WO2005103255A1 - Recepteur formylpeptide (fpr) utilise en tant que cible pour une therapie anti-gliome malin - Google Patents

Recepteur formylpeptide (fpr) utilise en tant que cible pour une therapie anti-gliome malin Download PDF

Info

Publication number
WO2005103255A1
WO2005103255A1 PCT/US2005/005652 US2005005652W WO2005103255A1 WO 2005103255 A1 WO2005103255 A1 WO 2005103255A1 US 2005005652 W US2005005652 W US 2005005652W WO 2005103255 A1 WO2005103255 A1 WO 2005103255A1
Authority
WO
WIPO (PCT)
Prior art keywords
fpr
glioma
cell
cells
agent
Prior art date
Application number
PCT/US2005/005652
Other languages
English (en)
Inventor
Ji Ming Wang
Ye Zhou
Ying-Ying Le
Wanghua Gong
Original Assignee
The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services filed Critical The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Publication of WO2005103255A1 publication Critical patent/WO2005103255A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/12—Cyclic peptides, e.g. bacitracins; Polymyxins; Gramicidins S, C; Tyrocidins A, B or C
    • A61K38/13—Cyclosporins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • the present invention relates, e.g., to agents which inhibit malignant properties of glioma cells that are mediated by a particular receptor protein, and to methods for inhibiting glioma cells, using such agents.
  • the agents include, e.g., siRNAs and small molecule antagonists of the receptor.
  • Glioma is the most common malignant neoplasm in the central nervous system (CNS). In degree of aggressiveness these tumors range from slower-growing "low-grade” tumors to more rapidly growing "high-grade” tumors, such as anaplastic astrocytoma (AA) and glioblastoma multiforme (GBM), which are characterized by the presence of necrotic foci and high degree of vascularity. Without wishing to be bound by any particular mechanism, it is likely that this vascularity is due to aberrant expression of angiogenic factors, such as VEGF, by the tumor cells. Gliomas are almost invariably fatal, and effective methods for inhibiting them have not been described.
  • AA aplastic astrocytoma
  • GBM glioblastoma multiforme
  • Formylpeptide receptor is a classical chemoattractant receptor. Like other chemoattractant receptors, it is a seven transmembrane, G protein-coupled receptor, which mediates cell migration ' in response to chemotactic factors. FPR was first identified in phagocytic leukocytes, in which it is a high affinity receptor for the bacterial chemotactic peptide fMLF, and plays an important role in host defense against microbial infection (see, e.g., Le et al. (2000), J. Neuroimmunol. 111. 102-108).
  • astrocytoma cell lines express a functional FPR, and that the cells are induced by the bacterial chemotactic peptide N-formyl-methionyl-leucyl- phenylalanine (fMLF) to migrate and to exhibit calcium (Ca 2+ ) mobilization.
  • fMLF bacterial chemotactic peptide N-formyl-methionyl-leucyl- phenylalanine
  • FIG. 1 shows the expression and function of FPR in human astrocytoma cell lines.
  • Fig. 1A shows experiments in which the expression of FPR mRNA by astrocytoma cell lines and normal astrocytes was examined by RT-PCR. Human monocytes were used as controls. PCR products were separated on agarose gel and stained with ethidium bromide.
  • Fig. IB different concentrations of chemoattractants were placed in the lower wells of the chemotaxis chamber.
  • U87 astrocytoma cells were placed in the upper wells. After incubation, the cells that migrated across the polycarbonate filters were stained and counted. The results are expressed as the mean number (+ SD) of migrated cells in 3 HPF.
  • Fig. IC and Fig. ID show inhibition of astrocytoma cell migration by FPR antagonists CsH and tBOC-MLF.
  • U87 cells were preincubated for 30 min at 37°C with 5 ⁇ M CsH (Fig. IC) or 100 ⁇ M tBOC-MLF
  • Fig. ID then were measured for migration in response to fMLF or W pep. * Denotes significantly reduced cell migration compared with cells pretreated with medium alone (P ⁇ 0.05).
  • Fig. IE U87 cells were loaded with Fura-2 and stimulated with different concentrations of FPR agonists. The increased ratio of fluorescence at 340 and 380 nm wavelengths was recorded.
  • FIG. 2 shows the activation of MAPKs and Akt in astrocytoma cells by the FPR agonist peptide fMLF.
  • U87 cells stimulated with fMLF at 37°C were lysed and examined for increased phosphorylation of ERK1/2 (Fig. 2A), p38 (Fig. 2B), JNK (Fig.2C), and Akt (Fig. 2D).
  • Antibodies against pan proteins were used to demonstrate the levels of total proteins.
  • U87 cells were also preincubated with 30 ⁇ M PD98059 (MEK1 inhibitor) (Fig. 2A), 10 ⁇ M SB202190 (p38 inhibitor) (Fig. 2B), or 10 ⁇ M LY294002 (PI3K inhibitor) (Fig. 2D) for 30 min at 37°C, followed by stimulation with 100 nM fMLF to examined the phosphorylation of ERK1/2 (3 min), p38 (5 min), or Akt (30 min).
  • Figure 3 shows the activation of NF- ⁇ B and HIF-l ⁇ in astrocytoma cells by fMLF.
  • U87 cells were treated with different concentrations of fMLF for the indicated times at 37°C.
  • EMSA Fig. 3A
  • 5 ⁇ g nuclear protein extracts were probed with the consensus NF- ⁇ B nucleotide sequence.
  • Supershift was performed by using anti-NF- KB ⁇ 50 and p65 antibodies.
  • NRS was used as a control.
  • the phorbol ester PMA (10 2 ng/ml) was a positive control.
  • Figure 4 shows the effect of fMLF on the expression of VEGF in astrocytoma cells.
  • U87 cells were incubated for different time periods (Fig. 4A) with different concentrations of fMLF (Fig. 4B).
  • Fig. 4A U87 cells were preincubated with 30 ⁇ M PD in DMSO (0.06%) or DMSO (0.06%) alone for 30 min at 37°C, followed by incubation with fMLF (10 2 nM) for an additional 6 h.
  • Fig.4C Total RNA was extracted and examined for the levels of VEGF transcripts.
  • the RT-PCR products at different dilutions were electrophoresed on agarose gel and visualized with ethidium bromide staining.
  • Figure 5 shows the biological activity of VEGF in supematants of U87 cells treated with fMLF.
  • VEGF contents in supematants of U87 cells treated with 10 2 nM fMLF for different times were determined by ELISA.
  • recombinant human VEGF (5 ng/ml) or supematants of U87 cells treated with fMLF (containing 5 ng/ml or 50 ng/ml VEGF) were preincubated with 1 ⁇ g/ml IgG or anti-VEGF antibody for 45 min at RT, then were tested for chemotactic activity for HUVECs.
  • supematants from U87 cells treated with fMLF (10 2 nM) for 72 h were preincubated with anti-VEGF antibody (1 ⁇ g/ml) or IgG for 45 min. HUVECs were then mixed with the supematants (containing 50 ng/ml VEGF) and examined for tubule formation on Matrigel. Photomicrographs were taken under a phase contrast microscope.
  • Figure 6 shows the phenotype and tumorigenicity of astrocytoma cells.
  • U87 and SHG44 cells were cultured on chamber slides and stained with anti-GFAP or anti-vimentin antibody. Arrows indicate positively stained tumor cells.
  • Fig. 6B U87 or SHG44 cells were implanted s.c. in the flanks of nude mice at 5 x 10 ⁇ tumor cells per mouse. The tumor size was measured daily and mice bearing tumors formed by U87 cells were euthanized on day 29 after tumor cell inoculation. ⁇
  • Figure 7 shows the production of endogenous formylpeptide receptor agonists by glioma cells.
  • Supematants from U87 cells under normal culture conditions Live
  • freezing-thawing Necrotic
  • 0.5 ⁇ M staurosporin for 7 h Apoptotic
  • U87 cells Fig. 7A
  • RBL rat basophilic leukemia
  • EFR cells EGF-induced FPR
  • FIG. 7B pretreated with IgG or anti-FPR antibody (10 ⁇ g/ml) for 30 min at 37°C were measured for chemotaxis in response to U87 supematants or fMLF (10 2 nM).
  • Fig. 7A Indicates significantly increased U87 cell migration in response to the supematants compared with medium (Fig. 7A) or denotes significantly reduced migration shown by ETFR cells treated with anti-FPR antibody compared to IgG (Fig. 7B).
  • Fig. 7C U87 cells were loaded with Fura-2 and stimulated with supematants from necrotic tumor cells or fMLF. The cells were also sequentially stimulated with the supematants and fMLF to examine FPR desensitization.
  • Figure 8 shows that the FPR inhibitor CDCA inhibits cell migration and abrogates the capacity of a glioma cell to grow tumors in nude mice.
  • Fig. 8A shows tumor growth in nude mice which were injected s.c. with 5xl0 6 human glioma cells and monitored over time. The mice bearing U87 tumors were sacrificed on day 29, while mice bearing SHG44 tumors were sacrificed on day 44.
  • Fig. 8B shows that incubation of U87 glioma cells with CDCA for 30 min significantly inhbited cell migration in response to fMLF.
  • Fig. 8C shows that mice injected with 2x10 ⁇ U87 tumor cells and treated daily with CD AC for 14 days showed reduced tumor size compared to controls.
  • Figure 9 shows the effect of siRNA on FPR function in U-87 cells.
  • Fig. 9A shows U-87 cells stably transfected with FPR-siRNA. Constructs were examined for FPR mRNA by RT-PCR.
  • Fig. 9B shows that siRNA transfected cells failed to migrate in response to fMLF; *P ⁇ 0.05 compared with mock transfected cells.
  • Fig. 9C and 9D show Mock or siRNA transfected U-87 cells that were stimulated with 10 2 nM fMLF and examined for phosphorylation of ERK1/2 (Fig. 9C) and STAT3 (Fig. 9D) by immunoblotting.
  • Fig. 9A shows U-87 cells stably transfected with FPR-siRNA. Constructs were examined for FPR mRNA by RT-PCR.
  • Fig. 9B shows that siRNA transfected cells failed to migrate in response to fMLF; *P ⁇ 0.05 compared with mock transfected cells.
  • Figure 10 shows the effect of FPR-siRNA on glioblastoma progression in athymic mice.
  • Fig. 10A shows U-87 cells with or without FPR-siRNA (1 x 10 cells/mouse) that were injected s.c. into athymic mice and examined for tumorigenicity.
  • Fig. 10B shows tumor sizes on day 30 and day 38 post-implantation of U-87 cells, as the mean (+ SD) volume of tumors from 8 mice.
  • Fig. 10C shows tumors grown in athymic mice on day 38 post-implantation.
  • Fig. 10D shows survival rates of tumor-bearing mice.
  • Fig. 10A shows U-87 cells with or without FPR-siRNA (1 x 10 cells/mouse) that were injected s.c. into athymic mice and examined for tumorigenicity.
  • Fig. 10B shows tumor sizes on day 30 and day 38 post-implantation of U-87 cells, as the mean (+ SD) volume of tumors from 8
  • FIG. 10E shows human glioblastoma cell line SNB75 that was stably transfected with FPR-siRNA and measured for chemotaxis induced by fMLF. * indicates significantly reduced cell migration as compared to Mock transfected cells.
  • Figure 11 shows the effect of the small molecule compound piceatannol (PA) on U87 growth in vivo (s.c. injection).
  • U-87 cells (5x10 6 ) were injected on the backs of Balb/C nude mice.
  • PA (5mg/kg) was administered when the tumor size reached 0.5 x 0.5 cm 3 by s.c. at tumor sites once each day. Tumor size was monitored twice every week.
  • Fig. 11A shows tumor growth curves.
  • Fig. 11B shows survival rates of the mice, indicates statistically significant inhibition of tumor growth by PA compared to controls (P ⁇ 0.05).
  • Figure 12 shows the effect of PA on U87 growth in vivo (i.p. injection).
  • U-87 cells (5xl0 6 ) were injected on the backs of Balb/C nude mice.
  • PA (5mg/kg) was administered when the tumor size reached 0.5 x 0.5 cm 3 by i.p. once each day. Tumor size was monitored twice every week. When the tumor size reached 2.0 x 2.0 cm 3 , mice were enthanized and the tumors were cut off to measure their weight.
  • Fig. 12A shows tumor growth curves.
  • Fig. 12B shows tumor weight on day 21. *indicates statistically significant inhibition of tumor growth compared to the controls (PO.05).
  • FPR formylpeptide receptor
  • FPR agonists stimulated a cascade of signaling events resulting in increased directional cell migration, phosphorylation of mitogen-activated protein kinases (MAPKs), activation of nuclear factor (NF) ⁇ B, and enhanced nuclear translocation of hypoxia-inducible factor-l (HIF-l ⁇ ).
  • MAPKs mitogen-activated protein kinases
  • NF nuclear factor
  • HIF-l ⁇ enhanced nuclear translocation of hypoxia-inducible factor-l
  • activation of FPR enhanced the mRNA expression and production by the astrocytoma cells of biologically active vascular endothelial growth factor (VEGF), a major angiogenic factor implicated in neovascularization of malignant tumors.
  • VEGF biologically active vascular endothelial growth factor
  • astrocytoma cell lines expressing functional FPR exhibited markedly greater tumorigenicity and growth rate in nude mice than tumor cell lines that did not express FPR.
  • necrotic astrocytoma cells released factors that activated FPR expressing rumor cells, suggesting a role for FPR as a sensor for agonists produced by necrotic astrocytoma cells promoting tumor cell migration and the production of angiogenic factors.
  • the Examples show that inhibitors of FPR expression (e.g., several siRNAs specific for FPR) or activity (e.g., known small molecule antagonists of FPR) reduced FPR-mediated responses of glioma cells in vitro (e.g., cell migration and calcium flux in response to a chemoattractant) and the tumorigenicity and growth of FPR- expressing malignant glioma cells in nude mice.
  • inhibitors of FPR expression e.g., several siRNAs specific for FPR
  • activity e.g., known small molecule antagonists of FPR
  • This invention relates, e.g., to a method for inhibiting a formylpeptide receptor (FPR)-mediated activity of a glioma cell that expresses FPR, comprising contacting the glioma cell with an effective amount of an agent that inhibits expression and/or activity of the FPR.
  • the cell is contacted in vitro (e.g., in culture).
  • the cell is contacted in an animal, e.g., a mammal, such as a laboratory animal (e.g., mouse, rat, guinea pig, rabbit, etc.), cat, dog, horse, non-human primate, or, preferably, a human.
  • the animal may be one that has a glioma tumor (either naturally occurring or implanted), or an animal that is susceptible to, or at risk for developing, a glioma.
  • a cell is contacted in order to prevent the growth of a tumor.
  • an inhibitor may be administered to an experimental animal (tumor model), such as an immunocompromised animal, in conjunction with the xenogeneic implantation of a glioma cell; or an agent may administered to an animal (such as a human) in which it is desired to prevent the recurrence of a glioma tumor, e.g. , following surgical removal of the bulk of a tumor.
  • FPR-mediated activities are, e.g., directional cell migration (e.g., in response to a chemoattractant); phosphorylation of mitogen-activated protein kinases (MAPKs) and the resulting activation of a cascade of signaling events; activation of nuclear factor (NF) ⁇ B; enhanced nuclear translocation of hypoxia-inducible factor-l ⁇ (HIF-l ⁇ ); and/or the production of biologically active vascular endothelial growth factor (VEGF).
  • NF nuclear factor
  • HIF-l ⁇ enhanced nuclear translocation of hypoxia-inducible factor-l ⁇
  • VEGF biologically active vascular endothelial growth factor
  • FPR-mediated activities that can be inhibited in an animal are, e.g., growth, invasion and/or metastasis of a glioma tumor in which the contacted glioma cell resides. These activities include all aspects of the progression of malignant gliomas, e.g., tumorigenesis, tumor growth, angiogenesis, formation of satellite lesions, tumor cell survival under the influence of FPR antagonists, and animal survival.
  • the agent inhibits the expression of FPR.
  • inhibitors of expression include an antisense nucleic acid, a ribozyme, or a small interfering nucleic acid (e.g., an siRNA), that is specific for a sequence encoding FPR, or for a sequence that regulates the expression of FPR.
  • the antisense nucleic acid, ribozyme, or interfering nucleic acid comprises a single stranded polynucleotide which is at least about 95% identical to the sequence AGAAATTGGTATTGCAGTG (SEQ ID NO: 1), ATTCGTCTTTACCATAGTG (SEQ ID NO: 2), or AACGGGGACAGTAGCCTGC (SEQ ID NO: 3), or a complement thereof.
  • Chimeric nucleic acid molecules in which two or more of these or other specific sequences are present, are also included in the invention.
  • the antisense nucleic acid, ribozyme, or small interfering nucleic acid may be, e.g., an oligonucleotide (single or double stranded); or it may be expressed in a cell from a polynucleotide comprising the inhibitory nucleic acid sequence, operably linked to an expression control sequence.
  • the inhibitory agent is an siRNA.
  • the agent inhibits an activity of the FPR.
  • inhibitors of activity include a small molecule FPR inhibitor, such as the gall bladder products deoxyxholic acid (DCA), chenodeosycholic acid (CDCA), the bacterial products cyclosporine A or cyclosporine H, or members of the stilbene family, such as piceatanol; a competitive inhibitor (e.g., a peptide) of FPR (such as Boc-FLFLF) (SEQ
  • one of the above agents may further comprise an effector molecule, such as a radionuclide, toxin, or other therapeutic moiety, or a molecule that enhances the stability and/or effectiveness of the agent (e.g., antibody).
  • Another aspect of the invention is a method for treating a subject having a glioma, comprising administering to the subject an effective amount of an agent that inhibits FPR expression and/or activity.
  • the inhibitor may be administered systemically or directly to the tumor (e.g., during brain surgery to resect the tumor).
  • an agent that inhibits FPR expression such as an interfering nucleic acid (e.g., an siRNA), an antisense nucleic acid, or a ribozyme, that is specific for a sequence encoding FPR or for a sequence regulating the expression of FPR.
  • an interfering nucleic acid e.g., an siRNA
  • an antisense nucleic acid or a ribozyme comprising (or consisting essentially of) a sequence that is at least about 95% identical to SEQ ID NO: 1, 2 and/or 3, or a complement thereof.
  • Another aspect of the invention is an agent that inhibits an FPR activity, such as a small molecule FPR inhibitor; a molecule, such as a peptide, that acts as a competitive inhibitor for FPR binding to a ligand; a nucleic acid in which sequences encoding such a peptide are operably linked to an expression control sequence; or an antibody specific for FPR.
  • an FPR activity such as a small molecule FPR inhibitor
  • a molecule such as a peptide, that acts as a competitive inhibitor for FPR binding to a ligand
  • a nucleic acid in which sequences encoding such a peptide are operably linked to an expression control sequence or an antibody specific for FPR.
  • Any of these agents may further be conjugated to an effector molecule, such as those noted above.
  • an effector molecule as used above, means one or more effector molecules, which may be the same or different.
  • any of the inhibitory agents of the invention can be in the form of a complex with FPR or with a functional domain of FPR. (The FPR N-terminus and the three extracellular loops described elsewhere herein are all involved in such binding, so an agent that binds to one or more of these domains has the potential of interfering with the functions of FPR.).
  • Such complexes can be formed in vitro (in which case they are "isolated” complexes); or they can be formed in vivo (e.g., following the administration of the inhibitory agent to a subject).
  • Complexes of the invention can associated by any of a variety of mechanisms, including, e.g., covalent, electrostatic, noncovalent, hydrophobic, hydrophilic, or noncovalent bonds, vanderWaals forces, coordination, adsortion, absorption, etc.
  • a glioma cell (or other cell that expresses FPR) comprising an inhibitory agent of the invention is also included in the invention.
  • the cell may contain an inhibitor of FPR expression, such as an interfering nucleic acid; or it may be associated with or bound to (e.g., on its surface) an agent that inhibits an activity of FPR.
  • any of the inhibitory agents of the invention can be in the form of a pharmaceutical composition, which comprises the inhibitory agent (e.g., a diagnostically or therapeutically effective amount of the inhibitory agent) and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition which comprises the inhibitory agent (e.g., a diagnostically or therapeutically effective amount of the inhibitory agent) and a pharmaceutically acceptable carrier.
  • “Therapeutic" compositions include compositions used to treat subjects as well as compositions that are used in diagnostic methods.
  • Another aspect of the invention is a diagnostic method for determining the degree of malignancy of a glioma, comprising detecting the presence and or the amount of FPR in a glioma cell from the glioma, wherein the presence of FPR, or the amount of FPR compared to a baseline value, is indicative of the degree of malignancy of the glioma (e.g., indicates that the glioma is highly malignant).
  • the cell is in a subject, or is in a sample from the patient (such as a biopsy sample).
  • FPR protein is detected on the surface of the glioma cell, and the detection is performed by contacting the glioma cell with a targeting molecule that binds specifically and efficiently to FPR, and which is attached (e.g., conjugated) to a detectable effector molecule (e.g., a chimeric molecule comprising an antibody specific for FPR and an effector molecule).
  • a detectable effector molecule e.g., a chimeric molecule comprising an antibody specific for FPR and an effector molecule.
  • the effector molecule is then detected, and/or its amount is measured.
  • the effector molecule may be, for example, a radioactive label, a fluorescent dye, a metal, or the like.
  • mRNA encoding FPR is detected, and the detection is performed by detecting (e.g., quantitating) the amount of mRNA (e.g., by hybridization, such as in situ hybridization, with a probe specific for sequences encoding FPR), or by amplification of the mRNA (e.g., using RT-PCR) with primers that are specific for FPR sequences.
  • Another aspect of the invention is a screening method for testing the ability of a putative agent to inhibit an FPR-mediated activity of a glioma cell expressing FPR (e.g.
  • a method for identifying an agent that inhibits an FPR- mediated activity of a glioma cell that expresses FPR comprising a) contacting a cell that expresses FPR or an active fragment, variant, mimetic or analog of FPR (e.g., a glioma cell, or a eukaryotic cell that has been transfected with a construct such that the cell over-expresses FPR) with a putative agent, under conditions effective for the putative agent to exert an effect on FPR expression and/or on an FPR activity; and b) determining the level of FPR expression and/or activity in the contacted cell compared to a baseline value, wherein a putative agent that elicits a decrease in the amount and/or activity of FPR in the contacted cell compared to the baseline value is a candidate for an anti-glioma agent.
  • the method further comprises c) determining if the candidate elicits an antiglioma effect in vivo (e.g., determining if it inhibits growth, invasion and/or metastasis of a glioma tumor in an animal).
  • Test compounds (putative agents) that can be evaluated by the method include antisense molecules, siRNAs, ribozymes, competitive inhibitors of FPR ligand binding, antibodies specific for FPR, small molecules, or the like.
  • Another aspect of the invention is a kit for carrying out any of the methods of the invention.
  • one embodiment is a kit for inhibiting an FPR-mediated activity of a glioma cell that expresses FPR, comprising an amount of an inhibitor of FPR expression and/or activity that is effective to inhibit said expression and/or activity and, optionally, means for contacting a glioma cell with the inhibitor.
  • Another embodiment is a kit for identifying an agent that inhibits an FPR-mediated activity of a glioma cell that expresses FPR, comprising an effective amount of a small molecule FPR inhibitor, a competitive inhibitor of FPR, or the like and, optionally, means to measure an effect of the agent.
  • the activity that is measured is Ca 2+ mobilization of the cell by a chemoattractant (e.g., fMLF), and or the assay is a high throughput assay.
  • a kit for detecting the presence and/or the amount of FPR in a glioma cell comprising an effective amount of an FPR- specific molecule (such as an antibody) that is attached to a detectable effector molecule, and, optionally, means for detecting the effector molecule.
  • This invention relates, e.g., to a method for inhibiting an FPR-mediated process in a cell that expresses FPR (e.g., a glioma cell; or a cell, such as a eukaryotic cell, which has been transfected with a construct such that the cell overexpresses FPR), comprising contacting the cell with an effective amount of an agent that inhibits expression and/or activity of the FPR (i.e., an FPR antagonist).
  • FPR e.g., a glioma cell; or a cell, such as a eukaryotic cell, which has been transfected with a construct such that the cell overexpresses FPR
  • the FPR-mediated process can be, for example, directional cell migration and/or Ca 2+ mobilization in response to a chemoattractant, such as f-MLF; phosphorylation of mitogen-activated protein kinases (MAPKs) and/or the activation of one or more of the resulting cascade of a signaling events, examples of which will be evident to a skilled worker; activation of nuclear factor (NF) ⁇ B; enhanced nuclear translocation of hypoxia-inducible factor-l ⁇ (HIF-l ⁇ ); and/or stimulation of the production of biologically active vascular endothelial growth factor (VEGF).
  • a chemoattractant such as f-MLF
  • MAMs mitogen-activated protein kinases
  • NF nuclear factor
  • HIF-l ⁇ enhanced nuclear translocation of hypoxia-inducible factor-l ⁇
  • VEGF biologically active vascular endothelial growth factor
  • an inhibitory agent of the invention generally has a net therapeutic effect on the environment in which the contacted cell resides (e.g., a tissue, tumor, metastasis, patient, or the like).
  • the therapeutic effect can be the inhibition of any physiological response of the cell. For example, a metabolic activity, a response to an internal or external environmental factor, a synthetic or catabolic process, activation, repression, etc., is altered.
  • the inhibitory agent can achieve inhibition or suppression of growth, killing, destruction, elimination, control, modification, etc. of the cell or tissue.
  • the inhibitor can inhibit, block, destabilize, decrease, down-regulate, diminish, lessen, reduce, etc a glioma cell or tumor. Cytostatic, cytolytic, cytotoxic, and carcinostatic effects are included.
  • the agent prevents the establishment, growth or metastasis of a neoplastic cell e.g., prevents the recurrence of a tumor in vivo, or prevents the establishment of a tumor when cells, such as astrocytomas, are implanted xenogeneically in an animal.
  • a "glioma,” as used herein, is one of the diverse groups of brain tumors that arise from normal astroglial cells of the brain or spinal cord.
  • the highly malignant form of glioma may invade cells of different parts of the CNS, e.g., the pineal gland or posterior pituitary gland. These tumors include, e.g., astrocytoma, neuroglioma, anaplastic astrocytoma, and glioblastoma multiforme. Whether gliomas originate from mature or neuroectodermal stem cells located in the adult brain is unknown, but pathological diagnosis depends on similarities of the tumor cells to non-neoplastic mature glial cells. According to WHO classification, there are three types of gliomas and each can be divided into four grades.
  • astrocytomas prilocytic astrocytoma (grade I); diffuse astrocytoma (grade II); anaplastic astrocytoma (grade III); glioblastoma (grade IV)); oligodendrogliomas (oligodendroglioma
  • the glioma can be a primary or secondary tumor.
  • the terms "glioma” and “glioma tumor” are used interchangeably herein.
  • a "glioma cell” is a cell from a glioma tumor.
  • a glioma cell can be in a tumor in a subject; a cell or tumor tissue comprising the cell which has been removed from a subject; or a primary cell or established cell line derived from a subject.
  • the cell is a cell (e.g., an astrocyte) that has been transformed into malignant cell experimentally (e.g., with a virus, tumor promoter, an oncogene, such as p-21-ras, by mutagenesis, etc.).
  • "Growth" of a glioma refers to an increase in size of the tumor. Without wishing to be bound by any particular mechanism, it is suggested that the growth can reflect proliferation of glioma cells, increased survival rate of glioma cells, and/or increase in the size of a tumor that is facilitated by increased angiogenesis supplying the tumor.
  • “Migration” of a glioma cell refers to directional movement of the cell in response to a chemoattractant. Such migration is important, for example, for invasion and/or metastasis of a glioma tumor.
  • An “inhibitor” of expression or activity is an agent that reduces the expression or activity by a detectable amount.
  • An “effective amount” of such an inhibitor is an amount that is sufficient to elicit a detectable amount of inhibition of expression or activity.
  • Effective conditions are conditions that are sufficient to elicit a detectable amount of inhibition of expression or activity.
  • expression of a gene refers to any aspect of the process by which information in a gene is converted to a functional molecule, e.g., any aspect of transcription or translation of the gene.
  • expression can refer to transcription, post-transcriptional processing, translation, or post-translational processing.
  • a "therapeutically effective” or “diagnostically effective” amount of a substance is an amount that is sufficient to elicit a detectable amount of a therapeutic effect (e.g., reduction of a symptom) or a diagnostic effect (e.g., the detection of FPR expression or activity).
  • an inhibitor can kill a cell (such as a glioma cell) to which it is administered.
  • the above method for inhibiting an FPR-mediated activity can be performed either in vitro (e.g., ex vivo) or in vivo.
  • In vitro methods can be performed with any suitable cell.
  • primary glioma tumor cells can be obtained from a subject, such as an experimental animal (e.g., a rat or mouse model) or a human (e.g., a human patient); or the cells can be from any of a variety of well-known suitable established cell lines, including but not limited to human glioma cell lines. Some suitable cell lines are illustrated in the Examples.
  • Cells other than glioma cells can also be used in methods of the invention, e.g., in methods for isolating or characterizing new agents that inhibit expression and or activity of FPR.
  • human FPR is inhibited in methods of the invention.
  • FPR has been isolated and characterized from a variety of organisms (e.g., P. troglodytes, G. gorilla, P. Pygmaeus, M mulatto, S. oedipus), and the methods of the invention can be used with inhibitors of any of these, or other, FPRs.
  • In vivo methods can be performed with cells in any of a variety of well-known animal models of glioma, including, e.g., immunocomprornised animals, such as nude mice, which harbor glioma xenografts. Once the effectiveness of an agent of the invention is confirmed in a suitable animal model, human patients can also be tested and treated.
  • a variety of types of inhibitors of expression of FPR will be evident to the skilled worker. These include, e.g., nucleic acid-based inhibitors, including antisense molecules, ribozymes and in a preferred embodiment, small interfering nucleic acids, such as siRNAs.
  • nucleic acid-based inhibitors are specific for a sequence encoding FPR, or for a sequence that regulates expression of FPR (an expression control sequence).
  • a nucleic acid- based inhibitor that is "specific for" an FPR sequence contains sequences that hybridize preferably to an FPR sequence (or its complement), but not to a non-FPR sequence (or its complement), under conditions in which specific binding is desired (e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, or, in the case of in vitro assays, under conditions in which the assays are performed).
  • An inhibitory nucleic acid of the invention includes a nucleic acid that is sufficiently complementary to the sequence of an mRNA encoding FPR so that expression of the inhibitory nucleic acid in a cell that normally expresses FPR, or addition of the inhibitory nucleic to the cell, results in diminution or loss of expression of the mRNA.
  • Sequences of FPR-encoding nucleic acids are well-known in the art. A skilled worker can readily design inhibitory nucleic acids, based on any suitable portuion of such a nucleic acid.
  • a nucleic acid sequence encoding human FPR is: aatcattaga gcctgagtca ctctccccag gagacccaga cctagaacta cccagagcaa gaccacagct ggtgaacagt ccaggagcag acaagatgga gacaaattcc tctctcccacgaacatctc tggagggaca cctgctgtat ctgctggcta tctctcctgccatcatcacttatctggt atttgcagtc acctttgtcc tcggggtcct gggcaacggg ctgtgatctgggtggctgg attccggatg acacacacacag tcaccaccat cagttacctg aacctggccgtggctggtggc
  • an inhibitory agent of the invention is an antisense nucleic acid molecule that is complementary to a gene encoding human FPR, or to a portion of said gene, or is a recombinant construct expressing said antisense nucleic acid molecule.
  • antisense nucleic acids to downregulate the expression of a particular protein in a cell is well known in the art (see, e.g., Weintraub et al (1986) Reviews— Trends in Genetics 1(1); Askari et al. (1996) N. Eng. J. Med. 334, 316-318; Bennett et al. (1995) Circulation 92, 1981-1993; Mercola et al. (1995) Cancer Gene Ther. 2, 47-59; Rossi et al. (1995) Br. Med. Bull. 51, 217-225; Wagner, R. W. (1994) Nature 372. 333-335).
  • an antisense nucleic acid molecule may comprise a nucleotide sequence that is complementary to the coding strand of another nucleic acid molecule (e.g., an mRNA sequence), or to a portion thereof, and accordingly is capable of hydrogen bonding to the coding strand of the other nucleic acid molecule.
  • antisense sequences can be complementary to a sequence found in the 5' or 3' untranslated region of the mRNA or a region bridging the coding region and an untranslated region (e.g., at the junction of the 5' untranslated region and the coding region).
  • an antisense nucleic acid can be complementary in sequence to a regulatory region of the gene encoding the mRNA, for instance a transcription initiation sequence or regulatory element.
  • an antisense nucleic acid is designed so as to be complementary to a region preceding or spanning the initiation codon on the coding strand or in the 3' untranslated region of an mRNA.
  • An antisense nucleic acid for inhibiting the expression of a protein of interest in a cell can be designed based upon the nucleotide sequence encoding the protein or upon sequences regulating its transcription or translation, constructed according to the rules of Watson and Crick base pairing.
  • antisense molecules that are complementary to a region of a gene involved in transcription (thereby blocking transcription), see, e.g., Lee et al. (1979) Nucl. Acids Res. 6, 3073; Cooney et al. (1988) Science 241. 456; and Dervan et al. (1991) Science 251. 1360.
  • antisense see, e.g., U.S. Pat. Nos.
  • An antisense nucleic acid can exist in a variety of different forms. For example, it can be DNA, RNA, PNA (peptide nucleic acid) or LNA (linked nucleic acid), or chimeric mixtures or derivatives or modified versions thereof, single stranded or double stranded.
  • the nucleic acid can be modified at the base moiety, sugar moiety, or phosphate backbone, using conventional procedures and modifications.
  • Modifications of the bases include, e.g., methylated versions of purines or pyrimidines. Modifications may include other appending groups such as peptides, or agents facilitating transport across the cell membrane (see, e.g. Letsinger et al, 1989, Proc. Natl. Acad. Sci. USA ⁇ 4:684-652; PCT Publication WO 88/09810 (1988), hybridization-triggered cleavage agents (e.g. Krol et al, 1988, BioTechniques 5:958-976) or intercalating agents (e.g., Zon, 1988, Pharm.
  • Antisense nucleic acids e.g., oligonucleotides
  • Such an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g. phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • antisense nucleic acids can be added to cells in culture media, e.g., about 50 - 500 ⁇ g oligonucleotide/ml, preferably at about 200 ⁇ g/ml.
  • Synthetic oligonucleotides are generally administered to patients at about 0.01 ⁇ g to 100 mg per kg of body weight, and may be given once or more daily, weekly, monthly, or yearly, or even once every 2 to 20 years.
  • an antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., nucleic acid transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
  • Expression control sequences e.g., regulatory sequences
  • operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the expression of the antisense RNA molecule in a cell of interest.
  • promoters and/or enhancers or other regulatory sequences can be chosen which direct constitutive, tissue specific or inducible expression of antisense RNA.
  • an inhibitory agent of the invention is a ribozyme.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes see e.g., Ohkawa et al. (1995) J. Biochem. 118, 251-258; NASAdsson et al. (1995) Trends Biotechnol. 13, 286-289; Rossi, J. J. (1995) Trends Biotechnol. 13, 301-306; Kiehntopf et al. (1995) J. Mot Med. 73, 65-71).
  • a ribozyme having specificity for an mRNA of interest can be designed based upon the nucleotide sequence of, e.g., the corresponding cDNA.
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the base sequence of the active site is complementary to the base sequence to be cleaved in a, FPR mRNA.
  • human FPR mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See for example Bartel et al. (1993) Science 261. 1411-1418.
  • the inhibitory molecule is an at least partially double stranded nucleic acid
  • RNAi RNA interference
  • the nucleic acid is completely double stranded.
  • the nucleic acid is partially double stranded, e.g. it comprises a double stranded portion and a single stranded loop.
  • RNAi one form of nucleic acid interference
  • dsRNA double-stranded nucleic acid RNA
  • siNA small, or short, interfering nucleic acid
  • siNA small, or short, interfering nucleic acid
  • RNA interference sequence specific RNAi
  • siRNA short (or small) interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • siRNA short interfering oligonucleotide
  • short interfering nucleic acid short interfering modified oligonucleotide
  • chemically-modified siRNA post-transcriptional gene silencing RNA (ptgsRNA), translational silencing, and others.
  • ptgsRNA post-transcriptional gene silencing RNA
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, or epigenetics.
  • siNA molecules of the invention can be used to epigenetically silence genes at both the post- transcriptional level or the pre-transcriptional level.
  • epigenetic regulation of gene expression by siNA molecules of the invention can result from siNA mediated modification of chromatin structure to alter gene expression (see, for example, Allshire (2002) Science 297. 1818-1819; Volpe et al.
  • An siNA can be designed to target any region of the coding or non-coding sequence of an mRNA.
  • An siNA is a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the siNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary.
  • the siNA can be assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based or non- nucleic acid-based linker(s).
  • the siNA can be a polynucleotide with a hairpin secondary structure, having self- complementary sense and antisense regions.
  • the siNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi.
  • the siNA can also comprise a single stranded polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (or can be an siNA molecule that does not require the presence within the siNA molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), wherein the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5'-phosphate (see for example Martinez et al. (2002) Cell 110. 563-574 and Schwarz et al. (2002) Molecular Cell 10, 537-568), or 5',3'-diphosphate.
  • a 5'-phosphate see for example Martinez et al. (2002) Cell 110. 563-574 and Schwarz et al. (2002) Molecular Cell 10, 537-568
  • the siNA molecule of the invention comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non- covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and or stacking interactions.
  • Some preferred siRNAs are discussed in the Examples.
  • siNA molecules need not be limited to those molecules containing only RNA, but further encompass chemically-modified nucleotides and non-nucleotides.
  • the short interfering nucleic acid molecules of the invention lack 2'-hydroxy (2'-OH) containing nucleotides.
  • short interfering nucleic acids do not require the presence of nucleotides having a 2'-hydroxy group for mediating RNAi and as such, short interfering nucleic acid molecules of the invention optionally do not include any ribonucleotides (e.g., nucleotides having a 2'-OH group).
  • ribonucleotides e.g., nucleotides having a 2'-OH group.
  • Such siNA molecules that do not require the presence of ribonucleotides within the siNA molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups.
  • siNA molecules can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
  • the modified short interfering nucleic acid molecules of the invention can also be referred to as short interfering modified oligonucleotides "siMON.”
  • Other chemical modifications e.g., as described in PCT/US03/05346 and PCT/US03/05028, can be applied to any siNA sequence of the invention.
  • an RNA interference molecule has a 2 nucleotide 3' overhang.
  • RNA interference molecule is expressed in a cell from a construct, for example from a hairpin molecule or from an inverted repeat of the desired FPR sequence, then the endogenous cellular machinery will create the overhangs.
  • RNAi molecule include, e.g., the sequence to be targeted, secondary structure of the RNA target and binding of RNA binding proteins. Methods of optimizing siRNA sequences will be evident to the skilled worker. Typical algorithms and methods are described, e.g., in Vickers et al. (2003) JBiol Chem 278, 7108-7118; Yang et al. (2003) Proc Natl Acad Sci USA 99, 9942-9947; Far et al. (2003) Nuc. Acids Res.
  • siRNAs are conventional and will be evident to the skilled worker.
  • In vitro methods include, e.g., processing the FPR ribopolynucleotide sequence in a cell-free system (e.g., digesting long double strand RNAs with RNAse III or Dicer), transcribing recombinant double stranded FPR DNA in vitro, and, preferably, chemical synthesis of nucleotide sequences homologous to an FPR sequence. See, e.g., Tuschl et al. (1999) Genes & Dev. 13, 3191-3197; e et al. J.
  • In vivo methods include, e.g., (1) transfecting DNA vectors into a cell such that a substrate is converted into siRNA in vivo [see, e.g., Kawasaki et al. (2003) Nucleic Acids Res 31, 700-707; Miyagishi et al. (2003) Nature Biotechnol 20, 497-500; Lee et al. (2002) Nature Biotechnol 20, 500-505, Brummelkamp et al. (2002) Science 296, 550-553; McManus et al.
  • RNA 8, 842-850 Paddison et al. (2002a) Gene Dev 16, 948-958; Paddison et al. (2002b) Proc Natl Acad Sci USA 99, 1443-1448); Paul et al. (2002) Nature Biotechnol 20, 505-508; Sui et al. (2002) Proc Natl Acad Sci USA 99, 5515-5520; Yu et al. (2002) Proc Natl Acad Sci USA 99, 6047-6052]; (2) expressing short hairpin RNAs from plasmid systems using RNA polymerase III (pol III) promoters [see, e.g., Kawasaki et al.
  • poly III RNA polymerase III
  • RNA synthesis provides about 1 milligram of siRNA, which is sufficient for about 1000 transfection experiments using a 24-well tissue culture plate format.
  • one or more siRNAs can be added to cells in culture media, typically at about 10 nM-10 ⁇ M (micromole/L), preferably about 100 nM siRNA/ml.
  • siRNAs that are specific for at least three regions of the coding sequence of FPR.
  • siRNAs comprise the sequence AGAAATTGGTATTGCAGTG (SEQ ID NO: 1, which is complementary to a sequence encoding amino acids in the 3 rd extracellular loop of the protein), ATTCGTCTTTACCATAGTG (SEQ ID NO: 2, which is complementary to a sequence encoding amino acids in the 3 rd transmembrane region of the protein), or AACGGGGACAGTAGCCTGC (SEQ ID NO: 3, which is complementary to a sequence encoding amino acids in the 2 nd transmembrane region of the protein).
  • Ribozymes and siNAs can take any of the forms, including modified versions, described above for antisense nucleic acid molecules; and they can be introduced into cells as oligonucleotides (single or double stranded), or in an expression vector.
  • an antisense nucleic acid, siNA (e.g., siRNA) or ribozyme comprises a single stranded polynucleotide comprising a sequence that is at least about 90% or 95%identical to SEQ ID NO: 1, 2, or 3, or a complement thereof.
  • Other inhibitory nucleic acids of the invention may be at least about 93%, 95%, 97%, 98% or 99% identical to sequences encoding other portions of FPR, or to their complements.
  • a DNA and an RNA encoded by it are said to contain the same "sequence,” taking into account that the "T's"
  • an antisense nucleic acid or siRNA may be of any length that is effective for inhibition of a gene of interest.
  • an antisense nucleic acid is between about 6 and about 50 nucleotides (e.g., at least about 12, 15, 20, 25, 30, 35, 40, 45 or 50 nt), and may be as large as about 100 to about 200 nucleotides, or larger. Antisense nucleic acids having about the same length as the gene or coding sequence to be inhibited may be used.
  • the length of an effective siNA is generally between about 15 bp and about 29 bp in length, preferably between about 19 bp and about 29 bp (e.g., about 15, 17, 19, 21, 23, 25, 29 or 29 bp), with shorter and longer sequences being acceptable.
  • siNAs are shorter than about 30 bp, to prevent eliciting interferon effects.
  • an active variant of an siRNA having, for one of its strands, the 19 nucleotide sequence of SEQ ID NO: 1, 2 or 3 can lack base pairs from either, or both, of the ends of the double stranded RNA; or it can comprise additional base pairs at either, or both, ends of the double stranded RNA, provided that the total of length of the siRNA is between about 19 and about 29 bp, inclusive.
  • One embodiment of the invention is an siRNA that consists essentially of one of the sequences represented by SEQ ID NO: 1, 2 or 3 and a complement of that sequence.
  • the term "consists essentially of is an intermediate transitional phrase, and in this case excludes, e.g., sequences that are long enough to induce a significant interferon response.
  • an siRNA of the invention that consists essentially of the noted sequences is generally between about 19 and about 29 bp in length.
  • an inhibitory nucleic acid such as an antisense molecule, a ribozyme (the recognition sequences), or an siNA, comprises a strand that is complementary (100% identical in sequence) to a sequence of a gene that it is designed to inhibit.
  • 100% sequence identity between the nucleic acid and the target gene is not required to practice the present invention.
  • the invention has the advantage of being able to tolerate naturally occurring sequence variations, e.g. in FPR, that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence.
  • the variant sequences may be artificially generated.
  • Nucleic acid sequences with, e.g., small insertions, deletions, and single point mutations relative to the target sequence can be effective for inhibition.
  • the degree of sequence identity maybe optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith- Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group).
  • At least about 90% sequence identity e.g., at least about 92%, 95%, 98% or 99%
  • 100% sequence identity between the inhibitory nucleic acid and the portion of the target gene is preferred.
  • an active variant of an inhibitory nucleic acid of the invention is one that hybridizes to the sequence it is intended to inhibit under conditions of high stringency.
  • the duplex region of an siRNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript under high stringency conditions (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C. or 70°C. hybridization for 12-16 hours), followed generally by washing.
  • an "isolated" biological entity such as an RNA, DNA, protein, complex, cell, or the like, is one that is in a form not found in its original environment or in nature, e.g., more concentrated, more purified, separated from at least one other component with which it is naturally associated, in a buffer, etc.
  • RNA, DNA, protein, complex, cell, or the like is one that is in a form not found in its original environment or in nature, e.g., more concentrated, more purified, separated from at least one other component with which it is naturally associated, in a buffer, etc.
  • inhibitors of FPR activity will be evident to the skilled worker. Many such inhibitors have been described, and some are commercially available.
  • Suitable inhibitors include, e.g., small molecule inhibitors of FPR; molecules, such as homologues of FPR ligands, which bind to FPR but do not stimulate an FPR activity (competitive inhibitors for the binding of natural agonists (ligands) to FPR); nucleic acids encoding and expressing such competitive inhibitors, and antibodies specific for FPR.
  • An antibody that is "specific for" FPR contains sequences that bind preferentially to FPR or a peptide fragment thereof, but not to other polypeptides, under conditions in which specific binding is desired (e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, or, in the case of in vitro assays, under conditions in which the assays are performed).
  • Suitable small molecule antagonists include, e.g., the endogenous bile-delivered hydrophobic bile acids deoxycholic acid (DCA) or chenodeoxycholic acid (CDCA), or derivatives of these molecules that are less toxic than the starting material.
  • DCA deoxycholic acid
  • DCA chenodeoxycholic acid
  • Other suitable small molecule inhibitors include cyclosporins, such as cyclosporine H and cyclosporine A, or similar molecules isolated from other bacterial strains that function in a similar manner. Still other suitable small molecule inhibitors can be identified using screening assays, as described elsewhere herein.
  • FPR agonists which are known to bind to FPR, are used as starting materials for engineering variants that function as antagonists.
  • Suitable agonists include a variety of formylated peptides, including mitochondrial peptides, formylated peptides released by necrotic cells, annexin I and its peptide fragments, etc.
  • small molecule antagonists of FPR can inhibit the interaction between FPR and one of its ligands, for example by binding to the receptor or to the ligand, and/or by blocking access of FPR by its agonists through steric hindrance on the cell membrane.
  • Suitable competitive inhibitors include, e.g., the synthetic peptide tertbutyloxycarbonyl-Phe(D)-Leu- Phe(D)-Leu-Phe-OH (Boc- FLFLF) (SEQ ID NO: 13), Spinorphin (Liang, et al. (2001) /. Immunol. 167, 6609- 6614) and other small peptide sequences derived from random peptide libraries that potentially act as FPR antagonists. Other homologs of f-ML that can serve as competitive inhibitors will be evident to the skilled worker. Furthermore, small molecules such as DCA or CDCA that establish steric hindrance on the cell surface can also block the binding of FPR agonist peptides.
  • inhibitory peptides generally bind to FPR but do not stimulate an FPR activity.
  • Methods of preparing such inhibitory peptides are conventional and include, e.g., chemical synthesis of the peptide; cleavage of a naturally occurring protein to generate the peptide; expression by a recombinant construct; or combinations of these methods.
  • Some inhibitory peptides are available commercially.
  • Other suitable inhibitors are recombinant nucleic acids that encode and express an inhibitory peptide, antisense nucleic acid, or interfering nucleic acid, of the invention.
  • Methods of making recombinant constructs in which a sequence encoding a peptide or an inhibitory nucleic acid of interest is operatively linked to an expression control sequence, are conventional.
  • a sequence of interest is operably linked to an expression control sequence in an expression vector.
  • a construct (a recombinant constract) generated in this manner can express the peptide or inhibitory nucleic acid when introduced into a cell.
  • expression control sequence means a polynucleotide sequence that regulates expression of a polypeptide (or inhibitory nucleic acid) coded for by a polynucleotide to which it is functionally
  • expression control sequence includes mRNA-related elements and protein-related elements. Such elements include promoters, domains within promoters, upstream elements, enhancers, elements that confer tissue or cell specificity, response elements, ribosome binding sequences, transcriptional terminators, etc.
  • An expression control sequence is operably linked to a nucleotide sequence (e.g., an "antisense" sequence or a coding sequence) when the expression control sequence is positioned in such a manner to effect or achieve expression of the antisense or coding sequence.
  • a promoter when operably linked 5' to a coding sequence, expression of the coding sequence is driven by the promoter.
  • Suitable expression control sequences can be selected for host compatibility and desired purpose. These include, e.g., enhancers such as from SV40, CMV, RSV, inducible or constitutive promoters, and cell-type or tissue-type specific elements or sequences that allow selective or specific cell expression.
  • Promoters that can be used to drive expression include, e.g., an endogenous promoter, MMTV, SV40, CMV, c-fos, ⁇ -globin; trp, lac, tac, or T7 promoters for bacterial hosts; or alpha factor, alcohol oxidase, or PGH promoters for yeast. See, e.g., Melton et al. (1984) Polynucleotide Res. 12(18), 7035-7056; Dunn et al. (1984) J. Mol. Bio. 166, 477-435; U.S. Pat. No.
  • polynucleotide is interchangeable with the terms oligonucleotide, oligomer, and nucleic acid (and the term polypeptide is interchangeable with the terms peptide or protein).
  • Suitable host cells will be evident to the skilled worker and include, e.g., prokaryotes, yeast, insect and animal, including mammalian, cells. Large amounts of the constract can be prepared by expressing the construct in a suitable host cell.
  • the amplified constract can then be introduced into, e.g., a glioma cell.
  • an inhibitory peptide, antisense nucleic acid, or interfering nucleic acid produced by a recombinant construct can be isolated, purified, if desired, and introduced into a glioma cell.
  • Methods to introduce polynucleotides (or peptides) of the invention into cells will be evident to the skilled worker.
  • transfection e.g., mediated by DEAE-Dexrran or calcium phosphate precipitation
  • infection via a viral vector e.g., retroviras, adenovirus, adeno-associated virus, lentiviras, pseudotyped retroviras or poxvirus vectors
  • injection such as microinjection, electroporation, sonoporation, a gene gun, liposome delivery (e.g., Lipofectin ® , Lipofectamine ® (GIBCO-BRL, Inc., Gaithersburg, MD), Superfect ® (Qiagen, Inc.
  • Oilier suitable agents that inhibit FPR activity comprise antibodies, or antigen binding fragments, that are specific for FPR.
  • An antibody "specific for" a polypeptide includes an antibody that recognizes a defined sequence of amino acids, or epitope, either present in the full length polypeptide or in a peptide fragment thereof. Any of a variety of antibodies can be used in methods of the invention. Such antibodies include, e.g. , polyclonal, monoclonal (mAbs), recombinant, humanized or partially humanized, single chain, Fab, and fragments thereof.
  • the antibodies can be of any isotype, e.g., IgM, various IgG isotypes such as IgGi, IgG 2a , etc., and they can be from any animal species that produces antibodies, including goat, rabbit, mouse, chicken or the like. Single chain antibodies are also encompassed by the invention. One may wish to employ an intact antibody (e.g., an IgG molecule), a bi- or multi-valent antibody which has specificity for at least two antigens, or a univalent antibody fragment.
  • Antibodies of the invention can be isolated from natural sources; from hybridomas, lymphomas, or the like; or they can be produced by synthetic and/or recombinant means.
  • the antibody is a neutralizing antibody.
  • neutralizing is meant herein that binding of an antibody to a receptor (in this case, FPR) inhibits or prevents the binding of a cognate ligand, and thereby inhibits the activity of the ligand.
  • an antibody of the invention is used as a targeting molecule, to deliver an effector molecule, such as a toxin or therapeutic substance (e.g., drag), to a glioma cell which expresses FPR receptor and or receptor subunit(s) on its surface.
  • an effector molecule such as a toxin or therapeutic substance (e.g., drag)
  • the toxin or therapeutic substance is attached to (e.g., conjugated to, bound to) the antibody in such a way that it does not substantially disturb the ability of the antigen-binding region to bind to its targets.
  • the effector can be attached to an Fc region.
  • the effector when it is in the form of a peptide, it can replace all or part of an Fc region, or it can substitute for part or all of an antigen-binding region of a third antibody moiety, forming a structure similar to a third Fab fragment.
  • An antibody (or other targeting molecule) attached to an effector molecule is sometimes referred to herein as a "chimeric" molecule.
  • Antibodies conjugated to toxic or therapeutic moieties need not be neutralizing (blocking the binding of a cytokine to a receptor). Rather, they can serve to deliver a molecule to a target cell, so that the molecule can, e.g., exert its effect at the surface of the cell, or be incorporated into the cell.
  • An effector molecule can be any substance which inhibits a cell bearing an FPR receptor or receptor subunit on its surface (e.g., the substance provides a therapeutic effect; suppresses a physiological activity of the cell; or achieves inhibition or suppression of growth, killing, destruction, elimination, control, modification, etc. of the cell).
  • the effector molecule can be isolated from natural sources, or it can be produced by synthetic and/or recombinant means, all of which are well-known to one of ordinary skill in the art.
  • the drugs or therapeutic moieties which can be used are chemotherapeutic and/or cytotoxic agents.
  • cytotoxins include cytotoxins, radionuclides, inhibitory ligands, steroids, antimetabolites, cytotoxic prodrags, antibodies, and therapeutic compositions such as liposomes or other vehicles that contain various drags.
  • toxins which can be used are, e.g., ricin (e.g., the A and or B chain thereof, or the deglycosylated form), poisonous lectins, diphtheria toxin, exotoxin from Psuedomonas aeruginosa, abrin, modeccin, botulina toxin, alpha-amanitan, pokeweed antiviral protein (PAP, including PAPI, PAPII and PAP-S), ribosome inhibiting proteins, especially the ribosome inhibiting proteins of barley, wheat, corn, rye, or gelonin, ribosome-inactivating glycoprotein (GPIR), doxorabicin, maytanisinoids, vinblastine, c
  • cytotoxins Fragments, subunits, muteins, mimetics, variants and/or analogues of such toxins are known to those of skill in the art and are encompassed by the invention. It is contemplated that all such variants or mutants which retain their toxic properties will be of use in accordance with the present invention.
  • suitable cytotoxins see USP 6,428,788.
  • Many possible therapeutic drugs can be attached to a targeting antibody, for example any of a variety of immunosuppressants or immunomodulatory agents, e.g., dexamethasone, cyclosporine or FK506.
  • Other therapeutic moieties include liposomes or micelles that contain a therapeutic composition such as a drag, a nucleic acid (e.g.
  • an antisense nucleic acid or another therapeutic moiety that is preferably shielded from direct exposure to the circulatory system.
  • Means of preparing liposomes attached to antibodies are well known to those of skill in the art. See, for example, USP 4,957,735, Connor et al. (1985) Pharm. Tlier. 28, 341-365.
  • the effector molecule can comprise any of a variety of art-recognized radioisotopes or radionuclides.
  • Radiotherapy in which cytotoxic doses of radioactivity are delivered to cells, are conventional in the art and are described, e.g., in EP 481,526; USP 5,962,424; Roeske et al (1990) Int. J Radiation Oncology Biol Phys. 19, 1539-48; and Leichner et al (1993) Med.Phys.20(2Pt.2), 569-77.
  • radioactive compounds can affect the targeted cell as well as adjacent tumor cells which, for one reason or another, do not display FPR on their surface. Further suitable radioactive agents are discussed below in reference to imaging agents.
  • the most preferred radiation sources are Tc-99 and In-111.
  • effector molecules do not exhibit a therapeutic property, per se, but act to stabilize the antibody or another attached effector molecule, e.g. improve its stability; increase its half-life; increase its resistance to proteolysis; decrease its immunogenicity; decrease the rate of its in vivo clearance; provide a means to attach or immobilize an antibody or antibody/effector conjugate of the invention onto a solid support matrix (see, e.g., Harris, in Poly(Ethylene Glycol) Chemistry: Biotechnical and Biomedical Applications, Harris, ed., Plenum Press: New
  • Suitable such agents include, e.g., polyethylene glycol, dextran, albumin, etc.
  • Antibodies of the invention can be coupled to more than one effector molecule, each of which, optionally, can have different effector functions (e.g., such as a toxin molecule (or an immunological reagent) and a polyethylene glycol, dextran, or albumin molecule. If desired, combinations of the various therapeutic effector molecules can be coupled to one targeting antibody to accommodating variable cytotoxicity. In another embodiment, antibodies comprising two or more different effector molecules are administered together. Other types of molecules that bind tightly and specifically to FPR can also be used as targeting agents to deliver effector molecules.
  • binding “tightly” is meant that the targeting agent binds with sufficient avidity to allow the effector molecule exert a therapeutic effect (or, in a case in which the effector is used in a diagnostic method, to allow the effector molecules to be detected).
  • binding “specifically” is meant that the targeting agent binds preferably to cells with FPR on their surface, but not to cells lacking FPR, under conditions as noted above.
  • the targeting agent can be any FPR antagonist that binds efficiently to FRP, is metabolized slowly and exerts prolonged action. Suitable targeting agents include small molecule antagonists or peptide competitive inhibitors, such as those discussed above.
  • An effector molecule can be attached to an antibody or other targeting agent of the invention by routine, conventional methods, e.g., chemical coupling, attachment via biotin avidin interactions or a peptide linker, recombinant methods, etc.
  • suitable attachment methods see, e.g., US publication 2002/0025317, USP 6,428,788, or WO00/54805.
  • chimeric molecules and methods of using them to detect or treat disease conditions see, e.g., USP 6,428,788.
  • Another suitable class of inhibitory agents includes agents that bind directly to FPR ligands.
  • ligands recognized by FPR on glioma cells are molecules released by the necrotic cells near the gliomas.
  • agents that target such ligands will be evident to the skilled worker. These agents include, e.g., antibodies specific for the ligands, molecules that "capture” the ligand and prevent it from binding to the receptor, etc.
  • Other agents of this type are agents that block the signal transduction pathways of agonist-activated FPR, resulting, e.g., in cell migration, survival and/or production of angiogenic factors.
  • Another aspect of the invention is a method for treating an FPR-mediated disorder, disease or condition in a subject (e.g., a human patient or other animal subject), comprising administering to the subject an effective amount of an inhibitor of expression and/or activity of FPR. More particularly, the method is a method for treating a glioma (which comprises glioma cells that express FPR) in a subject. Another aspect is a method for treating a subject having a glioma, or for inhibiting (impairing) the growth, invasion and/or metastasis of a glioma (bearing an FPR) in a subject, comprising a ⁇ ninistering to the subject an effective amount of an inhibitor of expression and/or activity of FPR.
  • a glioma which comprises glioma cells that express FPR
  • Another aspect is a method for treating a subject having a glioma, or for inhibiting (impairing) the growth, invasion and/or metastasis of
  • Such a method can, e.g., treat, prevent, ameliorate, control, suppress, stop, slow and/or inhibit the glioma.
  • a treatment strategy of the invention would likely decrease the tumor burden, at least to a measurable degree, and improve survival of patients suffering from the glioma.
  • Inhibitory agents of the invention can be formulated as pharmaceutical compositions, comprising an agent of the invention and a pharmaceutically acceptable carrier, using conventional components and methodologies.
  • Such pharmaceutical compositions are normally formulated with a solid or liquid carrier, depending upon the particular mode of administration chosen.
  • the pharmaceutically acceptable carriers useful in this disclosure are conventional.
  • parenteral formulations usually comprise injectable fluids that are pharmaceutically and physiologically acceptable fluid vehicles such as water, physiological saline, other balanced salt solutions, aqueous dextrose, glycerol or the like.
  • Excipients that can be included are, for instance, other proteins, such as human serum albumin or plasma preparations.
  • the pharmaceutical composition to be administered may also contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • any of a variety of well-known agents can be administered in conjunction with a composition of the invention.
  • Typical such permeability agents include, e.g., liposomes and or the chemical, labradimil (see, e.g., Emerich et al. (2001) Clin Pharmacokinet 40, 105-123). Oilier such agents, and further methods to enhance the delivery of an agent into the brain, are discussed in: Implications of the Blood-Brain Barrier and Its Manipulation: Clinical Aspects, Edward A.
  • agents of the invention also includes combinations of agents of the invention with one another, and/or with one or more other agents useful in the treatment of a glioma.
  • agents e.g., nucleic acids, peptides or small molecules
  • agents of this disclosure may be administered in combination with effective doses of other anti-cancer agents, immunomodulators, anti-inflammatories, anti-infectives, and or vaccines.
  • administration in combination refers to both concurrent and sequential adrninistration of the active agents.
  • anti-proliferatives examples include the following: ifosamide, cisplatin, methotrexate, procarizrne, etoposide, BCNU, vincristine, vinblastine, cyclophosphamide, gencitabine, 5-flurouracie, paclitaxel, or doxorubicin.
  • immuno-modulators examples include AS-
  • the combination therapies are of course not limited to the lists provided herein, but include any composition for the treatment of glioma.
  • the dosage form of a pharmaceutical composition will be determined by the mode of administration chosen. For example, injectable fluids, topical and oral formulations can be employed. Topical preparations can include eye drops, ointments, sprays and the like.
  • Oral formulations may be liquid (e.g., syrups, solutions or suspensions), or solid (e.g., powders, pills, tablets, or capsules).
  • conventional non-toxic solid carriers can include pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in the art. Effective dosages of the agents (e.g., inhibitors) of the invention will be evident to the skilled worker. The exact amount (effective dose) of the agent will vary from subject to subject, depending on, la., the species, age, weight and general or clinical condition of the subject, the severity or mechanism of any disorder being treated, the particular agent or vehicle used, the method and scheduling of administration, and the like.
  • a therapeutically effective dose can be determined empirically, by conventional procedures known to those of skill in the art. See, e.g., The Pharmacological Basis of Therapeutics, Goodman and Gilman, eds., Macmillan Publishing Co., New York. For example, an effective dose can be estimated initially either in cell culture assays or in suitable animal models. The animal model may also be used to determine the appropriate concentration ranges and routes of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • a therapeutic dose can also be selected by analogy to dosages for comparable therapeutic agents. In general, normal dosage amounts may vary from about 0.1 to 100,000 micrograms, up to a total dose of about 5g, depending on the nature of the agent, the route of administration and other factors as noted above.
  • routes of administration include, but are not limited to, oral; respiratory; intranasal; intrarectal; intravaginal; sublingual; intradermal; transdermal; intrethecal; extracorporeal; topical; intravenous, subcutaneous, intramuscular, intrameduUary, or intraperitoneal injection; other parenteral routes; or the like.
  • routes of administration include, but are not limited to, oral; respiratory; intranasal; intrarectal; intravaginal; sublingual; intradermal; transdermal; intrethecal; extracorporeal; topical; intravenous, subcutaneous, intramuscular, intrameduUary, or intraperitoneal injection; other parenteral routes; or the like.
  • One of skill in the art will recognize particular cells, tissues or organs into which therapeutic agents of the invention can be administered.
  • the particular mode of administration and the dosage regimen will be selected by the attending clinician, taking into account the particulars of the case (e.g., the subject, the degree of malignancy of the glioma
  • Treatment may involve daily or multi-daily doses of compound(s), nucleic acid(s) and/or peptide(s) over a period of a few days to months, or even years.
  • an agent of the invention is administered systemically, it is sometimes desirable to attach to the agent a molecule that can aid in targeting the agent to the brain.
  • Suitable such molecules include, e.g., lipid based carriers (liposomes), the BBB permeability enhancer labradimil, and antibodies directed against specific glial cells markers such as vimentin which is expressed by highly malignant glioma cells.
  • Inhibitory agents that are too large to cross the blood brain barrier efficiently are preferably not administered systemically. Rather, direct, intratumoral administration (e.g., injection) is preferred. This can be accomplished during surgery, e.g., surgery to resect the tumor from the brain; or the agent can be delivered to the brain through a needle (such as those used for removing biopsy tissue) or through a surgically implante
  • small molecules e.g., the therapeutic molecules of the invention
  • the therapeutic composition can be placed at the target site in a slow release formulation.
  • Such formulations can include, for example, a biocompatible sponge or other inert or resorbable matrix material impregnated with the therapeutic composition, slow dissolving time release capsules or microcapsules, and the like.
  • the catheter or time release formulation will be placed at the tumor site as part of a surgical procedure.
  • the perfusing catheter or time release formulation can be emplaced at the tumor site as an adjunct therapy.
  • the delivery of the therapeutic compositions of this invention may comprise the primary therapeutic modality.
  • an inhibitor of the invention when delivered during surgery, it can inhibit (preferably, destroy) residual glioma cells that are not removed, and/or can prevent recurrence of the tumor.
  • Methods of administering nucleic acids to subjects (patients) are conventional and well known to skilled workers. Such methods include transfection (e.g. transient or stable transfection), electroporation, or other methods known in the art. See, e.g., Harmon (2002) Nature 418, 244-251; Bernstein et al. (2002) RNA 7, 1509-1521;
  • an siRNA is synthesized, packaged in a liposome and transfected into a cell; such transfection can be achieved in vitro or in vivo.
  • nucleic acids e.g., methods of gene therapy
  • the gene delivery vehicle may be of viral or non- viral origin (see generally, Jolly, Cancer Gene Therapy 1:51-64 (1994) Kimura, Human Gene Therapy 5:845-852 (1994); Connelly, Human Gene Therapy 1:185- 193 (1995); and Kaplitt, Nature Genetics 6:148-153 (1994).
  • Suitable viral vectors include retroviras vectors, aphavirus-based vectors, parvovirus such as adeno-associated virus (AAV) vectors, and adenoviral vectors.
  • Non- viral, gene delivery vehicles and methods may be employed, including polycationic condensed DNA linked or unlinked to killed adenoviras alone, eukaryotic cell delivery vehicles, deposition of photopolymerized hydrogel materials; hand-held gene transfer particle gun, nucleic charge neutralization, fusion with cell membranes, nanospheres, and mechanical delivery systems.
  • Naked nucleic acid e.g., DNA, or synthetic siRNA
  • Exemplary naked nucleic acid introduction methods are described in WO 90/11092 and U.S. Patent No.
  • Uptake efficiency may be improved using biodegradable latex beads.
  • DNA coated latex beads are efficiently transported into cells after endocytosis initiation by beads.
  • the method may be improved further by treatment of the beads to increase hydrophobicity and thereby facilitate disruption of the endosome and release of the DNA into thr cytoplasm.
  • Liposomes that can act as gene delivery vehicles are described in U.S. Patent No. 5,422,120, PCT Patent Publication Nos. WO 95/13796, WO 94/23697 and WO 91/14445, and EP No. 0 524 968.
  • cells expressing a peptide that acts as a competitive inhibitor, or an inhibitory nucleic acid of the invention (such as an siRNA) are acLministered to a subject.
  • Suitable cells which will be evident to the skilled worker include, e.g., transgenic pluripotent or hematopoietic stem cells or B cells. In such a case, the cells may be administered at a dose of between about 10 6 and about 10 n cells, on one or several occasions.
  • Suitable method include, e.g., administration with liposomes or other carriers or carrier vesicles, electroporation, injection, or the like.
  • a protein may be administered locally (e.g., directly into a tumor) or systemically, provided that a suitable system is in place to direct the protein to a target of interest.
  • Another aspect of the invention is a method for identifying an agent that inhibits an FPR-mediated activity in a cell (such as a glioma cell) that expresses FPR, comprising a) contacting a cell that expresses FPR or an active fragment, variant, mimetic or analog of FPR (e.g., a glioma cell, or a eukaryotic cell that has been transfected with a construct such that the cell over-expresses the FPR or active variant, etc.) with a putative agent, under conditions effective for the putative agent to exert an effect on FPR expression and or an FPR activity of the cell; and b) determining the level of FPR expression and/or activity in the contacted cell compared to a baseline value, wherein a putative agent that elicits a decrease in the amount and or activity of FPR in the contacted cell compared to the baseline value is a candidate for an anti-glioma agent.
  • the method further comprises c) determining if the candidate elicits an antiglioma effect in vivo (e.g., dete ⁇ nining if it inhibits growth, invasion and/or metastasis of a glioma tumor in an animal).
  • Suitable transfected cells for the above method include any eukaryotic cell (e.g., a CHO cell or an HEK-293 cell) which has been transfected with a constract expressing a fragment, variant, mimetic or analog of FPR, such that the cell overexpresses the transgene.
  • a fragment, variant, mimetic or analog of FPR includes any of a variety of modified FPR molecules, provided that the modified protein retains at least one of the activities (e.g., the ability to be activated by a ligand) of the wild type protein.
  • Modified proteins can take the form of, e.g., conservative amino acid substitutions, deletions, additions, etc, and include naturally occurring allelic variants. Suitable types of modified proteins will be evident to the skilled worker.
  • glioma cells that express FPR can also be used in the method.
  • the above method to identify an agent which inhibits an FPR-mediated activity of a cell is preferably performed in vitro. Most preferably, the activity that is assayed is calcium flux, which is easily monitored.
  • VEGF vascular endothelial growth factor
  • Binding of putative agents to FPR can also be assayed. Promising candidates can subsequently be tested in vivo, e.g. in an animal model for glioma. Finally, the agent can be tested in a non-human primate or a human.
  • the order and numbering of the steps in the methods described herein are not meant to imply that the steps of any method described herein must be performed in the order in which the steps are listed or in the order in which the steps are numbered.
  • the steps of any method disclosed herein can be performed in any order which results in a functional method. In some embodiments, the method is performed with fewer than all of the steps, e.g., with just one step.
  • a putative agent may or may not inhibit expression of FPR or an FPR- mediated activity.
  • this invention relates to methods to determine if a putative agent exhibits such an inhibition, irrespective of whether such an inhibition is detected.
  • a variety of classes of putative inhibitory agents can be tested by this screening method, including antisense nucleic acids, siRNAs, competitive inhibitors of FPR, antibodies, etc.
  • the method is used to test small molecule compounds, e.g., compounds from a combinatorial library.
  • Small molecules sometimes referred to herein as “compounds,” can be generated as follows: Such small molecules may be isolated from natural sources or developed synthetically, e.g., by combinatorial chemistry.
  • such molecules are identified from large libraries of natural products or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art.
  • synthetic extracts or chemical libraries are not critical to the methods of the invention.
  • chemical extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds.
  • a known small molecule antagonist of FPR may be desirable to start with a known small molecule antagonist of FPR and to modify it to optimize its inhibitory properties and/or to reduce its toxic properties; or to modify an FPR agonist, in order to convert it into an FPR antagonist.
  • Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, polypeptide- and nucleic acid-based compounds.
  • Synthetic compound libraries are commercially available, e.g., from Brandon Associates (Merrimack, NH) and Aldrich Chemical (Milwaukee, WI).
  • libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, e.g., Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch
  • High throughput assays are generally performed on a large number of samples, and at least some of the steps are performed automatically, e.g., robotically.
  • Another aspect of the invention is a method for determining the degree of malignancy of a glioma in a subject (e.g., a subject suspected of having a high grade glioma), comprising detecting the presence and/or amount of expression of FPR in a cell or tissue of the subject, and comparing that level to a baseline value (e.g., a reference standard; the level in a low-grade glioma cell or a non-malignant cell; the level in an astrocyte cell of a subject not suffering from a glioma; etc.).
  • a baseline value e.g., a reference standard; the level in a low-grade glioma cell or a non-malignant cell; the level in an astrocyte cell of a subject not suffering from a glioma; etc.
  • glioma cell lines that exhibit highly malignant properties express detectable levels of FPR, whereas less malignant, or normal, cell lines do not. It is expected that glioma cells isolated from patients will exhibit a comparable relationship between the amount of FPR expressed and the degree of malignancy. That is, "high-grade" tumors, such as anaplastic astrocytoma (AA) and glioblastoma multiforme (GBM), would be expected to exhibit higher levels of expression of FPR than low-grade tumors.
  • AA anaplastic astrocytoma
  • GBM glioblastoma multiforme
  • a "highly malignant" glioma is generally one that expresses high levels of vimentin but low levels of glial fibriilary acidic protein (GFAP).
  • GFAP glial fibriilary acidic protein
  • Such an assay is useful, for example, for predicting the prognosis of a patient, or for helping to determine optimal treatment methods, appropriate to the detected degree of malignancy.
  • One of skill in the art will recognize various methods for detecting the level of FPR and the baseline value, and how to select appropriate cells or tissues for the assay.
  • Samples for analysis can be taken from any suitable source. Suitable samples can include, e.g., tissue, fluid, cell extracts, or the like from a subject. Cerebrospinal fluid and biopsy samples, such as brain biopsy material, are preferred. Any suitable method may be used to detect (e.g., measure or quantitate) the amount of expression and/or activity of FPR.
  • nucleic acids for example, changes in nucleic acid expression can be determined by polymerase chain reaction (PCR), ligase chain reaction (LCR), Q ⁇ -replicase amplification, nucleic acid sequence based amplification
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • Q ⁇ -replicase amplification nucleic acid sequence based amplification
  • NASBA transcription-mediated amplification techniques
  • differential display protocols analysis of northern blots, techniques based on hybridization to specific probes (e.g., in situ hybridization), enzyme linked assays, micro-arrays and the like. Examples of some of these techniques can be found in, for example, PCR Protocols A Guide to Methods and Applications (Innis et al., eds, Academic Press Inc. San Diego, Calif. (1990)). Levels of proteins can be detected, for example, by quantitative immunoprecipitation, Western analysis, or the like.
  • a variety of imaging methods can be used to detect the presence and or amount of FPR, either in vitro or in vivo.
  • an antibody specific for FPR is conjugated to an effector molecule that can be detected.
  • Detectable labels suitable for use as the effector molecule component of the chimeric molecules of this invention include any composition detectable by specrroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
  • Useful labels in the present invention include magnetic beads (e.g.
  • DynabeadsTM fluorescent dyes (e.g., fluorescein isothiocyanate, texas red, rhodamine, green fluorescent protein, and the like), radiolabels (e.g., 3 H, 125 1, 35 S, I4 C, or 32 P), phosphorescent entities, bioluminescent markers, gamma and X-ray emitters, signal reflectors (e.g., paramagnetic entities), signal absorbers (e.g., electron beam opacifier dyes), enzymes (e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an ELISA), and colorimetric labels such as colloidal gold or colored glass or plastic (e.g.
  • fluorescent dyes e.g., fluorescein isothiocyanate, texas red, rhodamine, green fluorescent protein, and the like
  • radiolabels e.g., 3 H, 125 1, 35 S, I4 C
  • radiolabels may be detected using photographic film or scintillation counters; and fluorescent markers may be detected using a photodetector to detect emitted illumination.
  • Enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and calorimetric labels are detected by simply visualizing the colored label.
  • Target-enhancing metals are encompassed by the invention and are particularly suitable for in vivo imaging.
  • Metals according to the invention include, e.g., paramagnetic metals for MRI; heavy metal ions, e.g., with atomic numbers of at least 37, preferably at least 50, for X-ray or ultrasound imaging; and ions of radioactive isotopes for scintigraphy.
  • the choice of metal will be determined by the desired diagnostic (or therapeutic) application.
  • radioactive ions include, e.g., ions of lanthanides or other metal ions, including isotopes and radioisotopes thereof, such as, e.g., iodine, iodine 125 , iodine 131 , technicium 99 , indium 111 , rhenium 188 , rhenium 186 , copper 67 , yttrium 90 , astatine 211 , gallium 67 , rridium 192 , cobalt 60 , radium 226 , gold 198 , cesium 137 , phosphorous 32 , carbon 14 , and tritium ions.
  • ions of lanthanides or other metal ions including isotopes and radioisotopes thereof, such as, e.g., iodine, iodine 125 , iodine 131 , technicium 99 , indium 111 , rhenium
  • fluorogenic agents examples include gadolinium and renagraphin.
  • a metal can be associated with a targeting agent by any of a variety of means, which are well-known to one of ordinary skill in the art. For methods of making image enhancing moieties, attaching them to targeting moieties, and using them for detection, see, e.g., EP 481,526; GB-A-2169598; and EP 136,812.
  • metals can be bound to (associated with, attached to) targeting moieties by chelating agents, including polychelants, bifunctional polychelants, and salts or macrocyclic intern- lediates thereof.
  • Imaging agents of the invention may be administered to patients for imaging in amounts sufficient to yield the desired contrast with the particular imaging techniques. Generally, dosages of from about
  • 0.001 to 5.0 mmoles of chelated imaging metal ion per kilogram of patient body weight are effective to achieve adequate contrast enhancements.
  • preferred dosages of imaging metal ions will be in the range of about 0.02 to 1.2 mmoles/kg body weight; while for X-ray applications, dosages from about 0.5 to 1.5 mmoles/kg are generally effective to achieve X-ray attenuation.
  • Preferred dosages for most X-ray applications are from 0.8 to 1.2 mmoles of the lanthanide or heavy metal/kg body weight.
  • activities of proteins can be measured, using conventional methods.
  • activities which can be measured include directional cell migration; phosphorylation of mitogen-activated protein kinases (MAPKs), and the activation of any of the steps in the resulting cascade of signaling events; activation of nuclear factor (NF) KB; enhanced nuclear translocation of hypoxia-inducible factor-l ⁇ (HIF-l ⁇ ); and/or the production of biologically active vascular endothelial growth factor (VEGF).
  • FPR-mediated activities that can be measured in vivo are, e.g., growth of, or invasion and/or metastasis of, a glioma tumor. Methods for measuring FPR-mediated activities are conventional; some such methods are described in the Examples.
  • kits suitable for performing any of the methods of the invention (e.g., assays for inhibitory agents, or diagnostic or treatment methods).
  • the components of the kit will vary according to which method is being performed.
  • a kit of the invention comprises an effective amount of an inhibitor of FPR expression and/or activity.
  • the kits also optionally contain means (e.g., suitable reagents) for detecting the presence or amount of FPR, an FPR-mediated activity, etc. Reagents for performing suitable controls may also be included.
  • the kits comprise instructions for performing the method.
  • Kits of the invention may further comprise a support on which a cell can be propagated (e.g., a tissue culture vessel) or a support to which a reagent used in the method is immobilized.
  • a support on which a cell can be propagated e.g., a tissue culture vessel
  • a support to which a reagent used in the method is immobilized e.g., a cell culture vessel
  • Other optional elements of a kit of the invention include suitable buffers, media components, or the like; a computer or computer-readable medium for storing and/or evaluating assay results; logical instructions for practicing the methods described herein; logical instructions for analyzing and/or evaluating assay results as generated by the methods herein; containers; or packaging materials.
  • the reagents of the kit may be in containers in which the reagents are stable, e.g., in lyophilized form or stabilized liquids.
  • the reagents may also be in single use form, e.g., in single dosage form for use as therapeutics, or in single reaction form for diagnostic use.
  • Kits of the invention have many uses, which will be evident to the skilled worker. For example, they can be used in experiments to study factors involved in FPR-mediated activities, or to understand facets of the molecular pathogenesis of gliomas; to determine the degree of malignancy of a glioma; to treat gliomas; to monitor the course of treatment of a glioma; or to identify inhibitory agents for use in the treatment of gliomas.
  • An agent of interest can be characterized by performing assays with the kit, and comparing the results to those obtained with known agents (or by comparison to a reference database). Such assays are useful commercially, e.g., in high- throughput drug studies.
  • the chemotactic formyl peptide fMLF, DCA, CDCA, and staurosporin were from Sigma-Aldrich (St. Louis, MO).
  • MMK-1 were synthesized and purified by the Department of Biochemistry, Colorado State University (Fort Collins, CO), according to the published sequences (Seo et al. (1997) J. Immunol.158, 1895-1901; Klein et al. (1998) Nat. Biotechnol.16, 1334-1337).
  • MEK1 inhibitor PD98059, and antibodies against phospho(p)-ERKl/2 (Thr202/Tyr204), -p38 (Thrl80/Tyrl82), -SAPK JNK (Thrl83/Tyrl85), -Akt (Ser473), ERK1/2, p38, SAPK JNK, and Akt were from Cell Signaling Technology (Beverly, MA).
  • Phorbol ester PMA, p38 inhibitor SB202190, and phosphoinositide 3-kinase (PI3K) inhibitor LY294002 were from Calbiochem (San Diego, CA).
  • Anti-hypoxia- inducible factor-l ⁇ (HIF-l ⁇ ) antibody was fromNovus Biologicals (Littleton, CO).
  • Anti-VEGF antibody was from R&D Systems (Minneapolis, MN).
  • Anti-FPR antibody was from BD Biosciences (San Diego, CA).
  • Anti- glial f ⁇ brillary acidic protein (GFAP), anti-vimentin antibodies, and EnVisionTM system were from DAKO (Carpinteria, CA). Cyclosporin H (CsH) was from Novartis, Basel, Switzerland. N-t-BOC-MET-LEU-PHE
  • tBOC-MLF was from MP Biomedicals (Aurora, OH).
  • Rat basophilic leukemia cells (RBL) stably transfected with epitope-tagged high affinity fMLF receptor FPR (designated ETFR cells) were obtained from Drs. H. Ali and R. Snyderman (Duke
  • HUVECs Human umbilical cord vein endothelial cells
  • HUVECs were isolated by treatment of umbilical cords with trypsin EDTA (0.25%/0.02%) in PBS for 10 min at 37°C. After elution with RPMI 1640 and 20% FCS, HUVECs were cultured on gelatin-coated (Sigma-Aldrich) flasks in EGM medium (Clonetics, Walkersville, MD). All experiments of HUVECs were performed with cells between the second to fifth "in vitro" passage.
  • RNA preparation and reverse transcription polymerase chain reaction Total RNA was extracted from cells with RNeasy Mini Kit (Qiagen, Valencia, CA), and 0.5 ⁇ g were used for RT-PCR.
  • sense primer 5'-CTCCAGTTGGACTAGCCACA-3' SEQ ID NO: 4
  • antisense primer 5 '-CCATCACCCAGGGCCCAATG-3 ' SEQ ID NO: 5
  • VEGF vascular endothelial growth factor
  • primers were designed for amplification of 4 isoforms of the VEGF gene.
  • CTGTATCAGTCTTTCCTGGTGAG-3' (SEQ ID NO: 7) were used to yield products of 514 bp for VEGF121, 646 bp for VEGF165, 718 bp for VEGF189, and 769 bp for VEGF206 (Zheng et al. (2000), Hum. Pathol. 31, 804-812).
  • RT-PCR was performed with a high fidelity ProSTARTM HF single-tube RT-PCR system (Stratagene, La Jolla,
  • CA chronic myelogenous growth factor
  • VEGF Moloney murine leukemia virus reverse transcriptase
  • 40 cycles (30 cycles for VEGF) of denaturing at 95°C (30 s), annealing at 60°C (30 s), and extension at 68°C (2 min), with a final extension for 10 min at 68°C.
  • Primers for glyceraldehyde-3- phosphate dehydrogenase (GAPDH) were used as controls (Stratagene).
  • GAPDH glyceraldehyde-3- phosphate dehydrogenase
  • the intensity of the fluorescence was measured as the ratio at 340 and 380 nm wavelengths and calculated using a FL WinLab program (Perkin-Elmer). >
  • glioma cells were washed with 5 volume of hypotonic buffer (10 mM HEPES, 10 mM KC1, 1.5 mM MgCl 2 , and 0.5 mM DTT, pH 7.9), then lysed in the same buffer supplemented with 1% Nonidet P-40.
  • hypotonic buffer 10 mM HEPES, 10 mM KC1, 1.5 mM MgCl 2 , and 0.5 mM DTT, pH 7.9
  • the nuclei-containing pellet was resuspended in 150 ⁇ l low-salt buffer (10 mM HEPES, 25% glycerol, 1.5 mM MgCl 2 , 20 mM KC1, 0.5 mM DTT, and 0.2 mM EDTA) and equal volume of high-salt buffer (containing 800 mM KC1). The nuclear extracts were then centrifuged at 150 ⁇ l low-salt buffer (10 mM HEPES, 25% glycerol, 1.5 mM MgCl 2 , 20 mM KC1, 0.5 mM DTT, and 0.2 mM EDTA) and equal volume of high-salt buffer (containing 800 mM KC1). The nuclear extracts were then centrifuged at
  • Luciferase assays Transient transfection of pNF- ⁇ B-Luc or AP-l-Luc reporter (Promega, Madison, WI) in tumor cells was performed with Fugene 6 (Roche Diagnostics, Indianapolis, IN). pTAP-Luc was used as a negative control. pRL- null vector (Promega) was used as an internal control for normalization of transfection and harvesting efficiency. After transfection, the tumor cells were cultured in normal medium for 24 h, and then were treated with fMLF. Cell lysis and luciferase assays were performed using a dual luciferase assay system (Promega) with minor modifications (Zhang et al. (2001) Immunol.
  • Promoter activity was expressed as units relative to that of the cells without fMLF treatment. Results are mean ⁇ SEM of three independent experiments conducted in triplicate.
  • Electrophoretic mobility shift assay EMSA was performed to detect anNF- ⁇ B binding element (5'-AGTTGAGGGGACTTTCCAGGC-3') (SEQ ID NO: 8) in the nuclei of tumor cells.
  • the probe was end labeled with [ 32 P]dATP and incubated with 5 ⁇ g nuclear proteins in 20 ⁇ l binding cocktail (50 mM Tris-HCl (pH 7.4), 25 mM MgCl 2 , 5 mM DTT, and 50% glycerol) at 4°C for 2 h.
  • binding cocktail 50 mM Tris-HCl (pH 7.4), 25 mM MgCl 2 , 5 mM DTT, and 50% glycerol
  • VEGF production by ELISA VEGF in the supematants of tumor cells cultured in the absence or presence of fMLF was quantified using commercial ELISA kits (Lymphokine Testing Laboratory, SAIC Frederick, National Cancer Institute-Frederick, Frederick, MD).
  • Flow cvtometrv Human mononuclear cells (0.5 x 10 6 ) were preincubated with different reagents for 30 min at 37°C, then were incubated with PE-conjugated anti-FPR antibody or an isotype matched control antibody (0.5 ⁇ g) for 30 min on ice in dark. The cells were washed twice with FACS buffer (5 mM EDTA, 0.1% NaN 3 , 1% FCS, in DPBS) and analyzed by flow cytometry.
  • FACS buffer 5 mM EDTA, 0.1% NaN 3 , 1% FCS, in DPBS
  • siRNA constructs To construct hairpin siRNA expression cassettes of the invention, two complementary oligonucleotide (nt) sequences were synthesized and inserted into a retroviral expression vector pSIREN-RetroQ designed to express a dsRNA using human U6 promoter that is suitable also for transient transfection of proliferating cells.
  • nt 19 nucleotide (nt) sense (corresponding to various positions in human FPR mRNA) and reverse complementary targeting sequences were designed and one of the constructs, termed FPRsiRNA T-28, targeting the positions nt 890-910 of human FPR mRNA (in the 3 rd extracellular loop of the putative protein) is shown below: Bam HI Target sense sequence Target antisense sequence EcoR V
  • the upper strand is SEQ ID NO: 11.
  • the lower strand is SEQ ID NO: 12.
  • Two additional pairs of siRNA were designed to target the following positions in FPR mRNA:
  • T10 FPR mRNA 356-376, in the 3 rd transmembrane region of the putative protein
  • ATTCGTCTTTACCATAGTG SEQ ID NO: 2
  • T16 FPR mRNA 569-589, in the 2 nd transmembrane region of the putative protein: AACGGGGACAGTAGCCTGC (SEQ ID NO: 3)
  • the dsRNA cassette features a TTCAAGAGA loop located between the sense and reverse complementary targeting sequences and a TTTTTT terminator downstream of the target antisense sequence.
  • glioma cell lines U87 and SNB75 Two human glioma cell lines U87 and SNB75, but not normal astrocytes and another glioma cell line SHG44, expressed transcripts for FPR (Fig. 1A) and responded to low concentrations of the bacterial chemotactic peptide fMLF with chemotaxis and Ca 2+ mobilization (Fig. IB, E).
  • W pep a synthetic hexapeptide that activates FPR (Le et al. (1999) J. Immunol. 163. 6777-6784) also induced the migration of U87 and SNB75 cells.
  • MMK-1 a synthetic peptide agonist specific for FPRLl, a FPR variant (Hu et al. (2001) J.
  • Example HI Signal transduction pathways coupled to FPR in glioma cells
  • fMLF time- and concentration-dependently increased the phosphorylation of ERK1/2 and p38 MAPKs in U87 cells (Fig. 2A, Fig. 2B).
  • the maximal increase in ERK and p38 phosphorylation occurred within 5 min after fMLF stimulation with an optimal agonist concentration at 10 2 nM.
  • fMLF also enhanced the phosphorylation of JNK in U87 cells (Fig. 2C).
  • PD98059 a MEK1 inhibitor
  • SB202190 an inhibitor of p38 MAPK
  • Akt protein kinase B
  • MAPK and PI3K pathways are coupled to FPR in malignant glioma cells and are activated by FPR agonists, similar to previous observations obtained in monocytes and other myeloid cells.
  • FPR agonists similar to previous observations obtained in monocytes and other myeloid cells.
  • Other experiments showed that fMLF stimulated the proliferation of U87 cells; increased the phosphorylation of STAT3, a growth promoting signaling molecule; and induced anti-apoptotic BCL2, in U87 cells.
  • FPR in glioma cells may mediate migration, growth, and anti-apoptotic and angiogenic responses in malignant glioma cells.
  • Example IV Activation of NK/cB and HIF-l ⁇ in glioma cells by FPR agonist
  • NF- ⁇ B a transcription factor that regulates gene expression in cells exposed to diverse stimulants.
  • EMSA assays the DNA-NF- ⁇ B complexes were detected in U87 cells as early as 5 min following stimulation with fMLF.
  • fMLF fMLF to enhance NF- ⁇ B activity in U87 glioma cells prompted us to investigate whether stimulation of fMLF may also promote the nuclear translocation of HIF-l ⁇ , a major stimulator of the transcription of the gene coding for VEGF, which is implicated in neovascularization in many malignant tumors.
  • Fig. 3C shows that under normal culture conditions, stimulation of U87 cells with fMLF significantly increased the nuclear translocation of HIF-l ⁇ and the activity of fMLF was inhibited by the MEK1 inhibitor PD98059.
  • activation of FPR expressed in glioma cells increases the activity of NF- ⁇ B and HIF-l ⁇ that may promote new gene transcription.
  • Example V Activation of FPR in glioma cells increases the production of VEGF.
  • Nonstimulated U87 cells expressed low levels of mRNA transcripts for VEGF, and the expression was significantly enhanced when the cells were exposed to fMLF as shown by RT-PCR (Fig. 4A, Fig. 4B).
  • the maximal effect on VEGF gene expression was obtained with fMLF in a concentration range comparable to that required to stimulate other FPR functions in U87 cells.
  • fMLF did not increase the level of VEGF mRNA in normal astrocytes or glioma cell lines that without FPR expression, suggesting that the presence of FPR is required for the stimulatory effect of fMLF.
  • VEGF gene stimulated by fMLF in U87 cells was inhibited by PD98059 (Fig.4B), but not SB202190, implying the involvement of MEKl/ERK, rather than p38, pathway in FPR- mediated enhancement of VEGF gene expression.
  • the elevated levels of VEGF mRNA in fMLF-stimulated U87 cells were associated with the production of VEGF protein.
  • Fig. 5A shows that although VEGF was produced and accumulated in the culture media of unstimulated U87 cells, fMLF treatment resulted in a significantly increased VEGF protein level reaching a maximum at 72 h.
  • VEGF contained in the supematants of fMLF-stimulated U87 cells was biologically active, since the supematants induced significant chemotaxis of HUVECs and the activity was completely abolished by a monoclonal antibody against human VEGF (Fig. 5B). Exposure of HUVECs to supematants of fMLF-stimulated glioma cells also resulted in the formation of capillary-like structures on Matrigel surface, which was also inhibited by an anti-VEGF antibody (Fig. 5C). Thus, VEGF in the supematants of FPR-activated glioma cells induces endothelial cell (EC) migration and tubule formation, two key events associated with neovascularization.
  • EC endothelial cell
  • Example VI Higher tumorigenicity and growth rate shown by FPR-expressing glioma cells
  • the degree of malignancy of astrocytoma is determined by the state of differentiation.
  • GFAP and vimentin are two typical differentiation markers for astroglial cells (Rutka et al. (1997) J. Neurosurg. 87, 420-430; Dahl et al. (1981) Eur. J. CellBiol. 24, 191-196).
  • FPR-expressing U87 cells expressed low levels of GFAP, but high levels of vimentin, suggesting these cells are poorly differentiated with a potentially higher degree of malignant phenotype.
  • Example VII Endogenous formylpeptide receptor agonists produced by glioma It has been reported that mitochondria of raptured cells contain formylated peptides, which are potential chemotactic agonists for formylpeptide receptors. Since highly malignant gliomas frequently contain necrotic regions and invade surrounding tissues to cause tissue damage, we investigated whether necrotic glioma cells were capable of producing FPR agonists. Supematants from necrotic U87 cells induced significant migration of live glioma cells (Fig. 7A) and human monocytes.
  • necrotic tumor cell supematants The chemotactic activity of necrotic tumor cell supematants was markedly higher than that exhibited by supematants derived from apoptotic tumor cells or cells under normal culture conditions.
  • Supematants from necrotic U87 cells also induced chemotaxis of ETFR cells, and the cell migration was significantly inhibited by an anti-FPR antibody (Fig. 7B).
  • supematants from necrotic tumor cells induced Ca 2+ flux in glioma cells expressing FPR and desensitized the cell response to fMLF (Fig. 7C).
  • Example VIH FPR inhibitors inhibit cell migration in response to fMLF
  • chenodeoxycholic acid (CDCA) chenodeoxycholic acid
  • U87 glioma cells were incubated with CDCA and cell migration was measured.
  • Figure 8A shows that the migration of cells incubated with CDCA for 30 minutes was significantly inhibited.
  • Example IX FPR inhibitors abrogate the capacity of a glioma cell to grow tumors in nude mice.
  • CDCA abrogates the capacity of U87 cells to grow tumors in nude mice.
  • Nude mice were injected s.c. with 2xl0 6 U87 tumor cells and were treated daily with CDCA for 30 minutes for 14 days, during which time tumor growth was monitored.
  • Fig. 8B shows that the treated cells exhibited greatly reduced tumor volume; in fact, they showed no detectable tumor growth at all.
  • FPR contributes to the tumorigenicity of U87 cells in vivo, we injected cells containing FPR-siRNA into athymic mice.
  • FPR/293 cells are human epithelial HEK-293 cells that have been transfected so as to constitutively over- express human FPR.
  • FPR293 cells were transiently transfected with the vectors containing dsRNA cassettes comprising siRNA T28, and were then evaluated for migration in response to FPR agonist fMLF. Transfection with T-28 completely attenuated the chemotaxis response of FPR/293 cells to fMLF. The T-28 dsRNA constract was also tested in glioma cells expressing FPR and exhibited potent inhibition of tumor cell migration and calcium flux induced by fMLF.
  • glioma cells depleted of FPR showed markedly reduced tumorigenicity and the rate of tumor growth in xenograft models.
  • U87 cells were transiently transfected with the vectors containing various dsRNA cassettes (comprising siRNAs T10, T16 or T28), and were then evaluated for migration in response to FPR agonist fMLF. Transfection with T-28 completely attenuated the chemotaxis response of FPR293 cells to fMLF. The T-28 dsRNA construct was also tested in glioma cells expressing FPR and exhibited potent inhibition of tumor cell migration and calcium flux induced by fMLF.
  • glioma cells depleted of FPR showed markedly reduced tumorigenicity and the rate of tumor growth in xenograft models.
  • U-87 cells were stably transfected with FPR-siRNA, and the expression and function of FPR were shown to be almost completely abolished, as determined by RT-PCR (Fig. 9A) and in vitro fMLF-induced chemotaxis (Fig. 9B).
  • the FPR-siRNA also abrogated the capacity of fMLF to induce phosphorylation of ERK1/2 (Fig. 9C) and STAT3 (Fig. 9D) in U87 cells.
  • Example XI Anti-FPR therapy of tumor cells implanted into the brains of immunocompromised animals.
  • Human glioma cells are implanted into the brains of nude mice or rats, and the tumor growth and the effect of anti-FPR therapy are assessed. Implantation of the cells into brains rather than subcutaneously provides an environment closer to the tissue of origin of the glioma cells.
  • tumor and surrounding tissues are collected and histopathology studies are carried out to examine the degree of tumor invasion, vascularization, production of angiogenic factors and the expression of FPR in tumor cells. All of these methods are conventional.
  • the inhibitors are expected to abrogate growth and other malignant properties of the implanted cells. Such experiments are corroborated with studies of freshly excised as well as preserved human glioma specimens. The latter experiments are expected to validate the potential of FPR as a promoting factor for glioma progression.
  • Example XII Anti-FPR therapy of tumor cells in the brains of animals Preexisting tumors are treated with anti-FPR antibodies, agents that have shown FPR antagonist activities such as CDCA (cheno-deoxycholic acid, see Le et al. (2003) Curr. Med. Chem. Anti-Infect. Agents 2, 83-93, which describes the stracture of various antagonists) and cyclosporine H . Based on the results that FPR agonists activate NFkB, HIF-la and STAT3 that are linked to the production of angiogenic factors, agents specific for signaling molecules and transcription factors associated with FPR are also tested for anti-glioma activity.
  • CDCA cheno-deoxycholic acid, see Le et al. (2003) Curr. Med. Chem. Anti-Infect. Agents 2, 83-93, which describes the stracture of various antagonists
  • cyclosporine H cyclosporine H .
  • FPR agonists activate NFkB, HIF-
  • Example XIH Inhibition of tumor growth with small molecules of the stilbene family
  • a small molecule constituent of grape seeds, piceatanol (PA), of the stilbene family was tested and found to inhibit the signaling of FPR in U87 glioblastoma cells.
  • PA piceatanol
  • Figures 11 and 12 show the inhibition of tumor growth in nude mice, following local or peritoneal injection of PA. Since another stilbene family member, Resveratrol, has been found to inhibit FPR in leukocytes and receptor transfected cells (Tao et al. (2004) Cell. Mol. Immunol.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne, entre autres, une méthode d'inhibition de l'activité d'une cellule de gliome exprimant FPR, induite par le récepteur formylpeptide (FPR), qui consiste à mettre la cellule en contact avec une quantité efficace d'un agent qui inhibe l'expression et/ou l'activité de FPR, in vitro ou in vivo. L'invention porte également sur des agents inhibiteurs et sur des compositions pharmaceutiques permettant la mise en oeuvre de cette méthode ; sur des méthodes diagnostiques pour l'identification de cellules de gliome très malignes ; et sur des méthodes d'identification d'un agent qui inhibe une activité d'une cellule de gliome, induite par FPR.
PCT/US2005/005652 2004-03-25 2005-02-22 Recepteur formylpeptide (fpr) utilise en tant que cible pour une therapie anti-gliome malin WO2005103255A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US55605804P 2004-03-25 2004-03-25
US60/556,058 2004-03-25

Publications (1)

Publication Number Publication Date
WO2005103255A1 true WO2005103255A1 (fr) 2005-11-03

Family

ID=34962470

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/005652 WO2005103255A1 (fr) 2004-03-25 2005-02-22 Recepteur formylpeptide (fpr) utilise en tant que cible pour une therapie anti-gliome malin

Country Status (1)

Country Link
WO (1) WO2005103255A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011045352A3 (fr) * 2009-10-15 2012-03-15 Novartis Forschungsstiftung Tyrosine kinase de la rate et cancers du cerveau

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB1541165A (en) * 1976-07-13 1979-02-21 Lipha Composition for treating biliary lithiasis
WO2000016794A1 (fr) * 1998-09-23 2000-03-30 Marcus Keep Neuro-immunophillines pour radioprotection neuronale selective
US20030157082A1 (en) * 2002-01-31 2003-08-21 Millennium Pharmaceuticals, Inc. Methods and compositions for treating cancer using 140, 1470, 1686, 2089, 2427, 3702, 5891, 6428, 7181, 7660, 25641, 69583, 49863, 8897, 1682, 17667, 9235, 3703, 14171, 10359, 1660, 1450, 18894, 2088, 32427, 2160, 9252, 9389, 1642, 85269, 10297, 1584, 9525, 14124, 4469, 8990, 2100, 9288, 64698, 10480,20893, 33230,1586, 9943, 16334, 68862, 9011, 14031, 6178, 21225, 1420, 32236, 2099, 2150, 26583, 2784, 8941, 9811, 27444, 50566 or 66428 molecules
US20040033941A1 (en) * 2001-07-25 2004-02-19 Hamawy Majed M. Immunosuppression using piceatannol and a calcineurin inhibitor
WO2005024058A2 (fr) * 2003-09-10 2005-03-17 Galapagos N.V. Composes destines au traitement de maladies provoquant un trouble cognitif, telles que la maladie d'alzheimer et methodes permettant d'identifier ces composes

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB1541165A (en) * 1976-07-13 1979-02-21 Lipha Composition for treating biliary lithiasis
WO2000016794A1 (fr) * 1998-09-23 2000-03-30 Marcus Keep Neuro-immunophillines pour radioprotection neuronale selective
US20040033941A1 (en) * 2001-07-25 2004-02-19 Hamawy Majed M. Immunosuppression using piceatannol and a calcineurin inhibitor
US20030157082A1 (en) * 2002-01-31 2003-08-21 Millennium Pharmaceuticals, Inc. Methods and compositions for treating cancer using 140, 1470, 1686, 2089, 2427, 3702, 5891, 6428, 7181, 7660, 25641, 69583, 49863, 8897, 1682, 17667, 9235, 3703, 14171, 10359, 1660, 1450, 18894, 2088, 32427, 2160, 9252, 9389, 1642, 85269, 10297, 1584, 9525, 14124, 4469, 8990, 2100, 9288, 64698, 10480,20893, 33230,1586, 9943, 16334, 68862, 9011, 14031, 6178, 21225, 1420, 32236, 2099, 2150, 26583, 2784, 8941, 9811, 27444, 50566 or 66428 molecules
WO2005024058A2 (fr) * 2003-09-10 2005-03-17 Galapagos N.V. Composes destines au traitement de maladies provoquant un trouble cognitif, telles que la maladie d'alzheimer et methodes permettant d'identifier ces composes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LE YINGYING ET AL: "Formyl-peptide receptors revisited", TRENDS IN IMMUNOLOGY, vol. 23, no. 11, November 2002 (2002-11-01), pages 541 - 548, XP002336332, ISSN: 1471-4906 *
LE YINGYING ET AL: "Silencing the formylpeptide receptor FPR by short-interfering RNA", MOLECULAR PHARMACOLOGY, vol. 66, no. 4, October 2004 (2004-10-01), pages 1022 - 1028, XP009050624, ISSN: 0026-895X *
TSENG SHENG-HONG ET AL: "Resveratrol suppresses the angiogenesis and tumor growth of gliomas in rats.", CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH. 15 MAR 2004, vol. 10, no. 6, 15 March 2004 (2004-03-15), pages 2190 - 2202, XP002336316, ISSN: 1078-0432 *
ZHOU YE ET AL: "Activation of formylpeptide receptor in malignant astrocytoma cells promotes the production of vascular endothelial growth factor.", FASEB JOURNAL, vol. 17, no. 4-5, March 2003 (2003-03-01), & FASEB MEETING ON EXPERIMENTAL BIOLOGY: TRANSLATING THE GENOME; SAN DIEGO, CA, USA; APRIL 11-15, 2003, pages Abstract No. 861.6 URL - http://ww, XP009050638, ISSN: 0892-6638 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011045352A3 (fr) * 2009-10-15 2012-03-15 Novartis Forschungsstiftung Tyrosine kinase de la rate et cancers du cerveau

Similar Documents

Publication Publication Date Title
Redaelli et al. Lorlatinib treatment elicits multiple on-and off-target mechanisms of resistance in ALK-driven cancer
JP2012502954A (ja) 癌治療のための方法および組成物
US20100015128A1 (en) GRP78 as a Predictor of Responsiveness to Therapeutic Agents
JP5919593B2 (ja) 併用療法
US20090311716A1 (en) METHODS TO TREAT OR PREVENT HORMONE-RESISTANT PROSTATE CANCER USING siRNA SPECIFIC FOR PROTOCADHERIN-PC, OR OTHER INHIBITORS OF PROTOCADHERIN-PC EXPRESSION OR ACTIVITY
US10105384B2 (en) Nucleic acids targeting TCTP for use in the treatment of chemo- or hormone-resistant cancers
WO2010002465A2 (fr) Procédé de traitement de la néoplasie par l’inhibition de lactate déshydrogénase et/ou de la phosphoribosyltransférase de nicotinamide
WO2013026059A1 (fr) Inhibition de la production et de la fonction de gm-csf induit par kras oncogène
US9187787B2 (en) Method of diagnosing and treating cancer
WO2013171753A1 (fr) Procédés de traitement et de diagnostic de maladies en utilisant des agents qui régulent les voies d'épissage alternatif
EP3289104B1 (fr) Procédé pour le traitement de gliomes de haut grade
US20140348744A1 (en) Compositions and methods for regulating cancer-related signaling pathways
WO2005103255A1 (fr) Recepteur formylpeptide (fpr) utilise en tant que cible pour une therapie anti-gliome malin
Wong et al. Semicarbazide-sensitive amine oxidase inhibition ameliorates albuminuria and glomerulosclerosis but does not improve tubulointerstitial fibrosis in diabetic nephropathy
US20100239596A1 (en) Grp78 and tumor angiogenesis
WO2012145129A2 (fr) Sous-typage moléculaire, pronostic et traitement du cancer de la prostate
US20130156702A1 (en) Methods for the treatment and the diagnosis of cancer
US20060099586A1 (en) Eef1a2 for use in the prognosis, diagnosis, and treatment of cancer
US20150023920A1 (en) Novel compositions and methods for preventing or treating cancer metastasis
Yu et al. Targeting tumor-macrophage interaction via the Notch2-Jag1 axis reverses tumor resistance to paclitaxel
Luu The Role of Endothelial-Specific Intraflagellar Transport Protein 88 in Doxorubicin-Induced Cardiotoxicity
US20140363449A1 (en) Methods, assays, and systems relating to sakt
KR20200135270A (ko) 전립선 암의 항암제에 대한 감수성 증진용 조성물 및 이의 용도
CN115485561A (zh) 预测对pd-1轴抑制剂的反应
WO2023164689A2 (fr) Ciblage de neuropiline 2 (nrp2) dans cancer de la prostate mortel

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase