WO2005000883A1 - Polypeptides having binding affinity for insulin - Google Patents

Abstract

A polypeptide, which has a binding affinity for insulin such that the KD value of the interaction is at most 1 x 10-6 M is provided. The polypeptide is related to a domain of staphylococcal protein A (SPA) in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having from 1 to about 20 substitution mutations. Nucleic acid encoding the polypeptide, expression vector comprising the nucleic acid, and host cell comprising the expression vector are additionally provided. Also provided is a method of separation of insulin present in a sample from other constituents in the sample, which method comprises a step of affinity separation, in which step a polypeptide according to the invention is used. Also provided is a method of detection of insulin in a sample, in which method a polypeptide according to the invention is used.

Description

Stap ylococcal protein A (SPA) variants and methods thereof.

Field of the invention The present invention is related to a new polypeptide, which binds to insulin, and to use of this polypeptide in a method of affinity separation, in diabetes diagnostics, in histochemical analys.es and in other areas of application. The polypeptide is related to a domain of staphylococcal protein A (SPA) in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having at least one substitution mutation.

Background The need for insulin is increasing worldwide, and thus there is a continuing need for means to efficiently purify insulin from various sources. This is conveniently done using chromatographic processes, which enable large- scale purification of insulin preparations. A very efficient method for the separation of any biomolecule frorn a complex mixture comprises a step of affinity separation. In such a step, a chromatography matrix is used, which has a molecule with specific affinity for the desired product coupled to it. The molecule with affinity for the desired product may be a polypeptide molecule, such as an antibody, which interacts with the desired product, or it may be another type of affinity ligand. A step of affin- ity chromatography in a purification process can in general replace many steps that have to be used when an affinity ligand is not available. Such molecules having an affinity for insulin are for example also useful in detection of insulin in pro- duction processes, in the diagnosis of diabetes, and/or in histochemical analyses of tissue. Molecules related to protein Z, derived from domain B of staphylococcal protein A (SPA) (Nilsson B et al (1987) Prot Eng 1, 107-133) , have been selected from a library of randomized such molecules (Nord K efc al (1995) Prot Eng 8:601-608) using different interaction targets. For example, human insulin has been used to select one such protein Z derivative, described in Nord K et al

(1997) Nature Biotechnology 15, 772-777. It is disclosed in this reference that the protein Z derivative has an affinity to human insulin such that the K_D of the interaction is 3 x 10^"5 M. However, this affinity is not suffi- cient for the molecule to be of much use in the various applications wherein an insulin-binding molecule would be useful. The experiments described in Nord K et al (1997, supra) outline principles of the general technology of selecting protein Z derivatives against given targets, rather than being a study directed towards the express objective of obtaining an insulin-binding molecule with high enough affinity for use as a reagent for capture, detection and/or separation in methods for e g separation, purification, diagnosis and/or histochemistry. The molecules traditionally used as affinity reagents are antibodies, polyclonal and monoclonal. Exist_r ing commercial monoclonal antibodies with an affinity for insulin typically exhibit affinities with K_D values in the vicinity of 10^"7-10^"8 M. Examples of such insulin binding antibodies are provided by Abeam (catalogue numbers ab8304, ab8305, ab8299, ab8300 and ab8301, all exhibiting K_D values of between 10^"7 and 10^"8) . Thus, in order to provide a practical alternative to such antibodies, an insulin binding polypeptide should have an affin- ity to insulin which is comparable. No such polypeptide based on an SPA domain has been described previously. Thus, there is a continued need for novel molecules with a high affinity for insulin, which can be used as reagents in various assays and processes where such an affinity is needed. Disclosure of the invention It is an object of -the present invention to meet this need through the provision of a polypeptide that exhibits specific binding to insulin with a high affinity. A related object of the invention is an insulin binding polypeptide which exhibits little or no nonspecific binding, e g to E. coll proteins. It is another object of the invention to provide an insulin binding polypeptide that can readily be used as a moiety in a fusion polypeptide. Another object is the provision of an insulin binding polypeptide, which does not exhibit the known problems of stability experienced with antibody reagents, but provides a stable and robust structure with the ability to withstand harsh environmental conditions. Furthermore, it is an object to provide an insulin binding polypeptide, the properties of which enables easy coupling thereof to a chromatography matrix. Yet another object is to provide an insulin binding polypeptide, which gives the possibility of obtaining a very high purity of insulin when the molecule is used in affinity purification thereof. A related object is to provide an insulin binding polypeptide, which enables efficient separation of insu- lin from other constituents of a sample. It is also an object to provide a molecule which can be used as a reagent for the detection of insulin at a low detection limit. These and other objects are met by the invention as claimed in the appended claims. Thus, in a first aspect, the invention provides a polypeptide, which has a binding affinity for insulin^' such that the K_D value of the interaction is at most 1 x 10^"6 M; and which is related to a domain of staphylococcal protein A (SPA) in that the se- quence of the polypeptide corresponds to the sequence of the SPA domain having from 1 to about 20 substitution mutations . In accordance herewith, the present inventors have found- that it is possible to obtain a high-affinity insulin binding polypeptide through substitution mutagenesis of a domain from SPA, and that such a polypeptide is able to interact with insulin with a K_D value of at most

1 x 10^"6 M. Such a K_D makes it possible to use the polypeptide according to the invention in methods of separation and other applications, where the previously known insulin binding polypeptide derived from protein Z of SPA origin (Nord et al (1997) supra) is not useful, due to its significantly lower affinity for insulin. Even more preferred are polypeptides of -the invention that are able to interact with insulin with a K_D value of at most 1 x 10^"7 M. In accordance herewith, the present inventors have found that it is possible to obtain a high-affinity insulin binding polypeptide through substitution mutagenesis of a domain from SPA, and that such a polypeptide is able to interact with insulin. The inventive polypeptide may for example find application as an alternative to antibodies against insulin in diverse applications. As non-, limiting examples, it will be useful in methods of separation and detection, and in other applications. The polypeptide according to the invention may prove useful in any method which relies on affinity for insulin of a reagent. Thus, the polypeptide may be used as a detection reagent, a capture reagent or a separation reagent in such methods. Methods that employ the polypeptide according to the invention in vi tro may be performed in.differ- ent formats, such as in microtiter plates, in protein arrays, on biosensor surfaces, on tissue sections, and so on. Different modifications of, and/or additions to, the polypeptide according to the invention may be performed in order to tailor the polypeptide to the specific use intended, without departing from the scope of the present invention. Such modifications and additions are described in more detail below, and may comprise additional amino acids comprised in the same polypeptide chain, or labels and/or ^"therapeutic agents that are chemically conjugated or otherwise bound to the polypeptide according to the invention. Furthermore, the invention also encompasses fragments of the polypeptide that retain the capability of binding tσ insulin. "Binding affinity for insulin" refers to a property of a polypeptide which may be tested e g by the use of surface plasmon resonance technology, such as in a Biacore^® instrument. Insulin binding affinity may be tested in an experiment wherein insulin is immobilized on a sensor chip of the instrument, and a sample containing the polypeptide to be tested is passed over the chip. Alternatively, the polypeptide to be tested is immobilized on a sensor chip of the instrument, and a sample containing insulin is passed over the chip. The skilled person may then interpret the sensorgrams obtained to establish at least a qualitative measure of the polypeptide' s binding affinity for insulin. If a quantitative measure is sought, e g with the purpose to establish a certain K_D value for the interaction, it is again possible to use , surface plasmon resonance methods . Binding values may e g be defined in a Biacore^® 2000 instrument (Biacore AB) . Insulin is immobilized on a sensor chip of the instru- ment, and samples of the polypeptide whose affinity is to be determined are prepared by serial dilution and injected in random order. K_D values may then be calculated from the results, using e g the 1:1 Langmuir binding model of the BIAevaluation 3.2 software provided by the instrument manufacturer. Determination in this fashion of the K_D of the interaction between specific polypeptides of the invention and insulin are presented in the Examples section. As stated above, the sequence of the polypeptide ac- cording to the present invention is related to the SPA domain sequence in that from 1 to about 20 amino acid residues of said SPA domain have been substituted for other amino acid residues. However, the substitution mutations introduced should not affect the basic structure of the polypeptide. That is, the overall fold of the C_α backbone of the polypeptide of the invention will be es- sentially the same as that of the SPA domain to which it is related, e g having the same elements of secondary structure in the same order etc. Thus, polypeptides fall under the definition of having the same fold as the SPA domain if basic structural properties are shared, those properties e g resulting in similar CD spectra. The skilled person is aware of other parameters that are relevant. This requirement of • essentially conserving the basic structure of the SPA domain, upon mutation thereof, places restrictions on what positions of the domain may be subject to substitution. When starting from the known structure of the Z protein, for example, it is preferred that amino acid residues located on the surface of the Z protein may be substituted, whereas amino acid residues buried within the core of the Z protein "three-helix bun- die" should be kept constant in order to preserve the structural properties of the molecule. The same reasoning applies to other SPA domains, and fragments thereof. The invention also encompasses polypeptides in which the insulin binding polypeptide described above is pre- sent as an insulin binding domain, to which additional amino acid residues have been added at either terminal. These additional amino acid residues may play a role in the binding of insulin by the polypeptide, but may equally well serve other purposes, related for example to one or more of the production, purification, stabilization or detection of the polypeptide. Such additional amino acid residues may comprise one or more amino acid residues added for purposes of chemical coupling, e g to a chromatographic matrix. An example of this is the addi- tion of a cysteine residue at the very first or very last position in the polypeptide chain, i e at the N or C terminus. Such additional amino acid residues may also com- prise a "tag" for purification or detection of the polypeptide^", such as a hexahistidyl (His_s) tag for interaction with chelating agents, or a "myc" tag or a "flag" tag for interaction with antibodies specific to the tag. The skilled person is aware of other alternatives. The "additional amino acid residues" discussed above may also constitute one or more polypeptide domain (s) with any desired function, such as the same binding function as the first, insulin-binding 'domain, or another binding function, or an enzymatic function, or a fluorescent function, or mixtures thereof. Thus, the invention encompasses multimers of the polypeptide with affinity for insulin. It may be of interest, e g in a method of purification of insulin, to obtain even stronger binding of insulin than is possible with one polypeptide according to the invention. In this case, the provision of a multimer, such as a dimer, trimer or tetramer, of the polypeptide may provide the necessary avidity effects. The multimer may consist of a suitable number of polypeptides according to the invention. These polypeptide domains according to the inven- tion, forming monomers in such a multimer, may all have the same amino acid sequence, but it is equally possible that they have different amino acid sequences . The linked polypeptide "units" in a multimer according to the invention may be connected by covalent coupling using known organic chemistry methods, or expressed as one or more fusion polypeptides in a system for recombinant expression of polypeptides, or joined in any other fashion, ei- ther directly or via a linker, for example an amino acid linker. Additionally, "heterogenic" fusion polypeptides, in which the insulin binding polypeptide constitutes a first domain, or first moiety, and the second and further moie- ties have other functions than binding insulin, are also contemplated and fall within the ambit of the present invention. The second and further moiety/moieties of the I 8 fusion polypeptide may comprise a binding domain with affinity ^"for another target molecule than insulin. Such a binding domain may well also be related to an SPA domain through substitution mutation at from 1 to about 20 posi- tions thereof. The result is then a fusion polypeptide having at least one insulin-binding domain and at least one domain with affinity for said other target molecule, in which both domains are related to an SPA domain. This makes it possible to create multispecific reagents that may be used in several biotechnological applications, such as used as capture, detection or separation reagents. The preparation of such multispecific multimers of SPA domain related polypeptides, in which at least one polypeptide domain has affinity for insulin, may be ef- fected as described above for the multimer of several insulin binding "units". In other alternatives, the second or further moiety or moieties may comprise an unrelated, naturally occurring or recombinant, protein (or a fragment thereof retaining the binding capability of the naturally occurring or recombinant protein) having a binding affinity for a target . An example of such a binding protein, which has an affinity for human serum albumin and may be used as fusion partner with the insulin binding SPA domain derivative of the invention, is the albumin binding domain of streptococcal protein G (SPG) (Nygren P-A et al (1988) Mol Recogn 1:69-74) . A fusion polypeptide between the insulin binding SPA domain- related polypeptide and the albumin binding domain of SPG thus falls within the scope of the present invention. Other possibilities for the creation of fusion polypeptides are also contemplated. Thus, the insulin binding SPA domain-related polypeptide according to the first aspect of the invention may be covalently coupled to a second or further moiety or moieties, which in addition to or instead of target binding exhibit other functions. One example is a fusion between one or more insulin binding polypeptide (s) and an enzymatically active polypeptide serving as a reporter or effector moiety. Examples of reporter ^"enzymes, which may be coupled to the insulin binding polypeptide to form a fusion protein, are known to the skilled person and include enzymes such as β- galactosidase, horseradish peroxidase, carboxypeptidase and alkaline phosphatase. Other options for the second and further moiety or moieties of a fusion polypeptide according to the invention include fluorescent polypeptides, such as green fluorescent protein, red fluorescent protein, luciferase and variants thereof. In regard to the description above of fusion proteins incorporating the insulin binding polypeptide according to the invention, it is to be noted that the designation of first, second and further moieties is made for clarity reasons to distinguish between the insulin binding moiety or moieties on the one hand, and moieties exhibiting other functions on the other hand. These designations are not intended to refer to the actual order of the different. domains in the polypeptide chain of the fusion protein. Thus, for example, said first moiety may without restriction appear at the N-terminal end, in the middle, or at the C-terminal end of the fusion protein. The invention also encompasses polypeptides in which the insulin binding polypeptide described above has been provided with a label group, such as at least one fluorophore, biotin or a radioactive isotope, for example for purposes of detection of the polypeptide. An example of an SPA domain for use as a starting point for the creation of a polypeptide according to the invention is protein Z, derived from domain B of staphylococcal protein A. As pointed out in the Background section, this protein has previously been used as a scaffold structure for the creation of molecules, denoted Affi- body^® molecules, capable of binding to a variety of tar- gets. The 58 amino acid sequence of unmodified protein Z, denoted wt, is set out in SEQ ID N0.-1 and illustrated in Figure 1. In an embodiment of the polypeptide according to the invention, it is related to a domain of SPA in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having from 4 to about 20 substitution mutations. Other embodiments may have from 1 to about 13 substitution mutations, or from 4 to about 13 substitution mutations. In a more specific embodiment of the polypeptide according to the invention, its sequence corresponds to the sequence set forth in SEQ ID NO:l having from 1 to about 20 substitution mutations, such as from 4 to about 20, from 1 to about 13 or from 4 to about 13 substitution mutations. The polypeptide according to the invention may in some embodiments correspond to the sequence set forth in SEQ ID N0:1, which sequence comprises substitution mutations at one or more of the positions 10, 13, 25, 27, 32 and 35. Additionally, the sequence of the polypeptide according to the invention may comprise substitution muta- tions at one or more of the positions 9, 11, 14, 17, 18,

24 and 28. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID N0:1, comprising at least a substitution mutation at position 13 from phenylalanine to an amino acid residue selected from tyrosine and tryptophan, preferably tryptophan. The sequence of a polypeptide according to a further embodiment of the invention corresponds to SEQ ID NO.l, comprising at least a substitution mutation at position 32 from glutamine to an amino acid residue selected from asparagine, aspartic acid and glutamic acid, preferably selected from aspartic acid and glutamic acid, most preferably to glutamic acid. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least a substitution mutation at position

25 from glutamic acid to glutamine. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least a substitution mutation at position 27 from arginine to tyrosine. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least a substitution mutation at position 10 from glutamine to tryptophan. The sequence of a polypeptide. according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least a substitution mutation at position 35 from lysine to arginine. Examples of specific sequences of polypeptides according to the invention, each comprising one or more of the specific mutations described above, are set out in SEQ ID NO: 2-14 and illustrated in Figure 1. The insulin binding characteristics of these polypeptides are disclosed in the examples that follow. As an alternative to using the unmodified SPA do- main, the SPA domain may also be subjected to mutagenesis in order to increase the stability thereof in alkaline , conditions. Such stabilization involves the site-directed substitution of any asparagine residues appearing in the unmodified sequence with amino acid residues that are less sensitive to alkaline conditions. When using the polypeptide according to the invention as an affinity ligand in affinity chromatography, this property of having a reduced sensitivity to alkali provides benefits; affinity chromatography columns are frequently subjected to harsh alkali treatment for cleaning in place (CIP) between separation runs, and the ability to withstand such treatment prolongs the useful lifetime of the affinity chromatography matrix. As an example, making use of protein Z as starting point, the polypeptide according to the invention may, in addition to the substitution mutations conferring insulin binding, have modifications in that at least one asparagine residue selected from N3 , N6, Nil, N21, N23, N28, N43 and N52 has been substituted with an amino acid residue that is less sensitive to alkaline treatment. Non-limiting examples of such polypeptides are those having the following sets of mutations (with respect to the sequence of Z_wt):_.N3A; N6D; N3A, N6D and N23T; N3A, N6D, N23T and N28A; N23T; N23T and N43E; N28A; N6A; N11S; N11S and N23T; N6A and N23T. Thus, these SPA domains, as well as other SPA domains that have been subjected to asparagine mutation for stability reasons , may all be subjected to further substitution mutation of amino acid residues in order to obtain the insulin binding polypeptide of the invention. Alternatively, an insulin binding polypeptide of the- invention which comprises asparagine residues may be subjected to further mutation to replace such residues. Evidently, this latter alternative is only possible to the extent that the insulin binding capability of such a molecule is not compromised to any significant extent. The invention also encompasses polypeptides that have been derived from any of the polypeptides described above, through generation of a fragment of the above / polypeptides, which fragment retains insulin affinity. The fragment polypeptide is such that it remains stable, and retains the specificity to bind insulin. The possi- bility to create fragments of a wild-type SPA domain with retained binding specificity to immunoglobulin G is shown by Braisted AC and Wells JA et al in Proc Natl Acad Sci USA 93:5688-5692 (1996). By using a structure-based design and phage display methods, the binding domain of a three-helix bundle of 59 residues was reduced to a resulting two-helix derivative of 33 residues. This was achieved by stepwise selection of random mutations from different regions, which caused the stability and binding affinity to be iteratively improved. Following the same reasoning with the polypeptides according to the first aspect of the invention, the skilled man would be able to obtain a "minimized" "insulin binding polypeptide with the same binding properties as that of the "parent" insulin polypeptide. Hence, a polypeptide constituting a fragment of a polypeptide according to the above aspect of the invention, which fragment retains binding affinity for in- sulin, is a further aspect of the invention. Another aspect of the present invention relates to a nucleic acid molecule comprising a nucleotide sequence which encodes a polypeptide according to the invention. A further aspect of the present invention relates to an expression vector comprising the nucleic acid molecule of the previous aspect, and other nucleic acid elements that enable production of the -polypeptide according to the invention through expression of the nucleic acid molecule . Yet another aspect of the present invention relates to a host cell comprising the expression vector of the previous aspect . The latter three aspects of the invention are tools for the production of a polypeptide according to the in- vention, and the skilled person will be able to obtain them and put them into practical use without undue bur-, den, given the information herein concerning the polypeptide that is to be expressed and given the current level of skill in the art of recombinant expression of pro- teins. As an example, a plasmid for the expression of unmodified protein Z (see e g Nilsson B et al (1987) , supra) may be used as starting material . The desired substitution mutations may be introduced into this plasmid, using known techniques, to obtain an expression vector in accordance with the invention. However, the polypeptide according to the invention may also be produced by other known means, including chemical synthesis or expression in different prokaryotic or eukaryotic hosts, including plants and transgenic ani- mals. When using chemical polypeptide synthesis, any of the naturally occurring amino acid residues in the polypeptide as described above may be replaced with any cor- responding, non-naturally occurring amino acid residue or derivative thereof, as "long as the insulin binding capacity of the polypeptide is not substantially compromised. The binding capability should at least be retained, but replacement with a corresponding, non-naturally occurring amino acid residue or derivative thereof may actually also serve to improve the insulin binding capacity of the polypeptide. Such non-classical amino acids, or synthetic amino acid analogs, include, but are not limited to, the D-isomers of the common amino acids, c.-amino isobutyric acid, 4-amino butyric acid, 2 -amino butyric acid, 6-amino hexanoic acid, 2-amino isobutyric acid, 3 -amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid, t-butylglycine, t- butylalanine, phenylglycine, cyclohexylalanine, β- alanine, fluoroamino acids, designer amino acids such as /3-methyl amino acids, Cc_-methyl amino acids, Nc-methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid residues can be present in D or L form. The present invention also concerns different as- - pects of using the above-described insulin binding polypeptide, as well as various methods for diagnosis and detection in which the polypeptide is useful due to its binding characteristics. When referring to the "insulin binding polypeptide" in the following description of these uses and methods, this term is intended to encompass the insulin binding polypeptide alone, but also all those molecules based on this polypeptide described above that e g constitute fragments thereof and/or incorporate the insulin binding polypeptide as a moiety in a fusion protein and/or are conjugated to a label or therapeutic agent and/or are provided with additional amino acid residues as a tag or for other purposes . As explained above, such fusion proteins, derivatives, fragments etc form a part of the present invention. Thus, according to one such aspect of the present invention, a method of -separation, removal and/or purification of insulin is provided. The method comprises a step of affinity separation, in which step a polypeptide according to the first aspect of the invention is used. Thus, the invention provides use of the polypeptide as described above in a method of affinity separation. Suitably, the method involves a separation device, such as chosen among chromatographic media, membranes, cellu- lose, silica, agarose, polyacrylamide, magnetic beads, two-phase systems and other such materials commonly used in separation. In an embodiment, the polypeptide according to the invention is coupled to the separation device. The thus obtained separation device, having polypeptide according to the invention coupled thereto, is referred to as an affinity matrix. For the purposes of purification of insulin from a sample, the sample containing the insulin to be purified is suitably applied to such an affinity matrix under con- ditions that are conducive to binding of insulin to the matrix. Thereafter, the affinity matrix is washed under, conditions such that the binding of insulin to the matrix is maintained, but most, ideally all, other proteins and contaminants bound to the matrix are washed away. In an elution step, the matrix is treated such that the insulin is released from the matrix in an insulin enriched fraction denoted "insulin fraction", which may be recovered. If, conversely, the purpose of the separation is the removal of insulin, essentially the same steps as above are suitably followed, with some exceptions. The sample containing the insulin to be removed is suitably applied to an affinity matrix under conditions that are conducive to binding of insulin to the matrix. Thereafter, the affinity matrix is washed under conditions such that the binding of insulin to the matrix is maintained, but most, ideally all, other proteins are recovered in the flow- through, thus obtaining a "depleted fraction" with a sub- stantial reduction in insulin content, which is recovered. Thus, Ahe non-insulin constituents of the sample, that were discarded in the purification method above, may instead be retained and used and/or processed further. As a further alternative of the inventive method, both the "depleted fraction" and the "insulin fraction" may be recovered from the same separation run. Then, once again, the sample containing insulin is suitably applied to an affinity matrix under conditions that are conducive to binding of insulin to the matrix. Thereafter, the affinity matrix is washed under conditions such that the binding of insulin to the matrix is maintained, but most, ideally all, other proteins are recovered in the flow- through. The thus obtained "depleted fraction" with a substantial reduction in insulin content is recovered. In an elution step, the matrix is treated such that the insulin is released from the matrix in an insulin enriched fraction denoted "insulin fraction", which is recovered. In a further aspect, the invention is directed to an affinity matrix comprising a polypeptide according to the invention as described above . , Yet another aspect of the present invention is constituted by the use of an insulin binding polypeptide as described herein in a method of detecting insulin in a biological fluid sample. This method comprises the steps of (i) providing a biological fluid sample from a patient to be tested, for example a blood plasma sample for the measurement of plasma insulin levels, (ii) applying an insulin binding polypeptide as described herein to the sample under conditions such that binding of the polypeptide to any insulin present in the sample is enabled, (iii) removing non-bound polypeptide, and (iv) detecting bound polypeptide. The amount of the detected bound polypeptide is correlated to the amount of insulin present in the sample. In step (ii) , the application of insulin binding polypeptide to the sample may be performed in any suitable format, and includes for example the situation when the insulin binding polypeptide is immobilized on a solid support with which the sample is brought into contact, as well as set-ups in which the insulin binding polypeptide is present in solution. The method according to this aspect of the invention may for example find application in the diagnosis of hypoglycemia, insulin resistance, glucose intolerance and/or insulinoma, in distinguishing between insulin- and non-insulin-dependent diabetes, and in determination of the beta-cell reserve. The method according to this aspect of the invention may suitably be performed in a standard 96-well format, in analogy to existing ELISA tests. As a preferred alternative, the polypeptide according to the invention is used as one or more reagent (s) in a sandwich assay, whereas an monoclonal or polyclonal antibody directed against insulin may be used as other reagents. A sandwich assay using the SPA domain derived insulin binding molecule as either capture or detection agent shows several advantages compared to using conventional antibody reagents for both capture and detection. One specific such advantage is the elimination of false positive results in the absence of, insulin, which false positives -are due to crosslinking between capture and detection antibodies by for example heterophilic anti-animal Ig antibodies (HAIA) . As an additional aspect, the invention provides the use of an insulin binding polypeptide as described herein in a method of detection of insulin in tissue samples. This method comprises the steps of (i) providing a tissue sample suspected of containing insulin, for example a cryostat section or a paraffin-embedded section of pancreatic tissue, (ii) applying an insulin binding polypeptide according to the invention to said sample under conditions conducive for binding of the polypeptide to any insulin present in the sample, (iii) removing non-bound polypeptide, and (iv) detecting bound polypeptide. The amount of the detected bound polypeptide is correlated to the amount of insulin present in the sample. Brief ^■ description of the drawings Figure 1 shows an alignment of the sequences of the sequence listing. The amino acid positions that have been subjected to modification in the polypeptides Zi_nsuii_n according to the invention (represented by SEQ ID NO: 2 -14) are indicated in bold. Figure 2 is a diagram of the A₂₈o signals for insulin binding by the Zinsuiin polypeptides..obtained in an ELISA experiment. Figure 3 is a schematic illustration of the amino acid sequence of a fusion polypeptide according to the invention. Zi_nSuiin represents an insulin binding domain with a sequence selected from SEQ ID NO: 2 -10 and ABD represents the albumin binding domain of streptococcal protein G. Figure 4 shows the result of gel electrophoresis of purified fusion proteins expressed in Example 2. Lane 1: Molecular weight marker (MultiMark™) ; Lane 2 : Zi_nsii _A- ABD ; Lane 3 : Zi_nΞuiin _B-ABD ; Lane 4 : Zinsu i_{n C}-ABD ; Lane 5 :

Zi_nsuii_{n D}- ABD ; Lane 6 : Zi_nsui _{n E}-ABD ; Lane 7 : Z_insuιi_n ~ABD ; , Lane 8 : Zi_nsuii_n G-ABD ; Lane 9 : Z_insui_{in H}-ABD ; Lane 10 : Zi_nSuiin i-ABD ; Lane 11 : Z_inSuiin j-ABD . Figure 5 shows Biacore sensorgrams obtained after injection of the indicated Zi_nsuii_n-ABD fusion proteins over sensor chip surfaces having insulin immobilized thereto. A: Zi_nsuiin _A-ABD; B: Z_insuι_{in B}-ABD; C: Zi_nsii_{n D}~ABD; D: Zi_nsuii_{n E}-ABD; E: Zi_nsuii_{n F}~ABD; F: Zi_nsuii_{n G}~ABD; G: Z_nsuii _H-ABD; H: Z_insuι_in i-ABD; I: Z_insu_lin j-ABD. Figure 6 shows Biacore sensorgrams obtained after injection of insulin over sensor chip surfaces having the indicated Zi_nsuii_n-ABD fusion proteins immobilized thereto. Figure 7 is a schematic illustration of the amino acid sequences of A: a tagged polypeptide with a C- terminal cysteine residue according to the invention, B: a tagged dimer of polypeptides according to the invention, the dimer having a C-terminal cysteine residue, C: a tagged trimer of polypeptides according to the invention, the trimer having- a C-terminal cysteine residue, and D: a tagged tetramer of polypeptides according to the invention, the tetramer having a C-terminal cysteine residue. His₆ represents a hexahistidyl. tag and Z_ns_uiin represents an insulin binding domain with a sequence selected from SEQ ID NO: 2 and 10. Figure 8 shows the result of gel electrophoresis of purified proteins expressed in Example 3. Lane 1: Molecu- lar weight marker; Lane 2: His₆-Zi_nsuiin A-Cys; Lane 3: His₆- (Zi_nsuii_{n A})₂-Cys; Lane 4: His_ε-Z_insuii_n j-Cys ; Lane 5: His_e-

( Zinsuiin j) 2 ~CyS . Figure 9 shows the result of Biacore analysis of the proteins expressed in Example 3. A: His_s-Zi_nsuii_{n A}-Cys; B: His₆- ( Zinsuiin A) 2 - Cys ; C : His_e- Zin_Suiin J-Cys ; D : His₆- (Z_inSulin σ) ₂-Cys . Figure 10 illustrates affinity chromatography on a thiol-coupled Zi_nsuii_n column. His₆- ( i_nSuii A) 2-Cys was immobilized via the free C-terminal cysteine on Activated Thiol Sepharose™ 4B as described in Example 3. A: Chroma- togram: 100 μg insulin was loaded onto the column. Ab- , sorption at 280 nm was used to detect proteins and absorption at 343 nm was used to detect 2-thiopyridone released during coupling of insulin binding polypeptide ac- cording to the invention to the column matrix. The second peak corresponds to the blocking of unused thiol sites using a low concentration of DTT (5 mM) . The third peak corresponds to the elution of insulin. The last large peak corresponds to insulin binding polypeptide according to the invention released by elution with 25 mM DTT. B:

Enlargement of the insulin elution section of the chro a- togram shown in A. C: Coomassie stained PAGE. Lane 1: insulin standard; Lane 2: elution fraction A7; Lane 3: elution fraction A8 ; Lane 4-5: empty; Lane 6: molecular weight marker. Figure 11 illustrates affinity chromatography on a thiol-coupled Zinsiin column . His₆- (Zi_nSuii_n j) 2-Cys was immo- bilized via the free C-terminal cysteine on Activated Thiol- Sepharose™ 4B as described in Example 3. A: Chroma- togra : An E. coli lysate spiked^' with insulin was loaded onto the column. The first peak represents the flow- through. Unbound proteins were removed by a washing step. The second peak represents the eluted insulin and the third peak represents Z_nsuiin molecules released by elution with 25 mM DTT. Proteins in the column fractions were analyzed by PAGE using 4 - 12. % BisTris NuPAGE gels. B: Coomassie stained PAGE. Lane 2: molecular weight marker; Lane 3: empty; Lane 4: insulin spiked lysate as loaded; Lane 5: flow-through; .Lane 6: empty; Lane 7: eluted fractions; Lane 8: insulin standard; Lane 9: empty; Lane 10: released Zinsuiin molecules; Lane 11: stan- dard of Zinsuii_n molecules. C: Silver stained PAGE. Lane 2: insulin spiked lysate as loaded; Lane 3 : flow-through; Lanes 4-5: empty; Lane 6: eluted fractions; Lane 7: insulin standard; Lanes 8-9: empty; Lane 10: molecular weight marker; Lane 11: empty; Lane 12: released Zinsuiin mole- cules. Figure 12 shows the result of an ELISA experiment , with His₆- ( i_nsuii_{n A}) ₂-Cys immobilized onto high binding plates and a two fold dilution series of biotinylated insulin from 45 pg/ml to 47 ng/ml. Detection was done with streptavidin poly-HRP 1:5000 (black diamonds, ♦), streptavidin poly-HRP 1:10000 (dark grey squares, ■) , mouse anti-biotin antibody (Dako #M0743, 1:500) in combination with anti-mouse antibody-HRP conjugate (Dako #051(102), 1:2000) (grey triangles, A) , and streptavidin-HRP 1:4000 (light grey circles, •) . The background level is indicated by the marks at 10 pg/ml. Figure 13 shows the result of an ELISA experiment with His_e- (Zi_nsuiin _J) -Cys, (grey circles, •) , His₆- (Zi_nSuiin j) ₂-Cys, (grey diamonds, ♦) , His₆- ( in_suii _J) ₃~Cys (dark grey squares, ■) , and His₆- (Zi_nSuiin _J) ₄-Cys (black triangles, A) , immobilized onto high binding plates and a two fold dilution series of biotinylated insulin from 45 pg/ml to 750 ng/ml. Streptavidin poly-HRP 1:5000 was used for detection. In addition, Figure 13 shows the result of an ELISA performed with the insulin binding polypeptide His₆- ( insuiin J) -Cys immobilized onto Sulfhydryl-Bind 96 well plate via the C-terminal cysteine (black open circles, o) . The invention will now be illustrated further through the non-limiting recital of experiments conducted in accordance therewith. In these experiments, several insulin binding polypeptides according to the invention were selected from a library of a multitude of different SPA domain related polypeptides, and subsequently characterized. Example 1

Selection and ELISA study of insulin binding polypeptides;

Library panning and clone selection A combinatorial phage display library was prepared essentially as described in Nord K et al (1995, supra) . The pool of this library which was used in the present , study comprised 8.7 x 10⁸ variants of protein Z (Affi- body^® molecules) , with random amino acid residues at positions 9, 10, 11, 13, 14, 17, 18, 24, 25, 27, 28, 32 and 35. Insulin binding Affibody^® molecules were selected in four panning cycles using human insulin as the target (recombinant human insulin from Roche Diagnostics (#1376479) , delivered in lyophilized form from a hydrochloric acid solution (pH 2.3)). Insulin was biotinylated at the two different pH values 7.4 and 8.9, and used in two parallel selection regimes. The outcome of the four selection cycles was four groups of clones. In total, 92 clones (23 from each selection group) were picked for phage ELISA in order to perform an analysis of their in- sulin binding activity. Phage ELISA for analysis of insulin binding Phages ^" from the clones obtained after four rounds of selection were produced in 96 well plates, and an Enzyme Linked ImmunoSorbent Assay (ELISA) was used for screening for phages expressing insulin binding Affibody^® molecules. Single colonies were used to inoculate 300 μl -TSB+YE medium (30.0 g Tryptic Soy Broth (Merck), 5.0 g yeast extract, water to a final volume of 1 1, auto- claved) supplemented with 2 % glucose and 100 μg/ml am- picillin in deep well 96 well plates and grown on a shaker over night at 37 °C. 5 μl overnight culture was added to 500 μl TSB+YE medium. supplemented with 0.1 % glucose and 100 μg/ml ampicillin in a new plate. After growing at 37 °C for 4 h, 50 μl of 1.4 x 10¹¹ pfu/ml (7 x 10⁹ pfu) helper phage M13K07 (New England Biolabs,

#N0315S) were added to each well, and the plates were incubated without shaking at 37 °C for 30 minutes. 350 μl TSB+YE supplemented with 100 μM IPTG, 25 μg/ml kanamycin and 100 μg/ml ampicillin were added' to each well, and the plates were incubated on a shaker overnight at 30 °C.

Cells were pelleted by centrifugation at 2500 g for 15 , minutes and supernatants, containing phages expressing Affibody^® molecules, were used in ELISA. 100 μl of 7.5 μg/ml of insulin or 100 μl of 0.75 μg/ml biotinylated insulin in PBS (2.68 mM KCl, 137 mM NaCl, 1.47 mM KH₂P0₄, 8.1 mM Na₂HP0₄, pH 7.4) were added to microtiter plates (Nunc #446612) and streptavidin coated microtiter plates (Nunc #236001) , respectively, and incubated overnight at 4 °C. After blocking wells with 1 % skim milk powder in PBS (blocking buffer) for 1 h at room temperature, 100 μl phage-containing supernatant and 50 μl blocking buffer were added. The plates were incubated for 2 h at room temperature. A polyclonal antibody (rabbit anti-M13, Abeam #ab6188) was diluted 1:1000 in blocking buffer, and 100 μl were added to each well. The plate was incubated at room temperature for 1 h. A goat anti-rabbit IgG antibody conjugated with alka- line phosphatase (Sigma #A-3687) was diluted 1:10000 in blocking buffer, after which 100 μl were added to each well and incubated for 1 h at room temperature. Developing solution was prepared by dissolving Sigma-104 sub- strate (Sigma #104-105) in a 1:1 mixture of 1 M dietha- nolamine, 5 mM MgCl₂, pH 9.8 and water (1 tablet/5 ml of 1:1 mixture). Thereafter, 100 μl of the developing solution was added to each well. Wells were washed three times with PBS-T (PBS + 0.1 % Tween-20) before addition of each new reagent. 60 minutes after addition. of substrate, the plates were read at A₄₀s in an ELISA spectro- photometer (Basic Sunrise, Tecan) . Insulin binders were identified using a threshold criterion of an ELISA value of A_40B above 0.3. Results for the 13 clones giving an ELISA signal above this value are shown in Figure 2 , together with the result of a control experiment using the unmodified Z protein (Z_wt) . The 13 clones were denoted Zi_nSuiin A, Zi_nSuii_n B, Zinsuiin D, Zi_nSuiin E,

Zinsuiin F, insuiin G, "insulin H, Zi_nsulin I , -^insulin J, Zinsuiin K, _nsu_ lin L, Zinsuiin M and Zinsuiin N -

DNA sequence analysis Sequencing of DNA encoding these Affibody^® molecules was performed with ABI PRISM^® dGTP, BigDye™ Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's recommendations, using the biotinylated oligonucleotides AFFI-71 (5'- biotin-TGCTTCCGGCTCGTATGTTGTGTG) and AFFI-72 (5'-biotin- CGGAACCAGAGCCACCACCGG) . DNA coding for Affibody^® mole- cules was amplified by PCR using the oligonucleotides AFFI-21 (5'-TGCTTCCGGCTCGTATGTTGTGTG) and AFFI-22 (5'- CGGAACCAGAGCCACCACCGG) . The sequences were analyzed on an ABI PRISM^® 3100 Genetic Analyser (Applied Biosystems) . The sequences of the Affibody^® molecules ^'expressed by the 13 clones selected in the ELISA binding assay are given in Figure 1 (Zi_nSuiin) and identified in the sequence listing as SEQ ID NO: 2-14. Example 2 Expression and characterization of insulin binding fusion polypeptides Of the 13 phage clones identified in Example 1 as expressing insulin binding Z variants, the following 9 were selected for further study: Z_inSuiin A, Z_inSuiin B, Zi_nSuii

D, Zinsuiin E, nsuiin F, ^insulin G, ^insulin H, insuiin I and Zinsuiin J •

In the experiments of this Example., these polypeptides are collectively denoted Zinsuiin- All experiments were conducted with all 9, individually.

Expression and purification of ■ fusion polypeptides Fusion polypeptides were expressed in E. coli RV308 cells (Maurer R et al , J Mol Biol 139 (1980), 147-161,

ATCC #31608) , adapting Nilsson J et al , Eur J Biochem 224 (1994) , 103-108, and using conventional molecular biology methods for cloning. The expression vector used encodes a fusion polypeptide as schematically illustrated in Figure 3, in which Zi_nsuii_n represents the different insulin binding domains with SEQ ID NO:2-10 (see Figure 1), and ABD, represents the albumin binding domain of streptococcal protein G. The amino acid sequence of this domain is known, e g from Kraulis PJ et al , FEBS Lett 378:190 (1996) . Colonies of transformed cells were used to inoculate 100 ml TSB+YE medium supplemented with 100 μg/ml ampicillin. The cultures were grown at 37 °C to an OD₆oo = 1, followed by induction with a final concentration of 1 mM IPTG and incubation at 30 °C over night. The cells were harvested by centrifugation at 2500 g for 10 minutes and periplasmic proteins were released by osmotic shock. Cell pellets were resuspended in 25 ml osmotic shock buffer (20 % sucrose, 0.3 M Tris-HCl, 1 mM EDTA, pH 8.0) and incubated at room temperature for 10 minut.es. After centrifugation at 7000 g for 10 minutes, the cell pellet was resuspended in 25 ml ice-cold water and incubated on ice for 10 minutes. Cells were removed by centrifugation at 9500 g for 10 minutes and 1.25 ml 20 x TST buffer (1 x TST buffer is 25 mM Tris-HCl, 1 mM EDTA, 200 mM NaCl, 0.05 % Tween-20, pH 8.0) was added to the supernatants . The fusion polypeptides were purified using affinity chromatography on HSA-Sepharose (CNBr-activated Sepharose 4FF, Amersham Biosciences, #17-0981-03, with HSA, Pharmacia & Upjohn, #818476-01/5) . Empty PD-10 columns (Amersham Biosciences, #17-0435-01) were packed with 2 ml HSA- Sepharose and equilibrated with 40. ml TST buffer. Super- natants obtained after osmotic shock treatment were filtered using a 0.45 μm filter, diluted to a total volume 75 ml with TST buffer and applied to the columns. After washing first with 80 ml TST buffer and then with 5 ml _s NH₄Ac (5 mM, pH 5.5), proteins were eluted with 7 ml 0.5 M HAc, pH 2.8 in 1 ml fractions. Protein content in eluted fractions was determined specrophotometrically using absorption at 280 nm, and relevant fractions were pooled. Protein concentration of pooled samples was calculated from the measured absorption value at 280 nm and the theoretical extinction coefficient of the respective protein. Proteins in the elution fractions were analyzed by SDS-PAGE on a 4-12 % BisTris NuPAGE gel (Invitrogen) under non-reducing conditions (Figure 4) . The purity of the Affibody^®-ABD fusion proteins in the elution frac- tions was about 95 %, as indicated by the PAGE analysis.

Biosensor analysis of fusion polypeptides Binding of the purified fusion polypeptides to insulin was analyzed using surface plasmon resonance in a Biacore^® 2000 instrument (Biacore AB) . Insulin, polyclonal hlgG (Biovitrum AB, #027490) and Zi_nsuii_n-ABD fusion polypeptides were immobilized in different flow cells by amine coupling onto the carboxylated dextran layer on surfaces of CM-5 chips (research grade, Biacore AB) , ac- cording to the manufacturer's recommendations. One cell surface on each chip was activated and deactivated for use as reference cell during injections. Immobilization of insulin and polyclonal hlgG (for use as control) to CM-5 chip surfaces resulted in 560 and 3150 resonance units (RU) , respectively. Samples of fusion polypeptides were diluted in HBS-EP buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.005 % surfactant P-20, pH 7.4) to a final concentration of 10 μM, and injected in random order in duplicates at a constant flow-rate of 5 μl/min for 5 minutes. When injected sequentially over the surfaces in this manner, all nine fusion polypeptides (Zi_nSuii_n-ABD) exhibited binding to insulin (Figures 5A-5I) . For further, more detailed analysis of the insulin binding kinetics, the four fusion polypeptides Zin_suiin _A, _E, _{F a}n_d j-ABD were selected on the basis of the first Biacore results. The selection criteria were a fast insulin bind- ing on rate, medium to slow off rate and from zero to low binding to IgG. K_D values of selected fusion polypeptides were determined using a CM-5 chip containing 150 RU of immobilized insulin. Samples of insulin binding fusion polypeptides were injected as duplicates in random order at seven different concentrations (78 nM - 5 μM) at a flow rate of 30 μl/min. Injections were made during 5 . minutes followed by dissociation for 15 minutes. The surface was regenerated with 2 injections of 10 mM HCl. A blank surface was used as control. K_D values were calcu- lated using the 1:1 Langmuir binding model of the BIA- evaluation 3.2 software (Biacore AB) , and are given in Table 1.

TABLE 1 "insulin ~ ABD k_a (M^'V¹) k_d (s-¹) K_D (nM) A 1 . 1 X 10⁴ 43 x 10^"4 390 E 0 . 23 X 10⁴ 2 . 0 X 10^"4 88 F 3 . 0 x 10⁴ 54 x 1-0^"4 180 J 1 . 5 X 10⁴ 5 . 1 X 10^"4 35 Specific insulin binding was also detected in a reversed ^"experimental setup, i e with the fusion polypeptides Zi_nsuii_{n A}, E, F an J -ABD immobilized on a CM-5 sensor chip and insulin as analyte. Immobilized _wt-ABD was used as control. The immobilization levels of Z_wt, insuii _A, i_nsuii _E/ nsuii F and Zinsuiin J were 783, 880, 2600, 2300 and 2100 RU, respectively. All four fusion polypeptides could bind. insulin that was injected over the surfaces (Figure 6) .

Example 3

Expression and characterization of monomers and dimers of tagged insulin binding polypeptides, and use thereof as capture ligands in affinity chromatography

In this Example, the insulin binding polypeptides Zi_suii _A and Zinsuii J were studied further, and are sometimes collectively referred to as Zinsuiin- All experiments were performed with both of the insulin binding Z vari- ants.

Expression and purification _nsuii_n polypeptides were expressed in E. coli BL- 21(DE3) cells (Novagen #69450-4), using expression vec- tors encoding constructs that are schematically illustrated in Figure 7A and 7B. In the figure, His₆ represents a hexahistidyl tag, and Zinsuii_n represents either of the two insulin binding domains corresponding to SEQ ID NO: 2 (Zinsui A) and 10 (Zi_nsuiin j) • Both monomeric (Figure 7A) and dimeric (Figure 7B) constructs were prepared. A

C-terminal cysteine residue was provided in all constructs. E. coli BL-21(DE3) cells harboring the expression plasmids were grown in 100 ml TSB+YE medium supplemented with 50 μg/ml kanamycin in baffled shaker flasks at 37

°C. At OD₆₀o = 0.5, protein production was induced by adding IPTG to a final concentration of 1 mM, and cells were grown at 37 °C for 5 h. Cells were harvested by centrifugation ^"at 2400 g for 10- -minutes. Pellets were resuspended in IMAC binding buffer (10 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 8.0), and the cells were thereafter lysed by sonication. After centrifugation at 7000 g for 10 minutes, the supernatants were filtrated using a 0.45 μm filter. The produced proteins were isolated using immobilized metal ion affinity chromatography (IMAC) as follows: 3 ml Talon Metal Affinity Resin (Clontech, #8901) for each protein was washed twice with IMAC binding buffer (the resin was recovered in each step by centrifugation at 700 g for 2 minutes . after addition of buffer) . The supernatants were added to . the washed resin and incubated with head-over-tail rotation for 1 h at room tem- perature. Unbound proteins were removed by washing twice with 30 ml IMAC binding buffer, and the resin was resuspended in 10 ml IMAC binding buffer and transferred to an empty PD-10 column. After washing with an additional volume of 20 ml IMAC binding buffer, proteins were eluted with 5 ml IMAC elution buffer (250 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 8.0) in 0.5 ml fractions. Pro-, tein content in eluted fractions was determined spectro- photometrically at A₂₈o (using a Smartspec 3000 spectro- photometer, Bio-Rad) , and relevant factions were pooled. To perform buffer exchange, PD-10 columns were equilibrated with PBS, and samples were passed over these according to the manufacturer's recommendations. Protein concentration was determined using absorption at A_2so and the extinction coefficient of the respective Zi_nSuii poly- peptide. The purity of the proteins was analyzed by SDS- PAGE on 20 % polyacrylamide gels and stained with Coomassie brilliant blue R-250, using the Phast™ system (Amersham Biosciences) according to the manufacturer's recommendations. The total amount of IMAC chromatography purified protein from cultivations of transformants producing the proteins His₆-Zin_Suiin A-Cys, His_s- (Z_inSuii_n A) 2-Cys, His₆-Zi_nSuii_n j-Cys and His₆- (Zi_nsuiin _J) ₂-Cys was determined spectropho- tometrically at ₂so and is shown in Table 2.

TABLE 2 Total amount Protein/ culture

Polypeptide (mg) (μg/ml)

HlSg - Zinsulin A~ CyS 3 . 7 37

His₆- ( Zinsuiin A) 2 ~ CyS 4 . 6 46

His₆- Zinsulin j- Cys 3 . 1 31

His₆- ( Zinsuiin j) 2 ~ CyS 0 . 8 fr 8

The proteins were analyzed with SDS-PAGE on 20 % polyacrylamide gels under reducing conditions, using the Phast™ system (Figure 8) .

Biosensor analysis The interactions between the produced Z variants and insulin were analyzed using surface plasmon resonance on a Biacore^® 2000 system. Human insulin or human polyclonal hlgG, used as control, was immobilized in different flow cells by amine coupling onto the carboxylated dextran layer on surfaces of a CM-5 chip, according to the manufacturer's recommendations. Immobilization of human insulin and human IgG resulted in 560 and 3150 resonance units (RU) , respectively. A third flow cell surface was activated and deactivated for use as blank during injections. The proteins were diluted in HBS-EP to a final concentration of 14 μM for the monomers and 8.5 μM for the dimers, and injected in random order in duplicates at a constant flow-rate of 10 μl/minute. The ability of the purified proteins His₆-Zi_nsuii_{n A}-Cys, His₆- (Zi_nSuii_{n A}) ₂-Cys, His₆-Zinsuiin J-Cys and His₆- ( insuiin J) 2-Cys to interact with insulin was confirmed, as illustrated by the sensorgrams of Figures 9A-9D. Furthermore, K_D, k_a and k_d values were determined for His₆-Zi_nsuii _A-Cys and His₆- i_nSuii j-Cys . CM-5 chips containing 500 and 240 RU of His₆-Zi_nsuiin A-Cys and His₆-Zin_Suiin _J- Cys respectively were used. The Z variants were immobilized by thiol coupling -according to the manufacturer's instructions. Eight different insulin concentrations (39 nM - 5 • μM) were prepared in HBS-EP and injected as duplicates at a flow-rate of 50 μl/minute. The total injection time was 5 minutes (association) followed by a wash during 10 minutes (dissociation) . The surfaces were regenerated with 2 injections of 10 mM HCl. The responses measured in reference cells (activated/deactivated surface) were subtracted from the response measured in the cells with immobilized Zi_nSuiin polypeptides. K_D, k_a and k_d values were calculated using BIAevaluation 3.2 software (Biacore AB, "separate k_a and k_d" ) and are given in Table 3. The calculations were based on the first 30-60 seconds of the association and dissociation phases from curves corresponding to the five lowest concentrations.

Affini ty chromatography His-tagged dimers of Zi_nsuiin A and Zi_nSuiin J provided with terminal cysteines, i e His₆- (Zi_nsuiin _A) 2-Cys and His₆ ( i_nsuii_{n J}) ₂-Cys, were coupled to Activated Thiol Sepharose™ 4B (Amersham Biosciences #17-0640-01) according to the manufacturer's recommendations, using the introduced, unique cysteine residue. The proteins were reduced by the addition of dithiothreitol (DTT) to a final concentration of 20 mM, and incubated at 37 °C for 30 minutes. DTT was removed on a NAP-5-column (Amersham Biosciences #17-0853- 01) and the buffer was exchanged to thiol column buffer (PBS, 0.1 M NaCl, 1 mM EDTA, pH 7.7; final concentration of NaCl 237 mM) . After buffer exchange, the concentration of His₆- (Zi_nsuii_{n A}) 2-Cys was 0.65 mg/ml, whereas that of His_e- (Zi_nsuii_{n J}) ₂-Cys was 0.5 mg/ml. Immediately after the buffer exchange, 1 ml of each protein solution was loaded onto a HR 5/5 column (Amersham Biosciences #18-0383-01) packed ^"with^"1.0 ml of Activated Thiol Sepharose™ 4B . The time of contact between the column matrix and the protein solution was 1 hour. Unbound Z variants and the released 2-thiopyridone were removed by washing with thiol column buffer. Remaining activated thiol-sites on the matrix were blocked by injection of a pulse of 2 ml 2 mM DTT in PBS. The column was washed and equilibrated with thiol column buffer at a flow-rate of 0..4 ml/min. Purified human insulin was used to prove the insulin binding activity of the affinity columns thus generated. Both columns, i e containing either His₆- (Z_nSuii_{n A}) ₂-Cys or His₆- (Zi_nsuii _J) ₂-Cys as affinity, ligand, were loaded sev- eral times with 100 μg insulin in 1 ml thiol column buffer, followed by a washing step and subsequent elution with 0.2 M HAc, pH 3.1. As shown for the column with immobilized His₆- (Zi_nsuii_{n A}) 2-Cys, insulin was eluted from the column (Figure 10) . Similar results were obtained for the column with immobilized His₆- (Zi_nΞuiin J) 2-Cys . In addition, the specificity for insulin of the generated columns was analyzed. In these experiments, the , columns were loaded with a complex mixture of proteins, constituted by a total protein lysate from E. coli strain RRIΔM15 (Rύther U, Nucleic Acids Res 10 (1982), 5765-72) spiked with insulin. In total, 200 μg insulin spiked into 12 mg E. coli-lysate was loaded onto the columns (ratio of insulin to E. coli protein of 1:60) . The generated columns retained insulin very efficiently. No insulin could be detected in the flow-through fractions by SDS- PAGE analysis (Figure 11) . Analysis of the column elution fractions on Coomassie stained PAGE indicated that insulin was eluted with more than 95 % purity from the complex mixture of E. coli proteins. Further analysis of the elution fractions, using a more sensitive staining tech- nique (silver stain) , showed a purity of 99-100 % of the^' eluted insulin (Figures 11B and 11C) . Example 4 Use of monomers, dimers-, trimers and tetramers of tagged insulin binding polypeptides as capture reagents in ELISA In this example, the insulin binding polypeptides insuii_{n A} and Zinsuiin J were studied further with respect to their use as capture reagents in ELISA. The two insulin binding Z variants were expressed in E. coli BL21 (DE3) cells (Novagen #69450-4) , using expression vectors encod- ing constructs that are schematically illustrated in Figure 7. As before, His_ε represents a hexahistidyl tag, and Zi_nsuii_n represents either of the two insulin binding domains corresponding to SEQ ID NO: 2 (Zinsuiin A) and 10 (Zinsuii_{n J}) - Monomeric (Figure 7A) , dimeric (Figure 7B) , trimeric (Figure 7C) and tetrameric (Figure 7D) constructs were prepared. A C-terminal cysteine residue was provided in all constructs. Expression and purification of the insulin binding polypeptides was done as described in Example 3.

ELISA His -tagged monomers , dimers, trimers and tetramers of Z _nsuii_{n A} and Zi_nsuiin J , provided with C-terminal cys- teines , namely His₆- ( Z_inSuiin A) 2 -Cys , His₆- (Zinsuiin J) -Cys , Hi S_S- (Zi_nsuii_n j) ₂ -CyS , Hi S_S- ( Zi_nsuii_n j) 3 -CyS and Hi S_S- ( Zi_nsuii_n j)₄-Cys, were immobilized by adsorption onto the flat bottom of the wells of a high binding 96 well plate (Costar #9018) . For immobilization (also often referred to as coating) , each insulin binding polypeptide variant was diluted to a final concentration of 8 μg/ml in carbonate buffer (15 mM Na₂C0₃, 35 mM NaHC0₃, pH 9 . 6 ) . Coating of the wells was done with 100 μl of the polypeptide dilution at 4° C over night. The wells were washed four times with 350 μl per well of PBS-T (2.68 mM KCl, 137 mM NaCl, 1.47 mM KH₂P0₄, 8.1 mM Na₂HP0₄, pH7.4, 0.05 % v/v Tween 20) using a Skatron ScanWasher 300 (Molecular Devices) , and blocked using 300 μl blocking buffer (2 % w/v non fat dry milk in PBS-T) at room temperature (RT) for 1 hour. The blocking buffer was- -decanted and 100 μl of serial dilution of biotinylated insulin in PBS was added to each well and incubated at RT for 1.5 hours. The wells were washed as described above and incubated with 100 μl of streptavidin-HRP (HRP : horseradish peroxidase, 1:5000, Dako #P0397) or streptavidin-poly-HRP (1:5000 or 1:10000, RDI #PHRP80-SA1) at RT for one hour. All streptavidin derivate dilutions were done in PBS - The wells were washed as described above, and 100 μl 1-Step Ultra TMB (Pierce #34028) was added. The 96 well plates were covered with aluminum foil and incubated at RT for a maximum of 30 minutes. The reaction was stopped by adding 100 μl of 2 M H₂S0₄, and the plates were read at 450 nm in an ELISA reader (Tecan Basic Sunrise) . In a parallel experiment, the insulin binding polypeptide His₆- (Zinsuiin J) -Cys was immobilized via the unique C-terminal cysteine on a Sulfhydryl-Bind 96 well plate ' (Costar #2509) , in order to achieve directed immobiliza- tion. Immobilization was done using 100 μl of 8 μg/ml polypeptide variant in PBS pH 6.5 supplemented with 1 mM EDTA and 0.0001 M dithiothreitol (DTT) at RT for 1 hour. The solution was decanted and the plate was washed three times with PBS. Blocking was done using 300 μl blocking buffer (0.2 % w/v non fat dry milk in PBS-T) at RT for 30 minutes. All other steps were performed as described above . Biotinylation of insulin (Roche Diagnostics #1 376 479) was done in PBS using a two fold molar excess of ΞZ- link Sulfo-NHS-LC-Biotin (Pierce #21335) and an insulin concentration of 1 mg/ml at RT for 30 min. Unbound biotinylation reagent was removed by buffer exchange to PBS pH 7.4 on NAP-5 columns (Amersham Biosciences #17-0853-01) . The protein concentrations were determined using the BCA assay (Pierce #23223 & 23224) and insulin as a standard. The number of biotin molecules per insulin molecule was determined using the HABA ( [2- (4' -hydroxyazobenzene) ] as- say (Pierce #28010) . On average, biotinylated insulin molecules contained 1.4-biotin molecules per insulin molecule. Figure 12 shows the result of an ELISA experiment with His₆- (Zi--_suiin _A) ₂-Cys immobilized onto high binding plates and a two fold dilution series of biotinylated insulin from 45 pg/ml to 47 ng/ml. Typical sigmoid binding curves were obtained. The sensitivity of insulin detection was dependent on the detection system used. The highest sensitivity was obtained with streptavidin poly- HRP 1:5000 (black diamonds, ♦) followed by streptavidin poly-HRP 1:10000 (dark grey squares, ■) , mouse anti- biotin antibody (Dako #M0743, 1:500) in combination with anti-mouse antibody-HRP conjugate (Dako #051(102), 1:2000) (grey triangles, A) , and streptavidin-HRP 1:4000 (light grey circles, •) . The background level is indicated by the marks at 10 pg/ml. Figure 13 shows an ELISA with monomer, dimer, trimer and tetramer of the insulin binding polypeptide Zinsuii _J, i e His_s- (Zinsuin J) -Cys, (grey circles, •) , His₆- (Z_insuii_{n σ})₂-Cys, (grey diamonds, ♦), His₆- (Zins_uii_{n J}) 3-Cys (dark , grey squares, ■) , and His₆- (Zi_nsuii_{n J}) ₄-Cys (black triangles, A) , immobilized onto high binding plates and a two fold dilution series of biotinylated insulin from 45 pg/ml to 750 ng/ml. Streptavidin poly-HRP 1:500 was used for detection. Typical sigmoid binding curves were obtained. The sensitivity of insulin detection was dependent on the number of insulin binding domains present in the protein. Highest sensitivity was obtained for the tetramer, followed by the trimer and the dimer of the insulin binding polypeptide Zi_nsuiin j- The background level is indicated by the marks at 10 pg/ml. The limit of detection (LOD) defined as the signal two-fold over background was 90 pg/ml for biotinylated insulin. In addi- tion, Figure 13 shows the result of the insulin binding polypeptide His₆- (Zinsuiin _J) -Cys immobilized onto Sulfhy- dryl-Bind 96 well plate via the C-terminal cysteine (black open circles, o) . The whole binding curve shifted to the. ^"left j to higher -insulin detection sensitivity. The LOD improved about 6-fold, from 94 ng/ml for His_s- ( insuin )-Cys, as immobilized by absorption, to 15 ng/ml for Hisg- (Zi_nsuii_{n J}) -Cys, as immobilized via the C-terminal cysteine. These data show that some of the insulin binding sites are shielded by the plastic surface of the 96 well plate due to random orientation of the insulin binding polypeptide if adsorption is used for immobilization, and that directed immobilization improved the insulin detection sensitivity in ELISA.

Claims

1. Polypeptide, which has a binding affinity for insulin such that the K_D value of the interaction is at most 1 x 10^"s M; and which is related to a domain of staphylococcal protein A (SPA) in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having from 1 to about 20 substitution mutations.

2. Polypeptide according to claim 1, which has a binding affinity for insulin such that the K_D value of the interaction is at most 1 x 10^~7 M.

3. Polypeptide according to claim 1 or 2, the se- quence of which corresponds to the sequence of SPA protein Z, as set forth in SEQ ID N0:1, comprising from 1 to about 20 substitution mutations.

4. Polypeptide according to claim 3, comprising from 4 to about 20 substitution mutations.

5. Polypeptide according to claim 3 or 4, comprising substitution mutations at one or more of the positions 10, 13, 25, 27, 32 and 35.

6. Polypeptide according to claim 5, additionally comprising substitution mutations at one or more of the positions 9, 11, 14, 17, 18, 24 and 28.

7. Polypeptide according to any one of claims 3-6, comprising a substitution mutation at position 13 from phenylalanine to an amino acid residue selected from tyrosine and tryptophan.

8. Polypeptide according to claim 7, in which the substitution mutation at position 13 is from phenylalanine to tryptophan.

9.^" Polypeptide according to claim 8, the amino acid sequence of which is as set out in any one of SEQ ID NO:3-4, 6-9 and 11-14.

10. Polypeptide according to any one of claims 3-9, comprising a substitution mutation at position 32 from glutamine to an amino acid residue selected from asparagine, aspartic acid and glutamic .acid.

11. Polypeptide according to claim 10, in which the substitution mutation at position 32 is from glutamine to an amino acid residue selected from aspartic acid and glutamic acid.

12. Polypeptide according to claim 11, in which the substitution mutation at position 32 is from glutamine to glutamic acid.

13. Polypeptide according to claim 12, the amino acid sequence of which is as set out in any one of SEQ ID NO: 2 -5, 7, 9 and 11.

14. Polypeptide according to any one of claims 3-13, comprising a substitution mutation at position 25 from glutamic acid to glutamine.

15. Polypeptide according to claim 14, the amino acid sequence of which is as set out in any one of SEQ ID NO: 4, 7 and 10.

16. Polypeptide according to any one of claims 3-15, comprising a substitution mutation at position 27 from arginine to tyrosine.

17. Polypeptide according to claim 16, the amino acid sequence of which -is as set out in any one of SEQ ID NO: 2, 4-5 and 9.

18. Polypeptide according to any one of claims 3-17, comprising a substitution mutation at position 10 from glutamine to tryptophan.

19. Polypeptide according to claim 18, the amino acid sequence of which is as set out in any one of SEQ ID NO: 2, 6, 8-9 and 13.

20. Polypeptide according. to any one of claims 3-19, comprising a substitution mutation at position 35 from lysine to arginine.

21. Polypeptide according to claim 20, the amino acid sequence of which is as set out in any one of SEQ ID NO: 2 -4 and 7-8.

22. Polypeptide according to any preceding claim, in which at least one of the asparagine residues present in the domain of staphylococcal protein A (SPA) to which said polypeptide is related have been replaced with an- other amino acid residue.

23. Polypeptide according to claim 22, the sequence of said domain of staphylococcal protein A (SPA) corresponding to the sequence of SPA protein Z as set forth in SEQ ID NO:l, and the polypeptide comprising substitution mutations at at least one position chosen from N3 , N6, Nil, N21, N23, N28, N43 and N52.

24. Polypeptide according to claim^' 3, comprising at least one of the following mutations: N3A, N6A, N6D,

N11S, N23T, N28A and N43E.

25. Polypeptide, which constitutes a fragment of a polypep^'tide ^'according to any preceding claim, which fragment retains binding affinity for insulin.

26. Polypeptide according to any preceding claim, which comprises additional amino acid residues at either terminal .

27. Polypeptide according to .claim 26, in which the additional amino acid residues comprise a cysteine residue at the N- or C-terminal of the polypeptide.

28. Polypeptide according -to any one of claims 26-

27, in which the additional amino acid residues comprise a tag, preferably chosen from a hexahistidinyl tag, a myc tag and a flag tag.

29. Polypeptide according to any one of claims 26-

28, in which the additional amino acid residues comprise at least one functional polypeptide domain, so that the polypeptide is a fusion polypeptide between a first moi ety, consisting of the polypeptide according to any one of claims 1-25, and at least one second and optionally further moiety or moieties.

30. Polypeptide according to claim 29, in which the second moiety consists of one or more polypeptide (s) according to any one of claims 1-25, making the polypeptide a multimer of insulin binding polypeptides according to any one of claims 1-25, the sequences of which may be the same or different .

31. Polypeptide according to claim 29, in which the second moiety comprises at least one polypeptide domain capable of binding to a target molecule other than insulin.

32. Polypeptide according to claim 31, in which the second moiety comprises- at least one polypeptide domain capable of binding to human serum albumin.

33. Polypeptide according to claim 32, in which the at least one polypeptide domain capable of binding to human serum albumin is the albumin binding domain of streptococcal protein G.

34. Polypeptide according claim 31, in which the second moiety comprises a polypeptide which is related to a domain of staphylococcal protein A (SPA) in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having from 1 to about 20 substitution mutations.

35. Polypeptide according claim 34, in which the sequence of the second moiety polypeptide corresponds to the sequence of SPA protein Z, as set forth in SEQ ID N0:1, having from 1 to about 20 substitution mutations.

36. Polypeptide according to claim 29, in which the second moiety is capable of enzymatic action.

37. Polypeptide according to claim 29, in which the second moiety is capable of fluorescent action.

38. Polypeptide according to claim 29, in which the second moiety is a phage coat protein or a fragment thereof.

39. Polypeptide according to any preceding claim, which comprises a label group.

40. Polypeptide according to claim 39, in which the label group is chosen from fluorescent labels, biotin and radioactive labels.

41^". Nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide according to any one of claims 1-38.

42. Expression vector comprising the nucleic acid molecule according to claim 41.

43. Host cell comprising the expression vector ac- cording to claim 42.

4 . Use of a polypeptide according to any one of claims 1-40 in a method of affinity separation.

45. Method of separation of insulin present in a sample from other constituents in the sample, comprising a step of affinity separation, in which step a polypeptide according to any one of claims 1-40 is used.

46. Method according to claim 45, comprising the steps: a) application of the sample to an affinity matrix comprising a polypeptide according to any one of claims 1-40 under conditions that are conducive to binding of insulin to the affinity matrix; b) washing the affinity matrix for removal of substances not bound thereto; and c) eluting the bound insulin from the affinity matrix, thus obtaining an insulin fraction with an enriched insulin content; and d) recovering said insulin fraction.

47. Method according to claim 45, comprising the steps: a) application of the sample to an affinity matrix comprising a polypeptide according to any one of claims 1-40 under conditions that are conducive to binding of insulin to the affinity- -matrix; b) washing the affinity matrix for recovery of substances not bound thereto, thus obtaining a depleted fraction with a substantially reduced insulin content; and c) recovering said depleted fraction.

48. Method according to claim.45, comprising the steps: a) application of the sample to an affinity matrix comprising a polypeptide according to any one of claims 1-40 under conditions that are - conducive to binding of insulin to the affinity matrix; b) washing the affinity matrix for recovery of substances not bound thereto, thus obtaining a depleted fraction with a substantially reduced insulin content; and c) eluting the bound insulin from the affinity ma- trix, thus obtaining an insulin fraction with an enriched insulin content; and d) recovering said insulin fraction and said depleted fraction.

49. Affinity matrix comprising a polypeptide according to any one of claims 1-40.

50. Use of a polypeptide according to any one of claims 1-40 for insulin detection.

51. Method of detection of insulin in a sample, in which method a polypeptide according to any one of claims 1-40 is used.

52. Method according to claim 51, comprising the steps: (i) providing a sample to be tested, (ii) applying a polypeptide according to any one of claims 1-40 to the sample under conditions such that binding of the polypeptide to any^" insulin present in the sample is enabled, (iii) removing non-bound polypeptide, and (iv) detecting bound polypeptide.

53. Method according to claim 52, in which the sample is a biological fluid sample, preferably a human blood plasma sample.

54. Method according to claim 52, in which the sample is a tissue sample.