WO2005007623A2 - Inhibition of syk kinase expression - Google Patents

Inhibition of syk kinase expression Download PDF

Info

Publication number
WO2005007623A2
WO2005007623A2 PCT/US2004/020990 US2004020990W WO2005007623A2 WO 2005007623 A2 WO2005007623 A2 WO 2005007623A2 US 2004020990 W US2004020990 W US 2004020990W WO 2005007623 A2 WO2005007623 A2 WO 2005007623A2
Authority
WO
WIPO (PCT)
Prior art keywords
sirna
cell
syk kinase
cells
nucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/020990
Other languages
English (en)
French (fr)
Other versions
WO2005007623A3 (en
WO2005007623A8 (en
Inventor
Alan D. Schreiber
Zena Indik
Moo-Kyung Kim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Pennsylvania Penn
Original Assignee
University of Pennsylvania Penn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Pennsylvania Penn filed Critical University of Pennsylvania Penn
Priority to AU2004257167A priority Critical patent/AU2004257167B2/en
Priority to CA002531069A priority patent/CA2531069A1/en
Priority to EP04756414A priority patent/EP1692153A4/en
Priority to HK07103911.3A priority patent/HK1096972B/xx
Priority to JP2006517793A priority patent/JP2007524397A/ja
Publication of WO2005007623A2 publication Critical patent/WO2005007623A2/en
Anticipated expiration legal-status Critical
Publication of WO2005007623A8 publication Critical patent/WO2005007623A8/en
Publication of WO2005007623A3 publication Critical patent/WO2005007623A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/10Drugs for disorders of the urinary system of the bladder
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/10Protein-tyrosine kinases (2.7.10)
    • C12Y207/10001Receptor protein-tyrosine kinase (2.7.10.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]

Definitions

  • the present invention relates, in general, to Syk kinase and, in particular, to a method of inhibiting Syk kinase expression using small interfering RNA (siRNA) .
  • siRNA small interfering RNA
  • Double stranded RNA has been shown to be a powerful agent for interfering with gene expression in a number of organisms, including C. elegans and Drosophila, as well as plants (Bernstein et al, RNA 7:1509-2151 (2001), McManus et al, Nat. Rev. Genet. 3:737-747 (2992), Hutvagner et al, Curr. Opin. Genet. Dev. 12:225-232 (2002), Za ore, Nat. Struct. Biol. 8:746-750 (2001) Tuschl et al, Genes Dev. 13:3191-3197 (1999)).
  • siRNAs can function well as gene silencing agents in mammalian cells (Elbashir et al, Nature 411:494-498 (2001), Elbashir et al, Genes Dev.
  • RNAi involves a multi-step process. Double stranded RNAs are cleaved by the endonuclease Dicer to generate 21-23 nucleotide fragments (siRNA) . The siRNA duplex is resolved into 2 single stranded RNAs, one strand being incorporated into a protein-containing complex where it functions as guide RNA to direct cleavage of the target RNA (Schwarz et al, Mol . Cell.
  • Anti-sense DNA has also been widely used to inhibit gene expression (Roth et al, Annu. Rev. Biomed. Eng. 1:265-297 (1999)). Once inside the cell, anti-sense oligonucleotides (ASO) recognize, then bind tightly to complementary mRNA, thus preventing the mRNA from interacting with the protein translation machinery of the cell.
  • ASO anti-sense oligonucleotides
  • siRNA is more potent and reliable than ASO as an inhibitor of gene expression.
  • the present invention results from studies designed to test the efficacy of siRNA as an inhibitor of Syk kinase expression.
  • the present invention relates generally to Syk kinase.
  • the invention relates to a method of inhibiting Syk kinase expression using small interfering RNA (siRNA) and to therapeutic strategies based on such a method.
  • siRNA small interfering RNA
  • each Syk kinase siRNA is the same sequence as the target sequence with the exception of the initial template adenine dimer and terminal overhang thymidine dimer .
  • the antisense strand of the siRNA is the reverse complement of the target sequence.
  • Figure 2. Expression of Syk kinase in RBL-2H3 cells transfected with siRNA targeted to Syk kinase mRNA. RBL-2H3 cells were transfected with siRNA-1 (Lane 2) , siRNA-2 (lane 3) or lipofectamine transfection control (Lane 1) . Proteins in cell lysates were separated by SDS-PAGE and transferred to nitrocellulose. Top panel, Syk kinase immunoblot; bottom panel, actin immunoblot.
  • FIG. 3 Expression of Syk kinase in human monocytes transfected with siRNA targeted to Syk kinase mRNA.
  • Monocytes were treated with siRNA (Lane 2) or lipofectamine transfection control (Lane 1) .
  • Proteins in cell lysates were separated by SDS- PAGE, transferred to nitrocellulose and immunoblotted with anti-Syk kinase antibody.
  • FIG. 1 Western blot analysis: Syk protein expression in HS-24 cells.
  • FIG. 5A HS-24 cells, following siRNA treatment, were lysed and equal amounts of total protein in HS-24 cell lysates were resolved by 10% SDS gel electrophoresis, and analyzed by Western blot using monoclonal antibody to Syk or actin.
  • Lane 1 - no treatment lane 2 - siRNA-1 (control) 24 h treatment, lane 3 - siRNA-1 48 h treatment, lane 4 - siRNA-2 24 h treatment, lane 5 - siRNA-2 48 h treatment.
  • FIG. 5B RNA was isolated and RT-PCR was performed for Syk and ⁇ - actin.
  • FIGS. 6A and 6B HS-24 cells plated on either polylysine coated plates (non stimulated, resting) or fibronectin coated plates (stimulated) were treated with siRNA-2, or siRNA-1 (control), or piceatannol. Cells were treated with 10 ng/ l of TNF during overnight culture.
  • Fig. 6A Following siRNA (48 h) or piceatannol (16 h) treatment, cells were removed, immunostained with anti-CD54 (ICAM-1) and analysed by flow cytometry.
  • FIG. 6B Cell culture supernatants were analysed for IL-6 release using an IL-6 ELISA kit.
  • FIGs 7A and 7B Effect of siRNA targeted to Syk kinase delivered via aerosol on total cell numbers in bronchoalveolar lavage (BAL) fluid of ovalbumin (OA) sensitized and challenged Brown Norway Rats after three treatments.
  • Fig. 7A provides data as bar graphs
  • Fig. 7B shows individual data points (individual animals) .
  • Figures 8A-8D Effect of siRNA targeted to Syk kinase delivered via aerosol on numbers of acrophages, neutrophils, lymphocytes and eosinophils in BAL fluid of OA sensitized and challenged Brown Norway rats after three treatments.
  • FIG. 8A provides data as bar graphs
  • Fig. 8B shows individual data points (individual animals) for macrophage numbers
  • Fig. 8C shows individual data points for neutrophil numbers
  • Fig. 8D shows individual data points for eosinophil numbers.
  • the present invention relates to RNA molecules that target Syk kinase mRNA.
  • the invention relates to RNA molecules about 19, 20 or 21 to about 23 nucleotides in length that direct cleavage and/or degradation of Syk kinase mRNA.
  • the present invention relates to the use of siRNA molecules, double stranded RNA molecules typically comprising two 20-23 nucleotide (nt) strands.
  • SiRNAs suitable for use in the invention can be produced using any of a variety of approaches. The siRNA can be prepared in vi tro and then introduced directly into cells (for example, by transfection) .
  • intracellular expression can be effected by transfecting into cells constructs (e.g., DNA-based vectors or cassettes) that express siRNA within cells.
  • siRNA suitable for use in the invention can be prepared, for example, via chemical synthesis, in vi tro transcription, enzymatic digestion of a longer dsRNA using an RNase III enzyme such as Dicer or RNase III, expression in cells from an siRNA expression plasmid or viral vector, or expression in cells from a PCR-derived siRNA expression cassette.
  • RNA 8 See also Sui et al, Proc Natl Acad Sci USA 99: 5515-20 (2002), Brummelkamp et al, Science 296:550-3 (2002), aul et al, Nature Biotechnology 20:505-8 (2002), Lee et al, Nature Biotechnology 20: 500-5 (2002), Castanotto et al, RNA 8: 1454-60 (2002) and US Appln. 20030108923.
  • Various approaches are available to enhance stability of RNA of the invention, (see, for example, U.S. Application Nos .
  • siRNA suitable for use in the invention can be prepared chemically.
  • 2 ' hydroxyls are protected during the synthetic process against degradation using, for example, acid labile orthoester protecting groups (see Scaringe et al, J. Am. Chem. Soc . 120:11820 (1998) and www.dharmacon.com (e.g., the ACE technology described therein) ) .
  • RNA oligo ers can be simultaneously 2 ' deprotected and annealed prior to use.
  • at least one strand of the double stranded molecule can have a 3 ' overhang from about 1 to about 6 nucleotides (e.g., pyrimidine and/or purine nucleotides) in length.
  • the 3 ' overhang is from about 1 to about 5 nucleotides (e.g., thymidines or uridines) , more preferably from about 1 to about 4 nucleotides and most preferably 2 or 3 nucleotides in length.
  • each strand has an overhang.
  • the length of the overhangs can be the same or different for each strand.
  • both strands have overhangs of the same length.
  • the RNA of the present invention comprises 21 or 22 nucleotide strands that are paired and that have overhangs of from about 1 to about 3, particularly, about 2, nucleotides on the 3 ' ends of both of the RNA strands .
  • siRNAs suitable for use in the invention can be prepared by enzymatic digestion of a longer dsRNA using an RNase III type enzyme (e.g., Dicer) .
  • Dicer an RNase III type enzyme
  • a commercially available Dicer siRNA generation kit can be used that permits generation of large numbers of siRNAs from full length target genes (Gene Therapy Systems, Inc, MV062603) .
  • SiRNA can be produced from target DNA and T7 RNA polymerase promoter sequences using PCR based cloning. Following RNA transcription from the target sequence, recombinant Dicer can cleave the transcribed RNAi into 22 bp siRNAs.
  • siRNA molecules suitable for use in the present invention can also be recombinantly produced using methods known in the art. (See references and web sites cited above.) Recombinant technology permits in vivo transcription of siRNAs in mammalian cells.
  • vectors can be used that contain, for example, RNA polymerase III or U6 promoter sequences.
  • Such vectors can be used as expression vectors or as shuttle vectors in conjunction with viral systems (e.g., adenoviral or retroviral systems) to introduce siRNA into mammalian cells.
  • Vectors can be engineered to express sense and anti-sense strands of siRNAs that anneal in vivo to produce functional siRNAs .
  • hairpin RNA can be expressed by inserting into a vector the sense strand (e.g., about 20 nt) of the target, followed by a short spacer (e.g., about 4 to about 10 nt) , then the antisense strand of the target (e.g., about 20 nt) and, for example, about 5-6 T's as transcription terminator.
  • the resulting RNA transcript folds back to form a stem-loop structure comprising, for example, about a 20 bp stem and about a 10 nt loop with 2-3 U's at the 3' end.
  • dsRNA can be used in the methods of the present invention provided it has sufficient homology to the targeted Syk kinase mRNA.
  • SiRNA duplexes can be designed, for example, by searching Syk kinase cDNA for the target motif "AA(N) ⁇ g", wherein N is any nucleotide, motifs with approximately 30% to 70% G/C content being preferred, those of about 50% G/C content being more preferred.
  • the sense strand of the siRNA duplex can correspond to nucleotides 3 to 21 of the selected AA(N) ⁇ 9 motif.
  • the antisense strand of the siRNA duplex can have a sequence complementary to nucleotides 1 to 21 of the selected AA(N)i 9 motif. Further design details are provided at http://www.mpibpc.gwdg.de/ en/100/105/sirna.html.
  • target sequences include sequences unique to Syk kinase mRNA.
  • target sequences can be selected from sequences between the two SH2 domains of Syk kinase or between the second SH2 domain and the kinase domain.
  • Certain specific DNA target sequences are described in the non- limiting Examples that follow. Additional targets include, but are not limited to, the following: *Sequence %GC Identified homologies of 16-18/19 nucleotides
  • siRNAs described herein can be used in a variety of ways.
  • the siRNA molecules can be used to target Syk kinase mRNA in a cell or organism.
  • the siRNA can be introduced into human cells or a human in order to mediate RNAi in the cells or in cells in the individual, so as to prevent or treat a disease or undesirable condition associated with Syk kinase expression (e.g., inflammation of the lungs, joints eyes or bladder) .
  • a disease or undesirable condition associated with Syk kinase expression e.g., inflammation of the lungs, joints eyes or bladder
  • the siRNA can also be used in the treatment of the immune destruction of blood cells, e.g., red blood cells in autoimmune hemolytic anemia and platelets in immune thrombocytopenic purpurea (ITP) (e.g., by targeting Syk kinase mRNA in acrophages and spleen and liver cells) .
  • ITP immune thrombocytopenic purpurea
  • the Syk kinase gene is targeted and the corresponding mRNA (the transcriptional product of the targeted Syk kinase gene) is degraded by RNAi .
  • an siRNA-containing composition can be aerosolized and administered, for example, via inhalation. Administration to joints can be effected by injection of an siRNA-containing solution.
  • Administration to the eyes can be effected, for example, by injection or by application of drops comprising the siRNA in a carrier.
  • Administration to the bladder, etc. can be effected, for example, by washing or irrigating the target tissue with a composition containing the siRNA.
  • Administration to the skin can be via topical administration (e.g., as a liquid, cream or gel) .
  • cells of an individual e.g., blood mononuclear cells, basophiles or mast cells
  • the cells to be treated can be obtained from the individual using known methods and the siRNAs that mediate degradation of the corresponding Syk kinase mRNA can be introduced into the cells, which can then be re-introduced into the individual .
  • the invention relates to the use of the above-described siRNAs to inhibit mediator (e.g., histamine) release from cells bearing an Fee receptor, such as mast cells. Inhibition of histamine (a mast cell mediator) release, for example, is of therapeutic importance in the treatment of asthma.
  • siRNAs (or constructs suitable for use in effecting intracellular production of siRNA) of the invention can be administered systemically (e.g., via IV) or directly to the target tissue (e.g., via aerosol administration to the lung) . Delivery can be effected using the techniques described herein (including liposome formulations) .
  • polymer formulations can be used.
  • Polyethylenimine (PEI) is an example of a suitable cationic polymer. Varying sizes of PEI can be used, including linear 22 kDa and branched 25 kDa PEI (other sizes, modified and unmodified, as well as biodegradable versions can be used) .
  • Delivery can also be effected using, for example, non-toxic viral delivery systems (e.g., an adeno-associated viral delivery system) .
  • non-toxic viral delivery systems e.g., an adeno-associated viral delivery system
  • Optimum dosing will depend on the patient, the siRNA, the mode of administration, and the effect sought. Optimum conditions can be established by one skilled in the art without undue experimentation. Certain aspects of the invention can be described in greater detail in the non-limiting Examples that follows. (See also US Applications 20030084471, 20030108923 and 20020086356. ) EXAMPLE 1
  • Lipofectamine 2000 and Opti-Mem were purchased from Invitrogen (San Diego, CA) .
  • Eagle's MEM (EMEM), FCS, penicillin, and streptomycin were purchased from Life Technologies (Grand Island, NY) .
  • Rabbit anti- urine Syk kinase polyclonal antibodies (Ab) and anti-actin Ab were purchased from Santa Cruz Biotechnology (Santa Cruz, CA) , and F(ab') 2 goat anti-rabbit Ab was supplied by The Jackson Laboratory (Bar Harbor, ME) .
  • Chemiluminescence reagent was purchased from DuPont NEN (Boston, MA) .
  • Rat basophilic cells were grown in EMEM supplemented with 17% FBS, 100 U penicillin, 100 ⁇ .g/m.1 streptomycin, and 4 mM glutamine at 37°C in 5% C0 2 .
  • siRNA duplex construction siRNAs for Syk kinase were prepared by Dharmacon Research Inc. (Lafayette, Co). In designing the siRNAs according to the guidelines provided by the manufacturer, potential siRNA targets (19 nucleotides immediately downstream of AA pairs) in human Syk kinase RNA were first identified. These sites were then scanned in the sequences of rat and mouse Syk kinase RNA in order to identify common Syk kinase RNA target sequences in these species.
  • siRNA-1 Human, bp 296 to bp 316; Mouse and Rat, bp 307 to bp 327. sense 5 ' - gaagcccuucaaccggccc dTdT 3 ' antisense 3 ' -dTdT cuucgggaaguuggccggg 5'
  • siRNA-2 Human, bp 364 to bp 382; Mouse and Rat, bp 375 to bp 393 sense 5 ' - ccucaucagggaauaucug dTdT 3 ' antisense 3'- dTdT ggaguagucccuuauagac 5'
  • SiRNA was introduced into RBL-2H3 cells and into monocytes by transfection.
  • 5 X 10 4 RBL-2H3 cells or 1 X 10 5 monocytes were seeded into each well of a 24-well plate. Twenty-four hours later, the complete medium was replaced with 400 ⁇ l fresh medium lacking serum and antibiotic and siRNA/Lipofectamine 2000 complex was added to each well.
  • the siRNA/Lipofectamine 2000 complex was formed by adding 3 ⁇ l of siRNA duplex (20 ⁇ M) and 3 ⁇ l of Lipofectamine 2000 to 100 ⁇ l Opti-mem without serum or antibiotic according to the manufacturer's protocol.
  • the siRNA/Lipofectamine 2000 complex was formed by adding 3 ⁇ l of siRNA duplex (20 ⁇ M) and l ⁇ l of Lipofectamine 2000 to 100 ⁇ l Opti-mem without serum or antibiotic. Cells were incubated at 37°C for 48 hours before examination of kinase protein expression by Western blotting .
  • Western blot analysis of Syk kinase protein Lysates were prepared by boiling cells in Laem li sample buffer (2% SDS, 10% glycerol, 100 mM DTT, and 60 mM Tris (pH 6.8) for 5 minutes.
  • Proteins in lysates were separated by SDS-PAGE (10% polyacrylamide) and transferred to a nitrocellulose membrane in sample buffer (25 mM Tris, 190 mM glycine, and 20% methanol) .
  • sample buffer 25 mM Tris, 190 mM glycine, and 20% methanol
  • the nitrocellulose membrane was incubated overnight at 4°C with I ⁇ g/ l rabbit anti-murine Syk kinsae polyclonal Ab before incubation with goat anti-rabbit HRP (1.5h at room temperature) . Protein bands on the membrane were visualized with chemiluminescence reagent according to the manufacturer's protocol.
  • the anti-Syk kinase Ab was removed by incubating the membrane in a stripping buffer containing 100 mM 2-ME, 2% SDS, and 62.5 mM Tris-HCL (pH 6.7) for 30 minutes at 50°C with occasional agitation. The membrane was then reprobed with anti-actin Ab and bands on the membrane were visualized with chemiluminescence reagent. Protein levels of Syk kinase were quantified by densitometry (Personal Densitometer, Molecular Dynamics) .
  • Syk kinase protein expression in siRNA-treated RBL cells was inhibited by 45-51% (Figure 2, lanes 2 and 3) compared to untreated RBL cells (lane 1) .
  • the magnitude of the inhibition of Syk kinase gene expression by siRNA in cultured cells was encouraging since previous experiments with Syk kinase mRNA ASO indicated that greater levels of Syk kinase inhibition can be achieved in non-multiplying cells such as monocytes than in multiplying cells cultured in vi tro .
  • Inhibition of Syk kinase expression by siRNA in monocytes maintained in culture ( Figure 3) was also observed.
  • Syk kinase expression in siRNA-treated monocytes was inhibited ( Figure 3, lane 2) .
  • siRNA duplexes can comprise 21-nucleotide sense and 21-nucleotide antisense strands, paired in a manner to have a 2-nucleotide (dT) 3 ' overhang .
  • the targeted region for siRNAs can be the sequence AA(N19) (N, any nucleotide) selected from the designated cDNA sequence beginning 50 to 100 nucleotides downstream of the start codon. G/C- contents of approximately 50% are preferred.
  • RNAs from pol III promoters are only efficient when the first transcribed nucleotide is a purine, it is preferred that the sense and antisense siRNAs begin with a purine nucleotide so that they can be expressed from pol III expression vectors without a change in targeting site.
  • potential siRNA targets in human Syk kinase mRNA were selected and then the sequences in rat and mouse Syk kinase mRNA were scanned in order to identify common Syk kinase mRNA target sequences in these species . Two appropriate target sequences were identified:
  • the target sequences and Syk kinase siRNAs are shown in Figure 1.
  • Duplexed RNA is not highly susceptible to nuclease degradation and the use of deoxynucleotides (thymidine (T) rather than uridine (U) ) may affect the stability of the 3' overhang.
  • HS-24 cells (2xl0 5 ) were pre-treated with 3 ⁇ l of siRNA-1 (control) DNA Target: 5' AAGAAGCCCTTCAACCGGCCC
  • DNA Target 5 ' AACCTCATCAGGGAATATCTG sense 5 ' - ccucaucagggaauaucug dTdT 3 ' antisense 3 ' -dTdT ggaguagucccuuauagac 5 '
  • IL-6 in culture supernatant (ELISA) and cell surface expression of ICAM-1 (Flow cyto etry) .
  • ELISA culture supernatant
  • ICAM-1 Flow cyto etry
  • HS-24 cells constitutively expressed low levels of ICAM-1 (Fig. 6A) not affected by siRNA-2 treatment (not shown) .
  • Stimulation of HS-24 cells with 10 ng/ml of TNF during overnight culture caused significant increase in ICAM-1 expression both in resting cells (plated on poly-L-lysine) and cells adherent to fibronectin (Fig. 6A) .
  • Cells adherent to fibronectin showed higher expression of ICAM-1 following stimulation with TNF compared to cells adherent to poly-L-lysine (P ⁇ 0.05).
  • IL-6 release by HS-24 cells without TNF stimulation was minimal, there was a trend to higher IL-6 levels in culture supernatants of cells adherent to fibronectin (Fig. 6B) .
  • a great elevation of IL-6 levels was observed following TNF stimulation in both culture conditions, with higher levels in fibronectin- adherent cells (P ⁇ 0.05).
  • SiRNA-2 treatment caused down-regulation of IL-6 release (55-58%) that reached statistical significance in fibronectin- adherent culture (P ⁇ 0.05).
  • Piceatannol almost completely inhibited TNF-induced IL-6 release (Fig. 6B) .
  • siRNA 2M refers to the above, modified by Dharmacon to provide additional stability.
  • SiRNA was used alone without liposome or was used after formation of siRNA/liposome complexes.
  • 1, 2 Dioleoyl-3-trimethylammonium-propane (DOTAP) /dioleoyl-phosphatidyl-ethanol-amine (DOPE) liposomes were prepared as previously described (see Stenton et al, J. Immunol. 169:1028 (2002) and references cited therein) .
  • DOTAP Dioleoyl-3-trimethylammonium-propane
  • DOPE dioleoyl-phosphatidyl-ethanol-amine
  • Cationic DOTAP DOPE liposomes were incubated at a 2.5:1 ratio of the liposome to the siRNA and 125 micrograms of siRNA (with or without liposomes) was administered by- aerosol following nebulization.
  • the aerosolized administration of Syk kinase- targeted siRNA was as described by Stenton et al, J. Immunol. 164:3790 (2000).
  • Nine milliters of saline, siRNA or siRNA/liposome were administered per rat by nebulization for 45 min using a Sidestream nebulizer as described in Stenton et al, J. Immunol. 169:1028 (2002) .
  • BAL Bronchoalveolar lavage

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Diabetes (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Ophthalmology & Optometry (AREA)
  • Pulmonology (AREA)
  • Dermatology (AREA)
  • Urology & Nephrology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
PCT/US2004/020990 2003-07-03 2004-07-01 Inhibition of syk kinase expression Ceased WO2005007623A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2004257167A AU2004257167B2 (en) 2003-07-03 2004-07-01 Inhibition of Syk kinase expression
CA002531069A CA2531069A1 (en) 2003-07-03 2004-07-01 Inhibition of syk kinase expression
EP04756414A EP1692153A4 (en) 2003-07-03 2004-07-01 INHIBITION OF EXPRESSION OF SYK-KINASE
HK07103911.3A HK1096972B (en) 2003-07-03 2004-07-01 Inhibition of syk kinase expression
JP2006517793A JP2007524397A (ja) 2003-07-03 2004-07-01 Sykキナーゼ発現の阻害

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US48429903P 2003-07-03 2003-07-03
US60/484,299 2003-07-03

Publications (3)

Publication Number Publication Date
WO2005007623A2 true WO2005007623A2 (en) 2005-01-27
WO2005007623A8 WO2005007623A8 (en) 2006-03-23
WO2005007623A3 WO2005007623A3 (en) 2006-05-18

Family

ID=34079054

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/020990 Ceased WO2005007623A2 (en) 2003-07-03 2004-07-01 Inhibition of syk kinase expression

Country Status (7)

Country Link
US (3) US7173015B2 (https=)
EP (2) EP2371835A1 (https=)
JP (2) JP2007524397A (https=)
CN (2) CN100577680C (https=)
AU (1) AU2004257167B2 (https=)
CA (1) CA2531069A1 (https=)
WO (1) WO2005007623A2 (https=)

Cited By (128)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005049838A3 (en) * 2003-11-14 2005-10-06 Univ Yale Syk-targeted nucleic acid interference
CN101443020A (zh) * 2006-04-13 2009-05-27 爱尔康研究有限公司 RNAi介导的脾酪氨酸激酶相关炎性病症的抑制
EP2152316A4 (en) * 2007-04-26 2011-03-23 Quark Pharmaceuticals Inc THERAPEUTIC DELIVERY OF INHIBITORY NUCLEIC ACID MOLECULES IN THE RESPIRATORY SYSTEM
WO2015131080A1 (en) 2014-02-28 2015-09-03 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
WO2016138352A1 (en) 2015-02-27 2016-09-01 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
WO2017004134A1 (en) 2015-06-29 2017-01-05 Nimbus Iris, Inc. Irak inhibitors and uses thereof
WO2017040757A1 (en) 2015-09-02 2017-03-09 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
WO2017070518A1 (en) 2015-10-23 2017-04-27 Navitor Pharmaceuticals, Inc. Modulators of sestrin-gator2 interaction and uses thereof
WO2017106352A1 (en) 2015-12-14 2017-06-22 Raze Therapeutics, Inc. Caffeine inhibitors of mthfd2 and uses thereof
WO2017156179A1 (en) 2016-03-09 2017-09-14 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
WO2017223239A1 (en) 2016-06-21 2017-12-28 X4 Pharmaceuticals, Inc. Cxcr4 inhibitors and uses thereof
WO2018071794A1 (en) 2016-10-14 2018-04-19 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
WO2018075937A1 (en) 2016-10-21 2018-04-26 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
WO2018127699A1 (en) 2017-01-06 2018-07-12 Bicyclerd Limited Compounds for treating cancer
WO2018165240A1 (en) 2017-03-08 2018-09-13 Nimbus Lakshmi, Inc. Tyk2 inhibitors, uses, and methods for production thereof
WO2018197893A1 (en) 2017-04-27 2018-11-01 Bicycletx Limited Bicyclic peptide ligands and uses thereof
WO2019002842A1 (en) 2017-06-26 2019-01-03 Bicyclerd Limited BICYCLIC PEPTIDE LIGANDS WITH DETECTABLE FRACTIONS AND USES THEREOF
WO2019034866A1 (en) 2017-08-14 2019-02-21 Bicyclerd Limited BICYCLIC PEPTIDE LIGANDS CONJUGATES AND USES THEREOF
WO2019034868A1 (en) 2017-08-14 2019-02-21 Bicyclerd Limited CONJUGATES PEPTIDE BICYCLIC-LIGAND PPR-A AND USES THEREOF
WO2019046491A1 (en) 2017-08-29 2019-03-07 Ariya Therapeutics, Inc. LIPIDIC PRODRUGS DIRECTING TO THE LYMPHATIC SYSTEM
WO2019126378A1 (en) 2017-12-19 2019-06-27 Ariya Therapeutics, Inc. Lipid prodrugs of mycophenolic acid and uses thereof
WO2019148132A1 (en) 2018-01-29 2019-08-01 Merck Patent Gmbh Gcn2 inhibitors and uses thereof
WO2019169001A1 (en) 2018-02-27 2019-09-06 Artax Biopharma Inc. Chromene derivatives as inhibitors of tcr-nck interaction
US10414727B2 (en) 2016-11-08 2019-09-17 Navitor Pharmaceuticals, Inc. Phenyl amino piperidine mTORC inhibitors and uses thereof
WO2019209757A1 (en) 2018-04-24 2019-10-31 Vertex Pharmaceuticals Incorporated Pteridinone compounds and uses thereof
WO2019209759A1 (en) 2018-04-24 2019-10-31 Merck Patent Gmbh Antiproliferation compounds and uses thereof
US10508120B2 (en) 2017-07-28 2019-12-17 Nimbus Lakshimi, Inc. TYK2 inhibitors and uses thereof
WO2019241789A1 (en) 2018-06-15 2019-12-19 Navitor Pharmaceuticals, Inc. Rapamycin analogs and uses thereof
WO2019243833A1 (en) 2018-06-22 2019-12-26 Bicycletx Limited Bicyclic peptide ligands specific for nectin-4
WO2020010177A1 (en) 2018-07-06 2020-01-09 Kymera Therapeutics, Inc. Tricyclic crbn ligands and uses thereof
WO2020051424A1 (en) 2018-09-07 2020-03-12 Pic Therapeutics Eif4e inhibitors and uses thereof
WO2020084305A1 (en) 2018-10-23 2020-04-30 Bicycletx Limited Bicyclic peptide ligands and uses thereof
WO2020112937A1 (en) 2018-11-30 2020-06-04 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
US10683308B2 (en) 2015-09-11 2020-06-16 Navitor Pharmaceuticals, Inc. Rapamycin analogs and uses thereof
EP3670659A1 (en) 2018-12-20 2020-06-24 Abivax Biomarkers, and uses in treatment of viral infections, inflammations, or cancer
WO2020165600A1 (en) 2019-02-14 2020-08-20 Bicycletx Limited Bicyclic peptide ligand sting conjugates and uses thereof
US10793563B2 (en) 2018-01-29 2020-10-06 Merck Patent Gmbh GCN2 inhibitors and uses thereof
WO2020201753A1 (en) 2019-04-02 2020-10-08 Bicycletx Limited Bicycle toxin conjugates and uses thereof
WO2020243423A1 (en) 2019-05-31 2020-12-03 Ikena Oncology, Inc. Tead inhibitors and uses thereof
US10874743B2 (en) 2017-12-26 2020-12-29 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
WO2021050964A1 (en) 2019-09-13 2021-03-18 Nimbus Saturn, Inc. Hpk1 antagonists and uses thereof
US10954220B2 (en) 2016-03-09 2021-03-23 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
US10988465B2 (en) 2016-06-21 2021-04-27 X4 Pharmaceuticals, Inc. CXCR4 inhibitors and uses thereof
US11045461B2 (en) 2018-08-31 2021-06-29 X4 Pharmaceuticals, Inc. Compositions of CXCR4 inhibitors and methods of preparation and use
WO2021133920A1 (en) 2019-12-23 2021-07-01 Kymera Therapeutics, Inc. Smarca degraders and uses thereof
US11091451B2 (en) 2016-12-05 2021-08-17 Raze Therapeutics, Inc. SHMT inhibitors and uses thereof
WO2021178488A1 (en) 2020-03-03 2021-09-10 PIC Therapeutics, Inc. Eif4e inhibitors and uses thereof
US11117889B1 (en) 2018-11-30 2021-09-14 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
WO2021188948A1 (en) 2020-03-19 2021-09-23 Kymera Therapeutics, Inc. Mdm2 degraders and uses thereof
US11174264B2 (en) 2019-01-23 2021-11-16 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
WO2021247897A1 (en) 2020-06-03 2021-12-09 Kymera Therapeutics, Inc. Deuterated irak degraders and uses thereof
WO2022038158A1 (en) 2020-08-17 2022-02-24 Bicycletx Limited Bicycle conjugates specific for nectin-4 and uses thereof
US11304954B2 (en) 2017-12-19 2022-04-19 Puretech Lyt, Inc. Lipid prodrugs of mycophenolic acid and uses thereof
US11311512B2 (en) 2014-08-12 2022-04-26 Monash University Lymph directing prodrugs
US11332470B2 (en) 2016-06-21 2022-05-17 X4 Pharmaceuticals, Inc. CXCR4 inhibitors and uses thereof
US11339144B2 (en) 2017-04-10 2022-05-24 Navitor Pharmaceuticals, Inc. Heteroaryl Rheb inhibitors and uses thereof
US11337969B2 (en) 2016-04-08 2022-05-24 X4 Pharmaceuticals, Inc. Methods for treating cancer
US11345654B2 (en) 2018-10-24 2022-05-31 Navitor Pharmaceuticals, Inc. Polymorphic compounds and uses thereof
WO2022120354A1 (en) 2020-12-02 2022-06-09 Ikena Oncology, Inc. Tead inhibitors and uses thereof
WO2022120353A1 (en) 2020-12-02 2022-06-09 Ikena Oncology, Inc. Tead inhibitors and uses thereof
US11358948B2 (en) 2017-09-22 2022-06-14 Kymera Therapeutics, Inc. CRBN ligands and uses thereof
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
WO2022167457A1 (en) 2021-02-02 2022-08-11 Liminal Biosciences Limited Gpr84 antagonists and uses thereof
WO2022167445A1 (en) 2021-02-02 2022-08-11 Liminal Biosciences Limited Gpr84 antagonists and uses thereof
US11414431B2 (en) 2018-10-15 2022-08-16 Nimbus Lakshmi, Inc. Substituted pyrazolo[1,5-a]pyrimidines as TYK2 inhibitors
US11434239B2 (en) 2017-03-14 2022-09-06 Artax Biopharma Inc. Aza-dihydro-acridone derivatives
WO2022221866A1 (en) 2021-04-16 2022-10-20 Ikena Oncology, Inc. Mek inhibitors and uses thereof
US11485750B1 (en) 2019-04-05 2022-11-01 Kymera Therapeutics, Inc. STAT degraders and uses thereof
US11485743B2 (en) 2018-01-12 2022-11-01 Kymera Therapeutics, Inc. Protein degraders and uses thereof
US11505526B2 (en) 2017-03-14 2022-11-22 Artax Biopharma Inc. Aryl-piperidine derivatives
US11512080B2 (en) 2018-01-12 2022-11-29 Kymera Therapeutics, Inc. CRBN ligands and uses thereof
US11591332B2 (en) 2019-12-17 2023-02-28 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
WO2023028235A1 (en) 2021-08-25 2023-03-02 PIC Therapeutics, Inc. Eif4e inhibitors and uses thereof
WO2023028238A1 (en) 2021-08-25 2023-03-02 PIC Therapeutics, Inc. Eif4e inhibitors and uses thereof
US11608345B1 (en) 2017-12-19 2023-03-21 Puretech Lyt, Inc. Lipid prodrugs of rapamycin and its analogs and uses thereof
US11623012B2 (en) 2017-12-19 2023-04-11 Bicyclerd Limited Bicyclic peptide ligands specific for EphA2
US11623932B2 (en) 2017-09-22 2023-04-11 Kymera Therapeutics, Inc. Protein degraders and uses thereof
US11679090B2 (en) 2017-04-26 2023-06-20 Navitor Pharmaceuticals, Inc. Modulators of Sestrin-GATOR2 interaction and uses thereof
WO2023114984A1 (en) 2021-12-17 2023-06-22 Ikena Oncology, Inc. Tead inhibitors and uses thereof
US11685750B2 (en) 2020-06-03 2023-06-27 Kymera Therapeutics, Inc. Crystalline forms of IRAK degraders
US11707457B2 (en) 2019-12-17 2023-07-25 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US11723890B2 (en) 2019-11-01 2023-08-15 Navitor Pharmaceuticals, Inc. Methods of treatment using an mTORC1 modulator
US11730819B2 (en) 2016-12-23 2023-08-22 Bicycletx Limited Peptide derivatives having novel linkage structures
US11738087B2 (en) 2015-09-08 2023-08-29 Monash University Lymph directing prodrugs
WO2023173053A1 (en) 2022-03-10 2023-09-14 Ikena Oncology, Inc. Mek inhibitors and uses thereof
WO2023173057A1 (en) 2022-03-10 2023-09-14 Ikena Oncology, Inc. Mek inhibitors and uses thereof
US11773103B2 (en) 2021-02-15 2023-10-03 Kymera Therapeutics, Inc. IRAK4 degraders and uses thereof
WO2023211889A1 (en) 2022-04-25 2023-11-02 Ikena Oncology, Inc. Polymorphic compounds and uses thereof
US11814447B2 (en) 2018-06-22 2023-11-14 Bicyclerd Limited Peptide ligands for binding to EphA2
US11819476B2 (en) 2019-12-05 2023-11-21 Janssen Pharmaceutica Nv Rapamycin analogs and uses thereof
WO2023230205A1 (en) 2022-05-25 2023-11-30 Ikena Oncology, Inc. Mek inhibitors and uses thereof
US11833211B2 (en) 2017-12-19 2023-12-05 Bicycletx Limited Methods of suppression and treatment of disease comprising administering bicycle peptide ligands specific for EphA2
US11845724B2 (en) 2019-09-11 2023-12-19 Vincere Biosciences, Inc. USP30 inhibitors and uses thereof
US11883497B2 (en) 2017-08-29 2024-01-30 Puretech Lyt, Inc. Lymphatic system-directing lipid prodrugs
WO2024028364A1 (en) 2022-08-02 2024-02-08 Liminal Biosciences Limited Aryl-triazolyl and related gpr84 antagonists and uses thereof
WO2024028363A1 (en) 2022-08-02 2024-02-08 Liminal Biosciences Limited Heteroaryl carboxamide and related gpr84 antagonists and uses thereof
WO2024028365A1 (en) 2022-08-02 2024-02-08 Liminal Biosciences Limited Substituted pyridone gpr84 antagonists and uses thereof
US11926625B2 (en) 2021-03-05 2024-03-12 Nimbus Saturn, Inc. HPK1 antagonists and uses thereof
US11970553B2 (en) 2019-07-30 2024-04-30 Bicycletx Limited Heterotandem bicyclic peptide complex
US11975073B2 (en) 2020-02-05 2024-05-07 Puretech Lyt, Inc. Lipid prodrugs of neurosteroids
WO2024112894A1 (en) 2022-11-22 2024-05-30 PIC Therapeutics, Inc. Eif4e inhibitors and uses thereof
US12049520B2 (en) 2017-08-04 2024-07-30 Bicycletx Limited Bicyclic peptide ligands specific for CD137
US12071442B2 (en) 2021-03-29 2024-08-27 Nimbus Saturn, Inc. Substituted pyrrolo[3,4-c]pyridines as HPK1 antagonists
US12091411B2 (en) 2022-01-31 2024-09-17 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12097261B2 (en) 2021-05-07 2024-09-24 Kymera Therapeutics, Inc. CDK2 degraders and uses thereof
US12150995B2 (en) 2020-12-30 2024-11-26 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12171768B2 (en) 2021-02-15 2024-12-24 Kymera Therapeutics, Inc. IRAK4 degraders and uses thereof
US12187744B2 (en) 2021-10-29 2025-01-07 Kymera Therapeutics, Inc. IRAK4 degraders and synthesis thereof
US12252488B2 (en) 2021-02-12 2025-03-18 Nimbus Saturn, Inc. HPK1 antagonists and uses thereof
WO2025062372A1 (en) 2023-09-21 2025-03-27 Takeda Pharmaceutical Company Limited Tyk2 inhibitors for use in the treatment of inflammatory bowel disease
US12318454B2 (en) 2014-10-29 2025-06-03 Bicyclerd Limited Bicyclic peptide ligands specific for MT1-MMP
US12325697B2 (en) 2021-04-09 2025-06-10 Nimbus Clio, Inc. CBL-B modulators and uses thereof
US12331046B2 (en) 2020-10-23 2025-06-17 Nimbus Clotho, Inc. CTPS1 inhibitors and uses thereof
US12350343B2 (en) 2018-12-13 2025-07-08 Bicycletx Limited Bicyclic peptide ligands specific for MT1-MMP
US12378288B2 (en) 2018-02-23 2025-08-05 Bicycletx Limited Multimeric bicyclic peptide ligands
US12377155B2 (en) 2018-12-13 2025-08-05 Bicyclerd Limited Bicyclic peptide ligands specific for PSMA
EP4620470A2 (en) 2023-06-23 2025-09-24 Kymera Therapeutics, Inc. Irak degraders and uses thereof
US12454520B2 (en) 2018-07-06 2025-10-28 Kymera Therapeutics, Inc. Protein degraders and uses thereof
US12492224B2 (en) 2018-12-21 2025-12-09 Bicycletx Limited Bicyclic peptide ligands specific for PD-L1
US12491253B2 (en) 2018-12-13 2025-12-09 Bicyclerd Limited Bicyclic peptide ligands specific for MT1-MMP
US12521438B2 (en) 2019-06-10 2026-01-13 Kymera Therapeutics, Inc. SMARCA degraders and uses thereof
US12540161B2 (en) 2020-08-03 2026-02-03 Bicycletx Limited Linkers
US12545659B2 (en) 2019-06-28 2026-02-10 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12551567B2 (en) 2018-12-21 2026-02-17 Bicyclerd Limited Bicyclic peptide ligands specific for PD-L1
US12551564B2 (en) 2019-12-10 2026-02-17 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12558427B2 (en) 2019-07-17 2026-02-24 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12569485B2 (en) 2019-12-23 2026-03-10 Kymera Therapeutics, Inc. SMARCA inhibitors and uses thereof
US12606568B2 (en) 2020-12-09 2026-04-21 Kymera Therapeutics, Inc. SMARCA degraders and uses thereof

Families Citing this family (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2001253408C1 (en) * 2000-04-13 2008-12-04 Mervyn Merrilees Therapeutic compounds and methods for formulating V3, A Versican Isoform
US20060160759A1 (en) * 2002-09-28 2006-07-20 Jianzhu Chen Influenza therapeutic
WO2006023491A2 (en) 2004-08-16 2006-03-02 The Cbr Institute For Biomedical Research, Inc. Method of delivering rna interference and uses thereof
NZ556097A (en) * 2005-01-07 2009-12-24 Alnylam Pharmaceuticals Inc Rnai modulation of RSV and therapeutic uses thereof
US20090203055A1 (en) * 2005-04-18 2009-08-13 Massachusetts Institute Of Technology Compositions and methods for RNA interference with sialidase expression and uses thereof
US20080139531A1 (en) * 2006-12-04 2008-06-12 Alcon Manufacturing Ltd. Use of connective tissue mast cell stabilizers to facilitate ocular surface re-epithelization and wound repair
TW200902025A (en) * 2007-04-11 2009-01-16 Alcon Res Ltd Use of an inhibitor of TNF α plus an antihistamine to treat allergic rhinitis and allergic conjunctivitis
WO2009033027A2 (en) * 2007-09-05 2009-03-12 Medtronic, Inc. Suppression of scn9a gene expression and/or function for the treatment of pain
WO2009061368A1 (en) * 2007-11-06 2009-05-14 Benaroya Research Institute Inhibition of versican with sirna and other molecules
AU2008334948B2 (en) * 2007-12-13 2014-11-20 Alnylam Pharmaceuticals, Inc. Methods and compositions for prevention or treatment of RSV infection
US8691971B2 (en) 2008-09-23 2014-04-08 Scott G. Petersen Self delivering bio-labile phosphate protected pro-oligos for oligonucleotide based therapeutics and mediating RNA interference
US20100168205A1 (en) * 2008-10-23 2010-07-01 Alnylam Pharmaceuticals, Inc. Methods and Compositions for Prevention or Treatment of RSV Infection Using Modified Duplex RNA Molecules
US20110082145A1 (en) * 2009-10-01 2011-04-07 Alcon Research, Ltd. Olopatadine compositions and uses thereof
CA2789276A1 (en) * 2010-02-09 2011-08-18 Drexel University New signaling molecule involved in ultraviolet damage to skin
KR101223483B1 (ko) * 2010-09-10 2013-01-17 한국과학기술연구원 전하결합 및 생분해성 공유결합으로 동시에 연결된 고분자―siRNA 나노입자 전달체
CN103328038A (zh) 2010-12-01 2013-09-25 史拜诺莫度雷森公司 向神经解剖结构直接递送药剂
EP2914296B2 (en) 2012-11-01 2021-09-29 Infinity Pharmaceuticals, Inc. Treatment of cancers using pi3 kinase isoform modulators
US20160024051A1 (en) 2013-03-15 2016-01-28 Infinity Pharmaceuticals, Inc. Salts and solid forms of isoquinolinones and composition comprising and methods of using the same
SG11201509842SA (en) 2013-05-30 2015-12-30 Infinity Pharmaceuticals Inc Treatment of cancers using pi3 kinase isoform modulators
TW201536329A (zh) 2013-08-09 2015-10-01 Isis Pharmaceuticals Inc 用於調節失養性肌強直蛋白質激酶(dmpk)表現之化合物及方法
MX2021012208A (es) 2013-10-04 2023-01-19 Infinity Pharmaceuticals Inc Compuestos heterocíclicos y usos de los mismos.
WO2015051241A1 (en) 2013-10-04 2015-04-09 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
WO2015061204A1 (en) 2013-10-21 2015-04-30 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
NZ724368A (en) 2014-03-19 2023-07-28 Infinity Pharmaceuticals Inc Heterocyclic compounds for use in the treatment of pi3k-gamma mediated disorders
US20150320754A1 (en) 2014-04-16 2015-11-12 Infinity Pharmaceuticals, Inc. Combination therapies
CA2983796A1 (en) * 2014-04-25 2015-10-29 The Brigham And Women's Hospital, Inc. Compositions and methods for treating subjects with immune-mediated diseases
WO2016054491A1 (en) 2014-10-03 2016-04-07 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
EP4585268A3 (en) 2015-09-14 2025-10-15 Twelve Therapeutics, Inc. Solid forms of isoquinolinone derivatives, process of making, compositions comprising, and methods of using the same
WO2017214269A1 (en) 2016-06-08 2017-12-14 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
RU2754507C2 (ru) 2016-06-24 2021-09-02 Инфинити Фармасьютикалз, Инк. Комбинированная терапия
AU2021262835A1 (en) 2020-04-30 2022-11-24 Fibrobiologics, Inc. Immunotherapeutic methods and compositions for targeting cancer fibroblasts
US12605387B2 (en) 2020-07-24 2026-04-21 Secura Bio, Inc. Treatment of cancers using PI3 kinase isoform modulators
EP4396352A4 (en) 2021-09-01 2025-10-01 Ionis Pharmaceuticals Inc COMPOUNDS AND METHODS FOR REDUCING DMPK EXPRESSION

Family Cites Families (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE151467T1 (de) 1987-11-30 1997-04-15 Univ Iowa Res Found Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene
US5256555A (en) 1991-12-20 1993-10-26 Ambion, Inc. Compositions and methods for increasing the yields of in vitro RNA transcription and other polynucleotide synthetic reactions
US5858981A (en) * 1993-09-30 1999-01-12 University Of Pennsylvania Method of inhibiting phagocytosis
US5939262A (en) 1996-07-03 1999-08-17 Ambion, Inc. Ribonuclease resistant RNA preparation and utilization
US6057134A (en) 1996-10-07 2000-05-02 Ambion, Inc. Modulating the efficiency of nucleic acid amplification reactions with 3' modified oligonucleotides
US6111086A (en) 1998-02-27 2000-08-29 Scaringe; Stephen A. Orthoester protecting groups
US20030084471A1 (en) 2000-03-16 2003-05-01 David Beach Methods and compositions for RNA interference
EP1272630A2 (en) * 2000-03-16 2003-01-08 Genetica, Inc. Methods and compositions for rna interference
PT1309726E (pt) 2000-03-30 2010-03-08 Whitehead Biomedical Inst Mediadores de interferência por rna específicos de sequência de rna
US20040259247A1 (en) * 2000-12-01 2004-12-23 Thomas Tuschl Rna interference mediating small rna molecules
CA2447360A1 (en) * 2001-05-09 2002-11-14 Alk-Abello A/S Pharmaceutical compositions for preventing or treating th1 and th2 cell related diseases by modulating the th1/th2 ratio.
AU2002365421A1 (en) 2001-07-10 2003-09-02 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for detecting the activation state of the multiple proteins in single cells
US7381535B2 (en) 2002-07-10 2008-06-03 The Board Of Trustees Of The Leland Stanford Junior Methods and compositions for detecting receptor-ligand interactions in single cells
WO2003029277A2 (en) * 2001-10-03 2003-04-10 Rigel Pharmaceuticals, Inc. Modulators of lymphocyte activation and migration
US7308364B2 (en) 2001-11-07 2007-12-11 The University Of Arkansas For Medical Sciences Diagnosis of multiple myeloma on gene expression profiling
US7894992B2 (en) 2001-11-07 2011-02-22 Board Of Trustees Of The University Of Arkansas Diagnosis and classification of multiple myeloma
US7371736B2 (en) 2001-11-07 2008-05-13 The Board Of Trustees Of The University Of Arkansas Gene expression profiling based identification of DKK1 as a potential therapeutic targets for controlling bone loss
US20060141493A1 (en) 2001-11-09 2006-06-29 Duke University Office Of Science And Technology Atherosclerotic phenotype determinative genes and methods for using the same
US20040018522A1 (en) 2002-05-09 2004-01-29 Brigham And Women's Hospital, Inc. Identification of dysregulated genes in patients with multiple sclerosis
US20040028685A1 (en) 2002-05-10 2004-02-12 Kinch Michael S. EphA2 monoclonal antibodies and methods of use thereof
US7192752B2 (en) 2002-12-20 2007-03-20 Acea Biosciences Real time electronic cell sensing systems and applications for cell-based assays
EP2305812A3 (en) 2002-11-14 2012-06-06 Dharmacon, Inc. Fuctional and hyperfunctional sirna
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
WO2004052364A1 (en) * 2002-12-06 2004-06-24 The Trustees Of Boston University METHODS FOR SUSTAINING eNOS ACTIVITY
CA2511816A1 (en) 2002-12-26 2004-07-22 Cemines, Inc. Methods and compositions for the diagnosis, prognosis, and treatment of cancer
US20060150262A1 (en) 2003-02-05 2006-07-06 Jadwiga Bienkowska Novel mucin-like polypeptides
US20050147593A1 (en) 2003-05-22 2005-07-07 Medimmune, Inc. EphA2, EphA4 and LMW-PTP and methods of treatment of hyperproliferative cell disorders
WO2005049838A2 (en) 2003-11-14 2005-06-02 Yale University Syk-targeted nucleic acid interference
US20050153923A1 (en) 2003-12-04 2005-07-14 Kinch Michael S. Targeted drug delivery using EphA2 or EphA4 binding moieties
US20060058255A1 (en) 2004-03-01 2006-03-16 Jianzhu Chen RNAi-based therapeutics for allergic rhinitis and asthma

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1692153A4 *

Cited By (249)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005049838A3 (en) * 2003-11-14 2005-10-06 Univ Yale Syk-targeted nucleic acid interference
US7368559B2 (en) 2003-11-14 2008-05-06 Diana Beardsley FcγRIIA-specific nucleic acid interference
US8048863B2 (en) 2006-04-13 2011-11-01 Alcon Research, Ltd. RNAi-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions
JP2009533475A (ja) * 2006-04-13 2009-09-17 アルコン リサーチ, リミテッド 脾臓チロシンキナーゼ関連する炎症状態のrnaiを介した阻害
EP2004240A4 (en) * 2006-04-13 2010-12-15 Alcon Res Ltd INHIBITION IN RNAI MEDIATION OF INFLAMMATORY CONDITIONS RELATED TO RATE TYROSINE KINASE
EP3156486A2 (en) 2006-04-13 2017-04-19 Arrowhead Research Corporation Rnai-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions
AU2007238027B2 (en) * 2006-04-13 2013-08-15 Arrowhead Research Corporation RNAi-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions
EP2662446A2 (en) 2006-04-13 2013-11-13 Alcon Research, Ltd. RNAi-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions
EP2662446A3 (en) * 2006-04-13 2014-04-02 Alcon Research, Ltd. RNAi-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions
US8865671B2 (en) 2006-04-13 2014-10-21 Alcon Research, Ltd. RNAi-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions
CN101443020A (zh) * 2006-04-13 2009-05-27 爱尔康研究有限公司 RNAi介导的脾酪氨酸激酶相关炎性病症的抑制
US9371529B2 (en) 2006-04-13 2016-06-21 Arrowhead Research Corporation RNAi-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions
EP3156486A3 (en) * 2006-04-13 2017-07-12 Arrowhead Research Corporation Rnai-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions
EP2152316A4 (en) * 2007-04-26 2011-03-23 Quark Pharmaceuticals Inc THERAPEUTIC DELIVERY OF INHIBITORY NUCLEIC ACID MOLECULES IN THE RESPIRATORY SYSTEM
EP4019518A1 (en) 2014-02-28 2022-06-29 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
WO2015131080A1 (en) 2014-02-28 2015-09-03 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
US11311512B2 (en) 2014-08-12 2022-04-26 Monash University Lymph directing prodrugs
US12318454B2 (en) 2014-10-29 2025-06-03 Bicyclerd Limited Bicyclic peptide ligands specific for MT1-MMP
WO2016138352A1 (en) 2015-02-27 2016-09-01 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
US10968236B2 (en) 2015-02-27 2021-04-06 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
US10253046B2 (en) 2015-02-27 2019-04-09 Nimbus Lakshmi TYK2 inhibitors and uses thereof
WO2017004134A1 (en) 2015-06-29 2017-01-05 Nimbus Iris, Inc. Irak inhibitors and uses thereof
US10781204B2 (en) 2015-09-02 2020-09-22 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
US11434240B2 (en) 2015-09-02 2022-09-06 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
WO2017040757A1 (en) 2015-09-02 2017-03-09 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
US10023571B2 (en) 2015-09-02 2018-07-17 Nimbus Lakshimi, Inc. TYK2 inhibitors and uses thereof
EP4327809A2 (en) 2015-09-02 2024-02-28 Takeda Pharmaceutical Company Limited Tyk2 inhibitors and uses thereof
US11738087B2 (en) 2015-09-08 2023-08-29 Monash University Lymph directing prodrugs
US10683308B2 (en) 2015-09-11 2020-06-16 Navitor Pharmaceuticals, Inc. Rapamycin analogs and uses thereof
EP4112611A2 (en) 2015-10-23 2023-01-04 Navitor Pharmaceuticals, Inc. Modulators of sestrin-gator2 interaction and uses thereof
US12378263B2 (en) 2015-10-23 2025-08-05 Navitor Pharmaceuticals, Inc. Modulators of sestrin-GATOR2 interaction and uses thereof
WO2017070518A1 (en) 2015-10-23 2017-04-27 Navitor Pharmaceuticals, Inc. Modulators of sestrin-gator2 interaction and uses thereof
US10752644B2 (en) 2015-10-23 2020-08-25 Navitor Pharmaceuticals, Inc. Modulators of Sestrin-GATOR2 interaction and uses thereof
US10414782B2 (en) 2015-10-23 2019-09-17 Navitor Pharmaceuticals, Inc. Modulators of sestrin-GATOR2 interaction and uses thereof
US10100066B2 (en) 2015-10-23 2018-10-16 Navitor Pharmaceuticals, Inc. Modulators of sestrin-GATOR2 interaction and uses thereof
US11325924B2 (en) 2015-10-23 2022-05-10 Navitor Pharmaceuticals, Inc. Modulators of Sestrin-GATOR2 interaction and uses thereof
US12187728B2 (en) 2015-12-14 2025-01-07 Raze Therapeutics, Inc. Caffeine inhibitors of MTHFD2 and uses thereof
US11370792B2 (en) 2015-12-14 2022-06-28 Raze Therapeutics, Inc. Caffeine inhibitors of MTHFD2 and uses thereof
WO2017106352A1 (en) 2015-12-14 2017-06-22 Raze Therapeutics, Inc. Caffeine inhibitors of mthfd2 and uses thereof
US10954220B2 (en) 2016-03-09 2021-03-23 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
US11535593B2 (en) 2016-03-09 2022-12-27 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
US20190071400A1 (en) * 2016-03-09 2019-03-07 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
EP3884939A1 (en) 2016-03-09 2021-09-29 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
US11014882B2 (en) 2016-03-09 2021-05-25 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
WO2017156179A1 (en) 2016-03-09 2017-09-14 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
US11634412B2 (en) 2016-03-09 2023-04-25 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
US12264132B2 (en) 2016-03-09 2025-04-01 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
EP4234552A2 (en) 2016-03-09 2023-08-30 Raze Therapeutics, Inc. 3-phosphoglycerate dehydrogenase inhibitors and uses thereof
US11337969B2 (en) 2016-04-08 2022-05-24 X4 Pharmaceuticals, Inc. Methods for treating cancer
US11780837B2 (en) 2016-06-21 2023-10-10 X4 Pharmaceuticals, Inc. CXCR4 inhibitors and uses thereof
EP3808748A1 (en) 2016-06-21 2021-04-21 X4 Pharmaceuticals, Inc. Substituted piperidines as cxcr4-inhibitors
US10988465B2 (en) 2016-06-21 2021-04-27 X4 Pharmaceuticals, Inc. CXCR4 inhibitors and uses thereof
US11306088B2 (en) 2016-06-21 2022-04-19 X4 Pharmaceuticals, Inc. CXCR4 inhibitors and uses thereof
WO2017223239A1 (en) 2016-06-21 2017-12-28 X4 Pharmaceuticals, Inc. Cxcr4 inhibitors and uses thereof
US11332470B2 (en) 2016-06-21 2022-05-17 X4 Pharmaceuticals, Inc. CXCR4 inhibitors and uses thereof
US11220508B2 (en) 2016-10-14 2022-01-11 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
WO2018071794A1 (en) 2016-10-14 2018-04-19 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
US10323036B2 (en) 2016-10-14 2019-06-18 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
US10793574B2 (en) 2016-10-14 2020-10-06 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
EP3848370A2 (en) 2016-10-14 2021-07-14 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
US10647713B2 (en) 2016-10-21 2020-05-12 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
WO2018075937A1 (en) 2016-10-21 2018-04-26 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
US11396508B2 (en) 2016-10-21 2022-07-26 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
US10844013B2 (en) 2016-11-08 2020-11-24 Navitor Pharmaceuticals, Inc. Phenyl amino piperidine mTORC inhibitors and uses thereof
US10414727B2 (en) 2016-11-08 2019-09-17 Navitor Pharmaceuticals, Inc. Phenyl amino piperidine mTORC inhibitors and uses thereof
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
US11091451B2 (en) 2016-12-05 2021-08-17 Raze Therapeutics, Inc. SHMT inhibitors and uses thereof
US11730819B2 (en) 2016-12-23 2023-08-22 Bicycletx Limited Peptide derivatives having novel linkage structures
WO2018127699A1 (en) 2017-01-06 2018-07-12 Bicyclerd Limited Compounds for treating cancer
US11433137B2 (en) 2017-01-06 2022-09-06 Bicyclerd Limited Compounds for treating cancer
US10624968B2 (en) 2017-01-06 2020-04-21 Bicyclerd Limited Compounds for treating cancer
WO2018165240A1 (en) 2017-03-08 2018-09-13 Nimbus Lakshmi, Inc. Tyk2 inhibitors, uses, and methods for production thereof
US10336752B2 (en) 2017-03-08 2019-07-02 Nimbus Lakshmi, Inc. TYK2 inhibitors, uses, and methods for production thereof
EP4338802A2 (en) 2017-03-08 2024-03-20 Takeda Pharmaceutical Company Limited Tyk2 inhibitors, uses, and methods for production thereof
US11040967B2 (en) 2017-03-08 2021-06-22 Nimbus Lakshmi, Inc. TYK2 inhibitors, uses, and methods for production thereof
US11434239B2 (en) 2017-03-14 2022-09-06 Artax Biopharma Inc. Aza-dihydro-acridone derivatives
US11505526B2 (en) 2017-03-14 2022-11-22 Artax Biopharma Inc. Aryl-piperidine derivatives
US11339144B2 (en) 2017-04-10 2022-05-24 Navitor Pharmaceuticals, Inc. Heteroaryl Rheb inhibitors and uses thereof
US12427130B2 (en) 2017-04-26 2025-09-30 Navitor Pharmaceuticals, Inc. Modulators of Sestrin-GATOR2 interaction and uses thereof
US11679090B2 (en) 2017-04-26 2023-06-20 Navitor Pharmaceuticals, Inc. Modulators of Sestrin-GATOR2 interaction and uses thereof
US11241473B2 (en) 2017-04-27 2022-02-08 Bicycletx Limited Bicyclic peptide ligands and uses thereof
US10857196B2 (en) 2017-04-27 2020-12-08 Bicycletx Limited Bicyclic peptide ligands and uses thereof
WO2018197893A1 (en) 2017-04-27 2018-11-01 Bicycletx Limited Bicyclic peptide ligands and uses thereof
US12552837B2 (en) 2017-06-26 2026-02-17 Bicyclerd Limited Bicyclic peptide ligands with detectable moieties and uses thereof
US11746126B2 (en) 2017-06-26 2023-09-05 Bicyclerd Limited Bicyclic peptide ligands with detectable moieties and uses thereof
US10899798B2 (en) 2017-06-26 2021-01-26 Bicyclerd Limited Bicyclic peptide ligands with detectable moieties and uses thereof
WO2019002842A1 (en) 2017-06-26 2019-01-03 Bicyclerd Limited BICYCLIC PEPTIDE LIGANDS WITH DETECTABLE FRACTIONS AND USES THEREOF
US11046698B2 (en) 2017-07-28 2021-06-29 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
US10562907B2 (en) 2017-07-28 2020-02-18 Nimbus Lakshimi, Inc. TYK2 inhibitors and uses thereof
US10562906B2 (en) 2017-07-28 2020-02-18 Nimbus Lakshimi, Inc. TYK2 inhibitors and uses thereof
US10508120B2 (en) 2017-07-28 2019-12-17 Nimbus Lakshimi, Inc. TYK2 inhibitors and uses thereof
US10577373B2 (en) 2017-07-28 2020-03-03 Nimbus Lakshimi, Inc. TYK2 inhibitors and uses thereof
US10570145B2 (en) 2017-07-28 2020-02-25 Nimbus Lakshimi, Inc. TYK2 inhibitors and uses thereof
US12049520B2 (en) 2017-08-04 2024-07-30 Bicycletx Limited Bicyclic peptide ligands specific for CD137
WO2019034866A1 (en) 2017-08-14 2019-02-21 Bicyclerd Limited BICYCLIC PEPTIDE LIGANDS CONJUGATES AND USES THEREOF
WO2019034868A1 (en) 2017-08-14 2019-02-21 Bicyclerd Limited CONJUGATES PEPTIDE BICYCLIC-LIGAND PPR-A AND USES THEREOF
US12178875B2 (en) 2017-08-29 2024-12-31 Seaport Therapeutics, Inc. Lymphatic system-directing lipid prodrugs
US11883497B2 (en) 2017-08-29 2024-01-30 Puretech Lyt, Inc. Lymphatic system-directing lipid prodrugs
WO2019046491A1 (en) 2017-08-29 2019-03-07 Ariya Therapeutics, Inc. LIPIDIC PRODRUGS DIRECTING TO THE LYMPHATIC SYSTEM
US12540127B2 (en) 2017-09-22 2026-02-03 Kymera Therapeutics, Inc. CRBN ligands and uses thereof
US11358948B2 (en) 2017-09-22 2022-06-14 Kymera Therapeutics, Inc. CRBN ligands and uses thereof
US11623932B2 (en) 2017-09-22 2023-04-11 Kymera Therapeutics, Inc. Protein degraders and uses thereof
US11938137B2 (en) 2017-12-19 2024-03-26 Puretech Lyt, Inc. Lipid prodrugs of mycophenolic acid and uses thereof
WO2019126378A1 (en) 2017-12-19 2019-06-27 Ariya Therapeutics, Inc. Lipid prodrugs of mycophenolic acid and uses thereof
US11608345B1 (en) 2017-12-19 2023-03-21 Puretech Lyt, Inc. Lipid prodrugs of rapamycin and its analogs and uses thereof
US11623012B2 (en) 2017-12-19 2023-04-11 Bicyclerd Limited Bicyclic peptide ligands specific for EphA2
US11304954B2 (en) 2017-12-19 2022-04-19 Puretech Lyt, Inc. Lipid prodrugs of mycophenolic acid and uses thereof
US11833211B2 (en) 2017-12-19 2023-12-05 Bicycletx Limited Methods of suppression and treatment of disease comprising administering bicycle peptide ligands specific for EphA2
US11723980B2 (en) 2017-12-26 2023-08-15 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US11318205B1 (en) 2017-12-26 2022-05-03 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US10874743B2 (en) 2017-12-26 2020-12-29 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12168057B2 (en) 2017-12-26 2024-12-17 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12516068B2 (en) 2018-01-12 2026-01-06 Kymera Therapeutics, Inc. Protein degraders and uses thereof
US12006329B2 (en) 2018-01-12 2024-06-11 Kymera Therapeutics, Inc. Protein degraders and uses thereof
US11512080B2 (en) 2018-01-12 2022-11-29 Kymera Therapeutics, Inc. CRBN ligands and uses thereof
US11932635B2 (en) 2018-01-12 2024-03-19 Kymera Therapeutics, Inc. CRBN ligands and uses thereof
US11485743B2 (en) 2018-01-12 2022-11-01 Kymera Therapeutics, Inc. Protein degraders and uses thereof
US10793563B2 (en) 2018-01-29 2020-10-06 Merck Patent Gmbh GCN2 inhibitors and uses thereof
US12084438B2 (en) 2018-01-29 2024-09-10 Merck Patent Gmbh GCN2 inhibitors and uses thereof
US10988477B2 (en) 2018-01-29 2021-04-27 Merck Patent Gmbh GCN2 inhibitors and uses thereof
EP4616913A2 (en) 2018-01-29 2025-09-17 Merck Patent GmbH Gcn2 inhibitors and uses thereof
WO2019148132A1 (en) 2018-01-29 2019-08-01 Merck Patent Gmbh Gcn2 inhibitors and uses thereof
US12378288B2 (en) 2018-02-23 2025-08-05 Bicycletx Limited Multimeric bicyclic peptide ligands
US11008310B2 (en) 2018-02-27 2021-05-18 Artax Biopharma Inc. Chromene derivatives as inhibitors of TCR-Nck interaction
WO2019169001A1 (en) 2018-02-27 2019-09-06 Artax Biopharma Inc. Chromene derivatives as inhibitors of tcr-nck interaction
US12319675B2 (en) 2018-02-27 2025-06-03 Artax Biopharma Inc. Chromene derivatives as inhibitors of TCR-Nck interaction
US11807633B2 (en) 2018-02-27 2023-11-07 Artax Biopharma Inc. Chromene derivatives as inhibitors of TCR-Nck interaction
US10696663B2 (en) 2018-02-27 2020-06-30 Artax Biopharma Inc. Chromene derivatives as inhibitors of TCR-NCK interaction
EP4043460A1 (en) 2018-04-24 2022-08-17 Merck Patent GmbH Antiproliferation compounds and uses thereof
WO2019209759A1 (en) 2018-04-24 2019-10-31 Merck Patent Gmbh Antiproliferation compounds and uses thereof
WO2019209757A1 (en) 2018-04-24 2019-10-31 Vertex Pharmaceuticals Incorporated Pteridinone compounds and uses thereof
US11944605B2 (en) 2018-06-15 2024-04-02 Janssen Pharmaceutica Nv Rapamycin analogs and uses thereof
WO2019241789A1 (en) 2018-06-15 2019-12-19 Navitor Pharmaceuticals, Inc. Rapamycin analogs and uses thereof
US10980784B2 (en) 2018-06-15 2021-04-20 Navitor Pharmaceuticals, Inc. Rapamycin analogs and uses thereof
EP4302827A2 (en) 2018-06-15 2024-01-10 JANSSEN Pharmaceutica NV Rapamycin analogs and uses thereof
EP4464715A2 (en) 2018-06-22 2024-11-20 BicycleTx Limited Bicyclic peptide ligands specific for nectin-4
US11180531B2 (en) 2018-06-22 2021-11-23 Bicycletx Limited Bicyclic peptide ligands specific for Nectin-4
EP4461739A2 (en) 2018-06-22 2024-11-13 BicycleTx Limited Bicyclic peptide ligands specific for nectin-4
EP4588934A2 (en) 2018-06-22 2025-07-23 BicycleTX Limited Bicyclic peptide ligands specific for nectin-4
US11453702B2 (en) 2018-06-22 2022-09-27 Bicycletx Limited Bicyclic peptide ligands specific for Nectin-4
US12459974B2 (en) 2018-06-22 2025-11-04 Bicycletx Limited Bicyclic peptide ligands specific for Nectin-4
WO2019243833A1 (en) 2018-06-22 2019-12-26 Bicycletx Limited Bicyclic peptide ligands specific for nectin-4
US11814447B2 (en) 2018-06-22 2023-11-14 Bicyclerd Limited Peptide ligands for binding to EphA2
US11912792B2 (en) 2018-06-22 2024-02-27 Bicycletx Limited Bicyclic peptide ligands specific for nectin-4
WO2019243832A1 (en) 2018-06-22 2019-12-26 Bicycletx Limited Bicyclic peptide ligands specific for nectin-4
WO2020010177A1 (en) 2018-07-06 2020-01-09 Kymera Therapeutics, Inc. Tricyclic crbn ligands and uses thereof
US11897882B2 (en) 2018-07-06 2024-02-13 Kymera Therapeutics, Inc. Tricyclic crbn ligands and uses thereof
US11292792B2 (en) 2018-07-06 2022-04-05 Kymera Therapeutics, Inc. Tricyclic CRBN ligands and uses thereof
US12454520B2 (en) 2018-07-06 2025-10-28 Kymera Therapeutics, Inc. Protein degraders and uses thereof
US11045461B2 (en) 2018-08-31 2021-06-29 X4 Pharmaceuticals, Inc. Compositions of CXCR4 inhibitors and methods of preparation and use
US12115156B2 (en) 2018-08-31 2024-10-15 X4 Pharmaceuticals, Inc. Compositions of CXCR4 inhibitors and methods of preparation and use
WO2020051424A1 (en) 2018-09-07 2020-03-12 Pic Therapeutics Eif4e inhibitors and uses thereof
US12221453B2 (en) 2018-10-15 2025-02-11 Takeda Pharmaceutical Company Limited Substituted pyrazolo[5′,1′:2,3]pyrimido[5,4-b][1,4]oxazines as TYK2 inhibitors
US11414431B2 (en) 2018-10-15 2022-08-16 Nimbus Lakshmi, Inc. Substituted pyrazolo[1,5-a]pyrimidines as TYK2 inhibitors
US10919937B2 (en) 2018-10-23 2021-02-16 Bicycletx Limited Bicyclic peptide ligands and uses thereof
US11396530B2 (en) 2018-10-23 2022-07-26 Bicycletx Limited Bicyclic peptide ligands and uses thereof
WO2020084305A1 (en) 2018-10-23 2020-04-30 Bicycletx Limited Bicyclic peptide ligands and uses thereof
US11697633B2 (en) 2018-10-24 2023-07-11 Navitor Pharmaceuticals, Inc. Polymorphic compounds and uses thereof
US11345654B2 (en) 2018-10-24 2022-05-31 Navitor Pharmaceuticals, Inc. Polymorphic compounds and uses thereof
US12252456B2 (en) 2018-10-24 2025-03-18 Navitor Pharmaceuticals, Inc. Polymorphic compounds and uses thereof
US11352350B2 (en) 2018-11-30 2022-06-07 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12258341B2 (en) 2018-11-30 2025-03-25 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US11053241B2 (en) 2018-11-30 2021-07-06 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
US11807636B2 (en) 2018-11-30 2023-11-07 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US11117889B1 (en) 2018-11-30 2021-09-14 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US11834449B2 (en) 2018-11-30 2023-12-05 Takeda Pharmaceutical Company Limited TYK2 inhibitors and uses thereof
WO2020112937A1 (en) 2018-11-30 2020-06-04 Nimbus Lakshmi, Inc. Tyk2 inhibitors and uses thereof
US12377155B2 (en) 2018-12-13 2025-08-05 Bicyclerd Limited Bicyclic peptide ligands specific for PSMA
US12350343B2 (en) 2018-12-13 2025-07-08 Bicycletx Limited Bicyclic peptide ligands specific for MT1-MMP
US12491253B2 (en) 2018-12-13 2025-12-09 Bicyclerd Limited Bicyclic peptide ligands specific for MT1-MMP
EP3670659A1 (en) 2018-12-20 2020-06-24 Abivax Biomarkers, and uses in treatment of viral infections, inflammations, or cancer
WO2020127853A1 (en) 2018-12-20 2020-06-25 Abivax Biomarkers, and uses in treatment of viral infections, inflammations, or cancer
US12492224B2 (en) 2018-12-21 2025-12-09 Bicycletx Limited Bicyclic peptide ligands specific for PD-L1
US12551567B2 (en) 2018-12-21 2026-02-17 Bicyclerd Limited Bicyclic peptide ligands specific for PD-L1
US11174264B2 (en) 2019-01-23 2021-11-16 Nimbus Lakshmi, Inc. TYK2 inhibitors and uses thereof
US12338242B2 (en) 2019-01-23 2025-06-24 Takeda Pharmaceutical Company Limited TYK2 inhibitors and uses thereof
WO2020165600A1 (en) 2019-02-14 2020-08-20 Bicycletx Limited Bicyclic peptide ligand sting conjugates and uses thereof
WO2020201753A1 (en) 2019-04-02 2020-10-08 Bicycletx Limited Bicycle toxin conjugates and uses thereof
US11746120B2 (en) 2019-04-05 2023-09-05 Kymera Therapeutics, Inc. Stat degraders and uses thereof
US12077555B2 (en) 2019-04-05 2024-09-03 Kymera Therapeutics, Inc. STAT degraders and uses thereof
US11485750B1 (en) 2019-04-05 2022-11-01 Kymera Therapeutics, Inc. STAT degraders and uses thereof
WO2020243423A1 (en) 2019-05-31 2020-12-03 Ikena Oncology, Inc. Tead inhibitors and uses thereof
US12521438B2 (en) 2019-06-10 2026-01-13 Kymera Therapeutics, Inc. SMARCA degraders and uses thereof
US12545659B2 (en) 2019-06-28 2026-02-10 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12558427B2 (en) 2019-07-17 2026-02-24 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12435107B2 (en) 2019-07-30 2025-10-07 Bicycletx Limited Heterotandem bicyclic peptide complex
US12570695B2 (en) 2019-07-30 2026-03-10 Bicycletx Limited Bicyclic peptide ligands specific for EphA2
US11970553B2 (en) 2019-07-30 2024-04-30 Bicycletx Limited Heterotandem bicyclic peptide complex
US12606594B2 (en) 2019-07-30 2026-04-21 Bicycletx Limited Heterotandem bicyclic peptide complexes
US11845724B2 (en) 2019-09-11 2023-12-19 Vincere Biosciences, Inc. USP30 inhibitors and uses thereof
US11021481B2 (en) 2019-09-13 2021-06-01 Nimbus Saturn, Inc. Substituted isoindolin-1-ones and 2,3-dihydro-1h-pyrrolo[3,4-c]pyridin-1-ones as HPK1 antagonists
US12215105B2 (en) 2019-09-13 2025-02-04 Nimbus Saturn, Inc. HPK1 antagonists and uses thereof
WO2021050964A1 (en) 2019-09-13 2021-03-18 Nimbus Saturn, Inc. Hpk1 antagonists and uses thereof
US11548890B1 (en) 2019-09-13 2023-01-10 Nimbus Saturn, Inc. HPK1 antagonists and uses thereof
US11028085B2 (en) 2019-09-13 2021-06-08 Nimbus Saturn, Inc. Substituted isoindolin-1-ones and 2,3-dihydro-1h-pyrrolo[3,4-c]pyridin-1-ones as hpk1 antagonists
US11034694B2 (en) 2019-09-13 2021-06-15 Nimbus Saturn, Inc. Substituted isoindolin-1-ones and 2,3-dihydro-1H-pyrrolo[3,4-c]pyridin-1-ones as HPK1 antagonists
US11078201B2 (en) 2019-09-13 2021-08-03 Nimbus Saturn, Inc. Substituted isoindolin-1-ones and 2,3-dihydro-1H-pyrrol[3,4-c]pyridin-1-ones as HPK1 antagonists
US11723890B2 (en) 2019-11-01 2023-08-15 Navitor Pharmaceuticals, Inc. Methods of treatment using an mTORC1 modulator
US12465583B2 (en) 2019-11-01 2025-11-11 Navitor Pharmaceuticals, Inc. Methods of treatment using an mTORC1 modulator
US11819476B2 (en) 2019-12-05 2023-11-21 Janssen Pharmaceutica Nv Rapamycin analogs and uses thereof
US12551564B2 (en) 2019-12-10 2026-02-17 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US11707457B2 (en) 2019-12-17 2023-07-25 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US11591332B2 (en) 2019-12-17 2023-02-28 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12539295B2 (en) 2019-12-17 2026-02-03 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US11779578B2 (en) 2019-12-17 2023-10-10 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
US12569485B2 (en) 2019-12-23 2026-03-10 Kymera Therapeutics, Inc. SMARCA inhibitors and uses thereof
WO2021133920A1 (en) 2019-12-23 2021-07-01 Kymera Therapeutics, Inc. Smarca degraders and uses thereof
US11679109B2 (en) 2019-12-23 2023-06-20 Kymera Therapeutics, Inc. SMARCA degraders and uses thereof
US11975073B2 (en) 2020-02-05 2024-05-07 Puretech Lyt, Inc. Lipid prodrugs of neurosteroids
WO2021178488A1 (en) 2020-03-03 2021-09-10 PIC Therapeutics, Inc. Eif4e inhibitors and uses thereof
US12528785B2 (en) 2020-03-19 2026-01-20 Kymera Therapeutics, Inc. MDM2 degraders and uses thereof
US11932624B2 (en) 2020-03-19 2024-03-19 Kymera Therapeutics, Inc. MDM2 degraders and uses thereof
WO2021188948A1 (en) 2020-03-19 2021-09-23 Kymera Therapeutics, Inc. Mdm2 degraders and uses thereof
US11685750B2 (en) 2020-06-03 2023-06-27 Kymera Therapeutics, Inc. Crystalline forms of IRAK degraders
WO2021247897A1 (en) 2020-06-03 2021-12-09 Kymera Therapeutics, Inc. Deuterated irak degraders and uses thereof
US12540161B2 (en) 2020-08-03 2026-02-03 Bicycletx Limited Linkers
WO2022038158A1 (en) 2020-08-17 2022-02-24 Bicycletx Limited Bicycle conjugates specific for nectin-4 and uses thereof
US12331046B2 (en) 2020-10-23 2025-06-17 Nimbus Clotho, Inc. CTPS1 inhibitors and uses thereof
WO2022120354A1 (en) 2020-12-02 2022-06-09 Ikena Oncology, Inc. Tead inhibitors and uses thereof
WO2022120353A1 (en) 2020-12-02 2022-06-09 Ikena Oncology, Inc. Tead inhibitors and uses thereof
US12606568B2 (en) 2020-12-09 2026-04-21 Kymera Therapeutics, Inc. SMARCA degraders and uses thereof
US12150995B2 (en) 2020-12-30 2024-11-26 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
WO2022167445A1 (en) 2021-02-02 2022-08-11 Liminal Biosciences Limited Gpr84 antagonists and uses thereof
WO2022167457A1 (en) 2021-02-02 2022-08-11 Liminal Biosciences Limited Gpr84 antagonists and uses thereof
US12252488B2 (en) 2021-02-12 2025-03-18 Nimbus Saturn, Inc. HPK1 antagonists and uses thereof
US12497402B2 (en) 2021-02-15 2025-12-16 Kymera Therapeutics, Inc. IRAK4 degraders and uses thereof
US11773103B2 (en) 2021-02-15 2023-10-03 Kymera Therapeutics, Inc. IRAK4 degraders and uses thereof
US12171768B2 (en) 2021-02-15 2024-12-24 Kymera Therapeutics, Inc. IRAK4 degraders and uses thereof
US11926625B2 (en) 2021-03-05 2024-03-12 Nimbus Saturn, Inc. HPK1 antagonists and uses thereof
US12071442B2 (en) 2021-03-29 2024-08-27 Nimbus Saturn, Inc. Substituted pyrrolo[3,4-c]pyridines as HPK1 antagonists
US12466841B2 (en) 2021-03-29 2025-11-11 Nimbus Saturn, Inc. Substituted pyrrolo[3,4-c]pyridines as HPK1 antagonists
US12325697B2 (en) 2021-04-09 2025-06-10 Nimbus Clio, Inc. CBL-B modulators and uses thereof
WO2022221866A1 (en) 2021-04-16 2022-10-20 Ikena Oncology, Inc. Mek inhibitors and uses thereof
US12097261B2 (en) 2021-05-07 2024-09-24 Kymera Therapeutics, Inc. CDK2 degraders and uses thereof
WO2023028235A1 (en) 2021-08-25 2023-03-02 PIC Therapeutics, Inc. Eif4e inhibitors and uses thereof
WO2023028238A1 (en) 2021-08-25 2023-03-02 PIC Therapeutics, Inc. Eif4e inhibitors and uses thereof
US12187744B2 (en) 2021-10-29 2025-01-07 Kymera Therapeutics, Inc. IRAK4 degraders and synthesis thereof
WO2023114984A1 (en) 2021-12-17 2023-06-22 Ikena Oncology, Inc. Tead inhibitors and uses thereof
US12091411B2 (en) 2022-01-31 2024-09-17 Kymera Therapeutics, Inc. IRAK degraders and uses thereof
WO2023173057A1 (en) 2022-03-10 2023-09-14 Ikena Oncology, Inc. Mek inhibitors and uses thereof
WO2023173053A1 (en) 2022-03-10 2023-09-14 Ikena Oncology, Inc. Mek inhibitors and uses thereof
WO2023211889A1 (en) 2022-04-25 2023-11-02 Ikena Oncology, Inc. Polymorphic compounds and uses thereof
WO2023230205A1 (en) 2022-05-25 2023-11-30 Ikena Oncology, Inc. Mek inhibitors and uses thereof
WO2024028363A1 (en) 2022-08-02 2024-02-08 Liminal Biosciences Limited Heteroaryl carboxamide and related gpr84 antagonists and uses thereof
WO2024028364A1 (en) 2022-08-02 2024-02-08 Liminal Biosciences Limited Aryl-triazolyl and related gpr84 antagonists and uses thereof
WO2024028365A1 (en) 2022-08-02 2024-02-08 Liminal Biosciences Limited Substituted pyridone gpr84 antagonists and uses thereof
WO2024112894A1 (en) 2022-11-22 2024-05-30 PIC Therapeutics, Inc. Eif4e inhibitors and uses thereof
EP4620470A2 (en) 2023-06-23 2025-09-24 Kymera Therapeutics, Inc. Irak degraders and uses thereof
WO2025062372A1 (en) 2023-09-21 2025-03-27 Takeda Pharmaceutical Company Limited Tyk2 inhibitors for use in the treatment of inflammatory bowel disease

Also Published As

Publication number Publication date
AU2004257167A1 (en) 2005-01-27
EP2371835A1 (en) 2011-10-05
US7173015B2 (en) 2007-02-06
CN1860127A (zh) 2006-11-08
AU2004257167A2 (en) 2005-01-27
US20050075306A1 (en) 2005-04-07
HK1096972A1 (zh) 2007-06-15
CA2531069A1 (en) 2005-01-27
WO2005007623A3 (en) 2006-05-18
CN101961497A (zh) 2011-02-02
CN100577680C (zh) 2010-01-06
US20070219152A1 (en) 2007-09-20
JP2007524397A (ja) 2007-08-30
WO2005007623A8 (en) 2006-03-23
US20120093913A1 (en) 2012-04-19
AU2004257167B2 (en) 2012-03-29
EP1692153A4 (en) 2007-03-21
EP1692153A2 (en) 2006-08-23
JP2011200238A (ja) 2011-10-13

Similar Documents

Publication Publication Date Title
AU2004257167B2 (en) Inhibition of Syk kinase expression
Choung et al. Chemical modification of siRNAs to improve serum stability without loss of efficacy
EP3236976B1 (en) Rna interference agents for p21 gene modulation
Sioud Single‐stranded small interfering RNA are more immunostimulatory than their double‐stranded counterparts: A central role for 2′‐hydroxyl uridines in immune responses
Lage MDR1/P-glycoprotein (ABCB1) as target for RNA interference-mediated reversal of multidrug resistance
Zhang et al. Silencing stathmin gene expression by survivin promoter-driven siRNA vector to reverse malignant phenotype of tumor cells
Zhang et al. Antisense inhibition: oligonucleotides, ribozymes, and siRNAs
Yokota et al. siRNA-based inhibition specific for mutant SOD1 with single nucleotide alternation in familial ALS, compared with ribozyme and DNA enzyme
US20100055783A1 (en) Nucleic acid compounds for inhibiting ras gene expression and uses thereof
US8318924B2 (en) Immunostimulatory siRNA molecules
US20100055782A1 (en) Nucleic acid compounds for inhibiting myc gene expression and uses thereof
US20220298512A1 (en) Sirna sequences targeting the expression of human genes jak1 or jak3 for a therapeutic use
EP1614751B1 (en) Oligoribonucleotide sequence homologous to a cdna region which codes for the human cd40 receptor and duplex oligoribonucleotides, vectors, pharmaceutical compositions and uses associated thereto
US20080299659A1 (en) Nucleic acid compounds for inhibiting apob gene expression and uses thereof
US9540644B2 (en) Small interference RNA for inhibiting intracellular expression of ribosomal protein S3
Mobergslien et al. Exploring 5′-biotinylation of the sense strand to improve siRNA specificity and potency
Oridate et al. Suppression of DNA methyltransferase 1 levels in head and neck squamous carcinoma cells using small interfering RNA results in growth inhibition and increase in Cdk inhibitor p21
HK1096972B (en) Inhibition of syk kinase expression
HK1153404A (en) Inhibition of syk kinase expression
Mobergslien et al. Chemical Strategies to Enhance Antisense Strand Selection and Minimize Off-Target Effect-Mediated by siRNAs
JP2010529852A (ja) 癌治療のためのNuMAのRNAi媒介ノックダウン
Ui-Tei et al. RNAi induced in mammalian and Drosophila cells via transfection of dimers and trimers of small interfering RNA
Mobergslien et al. A facile method for interfering with off-target silencing mediated by the sense strand
Wang et al. 244 [15] GENERAL METHODS OF RGS PROTEIN ANALYSIS
TW201718854A (zh) 供p21基因調控之RNA干擾劑

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200480019112.6

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006517793

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 2531069

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2004257167

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 157/DELNP/2006

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2004756414

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2004257167

Country of ref document: AU

Date of ref document: 20040701

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004257167

Country of ref document: AU

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: IN PCT GAZETTE 04/2005 UNDER (71) REPLACE "FOR US ONLY" BY "FOR ALL DESIGNATED STATES EXCEPT THE US"

WWP Wipo information: published in national office

Ref document number: 2004756414

Country of ref document: EP