAL the fractional excretion of NGAL (the clearance of NGAL, normalized for the clearance of creatinine) was greater than 100%), demonstrating that urinary NGAL derived from local synthesis, rather than only by filtration from the blood.
- mouse urine also contained markedly elevated levels of NGAL, shown in FIGURE 1 IE, following induction of ATN injury.
- FIGURE 12 To visualize sites of expression of NGAL in acute renal diseases, human kidney tissue sections were stained with affinity-purified polyclonal antibody to NGAL (FIGURE 12).
- the normal kidney demonstrated very weak staining in the distal tubular epithelia (mean 10% of cortical area) and in medullary collecting ducts, shown at low power in FIGURE 12A, and at high power in FIGURES 12B, and 12C. Rare focal staining of glomerular parietal epithelial cells, but not other glomerular cells was also identified. Proximal tubules however were entirely negative.
- FIGURE 12D ischemic ATN caused by sepsis
- FIGURE 12E hypovolemia (acute loss of blood volume)
- FIGURE 12F heart failure
- FIGURE 12G nephrotoxicity due to bisphosphonate
- FIGURE 12H nephrotoxicity due to cephosporin
- FIGURE 121 hemoglobinuria.
- NGAL was also widely expressed in the proximal tubule of patients with prohferative glomerulopathies, shown in FIGURES 12J and 12K, but to a lower degree than that found in ischemic damage (percentage of cortical parenchyma positive for NGAL was 20% in minimal change disease, 40% in diabetic nephropathy and 50 and 65% in ANCA and anti-glomerular basement membrane diseases).
- Tubular cells with less derangement had much less staining.
- EXAMPLE 9 [0157] Exogenous NGAL Rescues the Mouse Proximal Tubule from ATN.
- NGAL was protective in the ischemic model of ATN.
- NGAL systemically (1-300 ⁇ g by subcutaneous or intraperitoneal injection) prior to, or within one hour of the release of the arterial clamp.
- EXAMPLE 10 Correlates of Ischemia Perfusion Injury. Because the trafficking and metabolism of the cadherins is rapidly affected by ischemia, and because NGAL acts as an inducer of E-cadherin in rat embryonic metanephric mesenchyme, NGAL rescues cadherin expression in the ischemic kidney. To test this hypothesis we first confirmed that while E- cadherin could be detected in mouse proximal tubules by immunofluorescence, N-cadherin was present in all segments of the proximal tubule, shown in FIGURE 14 A, and appeared to be its major cadherin.
- N-cadherin is known to be processed by caspases, ⁇ -secretase and by matrix metalloproteinases which generate 30-40 Kd cytoplasmic fragments which are potentially important signaling molecules that modulate CREB signaling.
- N-cadherin was degraded to a 30 Kd fragment after ischemia reperfusion, demonstrated by immunoblot in FIGURE 14B, suggesting the activation of one or more of these pathways. In some animals degradation of the protein could be detected within 6 hours of reperfusion, and by 24 hours both N-cadherin immunofluorescence and the full-length protein was nearly abolished.
- N-cadherin immunofluorescence enhanced the expression of full length N-cadherin and reduced the appearance of its fragment when monitored at 6 hours (in some animals) or 24 hours of reperfusion.
- N-cadherin which is highly expressed in the distal tubule and collecting duct, was much less affected by ischemia and by NGAL treatment.
- metal induced nephrotoxic ATN triggered the degradation of N-cadherin but not E-cadherin.
- One effect of NGAL therefore, is to inhibit signaling by N-cadherin fragments.
- EXAMPLE 11 [0164] NGAL Upregulates Heme Oxygenase-1 in ATN.
- HO-1 heme oxygenase 1
- FIGURE 14E ischemia reperfusion (ATN lanes) enhanced the expression of HO-1, but when ATN-injured mice were treated with 10-100 ⁇ g NGAL (ATN Ngal lanes), the enzyme was further upregulated 5-10 fold by 24 hours after reperfusion.
- NGAL alone induced HO-1 healthy mice (Sham lanes) were injected with increasing doses of NGAL, and HO-1 protein levels were measured. However, the expression of HO-1 after NGAL injection was much less than the NGAL-treated ATN-injured kidneys, indicating that NGAL synergizes with other activators to upregulate HO-1 during ischemic-reperfusion events and protect the kidney from iron- mediated damage.
- EXAMPLE 12 [0165] Mechanism of Rescue from ATN: NGAL Targets the Proximal Tubule. Distribution of exogenous NGAL was determined after an intraperitoneal or subcutaneous injection to establish the mechanism by which NGAL protects the proximal tubule from ischemic damage. NGAL was found in the urine within 10 min of injection of 100 ⁇ g exogenous NGAL suggesting that the protein was rapidly cleared by the kidney, shown in FIGURE 15. The same time course was observed following injection of 10 ⁇ g NGAL (not shown). However, only 0.1-0.2% of the injected NGAL was recovered in the urine in the first hour. To better follow trafficking, fluorescent conjugates of NGAL were administered.
- proximal tubular lysosomes with fluorescein-dextran (43kDa) the day before administering Alexa-568 NGAL.
- fluorescein-dextran 43kDa
- 33% of the NGAL vesicles also contained dextran, shown in FIGURE 16B.
- many of these vesicles co-stained with the lysosomal marker LAMP1 (data not shown). Similar results were observed following injection of [ 125 I]-NGAL, FIGURE 16C, which showed that the full length protein was rapidly cleared from the blood and located in the kidney by the one hour time-point.
- the kidney had 13-fold more [ 125 I]-NGAL than the liver/mg protein.
- the kidney-localized protein was TCA precipitable (70%), and composed of both full-length NGAL and a specific 14kDa degradation product. These species persisted, and were only slowly lost after 5 hours after injection.
- the plasma, and particularly the urine contained mostly low molecular weight, TCA soluble [ 125 I]-fragments, (35% and 20% TCA precipitable, respectively).
- EXAMPLE 13 [0167] Rescue of the Proximal Tubule from ATN Requires Fe: Siderophore. To determine if NGAL can deliver iron to the proximal tubule, NGAL was saturated with the radionuclide iron species 55 Fe by incubating iron- free enterochelin-NGAL (Sid:NGAL) with 55 Fe at a 1:1 stoichiometry ( 55 Fe:Sid:NGAL).
- EXAMPLE 14 [0169] To determine the role of iron delivery in renal protection, we compared NGAL cloned in two different strains of E. coli bacteria. NGAL cloned in XL-lBlue bacteria contains enterochelin and is iron-loaded, while NGAL cloned in BL-21 bacteria does not contain enterochelin. Ten ⁇ g of XL- 1 Blue-cloned NGAL (holo-Ngal 10 ⁇ g, left panel) protected the kidney in comparison with sham-treated (Sham) and untreated ATN-injured kidney (ATN), shown in FIGURE 17 A.
- BL-21-cloned NGAL apo-Ngal 10 ⁇ g, center panel
- enterochelin apo-Ngal 10 ⁇ g, center panel
- BL-21-cloned NGAL was reconstituted with iron-free (apo-Ngal:Sid) and iron- saturated enterochelin (apo-Ngal:Sid:Fe).
- Loading with enterochelin (with or without iron) enhanced the protection of the kidney and blunted the rise in serum creatinine.
- the presence of iron was slightly less protective, since iron-saturated siderophore has a diminished capacity for chelating iron in the kidney.
- gallium is a metal that occupies iron binding sites with high affinity, including the enterochelin siderophore (gallium blocks 55 Fe binding to enterochelin to the same extent as unlabeled iron), and because it can not undergo redox reactions typical of iron, gallium competes with iron for binding to the siderophore.
- a single dose of free Siderophore (Sid), desferrioxamine mesylate (DFO) or retinol-binding protein (RBP) failed to protect against ATN.
- NGAL siderophore complexes provide the protective activity of NGAL, and that iron transport by the siderophore is dependent upon NGAL.
- An immunoblot of NGAL: Siderophore complexes with or without iron (Fe) are shown in FIGURE 17B.
- EXAMPLE 15 [0170] Demonstration of a Urine Siderophore.
- the actions of endogenous NGAL in vivo might differ from the pharmacological effect of exogenous NGAL, because the critical siderophore associated with exogenous NGAL is a bacterial product.
- the presence of endogenous low molecular weight factors that transport iron, however, have been suggested by a variety of studies. These molecules can include citrate, and related compounds, but also iron-transporting activities that have a molecular weight in the range of lKd.
- apo-NGAL from BL21 bacteria was mixed with urine samples from healthy mice.
- mouse urine contains a low molecular weight co-factor that permits NGAL-iron interactions. Because the endogenous factor is competitive with the bacterial siderophore, which binds the calyx with high affinity (0.4 nM), it appears that both bacterial and mammalian factors occupy the same binding pocket of the lipocalin.
- EXAMPLE 17 Use of NGAL measurement as a diagnostic tool for Acute Renal Failure.
- CPB cardiopulmonary bypass
- ARF acute renal failure
- Serum NGAL measurement can be highly predictive for patients who at risk of developing ARF.
- Standard curves for NGAL ELISA are shown in FIGURE 24, the linear relationships obtained from 10 independent standard curves.
- Urine NGAL levels at 2 hr postoperative correlated with length of CBP time during surgery, shown in FIGURE 29.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Diabetes (AREA)
- Gastroenterology & Hepatology (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Endocrinology (AREA)
- Marine Sciences & Fisheries (AREA)
- Wood Science & Technology (AREA)
- Environmental Sciences (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2005240190A AU2005240190C1 (en) | 2004-05-06 | 2005-05-06 | NGAL for reduction and amelioration of ischemic and nephrotoxic injuries |
| CA002565701A CA2565701A1 (en) | 2004-05-06 | 2005-05-06 | Ngal for reduction and amelioration of ischemic and nephrotoxic injuries |
| EP05749675.4A EP1750500B1 (en) | 2004-05-06 | 2005-05-06 | Ngal for reduction and amelioration of ischemic and nephrotoxic injuries |
| JP2007511623A JP2007536260A (ja) | 2004-05-06 | 2005-05-06 | 虚血性および腎毒性障害の軽減および改善用ngal |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US56864504P | 2004-05-06 | 2004-05-06 | |
| US60/568,645 | 2004-05-06 | ||
| US61556604P | 2004-10-01 | 2004-10-01 | |
| US60/615,566 | 2004-10-01 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2005107793A2 true WO2005107793A2 (en) | 2005-11-17 |
| WO2005107793A3 WO2005107793A3 (en) | 2005-12-29 |
Family
ID=35320735
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2005/015799 Ceased WO2005107793A2 (en) | 2004-05-06 | 2005-05-06 | Ngal for reduction and amelioration of ischemic and nephrotoxic injuries |
Country Status (6)
| Country | Link |
|---|---|
| US (5) | US7776824B2 (https=) |
| EP (2) | EP1750500B1 (https=) |
| JP (1) | JP2007536260A (https=) |
| AU (1) | AU2005240190C1 (https=) |
| CA (1) | CA2565701A1 (https=) |
| WO (1) | WO2005107793A2 (https=) |
Cited By (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008201677A (ja) * | 2007-02-16 | 2008-09-04 | Gekkeikan Sake Co Ltd | 抗炎症剤及び抗酸化剤 |
| WO2006078717A3 (en) * | 2005-01-19 | 2008-10-16 | Beth Israel Hospital | Lipocalin 2 for the treatment, prevention, and management of cancer metastasis, angiogenesis, and fibrosis |
| EP1946105A4 (en) * | 2005-10-13 | 2009-12-02 | Childrens Hosp Medical Center | DIAGNOSIS AND OBSERVATION OF A CHRONIC CHILDNESS FOR DISEASE USING NGAL |
| US20100086944A1 (en) * | 2006-11-14 | 2010-04-08 | Gunars Valkirs | Methods and Compositions for Diagnosis and Prognosis of Renal Artery Stenosis |
| EP2264459A2 (en) | 2004-06-07 | 2010-12-22 | The Children's Hospital Medical Center | Method for the early detection of renal disease and injury |
| EP2300048A4 (en) * | 2008-04-30 | 2011-08-24 | Versitech Ltd | LIPOCALIN-2 AS A PROGNOSTIC AND DIAGNOSTIC MARKER FOR HEART AND STROKE RISKS |
| EP2095107A4 (en) * | 2006-11-14 | 2011-12-28 | Alere San Diego Inc | METHOD AND COMPOSITIONS FOR MONITORING AND RISK ASSESSMENT OF HEART KIDNEY SYNDROME |
| WO2012042061A1 (en) * | 2010-10-01 | 2012-04-05 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for predicting the progression and treating a chronic kidney disease in a patient |
| US8313919B2 (en) | 2007-03-21 | 2012-11-20 | Bioporto Diagnostics A/S | Diagnostic test for renal injury |
| US8592170B2 (en) | 2008-03-12 | 2013-11-26 | The Trustees Of Columbia University In The City Of New York | High molecular weight Ngal as a biomarker for chronic kidney disease |
| US8628930B2 (en) | 2009-04-27 | 2014-01-14 | Niigata University | Use of megalin in urine as marker for detecting renal disorder |
| US8663931B2 (en) | 2009-04-27 | 2014-03-04 | Niigata University | Method for detecting renal disease comprising measuring human megalin in urine |
| US8703430B2 (en) | 2006-03-28 | 2014-04-22 | Niigata University | Method for measuring human megalin |
| US8846036B2 (en) | 2007-10-19 | 2014-09-30 | Abbott Laboratories | Antibodies that bind to mammalian NGAL and uses thereof |
| US9018347B2 (en) | 2010-02-04 | 2015-04-28 | Morphotek, Inc. | Chlorotoxin polypeptides and conjugates and uses thereof |
| US9023595B2 (en) | 2008-05-15 | 2015-05-05 | Morphotek, Inc. | Treatment of metastatic tumors |
| CN105699654A (zh) * | 2014-12-15 | 2016-06-22 | 株式会社芳珂 | 皮肤角质层的ngal的表达量的用途 |
| US9534027B2 (en) | 2010-05-24 | 2017-01-03 | The Trustees Of Columbia University In The City Of New York | Mutant NGAL proteins and uses thereof |
| US9624281B2 (en) | 2012-11-21 | 2017-04-18 | The Trustees Of Columbia University In The City Of New York | Mutant NGAL proteins and uses thereof |
| EP3184116A1 (en) * | 2015-12-23 | 2017-06-28 | National Taiwan Normal University | Neutrophil gelatinase-associated lipocalin for use in prevention or treatment of polycystic kidney disease |
| US9927446B2 (en) | 2006-05-30 | 2018-03-27 | Antibosyshop A/S | Methods and devices for rapid assessment of severity of injury |
| US9944683B2 (en) | 2010-05-11 | 2018-04-17 | Fred Hutchinson Cancer Research Center | Chlorotoxin variants, conjugates, and methods for their use |
| US10156559B2 (en) | 2012-12-10 | 2018-12-18 | Fred Hutchinson Cancer Research Center | Lipocalin fusion partners |
| US10307461B2 (en) | 2015-12-23 | 2019-06-04 | National Taiwan Normal University | Method of preventing polycystic kidney disease and PKD animal model with exogenous neutrophil gelatinase-associated lipocalin |
| EP3641798A1 (en) * | 2017-06-23 | 2020-04-29 | Aki Therapeutics Aps | Compositions for the prevention and treatment of acute renal injury |
| US11559580B1 (en) | 2013-09-17 | 2023-01-24 | Blaze Bioscience, Inc. | Tissue-homing peptide conjugates and methods of use thereof |
| US12048732B2 (en) | 2016-04-15 | 2024-07-30 | Blaze Bioscience, Inc. | Methods of treating breast cancer |
Families Citing this family (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2005288522B2 (en) * | 2004-09-28 | 2012-06-28 | Quark Pharmaceuticals, Inc. | Oligoribonucleotides and methods of use thereof for treatment of alopecia, acute renal failure and other diseases |
| ES2818028T3 (es) * | 2004-12-20 | 2021-04-09 | Antibodyshop As | Determinación de lipocalina asociada a gelatinasa de neutrófilos (NGAL) como marcador diagnóstico para trastornos renales |
| US20080090304A1 (en) * | 2006-10-13 | 2008-04-17 | Barasch Jonathan Matthew | Diagnosis and monitoring of chronic renal disease using ngal |
| US7825099B2 (en) * | 2006-01-20 | 2010-11-02 | Quark Pharmaceuticals, Inc. | Treatment or prevention of oto-pathologies by inhibition of pro-apoptotic genes |
| US7662578B2 (en) | 2006-04-21 | 2010-02-16 | Children's Hospital Medical Center | Method and kit for the early detection of impaired renal status |
| US20080090765A1 (en) * | 2006-05-25 | 2008-04-17 | The Trustees Of Columbia University In The City Of New York | Compositions for modulating growth of embryonic and adult kidney tissue and uses for treating kidney damage |
| WO2008017306A1 (en) * | 2006-08-07 | 2008-02-14 | Antibodyshop A/S | Diagnostic test to exclude significant renal injury |
| WO2009001359A2 (en) * | 2007-06-27 | 2008-12-31 | Quark Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of pro-apoptotic genes |
| US20100122355A1 (en) * | 2008-07-16 | 2010-05-13 | Neal Paragas | Transgenic Reporter Mouse and Method for Use |
| EP2330897A4 (en) * | 2008-09-18 | 2013-11-27 | Univ Columbia | NGAL-BINDING SIDEROPHORES AND THEIR USE FOR THE TREATMENT OF IRON DEFICIENCY AND IRON SURPLUS |
| JP2012507723A (ja) * | 2008-11-03 | 2012-03-29 | シェーリング コーポレイション | 炎症性腸疾患生物マーカーおよび関連治療方法 |
| KR101939964B1 (ko) * | 2008-11-21 | 2019-01-18 | 퓨처 메디칼 다이아그노스틱스 코 엘티디 | 급성 신장 손상의 발견 또는 감시 방법, 장치 및 키트 |
| US20100233739A1 (en) * | 2009-02-12 | 2010-09-16 | Jonathan Barasch | Use of urinary ngal to diagnose unilateral and bilateral urinary obstruction |
| US20100233740A1 (en) * | 2009-02-12 | 2010-09-16 | Jonathan Barasch | Use of urinary ngal to distinguish kidney disease and predict mortality in subjects with cirrhosis |
| EP2292284B1 (en) * | 2009-09-04 | 2014-02-26 | B. Braun Avitum AG | Kidney substitution treatment machine |
| WO2011140554A1 (en) * | 2010-05-07 | 2011-11-10 | The Trustees Of Columbia University In The City Of New York | Ngal and urinary tract infection |
| EP2697389A4 (en) * | 2011-04-11 | 2014-09-10 | Univ Columbia | ABOUT OSTEOBLASTEN EXPRESSED LIPOCALIN 2 FOR THE ADJUSTMENT OF GLUCOSE COMPOUND CHANGES |
| WO2012167092A2 (en) * | 2011-06-03 | 2012-12-06 | The Regents Of The University Of Colorado, A Body Corporate | Uses of and methods of treatment with cystathionine |
| EP3200582B1 (en) | 2014-09-29 | 2023-11-15 | Fred Hutchinson Cancer Center | Compositions, kits, and methods to induce acquired cytoresistance using stress protein inducers |
| WO2017027858A1 (en) | 2015-08-12 | 2017-02-16 | The Trustees Of Columbia University In The City Of New York | Methods of treating volume depletion and kidney injury |
| CN108290058B (zh) | 2015-09-17 | 2023-05-16 | 美国安进公司 | 使用il23途径生物标志物预测il23拮抗剂的临床应答 |
| EP3383415B1 (en) | 2015-12-01 | 2021-03-31 | Cornell University | Use of mitochondrial iron chelators for treatment of chronic obstructive pulmonary disease |
| US11220541B2 (en) | 2015-12-22 | 2022-01-11 | Amgen Inc. | CCL20 as a predictor of clinical response to IL23-antagonists |
| US11298564B2 (en) | 2020-03-10 | 2022-04-12 | Dennis M. Anderson | Medical, surgical and patient lighting apparatus, system, method and controls with pathogen killing electromagnetic radiation |
| CN113075371B (zh) * | 2021-03-22 | 2022-11-18 | 重庆医药高等专科学校 | 一种药物崩解仪 |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100251594B1 (ko) * | 1995-04-12 | 2000-06-01 | 알카 쿠보넨 | 치근막 질환의 진단과 이의 진행위험을 예견하는 방법과 이에 사용되는 테스트 키트 |
| ES2258793T5 (es) | 1996-05-24 | 2010-01-25 | Biogen Idec Ma Inc. | Moduladores de la regeneracion tisular. |
| AUPP784398A0 (en) | 1998-12-21 | 1999-01-21 | Monash University | Kidney disease detection and treatment |
| US6114123A (en) | 1999-06-14 | 2000-09-05 | Incyte Pharmaceuticals, Inc. | Lipocalin family protein |
| WO2003029462A1 (en) | 2001-09-27 | 2003-04-10 | Pieris Proteolab Ag | Muteins of human neutrophil gelatinase-associated lipocalin and related proteins |
| GB0215509D0 (en) | 2002-07-04 | 2002-08-14 | Novartis Ag | Marker genes |
| AU2003247303A1 (en) | 2002-07-17 | 2004-02-02 | Index Pharmaceuticals Ab | Antisense compounds, methods and compositions for treating ngal-related inflammatory disorders |
| DE602004022150D1 (de) | 2003-03-27 | 2009-09-03 | Childrens Hosp Medical Center | Verfahren und kit zum nachweis des frühstadiums einer nierentubuluszellenverletzung |
| US20050272101A1 (en) * | 2004-06-07 | 2005-12-08 | Prasad Devarajan | Method for the early detection of renal injury |
-
2005
- 2005-05-06 CA CA002565701A patent/CA2565701A1/en not_active Abandoned
- 2005-05-06 EP EP05749675.4A patent/EP1750500B1/en not_active Expired - Lifetime
- 2005-05-06 AU AU2005240190A patent/AU2005240190C1/en not_active Ceased
- 2005-05-06 WO PCT/US2005/015799 patent/WO2005107793A2/en not_active Ceased
- 2005-05-06 JP JP2007511623A patent/JP2007536260A/ja not_active Withdrawn
- 2005-05-06 EP EP13178086.8A patent/EP2661963B1/en not_active Expired - Lifetime
- 2005-05-06 US US11/123,364 patent/US7776824B2/en not_active Expired - Fee Related
-
2010
- 2010-06-17 US US12/817,566 patent/US8247376B2/en not_active Expired - Fee Related
-
2012
- 2012-01-27 US US13/359,772 patent/US20120219956A1/en not_active Abandoned
-
2013
- 2013-03-14 US US13/804,169 patent/US20130295589A1/en not_active Abandoned
-
2016
- 2016-02-26 US US15/054,551 patent/US20170003298A1/en not_active Abandoned
Non-Patent Citations (2)
| Title |
|---|
| None |
| See also references of EP1750500A4 |
Cited By (45)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2264459A2 (en) | 2004-06-07 | 2010-12-22 | The Children's Hospital Medical Center | Method for the early detection of renal disease and injury |
| WO2006078717A3 (en) * | 2005-01-19 | 2008-10-16 | Beth Israel Hospital | Lipocalin 2 for the treatment, prevention, and management of cancer metastasis, angiogenesis, and fibrosis |
| EP1946105A4 (en) * | 2005-10-13 | 2009-12-02 | Childrens Hosp Medical Center | DIAGNOSIS AND OBSERVATION OF A CHRONIC CHILDNESS FOR DISEASE USING NGAL |
| US8703430B2 (en) | 2006-03-28 | 2014-04-22 | Niigata University | Method for measuring human megalin |
| US9927446B2 (en) | 2006-05-30 | 2018-03-27 | Antibosyshop A/S | Methods and devices for rapid assessment of severity of injury |
| US11125761B2 (en) | 2006-05-30 | 2021-09-21 | Antibodyshop A/S | Methods and devices for rapid assessment of severity of injury |
| EP2095107A4 (en) * | 2006-11-14 | 2011-12-28 | Alere San Diego Inc | METHOD AND COMPOSITIONS FOR MONITORING AND RISK ASSESSMENT OF HEART KIDNEY SYNDROME |
| US8283128B2 (en) | 2006-11-14 | 2012-10-09 | Alere San Diego, Inc. | Methods and compositions for monitoring and risk prediction in cardiorenal syndrome |
| EP2500723A3 (en) * | 2006-11-14 | 2013-03-06 | Alere San Diego, Inc. | Methods for monitoring and risk prediction in cardiorenal syndrome |
| US8524462B2 (en) | 2006-11-14 | 2013-09-03 | Alere San Diego, Inc. | Methods and compositions for diagnosis and prognosis of renal artery stenosis |
| US20100086944A1 (en) * | 2006-11-14 | 2010-04-08 | Gunars Valkirs | Methods and Compositions for Diagnosis and Prognosis of Renal Artery Stenosis |
| US8969018B2 (en) | 2006-11-14 | 2015-03-03 | Alere San Diego, Inc. | Methods and compositions for monitoring and risk prediction in cardiorenal syndrome |
| JP2008201677A (ja) * | 2007-02-16 | 2008-09-04 | Gekkeikan Sake Co Ltd | 抗炎症剤及び抗酸化剤 |
| US8313919B2 (en) | 2007-03-21 | 2012-11-20 | Bioporto Diagnostics A/S | Diagnostic test for renal injury |
| US8846036B2 (en) | 2007-10-19 | 2014-09-30 | Abbott Laboratories | Antibodies that bind to mammalian NGAL and uses thereof |
| US8592170B2 (en) | 2008-03-12 | 2013-11-26 | The Trustees Of Columbia University In The City Of New York | High molecular weight Ngal as a biomarker for chronic kidney disease |
| EP2300048A4 (en) * | 2008-04-30 | 2011-08-24 | Versitech Ltd | LIPOCALIN-2 AS A PROGNOSTIC AND DIAGNOSTIC MARKER FOR HEART AND STROKE RISKS |
| US9023595B2 (en) | 2008-05-15 | 2015-05-05 | Morphotek, Inc. | Treatment of metastatic tumors |
| US9603952B2 (en) | 2008-05-15 | 2017-03-28 | Morphotek, Inc. | Treatment of metastatic tumors |
| US8663931B2 (en) | 2009-04-27 | 2014-03-04 | Niigata University | Method for detecting renal disease comprising measuring human megalin in urine |
| US8628930B2 (en) | 2009-04-27 | 2014-01-14 | Niigata University | Use of megalin in urine as marker for detecting renal disorder |
| US9018347B2 (en) | 2010-02-04 | 2015-04-28 | Morphotek, Inc. | Chlorotoxin polypeptides and conjugates and uses thereof |
| US9234015B2 (en) | 2010-02-04 | 2016-01-12 | Morphotek, Inc. | Chlorotoxin polypeptides and conjugates and uses thereof |
| US10183975B2 (en) | 2010-02-04 | 2019-01-22 | Morphotek, Inc. | Chlorotoxin polypeptides and conjugates and uses thereof |
| US9637526B2 (en) | 2010-02-04 | 2017-05-02 | Morphotek, Inc. | Chlorotoxin polypeptides and conjugates and uses thereof |
| US10822381B2 (en) | 2010-05-11 | 2020-11-03 | Fred Hutchinson Cancer Research Center | Chlorotoxin variants, conjugates, and methods for their use |
| US9944683B2 (en) | 2010-05-11 | 2018-04-17 | Fred Hutchinson Cancer Research Center | Chlorotoxin variants, conjugates, and methods for their use |
| US9534027B2 (en) | 2010-05-24 | 2017-01-03 | The Trustees Of Columbia University In The City Of New York | Mutant NGAL proteins and uses thereof |
| US10588937B2 (en) | 2010-05-24 | 2020-03-17 | The Trustees Of Columbia University In The City Of New York | Mutant NGAL proteins and uses thereof |
| US11730790B2 (en) | 2010-05-24 | 2023-08-22 | The Trustees Of Columbia University In The City Of New York | Mutant NGAL proteins and uses thereof |
| US10337008B2 (en) | 2010-10-01 | 2019-07-02 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Methods for predicting the progression and treating a chronic kidney disease in a patient |
| WO2012042061A1 (en) * | 2010-10-01 | 2012-04-05 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for predicting the progression and treating a chronic kidney disease in a patient |
| US10829525B2 (en) | 2012-11-21 | 2020-11-10 | The Trustees Of Columbia University In The City Of New York | Mutant NGAL proteins and uses thereof |
| US12173037B1 (en) | 2012-11-21 | 2024-12-24 | The Trustees Of Columbia University In The City Of New York | Mutant NGAL proteins and uses thereof |
| US9624281B2 (en) | 2012-11-21 | 2017-04-18 | The Trustees Of Columbia University In The City Of New York | Mutant NGAL proteins and uses thereof |
| US10156559B2 (en) | 2012-12-10 | 2018-12-18 | Fred Hutchinson Cancer Research Center | Lipocalin fusion partners |
| US11559580B1 (en) | 2013-09-17 | 2023-01-24 | Blaze Bioscience, Inc. | Tissue-homing peptide conjugates and methods of use thereof |
| US12048750B2 (en) | 2013-09-17 | 2024-07-30 | Blaze Bioscience, Inc. | Tissue-homing peptide conjugates and methods of use thereof |
| CN105699654A (zh) * | 2014-12-15 | 2016-06-22 | 株式会社芳珂 | 皮肤角质层的ngal的表达量的用途 |
| US10307461B2 (en) | 2015-12-23 | 2019-06-04 | National Taiwan Normal University | Method of preventing polycystic kidney disease and PKD animal model with exogenous neutrophil gelatinase-associated lipocalin |
| EP3184116A1 (en) * | 2015-12-23 | 2017-06-28 | National Taiwan Normal University | Neutrophil gelatinase-associated lipocalin for use in prevention or treatment of polycystic kidney disease |
| US12048732B2 (en) | 2016-04-15 | 2024-07-30 | Blaze Bioscience, Inc. | Methods of treating breast cancer |
| EP3641798A1 (en) * | 2017-06-23 | 2020-04-29 | Aki Therapeutics Aps | Compositions for the prevention and treatment of acute renal injury |
| US11471445B2 (en) | 2017-06-23 | 2022-10-18 | Aki Therapeutics Aps | Compositions for the prevention and treatment of acute renal injury |
| EP3641798B1 (en) * | 2017-06-23 | 2026-01-21 | Aki Therapeutics Aps | Compositions for the prevention and treatment of acute renal injury |
Also Published As
| Publication number | Publication date |
|---|---|
| US8247376B2 (en) | 2012-08-21 |
| EP1750500B1 (en) | 2015-07-08 |
| AU2005240190C1 (en) | 2012-01-19 |
| US20170003298A1 (en) | 2017-01-05 |
| EP2661963B1 (en) | 2015-09-16 |
| US7776824B2 (en) | 2010-08-17 |
| EP1750500A4 (en) | 2009-09-09 |
| US20130295589A1 (en) | 2013-11-07 |
| CA2565701A1 (en) | 2005-11-17 |
| AU2005240190A1 (en) | 2005-11-17 |
| WO2005107793A3 (en) | 2005-12-29 |
| JP2007536260A (ja) | 2007-12-13 |
| EP2661963A1 (en) | 2013-11-13 |
| US20120219956A1 (en) | 2012-08-30 |
| US20100254970A1 (en) | 2010-10-07 |
| EP1750500A2 (en) | 2007-02-14 |
| AU2005240190B2 (en) | 2011-08-25 |
| US20050261191A1 (en) | 2005-11-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7776824B2 (en) | NGAL for reduction and amelioration of ischemic and nephrotoxic injuries | |
| Scindia et al. | Hepcidin mitigates renal ischemia-reperfusion injury by modulating systemic iron homeostasis | |
| Mishra et al. | Amelioration of ischemic acute renal injury by neutrophil gelatinase-associated lipocalin | |
| Gburek et al. | Megalin and cubilin are endocytic receptors involved in renal clearance of hemoglobin | |
| US20230414709A1 (en) | Mutant ngal proteins and uses thereof | |
| Mori et al. | Endocytic delivery of lipocalin-siderophore-iron complex rescues the kidney from ischemia-reperfusion injury | |
| JP6406987B2 (ja) | ラジカルスカベンジャー及び抗酸化剤アルファ−1−ミクログロブリンの医薬的使用 | |
| US12173037B1 (en) | Mutant NGAL proteins and uses thereof | |
| Qi et al. | Mitoglitazone ameliorates renal ischemia/reperfusion injury by inhibiting ferroptosis via targeting mitoNEET | |
| Chen et al. | Human heat shock protein 27 overexpressing mice are protected against hepatic ischemia and reperfusion injury | |
| Beauchamp et al. | Increased nephrotoxicity of gentamicin in pyelonephritic rats | |
| Liao et al. | Hyperbilirubinemia aggravates renal ischemia reperfusion injury by exacerbating PINK1-PARKIN–mediated mitophagy | |
| CN101010001A (zh) | Ngal用于减少和改善局部缺血和肾中毒损伤 | |
| Madsen | Mercury accumulation in kidney lysosomes of proteinuric rats | |
| Li et al. | Expression of neutrophil gelatinase-associated lipocalin in low osmolar contrast-induced nephropathy in rats and the effect of N-acetylcysteine | |
| US20240238195A1 (en) | Methods and compositions for inhibiting a noxious insult | |
| Lin et al. | A new aspect of penehyclidine hydrochloride in alleviating myocardial ischemia–reperfusion injury: ferroptosis | |
| WO2018102603A1 (en) | The use of vimentin in the modulation of acute inflammation and thrombosis | |
| JP7412722B2 (ja) | 溶血反応により誘発される腎障害の抑制 | |
| Alsaadi | Identification of Signalling Pathways Regulating Autophagy in Response to Cellular Stress | |
| Carlos et al. | SHAM IR IR+ DEXA IR+ GAL-1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2005240190 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2565701 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007511623 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2005240190 Country of ref document: AU Date of ref document: 20050506 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005240190 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005749675 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200580022943.3 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005749675 Country of ref document: EP |