WO2005075507A1

WO2005075507A1 - Amyloid beta peptide binding polypeptide

Info

Publication number: WO2005075507A1
Application number: PCT/SE2005/000159
Authority: WO
Inventors: Nina Herne; Mårten ÖSTERLUND
Original assignee: Affibody Ab
Priority date: 2004-02-09
Filing date: 2005-02-08
Publication date: 2005-08-18
Also published as: SE0400274D0

Abstract

An amyloid beta peptide binding polypeptide is provided, which is related to a domain of staphylococcal protein A (SPA) in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having 1 to about 20 substitution mutations. Nucleic acid encoding the polypeptide, expression vector comprising the nucleic acid, and host cell comprising the expression vector are also provided. Also provided are methods comprising a step of affinity separation or detection, in which step a polypeptide according to the invention is used. Such methods may be used for reducing the content of amyloid beta peptide in a body fluid. The use of an amyloid beta peptide binding polypeptide as a medicament is also provided.

Description

AMYLOID BETA PEPTIDE BINDING POLYPEPTIDE

Field of the invention The present invention is related to a new polypeptide, which binds to an amyloid beta peptide, and to the use of such polypeptide in a method of affinity separa- tion, for example in a method for reducing the content of amyloid beta peptide in a body fluid, in diagnostics of Alzheimer's disease, in histochemical analyses and in other areas of application. The invention also relates to the use of such an amyloid beta peptide binding polypep- tide as a medicament. The polypeptide is related to a domain of staphylococcal protein A (SPA) , in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having at least one substitution mutation.

Background

Affibody® molecules Molecules related to protein Z, derived from domain B of staphylococcal protein A (SPA) (Nilsson B et al (1987) Protein Engineering 1, 107-133), have been selected from a library of randomized such molecules using different interaction targets (see e g W095/19374; WO00/63243; Nord K et al (1995) Prot Eng 8:601-608; Nord K et al (1997) Nature Biotechnology 15, 772-777) . Differ- ent target molecules have been used to select such protein Z derivatives, e g as described in Nord K et al (1997, supra ) . The experiments described in this reference outline principles of the general technology of selecting protein Z derivatives against given targets, rather than being a study directed towards the express objective of obtaining a molecule with high enough affinity for use in a specific therapeutic or biotechnological application. Amyloid beta peptide and its role in Alzheimer' s disease Many different diseases, such as Alzheimer's disease, type II diabetes, primary and secondary systemic amyloidosis, and familial amyloid polyneuropathy 1, have been recognized as belonging to the ever-growing family of amyloid diseases. All amyloid diseases have in common the presence of extracellular protein aggregates that may or may not be fibrillar. An attractive strategy for developing therapies for amyloid diseases is thus to in- hibit or reverse protein/peptide aggregation (Mason J et al , Curr Opin Struct Biol 13:526-532 (2003)). A recent review of therapeutic strategies for combating amyloid diseases in general is Sacchettini and Kelly, Nat Rev Drug Discov 1:267-275 (2002). There is great need for a treatment that targets the amyloidogenic intermediates of these diseases and not merely through their stabilization, but rather through their increased clearance. Alzheimer's disease is one of the most studied amyloid diseases, primarily due to its widespread occurrence and the fact that there is currently neither a cure nor a treatment available to reverse its effects. Alzheimer's disease is among the most common diseases of advanced age, affecting almost one out of ten individuals who survive beyond the age of 65 years, and another 10 % for each additional decade of the life span. Alzheimer's Disease International estimates that there are 18 million cases of dementia worldwide, of which 12 million cases are Alzheimer's disease. Current treatments for Alzheimer's disease provide only modest symptomatic relief, for periods between six and eighteen months. Since current compounds only provide symptomatic relief, there is great need for therapies that slow the course of the disease and prevent or delay the disease in susceptible individuals. The exact cause of Alzheimer's disease is unknown, but it has been suggested that a key event in Alzheimer's disease pathogenesis is the conversion of the amyloid beta peptide (Aβ) from soluble to aggregated form, as well as protein deposition in tissues. This process is believed to give rise to amyloid plaques, which are characteristic for Alzheimer's disease. Aβ is predominantly found to be 39-43 amino acids in length, appearing most frequently in a 40 amino acid form and/or a 42 amino acid form. It is a normal, soluble product of proteolysis of the amyloid precursor protein (APP) , and is generated in different body tissues and fluids (Neve RL et al , Brain Research 886:54-66 (2000)). Among treatments for Alzheimer's disease are antibody-mediated chronic therapies, i e passive immunization schemes, wherein antibodies to e g the amyloid beta peptide are administered to the patient. Currently however, few antibodies have been approved for long-term treatment. Bard et al, Proc Natl Acad Sci USA 100:2023-2028 (2003) , is a publication of a recent study of antibodies directed against Aβ . This article provides an overview of the current state of this technology, and the references cited therein can be consulted for further information on passive immunization. As an example of antibodies for use as therapeutic agents against Alzheimer's disease, F Hoffmann - La Roche and MorphoSys AG have developed phage display-derived human antibodies against Aβ, that bind to human amyloid plaques in vitro and in vivo in a mouse model of Alzheimer's disease. The antibodies were selected from a synthetic human combinatorial antibody library based on phage display (poster by Bohrmann B et al , IBC 14^th Annual International Conference on Antibody Engi- neering (30 Nov - 3 Dec 2003) San Diego, CA, USA) . Drawbacks of the approach of passive immunization with antibodies include the facts that only a transient effect is achieved, that the antibodies used are large proteins meaning they are problematic to administrate, and that the cost of such transient treatments with protein pharmaceuticals is exceedingly high. Another method for treatment of Alzheimer's disease is through active immunization, wherein Aβ itself is administered to a subject, leading to the formation of endogenous antibodies towards Aβ . Recent clinical studies conducted by Elan Corporation and yeth, however, have given rise to signs of central neuroinflammation and were therefore discontinued in the exploratory phase IIA study. At the moment, it is unclear whether it is possible to develop immunization treatments in Alzheimer's disease without similar harmful side effects. A representative, recent publication on the approach of active immunization is Hock et al, Neuron 38:547-554 (2003). There is evidence for a high significant correlation between plasma levels and brain levels of Aβ . Hence, an active lowering of the levels of Aβ in plasma may initiate a net efflux of Aβ from the brain into the periphery, so that this lowering would act as a peripheral sink (De- Mattos RB et al , Science 295:2264 (2002)). Furthermore, it has been suggested that this lowering of the Aβ levels in the brain of Alzheimer's disease patients could be achieved via extracorporeal removal of plasma Aβ through immunoabsorption using Aβ-specific antibodies (see e g a project proposal by Germino K, Northwestern University, Chicago, IL, USA, available at least from 9 Dec 2003 to 5 Feb 2004, on http: //mstp. northwestern. edu/M2JC_2003/Germino_Proposal .p df) . The significance of extracorporeal removal of Aβ peptides is supported by the studies on active immunization performed in humans (e g Hock et al, supra ) . During these trials, it was observed that Aβ immunization generated antibodies that were able to bind Aβ peptides, locally as well as in the periphery, thereby reducing the aggregation of the Aβ peptides and as such neutralizing their pathogenicity. Extracorporeal removal of Aβ in a body fluid of a subject have the advantage to other treatments of Alzheimer's disease of being non-invasive, hence also non-toxic to the subject. Whether the object is to find a novel therapeutic strategy for treating amyloid diseases, to establish novel methods for the separation of Aβ from other constituents in a sample, or some other application relying on Aβ binding, the provision of molecules having a binding affinity for the amyloid beta peptide is critical. Previously known antibodies and antibody related derivatives against Aβ are not always the optimal choice, due to the complexity of the antibody molecule. Thus, there is a continued need for novel and alternative molecules with a high affinity for Aβ, which can be used as reagents in various assays and processes where such an affinity is needed.

Disclosure of the invention It is an object of the present invention to meet this need through the provision of a polypeptide that exhibits specific binding to an amyloid beta peptide. A related object of the invention is an amyloid beta peptide binding polypeptide which exhibits little or no non-specific binding. It is another object of the invention to provide an amyloid beta peptide binding polypeptide that can readily be used as a moiety in a fusion polypeptide. Another object is the provision of an amyloid beta peptide binding polypeptide, which does not exhibit the known problems of stability experienced with antibody reagents, but provides a stable and robust structure with the ability to withstand harsh environmental conditions. Furthermore, it is an object to provide an amyloid beta peptide binding polypeptide, the properties of which enables easy coupling thereof to a matrix. A related object is to provide an amyloid beta peptide binding polypeptide, which enables efficient separa- tion of Aβ from other constituents of a sample. Preferably, such a polypeptide could also be used for reducing the content of Aβ in a body fluid of a human. It is also an object to provide a molecule which can be used as a reagent for the detection of Aβ at a low detection limit. A further object is to provide a novel medicament for the treatment of Alzheimer's disease. These and other objects are met by the invention as claimed in the appended claims. Thus, in a first aspect, the invention provides an amyloid beta peptide binding polypeptide, which is related to a domain of staphylococ- cal protein A (SPA) in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having 1 to about 20 substitution mutations. In accordance herewith, the present inventors have found that it is possible to obtain an amyloid beta pep- tide binding polypeptide through substitution mutagenesis of a domain from SPA. An embodiment of the polypeptide of the invention may have the ability to interact with Aβ with a K_D value of at most 5 x 10^~6 M. Preferably, the polypeptide of the invention has the ability to interact with Aβ with a K_D value of at most 1 x IO^-6 M. More preferably, the polypeptide of the invention has the ability to interact with Aβ with a K_D value of at most 9 x 10^"7 M. "An amyloid beta peptide" (abbreviated Aβ) refers to a peptide which may be from 1 to about 43 amino acids in length, but which is predominantly either 40 or 42 amino acids in length. As used herein, an amyloid beta peptide is a normal, soluble proteolytic product of the amyloid precursor protein (APP) . In the experiments presented below for illustration, Aβ₀ and Aβ₄₂ refers to an amyloid beta peptide being 40 and 42 amino acids in length, respectively. These peptides are also sometimes referred to in the literature as Aβι_₀ and Aβι_₄₂, respectively. For an overview of the processing of APP to Aβ peptides, see e g Golde TE et al , Science 255:728-730 (1992); Shoji M et al , Science 258:126-129 (1992); or Neve RL et al , supra . "Binding affinity for an amyloid beta peptide" refers to a property of a polypeptide which may be tested e g by the use of surface plasmon resonance technology, such as in a Biacore® instrument. Aβ binding affinity may be tested in an experiment wherein Aβ is immobilized on a sensor chip of the instrument, and a sample containing the polypeptide to be tested is passed over the chip. Alternatively, the polypeptide to be tested is immobilized on a sensor chip of the instrument, and a sample containing Aβ is passed over the chip. The skilled person may then interpret the sensorgrams obtained to establish at least a qualitative measure of the polypeptide' s binding affinity for the amyloid beta peptide. If a quantitative measure is sought, e g with the purpose to establish a certain K_D value for the interaction, it is again possible to use surface plasmon resonance methods. Binding values may e g be defined in a Biacore® 2000 instrument (Biacore AB) . Aβ peptide is immobilized on a sensor chip of the instrument, and samples of the polypeptide whose affinity is to be determined are prepared by serial dilution and injected in random order. K_D values may then be calculated from the results, using e g the 1:1 Langmuir binding model of the BIAevaluation 3.2 software provided by the instrument manufacturer. The polypeptide according to the invention may prove useful in any method relying on affinity for Aβ of a re- agent. Thus, the polypeptide may be used as a detection reagent, a capture reagent or a separation reagent in such methods, but also as a therapeutic agent in its own right or as a means for targeting other therapeutic agents to the amyloid beta peptide. Methods that employ the polypeptide according to the invention in vitro may be performed in different formats, such as in microtiter plates, in protein arrays, on biosensor surfaces, on tissue sections, and so on. Different modifications of, and/or additions to, the polypeptide according to the in- vention may be performed in order to tailor the polypeptide to the specific use intended, without departing from the scope of the present invention. Such modifications and additions are described in more detail below, and may comprise additional amino acids comprised in the same polypeptide chain, or labels and/or therapeutic agents that are chemically conjugated or otherwise bound to the polypeptide according to the invention. Furthermore, the invention also encompasses fragments of the polypeptide that retain the capability of binding to Aβ. As stated above, the sequence of the polypeptide according to the present invention is related to the SPA domain sequence in that 1 to about 20 amino acid residues of said SPA domain have been substituted for other amino acid residues. However, the substitution mutations introduced should not affect the basic structure of the polypeptide. That is, the overall folding of the C_α backbone of the polypeptide of the invention will be substantially the same as that of the SPA domain to which it is related, e g having the same elements of secondary structure in the same order etc. Thus, polypeptides fall under the definition of having the same fold as the SPA domain if basic structural properties are shared, those properties e g resulting in similar CD spectra. The skilled person is aware of other parameters that are relevant. This requirement of essentially conserving the basic structure of the SPA domain, upon mutation thereof, places restrictions on what positions of the domain may be subject to substitution. When starting from the known structure of the Z protein, for example, it is preferred that amino acid residues located on the surface of the Z protein may be substituted, whereas amino acid residues buried within the core of the Z protein "three-helix bundle" should be kept constant in order to preserve the structural properties of the molecule. The same reasoning applies to other SPA domains, and to the case when a fragment of an SPA domain is used. The invention also encompasses polypeptides in which an Aβ binding polypeptide described above is present as an Aβ binding domain, to which additional amino acid residues have been added at either terminal. These additional amino acid residues may play a role in the binding of Aβ by the polypeptide, but may equally well serve other purposes, related for example to one or more of the production, purification, stabilization, coupling or detection of the polypeptide. Such additional amino acid residues may comprise one or more amino acid residues added for purposes of chemical coupling, e g to a chromatographic resin to obtain an affinity matrix. An example of this is the addition of a cysteine residue at the very first or very last position in the polypeptide chain, i e at the N or C terminus. Such additional amino acid residues may also comprise a "tag" for purification or detection of the polypeptide, such as a hexahistidyl (Hisg) tag, or a " yc" tag or a "flag" tag for interaction with antibodies specific to the tag. The skilled person is aware of other alternatives. The "additional amino acid residues" discussed above may also constitute one or more polypeptide domain (s) with any desired function, such as the same binding function as the first, Aβ-binding domain, or another binding function, or an enzymatic function, or a fluorescent function, or mixtures thereof. Thus, the invention encompasses multimers of the polypeptide with affinity for Aβ . It may be of interest, e g in a method of purification of Aβ, to obtain even stronger binding of Aβ than is possible with one polypeptide according to the invention. In this case, the provision of a multimer, such as a dimer, trimer or tetramer, of the polypeptide may provide the necessary avidity effects. The multimer may consist of a suitable number of polypeptides according to the invention. These polypeptide domains according to the invention, forming monomers in such a multimer, may all have the same amino acid se- quence, but it is equally possible that they have different amino acid sequences. The linked polypeptide "units" in a multimer according to the invention may be connected by covalent coupling using known organic chemistry methods, or expressed as one or more fusion polypeptides in a system for recombinant expression of polypeptides, or joined in any other fashion, directly or mediated by a linker comprising a number of amino acids. Additionally, "heterogenic" fusion polypeptides, in which an Aβ binding polypeptide constitutes a first domain, or first moiety, and the second and further moieties have other functions than binding Aβ, are also con- templated and fall within the ambit of the present invention. The second and further moiety/moieties of the fusion polypeptide may comprise a binding domain with affinity for another target molecule than Aβ . Such a binding domain may well also be related to an SPA domain through substitution mutation at 1 to about 20 positions thereof. The result is then a fusion polypeptide having at least one Aβ-binding domain and at least one domain with affinity for said other target molecule, in which both domains are related to an SPA domain. This makes it possible to create multispecific reagents that may be used in several biotechnological applications. The preparation of such multispecific multimers of SPA domain related polypeptides, in which at least one polypeptide domain has affinity for Aβ, may be effected as described above for the multimer of several Aβ binding "units". In other alternatives, the second or further moiety or moieties may comprise an unrelated, naturally occurring or recombinant, protein (or a fragment thereof retaining the binding capability of the naturally occurring or recombi- nant protein) having a binding affinity for a target. An example of such a binding protein, which has an affinity for human serum albumin and may be used as fusion partner with an Aβ binding SPA domain derivative of the invention, is the albumin binding domain of streptococcal pro- tein G (SPG) (Nygren P-A et al (1988) Mol Recogn 1:69-

74) . A fusion polypeptide between an amyloid beta peptide binding, SPA domain-related polypeptide and the albumin binding domain of SPG thus falls within the scope of the present invention. When the polypeptide according to the invention is administered to a human subject as a therapeutic agent or as a targeting agent, the fusion thereof to a moiety which binds serum albumin may prove beneficial, in that the half-life in vivo of such a fusion protein may likely prove to be prolonged as compared to the half-life of the SPA domain related, Aβ binding moiety in isolation (this principle has been described e g in O91/01743) . Other possibilities for the creation of fusion polypeptides are also contemplated. Thus, an Aβ binding SPA domain-related polypeptide according to the first aspect of the invention may be covalently coupled to a second or further moiety or moieties, which in addition to or instead of target binding exhibit other functions. One example is a fusion between one or more Aβ binding polypeptide (s) and an enzymatically active polypeptide serving as a reporter or effector moiety. Examples of reporter enzymes, which may be coupled to the Aβ binding polypeptide to form a fusion protein, are known to the skilled person and include enzymes such as β-galactosidase, alkaline phosphatase, horseradish peroxidase, carboxypepti- dase. Other options for the second and further moiety or moieties of a fusion polypeptide according to the invention include fluorescent polypeptides, such as green fluorescent protein, red fluorescent protein, luciferase and variants thereof. In regard to the description above of fusion pro- teins incorporating Aβ binding polypeptide according to the invention, it is to be noted that the designation of first, second and further moieties is made for clarity reasons to distinguish between Aβ binding moiety or moieties on the one hand, and moieties exhibiting other func- tions on the other hand. These designations are not intended to refer to the actual order of the different domains in the polypeptide chain of the fusion protein. Thus, for example, said first moiety may without restriction appear at the N-terminal end, in the middle, or at the C-terminal end of the fusion protein. The invention also encompasses polypeptides in which an Aβ binding polypeptide as described above has been provided with a label group, such as at least one fluoro- phore, biotin or a radioactive isotope, for example for purposes of detection of the polypeptide. As examples of SPA related domains that are useful as starting points for the creation of a polypeptide according to the invention may be mentioned the five domains of naturally occurring staphylococcal protein A, i e a domain selected from the E domain, the D domain, the A domain, the B domain and the C domain (see for ex- ample Uhlen et al , J Biol Chem 259:1695-1702 (1984), reporting the original cloning of SPA) . Another example of an SPA related domain for use as a starting point for the creation of a polypeptide according to the invention is protein Z, derived from do- main B of staphylococcal protein A. As pointed out in the Background section, this protein has previously been used as a scaffold structure for the creation of molecules, denoted Affibody® molecules, capable of binding to a variety of targets. The 58 amino acid sequence of unmodi- fied protein Z, denoted Z_wt, is set out in SEQ ID NO:l and illustrated in Figure 1. In an embodiment of the polypeptide according to the invention, it is related to a domain of SPA in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having 4 to about 20 substitution mutations. Other embodiments may have 1 to about 13 substitution mutations, or 4 to about 13 substitution mutations. In a more specific embodiment of the polypeptide according to the invention, its sequence corresponds to the sequence set forth in SEQ ID NO:l having 1 to about 20 substitution mutations, such as 4 to about 20, 1 to about 13 or 4 to about 13 substitution mutations. The polypeptide according to the invention may in some embodiments correspond to the sequence set forth in SEQ ID N0:1, which sequence comprises substitution mutations at one or more of the positions 17, 18, 24, 27, 28 and 35. Additionally, the sequence of the polypeptide according to the invention may comprise substitution mutations at one or more of the positions 10, 14, 25 and 32 of the sequence of SPA protein Z in SEQ ID NO:l. The sequence may furthermore comprise substitution mutations at one or more of the positions 9, 11 and 13 of the sequence of SPA protein Z in SEQ ID N0:1. For example in an amyloid beta binding polypeptide in accordance with the invention which is related to protein Z, the amino acid at position 3 corresponds to the amino acid at position 3 in the original (or "wild-type") sequence of protein Z shown in SEQ ID NO:l when the amyloid binding polypeptide has 58 amino acids, but, when the polypeptide has an additional 10 amino acid N terminal extension, the amino acid at position 13 of that polypeptide corresponds to the amino acid at position 3 of the protein Z sequence in SEQ ID N0:1. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID N0:1, comprising at least a substitution mutation at a position corresponding to position 27 in SEQ ID NO:l from arginine to leucine. The sequence of a polypeptide according to yet another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least a substitution mutation at a position corresponding to position 17 in SEQ ID NO:l from leucine to valine. The sequence of a polypeptide according to a further embodiment of the invention corresponds to SEQ ID NO:l, comprising at least a substitution mutation at a position corresponding to position 24 in SEQ ID NO:l from glutamic acid to alanine. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least a substitution mutation at a position corresponding to position 18 in SEQ ID N0:1 from his- tidine to an amino acid residue selected from tyrosine and phenylalanine, more preferably to tyrosine. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least a substitution mutation at a position corresponding to position 28 in SEQ ID N0:1 from asparagine to an amino acid residue selected from cysteine and serine . In another embodiment of the invention, the sequence of the polypeptide corresponds to SEQ ID NO:l, comprising at least a substitution mutation at a position corresponding to position 35 in SEQ ID NO:l from lysine to an amino acid selected from glutamic acid and glutamine, more preferably from lysine to glutamic acid. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least a substitution mutation at a position corresponding to position 10 in SEQ ID NO:l from glutamine to glycine. Moreover, the sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID N0:1, comprising at least a substitution mutation at a position corresponding to position 14 in SEQ ID NO:l from tyrosine to an amino acid residue selected from glycine and proline. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising from 1 to about 20 substitution mutations, and having an acidic amino acid at a position corresponding to position 25 in SEQ ID NO:l. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least a substitution mutation at a position corresponding to position 32 in SEQ ID NO:l from glutamine to an amino acid residue selected from lysine, arginine and histidine, preferably selected from lysine and arginine. Furthermore, the sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least one substitution mutation at a position corresponding to one of positions 13-14 and 24-25 in SEQ ID NO:l from the amino acid residue in the sequence according to SEQ ID NO:l to proline. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID N0:1, comprising at least the following mutations: L17V, H18Y, E24A and R27L. The sequence of a polypeptide according to another embodiment of the invention corresponds to SEQ ID NO:l, comprising at least the following mutations: P20K, H18V, L17F and I16F. A polypeptide according to another embodiment of the invention is related to a domain of staphylococcal protein A (SPA) in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having from 1 to about 20 substitution mutations so that it contains the amino acid motif KLVFF. Examples of specific sequences of polypeptides according to the invention, each comprising one or more of the specific mutations described above, are set out in SEQ ID NO: 2-46 and illustrated in Figure 1. Aβ binding characteristics of these polypeptides, and of polypep- tides in which these polypeptides are present as Aβ binding domains, are disclosed in the examples that follow. Thus, as non limiting examples of the amyloid beta peptide binding polypeptides of the invention, the invention encompasses any amyloid beta peptide binding poly- peptide, or any amyloid beta peptide binding domain, whose amino acid sequence fulfils one definition selected from the following: a) it is selected from SEQ ID NO:2-46; b) it is an amino acid sequence having 85 % or greater identity to a sequence selected from SEQ ID NO:2-46; As evident from this definition, in addition to a polypeptide whose amino acid sequence is selected from SEQ ID NO: 2-46, the present invention also encompasses variants thereof. The amino acid sequences of such encompassed variants exhibit small differences only in com- parison with SEQ ID NO:2-46. One definition of such variants is given in b) above, i e amyloid beta peptide binding polypeptide with an amino acid sequence having at least 85 % identity to a sequence selected from SEQ ID NO: 2-46. In some embodiments of the invention, the amino acid sequence has at least 90 % identity, at least 95 % identity, or at least 98 % identity to a sequence selected from SEQ ID NO:2-46. As discussed above, the polypeptide according to the invention may be present as a moiety or domain in a fu- sion protein, or be provided with a tag of additional amino acid residues. In the experimental section of the present disclosure, the amyloid beta peptide binding properties of several such constructs are tested. The polypeptides described are all included in the scope of the present invention. Thus, the invention encompasses an amyloid beta peptide binding moiety fused to an albumin binding domain, wherein the amino acid sequence of the expressed product corresponds to a sequence selected from SEQ ID NO: 47-65 (see Example 2 and Figure 3). The sequences SEQ ID NO: 47- 65 may also be represented as:

Ala-Gln-His-Asp-Glu-Ala-Leu-Glu- [Z_Ap] -Val-Asp-Tyr- [ABD]

wherein [Z_Aβ] is a sequence selected from SEQ ID NO: 6, 7, 12, 13, 15, 19, 24-28, 31 and 38-44 and [ABD] is the al- bumin binding domain from streptococcal protein G (Nygren P-A et al (1988) Mol Recogn 1:69-74). Furthermore, the invention encompasses an amyloid beta peptide binding moiety fused to a His₆ tag, wherein the amino acid sequence of the expressed product corresponds to a sequence selected from SEQ ID NO: 66-75 (see Example 3 and Figure 5) . The sequences SEQ ID NO: 66-75 may also be represented as:

Met-Gly-Ser-Ser-His-His-His-His-His-His-Tyr-Tyr-Leu-Glu- [Z_Aβ] -Val-Asp

wherein [Z_Aβ] is a sequence selected from SEQ ID NO: 6, 12, 13, 15, 19, 38 and 41-44. Furthermore, the invention encompasses a dimer of two amyloid beta peptide binding moieties fused to a His₆ tag and a "myc" tag, wherein the amino acid sequence of the expressed product corresponds to a sequence selected from SEQ ID NO:76-81 (see Example 4 and Figure 7) . The sequences SEQ ID NO: 76-81 may also be represented as:

Met-Gly-Ser-Ser-His-His-His-His-His-His-Tyr-Tyr-Leu-Glu- [Z_Aβ] -Val-Asp- [Z_Aβ] -Val-Asp-Glu-Gln-Lys-Leu-Ile-Ser-Gln- Gln-Asp-Leu

wherein [Z_Aβ] is a sequence selected from SEQ ID NO: 6, 12, 13, 15, 42 and 43.

As an alternative to using an unmodified SPA domain as a starting point, the SPA domain may also be subjected to mutagenesis in order to increase the stability thereof in alkaline conditions. Such stabilization involves the site-directed substitution of any asparagine residues appearing in the unmodified sequence with amino acid resi- dues that are less sensitive to alkaline conditions. When using the polypeptide according to the invention as an affinity ligand in affinity chromatography, this property of having a reduced sensitivity to alkali provides benefits; affinity chromatography columns are frequently subjected to harsh alkali treatment for cleaning in place (CIP) between separation runs, and the ability to with- stand such treatment prolongs the useful lifetime of the affinity chromatography matrix. As an example, making use of protein Z as starting point, the polypeptide according to the invention may, in addition to the substitution mutations conferring Aβ binding, have modifications in that at least one asparagine residue selected from N3, N6,

Nil, N21, N23, N28, N43 and N52 has been substituted with an amino acid residue that is less sensitive to alkaline treatment. Non-limiting examples of such polypeptides are those having the following sets of mutations (with re- spect to the sequence of Z_wt) : N3A; N6D; N3A, N6D and

N23T; N3A, N6D, N23T and N28A; N23T; N23T and N43E; N28A; N6A; N11S; N11S and N23T; N6A and N23T. Thus, these SPA domains, as well as other SPA domains that have been subjected to asparagine mutation for stability reasons, may all be subjected to further substitution mutation of amino acid residues in order to obtain an Aβ binding polypeptide of the invention. Alternatively, an Aβ binding polypeptide of the invention which comprises asparagine residues may be subjected to further mutation to replace such residues. Evidently, this latter alternative is only possible to the extent that Aβ binding capability of such a molecule is retained. The invention also encompasses polypeptides that have been derived from any of the polypeptides described above through generation of a fragment of the above polypeptides, which fragment retains amyloid beta peptide affinity. The fragment polypeptide is such that it remains stable, and retains the specificity to bind Aβ . The possibility to create fragments of a wild-type SPA domain with retained binding specificity to immunoglobulin G is shown by Braisted AC and Wells JA in Proc Natl Acad Sci USA 93:5688-5692 (1996). By using a structure-based de- sign and phage display methods, the binding domain of a three-helix bundle of 59 residues was reduced to a resulting two-helix derivative of 33 residues. This was achieved by stepwise selection of random mutations from different regions, which caused the stability and binding affinity to be iteratively improved. Following the same reasoning with the polypeptides according to the first aspect of the invention, the skilled man would be able to obtain a "minimized" amyloid beta peptide binding poly- peptide with the same binding properties as that of the "parent" amyloid beta peptide binding polypeptide. Hence, a polypeptide constituting a fragment of a polypeptide according to the above aspect of the invention, which fragment retains binding affinity for an amyloid beta peptide, is a further aspect of the invention. Another aspect of the present invention relates to a nucleic acid molecule comprising a sequence which encodes a polypeptide according to the invention. A further aspect of the present invention relates to an expression vector comprising the nucleic acid molecule of the previous aspect, and other nucleic acid elements that enable production of the polypeptide according to the invention through expression of the nucleic acid molecule . Yet another aspect of the present invention relates to a host cell comprising the expression vector of the previous aspect. The latter three aspects of the invention are tools for the production of a polypeptide according to the in- vention, and the skilled person will be able to obtain them and put them into practical use without undue burden, given the information herein concerning the polypeptide that is to be expressed and given the current level of skill in the art of recombinant expression of pro- teins . As an example, a plasmid for the expression of unmodified protein Z (see e g Nilsson B et al (1987), supra ) may be used as starting material. The desired sub- stitution mutations may be introduced into this plasmid, using known techniques, to obtain an expression vector in accordance with the invention. However, the polypeptide according to the invention may also be produced by other known means, including chemical synthesis or expression in different prokaryotic or eukaryotic hosts, including plants and transgenic animals. When using chemical polypeptide synthesis, any of the naturally occurring amino acid residues in the poly- peptide as described above may be replaced with any corresponding, non-naturally occurring amino acid residue or derivative thereof, to the extent that the Aβ binding capacity of the polypeptide is not substantially affected. Such non-classical amino acids, or synthetic amino acid analogs, include, but are not limited to, the D-isomers of the common amino acids, α-amino isobutyric acid, 4- amino butyric acid, 2-amino butyric acid, 6-amino hexa- noic acid, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid, t-butylglycine, t- butylalanine, phenylglycine, cyclohexylalanine, β- alanine, fluoroamino acids, designer amino acids such as β-methyl amino acids, C -methyl amino acids, Nα-methyl amino acids, and amino acid analogs in general. Further- more, the amino acid residues can be present in D or L form.

The present invention also concerns different aspects of using the above-described Aβ binding polypep- tide, as well as various methods for treatment, diagnosis and detection in which the polypeptide is useful due to its binding characteristics. When referring to the "Aβ binding polypeptide" in the following description of these uses and methods, this term is intended to encom- pass the Aβ binding polypeptide alone, but also all those molecules based on this polypeptide described above that e g constitute fragments thereof and/or incorporate the Aβ binding polypeptide as a moiety in a fusion protein and/or are conjugated to a label or therapeutic agent and/or are provided with additional amino acid residues as a tag or for other purposes. As explained above, such fusion proteins, derivatives, fragments etc form a part of the present invention. According to another aspect of the present invention, a method of separation, removal and/or purification of Aβ is provided. The method comprises a step of affin- ity separation, in which step a polypeptide according to the first aspect of the invention is used. Thus, the invention provides the use of the polypeptide as described above in a method of affinity separation. Suitably, the method involves a separation device, such as chosen among chromatographic media, membranes, cellulose, silica, agarose, polyacrylamide, magnetic beads, two-phase systems and other such materials commonly used in separation. In an embodiment, the polypeptide according to the invention is coupled to the separation device. The thus obtained separation device, having polypeptide according to the invention coupled thereto, is referred to as an affinity matrix. For the purposes of purification of Aβ from a sample, the sample containing Aβ to be purified is suitably applied to such an affinity matrix under conditions that are conducive to binding of Aβ to the matrix. Thereafter, the affinity matrix is washed under conditions such that the binding of Aβ to the matrix is maintained, but most, ideally all, other proteins and contaminants bound to the matrix are washed away. In an elution step, the matrix is treated such that Aβ is released from the matrix in an Aβ enriched fraction denoted "Aβ fraction", which may be recovered. If, conversely, the purpose of the separation is the removal of Aβ, essentially the same steps as above are suitably followed, with some exceptions. The sample containing Aβ to be removed is suitably applied to an affin- ity matrix under conditions that are conducive to binding of Aβ to the matrix. Thereafter, the affinity matrix is washed under conditions such that the binding of Aβ to the matrix is maintained, but most, ideally all, other proteins are recovered in the flow-through, thus obtaining a "depleted fraction" with a substantial reduction in Aβ content, which is recovered. Thus, the non-Aβ constituents of the sample, that were discarded in the purification method above, may instead be retained and used and/or processed further. Another method of the invention, also performed with the purpose of removing Aβ from a sample but with the added requirement that the "depleted fraction" should not contain any substances or solvents not present in the original sample, comprises a similar sequence of steps. The sample containing Aβ to be removed is brought to interact with the affinity matrix under conditions that are conducive to binding of Aβ to the matrix, and subsequently recovered. This yields a sample ("depleted frac- tion") with a substantial reduction in Aβ content, which furthermore is essentially free from anything that was not present in the sample before application thereof to the affinity matrix. As a further alternative of the inventive method, both the "depleted fraction" and the "Aβ fraction" may be recovered from the same separation run. Then, once again, the sample containing Aβ is suitably applied to an affinity matrix under conditions that are conducive to binding of Aβ to the matrix. Thereafter, the affinity matrix is washed, under conditions such that the binding of Aβ to the matrix is maintained, but most, ideally all, other proteins are recovered in the flow-through. The thus obtained "depleted fraction" with a substantial reduction in Aβ content is recovered. In an elution step, the ma- trix is treated such that Aβ is released from the matrix in an Aβ enriched fraction denoted "Aβ fraction", which is recovered. Another related aspect of the invention is a method for reducing the content of Aβ in a portion of a body fluid of a human, comprising the steps to: a) provide a portion of a body fluid from a human; b) apply the por- tion to an affinity matrix comprising an amyloid beta peptide binding polypeptide as described herein, under conditions enabling binding of the Aβ to the affinity matrix, thereby causing a reduction of the content of Aβ in the portion of body fluid; and c) return at least a part of said portion of body fluid to said human. The method according to this aspect of the invention may be directed to reducing the content of Aβ in a body fluid of a subject afflicted by Alzheimer's disease, whereby the symptoms of Alzheimer's disease are alleviated by performing the method. The body fluid may for example be whole blood, plasma or serum. Hence, by using the method according to the invention, subjects afflicted by Alzheimer's disease could be treated by extracorporeal removal of Aβ . The skilled person with experience in the art of extracorporeal devices, e g for immunoadsorption, could use this method with the inventive affinity matrix for treatment of a subject afflicted with Alzheimer's disease, by extracorporeal removal of Aβ from for example a sample of blood from said subject. Affinity adsorption treatment of humans is described in many previous publications, inter alia in US patents US5753227, US6264623 and US6676622, all to Strahilevitz M. In a further aspect, the invention is directed to an affinity matrix comprising an amyloid beta binding poly- peptide according; to the invention as described above. Yet another aspect of the present invention is constituted by the use of an Aβ binding polypeptide as described herein in a method for detecting Aβ in a biological fluid sample. This method comprises the steps of (i) providing a biological fluid sample from a patient to be tested, for example a blood plasma sample for the measurement of plasma Aβ levels, (ii) applying an Aβ binding polypeptide as described herein to the sample under conditions suc that binding of the polypeptide to any Aβ present in the sample is enabled, (iii) removing non- bound polypeptide, and (iv) detecting bound polypeptide. The amount of the detected bound polypeptide is correlated to the amount of Aβ present in the sample. In step (ii) , the application of Aβ binding polypeptide to the sample may be performed in any suitable format, and includes for example the situation when Aβ binding polypep- tide is immobilized on a solid support with which the sample is brought into contact, as well as set-ups in which Aβ binding polypeptide is present in solution. The method according to this aspect of the invention may suitably be performed in a standard 96-well format, in analogy to existing ELISA tests. As a preferred alternative, the polypeptide according to the invention is used as one or more reagent (s) in a sandwich assay, whereas a monoclonal or polyclonal antibody directed against Aβ may be used as other reagents. A sandwich assay using the SPA domain derived Aβ binding molecule as either capture or detection agent shows several advantages compared to using conventional antibody reagents for both capture and detection. One specific such advantage is the elimination of false positive results in the absence of Aβ, which false positives are due to crosslinking between capture and detection antibodies by for example heterophilic anti-animal Ig antibodies (HAIA) . As an additional aspect, the invention provides the use of an Aβ binding polypeptide as described herein in a method of detection of Aβ in tissue samples. This method comprises the steps of (i) providing a tissue sample suspected of containing Aβ, (ii) applying an Aβ binding polypeptide according to the invention to said sample under conditions conducive for binding of the polypeptide to any Aβ present in the sample, (iii) removing non-bound polypeptide, and (iv) detecting bound polypeptide. The amount of the detected bound polypeptide is correlated to the amount of Aβ present in the sample. Another aspect of the present invention is the use of an amyloid beta peptide binding polypeptide as de- scribed herein as a medicament. In addition, the invention provides the use of an amyloid beta peptide binding polypeptide as described herein in the preparation of a medicament for the treatment of a disease characterized by an over-representation of Aβ . A method for treatment of a disease characterized by an over-representation of Aβ, which method comprises administering to a subject in need of such treatment a therapeutically effective amount of a composition comprising an amyloid beta peptide binding polypeptide as described herein is also provided. A particular such disease, characterized by an over- representation of Aβ, is Alzheimer's disease. Thus, the use of the polypeptide in the preparation of a medicament for the treatment of Alzheimer's disease is an embodiment of the invention. Another embodiment is a method for treatment of Alzheimer' s disease, which method comprises administering to a subject in need of such treatment a therapeutically effective amount of a composition comprising an amyloid beta peptide binding polypeptide as described herein. In analogy to the approach of passive immunization with Aβ antibodies, the administration of a polypeptide according to the invention to a subject afflicted with a disease characterized by an over-representation of Aβ would be likely to bring about a lowering of the concentration of free and circulating Aβ peptide in the subject. This, in turn, would also reduce the amount of insoluble Aβ in the body, because of the shift in equilibrium between soluble and aggregated forms of the amyloid beta peptide. Lowering the amounts of Aβ in this fashion serves to reduce, and perhaps entirely eliminate, the very source of the disease itself (DeMattos RB et al , Proc Natl Acad Sci USA 98:8850 (2001); DeMattos RB et al, Science (2002), supra ) . One advantage of the present invention in this regard, which is shown in Example 5, is that the Aβ binding polypeptides according to the present invention do not appear bind to the Amyloid Precursor

Protein (APP) on cell surfaces. This is an important feature to consider in using the Aβ binding polypeptides as a medicament.

Brief description of the drawings Figure 1 shows an alignment of the sequences of the sequence listing. The amino acid positions that have been subjected to modification in the polypeptides Z_Aβ accord- ing to the invention (represented by SEQ ID NO:2-46) are indicated in bold. Figure 2A and 2B is a diagram of the A₄₀s signals for

Aβ binding by the obtained Z_Aβ polypeptides, in an ELISA experiment. Molecules positive for binding to Aβ₄₀ are colored green (pale gray) and the background binding is colored brown (dark gray) . Figure 3 is a schematic illustration of the amino acid sequence of a fusion polypeptide according to the invention. Z_Aβ represents an Aβ binding domain with a se- quence selected from the sequences of Z_Api-₂₀ and ABD represents the albumin binding domain of streptococcal protein G. Figure 4 shows Biacore sensorgrams obtained after injection of the indicated Z_Aβ-ABD fusion proteins over sensor chip surfaces having Aβ₄₀ or Aβ₄₂ immobilized thereto. A: Binding of Z_Aβ ι_ι₀-ABD to Aβ₄₂; B: Binding of

Z_Aβ u-20-ABD to Aβ₄₂; C: Binding of Z_Aβ !-₁₀-ABD to Aβ₄₀; D:

Binding of Z_Aβ n_₂₀-ABD to Aβ₄₀. Figure 5 is a schematic illustration of the amino acid sequences of a tagged polypeptide according to the invention. HiS6 represents a hexahistidyl tag and Z_Aβ represents an Aβ binding domain with a sequence selected from the sequence of Z_Aβ i, ₃, ₄, _{5 12}, ₁₆, _{llr 18}, _{19ι and 20}. Figure 6 shows Biacore sensorgrams obtained after duplicated injections of different concentrations of the indicated His₆-Z_Ap fusion proteins over sensor chip surfaces having Aβ₄₂ immobilized thereto. A: His₆-Z_Aβ i; B: His₆-Z_{Aβ 3}; C: His₆-Z_{Aβ 4}; D: His₆-Z_{Aβ 5}; E: His₆-Z_{Aβ 12}; F: His₆-Z_Aβ ig,^• G: His₆-Z_{Aβ 17}; H: His₆-Z_Aβ ι₈; I: His₆-Z_{Aβ i9}; J: His₆-Z_{Ap 20}. Figure 7 is a schematic illustration of the amino acid sequences of the polypeptide according to the invention in a tagged dimeric construct. Hisε represents a hexahistidyl tag and Z_Aβ represents an Aβ binding domain with a sequence selected from the sequence of Z_Ap i, ₃, ₄, ₁₂, is, ₁9. Myc represents a myc-tag. Figure 8 shows Biacore sensorgrams obtained after injection of the indicated Hisε- (Z_Aβ) ₂-myc fusion proteins over sensor chip surfaces having Aβ₄₂ immobilized thereto. Figure 9 shows SDS-PAGE analysis of fractions from affinity chromatography of Aβ₄₂-peptide using His₆-(Z_Aβi, _3f 4, ori2)₂ ^_myc columns on silver-stained NuPAGE® gel (12 %). 1, 3, 4, and 12 in the figure indicate gels with samples originating from the different His₆-(Z_Api, _{3 f 0r}i₂)₂~πιyc columns respectively. Gels with samples from the experi- ments with PBS supplemented with Aβ₄₂ are marked with A and gels with samples from the Aβ₄₂-spiked plasma experiment are marked with B. Lane 1: Molecular weight marker; Lane 2: Aβ₄₂ and HSA reference (1 μg) ; Lane 3 Flow-through fraction; Lane 4-6: Fractions after washing with 0.3 M HAc pH 3.5; Lane 7-10: Fractions after elution with 0.3 M HAc pH 2.8; Lane 11: Fraction after regeneration of the columns with 0.3 M HAc pH 2.8; Lane 12: Fraction after column re-equilibration using PBS. Figure 10 shows immunofluorescence staining on APP⁺ human neuroblastoma SH-SY5Y cells. A and B show SH-SY5Y cells stained with goat-α-APP antibodies. Cells were fixed after the first step incubation and then stained in the absence (A) or presence (B) of saponin. C and D show SH-SY5Y cells stained with the Aβ-specific polypeptides in the absence (C) or presence (D) of saponin. Figure 11 shows SDS-PAGE analysis of fractions from affinity chromatography using His₆-(Z_Aβ₃ c₂8s)₂-"Cys columns of (A) 1 ml serum spiked with 100 μg Aβ₄₂ peptide and (B) 1 ml unspiked serum. Figure 12 shows SDS-PAGE analysis of fractions from affinity chromatography using His₆-(Z_Ap3 c_28s)₂-Cys columns of 1 ml serum spiked with 100 ng Aβ₄₂ peptide. Figure 13 shows the experimental setup of the in vitro assay described in Example 7.

The invention will now be illustrated further through the non-limiting recital of experiments conducted in accordance therewith. In these experiments, several Aβ binding polypeptides according to the invention were selected from a library of a multitude of different SPA domain related polypeptides, and subsequently character- ized, and used in chromatography and cellular studies.

Example 1 Selection and ELISA study of Aβ binding polypeptides

Library panning and clone selection A combinatorial phage display library was prepared essentially as described in Nord K et al (1995, supra ) . The pool of this library which was used in the present study comprised 3.3 x IO⁹ variants of protein Z (Affi- body® molecules) , with random amino acid residues at positions 9, 10, 11, 13, 14, 17, 18, 24, 25, 27, 28, 32 and 35. Aβ-binding Affibody® molecules were selected in four panning cycles using human biotin-conjugated Aβ₄₀ as the target (Usbio (Biosite) A2275) . After the four selection cycles, in total 384 clones were picked for phage Enzyme Linked ImmunoSorbent Assay (ELISA) in order to perform an analysis of their Aβ binding activity. Phage ELISA for analysis of Aβ binding Phages from the clones obtained after four rounds of selection were produced in 96 well plates, and an ELISA was used for screening for phages expressing Aβ₄₀-binding Z mutants. Single colonies were used to inoculate 500 μl TSB+YE medium (30.0 g Tryptic Soy Broth (Merck), 5.0 g yeast extract, water to a final volume of 1 1, auto- claved) supplemented with 2 % glucose and 100 μg/ml am- picillin in deep well 96 well plates and grown on a shaker overnight at 37 °C. 30 μl overnight culture was added to 720 μl TSB+YE medium supplemented with 100 μg/ml ampicillin in a new plate. After growing at 37 °C for 2 h, 100 μl TSB+YE medium containing 5 x IO⁹ pfu helper phage M13K07 (New England Biolabs, #N0315S) were added to each well, and the plates were incubated without shaking at 37 °C for 30 minutes. 50 μl TSB+YE supplemented with 1.8 μM IPTG (isopropyl-β-D-thiogalactopyranosid) , 450 μg/ml kanamycin and 100 μg/ml ampicillin were added to each well, and the plates were incubated on a shaker overnight at 30 °C. Cells were pelleted by centrifugation at 3000 rpm for 10 minutes and 700 μl of the supernatant was transferred to a new plate with 175 μl precipitation buffer (20 % PEG, 2,5 M NaCl). After 4 h of incubation on ice, the phages were centrifuged for 30 minutes at 4300 rpm. The pellet was dissolved in 300 μl PBS (2.68 mM KCI, 137 mM NaCl, 1.47 mM KH₂P0₄, 8.1 mM Na₂HP0₄, pH 7.4) and stored at 4 °C until it was used in ELISA. 100 μl of 2 μg/ml of biotin-conjugated Aβ₄o in ELISA coating buffer (0.1 M NaC0₃, pH 9.5) was added to strepavidin coated microtiter plates (Nunc #236001) , and incubated overnight at 4 °C. Blocking buffer (1 % skim milk powder in PBS) was added and incubated for 2 h at room temperature. 100 μl phage-containing supernatant and 50 μl blocking buffer were added. The plates were incubated for 1.5 h at room temperature. A polyclonal antibody (rabbit anti-M13, Abeam #ab6188) was diluted 1:1000 or 1:200 times in block- ing buffer, and 100 μl were added to each well . The plate was incubated at room temperature for 1 h. A goat anti- rabbit IgG antibody conjugated with alkaline phosphatase (Sigma #A-3687) was diluted 1:10000 in blocking buffer, after which 100 μl were added to each well and incubated for 1 h at room temperature. Developing solution was prepared by dissolving Sigma-104 substrate in a 1:1 mixture of water and 1 M diethanolamine, 5 mM MgCl₂, pH 9.8 (1 tablet/5 ml) . Thereafter, 100 μl of the developing solu- tion was added to each well. Wells were washed three times with PBS-T (PBS + 0.1 % Tween-20) before addition of each new reagent. 30 minutes after addition of substrate, the plates were read at A₄05 in an ELISA spectro- photometer (Basic Sunrise, Tecan) . The results obtained by the ELISA analysis are illustrated in Figure 2. Aβ binders were identified using a threshold criterion of an ELISA value of ₄₀₅ above 0.2. The binders giving an ELISA signal above this value were selected for further DNA sequence analysis.

DNA sequence analysis Sequencing of DNA encoding these Z_Aβ variants was performed with ABI PRISM® dGTP, BigDye™ Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's recommendations, using the biotinylated oligonucleotides AFFI-71 (5'-biotin- TGCTTCCGGCTCGTATGTTGTGTG) and AFFI-72 (5'-biotin- CGGAACCAGAGCCACCACCGG) . The sequences were analyzed on an ABI PRISM® 3100 Genetic Analyser (Applied Biosystems. A number of clones did not give readable sequences and identical phagemid inserts occurred between 1 to 38 times. Thus, the sequence analysis resulted in 43 unique sequences. The sequences of the Z_Aβ variants expressed by the clones selected in the ELISA binding assay are given in Figure 1, and identified in the sequence listing as SEQ ID NO:2-44. Example 2 Expression and characterization of Aβ binding ABD-fusion polypeptides From the 44 phage clones identified in Example 1 as expressing Aβ binding Z variants, 20 were selected for further study, and denoted Z_Api-Z_Ap20. In the experiments of this Example, these polypeptides are collectively denoted Z_Ap. All experiments were individually conducted with all 20.

Expression and purification of fusion polypeptides Fusion polypeptides were expressed in E. coli RV308 cells (Maurer R et al , J Mol Biol 139 (1980), 147-161, ATCC #31608), by adapting the methods of Nilsson B et al , Eur J Biochem 224 (1994), 103-108 and using conventional molecular biology methods for cloning. The expression vector used encodes a fusion polypeptide as schematically illustrated in Figure 3, in which Z_Aβ represents the -d'if- ferent Aβ binding domains with the sequence of _Aβi-Z_Aβ₂θ' (see Figure 1) , and ABD represents the albumin binding domain of streptococcal protein G. Colonies of transformed cells were used to inoculate 100 ml TSB+YE medium supplemented with 100 μg/ml ampicillin. The cultures were grown at 37 °C to an OD_δoo * 0.7-1, followed by induction with a final concentration of 0.5 mM IPTG and incubation at room temperature overnight. The cells were harvested by centrifugation at 6000 g for 8 minutes and periplasmic proteins were released by sonication. Cell pellets were resuspended in 10 ml TST buffer (25 mM Tris-HCl, 1 mM

EDTA, 200 mM NaCl, 0.05 % Tween-20, pH 8.0) and the cells were lysed by freezing and thawing the samples followed by sonication. Cell debris was removed by centrifugation at 6000 x g for 10 min and the supernatants were allowed to pass through a 0.45 μm filter. The ABD-fusion polypeptides were purified using affinity chromatography on HSA-Sepharose (CNBr-activated Sepharose 4FF, Amersham Biosciences #17-0981-03, with HSA, Pharmacia & Upjohn #818476-01/5) . A HR 5/5 column (Amersham Biosciences) was packed with 1 ml HSA-Sepharose and connected on an AKTA™explorer 100 chromatography sys- tem (Amersham Biosciences) . The column was equilibrated with TST buffer. Sterile filtered cell lysates were separately applied to the column at a flow rate of 0.5 ml/min. After washing with 12 ml TST buffer, proteins were eluted with 0.5 M HAc, pH 2.8. The flow rate was 1 ml/min during the wash and elution steps. Protein content in eluted fractions was determined spectrophotometrically using absorption at 280 nm, and relevant fractions were pooled. Protein concentration of pooled samples was calculated from the measured absorption value at 280 nm and the theoretical extinction coefficient of the respective protein (calculated by using VectorNTI). Protein preparations were analyzed on 10-15 % Phast gels® using the PhastSystem (Amersham Biosciences) under reducing conditions .

Biosensor analysis of fusion polypeptides Binding of the purified fusion polypeptides to Aβ was analyzed using surface plasmon resonance in a Biacore® 2000 instrument (Biacore AB) . Aβ₄₂ and bioti- nylated Aβ₄₀ were immobilized in different flow cells by amine coupling onto the carboxylated dextran layer on surfaces of CM-5 chips (research grade, Biacore AB) , according to the manufacturer's recommendations. One cell surface on each chip was activated and deactivated for use as reference cell during injections. Immobilization of Aβ₄₂ and biotinylated Aβ₄₀ to CM-5 chip surfaces resulted in approximately 3200 and 1000 resonance units (RU) , respectively. Samples of fusion polypeptides were diluted in HBS-EP buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.005 % surfactant P-20, pH 7.4 ) to a final concentration of 1 μM, and injected in random order as duplicates at a constant flow-rate of 10 μl/min for 5 minutes. After each injection, the surfaces were regenerated with 50 mM NaOH. When injected sequentially over the surfaces in this manner, all 20 fusion polypeptides (Z_Aβ-ABD) exhibited binding to Aβ₄₂ and biotinylated Aβ₄₀ (Figures 4A- 4D) . Based on this experiment, the 10 different fusion polypeptides Z_Aβ i, ₃, ₄, 5, 12, ie, 17, is, 19, and 20-ABD were selected for further, more detailed analysis of the Aβ binding kinetics. The main selection criteria were a fast "on rate", and a medium to slow "off rate" for the bind- ing to Aβ .

Example 3 Expression and characterization of Aβ binding hexa- histidyl fusion polypeptides

In this Example, the Aβ binding polypeptides Z_{Aβ 1}, ₃ 4, 5, 12, 16, 17, is, 19, and 20 were studied further, and are sometimes collectively referred to as Z_Aβ. All experiments were performed with each of these Aβ binding Z variants.

Expression and purification Z_AP polypeptides were expressed in E. coli BL-21(DE3) cells (Novagen #69450-4), using expression vectors encod- ing constructs that are schematically illustrated in Figure 5. In the figure, His₆ represents a hexahistidyl tag, and Z_Aβ represents any one of the Aβ binding domains corresponding to the sequences of Z_Aβ i, ₃, ₄, 5, 12, ie, 17, is, 19, and ₂0. Expression was followed by purification by Immobilized Metal ion Affinity Chromatography (IMAC) . E . coli BL-21(DE3) cells harboring the expression plasmids were grown in 10 ml TSB medium supplemented with 50 μg/ml kanamycin in baffled shaker flasks at 200 rpm at 37 °C overnight. The following day the cultures were di- luted 1000 times in 200 ml TSB+YE medium supplemented with 50 μg/ml kanamycin in 2 liter baffled shaker flasks. The cultures were grown at 37 °C to an OD₆₀o ~ 0.7-1, and production was induced by adding IPTG to a final concentration of 0.5 mM followed by incubation at room temperature overnight. Cultures were harvested by centrifugation at 6000 x g for 8 minutes and pellets were stored in the freezer until protein preparation. Cell pellets were thawed and resuspended in 10 ml IMAC binding buffer (10 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, 6 M guanidiniu HC1, pH 8.0). The solutions were transferred to 50 ml Falcon tubes and cells were thereafter lysed by sonica- tion. Cell debris was removed by centrifugation at 12000 x g for 8 min and supernatants were filtrated using a 0.45 μm filter. The produced proteins were isolated using IMAC as follows: 3 ml Talon Metal Affinity Resin (Clon- tech, #8901) for each protein was washed twice with IMAC binding buffer (the resin was recovered in each step by centrifugation at 700 x g for 2 minutes after addition of buffer) . The supernatants were added to the washed resin and incubated with head-over-tail rotation for 1 h at room temperature. Unbound proteins were removed by wash- ing twice with 30 ml IMAC binding buffer, and the resin was resuspended in 10 ml IMAC binding buffer and transferred to an empty PD-10 column (Amersham Biosciences) . After washing with an additional volume of 20 ml IMAC binding buffer, proteins were eluted with 5 ml IMAC elu- tion buffer (250 mM imidazole, 0.5 M NaCl, 20 mM Tris- HCl, 6 M guanidinium HCl, pH 8.0) in 0.5 ml fractions. Protein content in eluted fractions was determined spec- trophotometrically at A₂so using a Smartspec 3000 spectro- photometer, Bio-Rad, and relevant fractions were pooled. To perform buffer exchange, PD-10 columns (Amersham Biosciences) were equilibrated with PBS, and samples were passed over these according to the manufacturer's recommendations. Protein concentration was determined using absorption at A₂so and the extinction coefficient of the respective Z_Aβ polypeptide. The purity of the proteins was analyzed by SDS-PAGE on 20 % polyacrylamide gels under reducing (DTT) and non reducing conditions and stained with Coomassie brilliant blue R-250, using the Phast™ system (Amersham Biosciences) according to the manufacturer's recommendations.

Biosensor analysis The interactions between the produced Z variants and Aβ₄₂ were analyzed using surface plasmon resonance on a Biacore® 2000 system. Aβ₄₂ was immobilized in different flow cells by amine coupling onto the carboxylated dex- tran layer on surfaces of a CM-5 chip, according to the^* manufacturer's recommendations. Immobilization of Aβ₄₂ resulted in 470 resonance units (RU) . One flow cell surface on each chip was activated and deactivated for use as reference cell during injections. Six or seven different concentrations were measured as duplicates using two-fold dilutions in HBS-EP, and injected in random order in duplicates at a constant flow-rate of 30 μl/minute. The ability of the purified His₆-Z_Aβ i, ₃, ₄, ₅, _lz, ιβ, ii, is, 19, and 20 to interact with Aβ was confirmed, as illustrated by the sensorgrams of Figures 6A-6J. Furthermore, affinity constant K_D values were determined for His₆-Z_Aβ 1, ₃, ₄, 5, 12, ie, 17, is, 19, and 20- Six or seven different Aβ concentrations (10 μM - 0.156 μM) were prepared in HBS-EP and injected as duplicates at a flow-rate of 30 μl/minute. The total injection time was 5 minutes (association) followed by a wash during 10 minutes (dissociation) . The surfaces were regenerated with 2 injections of 50 mM NaOH. The responses measured in reference cells (activated/deactivated surface) were subtracted from the response measured in the cells with immobilized Z_Ap polypeptides. K_D values were calculated using the 1:1 Langmuir binding model of the BIAevaluation 3.2 software (Biacore AB) , and are presented in Table 1. TABLE 1

Example 4 Expression and characterization of dimers of tagged Aβ binding polypeptides, and use thereof as capture ligands in affinity chromatography In this Example, the Aβ binding polypeptides _Aβι ,₃, ₄, 12, is, 19 were further studied, except for the example regarding affinity chromatography, where Z_Aβi ,₃, ₄, ₁₂ were studied. In this experiment, the polypeptides are sometimes collectively referred to as Z_Aβ.

Expression and purification Z_Aβ polypeptides were expressed in E. coli BL21(DE3) (Novagen #69450-4), using expression vectors encoding dimeric His₆-(Z_Aβi, ₃, ₄, ι₂, ι_{8 and} i₉)₂-πιyc constructs schemati- cally illustrated in Figure 7. In the figure, His₆ represents a hexahistidyl tag, and Z_Aβ represents any of the Aβ binding domains corresponding to the sequences of _Aβι, ₃, 4, 12, is, 19_' A "myc" tag was added to the end (amino acid sequence EQKLISEEDL) . The cells harboring the expression plasmid were separately inoculated in 10 ml TSB medium supplemented with 50 μg/ml kanamycin. The cultures were grown overnight at 200 rpm and 37 °C. The following day 500 μl overnight culture were inoculated with 500 ml TSB+YE medium supplemented with 50 μg/ml kanamycin in 5 liter baffled shaker flasks. The cultures were grown at 37 °C to an OD₆₀₀ * 0.7-1, followed by addition of IPTG to a final concentration of 0.5 mM and incubated at room temperature overnight. Each culture was divided into two samples and harvested by centrifugation at 6000 x g for 8 min. The pellets were stored in the freezer until protein preparation. A pellet of each protein construct was thawed and resuspended in 35 ml IMAC binding buffer containing 6 M guanidinium HC1. The solutions were trans- ferred to 50 ml Falcon tubes and sonicated on ice. Cell debris was removed by centrifugation at 12000 x g for 8 min and the supernatants were filtrated using a 0.45 μm filter. The AKTA™ 3D Kit together with the AKTA™explorer 100 chromatography system (Amersham Biosciences) was used for purification of His₆-(Z_Aβι, ₃, ₄, 12, is andi9)₂-myc fusion proteins. Six samples could be purified on IMAC-columns in a single run followed by subsequent desalting on a HiPrep 26/10 desalting column (Amersham Biosciences) . The IMAC columns consisted of HiTrap® Chelating HP columns prepacked with 5 ml Chelating Sepharose™ High Performance charged with Ni²⁺. The desalting column was equilibrated with PBS manually before starting the purification run. Protocols supported by the AKTA™ 3D Kit were used for the automatic two-step purification as well as for metal ion charging and stripping of the HiTrap® Chelating HP columns . The crude samples of His₆-(Z_Aβι , ₃, _{4; 12}, is, i9)₂ ^_myc were added to appropriate vials and subsequently loaded on the AKTA™explorer . Automatic purification of the sam- pies included pre-equilibration of HiTrap® columns with IMAC binding buffer, sample loading, sample wash with IMAC binding buffer, elution by IMAC elution buffer onto the desalting column and fractionation of collected peak after elution from the desalting column. An additional wash step was performed, after the general wash step recommended by the manufacturer, with IMAC binding buffer containing 50-60 mM imidazole. After elution, relevant fractions were pooled and the protein concentration was determined spectrophoto et- rically at A₂₈₀. The purity of protein preparations was analyzed using 12 % Bis-Tris NuPAGE® gels according to the manufacturer's recommendation. When appropriate, DTT (reducing agent) was added to a final concentration of 50 mM. The gels were subsequently stained with Coomassie.

Biosensor analysis The purified fusion polypeptides' ability to bind Aβ4₂ was analyzed using surface plasmon resonance on a Biacore® 2000 system. Aβ₂ was immobilized in different flow cells by amine coupling onto the carboxylated dex- tran layer on surfaces of a CM-5 chip, according to the manufacturer's recommendations. Immobilization of Aβ₄₂ resulted in 470 RU. One flow cell surface on each chip was activated and deactivated for use as reference cell during injections. Samples of His₆-(Z_Aβι, ₃, ₄, 1₂, is and 19) 2-myc were diluted in HBS-EP to a final concentration of 5 μM and injected in random order at a constant flow rate of 30 μl/min for 5 minutes. After each injection, the surfaces were regenerated with 2 injections of 50 mM NaOH. The samples' ability to interact with Aβ was confirmed, as illustrated by the sensorgrams in Figure 8.

Production of E. coli lysate The E . coli strain HB101F' was cultivated in 50 ml TSB medium overnight at 37 °C. The cells were harvested by centrifugation at 6000 x g for 8 min and the pellets were stored in -20 °C until protein preparation. Cell pellets were resuspended in 40 ml PBS and proteins were released by sonication. The total protein concentration from strain HB101F' lysate was determined using the Pierce BCA-protein assay as recommended by the manufacturer.

Affinity chromatography The specificity of the polypeptides His₅- (Z_AβX,₃, ₄ a_nd 12) 2~'^rnyc was evaluated by applying E. coli lysate prepared as described above, human plasma and PBS, all spiked with Aβ₂, to columns having Z_Aβ variants coupled thereto, fol- lowed by washing and elution. Spiked E. coli lysate was only applied to a column with His₆- (Z_Api) ₂-myc, whereas spiked plasma and spiked PBS were applied to all four columns. 1 mg of each His₆-(Z_Api, ₃, 4 ad i2)₂-πιyc variant were separately coupled to 1 ml HiTrap® affinity columns (with NHS-activated Sepharose® High Performance) , according to the manufacturer's recommendations. The coupling efficiencies of the different Z_Aβ variants to the columns were almost 100 %, determined by using a protocol from the manufacturer (data not shown) . The columns were con- nected to an AKTA™explorer 10 system, and equilibrated with 5 column volumes of PBS buffer. 1 ml of E. coli lysate or plasma supplemented with 100 μg Aβ₄₂ was loaded onto the different Z_Aβ columns at a flow rate of 0,.2 ml/minute. PBS supplemented with 100 μg Aβ₄₂ was also separately loaded onto the columns. The Aβ₄₂ was eluted with 0.3 M HAc, pH 2.8. The selected fractions from the purification were lyophilized and dissolved in PBS or water. The purity of protein preparations was analyzed using 12 % Bis-Tris NuPAGE®. A NuPAGE® gel stained with Coomassie indicated that β₄₂ was the only product detected in the eluates originating from the spiked E. coli lysate separation experiment (data not shown) . The other gels were stained with silver. The results for spiked PBS and spiked plasma are shown in Figure 9. As shown in Fig- ure 9, Aβ₄₂ was only found in the eluates and not detected in the flow through and wash fractions. Thus, from these experiments it is evident that Aβ₄₂ could be efficiently captured from complex solutions using immobilised, Aβ₄₂- binding Z mutants according to the invention.

Example 5

Investigation of the possibility that selected Aβ-binding polypeptides bind also to Amyloid Precursor Protein (APP)

In this Example, the Aβ binding polypeptides His₆- Z_Aβι-myc, His₆-Z_Aβ3-myc, His₆-Z_Ap4-myc, and His₆-Z_Api₂-myc were studied in order to determine whether they also bind to the Amyloid Precursor Protein (APP) . In order to investigate this, immunofluorescence staining was performed on an APP⁺ human neuroblastoma cell line, SH-SY5Y.

Cell prepara tion SH-SY5Y cells (DSMZ, ACC209) were grown in a 25 cm³ flask in DMEM (Dulbecco's Modified Eagles Medium, Gibco 41965-039) supplemented with 15 % FCS (Fetal Calf Serum, Gibco 10106-165) . The cells were harvested from the flask by trypsination and pelleted by centrifugation. The pellet was resuspended in 3 ml cell culture medium and 1 drop was added per field/well of a Histolab glass slide with 8 fields. The density was checked by microscope ex- amination and extra cells were added if the density was found to be too low. An extra drop of medium was added per field/well to avoid dehydration. The cells were left to grow overnight at 37 °C and 5 % C0₂. The cells were either stained directly or fixed with 2 % formaldehyde (Sigma F1635) in PBS for 10 minutes.

Immunof luorescence staining The volumes used were approximately 20 ml/well for all incubations. Dilutions and washes were made with PBS or PBS + 0,1 % saponin (Sigma S4521) and washing was done for 3 x 5 min. All incubations were performed at room temperature inside a humidified, dark chamber. The last wash was done in PBS for 5 min, followed by addition of 1 drop DAPI (4 , 6-diamidino-2-phenylindole, Molecular Probes, D1306) per well. DAPI was removed after 20 seconds by washing in PBS. The slides were left to dry and thereafter mounted with α-fading (Vector H-1000) before examination in an UV-microscope . Two pictures were taken for each photo, for ALEXA (green) and DAPI (blue) staining at 400x or 630x magnification using a CCD camera (Leica) . The first step staining with myc-tagged Aβ-specific polypeptides according to the invention (5 mg/ml) or goat-α-APP (Biosite A2275-69R) (1:100) was done on living or fixed cells. Incubation was carried out at 37 °C in 5 % C0₂ for 1 h. The slides were rinsed in PBS and living cells were then fixed with 2 % formaldehyde in PBS for 10 min. Slides were then blocked for 30 min with blocking solution and emptied. Then, the second step mouse-α-myc (Sigma F1635) was added, with or without saponin (separate slides) , to the wells that had previously been incu- bated with Aβ-specific polypeptides. The second step was incubated for 1 h at RT. In addition, wells that received the positive control, goat-α-APP, were incubated for one additional hour with the same antibody. Slides were washed and anti-mouse/anti-goat Alexa 488 antibodies (Mo- lecular Probes, D1306/A211467 ) were added. The slides were washed after 30 min of incubation and nuclei of cells were stained with DAPI before mounting and examination. The resulting immunostaining images are presented as Figures 10A-D. The goat-α-APP antibody gave a bright intracellular staining (Figure 10A) . Addition of saponin resulted in a considerably higher percentage of positive cells (Figure 10B) . All cells that were fixed with formaldehyde after the first step staining with Aβ binding polypeptides according to the invention, and had no saponin added, were completely negative (Figure 10C) . The His6- _aβ-myc and His₆-Z_aβi₂-myc molecules gave a weak in- tracellular, unspecific signal if saponin was added (Figure 10D) , but the His₆-Z_Api-myc and His₆-Z_Aβ3-myc molecules remained completely negative also in the presence of saponin (data not shown) . In conclusion, the experiment suggests that the four tested Aβ binding polypeptides do not bind to APP.

Example 6 Expression of Aβ binding polypeptides His₆- (Z_Aβi__c28s) ₂~Cys and His₆-(Z_{Aβ3 C28}s)₂-Cys, and use of His₆-(Z_Aβ3 c₂₈s)₂~Cys as capture ligand in affinity chromatography

In this Example, the two Aβ binding polypeptide dimers His₆- (Z_APi__c28s) 2~Cys and His₆- (Z_{Aβ3 C}28s) 2~Cys were created and studied. The two variants Z_Aβi and Z_Aβ3 each contain an internal cysteine residue, giving rise to multimerization of the Aβ binding polypeptides. It is thought that some of the binding sites will, upon mul- timerization, be hidden from the Aβ target, thus resulting in a less efficient binding of Aβ peptides. Therefore, the Aβ binding polypeptides Z_Apι and Z_Aβ3 were subjected to site-directed mutagenesis of the amino acid at position 28 from a cysteine residue to serine. These new variants still exhibited good binding to Aβ₄₂. The constructs His₆- (Z_Aβι c28s) 2-Cys and His₆- (Z_{Aβ3 c2}8s) 2~Cys made it possible to direct immobilization of the Aβ binding polypeptides, using the C-terminal cysteine residue (disul- phide bridges) .

Mutagenesis, expression and purification The sequences of Aβ binding variants Z_Aβι and Z_Aβ3 were subjected to site-directed mutagenesis using conventional methods. In this way, the cysteine residue at po- sition 28 of both molecules was replaced with a serine residue. The resulting Aβ binding variants were denoted Z_Aβi c28s and Z_Aβ₃ c28s<- and are represented in Figure 1 by SEQ ID NO: 45 and 46, respectively. By way of conventional methods of molecular biology, the mutated Z_Aβ polypeptides were expressed using expression vectors encoding Hisβ- (Z_Aβι c28s a_n 3 c28s) ₂-Cys constructs His₆ represents a hexa- histidyl tag, and Z_Aβ represents either of the Aβ binding domains having the sequences Z_{Aβi C}28s ad 3 c28s- A C-terminal cysteine residue was added.

Immobiliza tion of biotinyla ted Hisβ- (Z_Aβ_{3 C2}ss) ₂~Cys The Aβ binding polypeptide His₆- (Z_{Aβ3 C2}8s) ₂~Cys was biotinylated so it could become immobilized on strepta- vidin columns (HiTrap streptavidin HP, Amersham Biosciences) . The procedure for biotinylation was to reduce the sample with DTT in a molar excess of 200x for 45 min at 37 °C followed by buffer exchange on NAP™5 columns (Amersham Biosciences) according to the manufacturer's instructions. A 33x molar excess of biotin (NoWeight™ Maleimide PE0₂-Biotin, Pierce) was dissolved in PBS and added to the sample with incubation for 2 h at room tem- perature. A final buffer exchange was performed overnight to get the biotinylated Aβ binding polypeptides in "binding buffer" (20 mM sodium phosphate, 0.15 M NaCl, pH 7.5), using a Slide-A-Lyzer® Dialysis Cassette with a cut-off of 3500 Da (Pierce) . To equilibrate the streptavidin column, 10 ml of binding buffer was passed through the column with a flow rate of 1 ml/min. For immobilization, His₆- (Z_Aβ_{3 C}28s) 2-Cys was added (1.25 mg of the biotinylated His6~ (Z_{Aβ3 C}28s) 2~Cys in a volume of 1 ml) at a flow rate of 0.1 ml/min. Wash- ing with binding buffer was performed (10 ml, 1 ml/min) , and the column was stored in binding buffer containing 20 % EtOH.

Affinity chromatography The specificity of the Aβ binding polypeptide Hise- (Z_Aβ3 c₂₈s) ₂-Cys was evaluated by applying 1 ml of human serum (H4522, Sigma-Aldrich Sweden AB) or human plasma (provided by Affibody AB, samples from 20 individuals) , unspiked or spiked with 100 μg Aβι-₄₂ (American Peptide Company) to the column with immobilized Aβ binding polypeptides, followed by washing and elution. The chromatographic method used is illustrated in Table 2. Briefly, 100 μg Aβ was added to 1 ml serum and let through the column. 1 ml unspiked serum was used as a negative control. Washing with binding buffer was followed by a preliminary elution step (0.3 M HAc, pH 3.5) to release some of the "sticky" serum proteins. Finally, the Aβ was eluted with 0.3 M HAc, pH 2.8.

TABLE 2. Chromatography of samples with 100 μg/ml Aβ in serum ("spiked") and control samples ("unspiked")

During purification of Aβ peptide, fractions from each step were collected, concentrated (SpeedVac® System, Savant) and dissolved in reducing agent. Purity of protein preparations was analyzed with SDS-PAGE (Novex system, Invitrogen) in gels with 12 wells (NuPAGE™ 4-12 % Bis-Tris Gel, Invitrogen) . A molecular weight marker ranging from 3-185 kD was used (MultiMark® Multi-colored standard, Invitrogen) . After the first addition of reducing agent, the samples were heated (96 °C, 5 min) giving completely reduced proteins. 10 μl of loading buffer (re- ducing agent, 20 % glycerol (87 % stock), 1 ml) was added to 3 μl of the protein samples. The gels were run in NuPAGE® MES SDS Running buffer (50 mM MES, 50 mM Tris Base, 0.1 % SDS, 1 mM EDTA, pH 7.3) at 125 V for 1.5 h, and stained by silver stain (SilverXpress® Silver Staining Kit, Invitrogen) according to the manufacturer's instructions . Western Blot with antibodies against Aβ was used to find out what bands on the gels corresponded to Aβ . Transfer buffer (25 mM Bicine, 25 mM Bis-Tris, 1 mM EDTA, pH 7.2) was used for transferring of the proteins (Novex system, Invitrogen), 25 V for 2h. The membrane (Nitrocellulose Membrane Filter Paper Sandwich, Invitrogen) was blocked overnight in blocking solution (1 % milk powder in TST) before 3 x 5 min washing in TST (0.025 M Tris- HC1, 0.2 M NaCl, 1 mM EDTA, 0.05 % Tween 20, pH 8.0). A primary antibody (directed against amino acids 1-16 of Aβ, mouse monoclonal, Nordic BioSite) was added (1:2000), and samples incubated for 1.5 h. Another wash was performed before addition of a secondary antibody (rabbit- anti-mouse, conjugated with alkaline phosphatase, Dako) (1:1000), and incubation for 1.5 h. A final wash of the membrane was performed before developing of the membrane (alkaline phosphatase substrate tablet, insoluble, B-5655 Sigma) according to the supplier's recommendation. The results of the experiment are displayed in Figure 11, showing the SDS-PAGE and Western Blot analysis of fractions from affinity chromatography of (A) 1 ml serum spiked with 100 μg Aβ₄₂ peptide and (B) 1 ml unspiked serum. Fifteen 1 ml fractions were eluted with 0.3 M HAc pH 2.8 and analyzed in lanes 6-8 of the gel. Lane 1: Multi- Mark® Multi-colored Standard (kD). Lane 2: Unspiked serum (1:100). Lane 3: Spiked serum (1:100). Lane 4: Flow through (1:100) . Lane 5: Pre-elution wash with 0.3 M HAc pH 3.5. Lane 6: Eluted fractions 1-2. Lane 7: Eluted fractions 3-10. Lane 8: Eluted fractions 11-15. Lane 9: Empty. Lane 10: Wash after equilibration of column, acidic pulses (HAc 0.3 M, pH 2.8). Lane 11: Aβ control (1 μg) . Lane 12: HSA control (1 μg) . As can be seen in Figure 11A, the affinity column with biotinylated His₆- (Z_{Aβ3 C28}s) ₂ ^_Cys immobilized thereto was able to efficiently separate the content of Aβ peptide from the spiked serum samples.

Chroma tography of physiological levels of Aβ peptides in serum A patient suffering from Alzheimer's disease normally has a concentration of Aβ peptides in blood in the range of picograms to nanograms per ml. Therefore, the Aβ binding polypeptide His₆- (Z_{Ap3 C2}8s) ₂ ^_Cys was tested in conditions closer to physiological levels of the target Aβ peptide, i e a lower concentration of Aβ in serum was let through the columns than in the previous experiment. Immobilization of biotinylated Aβ binding polypeptide to the column was performed as above, except that 372 μg of biotinylated His₆- (Z_{Aβ3 C28}s) ₂ ^_Cys in a volume of 300 μl was used. 100 ng Aβ peptide was added to 1 ml serum and run through the column using the chromatography protocol illustrated in Table 3.

TABLE 3. Chromatography of samples with physiological levels of Aβ in serum (100 ng/ml)

The "physiological samples" were treated differently after concentration (SpeedVac® System, Savant) than the samples from the previous experiment, since everything in the eluted fractions (split in 15 x 1 ml eppendorf tubes) needed to be loaded in the gel, to make detection of these small amounts of Aβ possible. What was left in the eppendorf tubes was dissolved in 200 μl sterile H₂0. 800 μl of acetone was added for precipitation of the proteins (5 minutes, -20 °C) . The samples were centrifuged (13000 rpm, 20 minutes, 4 °C) and the pellets were left to dry. 10 μl of reducing agent was added to the first eluted fraction and dissolved. This mixture was then transferred to the second fraction, followed by the third and so on. Thus, everything in the fifteen eluted fractions was fi- nally collected in three test tubes, each with a volume of 10 μl reducing agent. The whole amount was loaded on the gel, together with 10 μl of loading buffer. Collected fractions at the end of each wash were dissolved in 10 μl of reducing agent, where of 3 μl was added in the gel, mixed with 10 μl of loading buffer. Western Blot was performed as described above. The results of the experiment are displayed in Figure 12, showing the SDS-PAGE and Western Blot analysis of fractions from affinity chromatography of 1 ml serum spiked with 100 ng Aβ₄₂ peptide using the biotinylated His₆- (Z_Aβ₃ c28s) ₂ ^_Cys immobilized to a streptavidin column. Fifteen 1 ml fractions were eluted with 0.3 M HAc pH 2.8, collected as described above, and analyzed in lanes 5-7 of the gel. Lane 1: MultiMark® Multi-colored Standard (kD) . Lane 2: Unspiked serum (1:100). Lane 3: Spiked serum (1:100). Lane 4: Flow through (1:100). Lane 5: Eluted fractions 2-5. Lane 6: Eluted fractions 6-10. Lane 7:

Eluted fractions 11-15. Lane 8: Empty. Lane 9: Wash before elution (0.3 M HAc pH 4.3). Lane 10: Wash after equilibrating the column, acidic pulses (HAc 0.3 M, pH 2.8). Lane 11: Aβ control (100 ng) . Lane 12: Aβ control (1 μg) . The results of the experiment demonstrate that a polypeptide according to the invention is useful for selective capture of amyloid beta peptide from plasma at physiological conditions.

Example 7 In vitro assay: Aβ sink An in vi tro assay was developed to identify the relative efficacy of Aβ binding polypeptides on sequestering soluble Aβ peptides. A set-up of two compartments, separated by a 10 kD cut off dialysis membrane (Mini Dialysis Units, Slide-A-Lyzer, Pierce) with volumes of 500 μl (top chamber) and 950 μl (bottom chamber) was used. The size of monomeric Aβ peptides is 4 kD and the Aβ binding polypeptides have a size of 15 kD. Molecules lar- ger than 10 kD cannot pass through the membrane. Since it is known that Aβ peptides tend to aggregate, forming mul- timeric complexes, the pore size of the membrane was chosen to be large enough to also let dimeric Aβ peptides through. It was presumed that the fraction of monomeric and dimeric Aβ peptides in the chamber containing Aβ peptides was large enough to show a possible "Aβ sink" effect by the Aβ binding polypeptides of the invention. The Aβ binding polypeptide His₆- (Z_{Aβ3 C}28s) ₂~Cys was placed in the bottom chamber at a concentration of 20 μg/ml (total volume 950 ml) . The top chamber contained biotinylated Aβ₄₀ (US Biological) at a concentration of 10 ng/ml (total volume 500 ml) . Aβ binding polypeptide and Aβ peptide were diluted in PBS. To compare the possible "pulling effect" of the Aβ binding polypeptide, a negative control (PBS in the bottom chamber) was used. As a positive control, a monoclonal antibody against Aβ (α- Aβι₇-₂6, US Biological) was used. The antibody was diluted in PBS at the same concentration as the Aβ binding poly- peptide according to the invention (20 μg/ml) . The three test tubes (test sample and the two controls) were placed upright in room temperature overnight. The set-up is shown schematically in Figure 13. To detect the levels of Aβ in the different compart- ments, an ELISA was developed for detection of biotinylated Aβ peptides (see below) . Samples from each compartment were taken after more than 14 h, and added in 2- step dilution series to double wells in the ELISA for detection. Standard samples were made with known concentra- tions of biotinylated Aβ in PBS (ranging from 0 to 25 ng/ml) . For the ELISA, 96-well plates (Costar) were coated with 100 μl/well of capture antibodies (mouse anti human- βι-i6, Nordic BioSite) diluted in coating buffer (0.1 M sodium carbonate, pH 9.5) to a concentration of 0.1 μg/ml overnight. Washing (PBS with 0.05 % Tween 20) removed any free antibody. Blocking buffer (0.5 % casein in PBS) was added for 2 h at room temperature and followed by another wash. 100 μl/well of sample or standard (Biotinylated Aβ₄₀, US Biological) was added in 2-step dilution series to duplicate wells and incubated for 1-2 h at room 5 temperature. Washing was then performed to remove unbound sample. 100 μl/well of HRP conjugated streptavidin, 1:5000 (P0397 Dako) was added and incubated on a shaker for 1 h at room temperature. Washing was performed, and followed by addition of 100 μl/well of substrate (Im- 10 munopure TMB substrate kit, Pierce) , which was incubated for 15-30 minutes. The color-changing reaction was stopped by adding 100 μl/well of stop solution (2 M H₂S0₄) according to the manufacturer's instructions. The plates were read at 450 nm (Magellan Sunrise) . 15 With the help of a standard curve prepared using samples with known concentrations of Aβ, the ELISA result of the samples could be translated to a concentration. Concentrations determined by ELISA after 14 h are shown in Table 4, and suggest that the Aβ binding poly- 0 peptides is able to sequester soluble Aβ through a membrane .

TABLE 4. Concentrations of Aβ in the in vi tro assay

Claims

1. Amyloid beta peptide binding polypeptide, which is related to a domain of staphylococcal protein A (SPA) in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having 1 to about 20 substitution mutations.

2. Amyloid beta peptide binding polypeptide accord- ing to claim 1, which has a binding affinity for amyloid beta peptide such that the K_D value of the interaction is at most 5 x IO^-6 M, as measured by surface plasmon resonance.

3. Amyloid beta peptide binding polypeptide according to claim 2, the K_D value of the interaction being at most 1 x 10^~6 M, as measured by surface plasmon resonance.

4. Amyloid beta peptide binding polypeptide accord- ing to claim 3, the K_D value of the interaction being at most 9 x IO^"7 M, as measured by surface plasmon resonance.

5. Amyloid beta peptide binding polypeptide according to any preceding claim, the sequence of which corre- sponds to the sequence of SPA protein Z, as set forth in SEQ ID N0:1, comprising 1 to about 20 substitution mutations .

6. Amyloid beta peptide binding polypeptide accord- ing to claim 5, comprising 4 to about 20 substitution mutations compared to the sequence of SPA protein Z in SEQ ID NO:l.

7. Amyloid beta peptide binding polypeptide accord- ing to claim 6, comprising 4 to about 13 substitution mutations compared to the sequence of SPA protein Z in SEQ ID NO:l.

8. Amyloid beta peptide binding polypeptide according to any of the claims 5-7, comprising substitution mutations at one or more of the positions 17, 18, 24, 27, 28 and 35 of the sequence of SPA protein Z in SEQ ID N0:1.

9. Amyloid beta peptide binding polypeptide according to claim 8, additionally comprising substitution mu- tations at one or more of the positions 10, 14, 25 and 32 of the sequence of SPA protein Z in SEQ ID NO:l.

10. Amyloid beta peptide binding polypeptide according to claim 8 or 9, additionally comprising substitution mutations at one or more of the positions 9, 11 and 13 of the sequence of SPA protein Z in SEQ ID NO:l.

11. Amyloid beta peptide binding polypeptide according to any one of claims 5-10, comprising a substitution mutation at a position corresponding to position 27 in SEQ ID NO:l from arginine to leucine.

12. Amyloid beta peptide binding polypeptide according to claim 11, the amino acid sequence of which is as set out in any one of SEQ ID NO:2-38 and 45-46.

13. Amyloid beta peptide binding polypeptide according to any one of claims 5-12, comprising a substitution mutation at a position corresponding to position 17 in SEQ ID NO:l from leucine to valine.

14. Amyloid beta peptide binding polypeptide according to claim 13, the amino acid sequence of which is as set out in any one of SEQ ID NO:2-6, 8-13, 15-19, 21, 23- 24, 26-36, 38-40, 43, 45 and 46.

15. Amyloid beta peptide binding polypeptide according to any one of claims 5-14, comprising a substitution mutation at a position corresponding to position 24 in SEQ ID NO:l from glutamic acid to alanine.

16. Amyloid beta peptide binding polypeptide according to claim 15, the amino acid sequence of which is as set out in any one of SEQ ID N0:2, 4-11, 13, 15, 17, 18, 22, 24-38 and 45.

17. Amyloid beta peptide binding polypeptide according to any one of claims 5-16, comprising a substitution mutation at a position corresponding to position 18 in SEQ ID NO:l from histidine to an amino acid residue se- lected from tyrosine and phenylalanine.

18. Amyloid beta peptide binding polypeptide according to claim 17, the amino acid sequence of which is as set out in any one of SEQ ID NO:4-8, 11, 12, 14, 16-23, 25, 27, 29-34, 36, 39-41, 45 and 46.

19. Amyloid beta peptide binding polypeptide according to claim 17, comprising a substitution mutation at a position corresponding to position 18 in SEQ ID NO:l from histidine to tyrosine.

20. Amyloid beta peptide binding polypeptide according to any one of claims 5-19, comprising a substitution mutation at a position corresponding to position 28 in SEQ ID NO:l from asparagine to an amino acid residue selected from cysteine and serine.

21. Amyloid beta peptide binding polypeptide according to claim 20, the amino acid sequence of which is as set out in any one of SEQ ID NO:2-40 and 45-46.

22. Amyloid beta peptide binding polypeptide according to any one of claims 5-21, comprising a substitution mutation at a position corresponding to position 35 in SEQ ID NO : 1 from lysine to an amino acid selected from glutamic acid and glutamine.

23. Amyloid beta peptide binding polypeptide according to claim 22, comprising a substitution mutation at a position corresponding to position 35 in SEQ ID N0:1 from lysine to glutamic acid.

24. Amyloid beta peptide binding polypeptide according to claim 22, the amino acid sequence of which is as set out in any one of SEQ ID NO:2-ll, 13-17, 19-21, 23, 24, 26-38 and 45.

25. Amyloid beta peptide binding polypeptide according to any one of claims 5-24, comprising a substitution mutation at a position corresponding to position 10 in SEQ ID NO: 1 from glutamine to glycine.

26. /Amyloid beta peptide binding polypeptide according to any one of claims 5-25, comprising a substitution mutation at a position corresponding to position 14 in SEQ ID NO: 1 from tyrosine to an amino acid residue selected from glycine and proline.

27. Amyloid beta peptide binding polypeptide according to any one of claims 5-26 comprising an acidic amino acid residue at a position corresponding to position 25 in SEQ ID NO:l.

28. Amyloid beta peptide binding polypeptide according to any one of claims 5-27, comprising a substitution mutation at a position corresponding to position 32 in SEQ ID NO:l from glutamine to an amino acid residue selected from lysine, arginine and histidine.

I 29. .amyloid beta peptide binding polypeptide according to claim 28, comprising a substitution mutation at said position from glutamine to an amino acid residue se- lected from lysine and arginine.

30. Amyloid beta peptide binding polypeptide according to any one of claims 5-29, comprising a substitution mutation at one or more of the positions corresponding to positions 13-14 and 24-25 in SEQ ID NO:l from the amino acid residue in the sequence according to SEQ ID NO:l to proline . -^;

31. Amyloid beta peptide binding polypeptide accord- ing to any one of claims 5-30, the amino acid sequence of which corresponds to that of SEQ ID NO:l comprising at least the following mutations: L17V, H18Y, E24A and R27L.

32. &myloid beta peptide binding polypeptide accord- ing to any one of claims 5-31, the amino acid sequence of which corresponds to that of SEQ ID NO:l comprising at least the following mutations: P20K, H18V, L17F and I16F.

33. Amyloid beta peptide binding polypeptide accord- ing to any preceding claim, the amino acid sequence of which comprises substitution mutations in the sequence so as to contain the amino acid motif KLVFF.

34. Amyloid beta peptide binding polypeptide, whose amino acid sequence fulfils one definition selected from the following: a) it is selected from SEQ ID NO : 2-46; b) it is an amino acid sequence having 85 % or greater identity to a sequence selected from SEQ ID NO:2-46.

35. Amyloid beta peptide binding polypeptide according to any preceding claim, in which at least one of the asparagine residues present in the domain of staphylococcal protein A (SPA) to which said polypeptide is related have been replaced with another amino acid residue.

36. Amyloid beta peptide binding polypeptide according to claim 35, the sequence of said domain of staphylococcal protein A (SPA) corresponding to the sequence of SPA protein Z as set forth in SEQ ID NO:l, and the polypeptide comprising substitution mutations at at least one position chosen from N3, N6, Nil, N21, N23, N28, N43 and N52.

37. Amyloid beta peptide binding polypeptide according to claim 36, comprising at least one of the following mutations: N3A, N6A, N6D, N11S, N23T, N28A and N43E.

38. Amyloid beta peptide binding polypeptide, which constitutes a fragment of a polypeptide according to any preceding, claim, which fragment retains binding affinity for an amyloid beta peptide.

39. Amyloid beta peptide binding polypeptide accord- ing to any preceding claim, which comprises additional amino acid residues at either terminal.

40. Amyloid beta peptide binding polypeptide according to claim 39, in which the additional amino acid resi- dues comprise a cysteine residue at the N- or C-terminal of the polypeptide .

41. Amyloid beta peptide binding polypeptide according to any one of claims 39-40, in which the additional amino acid residues comprise a tag, preferably chosen from a hexahistidyl tag, a myc tag and a flag tag.

42. Amyloid beta peptide binding polypeptide according to claim 41, comprising an amino acid sequence selected from SEQ ID NO: 66-75.

43. Amyloid beta peptide binding polypeptide according to any one of claims 40-42, in which the additional amino acid residues comprise at least one functional polypeptide domain, so that the polypeptide is a fusion polypeptide between a first moiety, consisting of the polypeptide according to any one of claims 1-38, and at least one second and optionally further moiety or moieties .

44. Amyloid beta peptide binding polypeptide accord- ing to claim 43, in which the second moiety consists of one or more polypeptide (s) according to any one of claims 1-38, making the polypeptide a multimer of amyloid beta peptide binding polypeptides according to any one of claims 1-38, the sequences of which may be the same or different.

45. Amyloid beta peptide binding polypeptide according to claim 44, comprising an amino acid sequence selected from SEQ ID NO: 76-81.

46. Amyloid beta peptide binding polypeptide according to claim 43, in which the second moiety comprises at least one polypeptide domain capable of binding to a target molecule other than amyloid beta peptide.

47. Amyloid beta peptide binding polypeptide according to claim 46, in which the second moiety comprises at least one polypeptide domain capable of binding to human serum albumin.

48. Amyloid beta peptide binding polypeptide according to claim 47, in which the at least one polypeptide domain capable of binding to human serum albumin is the albumin binding domain of streptococcal protein G.

49. Amyloid beta peptide binding polypeptide accord- ing to claim 48, comprising an amino acid sequence selected from SEQ ID NO: 47-65.

50. Amyloid beta peptide binding polypeptide according to claim 46, in which the second moiety comprises a polypeptide which is related to a domain of staphylococcal protein A (SPA) in that the sequence of the polypeptide corresponds to the sequence of the SPA domain having 1 to about 20 substitution mutations.

51. Amyloid beta peptide binding polypeptide according claim 50, in which the sequence of the second moiety polypeptide corresponds to the sequence of SPA protein Z, as set forth in SEQ ID NO:l, having 1 to about 20 substitution mutations.

52. Amyloid beta peptide binding polypeptide according to claim 43, in which the second moiety is capable of enzymatic action.

53. Amyloid beta peptide binding polypeptide according to claim 43, in which the second moiety is capable of fluorescent action.

54. Amyloid beta peptide binding polypeptide accord- ing to claim 43, in which the second moiety is a phage coat protein or a fragment thereof.

55. Amyloid beta peptide binding polypeptide according to any preceding claim, which comprises a label group.

56. Amyloid beta peptide binding polypeptide according to claim 55, in which the label group is chosen from fluorescent labels, biotin and radioactive labels.

57. Nucleic acid molecule comprising a sequence encoding a polypeptide according to any one of claims 1-56.

58. Expression vector comprising the nucleic acid molecule according to claim 57.

59. Host cell comprising the expression vector according to claim 58.

60. Use of a polypeptide according to any one of claims 1-56 in a method of affinity separation.

61. Method of separation of amyloid beta peptide present in a sample from other constituents in the sample, comprising a step of affinity separation, in which step a polypeptide according to any one of claims 1-56 is used.

62. Method according to claim 61, comprising the steps : a) applying the sample to an affinity matrix comprising a polypeptide according to any one of claims 1-56 under conditions that are conducive to binding of amyloid beta peptide to the affinity matrix; b) washing the affinity matrix for removal of sub- stances not bound thereto; and c) eluting the bound amyloid beta peptide from the affinity matrix, thus obtaining an amyloid beta peptide fraction with an enriched amyloid beta peptide content; and d) recovering said amyloid beta peptide fraction.

63. Method according to claim 61, comprising the steps : a) applying the sample to an affinity matrix comprising a polypeptide according to any one of claims 1-56 under conditions that are conducive to binding of amyloid beta peptide to the affinity matrix; b) washing the affinity matrix for recovery of substances not bound thereto, thus obtaining a depleted fraction with a substantially reduced amyloid beta pep- tide content; and c) recovering said depleted fraction.

64. Method according to claim 61, comprising the steps : a) applying the sample to an affinity matrix comprising a polypeptide according to any one of claims 1-56 under conditions that are conducive to binding of amyloid beta peptide to the affinity matrix; and b) recovering the sample.

65. Method according to claim 61, comprising the steps : a) applying of the sample to an affinity matrix comprising a polypeptide according to any one of claims 1-56 under conditions that are conducive to binding of amyloid beta peptide to the affinity matrix; b) washing the affinity matrix for recovery of substances not bound thereto, thus obtaining a depleted fraction with a substantially reduced amyloid beta pep- tide content; and c) eluting the bound amyloid beta peptide from the affinity matrix, thus obtaining an amyloid beta peptide fraction with an enriched amyloid beta peptide content; and d) recovering said amyloid beta peptide fraction and said depleted fraction.

66. Affinity matrix comprising a polypeptide according to any one of claims 1-56.

67. Method according claim 61 for reducing the con- tent of amyloid beta peptide in a portion of a body fluid of a human, comprising the steps to: a) provide a portion of a body fluid from a human; b) apply the portion of a body fluid to an affinity matrix comprising a polypeptide according to any one of claims 1-56 under conditions enabling binding of amyloid beta peptide to the affinity matrix, thereby causing a reduction of the content of amyloid beta peptide in the portion of body fluid; and c) return at least a part of said portion of body fluid to said human.

68. Method according to claim 67, wherein said sample of a body fluid is obtained from a subject afflicted by Alzheimer's disease, and the symptoms of Alzheimer's disease are alleviated by performing said method.

69. Method according to any one of claims 67-68, wherein said body fluid is whole blood.

70. Method according to any one of claims 67-68, wherein said body fluid is plasma.

71. Method according to any one of claims 67-68, wherein said body fluid is serum.

72. Use of a polypeptide according to any one of claims 1-56 for detection of amyloid beta peptide.

73. Method for detection of amyloid beta peptide in a sample, in which method a polypeptide according to any one of claims 1-56 is used.

74. Method according to claim 73, comprising the steps: (i) providing a sample to be tested, (ii) applying a polypeptide according to any one of claims 1-56 to the sample under conditions such that binding of the polypeptide to any amyloid beta peptide present in the sample is enabled, (iii) removing non-bound polypeptide, and (iv) detecting bound polypeptide.

75. Method according to claim 73 or 74, in which the sample is a biological fluid sample, preferably a human blood plasma sample.

76. Method according to claim 73 or 74, in which the sample is a tissue sample.

77. Use of a polypeptide according to any one of claims 1-56 as a medicament.

78. Use of a polypeptide according to any one of claims 1-56 in the preparation of a medicament for the treatment of a disease characterized by an over- representation of Aβ .

79. Use according to claim 78, in which said disease characterized by an over-representation of Aβ is Alzheimer's disease.

80. Method for treatment of a disease characterized by an over-representation of Aβ, comprising administering to a subject in need of such treatment a therapeutically effective amount of a composition comprising a polypeptide according to any one of claims 1-56.

81. Method according to claim 80, in which said disease characterized by an over-representation of Aβ is Alzheimer's disease.