WO2005007847A1 - Procede de production d'acide l-glutamique - Google Patents

Procede de production d'acide l-glutamique Download PDF

Info

Publication number
WO2005007847A1
WO2005007847A1 PCT/JP2004/008808 JP2004008808W WO2005007847A1 WO 2005007847 A1 WO2005007847 A1 WO 2005007847A1 JP 2004008808 W JP2004008808 W JP 2004008808W WO 2005007847 A1 WO2005007847 A1 WO 2005007847A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
strain
qor
seq
glutamic acid
Prior art date
Application number
PCT/JP2004/008808
Other languages
English (en)
Japanese (ja)
Inventor
Gen Nonaka
Yoko Kuwabara
Kazuhiko Matsui
Hiroyuki Kojima
Original Assignee
Ajinomoto Co., Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ajinomoto Co., Inc. filed Critical Ajinomoto Co., Inc.
Publication of WO2005007847A1 publication Critical patent/WO2005007847A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/14—Glutamic acid; Glutamine

Definitions

  • the present invention relates to the fermentation industry, and more particularly, to a method for producing L-gnoretamic acid and a bacterium used for the method.
  • L-glutamic acid is widely used as a seasoning raw material and the like.
  • L-glutamic acid has been industrially produced by a fermentation method using a coryneform bacterium belonging to the genus Brevibataterum, which has the ability to produce L-gnoretamic acid.
  • a method for producing L-glutamic acid using bacteria such as Escherichia's colipantair'ananatis (Enterobacter i-agromelans) has been developed.
  • An object of the present invention is to provide a novel technique for improving L-glutamic acid productivity in the production of L-glutamic acid using ⁇ -proteobacteria.
  • the present invention is as follows.
  • the method is characterized in that the bacterium is modified so that quinone oxide reductase activity is increased, and the bacterium is modified.
  • a protein comprising the amino acid sequence of SEQ ID NO: 21 including substitution, deletion, insertion or addition of one or several amino acids, and having a quinone oxidoreductase activity.
  • L-Gunoretamin have acid-producing ability, and, I quinone O sulfoxide reductase activity which has been modified to increase - Proteobacteria.
  • FIG. 1 is a diagram showing the QOR activity of an ORF39 gene product when 1,2-NQ and 9,10-PQ are used as substrates.
  • FIG. 3 Growth curves of JM109 / pECQ28B (qor gene amplified strain) and JM109 / pSTV28 strain (control strain) under acidic conditions (pH 5.0).
  • FIG. 6 is a view showing the construction of a plasmid pMWCPG having a gltA gene, a ppc gene, and a gdhA gene.
  • FIG. 7 is a view showing the construction of a plasmid RSF-Tet containing a replication origin of a broad host range plasmid RSF1010 and a tetracycline resistance gene.
  • FIG. 8 is a view showing the construction of a plasmid RSFCPG having a replication origin, a tetracycline resistance gene, a gltA gene, a ppc gene and a gdhA gene of a broad host range plasmid RSF1010.
  • FIG. 9 is a view showing the construction of a plasmid pSTVCB having a gltA gene.
  • the ⁇ -proteobacterium of the present invention is a ⁇ -proteobacterium having L-glutamic acid-producing ability and modified so that quinone oxidoreductase activity is increased.
  • L_glutamine-producing ability refers to the ability to accumulate L-gnoretamine in a medium when the ⁇ -proteobacterium of the present invention is cultured.
  • Examples of the ⁇ -proteobacteria used in the present invention include microorganisms belonging to ⁇ -proteobacteria, such as Pantoea, Escherichia, Enterobacter, Klebsiella, Serratia, Elvinia, Salmonella, Morganella, and the like. It is not particularly limited as long as it has an ability to produce L-gnoretamic acid and can improve the ability to produce L-gnoretamic acid by increasing quinone oxide reductase activity. Specifically, those belonging to ⁇ -proteobacteria can be used by moths that are listed on the NCBI (National Center for Biotechnology Information Retainer Database) (
  • Examples of the bacterium belonging to the genus Escherichia include Escherichia coli.
  • examples of the bacteria belonging to Pantoea include Pantoea 'ananatis (P. ananatis), Pantoea' agglomerans ( ⁇ . Agglomerans), and Pantoea 'stuarti (P. stewartii).
  • Examples of the Enterobacter bacteria include Enterobacter 1 agglomerans, Enterobacter aerogenes and the like. Recently, enterobacter agglomerans have been developed by Pantoea 'Agglomerans, Pantoea' Ananatis, based on 16S rRNA nucleotide sequence analysis.
  • the Pantoea bacteria include such Enterobacter bacteria.
  • Examples of the bacterium belonging to the genus Escherichia having the ability to produce L-glutamic acid include, for example, a bacterium belonging to the genus Escherichia deficient in or having a reduced ketoglutarate dehydrogenase (hi KGDH) activity, and a bacterium belonging to the genus Escherichia having a reduced L-glutamic acid degradability. And the like.
  • Escherichia bacteria whose KGDH activity is deficient or reduced and a method for obtaining the same are described in JP-A-5-244970 and JP-A-7-203980. Specifically, the following strains can be mentioned.
  • Escherichia. Coli W3110sucA Km r Escherichia Kori AJ12624 (FERM BP-3853)
  • Eshierihia 'E. coli W3110sucA Km r is Eshierihia' coli W3110 Nohi KGDH gene (hereinafter, "sucA gene") abbreviated) is a strain obtained is destroyed, non KGDH completely deficient strain.
  • sucA gene Escherichia coli MG1655A sucA strain described in Examples below is also one of suitable strains.
  • L-palin-resistant strains for example, Escherichia coli 'Bll, Escherichia coli' K-12 (ATCC10798), Escherichia coli '(ATCC11303), Escherichia coli 'Kori W (ATCC9637) and the like.
  • Examples of the bacteria belonging to the genus Pantoea having L-glutamic acid-producing ability include Pantoea ananatis strain AJ13355, and strains AJ13356 and AJ13601 derived from the strain (see Examples).
  • the AJ13355 strain was isolated from soil in Iwata City, Shizuoka Prefecture, as a strain that can grow at low pH on a medium containing L-gnoretamic acid and a carbon source. The strain was deposited on February 19, 1998 with the Ministry of International Trade and Industry's Institute of Industrial Science and Technology, Institute of Biotechnology and Industrial Technology (currently, National Institute of Advanced Industrial Science and Technology) under the accession number FERM P-16644.
  • the AJ13356 strain was obtained by disrupting the KGDH-E1 subunit gene (sucA). a Lack of KGDH activity. a Pantoea bacteria with deficient or reduced KGDH activity and methods for obtaining them are described in EP-A-1078989.
  • the AJ13356 strain was deposited on February 19, 1998 with the Ministry of International Trade and Industry's Institute of Industrial Science and Technology, Institute of Biotechnology and Industrial Technology (currently, National Institute of Advanced Industrial Science and Technology) under the accession number FERM P-16645. Was transferred to an international deposit under the Budapest Treaty on January 11, 1999, and has been assigned the accession number FERM BP-6615.
  • the AJ13601 strain is obtained by selecting a mucus-low-producing strain from the AJ13355 strain, disrupting the KGDH gene, gltA gene derived from Escherichia coli, each gene of gdhA, and gltA gene derived from Brevibacterium lactofermentum. This strain was obtained by introduction, selection of a high-concentration L-glutamic acid-resistant strain at low pH, and selection of a strain having high growth rate and high L-glutamic acid-producing ability. Each of the genes will be described later.
  • the AJ13601 strain was established on August 18, 1999 by the Ministry of International Trade and Industry, the Institute of Industrial Science and Technology, and the Institute of Biotechnology and Industrial Technology (currently the National Institute of Advanced Industrial Science and Technology). Deposited in Tsukuba, Ibaraki Pref. 1-3-1, Higashi) as accession number FERM P-17516, transferred to an international deposit based on the Budapest Treaty on July 6, 2000, and given accession number FERM BP-7207. Have been.
  • a plasmid (pSTVCB) containing the gltA gene derived from Brevibataterium 'ratatofamentumum' was dropped from the AJ13601 strain, and a plasmid containing each gene of gltA, ppc and gdhA derived from Escherichia coli '
  • the strain G106S which has only RSFCPG), is also a suitable strain (see Examples).
  • the L-gnoretamine-producing ability of the bacterium of the present invention may be a property imparted or enhanced by breeding, which may be a property of a wild-type ⁇ -proteobacterium.
  • the L-glutamic acid-producing ability can be imparted or enhanced by, for example, increasing the activity of an enzyme that catalyzes the biosynthesis reaction of L-glutamic acid.
  • L-glutamic acid-producing ability is also enhanced by reducing or eliminating the activity of an enzyme that catalyzes a reaction that produces a compound other than L-glutamic acid by branching off from the L-glutamic acid biosynthetic pathway. Power S can.
  • Examples of enzymes that catalyze the biosynthesis reaction of L-glutamic acid include glutamate dehydrogenase (hereinafter, also referred to as "GDH"), glutamine synthetase, glutamate synthase, isocitrate dehydrogenase, aconitate hydratase, and quinone.
  • GDH glutamate dehydrogenase
  • Acid synthase hereinafter also referred to as “CS”), phosphoenolpyruvate carboxylase (hereinafter also referred to as “PEPC”), pinolevic acid dehydrogenase, pyruvate kinase, enolase, phosphoglyceromutase, phosphoglycerate kinase, Cellulaldehyde-3-phosphate dehydrogenase, triosephosphate isomerase, fructosebisphosphate aldolase, phosphofructokinase, glucose phosphate isomerase and the like.
  • CS Acid synthase
  • PEPC phosphoenolpyruvate carboxylase
  • pinolevic acid dehydrogenase pinolevic acid dehydrogenase
  • pyruvate kinase pyruvate kinase
  • enolase phosphoglyceromutase
  • phosphoglycerate kinase
  • CS Brevibataterium ratatofamentum is preferred because it is not inhibited by peak ketoglutaric acid, L-glutamic acid and NADH.
  • Enhancing CS, PEPC or GDH activity can be achieved by a method similar to that for enhancing quinone oxide reductase activity described below. That is, for example, a gene that increases the copy number of a gene encoding CS, PEPC or GDH (hereinafter, abbreviated as “gltA gene”, “ppc gene”, and “gdhA gene”, respectively) or The CS, PEPC or GDH activity can be increased by modifying the expression control sequences of these genes so that the expression of these genes is enhanced. The activity of other enzymes can be similarly increased.
  • any organism having CS, PEPC, and GDH activity may be used.
  • bacteria that are prokaryotes for example, those belonging to the genus Pantoea, Enterobacter, Klebsiella, Enoreville, Serratia, Escherichia, Corynebacterium, Brevibacterium, and Bacillus are preferred. Specific examples include Escherichia coli and Brevibataterum Ratatofu amentum.
  • the gltA gene, ppc gene, and gdhA gene can be obtained from the chromosomal DNA of a microorganism as described above.
  • the gltA gene, ppc gene, and gdhA gene are each CS, PEPC or G It can be obtained by isolating a DNA fragment that complements its auxotrophy from the chromosomal DNA of the microorganism using a mutant strain lacking DH activity.
  • these genes of the genus Escherichia and those of the bacteria belonging to the genus Corynebacterium have already been sequenced and their ability to be confirmed has been reviewed (Biochemistry, Vol. 22, pages 5243-5249, 1983; J. Biochem. Vol. 95, 909 916, 1984; Gene, Vol. 27, 193 199, 1984; Microbiology, Vol. 140, 1817 1828, 1994; Mol. Gen. Genet., Vol.
  • Examples of enzymes that catalyze a reaction that branches off from the L-glutamic acid biosynthetic pathway to produce a compound other than L-glutamic acid include: a KGDH, isocitrate lyase, acetyltransferase phosphate, acetate kinase, acetate acetate, and the like. Examples include hydroxy acid synthase, acetolactate synthase, acetyl formate transferase, lactate dehydrogenase, glutamate decarboxylase, and 1-pyrroline dehydrogenase. Of these enzymes, aKGDH is preferred.
  • the activity of the enzyme as described above can be reduced or abolished by a conventional mutagenesis method or a genetic engineering technique by adding the gene of the enzyme to the cells in the cell.
  • a mutation may be introduced so that the activity of the enzyme is reduced or deleted.
  • Examples of the mutation treatment method include a method of irradiating X-rays or ultraviolet rays, and a method of treating with a mutagen such as N-methyl-N'-nitro-N-nitrosogazine.
  • the site where the mutation is introduced into the gene may be a coding region encoding an enzyme protein or an expression control region of a promoter or the like.
  • Examples of the genetic engineering technique include a method using a gene recombination method, a transduction method, a cell fusion method, and the like. For example, a drug-resistant gene is inserted into a cloned target gene to produce a gene that has lost its function (deleted gene). Next, the deletion type gene is introduced into cells of a host microorganism, and the target gene on the chromosome is replaced with the deletion type gene using homologous recombination (gene disruption).
  • the ability to select a target mutant can be determined depending on the phenotype of the mutant. For example, a mutant strain that is deficient or has reduced KGDH activity cannot grow or grow on a minimal medium containing glucose or a minimal medium containing acetic acid or L-glutamic acid as the sole carbon source under aerobic culture conditions. The speed drops significantly. Under normal conditions, normal growth can be achieved by adding succinic acid or lysine, methionine, and diaminopimelic acid to a minimal medium containing glucose even under the same conditions. Using these events as indices, it is possible to select mutant strains in which aKGDH activity is deficient or reduced.
  • a method for producing a KGDH gene-deficient strain of Brevibataterium 'ratatophamentum using homologous recombination is described in detail in W095 / 34672, and the same method is applied to other microorganisms. be able to.
  • Pantoea ananathase which is an example of the ⁇ -proteobacterium used in the present invention, has a high operation efficiency when cultured in a medium containing sugar, because it generates mucus outside the cells. There may not be. Therefore, when using Pantoea ananatis having such a mucus-producing property, it is preferable to use a mutant in which the amount of mucus produced is lower than that of a wild-type strain.
  • Mutation treatment methods include, for example, irradiation with X-rays or ultraviolet rays. Or a method involving treatment with a mutagen such as N-methyl-N'-two-trough N-nitrosogazine.
  • mutant strain with reduced amount of mucus was spread on a medium containing sugar, for example, an LB medium plate containing 5 g / L of gnorecose, and the plate was inclined at about 45 ° and cultured. Selection can be made by selecting a colony in which the liquid does not flow down.
  • the imparting or enhancing of the L-glutamic acid-producing ability and the above-mentioned preference and properties such as the above-mentioned mucus-low production mutation can be performed in any order.
  • SEQ ID NO: 22 shows the nucleotide sequence of plasmid RSFCPG (see Examples) containing the gltA gene, gdhA gene, and ppc gene derived from Escherichia coli.
  • the coding regions of the gltA gene, the gdhA gene, and the ppc gene correspond to base numbers 1770-487 (encoded by the bottom strand), 2598-3941, 7869-5218 (depending on the complementary strand, respectively). Coded).
  • the amino acid sequences of CS, GDH and PEPC encoded by these genes are shown in SEQ ID NOS: 23, 24 and 25.
  • SEQ ID NO: 26 and SEQ ID NO: 27 show the nucleotide sequence of plasmid pSTVCB (see Example 1) containing the gltA gene derived from Brevi batatum ratatophamentum and the CS encoded by the gene.
  • CS, GDH, and PEPC are substituted, deleted, inserted, added, or substituted with one or several amino acid residues such that the activity of each enzyme is not substantially impaired. It may have an amino acid sequence containing an inversion.
  • severe refers to a force that varies depending on the position and type of the amino acid residue in the three-dimensional structure of the protein. Specifically, 2 to 30, preferably 2 to 20, and more preferably 2 From 10.
  • the above-mentioned mutation of CS, GDH or PEPC is a conservative mutation that maintains the activity of CS, GDH or PEPC.
  • Substitutions are changes in which at least one residue in the amino acid sequence has been removed and another residue has been inserted there.
  • Amino acids that replace the original amino acids of the CS, GDH or PEPC proteins and are considered conservative substitutions include the substitution of Ala for ser or thr.
  • substitution of arg power to gln, his or lys substitution of asn power to glu, gln, lys, his or asp, substitution of asp power to asn, glu or gin, cys power to ser or ala
  • substitution, replacement with gin power, asn, glu, lys, his, asp or arg replacement with glu power, asn, gln, lys or asp, replacement with gly power, pro, his power asn, lys, gln Arg or f to tyr, ile force to leu, met, val or f to phe, leu force, ile, met, val or phe, lys force to asn, glu, gln, substitution to his or arg, met force, et al.
  • DNA encoding a protein or peptide substantially the same as CS, GDH and PEPC as described above includes the base sequence lj shown in SEQ ID NO: 26 or the base sequence shown in SEQ ID NO: 22 DNA that encodes a protein that hybridizes with a probe that can be prepared under stringent conditions and has CS, GDH or PEPC activity.
  • stringent conditions refers to conditions under which a so-called specific hybrid is formed and a non-specific hybrid is not formed. Although it is difficult to quantify these conditions clearly, as an example, DNAs with high homology have a homology of 50% or more, preferably 70% or more, more preferably 90% or more.
  • the conditions are such that DNAs hybridize with each other and homology is lower than that of DNAs, or the conditions for washing of ordinary southern hybridizers and hybridizations are used60.
  • C 1 X SSC, 0. 1 0/0 SDS, or preferably ⁇ , 0. 1 X SSC, Haiburidizu conditions and the like at a salt concentration corresponding to 0. 1% SDS
  • the base sequence shown in SEQ ID NO: 26, or each ORF in the base sequence of SEQ ID NO: 22 or a partial sequence thereof can also be used.
  • Such a probe is prepared by PCR using an oligonucleotide prepared based on the nucleotide sequence of SEQ ID NO: 26 or 22 as a primer and a DNA fragment containing SEQ ID NO: 26 or 22 or a partial nucleotide sequence thereof as a ⁇ type. can do.
  • the conditions for washing the hybridization include 50 ° C., 2 ⁇ SSC, 0.1% SDS.
  • the deletion type sucA gene used for gene disruption should have homology to homologous recombination with the sucA gene on the chromosomal DNA of the target microorganism. Such homology is preferably at least 85%, more preferably at least 90%, particularly preferably at least 95%. In addition, homologous recombination can occur between DNAs that can hybridize under stringent conditions.
  • .gamma.-proteobacteria of the present invention is a .gamma.-proteobacteria having L Gunoretamin acid-producing ability as described above, and, I one proteobacteria quinone O sulfoxide reductase activity was by Uni modified to increase It is.
  • Q ⁇ R activity refers to 1,2_NQ (1,2-naphthoquinone), 9,10_PQ (9 , 10-Fuenanthrene quinone
  • QOR activity can be measured, for example, by measuring the change in absorbance at 340 nm in a reaction system containing 1,2_NQ or 9,10_PQ as a substrate and NADPH as a coenzyme.
  • Monkey PVRao. M. Krishna JSZigier Jr., Jounal of Biological Cnemistry, 267 (1), pp96-102, 1992).
  • Modified to increase intracellular QOR activity means that the QOR activity per cell has become higher than that of a non-modified strain, for example, a wild-type ⁇ -proteobacterium. For example, when the number of QOR molecules per cell increases, or when the activity per QOR molecule increases. Examples of wild-type ⁇ _proteobacteria to be compared include Escherichia coli MG1655 and Pantoea ananatis. Increasing the QOR activity of ⁇ -proteobacteria increases the ability of the bacterium to produce L-glutamate. In addition, growth under acidic conditions is improved.
  • Enhancement of QOR activity in ⁇ -proteobacterial cells is achieved by enhancing expression of a gene (qor) encoding QOR. Enhancement of the expression level of the gene can be achieved by increasing the number of copies of qor.
  • the qor fragment is ligated to a vector, preferably a multicopy vector, which functions in the bacterium to prepare a recombinant DNA, which is then introduced into a host having the ability to produce L-gnoretamine for transformation. Just fine.
  • a transformant was obtained by introducing the above recombinant DNA into wild-type ⁇ _ proteobacteria, and then L-glutamine-producing ability may be imparted to the transformed strain.
  • qor can use both genes from ⁇ -proteobacteria and genes from other organisms. Among them, a gene derived from ⁇ -proteobacteria is preferred from the viewpoint of ease of expression.
  • the host bacterium is preferably a bacterium belonging to the same genus as the bacterium from which qor is collected.
  • the primers prepared based on the base sequence for example, the primers shown in SEQ ID NOS: 5 and 6, were used to obtain the qor of the Escherichia coli.
  • Qor and its adjacent region can be obtained by PCR using chromosomal DNA of E. coli as type II (PG: polymerase chain reaction; see White, TJ et al.,. Rends Genet. 5, 185 (1989)). .
  • the qor of Pantoea ananatis can be obtained, for example, by using the primers shown in SEQ ID NOs: 18 and 19 by a PCR method using the chromosomal DNA of Pantoea ananatis as type III. Homologs of qor of other microorganisms can be obtained in a similar manner.
  • nucleotide sequence of qor of Pantoea ananatis is shown in SEQ ID NO: 20.
  • amino acid sequence encoded by the nucleotide sequence is shown in SEQ ID NO: 21.
  • Chromosomal DNA can be obtained from a DNA donor bacterium by, for example, the method of Saito and K. Miura (H. Saito and K. Miura, Biochem. Biophys. Acta, 72, 619 (1963), Bioengineering Experiments, Eds., Pages 97-98, Baifukan, 1992).
  • the qor amplified by the PCR method is connected to a vector DNA capable of autonomously replicating in the cells of ⁇ proteobacteria to prepare a recombinant DNA, which is introduced into ⁇ proteobacteria.
  • vectors include pUC19, pUC18, pHSG299, pHSG399, pHSG398, RSF1010, pBR322, pACYC184, pMW219, pSTV28, pTWV228 and the like.
  • the vector is cleaved with a restriction enzyme that matches the end of the qor. Ligation is usually performed using a ligase such as T4 DNA ligase.
  • the recombinant DNA prepared as described above may be introduced into ⁇ -proteobacteria according to the transformation method reported so far.
  • Escherichia coli ⁇ - Methods for increasing DNA permeability by treating recipient cells with calcium chloride as reported in 12 (Mandel, M. and Higa, A., J. Mol. Biol., 53, 159 (1970)).
  • a method for preparing a competent cell from a cell at the growth stage and introducing DNA as described in Bacillus' subtilis (Duncan, CH, Wilson, GA and Young, FE, Gene, 1, 153). (1977)).
  • the recombinant DNA can be transformed into protoplasts or fluent plasts, as is known for Bacillus subtilis, actinomycetes, and yeast, to facilitate the uptake of recombinant DNA. (Chang'S. And Choen, SN, Molec. Gen. Genet., 168, 111)
  • Increasing the copy number of qor can also be achieved by causing multiple copies of qor to exist on the chromosomal DNA of ⁇ -proteobacteria.
  • homologous recombination is performed using a sequence that exists in multiple copies on the chromosomal DNA as a target.
  • a sequence present in multiple copies on chromosomal DNA repetitive DNA and inverted 'repeat existing at the end of a transposable element can be used.
  • the enhancement of QOR activity can also be achieved by replacing an expression control sequence such as a qor promoter on chromosomal DNA or plasmid with a strong one, in addition to the gene amplification described above.
  • an expression control sequence such as a qor promoter on chromosomal DNA or plasmid
  • a strong one for example, lac promoter, t ⁇ promoter, trc promoter and the like are known as strong promoters.
  • These modifications of the expression control sequence may be combined with increasing the copy number of qor.
  • the replacement of the expression control sequence can be performed, for example, in the same manner as the gene replacement using a temperature-sensitive plasmid.
  • temperature-sensitive plasmids of Escherichia coli include p48K and pSFKT2 (see JP-A-2000-262288), pHSC4 (see French Patent Publication 1992 2667875 and JP-A-5-7491), pMAN997 ( International Publication Pamphlet No. WO 99/03988).
  • the qor used in the present invention is a QOR containing one or several amino acid substitutions, deletions, insertions, or additions at one or more positions, as long as the QOR activity of the encoded protein is not impaired. It may be something that codes.
  • “several” refers to a force that varies depending on the position and type of the amino acid residue in the three-dimensional structure of the protein.Specifically, 2 to 30, preferably 2 to 20, more preferably 2 to There are ten.
  • substitutions are changes in which at least one residue in the amino acid sequence is removed and another residue is inserted therein.
  • Amino acids that replace the original amino acids of the qor protein and are considered conservative substitutions include Ala to ser or thr substitution, arg to gln, his or lys substitution, asn force glu, gin, etc.
  • DNA encoding a protein substantially identical to the QOR as described above may be obtained by substituting, deleting, inserting, adding, or inverting amino acid residues at a specific site by, for example, site-directed mutagenesis. It is obtained by modifying the base sequence of qor to include
  • the modified DNA as described above can also be obtained by conventionally known mutation treatment.
  • Mutation treatment includes in vitro treatment of DNA before mutation treatment with hydroxynoreamine or the like, and irradiation of a microorganism holding the DNA before mutation treatment, for example, a bacterium belonging to the genus Escherichia with ultraviolet light.
  • a method of treating with a mutagen such as N-methyl-N'-two-row N-nitrosogazine (NTG) or nitrite, which is usually used in a mutation treatment, is used.
  • DNA having the above mutation is expressed in a suitable cell, and the activity of the expression product is examined, whereby a DNA encoding a protein substantially identical to the QOR can be obtained.
  • the nucleotide sequence of the reported qor gene of Escherichia coli (GenBank accession gl790485) or the nucleotide sequence of the qor gene of Pantoea ananatis (sequence)
  • a base sequence consisting of base numbers 304 1287 of the base sequence described in No. 20, or a probe having a portion thereof, which hybridizes under stringent conditions and has a QR activity; Is obtained.
  • stringent conditions refers to conditions under which a so-called specific hybrid is formed and a non-specific hybrid is not formed. Although it is difficult to quantify this condition clearly, as an example, DNAs having high homology, for example, 40% or more, preferably 60% or more, more preferably 70% or more, and still more preferably 80% or more %, Particularly preferably 90% or more, most preferably 95% or more under conditions in which DNAs having homology are hybridized and DNAs having lower homology are not hybridized, or ordinary Southern hybridization. Washing conditions are 60. C, 1 X SSC, 0. 1 0/0 SDS, or preferably ⁇ , 0. 1 X SSC, Haiburidizu conditions are mentioned in the primate equivalent salt concentration in 0. 1 0/0 SDS.
  • a partial sequence of the base sequence of the gene can also be used.
  • Such a probe can be prepared by PCR using an oligonucleotide prepared based on the nucleotide sequence of the qor gene as a primer and a DNA fragment containing the qor gene as type III.
  • conditions for washing the hybridization include 50 ° C., 2 ⁇ SSC, and 0.1% SDS.
  • DNA encoding a protein substantially identical to Q0R specifically, the amino acid sequence represented by SEQ ID NO: 21 is preferably 30% or more, more preferably 50% or more, and even more preferably 70% or more. % Or more, more preferably 80. / ⁇ or more, particularly preferably 90.
  • the qor of Escherichia coli and the qor of Pantoea ananatis are amino acid residues. Has 70% homology at the bell.
  • the ⁇ -proteobacteria obtained as described above are cultured in a medium, L-glutamine is produced and accumulated in the medium, and L-glutamine is collected from the medium to efficiently produce L-gnoretamine. be able to.
  • a conventional medium containing a carbon source, a nitrogen source, inorganic salts, and, if necessary, organic trace nutrients such as amino acids and vitamins is used.
  • a synthetic medium or a natural medium can be used.
  • the carbon source and the nitrogen source used in the medium any type may be used as long as the strain to be cultured is available.
  • Examples of the carbon source include sugars such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolyzate, molasses, and organic acids such as acetic acid and citric acid, and ethanol. Alcohols are also used alone or in combination with other carbon sources.
  • ammonia ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate, or nitrates are used.
  • organic trace nutrients amino acids, vitamins, fatty acids, nucleic acids, and peptones, casamino acids, yeast extracts, soybean protein decomposed products containing these, and the like are used, and nutrients that require amino acids or the like for growth are used.
  • an auxotrophic mutant it is preferable to supplement the required nutrients.
  • inorganic salts phosphates, magnesium salts, calcium salts, iron salts, manganese salts and the like are used.
  • Culture is performed by controlling the fermentation temperature to 20 45 ° C and the pH to 59, and performing aeration culture. If the pH drops during cultivation, neutralize with an alkali such as ammonia gas for adding calcium carbonate. By cultivating vigorously for about 10 to 120 hours, a significant amount of L-glutamine is accumulated in the culture solution.
  • an alkali such as ammonia gas for adding calcium carbonate.
  • the method of collecting L-glutamine from the culture solution after completion of the culture follows a known recovery method. Just do it. For example, after the cells are removed from the culture solution, the cells are collected by concentration and crystallization.
  • the screening method is as follows.
  • the continuously cultured cells were cultured in MM / MES medium (pH: 5.7 (adjusted with KOH)) (20 g / L glucose, 10 g / L (NH) SO, lg / L KHPO, 0.4 g / L MgSO-7H0,
  • Chromosomal DNA was prepared from each of the strains of Brevibataterium 'ratatophamentum 16-1, 16-20, and 15-11 obtained as described above, and partially degraded with the restriction enzyme Sau3AI. One 6 kbp DNA fragment was purified. These DNA fragments were inserted into the BamHI site of a plasmid vector (pSFK6) capable of autonomous replication in both Escherichia coli and Corynebacterium bacteria. A genomic library consisting of about 14000 clones for the 16-1 strain, about 7000 clones for the 16-20 strain, and about 14,000 clones for the 15-11 strain was obtained.
  • pSFK6 plasmid vector
  • the pSFK6 is derived from a vector for Escherichia coli, pHSG399 (see S. Takeshita et al: Gene 61, 63-74 (1987), which can be purchased from Takara Shuzo Co., Ltd.) and the ability of Streptococcus fucaris namycin resistance gene.
  • This is a plasmid constructed from the prepared plasmid pKl and the plasmid pAM330 extracted from Brevibatadium 'ratatofamentum ATCC 13869 (see U.S. Pat. No. 4,427,773, and Japanese Patent Publication No. 58-67699). 2000-262288, U.S. Patent No. 6,303,383).
  • Brevibacterium lactofermentum ATCC13869 has the ability to prevent colony formation on MM / MES plates with a pH of 5.7 or less, and the obtained clones were acid-resistant by a gene on the plasmid. It is believed that there is.
  • Four such clone strengths (clone # D5, clone # F1, clone # F2, clone # H87) were obtained.
  • Each of the clones # D5, # F1, # F2, and # H87 contained an open reading frame (ORF) in the nucleotide sequence of the genomic DNA fragment on the plasmid.
  • ORF39 open reading frame contained in the plasmid of clone # F2 was found to contain the Escherichia coli qor gene and amino acids. About 30% homology was observed at the sequence level.
  • SEQ ID NO: 1 shows the nucleotide sequence of ORF39 and its adjacent region.
  • the amino acid sequence encoded by ORF39 is shown in SEQ ID NO: 2. It should be noted that base numbers 117 in SEQ ID NO: 1 are sequences derived from pHSG399.
  • Pyrobest DNA polymerase manufactured by Takara Shuzo
  • the amplification product is cut at the EcoRI site (primer CHIS-FW) and the Pstl site (primer CHIS-RV) designed on the primer, and the resulting fragment is expressed in the expression vector pTrc99A (Parmacia Biotech).
  • the primer CHIS-RV is designed so that His X6 is fused in frame with the last amino acid residue at the C 'terminus of ORF39, followed by a stop codon and a Pstl site. Have been.
  • an EcoRI site has been introduced into the primer CHIS-FW.
  • the measurement was performed using ANA-7A manufactured by Sharp. Cells were collected from 12 ml of the culture solution, and washed three times with 0.85 M NaCl. The cells were suspended in 600 ⁇ l of an adsorption / washing solution (MagExtractor-His-tag-, Toyobo), sonicated for 5 minutes, and the supernatant was separated by centrifugation to separate the crude enzyme solution. I got it.
  • an adsorption / washing solution MagneticExtractor-His-tag-, Toyobo
  • the QOR activity of dicumarol was determined to confirm whether the enzyme activity measured above was a specific QOR activity.
  • the enzyme solution was added to the same reaction system as above, and the QOR activity was measured. (Fig. 2). Therefore, it was confirmed that the enzyme activity measured in the above reaction system was a specific QR activity.
  • Sigma Co., Ltd. product (M-1390) was used.
  • a DNA fragment containing the qor gene and about 300 bp upstream and about 200 bp downstream thereof was obtained by PCR using the genomic DNA of the Escherichia coli W3110 strain as type III and the following oligonucleotides as primers. PCR was performed at 94 ° C using Pyrobest DNA polymerase (Takara Shuzo). After 30 minutes, 30 cycles of 5 seconds at 98 ° C, 10 seconds at 65 ° C, and 90 seconds at 72 ° C were performed.
  • the obtained DNA fragment containing the 1.5 kb qor gene is cut at the EcoRI site designed on the 5 'end of both primers, and inserted into the EcoRI site of the cloning vector pHSG299 (Takara Shuzo). did. From the plasmid, the qor gene fragment was cut out again at the EcoRI site, and the qor gene fragment was inserted into the EcoRI site of the cloning vector pSTV28 (manufactured by Takara Shuzo) so as to be in the forward direction to the transcription direction of the lacZ gene. Got.
  • Primers were synthesized based on the reported nucleotide sequence of the sucA gene, and the N-terminal and C-terminal fragments of the sucA gene were amplified by PCR using the genomic DNA of Escherichia coli MG1655 strain as type III. PCR was performed using Pyrobest DNA Polymerase (Takara Shuzo) according to the instructions and the attached instructions. Primers 7 and 8 were used as N-terminal fragment amplification PCR primers, and primers 9 and 10 were used as C-terminal fragment amplification PCR primers. Primer 9 has Hindlll site and Primer 10 has Xbal site
  • gggtctagaccactttgtcagtttcgatt GenBank accession No. AE000175, base sequence of nucleotide sequence 1318-13820, complementary sequence to base sequence 13801-13820, with ggg and Xbal sites added at the 5 'end: sequence: 10)
  • the amplified DNA fragments after PCR were each purified using the QIAquick PCR Purification Kit (manufactured by QIAGEN), and crossover PCR was performed using the purified N-terminal and C-terminal DNA fragments and primers 7 and 10.
  • a defective sucA fragment was obtained by the method (AJ Link, D. Phillips, GM Church, Journal of Bacteriology, 179, 6228-6237 (1997)).
  • the purified DNA fragment was digested with Hindlll and Xbal, and then treated with phenol Z-cloth form and precipitated with ethanol.
  • the temperature-sensitive plasmid pMAN997 (WO 99/03988, International Publication Pamphlet) cleaved with Hindlll and Xbal and the DNA fragment were ligated using DNA ligation Kit Ver.2 (Takara Shuzo).
  • the ligation reaction solution was used to transform JM109 competent cells (Takara Shuzo) and applied to an LB agar plate (LB + ampicillin plate) containing 25 ⁇ g / mL of ampicillin (Sigma).
  • the grown colonies were cultured in an LB medium containing 25 ⁇ g / mL ampicillin at 30 ° C in a test tube, and an automatic plasmid extractor H-50 (Kurabo Co., Ltd.) was used. To perform plasmid extraction. The resulting plasmid was digested with Hindlll and Xbal, and subjected to agarose gel electrophoresis. The plasmid into which the target fragment was inserted was designated as a sucA disruption plasmid pMA ⁇ sucA. The pMAN997 is obtained by reconnecting the respective Vspl-Hindlll fragments of MAN031 (S. Matsuyama and S. Mizushima, J. Bacteriol., 162, 1196 (1985)) and pUC19 (Takara Shuzo). .
  • Escherichia coli MG1655 strain was transformed with the plasmid pMAN # A sucA by the method of CT Chung et al., And colonies were selected at 30 ° C on an LB + ampicillin plate. After overnight liquid culture the selected clones to 30 ° C, the culture solution 10 3 diluted to plated on an LB + ampicillin plate, and colonies were selected at 42 ° C. After the selected clones were spread on an LB + ampicillin plate and cultured at 30 ° C, 1/8 of the cells on the plate were suspended in 2 mL of LB medium and cultured at 42 ° C with shaking for 4.5 hours.
  • sucA-disrupted strain derived from the MG1655 strain MG1655A sucA strain was obtained.
  • the plasmid PECQ28B was introduced into Escherichia coli 'JM109 strain (manufactured by Takara Shuzo) to obtain a qor gene amplified strain JM109 / pECQ28B strain.
  • a JM109 / pSTV28 strain into which the closing vector PSTV28 (Takara Shuzo) was introduced was obtained.
  • PECQ28B was introduced into a sucA gene-deficient strain derived from Escherichia coli MG1655 strain, and a qor gene amplified strain MG1655A sucA / pECQ28B strain was obtained.
  • As a control strain an MG1655 ⁇ sucA / pSTV28 strain into which the cloning vector pSTV28 (Takara Shuzo) was introduced was obtained.
  • JM109 / pECQ28B strain qor gene amplified strain
  • JM109 / pSTV28 strain and their control strains were cultured in LB medium (10 g / l tryptone, 5 g / l yeast extratat, 10 g / l NaCl, pH 7.0).
  • the cells were cultured at 37 ° C. overnight.
  • This culture solution is transferred to a new LB medium (4 ml test tube) so that the OD (660 nm) becomes about 0.1 (using the Tokyo Photoelectric OD meter), and the OD (660 nm) force is around 0.5 (Tokyo Photoelectric OD meter). ).
  • LBG / MES medium (10 g / l yeast extract, 10 g / l yeast extract, 10 g / l NaCU 5 g / l glucose, 100 mM MES, pH 5.0), L5.0 / L
  • the cells were subcultured into 4 ml of -tube and cultured at 37 ° C for 24 hours using a small shaking culture device (ADVANTEC).
  • Figure 3 shows the growth curve at this time. It can be seen that the growth of the qor gene amplified strain is improved as compared to the control strain. Thus, the growth of E. coli under acidic conditions could be improved by amplification of the qor gene.
  • M9G / MES medium M9 minimal medium (Molecular Cloning 3 rd Edition, by old Spring Harbor Laboratory Press, and old Spring Harbor, NY) 37 ° until the OD (660 nm) becomes around 0.7 (using an OD meter from Tokyo Photoelectric) using the added calorie, pH 7.0) so that the degree becomes 0.4% glucose, 0.0
  • the obtained bacterial cells were adjusted to a new M9G / MES medium (the components were the same as above, adjusted to 6 different pHs ( ⁇ 7.5, ⁇ 7.0, ⁇ 6.8, ⁇ ⁇ 6.5, ⁇ 6.0, ⁇ 5 .5) Inoculate 10% by volume of), and 37 with an L-shaped tube.
  • the concentrations of L-gunoletamic acid and gnorecose in the medium were measured.
  • FIG. 4 shows the yield of L-glutamic acid based on the consumed sugar at this time.
  • the yield of L-glutamic acid was improved in the qor gene-amplified strain in the range of pH 5.5 to pH 7.5.
  • the L-glutamic acid yield of Escherichia coli could be improved in the range of pH 5.5 to pH 7.5.
  • the search for microorganisms having L-glutamic acid resistance in an acidic environment was performed as follows. Approximately 500 samples obtained from nature such as soil, fruits, plants, and river water of lg are suspended in 5 mL of sterilized water, and 200 of them are adjusted to pH 4.0 with hydrochloric acid, 20 mL of solid medium 20 mL Was applied.
  • the composition of the medium is as follows. Dalkose 3 g, ammonium sulfate lg / L, magnesium sulfate heptahydrate 0.2 g / L, dihydrogen phosphate 0.5 g, sodium salt sodium 0.2 g / L, salt sodium calcium dihydrate O.
  • the medium coated with the sample was cultured at 28 ° C, 37 ° C or 50 ° C for 2-4 days, and 378 strains forming colonies were obtained.
  • the strain obtained as described above was transformed into a liquid containing a saturated concentration of L-glutamic acid. Inoculate a 16.5 cm long, 14 mm diameter test tube into which 3 mL of medium (adjusted to pH 4.0 with hydrochloric acid) is injected, and shake at 28 ° C, 37 ° C, or 50 ° C for 24 hours to 3 days. After cultivation, a growing strain was selected.
  • the composition of the medium is as follows.
  • AJ13355 strain obtained from soil in Iwata City, Shizuoka Prefecture was obtained as a strain with good growth.
  • This strain was determined to be Enterobacter agglomerans based on its bacteriological properties. Enterobacter agglomerans are reclassified into Pantoea agglomerans or Pantoanananatis, P. stewartii, etc. by analyzing the nucleotide sequence of 16S rRNA. The AJ13355 strain is classified into Pantoea ananatis among these.
  • Pantoea'ananatis strain AJ13355 When cultured in a medium containing sugar, Pantoea'ananatis strain AJ13355 is not efficient due to the production of mucus outside the cells. Therefore, the acquisition of a low mucus-producing strain was determined by the UV irradiation method (Miller, JH et al., "A Short Cource in Bacterial Genetics; Laboratory Manual ", Cold Spring Harbor Laboratory Press, USA, p.150, 1992).
  • the Pantoea'ananatis AJ13355 strain was irradiated with ultraviolet light for 2 minutes, and then cultured overnight in an LB medium to fix the mutation.
  • the mutagenized strain is diluted and spread on an LB medium containing 5 g / L glucose and 20 g / L agar so that about 100 colonies appear per plate. Cultivation was performed overnight at ° C, and 20 colonies where mucus did not flow down were selected.
  • sucAB gene of Pantoea ananatis AJ13355 strain is a DNA fragment that complements the non-acetic acid assimilation property of the aKGDH-El subunit gene (hereinafter referred to as "sucA") deficient strain of Escherichia coli. Cloning was performed by selecting from chromosomal DNA.
  • the chromosomal DNA of Pantoea 'Ananatis strain AJ13355 can be obtained by the same method as that used for normal extraction of chromosomal DNA in Escherichia coli (Bioengineering Experiments, Biological Engineering Society of Japan, pp. 97-98). , Baifukan, 1992).
  • PTWV228 ampicillin resistance used as a vector was a commercial product from Takara Shuzo.
  • coli JRG465 harboring pTWVEK101 restored the requirement for succinic acid or L-lysine and L-methionine in addition to the trait of assimilating acetic acid. This suggests that pTWVEKlOl contains the sucA gene of Pantoea 'ananatis.
  • FIG. 5 shows a restriction enzyme map of a DNA fragment derived from Pantoea ananatis of pTWVEK101.
  • SEQ ID NO: 11 shows the result of determining the base sequence of the portion shown by hatching in FIG. In this sequence, two full-length ORFs and a base sequence that was considered to be a partial sequence of the two ORFs were found.
  • the amino acid sequences that can be encoded by these ⁇ RF or a partial sequence thereof are shown in SEQ ID NOs: 12 to 15 in order from the 5 ′ side.
  • the base sequence was determined to be a partial sequence at the 3 ′ end of the succinate dehydrogenase iron-sulfurbin tin gene (sdhB), a full-length sucA and a KGDH_E2 subunit gene ( sucB), the succinyl CoA synthetase ⁇ subunit gene (sue C) was found to contain a partial sequence at the 5 'end.
  • the amino acid sequences deduced from these nucleotide sequences were compared with those of Escherichia coli (Eur. J. Biochem., 141, 351-359 (1984), Eur. J. Biochem., 141, 361-374 (1984)). , Biochemistry, 24,
  • pTWVEKlOl was cut with Sphl to cut out a fragment containing sucA. Fragment (Takara Shuzo Co., Ltd.) and pBR322 (Takara Shuzo Co., Ltd.), which has been cut with EcoRI and blunt-ended with Klenow fragment, are ligated using T4 DNA ligase (Takara Shuzo Co., Ltd.) did.
  • the resulting plasmid was cleaved with the restriction enzyme BglII recognition site located at approximately the center of sucA using the same enzyme, blunt-ended with Klenow fragment, and ligated again with T4 DNA ligase.
  • the Pantoea'ananatis SC17 strain was purified by the electoporation method (Miller JH, "A Short Course in Bacterial Genetics; Handbook, Cold Spring Harbor Laboratory Press, USA, p.279, 1992) to obtain a strain in which the sucA on the chromosome was replaced with a mutant by homologous recombination using tetracycline resistance as an index.
  • the obtained strain was SCI 7sucA. The strain was named.
  • the SC17sucA strain was transfected with a citrate synthase gene, a phosphoenolpyruvate carboxylase gene, and a glutamate dehydrogenase gene derived from Escherichia coli.
  • Plasmid pBRGDH JP-A-7-203980 having a gdhA gene derived from Escherichia coli was digested with HindIII and SpM, and both ends were blunt-ended by treatment with T4 DNA polymerase. Purified and recovered.
  • a plasmid pMWCP (WO97 / 08294) having a gltA gene and a ppc gene derived from Escherichia coli was digested with Xbal, and both ends were blunt-ended with T4 DNA polymerase.
  • the above-purified DNA fragment having the gdhA gene was mixed with the mixture and ligated with T4 ligase to obtain a plasmid pMWCPG in which the gdhA gene was further added to pMWCP (FIG. 6).
  • plasmid pVIC40 having a replication origin of the broad host range plasmid RSF1010 Japanese Unexamined Patent Publication No. 8-47397 was digested with Notl, treated with T4 DNA polymerase, and then digested with Pstl, and pBR322 was digested with EcoT14I plasmid. After treatment with T4 DNA polymerase, the resultant was mixed with Pstl-digested DNA and ligated with T4 ligase to obtain a plasmid RSF-Tet having an RSF1010 replication origin and a tetracycline resistance gene (FIG. 7).
  • pMWCPG was digested with EcoRI and Pstl, a DNA fragment containing the gltA gene, the ppc gene, and the gdhA gene was purified and recovered.
  • RSF-Tet was similarly digested with EcoRI and Pstl to have a replication origin of RSF1010. After mixing with the purified and recovered DNA fragment, it was ligated with T4 ligase to obtain a plasmid RSFCPG carrying the gltA gene, ppc gene, and gdhA gene on RSF-Tet (FIG. 8).
  • the expression of the gltA gene, ppc gene and gdhA gene in the obtained plasmid RSFCPG was confirmed by complementation of the auxotrophy of the gltA gene, ppc gene or gdhA gene-deficient strain of Escherichia coli, and measurement of each enzyme activity. Confirmed by
  • a plasmid having the gltA gene derived from Brevibacterium 'ratatophamentum' was constructed as follows. Based on the nucleotide sequence of the gltA gene of Corynebacterium gonoretamicum (Microbiology, 1994, 140, 1817-1828), primer DNAs having the nucleotide sequences shown in SEQ ID NOs: 16 and 17 were used. '' Ratatov Armament ATCC1 PCR was performed using the 3869 chromosomal DNA as type I to obtain a gltA gene fragment of about 3 kb.
  • This fragment was inserted into Smal-digested plasmid pHSG399 (purchased from Takara Shuzo Co., Ltd.) to obtain a plasmid pHSGCB (FIG. 9).
  • pHSGCB was digested with Hindlll, and the cut out gltA gene fragment of about 3 kb was introduced into Hindlll digested plasmid pSTV29 (purchased from Takara Shuzo Co., Ltd.) to obtain plasmid pSTVCB (FIG. 9).
  • the expression of the gltA gene in the obtained plasmid pSTVCB was confirmed by measuring the enzyme activity in Pantoea'ananatis strain AJ13355.
  • the Pantoea ananatis strain SC17sucA was transformed by RSFCPG by the electoporation method to obtain a tetracycline-resistant transformant SC17sucA / RSFCPG strain. Further, the SC17sucA / RSFCPG strain was transformed using pSTVCB by electoporation, and a transformant showing chloramphenicol resistance was obtained.
  • a strain with improved resistance to high concentrations of L-glutamic acid in a low pH environment was isolated from Pantoea ananatis SC17sucA / RSFCPG + pSTVCB strain (hereinafter, also referred to as a "high-concentration Glu-resistant strain at low pH").
  • the cells washed with physiological saline are appropriately diluted, and the M9-E medium (4 g of glucose, 17 g of NaHPO ⁇ 12 ⁇ O / L, KH PO
  • the colonies that appeared after culturing at 32 ° C for 2 days were obtained as low-pH, high-concentration Glu-resistant strains.
  • the growth of the obtained strain was measured in an M9-E liquid medium, and L-glutamic acid production test medium (glucose 40 g / ammonium resulfate 20 g / L, magnesium sulfate heptahydrate 0.5 g / L, potassium dihydrogen phosphate 2g / L, sodium chloride 0.5g / L, calcium chloride dihydrate 0.25 g / L, ferrous sulfate heptahydrate 0.02 g / L, manganese sulfate tetrahydrate 0.02 g / L, zinc sulfate dihydrate 0.72 mg / L, copper sulfate pentahydrate 0.64 mg / L, cobalt chloride hexahydrate 0.72mg of water salt, boric acid
  • the AJ13601 strain was cultured in a LBGM9 liquid medium with shaking at 31.5 ° C. overnight, appropriately diluted to 100-200 colonies per plate, and spread on an LBGM9 plate containing 12.5 mg / L of tetracycline. The resulting colony was replicated on an LBGM9 plate containing 12.5 mg / L of tetracycline and 25 mg / L of chloramphenicol to obtain a strain that became chloramphenicol-sensitive, and this strain was named G106S.
  • the G106S strain has only RSFCPG and pSTVCB has dropped out.
  • PCR Pyrobest DNA polymerase (manufactured by Takara Shuzo Co., Ltd.) was used, followed by 30 cycles of 94 ° C for 5 minutes, followed by 98 ° C for 5 seconds, 65 ° C for 10 seconds, and 72 ° C for 90 seconds.
  • the ORF obtained here has a high homology of about 67% in the DNA sequence and about 70% in the amino acid sequence with the qor gene of Escherichia coli, it encodes the qor gene of Pantoea ananatis. Conceivable.
  • the plasmid PEAQ28AA was introduced into Pantoea ananatis G106S strain to obtain a qor gene amplified strain G106S / pEAQ28AA strain. Also, a G106S / pSTV28 strain into which the cloning vector PSTV28 (Takara Shuzo) was introduced was obtained as a control strain.
  • G106S / pEAQ28AA strain qor gene amplified strain
  • G106S / pSTV28 strain control strain
  • LBG medium 10 g / l tryptone, 5 g / l yeast extratato, 10 g / l NaCl, 5 g / l glucose.
  • the cells were shake-cultured at 34 ° C. until the OD (660 nm) force was reached (using an OD meter from Tokyo Photoelectric) to prepare bacterial cells.
  • G106S / pEAQ28AA strain qor gene amplified strain
  • G106S / pSTV28 strain control strain
  • LBG medium 10 g / l tryptone, 5 g / l yeast extratato, 10 g / l NaCl, 5 g / l glucose
  • Shaking culture was performed at 34 ° C until the OD (660 nm) was around 0.5 (using an OD meter from Tokyo Photoelectric) to prepare bacterial cells.
  • the medium was inoculated to a concentration of 2% by weight and cultured in an L-shaped tube at 34 ° C for 17 hours with shaking.
  • the concentration of L-glutamic acid and glucose in the medium was measured using a Biotech Analyzer (Sakura Seiki).
  • Table 1 shows the yield of glutamic acid based on the sugar consumed at this time.
  • SEQ ID NO: 1 Nucleotide sequence of B. lactofermentum ORF39
  • SEQ ID NO: 2 Amino acid sequence encoded by ORF39
  • SEQ ID NO: 3 ORF39 amplification primer CHIC-FW
  • SEQ ID NO: 4 Primer for ORF39 amplification CHIC-RV
  • SEQ ID NO: 5 Primer for amplifying E. coli qor gene Ecqor-FW
  • SEQ ID NO: 6 Primer for amplifying E. coli qor gene Ecqor-RV
  • SEQ ID NO: 7 Primer for N-terminal amplification of sucA gene 7
  • SEQ ID NO: 8 Primer for N-terminal amplification of sucA gene 8
  • SEQ ID NO: 9 Primer 9 for C-terminal amplification of sucA gene
  • SEQ ID NO: 10 Primer for amplifying C-terminal of sucA gene 10
  • SEQ ID NO: 11 Base sequence of DNA fragment containing P. ananatis sucA gene
  • SEQ ID NO: 12 Amino acid sequence encoded by 3 ′ terminal region of P. ananatis sdhB gene
  • SEQ ID NO: 13 Amino acid sequence encoded by P. ananatis sucA gene
  • SEQ ID NO: 14 Amino acid sequence encoded by P. ananatis sucB gene
  • SEQ ID NO: 15 Amino acid sequence encoded by 5 ′ terminal region of P. ananatis sucC gene
  • SEQ ID NO: 16 B Primer for amplifying lactofermentum gltA gene
  • SEQ ID NO: 17 Primer for amplifying B. lactofermentum gltA gene
  • SEQ ID NO: 20 Base sequence of DNA fragment containing P. ananatis qor gene
  • SEQ ID NO: 21 Amino acid sequence encoded by P. ananatis qor gene
  • SEQ ID NO: 22 Base sequence of plasmid RSFCPG containing E. coli gltA, gdhA, and ppc genes
  • SEQ ID NO: 26 B Nucleotide sequence of plasmid pSTVCB containing gltA gene of lactofermentum
  • SEQ ID NO: 27 B Amino acid sequence of CS encoded by gltA gene of lactofermentum Potential for industrial use
  • L-glutamic acid-producing ability of ⁇ _proteobacteria can be improved.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention porte sur un procédé de production d'acide L- glutamique consistant à mettre en culture des protéobactéries Ω capables de produire l'acide L- glutamique et modifiées pour accroître dans le milieu de culture l'activité de la quinone oxydoréductase et assurer dans ledit milieu la formation et l'accumulation dans ledit milieu de l'acide L- glutamique et permettre son recueil.
PCT/JP2004/008808 2003-06-23 2004-06-23 Procede de production d'acide l-glutamique WO2005007847A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2003178216A JP2006230202A (ja) 2003-06-23 2003-06-23 Ｌ−グルタミン酸の製造法
JP2003-178216 2003-06-23

Publications (1)

Publication Number Publication Date
WO2005007847A1 true WO2005007847A1 (fr) 2005-01-27

Family

ID=34074276

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2004/008808 WO2005007847A1 (fr) 2003-06-23 2004-06-23 Procede de production d'acide l-glutamique

Country Status (2)

Country Link
JP (1) JP2006230202A (fr)
WO (1) WO2005007847A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE602009000714D1 (de) * 2008-03-06 2011-03-24 Ajinomoto Kk L-Zystein-produzierendes Bakterium und Verfahren zur Herstellung von L-Zystein
EP2857510A4 (fr) 2012-05-29 2016-02-10 Ajinomoto Kk Procédé de production d'acide 3-acétylamino-4-hydroxybenzoïque

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU711102B2 (en) * 1996-04-23 1999-10-07 Ajinomoto Co., Inc. Process for producing L-glutamic acid by fermentation
EP0955368A2 (fr) * 1998-03-18 1999-11-10 Ajinomoto Co., Ltd. Bactérie produisant de l'acide glutamique et procédé de préparation de l'acide glutamique
EP1092776A1 (fr) * 1999-10-14 2001-04-18 Ajinomoto Co., Inc. Procédé de préparation de L-aminoacides par fermentation
EP1103611A1 (fr) * 1999-11-25 2001-05-30 Degussa AG Séquences nucléotidiques codantes pour les gènes sucC et sucD
EP1106684A1 (fr) * 1999-12-10 2001-06-13 Degussa AG Séquences polynucleotidiques de Corynebacterium glutamicum codant pour des sous-unités de succinate déshydrogénase

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU711102B2 (en) * 1996-04-23 1999-10-07 Ajinomoto Co., Inc. Process for producing L-glutamic acid by fermentation
EP0955368A2 (fr) * 1998-03-18 1999-11-10 Ajinomoto Co., Ltd. Bactérie produisant de l'acide glutamique et procédé de préparation de l'acide glutamique
EP1092776A1 (fr) * 1999-10-14 2001-04-18 Ajinomoto Co., Inc. Procédé de préparation de L-aminoacides par fermentation
EP1103611A1 (fr) * 1999-11-25 2001-05-30 Degussa AG Séquences nucléotidiques codantes pour les gènes sucC et sucD
EP1106684A1 (fr) * 1999-12-10 2001-06-13 Degussa AG Séquences polynucleotidiques de Corynebacterium glutamicum codant pour des sous-unités de succinate déshydrogénase

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
THORN J.M. ET AL.: "Crystal structure of Escherichia coli QOR quinone oxidoreductase complexed with NADPH", J. MOL. BIOL., vol. 249, no. 4, 1995, pages 785 - 799, XP002982449 *

Also Published As

Publication number Publication date
JP2006230202A (ja) 2006-09-07

Similar Documents

Publication Publication Date Title
AU756507B2 (en) L-glutamic acid-producing bacterium and method for producing L-glutamic acid
JP4427878B2 (ja) 析出を伴う発酵法によるｌ−グルタミン酸の製造法
KR101224367B1 (ko) Ｌ-글루탐산을 생산하는 미생물 및 ｌ-글루탐산을 생산하는방법
JP5218400B2 (ja) カルボキシル基を有する酸性物質の製造法
US7879583B2 (en) Process for producing L-glutamic acid
US8222007B2 (en) L-glutamic acid producing bacterium and a method for producing L-glutamic acid
AU783270B2 (en) Method for producing L-glutamic acid
AU1566102A (en) Method for producing L-glutamic acid
US7294491B2 (en) Method for producing L-glutamic acid
JP4665558B2 (ja) Ｌ−グルタミン酸生産微生物及びｌ−グルタミン酸の製造法
JP4292724B2 (ja) 有機態窒素含有組成物及びそれを含む肥料
JP3921866B2 (ja) Ｌ−グルタミン酸生産菌及びｌ−グルタミン酸の製造法
AU783280B2 (en) Method for producing L-glutamic acid
WO2005007847A1 (fr) Procede de production d'acide l-glutamique
JP2008029202A (ja) Ｌ−グルタミン酸の製造法
CN101506347B (zh) 产l-谷氨酸细菌和产生l-谷氨酸的方法
JP5407124B2 (ja) Ｌ−グルタミン酸生産細菌及びｌ−グルタミン酸の製造法
JP2006129840A (ja) Ｌ−グルタミン酸の製造法
AU2005200716B2 (en) Method for producing L-glutamic acid by fermentation accompanied by precipitation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP