WO2004113370A1 - NEUE OBERFLÄCHENPROTEIN-(HBsAG-) VARIANTE DES HEPATITIS B VIRUS - Google Patents

NEUE OBERFLÄCHENPROTEIN-(HBsAG-) VARIANTE DES HEPATITIS B VIRUS Download PDF

Info

Publication number
WO2004113370A1
WO2004113370A1 PCT/EP2004/006516 EP2004006516W WO2004113370A1 WO 2004113370 A1 WO2004113370 A1 WO 2004113370A1 EP 2004006516 W EP2004006516 W EP 2004006516W WO 2004113370 A1 WO2004113370 A1 WO 2004113370A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
oligo
polynucleotide
hepatitis
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2004/006516
Other languages
English (en)
French (fr)
Inventor
Udo Krupka
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Siemens Healthcare Diagnostics GmbH Germany
Original Assignee
Dade Behring Marburg GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dade Behring Marburg GmbH filed Critical Dade Behring Marburg GmbH
Priority to EP04739976.1A priority Critical patent/EP1638995B1/de
Priority to CA002529997A priority patent/CA2529997A1/en
Priority to JP2006515968A priority patent/JP4866238B2/ja
Priority to US10/561,343 priority patent/US7485312B2/en
Publication of WO2004113370A1 publication Critical patent/WO2004113370A1/de
Anticipated expiration legal-status Critical
Priority to US12/292,747 priority patent/US8628772B2/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • HBsAg New surface protein variant of the hepatitis B virus
  • the invention relates to sequences of a new variant of the hepatitis B surface antigen (HBsAg) and methods to detect this genome and protein variant and antibodies directed against them from patient samples.
  • HBsAg hepatitis B surface antigen
  • the invention also relates to immunochemical detection methods for the simultaneous detection of this new HBV variant together with known variants / subtypes and the use of the new sequences in conjunction with known sequences for the simultaneous detection of HBV-specific antibodies.
  • the antigen or antibody determinations can each be carried out differentially or non-differentiatingly in a test batch.
  • the invention also relates to the detection of the corresponding nucleic acids with the aid of so-called nucleic acid tests (e.g. polymerase chain reaction, PCR) with the aid of suitable primers, and to the use of the new amino acid sequences for generating vaccines.
  • nucleic acid tests e.g. polymerase chain reaction, PCR
  • the hepatitis B virus is the trigger for a variety of disease courses from mild inapparent infections to chronically active and fulminant liver infections caused by viral infections (viral hepatitis).
  • HBV infection is a global health problem with an estimated 400 million people affected (Lee, N. Engl. J. Med. 337; 1733-1745 (1997)).
  • Active immunization stimulation of the antibody response by antigen administration
  • passive immunization by injection of preformed antibodies
  • the HBV belongs to the Hepadna viruses and is a virus particle with a diameter of 42 nm, which consists of the core and the shell.
  • the genome of the virus is a double-stranded, circular DNA sequence of approximately 3200 nucleotides, which encode at least six different viral genes (Tiollais et al., Nature 317: 489-495 (1985)). There are four open reading frames for the formation of the viral proteins.
  • HBV surface antigen which is also called small protein (S)
  • S small protein
  • L large protein
  • M middle protein
  • the protein regions before the small HBs are also referred to as Pre-S1 and Pre-S2, comprise 108 and 55 amino acids, respectively, and are both contained in the L-protein (389 amino acids), while the M-protein only contains the Pre-S2 together with the S antigen includes (281 amino acids).
  • the Pre-S proteins have different degrees of glycosylation and carry the receptors for the recognition of the liver cells. Unless otherwise stated, the amino acid positions in this application relate to the S antigen (226 aa) without a Pre-S1 and without a Pre-S2 region.
  • the C gene carries the information for the nucleocapsid protein, hepatitis B Gore antigen (HBcAg).
  • HBcAg hepatitis B Gore antigen
  • the translation of this protein can start in the pre-C region and lead to the formation of hepatitis B e-antigen (HBeAg).
  • HBeAg has a different folding and immunogenicity compared to HBcAg. In contrast to HBcAg, HBeAg occurs freely in the serum and, if positive, is regarded as an indicator for the formation of HBcAg and thus for the formation of infectious virus particles.
  • the reverse transcription DNA polymerase contained in the virus particle is encoded by P-Gen and a causative role for the development of HBV-associated primary liver cell carcinomas for the transactivator X-gene is discussed.
  • the viral replication cycle of HBV comprises an intracellular pre-genomic RNA that is rewritten into the DNA in the viral nucleocapsid. Since HBV's own reverse transcriptase DNA polymerase does not have proof-reading capability, incorrect nucleotides are incorporated with a relatively high frequency.
  • the HBV has a mutation rate which, at approximately 1 nucleotide / 10,000 bases / year of infection, corresponds to approximately 10 times that of other DNA viruses (Blum, Digestion 56: 85-95 (1995); Okamoto et al. , Jpn. J. Exp. Med. 57: 231-236 (1987)).
  • deletions and insertions also occur quite frequently (Carman et al., Lancet 341: 349-353 (1993)).
  • HBV The resulting variability of HBV is expressed, among other things, in the appearance of 9 serologically defined subtypes (Courouce et al., Bibliotheca Haematologica 42: 1 (1976) and a total of at least 6 different genotypes, which are designated A to F (Fig. 1 ) and have a geographical distribution (Norder et al., J. Gen. Virol. 73: 3141-3145 (1992), Norder et al., Virology 198: 489-503 (1994)).
  • HBV immunoglobulins and / or antiviral therapy can exert a so-called selection pressure, which leads to the increased occurrence of so-called "escape mutants” "and significantly increase the likelihood of HBV mutants occurring (Terrault et al., Hepatology 28: 555-561 (1998); Tillmann et al., Hepatology 30: 244-256 (1999); Hunt et al., Hepatology 31: 1037-1044 (2000).
  • the immune response after infection with HBV is mainly directed against the so-called a-determinant as a region of the S protein common to all hepatitis B viruses, which is located on the surface of the virus particles (Gerlich et al., Supra) and which is the most heterogeneous part of the B cell epitopes of the S gene.
  • Sequence epitopes which can be represented with the help of synthetically produced cyclic peptide structures, are also partially present.
  • the currently widely used diagnostics are based on the binding of a-determinant-specific antibodies to epitopes of the a-determinant.
  • HBV surface antigen with antibodies against the a-determinant (polyclonal or monoclonal origin) is detected in the serum of donors and, if the result is positive, the corresponding one Blood donation discarded to prevent iatrogenic HBV infections from HBV-contaminated blood.
  • Another application of the HBsAg determination lies in the detection of an acute HBV infection.
  • HBs-specific antibodies in the blood of subjects with a positive determination result of HBsAg-specific antibodies (anti-HBs) proves that either a natural infection has occurred or that a vaccination has been carried out successfully.
  • variants and mutants of HBV are not clear, although a proposal in this regard is widely used (Carman, J. Viral Hepat. 4 (suppl.1): 11-20 (1997). Accordingly, the term "variant" can be used for naturally occurring subtypes that occur without known interference from selection pressure (antiviral therapy and / or administration of immunoglobulin) and have a geographical distribution pattern.
  • the characterization and subsequent classification of the subtypes is carried out with the help of monoclonal antibodies and is based on a changed reaction pattern due to the exchange of one or a few amino acids.
  • HBV subtypes can be roughly divided into adr, adw, ayr or ayw, which can be further divided into at least 9 sub-types: aywl, ayw2, ayw3, ayw4, ayr, adwr2, adw4, adrq + and adrq- (Swenson et al., J. Virol. Meth. 33: 27-28 (1991), Blitz et al. J. Clin. Microbiol. 36: 648-651, Ashton-Rickardt et al., J. Med. Virol. 29: 204-214 (1989)).
  • the present invention therefore relates to an oligo- or polypeptide comprising an amino acid sequence which has at least 78% identity to SEQ ID NO: 14.
  • the amino acid sequence shown in SEQ ID NO: 14 corresponds to amino acid positions 93 to 140 of the S antigen of hepatitis B, which has a total length of 226 amino acids.
  • Preferred embodiments relate to an oligo- or polypeptide comprising an amino acid sequence 'at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to SEQ ID NO: 14 has.
  • the invention also relates to an oligo- or polypeptide comprising an amino acid sequence which has at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to SEQ ID NO: 12.
  • the amino acid sequence shown in SEQ ID NO: 12 corresponds to amino acid positions 43 to 196 of the S antigen of the hepatitis B virus, which has a length of 226 amino acids.
  • the determination of the identity between two amino acid sequences is known per se to the person skilled in the art and can be carried out using conventional computer programs. The identity is preferably determined using the computer program “Bestfit” from the Genetics Computer Group (Madison, Wl). The parameters are used in the standard settings.
  • the program version current on the priority date of the present application is preferably used.
  • a high percentage of identity means a high correspondence, equality or equivalence between two sequences.
  • the oligo- or polypeptide according to the invention can also comprise an amino acid sequence in which zero to 10 amino acids are substituted, deleted or inserted with respect to SEQ ID NO: 14.
  • amino acid sequence 0 to 9, 0 to 8, 0 to 7, 0 to 6, 0 to 5, 0 to 4, 0 to 3, 0 to 2 amino acids or 1 amino acid can also be substituted, deleted or substituted for SEQ ID NO: 14 be advertised.
  • Substitutions can also affect the amino acid positions corresponding to positions 96, 103, 114 to 118, 120, 127, 129 and 136 of the S-antigen of HBV.
  • the oligo- or polypeptide according to the invention can also comprise an amino acid sequence in which zero to 10 amino acids are substituted, deleted or inserted with respect to SEQ ID NO: 12.
  • amino acid sequence 0 to 9, 0 to 8, 0 to 7, 0 to 6, 0 to 5, 0 to 4, 0 to 3, 0 to 2 amino acids or 1 amino acid can also be substituted, deleted or substituted for SEQ ID NO: 12 be advertised.
  • the oligo- or polypeptide according to the invention can also comprise an amino acid sequence in which zero to 9 amino acids are substituted, deleted or inserted with respect to SEQ ID NO: 16.
  • amino acid sequence 0 to 8, 0 to 7, 0 to 6, 0 to 5, 0 to 4, 0 to 3, 0 to 2 amino acids or 1 amino acid can also be substituted, deleted or inserted with respect to SEQ ID NO: 16.
  • the oligo- or polypeptide of the present invention can also comprise an amino acid sequence which is a partial sequence of SEQ ID NO: 12 with at least 5 consecutive amino acids of SEQ ID NO: 12, the partial sequence being at least one of positions 54, 61, 72, 73 , 74, 75, 76, 78, 85, 87 and 94 of SEQ ID NO: 12. These amino acid positions correspond to positions 96, 103, 114 to 118, 120, 127, 129 and 136 of the S-antigen of HBV.
  • the partial sequence preferably comprises at least 6, more preferably at least 7, most preferably at least 8 consecutive amino acids of the amino acid sequence shown in SEQ ID NO: 12.
  • Embodiments comprise the partial sequence at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95 or at least 100 consecutive amino acids of the amino acid sequence shown in SEQ ID NO: 12.
  • the subsequence includes two, three, four, five, six, seven, eight, nine, ten, or all eleven of positions 54, 61, 72, 73, 74, 75, 76, 78, 85, 87 and 94 of SEQ ID NO: 12 a.
  • the polypeptide of the invention may also comprise a fragment of an HBs antigen from a hepatitis B virus, the fragment being at least 5 amino acids in length, the HBs antigen at position 96 alanine, at position 103 isoleucine, at position 114 alanine, at position 115 isoleucine, at position 116 asparagine, at position 117 asparagine, at position 118 arginine, at position 120 glutamine, at position 127 threonine, at position 129 histidine and / or at position 136 has tyrosine, and the fragment Alanine 96, isoleucine 103, Alanine 114, isoleucine 115, asparagine 116, asparagine 117, arginine 118, glutamine 120, threonine 127, histidine 129 and / or tyrosine 136 ' .
  • the oligo- or polypeptide can include one, two, three, four,
  • the minimum length of the oligo- or polypeptides according to the invention is 5, preferably 6, more preferably 7, most preferably 8 amino acids.
  • the total length of the oligo- or polypeptide is usually 5 to 1000 amino acids, preferably 6 to 500 amino acids, more preferably 7 to 300 amino acids, most preferably 8 to 200 amino acids.
  • the oligo- or polypeptides can also contain foreign amino acids that are not encoded by the genome of a hepatitis B virus. For example, amino acids can be contained which facilitate coupling to solid phases or which enable coupling to labeling substances. It may contain amino acids which have arisen due to the cloning and which were also expressed in the recombinant expression.
  • the oligo- or polypeptide according to the invention can be a fusion protein which contains a fusion partner in addition to amino acids derived from HBV, e.g. B. a "tag" sequence, which facilitates purification, or a protein content, which increases the solubility and / or yield in the recombinant expression. Fusion partners of this type are known per se to the person skilled in the art.
  • the oligo- or polypeptides do not contain foreign amino acids that are not encoded by the genome of an HBV. Accordingly, these oligo- or polypeptides consist of one of the amino acid sequences described above and / or in the claims.
  • the oligo- or polypeptide according to the invention is preferably immunogenic, i.e. it can induce an antibody response in a mammalian organism.
  • the oligo- or polypeptide contains at least one antigenic determinant or at least one epitope.
  • the oligo- or polypeptide contains an epitope, which in other HBV variants, e.g. B. in subtype ayw2, is not included.
  • the oligo- or polypeptide preferably comprises one of the amino acid sequences SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID N0.17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.
  • Another aspect of the invention is an immunogenic peptide or a mixture of immunogenic peptides containing one or more of the oligo- or polypeptides described in this application.
  • the immunogenic peptide or the immunogenic mixture can contain the oligo- or polypeptide (s) alone or in conjunction with known HBV immunogens.
  • the present invention also relates to nucleic acid molecules which are derived from the genome of the new HBV variant HDB 11 or mutants thereof, in particular nucleic acid molecules which are derived from the gene encoding HSbAg.
  • the invention therefore relates, for example, to an oligonucleotide or polynucleotide which comprises a nucleotide sequence which has at least 91% identity to SEQ ID NO: 3.
  • the nucleotide sequence SEQ ID NO: 3 codes for the amino acid sequence SEQ ID NO: 14.
  • Preferred embodiments relate to an oligonucleotide or polynucleotide comprising a nucleotide sequence which is at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO : 3 has.
  • the invention also relates to an oligonucleotide or polynucleotide comprising a nucleotide sequence which has at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of SEQ ID NO: 1.
  • the nucleotide sequence SEQ ID NO: 1 codes for the amino acid sequence SEQ ID NO: 12.
  • Identity is defined here as the degree of equality between two strands of two DNA segments. Identity is expressed as a percentage by dividing the number of identical bases of two sequences to be compared by the length of the shorter sequence and multiplying by 100 (Smith et al., Adv. Appl. Mathem. 2: 482-489 (1981).
  • the determination of the identity between two amino acid sequences is known per se to the person skilled in the art and can be carried out using conventional computer programs.
  • the identity is preferably determined using the computer program “Bestfit” from the Genetics Computer Group (Madison, Wl). The parameters are used in the standard settings.
  • the program version current on the priority date of the present application is preferably used.
  • a high percentage of identity means a high correspondence, equality or equivalence between two sequences.
  • the invention further relates to an oligonucleotide or polynucleotide comprising a nucleotide sequence in which, compared to SEQ ID NO: 3, 0 to 13 nucleotides are substituted, deleted or added.
  • the nucleotide sequence can also contain 0 to 12, 0 to 11, 0 to 10, 0 to 9, 0 to 8, 0 to 7, 0 to 6, 0 to 5, 0 to 4, 0 to 3, 0 to 2 nucleotides or 1 nucleotide compared to SEQ ID NO: 3, deleted or inserted.
  • the oligonucleotide or polynucleotide according to the invention can also comprise a nucleotide sequence which is a partial sequence of SEQ ID NO: 1 with at least 8 consecutive nucleotides of SEQ ID NO. where the partial sequence is at least one of positions 161, 183, 213, 214, 218, 221, 224, 227, 233, 234, 239, 253, 261, 281, 294, 306, 312, 387, 405 and 408 of SEQ ID NO: 1 includes.
  • the partial sequence preferably comprises at least 9, more preferably at least 10, most preferably at least 12 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 1.
  • the partial sequence comprises at least 15, at least 18, at least 20, at least 25, at least 30, at least 35, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 150, at least 175, at least 200, at least 250 or at least 300 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 1.
  • the partial sequence preferably includes two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, 13, 14, 15, 16, 17, 18, 19 or all 20 of positions 161, 183, 213, 214, 218, 221, 224, 227, 233, 234, 239, 253, 261, 281, 294, 306, 312, 387, 405 and 408 of SEQ ID NO: 1.
  • the oligonucleotide or polynucleotide comprises a nucleotide sequence which hybridizes under stringent conditions, preferably specifically, with a polynucleotide complementary to the sequence SEQ ID NO: 1.
  • the oligonucleotide or polynucleotide comprises a nucleotide sequence which, under stringent conditions, preferably specifically, has a sequence with the sequence SEQ ID NO.2, SEQ ID 0: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and / or SEQ ID NO. 1 complementary polynucleotide hybridized.
  • stringent conditions are the following conditions: a) 16-hour incubation at 42 ° C. in a solution containing 50% formamide, 5xSSC (150 m NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate pH 7.6, ⁇ xDenhardt's Solution, 10% dextran sulfate and 20 ⁇ g / ml denatured, sheared salmon sperm DNA; b) then washing in 0.1xSSC at about 65 ° C.
  • a nucleotide sequence hybridizes specifically to a given polynucleotide if it does not hybridize to other nucleotide sequences or does so much less. In the present case, this can mean that the nucleotide sequence does not hybridize or only weakly hybridizes to polynucleotides from HBV-coding from conventional HBV variants (eg genotype D, subtype ayw2).
  • the invention also relates to an oligonucleotide or polynucleotide comprising a nucleotide sequence which codes for an oligo or polypeptide according to the invention, as described in this application is described.
  • Another aspect of the invention is an oligonucleotide or polynucleotide comprising a nucleotide sequence which is complementary to the nucleotide sequences described above.
  • the minimum length of the oligonucleotides or polynucleotides according to the invention is 6, preferably 8, more preferably 10, most preferably 12 nucleotides.
  • the total length of the oligo- or polynucleotide is usually 6 to 3000 nucleotides, preferably 6 to 1500 nucleotides, more preferably 8 to 900 nucleotides, most preferably 8 to 600 nucleotides.
  • the oligonucleotides or polynucleotides can also contain nucleotides that are not derived from the genome of a hepatitis B virus. It can contain nucleotides that code for certain amino acids that are intended to perform the desired functions, as described above.
  • the oligonucleotide or polynucleotide according to the invention can code for a fusion protein which contains a fusion partner in addition to amino acids derived from HBV, e.g. B. a "tag" sequence, - which facilitates cleaning, or a protein content, which increases the solubility and / or yield in the recombinant expression. Fusion partners of this type and the DNA encoding them are known per se to the person skilled in the art.
  • Preferred oligonucleotides or polynucleotides of the present invention comprise a nucleotide sequence which is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 11.
  • polynucleotides according to the invention can also be labeled, for example by a fluorescent label or a radioactive label.
  • a fluorescent label or a radioactive label.
  • Such polynucleotides can advantageously be used in a hybridization reaction or a polymerase chain reaction (PCR).
  • the invention also relates to a vector or a plasmid containing an oligonucleotide or polynucleotide according to the invention.
  • the plasmid can, for example, be a cloning vector which serves to multiply the nucleic acid in host cells or to provide certain restriction sites.
  • Expression vectors are vectors that allow expression of the cloned nucleic acid in host cells.
  • Host cells can be various prokaryotic or eukaryotic cells.
  • Prokaryotic host cells are e.g. B. bacterial cells such as E. co // cells.
  • the expression vectors according to the invention can contain certain control elements such as promoters or binding sites for repression factors.
  • the expression vectors contain a nucleic acid segment which codes for a part of a fusion protein.
  • the invention also relates to a cell, e.g. B. a host cell containing a polynucleotide according to the invention, a plasmid or a vector according to the invention.
  • the host cells can be cultivated under suitable conditions so that the nucleic acid contained is transcribed and subsequently translated.
  • the invention also relates to a method for producing a polypeptide, in which a polynucleotide, a plasmid or an expression vector of the invention is introduced into host cells and the host cells are cultivated under conditions which lead to the expression of the polypeptide. If appropriate, the polypeptide can then be obtained from the host cells.
  • the polypeptide is preferably produced in bacteria, most preferably in E. co // cells.
  • Suitable means and conditions for cultivation are, for example, in Ausubel et al. (1993) "Current Protocols in Molecular Biology”.
  • the expression of the expressed polypeptide takes place according to methods known per se to the person skilled in the art.
  • Various methods for protein purification are described, for example, in Scopes R. (1994) “Protein Purification: Principles and Practice” (3rd edition) Springer Verlag.
  • polypeptides and peptides of the present invention can also be chemically processed by known methods such as e.g. Solid phase synthesis can be produced.
  • the polynucleotides according to the invention can also be produced by known methods of chemical synthesis. Polynucleotide fragments obtained by chemical synthesis can then also be linked enzymatically by ligases.
  • the oligonucleotides or polynucleotides according to the invention can also be produced by "site-directed mutagenesis" from known sequences by introducing point mutations at certain positions. Such methods are known per se to the person skilled in the art.
  • Another aspect of the invention is an antibody that binds to an oligo or polypeptide according to the invention.
  • Such antibodies can be made in a known manner, either by means of an oligo or polypeptide of the invention, e.g. B. a peptide with one of the sequences SEQ ID NO: 12 to 30, or a fragment thereof (Harlow and Lane (1988) Antibodies: A Laboratory Manual; Cold Spring Harbor Laboratory). They can be polyclonal or rhonoclonal antibodies, but monoclonal antibodies are preferred. Preferably, they are specific antibodies against HBsAg the new HBV variant are directed, but the HBsAg from other HBV variants, e.g. B. Genotype D subtype ayw2, do not recognize.
  • Such antibodies can be obtained by determining peptides specific for the new HBsAg from known strains based on a sequence comparison of the amino acid sequences of the new HBsAg and HBsAg and using these peptides to produce the antibodies. It is also possible to prepare a mixture of polyclonal antibodies and to deplete them by incubation with known HBsAg. In another embodiment, the antibody recognizes not only the new HBsAg, but also known HBsAg variants. This makes it possible to detect different variants of HBsAg at the same time.
  • the antibody of the invention can bind to an oligo or polypeptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO.i ⁇ , SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.
  • the antibody particularly preferably binds to an oligo- or polypeptide which consists of an amino acid sequence which is selected from the group consisting of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.
  • the antibody does not bind to the a-determinants of the known HBV genotypes A, B, C, D, E and F (see Fig. 1).
  • the antibody does not bind to the a-determinant of HBV genotype D, subtype ayw2.
  • Another object of the invention is an anti-idiotypic antibody which represents an amino acid sequence of an oligo- or polypeptide according to the invention.
  • Methods for producing anti-idiotypic antibodies are known per se to the person skilled in the art.
  • the invention also relates to a test kit for the detection of hepatitis B viruses, containing an oligo- or polypeptide according to the invention, an oligo- or polynucleotide according to the invention and / or an antibody according to the invention.
  • the invention also relates to an immunogenic peptide or a mixture of immunogenic peptides containing one or more oligo- or polypeptides according to the invention, alone or in conjunction with known HBV immunogens.
  • Another aspect of the invention is a method for the detection of a hepatitis B antigen, characterized in that (a) a sample is incubated with an antibody according to the invention under conditions which allow the formation of an antigen-antibody complex; and (b) an antigen-antibody complex containing the antibody is detected.
  • Monoclonal or polyclonal antibodies (or mixtures or fragments thereof or mixtures of fragments) which react with epitopes of the new HBV variant can be used to test the a-determinant of the HBV variant according to the invention in the form of the entire polypeptide sequence or parts thereof to be determined: HBsAg of the HDB 11 variant.
  • HBsAg bound to the antibodies is detected after removal of excess sample by further incubation with anti-HBs antibodies (monoclonal or polyclonal or fragments or mixtures of these fragments) which are provided with a probe.
  • An enzyme is often used as the probe, the catalytic conversion (after removal of the excess reagent) of a suitable substrate leads to a color reaction which is measured photometrically and the intensity of which is proportional to the HBsAg content present in the sample.
  • methods which are homogeneous in nature (ie do not require bound / free separation) and which do entirely without a probe (eg agglutination method), can be evaluated with the naked eye (eg radial immunodiffusion) or use other probes (eg radioactive isotopes or chemiluminescence) or several probes (such as the biotin / streptavidin system).
  • HBsAg of the new HBV variant means all methods which are suitable for the detection of polypeptide sequences or antigens of the new HBV variant, regardless of whether the HBsAg of the new variant is determined or in connection with HBsAg of known a-determinants and / or known mutations in the a-region.
  • HBsAg with a detection method against another analyte (e.g. HIV antigen or the simultaneous determination of HBV variant HBsAg and specific antibodies directed against it) in a test approach (differentiating or non-differentiating) combine.
  • another analyte e.g. HIV antigen or the simultaneous determination of HBV variant HBsAg and specific antibodies directed against it
  • the invention also relates to a method for the detection of antibodies which are directed against a hepatitis B antigen, characterized in that (a) a sample is incubated with an oligo- or polypeptide according to the invention under conditions which prevent the formation of an antigen-antibody Allow complex; and (b) the antibody-antigen complex containing the oligo- or polypeptide is detected.
  • epitope-carrying polypeptide or protein sequences which are immobilized on a suitable carrier are incubated with the test sample.
  • Antibodies bound to the epitopes are detected after excess sample has been removed by further incubation with epitope-carrying polypeptide or protein sequences which are provided with a probe.
  • An enzyme is often used as a probe, the catalytic conversion (after removal of the excess reagent) of a suitable substrate leads to a color reaction which is measured photometrically and the intensity of which is proportional to the antibody content present in the sample.
  • methods which are homogeneous in nature (ie do not require bound / free separation), which do entirely without a probe (e.g. agglutination method), can be evaluated with the naked eye (e.g. radial immunodiffusion) or which involve other probes (e.g. radioactive Use isotopes or chemiluminescence) or several probes (such as the biotin / streptavidin system).
  • the polypeptide structures of the HBV variant can be represented by anti-idiotypic antibodies or, by choosing a suitable test principle, variant-specific monoclonal or polyclonal antibodies can also be used to determine anti-HBs antibodies (e.g. in a competitive test format). It is also known that the choice of test principle can also be used to differentiate the immunoglobulin classes (eg by the "indirect" method with a second class-specific antibody (eg IgG or IgM specific) with a probe or with the help of the so-called anti- ⁇ - Principle (IgM specific) Of course the methods and materials (incl. Probe and polypeptide sequences) have to be adapted to the respective target.
  • hepatitis B nucleic acid can be detected.
  • This method is characterized in that (a) a sample is incubated with an oligo- or polynucleotide according to the invention under conditions which allow the selective hybridization of the oligo- or polynucleotide with a hepatitis B nucleic acid in the sample; and (b) determining whether polynucleotide duplexes comprising the oligo- or polynucleotide have been formed.
  • the hepatitis B nucleic acid can also be detected by (a) incubating a sample with at least one oligonucleotide or polynucleotide according to the invention under conditions which allow the selective hybridization of the oligonucleotide or polynucleotide with a hepatitis B nucleic acid in the sample; (b) a polymerase chain reaction is carried out; and (c) determining whether a nucleic acid has been amplified.
  • the invention also relates to the use of an oligonucleotide or polynucleotide according to the invention as a primer and / or as a probe.
  • the present nucleotide sequences can be used to produce primers and / or gene probes, which is why the invention also relates to kits containing primers and / or probes for the detection of HBV variant-specific nucleic acid either alone or in conjunction with known HBV nucleotide sequences in test samples.
  • PCR is a method for amplifying a desired nucleotide sequence of a nucleic acid or a nucleic acid mixture.
  • the primers are each specifically extended by a polymerase with the desired nucleic acid as a reading frame. After dissociation from the original strand, new primers are hybridized and in turn extended by the polymerase. By repeating these cycles, the desired target sequence molecules are enriched.
  • nucleic acid tests it is possible to use nucleotide sequences of the present invention to produce DNA oligomers of 6-8 nucleotides or larger which are suitable as hybridization probes for detecting the viral genome of the HBV variant described here in humans who may carry the virus variant, or e.g. in the blood donation system to screen preserved blood for the presence of the variant genome either specifically or in combination with the detection of nucleotide sequences of known HBV variants and / or HBV mutants.
  • NAT nucleic acid tests
  • Corresponding primers can also be developed on the basis of the nucleotide sequences found for the new HBV variant, which primers are specific for the new variant or can detect both the new variant and variants known in the prior art.
  • the present invention further relates to an isolated hepatitis B virus which has an HBs antigen which comprises an amino acid sequence with at least 91% identity to SEQ ID NO: 12.
  • the HBs antigen of the virus according to the invention preferably comprises the amino acid sequence SEQ ID NO: 12.
  • the invention also includes cultures of tissue cells which are infected with the HBV variant according to the invention as well as the isolated HBV variant itself.
  • the invention also relates to an immunogenic preparation which contains the attenuated or inactivated HDB 11 variant of HBV.
  • the invention also relates to the use of an oligo- or polynucleotide according to the invention or an oligo- or polypeptide according to the invention for the manufacture of a medicament for the treatment or prevention of an HBV infection.
  • the oligo- or polynucleotides or oligo- or polypeptides according to the invention can be used to produce a vaccine against HBV.
  • the invention also includes a vaccine comprising a polypeptide of the present invention and a common adjuvant (eg Freund 's adjuvant, phosphate : buffered saline or the like). Such a vaccine can be used to stimulate the production of antibodies in mammals.
  • a vaccine can be used to stimulate the production of antibodies in mammals.
  • the invention includes a particle that includes a non-variant specific amino acid sequence that induces particle formation along with an epitope-containing polypeptide that is specific for the HBV variant of the invention.
  • nucleotide sequences of the invention can also be used to display so-called antisense oligonucleotides (possibly for therapeutic purposes).
  • SEQ ID NO: 7 340 GCAATCAACAACAGGGGACAA 360
  • An oligonucleotide or polynucleotide according to (1) which is at least 65% or 66% or 67% or 68% or 69% or 70% or 71% or 72% or 73% or 74% or 75% or 76% or 77% or 78% or 79% or 80% or 81% or 82% or 83% or 84% or 85% or 86% or 87% or 88% or 89% or 90% or 91% or 92% or 93% or 94% or 95% or 99% or 97% or 98% or 99% with one of the sequences selected from the group from SEQ ID NO: 1 to SEQ ID NO: 11 is identical.
  • An oligo or polynucleotide according to (1) or (2) which is complementary to an oligo or polynucleotide which is one of one of the sequences selected from the group from SEQ ID NO: 1 to SEQ ID NO: 11 Sequence has hybridized under stringent conditions.
  • Virus encoded characterized in that the fragment contains an oligo or polypeptide according to (1), (2) or (3).
  • An isolated oligonucleotide or polynucleotide which codes for the a-determinant of the HBs antigen of the hepatitis B virus and contains an oligonucleotide or polynucleotide according to (1), (2) or (3).
  • a primer which is for an oligo- or polynucleotide according to one of the items (1) to
  • Isolated oligo- or polypeptide which has an amino acid sequence selected from the group from SEQ ID NO: 12 to SEQ ID NO: 30: SEQ m NO: 12
  • Isolated polypeptide according to the sequence of the HBs antigen of the hepatitis B virus, characterized in that it contains an oligo or polypeptide according to one of the items (10) to (12).
  • Isolated polypeptide which codes for the a-determinant of the HBs antigen of the hepatitis B virus, characterized in that it contains an oligo or polypeptide according to one of the items (10) to (12).
  • Monoclonal or polyclonal antibody which binds to HBs antigen containing an oligo or polypeptide according to one of the items (10) to (15), but which does not bind to HBs antigen from a hepatitis B wild-type virus, or at least significantly less ,
  • Test kit for the detection or determination by means of a hybridization reaction of a nucleic acid which is specific for a variant or mutant of the hepatitis B virus, using at least one oligo- or polynucleotide according to one or more of the items (1) to (7) ,
  • the present invention comprises an isolated nucleotide sequence which is at least 65% identical to SEQ ID NO: 1 or a fragment of this sequence shown in FIGS. 3 and 4, which is specific to the complement of SEQ ID NO: 1 to 11 hybridized.
  • the present invention includes an isolated nucleotide sequence which encodes the present inventive variant of the a-determinant of hepatitis B surface antigen (HBsAg) in the amino acid positions between aa 101 and 180 or leads to a peptide product which in at least 65% of the aa sequence with that in Fig. 5 and 6 shown SEQ ID NO: 12 matches or fragments thereof according to SEQ ID NO: 13 to 30.
  • HBsAg hepatitis B surface antigen
  • the present invention includes a vector comprising one or more of the nucleotide sequences mentioned, as well as a host cell which contains this vector and a method for the preparation of a corresponding polypeptide from the a-determinant, comprising the incubation of the above-mentioned host cell over time and under conditions required for expression of the polypeptide.
  • the invention also relates to antibodies which react with the a-determinant described in SEQ ID NO: 12 to 30, the binding preferably taking place in the amino acid range aa 101 to 150.
  • the antibodies can be polyclonal or monoclonal of animal or human origin.
  • An isolated HBV variant is also the subject of the invention, the virus having an a-determinant which corresponds to the aa sequences at least between position 101 and 120 and / or aa 121 to 140, ideally both regions mentioned between 101 and 140.
  • the present invention also relates to an immunogenic mixture for generating polyclonal or monoclonal antibodies, comprising the isolated HBV described or one or more of the described polymer peptides.
  • the invention also includes a polynucleotide probe containing an HBV genome sequence which, by substitution of amino acids, leads to a modified a-determinant which is identical to the described aa sequence of the new HBV variant or corresponds to at least 65%.
  • kits for the detection of polynucleotides of the HBV variant with the aid of the above-mentioned probe as well as kits for the detection of HBsAg of the variant or individual epitopes thereof and antibodies which are specific for the variant or epitopes thereof are the subject of the invention, such as Methods for the detection of polynucleotides, antigen and antibodies, comprising an incubation to form corresponding complexes and detection of these complexes by suitable methods known to those skilled in the art.
  • kits and detection methods can be designed for the specific and sole detection of nucleotides and antigens of the HBV variant or antibodies directed against them, or as a supplement, ie the additional detection of the variant analytes according to the invention to currently known HBV nucleotides, antigens or - Allow antibodies.
  • an immunogenic mixture of polypeptide sequences according to the invention can also be used in conjunction with known antigens e.g. can be used to improve the effectiveness of a vaccine.
  • the present invention describes a new variant of the hepatitis B virus (HBV), which has a completely new a-determinant as a result of amino acid exchanges in the subsequent aa positions of the S-HBsAg sequence.
  • HBV hepatitis B virus
  • the 1-letter code is used to describe the amino acids:
  • position aa 96 of HDB 11 contains alanine (A) instead of valine (V): A 96 V
  • the present invention relates to an isolated nucleotide sequence which codes for the a-determinant of the virus (Fig. 3 and SEQ ID No .: 1).
  • the invention also includes nucleotides with at least 65% agreement, preferably at least 75% agreement and particularly preferably with at least 90% agreement with the nucleotide sequence of the present invention or fragments thereof as well as sequences complementary thereto.
  • the invention also encompasses polypeptides encoded by the nucleotide sequences described above, in particular those amino acid sequences which determine the a-determinant of HBsAg and polypeptides which are at least 65%, preferably 75% and more preferably 95% similar to these sequences exhibit.
  • nucleotide fragment is understood to mean a consecutive sequence of at least 8 or 9, preferably 9-15, particularly preferably 15-21 and even very particularly preferably 21-60 nucleotides from the nucleotide sequence of the new HBV variant, mixtures of such nucleotide fragments are also included.
  • a polypeptide fragment is understood to mean a sequence of at least 3, preferably 3-5, particularly preferably 5-7 and even very particularly preferably 7-20 amino acids from the a-determinant of the new HBV variant, mixtures of such polypeptide fragments also being understood fall under this invention.
  • the present invention also includes an isolated nucleotide sequence which can be hybridized and leads to nucleotide sequences which correspond to the nucleotide sequences of the HBsAg of the new HBV variant or parts of the a-determinant of the new HBV variant, are complementary thereto or as a subtype or Mutation due to HDB 11.
  • a nucleotide sequence after its isolation by methods according to the prior art, is introduced into prokaryotic (eg E. coli), eukaryotic host cells (eg Chinese Hamster Ovary Cell) or yeast (eg S. Cerevisiae) with the aid of a vector or construct can be (using methods known to those skilled in the art such as transfection, transformation or electroporation: Molecular Cloning: A Laboratory Manual, 2 ⁇ d ed., Vol. 1-3, ed Sambrook et al., Cold Spring Harbor Laboratory Press (1989), whereby transient or permanent cultures can be applied.
  • prokaryotic eg E. coli
  • eukaryotic host cells eg Chinese Hamster Ovary Cell
  • yeast eg S. Cerevisiae
  • the present invention comprises isolated nucleotide sequences of the a-determinant of the new HBV variant, polypeptides which are encoded by these nucleotides, vectors which contain nucleotide sequences of the a-determinant of the new HBV variant as well as the host cell into which a vector is brought.
  • vectors which contain nucleotide sequences of the a-determinant of the new HBV variant as well as the host cell into which a vector is brought.
  • analogous polypeptide structures can also be produced fully synthetically or directly from the virus variant by purification.
  • polypeptides or proteins of the new HBV variant it is possible to use the polypeptides or proteins of the new HBV variant to generate monoclonal and / or polyclonal antibodies which immunologically bind to binding sites (epitopes) of the a-determinant of the new HBV variant.
  • the methods for producing antibodies are known to the person skilled in the art (e.g. Koehler et al., Nature 256-494 (1975), Mimms et al., Vi. 176: 604-619 (1990).
  • the a-determinant of the HDB 11 variant according to the invention in the form of the entire polypeptide sequence or parts thereof for the determination of antibodies directed against the HBV variant (anti-HBs antibodies) (see above).
  • the invention also relates to diagnostic reagents as kits which, based on the methods described above, detect HBV variant-specific antigen (HBsAg) or antibodies directed against it (anti-HBs), either as singular determinations or with one another or with other known HBV antigens or antibodies which react specifically with it or can also be combined with completely different analytes.
  • HBV variant-specific antigen HBsAg
  • anti-HBs antibodies directed against it
  • Fig. 1 shows an overview of the amino acid sequences of the a-determinant of 6 described genotypes of HBV compared to HDB 11.
  • Fig. 2 shows the nucleotide and amino acid sequences of the a-determinant and immediately adjacent regions of genotype D, subtype ayw2 of HBV.
  • Fig. 3 shows the nucleotide sequence of the a-determinant of the HBV surface antigen for subtype ayw2 of genotype D of HBV in comparison to the nucleotide sequence of HDB 11.
  • Fig. 4 summarizes the translation-relevant deviations of the nucleotide sequence of HDB 11.
  • Fig. 5 shows the nucleotide sequence of HDB 11 in the region of the a-determinant and the corresponding amino acid sequence.
  • the a-determinant is between amino acid No. 101 and 180 of the small HBsAg (Small, S).
  • Fig. 6 shows the corresponding polypeptide sequence of the a-determinant of HDB 11, which is encoded by the nucleotide sequence described in Fig. 5.
  • Example 1 HBsAg determination using an enzyme immunoassay, EIA
  • test principle is a so-called sandwich test in microtiter plate format:
  • a one-step process 100 ⁇ l of the sample to be examined are brought into contact with 25 ⁇ l conjugate 1 (monoclonal HBsAg-specific antibodies from the mouse which are covalently labeled with biotin) and immobilized HBsAg-specific polyclonal antibodies from the sheep. After incubation for 60 minutes at 37 ° C. and removal of excess components by washing the plate cavities four times, 100 ⁇ l conjugate 2, which consists of streptavidin, to which the probe enzyme peroxidase is covalently bound, is added.
  • conjugate 1 monoclonal HBsAg-specific antibodies from the mouse which are covalently labeled with biotin
  • immobilized HBsAg-specific polyclonal antibodies from the sheep. After incubation for 60 minutes at 37 ° C. and removal of excess components by washing the plate cavities four times, 100 ⁇ l conjugate 2, which consists of streptavidin, to which the probe enzyme peroxidase is covalently bound, is added.
  • the intensity of the color development is directly proportional to the HBsAg content of the test sample, an O.D. Value of less than the limit is rated as HBsAg negative.
  • the limit is defined as the O.D. mean of the control tested in parallel, negative (included in the test kit), at which a constant amount of 0.05 O.D. is added.
  • the DNA was isolated from a 200 ⁇ l aliquot of the Egyptian sample by using the QIA amp® DNA Blood Mini Kit from Qiagen, Hilden Germany). All process steps were followed as described in the package insert and the elution was carried out in a volume of 50 ⁇ l.
  • Primer 1 with the 5 '> 3' sequence GGGTCACCATATTCTTGGGAAC (SEQ ID NO: 31)
  • the 50 ⁇ l batch was amplified using the thermal cycler described under the following conditions:
  • PCR 2 product was separated electrophoretically (1.5% agarose) while carrying suitable molecular weight markers.
  • the band with about 520 base pairs was cut out and isolated using the QIA quick gel extraction kit from Qiagen, Hilden Germany.
  • the purified PCR product was sequenced by Medigenomix, Martinsried, Germany using the ABI 3700 capillary system in connection with the ABI BigDye Terminator Chemistry Version 1.1. and the ABI Sequencing Analysis Software Version 3.6. using primers 3 and 4 described in Example 3.
  • HBsAg of the sample within the sequenced area best matches the nucleotide and amino acid sequence with that Genotype D, subtype ayw2 shows, but has a total of 10 amino acid substitutions in the region of the a-determinant (see also Fig. 2 and 5):
  • HDB 11 D, ayw2:
  • position aa # 122 was read as Arg R in the first analysis, while the second analysis spoke more for Lys (K).
  • the nucleotide profile allows both interpretations, which is also an indication for the
  • the detection limits of the EIA determination method used should in any case have given rise to a positive EIA result.
  • the amino acid corresponding to position 122 can therefore be found in the sequences SEQ ID NO: 12, SE Q IDNO: 14, SEQIDNO: 15, SEQIDNO: 16, SEQ ID NO: 25, SEQ ID NO: 27, SE Q ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30 can be either K or R.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Die Erfindung betrifft Sequenzen einer neuen Variante des Hepatitis B surface Antigens (HBsAG) und Methoden zum Nachweis von Nukleinsäuren, Antigenen und dagegen gerichteten Antikörpern in Patientenproben.

Description

Neue Oberflächenprotein- (HBsAg-) Variante des Hepatitis B Virus
Die Erfindung betrifft Sequenzen einer neuen Variante des Hepatitis B surface Antigens (HBsAg) und Methoden, diese Genom- und Protein-Variante sowie dagegen gerichtete Antikörper aus Patientenproben zu detektieren.
Die neuen Sequenzen führen zu 11 im Stand der Technik noch nicht bekannten Aminosäure- Austauschen in dem Hepatitis B surface Antigen (HBsAg) in den Aminosäurepositionen 96 bis 136 der Aminosäuresequenz des surface Antigens, wobei sich 10 Substitutionen in der Region der a-Determinante befinden (aa 101 bis aa 180)
Die Erfindung betrifft auch immunchemische Nachweisverfahren zum gleichzeitigen Nachweis dieser neuen HBV - Variante zusammen mit bekannten Varianten/Subtypen sowie die Verwendung der neuen Sequenzen in Verbindung mit bekannten Sequenzen zum gleichzeitigen Nachweis von HBV-spezifischen Antikörpern. Die Antigen bzw. Antikörper- Bestimmungen können jeweils in einem Testansatz differenzierend oder nicht- differenzierend durchgeführt werden.
Schließlich betrifft die Erfindung auch den Nachweis der entsprechenden Nukleinsäuren mit Hilfe sogenannter Nukleinsäure-Tests (z.B. Polymerase Chain Reaction, PCR) mit Hilfe geeigneter Primer sowie die Verwendung der neuen Aminosäuresequenzen zur Erzeugung von Impfstoffen.
Das Hepatitis B Virus ist bekanntermaßen der Auslöser einer Vielzahl von Erkrankungs- Verläufen von milden inapparenten Infektionen bis hin zu chronisch aktiven und fulminant verlaufenden durch virale Infektionen ausgelösten Leberentzündungen (Virushepatitiden).
Die chronische Infektion mit HBV stellt mit geschätzten 400 Millionen betroffenen Menschen ein globales Gesundheitsproblem dar (Lee, N. Engl. J. Med. 337; 1733-1745 (1997)). Als geeignetste Prophylaxe für die weltweit häufig anzutreffende HBV-Infektion gilt die aktive Immunisierung (Stimulation der Antikörperantwort durch Antigengabe) und auch die passive Immunisierung (durch Injektion präformierter Antikörper).
Das HBV gehört zu den Hepadna-Viren und stellt ein Viruspartikel mit einem Durchmesser von 42 nm dar, das aus Kern und Hülle besteht. Das Genom des Virus ist eine doppelsträngige, ringförmige DNA- Sequenz von etwa 3200 Nukleotiden, die mindestens sechs verschiedene virale Gene kodieren (Tiollais et al., Nature 317: 489-495 (1985)). Es liegen vier offene Leserahmen für die Bildung der viralen Proteine vor.
Im S-Gen liegt die Information für das HBV surface Antigen (HBsAg), das auch small protein (S) genannt wird. Daneben gibt es auch größere Formen, die als large protein (L) und middle protein (M) bezeichnet werden. t Allen drei Proteinen gemeinsam ist die 226 Aminosäuren umfassende S-HBsAg Sequenz
(Gerlich et al., Viral Hepatitis and Liver Disease, Hollinger et al., William-Wilkens, Baltimore,
MD, pages 121-134 (1991)).
Die Proteinregionen vor dem small HBs werden auch Pre-S1 und Pre-S2 bezeichnet, umfassen 108 bzw. 55 Aminosäuren und sind beide in dem L-Protein (389 Aminosäuren) enthalten, während das M-Protein nur das Pre-S2 zusammen mit dem S-Antigen umfasst (281 Aminosäuren). Die Pre-S Proteine weisen unterschiedliche Glykosilierungsgrade auf und tragen die Rezeptoren für die Erkennung der Leberzellen. Sofern nicht anders angegeben, beziehen sich die Aminosäurepositionen in dieser Anmeldung auf das S-Antigen (226 aa) ohne Pre-S1- und ohne Pre-S2-Region.
Das C-Gen trägt die Information für das Nukleokapsid Protein, Hepatitis B Gore Antigen (HBcAg). Die Translation dieses Proteins kann bereits in der Pre-C-region starten und zur Bildung von Hepatitis B e-Antigen (HBeAg) führen. Das HBeAg weist gegenüber HBcAg eine andere Faltung und Immunogenität auf. HBeAg kommt im Gegensatz zu HBcAg frei im Serum vor und wird bei positivem Nachweis als Indikator für die Bildung von HBcAg und damit für die Bildung infektiöser Viruspartikel angesehen.
Die im Viruspartikel enthaltene Reverse Transkriptions DNA-Polymerase wird von P-Gen codiert und für das Transaktivator X-Gen wird eine ursächliche Rolle bei der Entstehung von HBV-assoziierten primären Leberzeil-Karzinomen diskutiert. Der virale Replikationszyklus von HBV umfasst eine intrazelluläre pre-genomische RNA, die im viralen Nukleocapsid in die DNA umgeschrieben wird. Da die HBV - eigene Reverse Transkriptase DNA- Polymerase über keine Richtigkeits-Lesefähigkeit verfügt (proof-reading capability), werden mit relativ hoher Häufigkeit falsche Nukleotide eingebaut. Als Folge weist das HBV eine Mutationsrate auf, die mit ca. 1 Nukleotid/10000 Basen/Infektionsjahr etwa dem 10-fachen dessen entspricht, was andere DNA Viren aufweisen (Blum, Digestion 56: 85-95 (1995); Okamoto et al., Jpn. J. Exp. Med. 57: 231-236 (1987)). Daneben treten auch recht häufig Deletionen und Insertionen auf (Carman et al., Lancet 341 : 349-353 (1993)).
Die resultierende Variabilität von HBV drückt sich unter anderem in dem Auftreten von 9 serologisch definierten Subtypen (Courouce et al., Bibliotheca Haematologica 42: 1 (1976) und insgesamt mindestens 6 verschiedenen Genotypen aus, die mit A bis F bezeichnet werden (Abb. 1) und eine geographische Verteilung aufweisen. (Norder et al., J. Gen. Virol. 73: 3141-3145 (1992), Norder et al., Virology 198: 489-503 (1994)).
Außerdem werden eine Reihe von Mutanten beschrieben, bei denen 1 Aminosäure oder mehrere ausgetauscht vorliegen, fehlen oder überzählig sind.
Neben natürlicherweise stattfindenden Mutationen (Cooreman et al., Hepatology 30: 1287- 1292 (1999) kann eine Gabe von HBV Immunglobulinen und / oder eine antivirale Therapie (z.B. mit Lamivudine) einen sogenannten Selektionsdruck ausüben, was zum vermehrten Auftreten sogenannter "Escape-Mutanten" führen und die Auftretens-Wahrscheinlichkeit von HBV-Mutanten deutlich erhöhen kann (Terrault et al., Hepatology 28: 555-561 (1998); Tillmann et al., Hepatology 30: 244-256 (1999); Hunt et al., Hepatology 31: 1037-1044 (2000).
Nicht alle HBV-Mutationen führen zu replikationsfähigen Viren und oft liegt eine Coexistenz von nicht vitalem und replikationsfähigem Virus vor, was auch die Sequenzierungs- Genauigkeit von isolierter DNA limitiert oder gar zur Nichterkennung von veränderten Sequenzen durch PCR, Klonierungsarbeiten mit anschließender Sequenzierung führt, wenn diese quantitativ < 10 % der Gesamt-DNA ausmachen (Cooreman et al., J. Biomed. Sei. 8: 237-247 (2001). Demnach ist die Isolierung von Mutanten vorteilhaft, wobei die sich anschließende Identifizierung und Charakterisierung einzelner Mutanten möglicherweise zu verbesserten Vakzinen und Diagnostika führt.
Die Immunantwort nach einer Infektion mit HBV ist hauptsächlich gegen die sogenannte a- Determinante als eine allen Hepatitis B Viren gemeinsame Region des S-Proteins gerichtet, die sich auf der Oberfläche der Viruspartikel befindet (Gerlich et al., supra) und die den heterogensten Teil der B-Zell-Epitope des S-Gens darstellen.
Als Bindestellen für Antikörper werden nach heutigem Kenntnisstand insgesamt mindestens 5 sich teilweise überlappende Epitope auf der a-Determinante zwischen Aminosäure- Position 101 und 180 angenommen (Abb. 1 und 2) wie durch die Anwendung von monokl.onalen Antikörpern gezeigt werden konnte (Peterson et al., J. Immunol. 132: 920-927 (1984)).
Es handelt sich hauptsächlich um komplexe Konformations-Epitope, die durch mehrere Disulfid-Brücken stabilisiert werden. Teilweise liegen auch Sequenz-Epitope vor, die mit Hilfe synthetisch hergestellter zyklischer Peptid-Strukturen dargestellt werden können.
Sogenannte "schützende Antikörper", die nach einer natürlichen Infektion mit HBV im Serum zirkulieren, sind zu 99% gegen die sehr immunogene a-Determinante des HBV gerichtet (Jilg, Vaccine 16: 65-68 (1998).
Auf diese Tatsache stützt sich die breite Anwendung der Immunisierung mit Vakzinen, die entweder aus Humanserum isoliert oder gentechnologisch hergestellt wurden und die Verabreichung von Hepatitis B Immunglobulinen, die humane HBV - spezifische Antikörper enthalten. Beide prophylaktischen Strategien beruhen auf dem neutralisierenden Effekt, die HBs-spezifische Antikörper nach Bindung an die "a-Loop-Epitope" entfalten (Carman et al., Hepatology 24: 489-493 (1996), Muller et al., J. Hepatol. 13: 90-96 (1991) und Samuel et al., N. Engl. J. Med. 329: 1842-1847 (1993)).
Ähnlich beruhen die heute weit verbreiteten Diagnostika auf der Bindung von a-De- terminanten-spezifischen Antikörpern an Epitope der a-Determinante. So wird bei der im Blutspendewesen weltweit angewendeten HBsAg-Bestimmung mit immunchemischen Bestimmungsmethoden im Serum von Spendern zirkulierendes HBV Oberflächenantigen mit Antikörpern gegen die a-Determinante (polyklonal oder monoklonaleh Ursprungs) nachgewiesen und bei positivem Resultat die entsprechende Blutspende verworfen, um iatrogene HBV Infektionen durch HBV-kontaminiertes Blut zu verhindern. Eine weitere Anwendung der HBsAg-Bestimmung liegt im Nachweis einer vorliegenden akuten HBV-Infektion.
Umgekehrt wird mit der Bestimmung von HBs-spezifischen Antikörpern im Blut von Probanden mit einem positiven Bestimmungsresultat von HBsAg-spezifischen Antikörpern (Anti-HBs) nachgewiesen, dass entweder eine natürliche Infektion abgelaufen oder dass eine durchgeführte Vakzinierung erfolgreich verlaufen ist.
Schließlich beruht auch die Nukleinsäure-Testung z.B. mit Hilfe der Poiymerase-Ketten- Reaktion ("Polymerase Chain Reaction" = PCR) auf der Verwendung von Primern, die für die HBV Nukleotide spezifisch sind.
Auf Grund der zentralen Rolle, die die a-Determinante bei der aktiven Immunisierung (Vakzinierung mit HBV Antigen), der passiven Immunisierung (Schutz durch HBV -spezische Immunglobuline), dem Nachweis von Impferfolg bzw. stattgefundener HBV Infektion (beides mittels Bestimmung von HBsAg-spezischen Antikörpern, Anti-HBs)und schließlich der Sicherheit im Blutspendewesen (HBsAg-Bestimmung und PCR), ist verständlich, dass in Fachkreisen das Auftreten von Mutanten und auch neuen Varianten mit großer Aufmerksamkeit verfolgt wird.
Als Konsequenz könnten in der a-Determinante des HBV veränderte aber replikationsfähige neue Mutanten und/oder Varianten sowohl das prophylaktische als auch das diagnostische Konzept unterlaufen (Brind et al., J. Hepatol. 26: 228-235 (1997), Fischer et al.,Transplant Proc. 31 : 492-493 (1999), Ghany et al., Hepatology 27: 213-222 (1998), Protzer-Knolle et al., Hepatology 27: 254-263 (1998), Carman et al., Gastroenterology 102: 711-719 (1992) und Coleman et al., WO 02/079217 A1 , (2002)).
Die Abgrenzung von Varianten und Mutanten des HBV ist nicht scharf, wobei ein diesbezüglicher Vorschlag breite Anwendung findet (Carman, J. Viral Hepat. 4 (suppl.1): 11- 20 (1997). Dem zu Folge sollte die Bezeichnung "Variante" für natürlicherweise vorkommende Subtypen angewendet werden, die ohne bekannte Interferenz durch Selektionsdruck (antivirale Therapie und / oder Irhmunglobulin-Gabe) auftreten und ein geographisches Verteilungsmuster aufweisen. Die Charakterisierung und anschließende Klassifizierung der Subtypen erfolgt mit Hilfe monoklonaler Antikörper und basiert auf einem veränderten Reaktionsmuster auf Grund des Austausches von einer oder wenigen Aminosäure(n). Die Grundlage der Klassifizierung stellen die Aminosäurepositionen 122 oder 160 der verbreitetsten HBV Sequenz dar: aa 122 und aa 160 = Lysin, K.
Alle Serotypen enthalten die Gruppen-spezifische a-Determinante, während die aa 122 und zusätzlich 133 und 134 den d- bzw. r-Subtyp und aa 160 die Zugehörigkeit zum w- bzw r- Subtyp bestimmen. Auf dieser Basis lassen sich HBV Subtypen grob in adr, adw, ayr oder ayw einteilen, die sich weiter in mindestens 9 Sub-Subtypen unterscheiden lassen: aywl , ayw2, ayw3, ayw4, ayr, adwr2, adw4, adrq+ und adrq- (Swenson et al., J. Virol. Meth. 33: 27- 28 (1991), Blitz et al. J. Clin. Microbiol. 36: 648-651 , Ashton-Rickardt et al., J. Med. Virol. 29: 204-214 (1989)).
Da diese Klassifizierung eine serologische Reaktivität zur Grundlage macht, muß nicht jede Typisierung notwendigerweise eine Variabilität auf der Aminosäure-Ebene bedeuten, weshalb dem Genotyping auf der S-Gen-Ebene der Vorzug gegeben wird (Ohba et al., Virus Res. 39: 25-34 (1995).
Subtypen treten aus noch nicht bekannten Gründen in bestimmten geographischen und ethnischen Mustern auf.
Die Bezeichnung Mutation sollte nach Carman Varianten vorbehalten bleiben, die ausschließlich unter Selektionsdruck wie Vakzinierung oder antivirale Therapie entstehen. Es sind bereits viele Mutationen beschrieben worden, von denen manche zu diagnostisch falschen Befundungen führten (Carman et al., Lancet 345: 1406-1407) und von denen die nachstehend genannten aa-Austausche beispielhaft zitiert werden:
Consensus: aa-Position Mutante:
1 110 V
P 111 T
T 114 s
T 116 s
P 120 T / S
T 123 A / N l/T 126 A / S
Q 129 H / R
K M 133 L
T 143 M / L
D 144 H / A / E
G 145 R /A
A 157 R sowie Cystein Austausche in den aa-Positionen 107, 124, 137, 147 & 149.
(Coleman, supra; Okamoto et al., Pediatr. Res. 32: 264-268 (1992); Zhang et al., Scand. J. Infect. Dis. 28: 9-15 (1996); Zuckermann et al.', Lancet 343: 737-738 (1994)).
Überraschend wurde in einer Humanprobe eines an Leberentzündung erkrankten ägyptischen Patienten (interne Nummer: 118234, Entnahme vom 02. Okt. 2002) ein atypisches Reaktionsmuster von Hepatitis-Markern gefunden.
Neben dem Krankheitsbild mit Erhöhung der für eine derartige Infektion typischen Leberwerte weisen auch nachgewiesene Hepatitis Gore Antikörper der IgM-Klasse auf eine akute HBV-Infektion hin, ohne dass allerdings der HBsAg-Nachweis mit einem zugelassenen leistungsstarken HBsAg-ELISA gelang.
Eine durchgeführte PCR ergab überraschend ein positives Resultat und das Sequenzierungsergebnis führte völlig überraschend zu den in Abb. 3 und 4 dargestellten Nukleotid-Sequenzen und den in Abb. 5 und 6 abgebildeten Aminosäure-Sequenzen.
Aus diesen Sequenzen wird deutlich, dass es sich völlig überraschend nicht um eine Punktmutation, d.h. Austausch weniger Nukleotide und auch nicht um einen möglicherweise serologisch zu charakterisierenden Subtyp handelt, da insgesamt n=11 Aminosäuren in der Region von aa 96 bis 180 gegenüber dem Genotyp D substituiert vorliegen. Im Hinblick auf die Häufigkeit der Aminosäure-Substitutionen ist völlig überraschend davon auszugehen, dass es sich um einen neuen Wildtyp handelt oder dass die Mutationen so ausgeprägt sind, dass die Konsequenz eher als neue Variante zu beschreiben ist, die im Folgenden als HDB 11 -Variante bezeichnet wird.
Die Analyse der besten Übereinstimmung der Aminosäuresequenz der a-Determinante mit bekannten Sequenzen verweist auf Genotyp D (Abb. 1), Subtyp ayw2 (Abb. 2) von dem sich die neue Variante überraschend allerdings noch in 11 aa-Positionen unterscheidet. Prominentestes Merkmal sind die 10 Substitutionen in der Region wischen aa 103 und 136 gemäß Abb. 1 , 5 und 6.
Selbst wenn man die Möglichkeit berücksichtigt, dass eine Koexistenz der neuen HDB 11- Variante mit einem bekannten Wildtyp vorliegt, bleibt als überraschendes Merkmal die charakteristische und neue Sequenz in der Aminosäure-Region aa 114 bis 120 bestehen, die mit 6 neuen Aminosäure-Sequenzen/ -Substitutionen zu beschreiben ist (Abb. 1).
Die vorliegende Erfindung betrifft daher ein Oligo- oder Polypeptid umfassend eine Aminosäuresequenz, die wenigstens 78 % Identität zu SEQ ID NO: 14 hat. Die in SEQ ID NO:14 gezeigte Aminosäuresequenz entspricht den Aminosäurepositionen 93 bis 140 des S-Antigens von Hepatitis B, welches insgesamt eine Länge von 226 Aminosäuren aufweist. Bevorzugte Ausführungsformen betreffen ein Oligo- oder Polypeptid umfassend eine Aminosäuresequenz, 'die wenigstens 79 %, wenigstens 80 %, wenigstens 81 %, wenigstens 82 %, wenigstens 83 %, wenigstens 84 %, wenigstens 85 %, wenigstens 86 %, wenigstens 87 %, wenigstens 88 %, wenigstens 89 %, wenigstens 90 %, wenigstens 91 %, wenigstens 92 %, wenigstens 93 %, wenigstens 94 %, wenigstens 95 %, wenigstens 96 %, wenigstens 97 %, wenigstens 98 % oder wenigstens 99 % Identität zu SEQ ID NO:14 hat.
Die Erfindung betrifft auch ein Oligo- oder Polypeptid umfassend eine Aminosäuresequenz, die wenigstens 93 %, wenigstens 94 %, wenigstens 95 %, wenigstens 96 %, wenigstens 97 %, wenigstens 98 % oder wenigstens 99 % Identität zu SEQ ID NO:12 hat. Die in SEQ ID NO:12 gezeigte Aminosäuresequenz entspricht den Aminosäurepositionen 43 bis 196 des S-Antigens des Hepatitis B-Virus, welches eine Länge von 226 Aminosäuren aufweist. Die Bestimmung der Identität zwischen zwei Aminosäuresequenzen ist dem Fachmann an sich bekannt und kann mit üblichen Computerprogrammen durchgeführt werden. Vorzugsweise wird die Bestimmung der Identität mit dem Computerprogramm "Bestfit" der Genetics Computer Group (Madison, Wl) durchgeführt. Die Parameter werden in den Standardeinstellungen (default) verwendet. Vorzugsweise wird die am Prioritätstag der vorliegenden Anmeldung aktuelle Programmversion verwendet. Ein hoher Prozentwert der Identität bedeutet eine hohe Entsprechung, Gleichheit oder Äquivalenz zweier Sequenzen.
Das erfindungsgemäße Oligo- oder Polypeptid kann auch eine Aminosäuresequenz umfassen, in der gegenüber SEQ ID NO:14 null bis 10 Aminosäuren substituiert, deletiert oder inseriert sind. In der Aminosäuresequenz können auch 0 bis 9, 0 bis 8, 0 bis 7, 0 bis 6, 0 bis 5, 0 bis 4, 0 bis 3, 0 bis 2 Aminosäuren oder 1 Aminosäure gegenüber SEQ ID NO:14 substituiert, deletiert oder inseriert sein. Substitutionen können auch die Aminosäurepositionen betreffen, die den Positionen 96, 103, 114 bis 118, 120, 127, 129 und 136 des S-Antigens von HBV entsprechen.
Das erfindungsgemäße Oligo- oder Polypeptid kann auch eine Aminosäuresequenz umfassen, in der gegenüber SEQ ID NO:12 null bis 10 Aminosäuren substituiert, deletiert oder inseriert sind. In der Aminosäuresequenz können auch 0 bis 9, 0 bis 8, 0 bis 7, 0 bis 6, 0 bis 5, 0 bis 4, 0 bis 3, 0 bis 2 Aminosäuren oder 1 Aminosäure gegenüber SEQ ID NO: 12 substituiert, deletiert oder inseriert sein.
Das erfindungsgemäße Oligo- oder Polypeptid kann auch eine Aminosäuresequenz umfassen, in der gegenüber SEQ ID NO: 16 null bis 9 Aminosäuren substituiert, deletiert oder inseriert sind. In der Aminosäuresequenz können auch 0 bis 8, 0 bis 7, 0 bis 6, 0 bis 5, 0 bis 4, 0 bis 3, 0 bis 2 Aminosäuren oder 1 Aminosäure gegenüber SEQ ID NO: 16 substituiert, deletiert oder inseriert sein.
Das Oligo- oder Polypeptid der vorliegenden Erfindung kann auch eine Aminosäuresequenz umfassen, die eine Teilsequenz von SEQ ID NO:12 mit wenigstens 5 aufeinanderfolgenden Aminosäuren von SEQ ID NO: 12 ist, wobei die Teilsequenz wenigstens eine der Positionen 54, 61 , 72, 73, 74, 75, 76, 78, 85, 87 und 94 von SEQ ID NO:12 einschließt. Diese Aminosäurepositionen entsprechen den Positionen 96, 103, 114 bis 118, 120, 127, 129 und 136 des S-Antigens von HBV. Vorzugsweise umfasst die Teilsequenz wenigstens 6, bevorzugter wenigstens 7, am bevorzugtesten wenigstens 8 aufeinanderfolgende Aminosäuren der in SEQ ID NO:12 gezeigten Aminosäuresequenz. In weiteren Ausführungsformen umfasst die Teilsequenz wenigstens 9, wenigstens 10, wenigstens 11 , wenigstens 12, wenigstens 13, wenigstens 14, wenigstens 15, wenigstens 20, wenigstens 25, wenigstens 30, wenigstens 35, wenigstens 40, wenigstens 45, wenigstens 50, wenigstens 55, wenigstens 60, wenigstens 65, wenigstens 70, wenigstens 75, wenigstens 80, wenigstens 85, wenigstens 90, wenigstens 95 oder wenigstens 100 aufeinanderfolgende Aminosäuren der in SEQ ID NO: 12 gezeigten Aminosäuresequenz.
Vorzugsweise schließt die Teilsequenz zwei, drei, vier, fünf, sechs, sieben, acht, neun, zehn oder alle elf der Positionen 54, 61 , 72, 73, 74, 75, 76, 78, 85, 87 und 94 von SEQ ID NO: 12 ein.
Das erfindungsgemäße Polypeptid kann auch ein Fragment eines HBs-Antigens eines Hepatitis B-Virus umfassen, wobei das Fragment eine Länge von wenigstens 5 Aminosäuren hat, das HBs-Antigen an Position 96 Alanin, an Position 103 Isoleucin, an Position 114 Alanin, an Position 115 Isoleucin, an Position 116 Asparagin, an Position 117 Asparagin, an Position 118 Arginin, an Position 120 Glutamin, an Position 127 Threonin, an Position 129 Histidin und/oder an Position 136 Tyrosin aufweist, und das Fragment Alanin 96, Isoleucin 103, Alanin 114, Isoleucin 115, Asparagin 116, Asparagin 117, Arginin 118, Glutamin 120, Threonin 127, Histidin 129 und/oder Tyrosin 136' umfasst. Das Oligo- oder Polypeptid kann ein, zwei, drei, vier, fünf, sechs, sieben, acht, neun, zehn oder elf dieser spezifischen Aminosäurereste einschließen.
Die Mindestlänge der erfindungsgemäßen Oligo- oder Polypeptide beträgt 5, vorzugsweise 6, bevorzugter 7, am bevorzugtesten 8 Aminosäuren. Die Gesamtlänge des Oligo- oder Polypeptids ist in der Regel 5 bis 1000 Aminosäuren, vorzugsweise 6 bis 500 Aminosäuren, bevorzugter 7 bis 300 Aminosäuren, am bevorzugtesten 8 bis 200 Aminosäuren. Die Oligo- oder Polypeptide können auch Fremdaminosäuren enthalten, die nicht vom Genom eines Hepatitis B-Virus kodiert werden. So können Aminosäuren enthalten sein, die die Kopplung an feste Phasen erleichtern oder die Kopplung an Markierungssubstanzen ermöglichen. Es können Aminosäuren enthalten sein, die aufgrund der Klonierung entstanden sind und bei der rekombinanten Expression mit exprimiert wurden. Schließlich kann das erfindungsgemäße Oligo- oder Polypeptid ein Fusionsprotein sein, das neben von HBV abgeleiteten Aminosäuren einen Fusionspartner enthält, z. B. eine "tag"-Sequenz, die die Reinigung erleichtert, oder ein Proteinanteil, der die Löslichkeit und/oder Ausbeute bei der rekombinanten Expression erhöht. Derartige Fusionspartner sind dem Fachmann an sich bekannt. In einer anderen Ausführungsform enthalten die Oligo- oder Polypeptide keine Fremdaminosäuren, die nicht vom Genom eines HBV kodiert werden. Entsprechend bestehen diese Oligo- oder Polypeptide aus einer der oben und/oder in den Ansprüchen beschriebenen Aminosäuresequenzen.
Das erfindungsgemäße Oligo- oder Polypeptid ist vorzugsweise immunogen, d.h. es kann eine Antikörperantwort in einem Säugerorganismus induzieren. Üblicherweise enthält das Oligo- oder Polypeptid wenigstens eine antigene Determinante oder wenigstens ein Epitop. In einer besonderen Ausführungsform enthält das Oligo- oder Polypeptid ein Epitop, das in anderen HBV-Varianten, z. B. in Subtyp ayw2, nicht enthalten ist.
Vorzugsweise umfasst das Oligo- oder Polypeptid eine der Aminosäuresequenzen SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: 16, SEQ ID N0.17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 und SEQ ID NO:30.
Ein weiterer Aspekt der Erfindung ist ein immunogenes Peptid oder eine Mischung immunogener Peptide, enthaltend eines oder mehrere der in dieser Anmeldung beschriebenen Oligo- oder Polypeptide. Das immunogene Peptid oder die immunogene Mischung kann das/die Oligo- oder Polypeptide alleine oder in Verbindung mit bekannten HBV-Immunogenen enthalten.
Gegenstand der vorliegenden Erfindung sind auch Nukleinsäuremoleküle, die vom Genom der neuen HBV-Variante HDB 11 oder Mutanten davon abgeleitet sind, insbesondere Nukleinsäuremoleküle, die von dem Gen abgeleitet sind, das HSbAg kodiert.
Die Erfindung betrifft daher beispielsweise ein Oligo- oder Polynukleotid, das eine Nukleotidsequenz, die wenigstens 91% Identität zu SEQ ID NO:3 hat, umfasst. Die Nukleotidsequenz SEQ ID NO:3 kodiert für die Aminosäuresequenz SEQ ID NO:14. Bevorzugte Ausführungsformen betreffen ein Oligo- oder Polynukleotid umfassend eine Nukleotidsequenz, die wenigstens 92 %, wenigstens 93 %, wenigstens 94 %, wenigstens 95 %, wenigstens 96 %, wenigstens 97 %, wenigstens 98 %, oder wenigstens 99 % Identität zu SEQ ID NO:3 hat. Gegenstand der Erfindung ist auch ein Oligo- oder Polynukleotid umfassend eine Nukleotidsequenz, die wenigstens 95 %, wenigstens 96 %, wenigstens 97 %, wenigstens 98 % oder wenigstens 99 % zu SEQ ID NO:1 hat. Die Nukleotidsequenz SEQ ID NO:1 kodiert für die Aminosäuresequenz SEQ ID NO: 12.
Identität ist hier definiert als Grad der Gleichheit zwischen zwei Strängen von zwei DNA Segmenten. Ausgedrückt wird die Identität als prozentualer Wert, indem die Anzahl identischer Basen zweier zu vergleichender Sequenzen geteilt durch die Länge der kürzeren Sequenz und mit 100 multipliziert wird (Smith et al., Adv. Appl. Mathem. 2: 482-489 (1981).
Die Bestimmung der Identität zwischen zwei Aminosäuresequenzen ist dem Fachmann an sich bekannt und kann mit üblichen Computerprogrammen durchgeführt werden. Vorzugsweise wird die Bestimmung der Identität mit dem Computerprogramm "Bestfit" der Genetics Computer Group (Madison, Wl) durchgeführt. Die Parameter werden in den Standardeinstellungen (default) verwendet. Vorzugsweise wird die am Prioritätstag der vorliegenden Anmeldung aktuelle Programmversion verwendet. Ein hoher Prozentwert der Identität bedeutet eine hohe Entsprechung, Gleichheit oder Äquivalenz zweier Sequenzen.
Diese Bewertung ist auch auf Aminosäuresequenzen von Peptiden und Proteinen anwendbar (Dayhoff, Atlas of Protein Sequences and Structure, M.O Dayhoff ed. 5 Suppl. 3: 353-358, Nat. Bio . Res. Found., Washington D.C., USA, Gribskov, Nucl. Acids Res. 14 (6): 6745-66763 (1986).
Die Erfindung betrifft weiterhin ein Oligo- oder Polynukleotid umfassend eine Nukleotidsequenz, in der im Vergleich zu SEQ ID NO:3 null bis 13 Nukleotide substituiert, deletiert oder hinzugefügt sind. In der Nukleotidsequenz können auch 0 bis 12, 0 bis 11 , 0 bis 10, 0 bis 9, 0 bis 8, 0 bis 7, 0 bis 6, 0 bis 5, 0 bis 4, 0 bis 3, 0 bis 2 Nukleotide oder 1 Nukleotid gegenüber SEQ ID NO:3 substituiert, deletiert oder inseriert sein.
Das erfindungsgemäße Oligo- oder Polynukleotid kann auch eine Nukleotidsequenz umfassen, die eine Teilsequenz von SEQ ID NO:1 mit wenigstens 8 aufeinanderfolgenden Nukleotiden von SEQ ID NO. ist, wobei die Teilsequenz wenigstens eine der Positionen 161 , 183, 213, 214, 218, 221 , 224, 227, 233, 234, 239, 253, 261, 281, 294, 306, 312, 387, 405 und 408 von SEQ ID NO:1 einschließt. Vorzugsweise umfasst die Teilsequenz wenigstens 9, bevorzugter wenigstens 10, am bevorzugtesten wenigstens 12 aufeinanderfolgende Nukleotide der in SEQ ID NO:1 gezeigten Nukleotidsequenz. In weiteren Ausführungsformen umfasst die Teilsequenz wenigstens 15, wenigstens 18, wenigstens 20, wenigstens 25, wenigstens 30, wenigstens 35, wenigstens 30, wenigstens 35, wenigstens 40, wenigstens 45, wenigstens 50, wenigstens 60, wenigstens 70, wenigstens 80, wenigstens 90, wenigstens 100, wenigstens 120, wenigstens 150, wenigstens 175, wenigstens 200, wenigstens 250 oder wenigstens 300 aufeinanderfolgende Nukleotide der in SEQ ID NO:1 gezeigten Nukleotidsequenz.
Vorzugsweise schließt die Teilsequenz zwei, drei, vier, fünf, sechs, sieben, acht, neun, zehn, elf, zwölf, 13, 14, 15, 16, 17, 18, 19 oder alle 20 der Positionen 161 , 183, 213, 214, 218, 221, 224, 227, 233, 234, 239, 253, 261, 281, 294, 306, 312, 387, 405 und 408 von SEQ ID NO:1 ein.
In einer anderen Ausführungsform umfasst das Oligo- oder Polynukleotid eine Nukleotidsequenz, die unter stringenten Bedingungen, vorzugsweise spezifisch, mit einem zu der Sequenz SEQ ID NO:1 komplementären Polynukleotid hybridisiert. In wiederum anderen Ausführungsformen umfasst das Oligo- oder Polynukleotid eine Nukleotidsequenz, die unter stringenten Bedingungen, vorzugsweise spezifisch, mit einem zu der Sequenz SEQ ID N0.2, SEQ ID O:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 und/oder SEQ ID NO. 1 komplementären Polynukleotid hybridisiert. Verfahren zur Bestimmung, ob eine gegebenes Oligo- oder Polynukleotid mit einem anderen Polynukleotid hybridisiert, sind dem Fachmann an sich bekannt. Ein spezielles Beispiel für "stringente Bedingungen" sind folgende Bedingungen: a) 16-stündige Inkubation bei 42 °C in einer Lösung enthaltend 50 % Formamid, 5xSSC (150 m NaCI, 15 mM Trinatriumcitrat), 50 mM Natriumphosphat pH 7,6, δxDenhardt's Lösung, 10 % Dextransulfat und 20 μg/ml denaturierte, gescherte Lachssperma-DNA; b) anschließend Waschen in 0,1xSSC bei ungefähr 65 °C. Hybridisierungs- und Waschbedingungen sind dem Fachmann an sich bekannt und beispielhaft in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989) angegeben. Eine Nukleotidsequenz hybridisiert spezifisch an ein gegebenes Polynukleotid, wenn sie nicht oder wesentlich schwächer an andere Nukleotidsequenzen hybridisiert. Im vorliegenden Fall kann das bedeuten, dass die Nukleotidsequenz nicht oder nur schwach an für HBsAg kodierende Polynukleotide aus herkömmlichen HBV-Varianten (z. B. Genotyp D, Subtyp ayw2) hybridisiert.
Die Erfindung betrifft auch ein Oligo- oder Polynukleotid umfassend eine Nukleotidsequenz, die für ein erfindungsgemäßes Oligo- oder Polypeptid kodiert, wie es in dieser Anmeldung beschrieben ist. Ein weiterer Aspekt der Erfindung ist ein Oligo- oder Polynukleotid umfassend eine zu den oben beschriebenen Nukleotidsequenzen komplementäre Nukleotidsequenz.
Die Mindestlänge der erfindungsgemäßen Oligo- oder Polynukleotide beträgt 6, vorzugsweise 8, bevorzugter 10, am bevorzugtesten 12 Nukleotide. Die Gesamtlänge des Oligo- oder Polynukleotids ist in der Regel 6 bis 3000 Nukleotide, vorzugsweise 6 bis 1500 Nukleotide, bevorzugter 8 bis 900 Nukleotide, am bevorzugtesten 8 bis 600 Nukleotide. Die Oligo- oder Polynukleotide können auch Nukleotide enthalten, die nicht vom Genom eines Hepatitis B-Virus herstammen. So können Nukleotide enthalten sein, die für bestimmte Aminosäuren kodieren, die gewünschte Funktionen erfüllen sollen, wie oben beschrieben. Es können Nukleotide enthalten sein, die aufgrund der Klonierung entstanden sind, z. B. um bestimmte Schnittstellen einzuführen. Schließlich kann das erfindungsgemäße Oligo- oder Polynukleotid für ein Fusionsprotein kodieren, das neben von HBV abgeleiteten Aminosäuren einen Fusionspartner enthält, z. B. eine "tag"-Sequenz,- die die Reinigung erleichtert, oder ein Proteinanteil, der die Löslichkeit und/oder Ausbeute bei der rekombinanten Expression erhöht. Derartige Fusionspartner und die sie kodierende DNA sind dem Fachmann an sich bekannt.
Bevorzugte Oligo- oder Polynukleotide der vorliegenden Erfindung umfassen eine Nukleotidsequenz, die ausgewählt ist aus der Gruppe bestehend aus SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 und SEQ ID NO:11.
Die erfindungsgemäßen Polynukleotide können auch markiert sein, beispielsweise durch eine Fluoreszenzmarkierung oder eine radioaktive Markierung. Derartige Polynukleotide können vorteilhaft in einer Hybridisierungsreaktion oder einer Polymerasekettenreaktion (PCR) eingesetzt werden.
Die Erfindung betrifft auch einen Vektor oder ein Plasmid enthaltend ein Oligo- oder Polynukleotid gemäß der Erfindung. Das Plasmid kann beispielsweise ein Klonierungsvektor sein, der dazu dient, die Nukleinsäure in Wirtszellen zu vermehren oder bestimmte Restriktionsschnittstellen zur Verfügung zu stellen. Expressionsvektoren sind Vektoren, die die Expression der klonierten Nukleinsäure in Wirtszellen erlauben. Wirtszellen können verschiedene prokaryontische oder eukaryontische Zellen sein. Prokaryontische Wirtszellen sind z. B. bakterielle Zellen wie E. co//-Zellen. Die erfindungsgemäßen Expressionsvektoren können bestimmte Steuerelemente wie z.B. Promotoren oder Bindungsstellen für Repressionsfaktoren enthalten. In einer weiteren Ausführungsform enthalten die Expressionsvektoren einen Nukleinsäureabschnitt, der für einen Teil eines Fusionsproteins kodiert.
Die Erfindung betrifft ebenfalls eine Zelle, z. B. eine Wirtszelle, die ein erfindungsgemäßes Polynukleotid, Plasmid oder einen erfindungsgemäßen Vektor enthält. Die Wirtszellen können unter geeigneten Bedingungen kultiviert werden, so dass eine Transkription der enthaltenen Nukleinsäure und nachfolgende Translation stattfindet. Die Erfindung betrifft auch ein Verfahren zur Herstellung eines Polypeptids, bei dem man ein Polynukleotid, ein Plasmid oder einen Expressionsvektor der Erfindung in Wirtszellen einbringt und die Wirtszellen unter Bedingungen kultiviert, die zur Expression des Polypeptids führen. Gegebenenfalls kann anschließend das Polypeptid aus den Wirtszellen gewonnen werden. Vorzugsweise findet die Herstellung des Polypeptids in Bakterien, am bevorzugtesten in E. co//-Zellen statt. Geeignete Mittel und Bedingungen zur Kultivierung sind beispielsweise in Ausubel et al. (1993) "Current Protocols in Molecular Biology" beschrieben. Die Gewinnung des exprimierten Polypeptids geschieht nach für den Fachmann an sich bekannten Methoden. Verschiedene Verfahren zur Proteinreinigung sind beispielsweise beschrieben in Scopes R. (1994) "Protein Purification: Principles and Practice" (3rd edition) Springer Verlag.
Die Polypeptide und Peptide der vorliegenden Erfindung können jedoch auch chemisch durch bekannte Verfahren wie z.B. Festphasensynthese hergestellt werden. Ebenso können die erfindungsgemäßen Polynukleotide durch bekannte Verfahren der chemischen Synthese hergestellt werden. Durch chemische Synthese erhaltene Polynukleotidfragmente können dann auch enzymatisch durch Ligasen verknüpft werden. Die erfindungsgemäßen Oligo- oder Polynukleotide können auch durch "site-directed mutagenesis" aus bekannten Sequenzen hergestellt werden, indem an bestimmten Positionen Punktmutationen eingeführt werden. Derartige Verfahren sind dem Fachmann an sich bekannt.
Ein weiterer Aspekt der Erfindung ist ein Antikörper, der an ein erfindungsgemäßes Oligo- oder Polypeptid bindet. Solche Antikörper können auf bekannte Weise hergestellt werden, entweder mittels eines Oligo- oder Polypeptids der Erfindung, z. B. eines Peptids mit einer der Sequenzen SEQ ID NO: 12 bis 30, oder eines Fragments davon (Harlow und Lane (1988) Antibodies: A Laboratory Manual; Cold Spring Harbor Laboratory). Es kann sich um polyklonale oder rhonoklonale Antikörper handeln, monoklonale Antikörper sind aber bevorzugt. Vorzugsweise handelt es sich um spezifische Antikörper, die gegen das HBsAg der neuen HBV-Variante gerichtet sind, die aber HBsAg aus anderen HBV-Varianten, z. B. Genotyp D Subtyp ayw2, nicht erkennen. Solche Antikörper können erhalten werden, indem aufgrund eines Sequenzvergleichs der Aminosäuresequenzen des neuen HBsAg und HBsAg aus bekannten Stämmen Peptide ermittelt werden, die spezifisch für das neue HBsAg sind, und diese Peptide zur Herstellung der Antikörper verwendet werden. Es ist auch möglich, eine Mischung polyklonaler Antikörper herzustellen und sie durch Inkubation mit bekanntem HBsAg zu depletieren. In einer anderen Ausführungsform erkennt der Antikörper nicht nur das neue HBsAg, sondern auch bekannte HBsAg-Varianten. Dadurch ist es möglich, gleichzeitig verschiedene Varianten von HBsAg zu detektieren.
Der Antikörper der Erfindung kann an ein Oligo- oder Polypeptid binden, das aus einer Aminosäuresequenz besteht, die ausgewählt ist aus der Gruppe bestehend aus SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO.iδ, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 und SEQ ID NO:30. Besonders bevorzugt bindet der Antikörper an ein Oligo- oder Polypeptid, das aus einer Aminosäuresequenz besteht, die ausgewählt ist aus der Gruppe bestehend aus SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 und SEQ ID NO:30. In einer besonderen Ausführungsform bindet der Antikörper nicht an die a-Determinanten der bekannten HBV-Genotypen A, B, C, D, E und F (siehe Abb. 1). In einer besonderen Ausführungsform bindet der Antikörper nicht an die a- Determinante von HBV Genotyp D, Subtyp ayw2.
Ein weiterer Gegenstand der Erfindung ist ein anti-idiotypischer Antikörper, der eine Aminosäuresequenz eines erfindungsgemäßen Oligo- oder Polypeptids repräsentiert. Verfahren zur Herstellung antiidiotypischer Antikörper sind dem Fachmann an sich bekannt.
Die Erfindung betrifft auch einen Testkit zum Nachweis von Hepatitis B-Viren, enthaltend ein erfindungsgemßes Oligo- oder Polypeptid, ein erfindungsgemäßes Oligo- oder Polynukleotid und/oder einen erfindungsgemäßen Antikörper.
Die Erfindung bezieht sich auch auf ein immunogenes Peptid oder eine Mischung immunogener Peptide, enthaltend ein oder mehrere erfindungsgemäßen Oligo- oder Polypeptide alleine oder in Verbindung mit bekannten HBV-lmmunogenen. Ein weiterer Aspekt der Erfindung ist ein Verfahren zum Nachweis eines Hepatitis B- Antigens, dadurch gekennzeichnet, dass (a) eine Probe mit einem erfindungsgemäßen Antikörper unter Bedingungen inkubiert wird, die die Bildung eines Antigen-Antikörper- Komplexes gestatten; und (b) ein Antigen-Antikörper-Komplex, der den Antikörper enthält, nachgewiesen wird.
Es können monoklonale oder polyklonale Antikörper (oder Mischungen bzw. Fragmente davon oder Mischungen von Fragmenten), die mit Epitopen der neuen HBV Variante reagieren, dazu verwendet werden, die a-Determinante der erfindungsgemäßen HBV Variante in Form der gesamten Polypeptidsequenz oder Teilen davon in Untersuchungsproben zu bestimmen: HBsAg der HDB 11 -Variante.
Dem Fachmann ist eine Vielzahl von Bestimmungsmethoden geläufig, bei denen mit einem oder mehreren monoklonalen Antikörper(n) oder polyklonalen Antikörpern (oder Mischungen davon bzw. Fragmenten oder Mischungen von Fragmenten), die spezifisch für die a- Determinante der HBV Variante sind, Immunkomplexe gebildet oder deren Bildung gehemmt werden.
Eine spezielle Ausführung stellt der sogenannte Enzymimmunoassay dar, von dem ein mögliches. Testprinzip im folgenden beispielhaft beschrieben wird, ohne jedoch die erfindungsgemäße Idee darauf zu beschränken:
Bei dem sehr weit verbreiteten sogenannten Sandwich-Prinzip werden auf einem geeigneten Träger (z.B. Mikropartikel oder Oberfläche von Vertiefungen einer Mikrotitrationsplatte) immobilisierte Antikörper oder Fragmente davon mit der Untersuchungsprobe inkubiert. An die Antikörper gebundenes HBsAg wird nach Entfernen überschüssiger Probe detektiert, indem eine weitere Inkubation erfolgt mit Anti-HBs-Antikörpem (monoklonal oder polyklonal oder Fragmente bzw. Mischungen dieser Fragmente), die mit einer Sonde versehen sind. Als Sonde wird häufig ein Enzym eingesetzt, dessen katalytische Umsetzung (nach Entfernen des überschüssigen Reagenzes) eines geeigneten Substrates zu einer Farbreaktion führt, die photometrisch gemessen wird und deren Intensität dem in der Probe vorhandenen HBsAg-Gehalt proportional ist.
Neben dieser speziellen Äusführungsform sind auch Methoden bekannt, die homogener Natur sind (d.h. keine bound/free Trennung erfordern), die ganz ohne Sonde auskommen (z.B. Agglutinationsverfahren), mit bloßem Auge auswertbar sind (z.B. radiale Immundiffusion) oder sich anderer Sonden (z.B. radioaktive Isotope oder Chemilumineszenz) bzw. mehrerer Sonden bedienen (wie z.B. Das Biotin/Streptavidin- System).
All diese Ausführungsformen entsprechen dem Stand der Technik, so dass unter "Bestimmung von HBsAg der neuen HBV Variante" mit der vorliegenden Erfindung alle Verfahren verstanden werden, die sich zum Nachweis von Polypeptidsequenzen oder Antigenen der neuen HBV Variante eignen, ungeachtet ob alleine das HBsAg der neuen Variante bestimmt wird oder in Verbindung mit HBsAg von bekannten a-Determinanten und/oder bekannten Mutationen in der a-Region.
Ebenso ist es möglich, aus ökonomischen Gründen eine HBsAg-Bestimmung mit einer Nachweismethode gegen einen weiteren Analyten (z.B. HIV-Antigen oder die gleichzeitige Bestimmung von HBV Varianten-HBsAg und dagegen gerichtete spezifische Antikörper) in einem Testansatz (differenzierend oder nicht-differenzierend) zu kombinieren.
Die Erfindung betrifft auch ein Verfahren zum Nachweis von Antikörpern, die gegen ein Hepatitis B-Antigen gerichtet sind, dadurch gekennzeichnet, dass (a) eine Probe mit einem erfindungsgemäßen Oligo- oder Polypeptid unter Bedingungen inkubiert wird, die die Bildung eines Antigen-Antikörper-Komplexes gestatten; und (b) der Antikörper-Antigen-Komplex, der das Oligo- oder Polypeptid enthält, nachgewiesen wird.
Eine spezielle Ausführung stellt der sogenannte Enzymimmunoassay dar, von dem ein mögliches Testprinzip im folgenden beispielhaft beschrieben wird, ohne jedoch die erfindungsgemäße Idee darauf einzuschränken:
Bei dem sehr weit verbreiteten sogenannten Sandwich-Prinzip werden auf einem geeigneten Träger (z.B. Mikropartikel oder Oberfläche von Vertiefungen einer Mikrotitrationsplatte) immobilisierte Epitop-tragende Polypeptid- oder Protein-Sequenzen mit der Untersuchungsprobe inkubiert. An die Epitope gebundene Antikörper werden nach Entfernen überschüssiger Probe detektiert, indem eine weitere Inkubation erfolgt mit Epitop-tragenden Polypeptid- oder Protein-Sequenzen, die mit einer Sonde versehen sind. Als Sonde wird häufig ein Enzym eingesetzt, dessen katalytische Umsetzung (nach Entfernen des überschüssigen Reagenzes) eines geeigneten Substrates zu einer Farbreaktion führt, die photometrisch gemessen wird und deren Intensität dem in der Probe vorhandenen Antikörpergehalt proportional ist.
Neben dieser speziellen Ausführungsform sind auch Methoden bekannt, die homogener Natur sind (d.h. keine bound/free Trennung erfordern), die ganz ohne Sonde auskommen (z.B. Agglutinationsverfahren), mit bloßem Auge auswertbar sind (z.B. radiale Immundiffusion) oder sich anderer Sonden (z.B. radioaktive Isotope oder Chemilumineszenz) bzw. mehrerer Sonden bedienen (wie z.B. Das Biotin/Streptavidin- System).
Ebenso können die Polypeptidstrukturen der HBV Variante durch anti-idiotypische Antikörper dargestellt werden oder durch Wahl eines geeigneten Testprinzips auch Variantenspezifische monoklonale oder polyklonale Antikörper zur Bestimmung von Anti-HBs- Antikörpem (z.B. in einem kompetitiven Testformat) herangezogen werden. Es ist ebenso bekannt, dass durch Wahl des Testprinzips auch eine Differenzierung der Immunglobulin- Klassen erfolgen kann (z.B. durch das "indirekte" Verfahren mit einem zweiten Klassenspezifischen Antikörper (z.B. IgG oder IgM spezifisch) mit Sonde oder mit Hilfe des sogenannten Anti-μ-Prinzips (IgM spezifisch). Natürlich müssen die Methoden und Materialen (inkl. Sonde und Polypeptidsequenzen) dem jeweiligen Ziel angepaßt werden.
All diese Ausführungsformen entsprechen dem Stand der Technik, so dass unter "Bestimmung von Antikörpern, die für die a-Determinante der neuen HDB 11-Variante spezifisch sind" mit der vorliegenden Erfindung alle Verfahren verstanden werden, die sich zum Nachweis von Immunglobulinen und/oder Immunglobulin-Klassen gegen die neue HBV Variante eignen, ungeachtet ob alleine der Antikörper gegen die neue Variante gesucht wird oder in Verbindung mit Antikörpern gegen bekannte a-Determinanten und / oder bekannte Mutationen in der a-Region.
In einem anderen Verfahren kann eine Hepatitis B-Nukleinsäure nachgewiesen werden. Dieses Verfahren ist dadurch gekennzeichnet, dass (a) eine Probe mit einem erfindungsgemäßen Oligo- oder Polynukleotid unter Bedingungen inkubiert wird, die die selektive Hybridisierung des Oligo- oder Polynukleotids mit einer Hepatitis B-Nukleinsäure in der Probe gestatten; und (b) bestimmt wird, ob Polynukleotidduplexe gebildet wurden, die das Oligo- oder Polynukleotid umfassen. Die Hepatitis B-Nukleinsäure kann auch dadurch nachgewiesen werden, dass (a) eine Probe mit wenigstens einem erfindungsgemäßen Oligo- oder Polynukleotid unter Bedingungen inkubiert wird, die die selektive Hybridisierung des Oligo- oder Polynukleotids mit einer Hepatitis B-Nukleinsäure in der Probe gestatten; (b) eine Polymerasekettenreaktion durchgeführt wird; und (c) bestimmt wird, ob eine Nukleinsäure amplifiziert wurde.
Die Erfindung betrifft auch die Verwendung eines erfindungsgemäßen Oligo- oder Polynukleotids als Primer und/oder als Sonde. Die vorliegenden Nukleotidsequenzen können benutzt werden, um Primer und/oder Gensonden herzustellen, weshalb auch Kits, enthaltend Primer und/oder Sonden zum Nachweis von HBV Varianten-spezifischer Nukleinsäure entweder alleine oder in Verbindung mit bekannten HBV Nukleotidsequenzen in Untersuchungsproben ebenfalls Gegenstand der Erfindung sind.
Auf Basis der vorliegenden Nukleotidsequenzen können Primer entwickelt werden, die in der sog. "Polymerase Chain Reaction" (PCR) Verwendung finden. Die PCR stellt eine Methode dar, um eine gewünschte Nukleotidsequenz einer Nukleinsäure oder eines Nukleinsäuregemisches zu amplifizieren. Dabei werden die Primer jeweils spezifisch durch eine Polymerase mit der gewünschten Nukleinsäure als Leseraster verlängert. Nach Dissoziation von dem Originalstrang werden neue Primer hybridisiert und wiederum durch die Polymerase verlängert. Durch Wiederholung dieser Zyklen wird eine Anreicherung der gesuchten Zielsequenz-Moleküle erreicht.
In Bezug auf Nukleinsäuretests (NAT) ist es möglich, Nukleotid-Sequenzen der vorliegenden Erfindung zu verwenden, um DNA- Oligomere von 6-8 Nukleotiden oder größer herzustellen, die geeignet sind, als Hybridisierungssonden das virale Genom der hier beschriebenen HBV Variante in Personen nachzuweisen, die möglicherweise die Virus-Variante tragen, oder z.B. im Blutspendewesen Blutkonserven auf Vorhandensein des Varianten-Genoms entweder gezielt oder in Kombination mit dem Nachweis von Nukleotidsequenzen bekannter HBV Varianten und/oder HBV-Mutatanten zu screenen.
Ebenso können auf Basis der gefundenen Nukleotidsequenzen der neuen HBV Variante entsprechende Primer entwickelt werden, die für die neue Variante spezifisch sind oder sowohl die neue Variante als auch im Stand der Technik bekannte Varianten detektieren können. Ein weiterer Gegenstand der vorliegenden Erfindung ist ein isoliertes Hepatitis B-Virus, das ein HBs-Antigen aufweist, das eine Aminosäuresequenz mit wenigstens 91 % Identität zu SEQ ID NO: 12 umfasst. Vorzugsweise umfasst das HBs-Antigen des erfindungsgemäßen Virus die Aminosäuresequenz SEQ ID NO:12. Schließlich umfasst die Erfindung auch Kulturen von Gewebezellen, die mit der erfindungsgemäßen HBV-Variante infiziert sind ebenso wie die isolierte-HBV Variante selbst. Auch eine immunogene Zubereitung, die die attenuierte oder inaktivierte HDB 11 -Variante von HBV enthält, ist Gegenstand der Erfindung.
Die Erfindung betrifft auch die Verwendung eines erfindungsgemäßen Oligo- oder Polynukleotids oder eines erfindungsgernäßen Oligo- oder Polypeptids zur Herstellung eines Arzneimittels zur Behandlung oder Vorbeugung einer HBV-Infektion. Insbesondere können die erfindungsgemäßen Oligo- oder Polynukleotide bzw. Oligo- oder Polypeptide zur Herstellung eines Impfstoffs gegen HBV verwendet werden.
Ferner schließt die Erfindung auch eine Vakzine ein umfassend ein Polypeptid der vorliegenden Erfindung und ein gebräuchliches Adjuvans (z.B. Freund 'sches adjuvans, Phosphat:gepufferte Saline o.a.). Eine derartige Vakzine kann dazu verwendet werden, um die Bildung von Antikörpern in Säugetieren anzuregen. Ähnlich umfasst die Erfindung ein Partikel, das eine Nicht-Varianten spezifische Aminosäure-Sequenz beinhaltet, die eine Partikel-Bildung induziert zusammen mit einem Epitop-enthaltenden Polypeptid, das spezifisch für die erfindungsgemäße HBV Variante ist.
Die Nukleotidsequenzen der Erfindung können auch dazu verwendet werden, sog. Antisense Oligonukleotide darzustellen (gegebenenfalls für therapeutische Zwecke).
Weitere Aspekte der vorliegenden Erfindung sind die folgenden Gegenstände (1) bis (21):
(1) Ein isoliertes Oligo- oder Polynukleotid mit einer der Sequenzen ausgewählt aus der Gruppe von SEQ ID NO:1 bis SEQ ID NO:11 : SEQ ID NO:l
127 GGGGGAACTACCGTGTGTCTTGGCCAAAATTCGCAGTCCCCAACCTCCAATCAC
TCACCAACCTCCTGTCCTCCAACTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTT
ATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGCTCTTCTGGACTAT
CAAGGTATATTGCCCGTTTGTCCTCTAATTCCAGGATCTGCAATCAACAACAGGGGACAA
TGCAAAACCTGCACGACTACTGCTCACGGAACCTCTATGTATCCCTACTGTTGCTGTACC
AAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCCTGGGCTTTCGGAAAA
TTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTTCCCTTTGTT
CAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGG 588
SEQ ID NO:2
277 TTCTTGTTGGCTCTTCTGGACTATCAAGGTATATTGCCCGTTTGTCCTCTAATTCCA GGATCTGCAATCAACAACAGGGGACAA 360
SEQ ID NO:3
277 TTCTTGTTGGCTCTTCTGGACTATCAAGGTATATTGCCCGTTTGTCCTCTAATTCCA GGATCTGCAATCAACAACAGGGGACAATGCAAAACCTGCACGACTACTGCTCACGGA ACC TCTATGTATCCCTACTGTTGCTGTACC 420
SEQ ID NO:4
301 CAAGGTATATTGCCCGTTTGTCCTCTAATTCCAGGATCTGCAATCAACAACAGG GGACAATGCAAA 366
SEQ DJ NO:5
301 CAAGGTATATTGCCCGTTTGTCCTCTAATTCCAGGATCTGCAATCAACAACAGG GGACAATGCAAAACCTGCACGACTACTGCTCACGGAACCTCTATGTATCCCTACTGT TGCTGTACC 420
SEQ ID NO:6
340 GCAATCAACAACAGG 354
SEQ ID NO:7 340 GCAATCAACAACAGGGGACAA 360
SEQ ID NO:8
340 GCAATCAACAACAGGGGACAATGCAAA 366
SEQ ID NO.-9
340 GCAATCAACAACAGGGGACAATGCAAAACCTGCACGACTACTGCTCAC 387
SEQ ID NO: 10
340 GCAATCAACAACAGGGGACAATGCAAAACCTGCACGACTACTGCTCACGGAACC TCTATGTATCCCTACTGTTGCTGTACC 420
SEQ ID NO: 11
361 TGCAAAACCTGCACGACTACTGCTCACGGAACCTCTATGTATCCCTACTGTTGC TGT ACC 420
(2) Ein Oligo- oder Polynukleotid nach (1), das zu jeweils mindestens 65 % oder 66 % oder 67 % oder 68 % oder 69 % oder 70 % oder 71 % oder 72 % oder 73 % oder 74 % oder 75 % oder 76 % oder 77 % oder 78 % oder 79 % oder 80 % oder 81 % oder 82 % oder 83 % oder 84 % oder 85 % oder 86 % oder 87 % oder 88 % oder 89 % oder 90 % oder 91 % oder 92 % oder 93 % oder 94 % oder 95 % oder 99 % oder 97 % oder 98 % oder 99 % mit einer der Sequenzen ausgewählt aus der Gruppe von SEQ ID NO:1 bis SEQ ID NO:11 identisch ist.
(3) Ein Oligo- oder Polynukleotid nach (1) oder (2), das mit einem Oligo- oder Polynukleotid, welches eine zu einer der Sequenzen, ausgewählt aus der Gruppe von SEQ ID NO:1 bis SEQ ID NO:11 , komplementäre Sequenz hat, unter stringenten Bedingungen hybridisiert.
(4) Ein isoliertes Oligo- oder Polynukleotid, welches für HBs-Antigen des Hepatitis B-Virus kodiert und ein Oligo- oder Polynukleotid nach (1), (2) oder (3) enthält.
(5) Ein Fragment eines Oligo- oder Polynukleotids, welches für HBs-Antigen des Hepatitis B-
Virus kodiert, dadurch gekennzeichnet, dass das Fragment ein Oligo- oder Polypeptid nach (1), (2) oder (3) enthält.
(6) Ein isoliertes Oligo- oder Polynukleotid, welches für die a-Determinante des HBs- Antigens des Hepatitis B-Virus kodiert und ein Oligo- oder Polynukleotid nach (1), (2) oder (3) enthält.
(7) Ein Primer, der für ein Oligo- oder Polynukleotid gemäß einem der Gegenstände (1) bis
(6) spezifisch ist.
(8) Ein Vektor, der mindestens ein Oligo- oder Polynukleotid gemäß einem der Gegenstände
(1) bis (5) enthält.
(9) Eine Wirtszelle, die einen Vektor nach (8) enthält.
(10) Ein Oligo- oder Polypeptid welches durch ein Oligo- oder Polynukleotid nach einem der Gegenstände (1) bis (5) kodiert wird.
(11) Isoliertes Oligo- oder Polypeptid, das eine Aminosäuresequenz ausgewählt aus der Gruppe von SEQ ID NO:12 bis SEQ ID NO:30 hat: SEQ m NO: 12
43 G G TT V C L G Q N S Q S P T S N H
S P T S C P P T C P G Y RW MC L R R F
I I F L F I L LL C L I F L LA L L D Y
Q G I L PV C P L I P G S A IN N R GQ 1
C K T C TT T A HG T S M Y P Y C C C T
K P S DGN C T C I P I P S S WA F G K
F LW EWA S A R F S W L S L L V P F V
QW F V G L S P T VW L S V I W 196
SEQ ID NO: 13
93 F L L AL L D Y Q G I L P V C PL I P G
S A I N N R GQ 120
SEQ D3 NO:14
93 F L LAL L D Y < Q G I L P V C P L I P G
S A IN N RG Q C K T C T M Y PY C C C T 140
SEQ ID NO: 15
101 Q G I L P V C P L I P G S A I NN RGQ C K 122
SEQ ID NO: 16
101 Q G I L P V C P L I P G S A I N RGQ
C K TC T T T A HG T S MY PY C C C T 140
SEQ m NO:17
114 A I N N R 118
SEQ ID NO: 18
110 I P G S A 114
SEQ ID NO: 19
111 P G S A I 115
SEQ DD NO:20
112 G S A I N 116
SEQ 1 No.: 21
113 S A I N N 117
SEQ DD NO:22
115 I N N R G 119
SEQ DD NO:23
116 N N R GQ 120 SEQ DD NO:24
117 N R G Q C 121
SEQ DD NO:25
118 R G Q C K 122
SEQ DD NO:26
114 A I NN RGQ 120
SEQ DD NO:27
114 A I N N R GQ C K 122
SEQ DD NO:28
114 A I N R G Q C K T C T T T AH 129
SEQ DD NO:29
114 A I N N R G Q C K TC T T T A H G T S M Y P Y C C C T 140
SEQ ID NO:30
121 C K T C T T T A H G T S M Y P Y C C C T 140.
(12) Oligo- oder Polypeptid gemäß (10) oder (11), das zu jeweils mindestens 65 % oder 66 % oder 67 % oder 68 % oder 69 % oder 70 % oder 71 % oder 72 % oder 73 % oder 74 % oder 75 % oder 76 % oder 77 % oder 78 % oder 79 % oder 80 % oder 81 % oder 82 % oder 83 % oder 84 % oder 85 % oder 86 % oder 87 % oder 88 % oder 89 % oder 90 % oder 91 % oder 92 % oder 93 % oder 94 % oder 95 % oder 99 % oder 97 % oder 98 % oder 99 % mit einer der Sequenzen, ausgewählt aus der Gruppe von SEQ ID NO:12 bis SEQ ID NO:30, identisch ist.
(13) Isoliertes Polypeptid entsprechend der Sequenz des HBs-Antigens des Hepatitis B- Virus, dadurch gekennzeichnet, dass es ein Oligo- oder Polypeptid gemäß einem der Gegenstände (10) bis (12) enthält.
(14) Fragment eines Polypeptids, welches der Sequenz des HBs-Antigens des Hepatitis B- Virus entspricht, dadurch gekennzeichnet, dass das Fragment ein Oligo- oder Polypeptid gemäß einem der Gegenstände (10) bis (12) enthält.
(15) Isoliertes Polypeptid, welches für die a-Determinante des HBs-Antigens des Hepatitis B- Virus kodiert, dadurch gekennzeichnet, dass es ein Oligo- oder Polypeptid gemäß einem der Gegenstände (10) bis (12) enthält. (16) Monoklonaler oder polyklonaler Antikörper, der an HBs-Antigen, enthaltend ein Oligo- oder Polypeptid gemäß einem der Gegenstände (10) bis (15) bindet, der an HBs- Antigen eines Hepatitis B-Wildtypvirus aber nicht oder wenigstens signifikant schwächer bindet.
(17) Ein anti-idiotypischer Antikörper, der eine Aminosäuresequenz gemäß einem der Gegenstände (10) bis (15) repräsentiert.
(18) Testkit zum Nachweis oder zur Bestimmung mittels einer Hybridisierungsreaktion einer Nukleinsäure, die für eine Variante oder Mutante des Hepatitis B-Virus spezifisch ist, unter Verwendung mindestens eines Oligo- oder Polynukleotids gemäß einem oder mehreren der Gegenstände (1) bis (7).
(19) Testkit zum immunchemischen Nachweis oder zur immunchemischen Bestimmung eines Antigens, das für eine Variante oder Mutante des Hepatitis B-Virus spezifisch ist, unter Verwendung mindestens eines monoklonalen oder polyklonalen Antikörpers gemäß (16).
(20) Testkit zum immunchemischen Nachweis oder zur immunchemischen Bestimmung eines gegen eine Variante oder Mutante des Hepatitis B-Virus gerichteten Antikörpers unter Verwendung mindestens eines Oligo- oder Polypeptids gemäß einem der Gegenstände (10) bis (15).
(21) Immunogenes Peptid oder Mischung immunogener Peptide enthaltend ein oder mehrere Oligo- oder Polypeptide gemäß einem oder mehreren der Gegenstände (3) und (4) alleine oder in Verbindung mit bekannten HBV-Immunogenen.
Die vorliegende Erfindung umfasst eine isolierte Nukleotid-Sequenz, die zu mindestens 65 % mit SEQ ID NO:1 identisch ist bzw. mit einem Fragment dieser in Abb. 3 und 4 dargestellten Sequenz, das spezifisch zum Komplement der SEQ ID NO:1 bis 11 hybridisiert.
Zusätzlich beinhaltet die vorliegende Erfindung eine isolierte Nukleotid-Sequenz, die die vorliegende erfindungsgemäße Variante der a-Determinante des Hepatitis B surface Antigens (HBsAg) in den Aminosäuren-Positionen zwischen aa 101 und 180 kodiert bzw. zu einem Peptid-Produkt führt, das in der aa-Sequenz zu mindestens 65 % mit der in Abb. 5 und 6 dargestellten SEQ ID NO: 12 übereinstimmt oder Fragmenten davon gemäß SEQ ID NO: 13 bis 30.
Des weiteren beeinhaltet die vorliegende Erfindung einen Vektor, umfassend eine oder mehrere der genannten Nukleotid-Sequenzen wie auch eine Wirtszelle, die diesen Vektor enthält und eine Methode zur Darstellung eines entsprechenden Polypeptids aus der a- Determinante, umfassend die Inkubation der oben genannten Wirtszelle über Zeiten und unter Bedingungen, die für die Expression des Polypeptides erforderlich sind.
Auch Gegenstand der Erfindung sind Antikörper, die mit der in SEQ ID NO:12 bis 30 beschriebenen a-Determinante reagieren, wobei die Bindung bevorzugt in dem Aminosäurebereich aa 101 bis 150 erfolgt. Die Antikörper können polyklonalen oder monoklonalen tierischen oder menschlichen Ursprungs sein.
Eine isolierte HBV Variante ist ebenfalls Gegenstand der Erfindung, wobei das Virus eine a- Determinante aufweist, die den aa-Sequenzen mindestens zwischen Position 101 und 120 und/oder aa 121 bis140 entspricht, idealerweise beiden genannten Regionen zwischen 101 und 140.
Auch eine immunogene Mischung zur Erzeugung polyklonaler oder monoklonaler Antikörper ist Gegenstand der vorliegenden Erfindung umfassend das beschriebene isolierte HBV oder ein bzw. mehrere der beschriebenen Poypeptide.
Die Erfindung beinhaltet auch eine Polynukleotid-Sonde, enthaltend eine HBV Genom- Sequenz, welche durch Substitution von Aminosäuren zu einer modifizierten a- Determinanten führt, die mit der beschriebenen aa-Sequenz der neuen HBV-Variante identisch ist oder zu mindestens 65 % entspricht.
Auch Kits zum Nachweis von Polynukleotiden der HBV-Variante mit Hilfe der genannten Sonde wie auch Kits zum Nachweis von HBsAg der Variante bzw. einzelnen Epitopen davon und Antikörper, die für die Variante oder Epitope davon spezifisch sind, sind ebenso Gegenstand der Erfindung, wie die Methoden des Nachweises von Polynukleotiden, Antigen und Antikörper, umfassend eine Inkubation zur Bildung entsprechender Komplexe und Nachweis dieser Komplexe durch geeignete dem Fachmann bekannte Verfahren. Die Ausführungsformen dieser Kits und Nachweismethoden können zum spezifischen und alleinigen Nachweis von Nukleotiden und Antigen der HBV-Variante bzw. dagegen gerichteter Antikörper ausgelegt sein oder supplementär, d.h. den zusätzlichen Nachweis der erfindungsgemäßen Varianten-Analyten zu derzeitig bekannten HBV-Nukleotiden, - Antigenen bzw. - Antikörpern gestatten.
Analog kann eine immunogene Mischung von erfindungsgemäßen Polypeptidsequenzen auch in Verbindung mit bekannten Antigenen z.B. für die Verbesserung der Wirksamkeit einer Vakzine angewendet werden.
Die vorliegende Erfindung beschreibt eine neue Variante des Hepatitis B Virus (HBV), die eine völlig neue a-Determinante als Resultat von Aminosäure-Austauschen in den nachfolgenden aa-Positionen der S-HBsAg Sequenz aufweist. Für die Beschreibung der Aminosäuren wird der 1 -Buchstaben-Code verwendet:
aa von HDB 11 aa-Position aa von ayw2/Genotyp D
I 103 M
A 114 S
I 115 T
N 116 T
N 117 s
R 118 T
Q 120 P
T 127 P
H 129 Q
Y 136 S.
Außerdem liegt in Position aa 96 von HDB 11 Alanin (A) statt Valin (V) vor: A 96 V
Diese aa-Substitutionen lassen sich auf entsprechende Nukleotid-Substitutionen der entsprechenden Codons zurückführen. Die vorliegende Erfindung betrifft eine isolierte Nukleotid-Sequenz, die für die a-Determinante des Virus kodiert (Abb. 3 sowie SEQ ID No.: 1).
Die Erfindung umfasst auch Nukleotide mit mindestens 65 % Übereinstimmung, bevorzugt mindestens 75 % Übereinstimmung und besonders bevorzugt mit mindestens 90 % Übereinstimmung mit der Nukleotid-Sequenz der vorliegenden Erfindung bzw. Fragmenten davon sowie dazu komplementäre Sequenzen.
Die Erfindung umfasst auch Polypeptide, die von oben beschriebenen Nukleotid-Sequenzen kodiert werden, insbesondere solche Aminosäuresequenzen, die die a-Determinante des HBsAg bestimmen und Polypeptide, die mindestens eine Ähnlichkeit von 65 %, bevorzugt 75 % und noch bevorzugter 95 % zu diesen Sequenzen aufweisen.
Für die Beschreibung der vorliegenden Erfindung wird unter einem Nukleotid-Fragment eine konsekutive Folge von mindestens 8 oder 9, bevorzugt 9-15, besonders bevorzugt 15-21 und sogar ganz besonders bevorzugt 21-60 Nukleotide aus der Nukleotidsequenz der neuen HBV-Variante verstanden, wobei auch Mischungen derartiger Nukieotid-Fragmente umfasst sind.
Unter einem Polypeptid-Fragment wird eine Folge von mindestens 3, bevorzugt 3-5, besonders bevorzugt 5-7 und sogar ganz besonders bevorzugt 7-20 Aminosäuren aus der a- Determinante der neuen HBV-Variante verstanden, wobei auch Mischungen derartiger Polypeptid-Fragmente unter diese Erfindung fallen.
Unter die vorliegende Erfindung fällt auch eine isolierte Nukleotid-Sequenz, die hybridisierbar ist und zu Nukleotid-Sequenzen führt, die den Nukleotidsequenzen des HBsAg der neuen HBV Variante oder Teilen der a-Determinante der neuen HBV Variante entsprechen, komplementär dazu sind oder als Subtyp oder Mutation auf HDB 11 zurückzuführen sind.
Dem Fachmann ist bekannt, dass eine Nukleotidsequenz nach deren Isolierung nach Methoden gemäß Stand der Technik in prokaryontische (z.B. E. coli), eukaryontische Wirtszellen (z.B. Chinese Hamster Ovary Cell) oder Hefe (z.B. S. Cerevisiae) mit Hilfe eines Vektors oder Konstruktes eingebracht werden können (mit dem Fachmann bekannten Methoden wie z.B. Transfektion, Transformation oder Elektroporation: Molecular Cloning: A Laboratory Manual, 2πd ed., Vol. 1-3, ed Sambrook et al., Cold Spring Harbor Laboratory Press (1989), wobei transiente oder permanente Kulturen angewendet werden können. Demzufolge umfasst die vorliegende Erfindung isolierte Nukleotidsequenzen der a- Determinante der neuen HBV Variante, Polypeptide, die durch diese Nukleotide kodiert werden, Vektoren, die Nukleotidsequenzen der a-Determinante der neuen HBV Variante enthalten wie auch die Wirtszelle, in die ein Vektor gebracht wird. Neben der Darstellung von Polypeptiden mit Hilfe eines Expressions-Systems (rekombinant oder gentechnologisch) ist dem Fachmann bekannt, dass analoge Poiypeptid-Strukturen auch vollsynthetisch oder direkt durch Reinigung aus der Virusvariante hergestellt werden können.
Es ist möglich, die Polypeptide oder Proteine der neuen HBV Variante zur Erzeugung von monoklonalen und/oder polyklonalen Antikörpern zu verwenden, die immunologisch an Bindestellen (Epitope) der a-Determinante der neuen HBV Variante binden. Die Methoden zur Darstellung von Antikörpern sind dem Fachmann bekannt (z.B. Koehler et al., Nature 256-494 (1975), Mimms et al., Vi. 176: 604-619 (1990).
Ferner ist es möglich, die a-Determinante der erfindungsgemäßen HDB 11 -Variante in Form der gesamten Polypeptidsequenz oder Teilen davon für die Bestimmung von gegen die HBV Variante gerichteten Antikörpern (Anti-HBs-Antikörpem) zu verwenden (siehe oben).
Dem Fachmann ist eine Vielzahl von Bestimmungsmethoden geläufig, bei denen mit Polypeptiden aus der a-Determinante der HBV Variante und Antikörpern tierischen oder menschlichen Ursprungs Immunkomplexe gebildet oder deren Bildung gehemmt werden.
Schließlich ist es möglich, monoklonale oder polyklonale Antikörper (oder Mischungen bzw. Fragmente davon oder Mischungen von Fragmenten), die mit Epitopen der neuen HBV Variante reagieren, dazu zu verwenden, die a-Determinante der erfindungsgemäßen HBV Variante in Form der gesamten Polypeptidsequenz oder Teilen davon in Untersuchungsproben zu bestimmen: HBsAg der HDB 11-Variante.
Dem Fachmann ist eine Vielzahl von Bestimmungsmethoden geläufig, bei denen mit einem oder mehreren monoklonalen Antikörper(n) oder polyklonalen Antikörpern (oder Mischungen davon bzw. Fragmenten oder Mischungen von Fragmenten), die spezifisch für die a- Determinante der HBV Variante sind, Immunkomplexe gebildet oder deren Bildung gehemmt werden. Ebenso können auf Basis der gefundenen Nukleotidsequenzen der neuen HBV-Variante entsprechende Primer entwickelt werden.
Schließlich sind auch diagnostische Reagenzien als Kits Gegenstand der Erfindung, die basierend auf den oben beschriebenen Verfahren einen Nachweis von HBV Variantenspezifischem Antigen (HBsAg) oder dagegen gerichtete Antikörper (Anti-HBs), entweder als singuläre Bestimmungen oder miteinander oder mit anderen bekannten HBV-Antigen bzw. spezifisch damit reagierenden Antikörpern bzw. auch mit ganz anderen Analyten kombinierbar.
Die vorliegende Erfindung ist darüber hinaus in den Patentansprüchen beschrieben.
Beschreibung der Abbildungen:
Abb. 1 stellt eine Übersicht der Aminosäure- Sequenzen der a-Determinante von 6 beschriebenen Genotypen des HBV im Vergleich zu HDB 11 dar.
In Abb. 2 sind die Nukleotid- und Aminosäure-Sequenzen der a-Determinante sowie unmittelbar benachbarter Regionen des Genotyps D, Subtyp ayw2 von HBV dargestellt.
Abb. 3 zeigt die Nukleotid-Sequenz der a-Determinante des HBV surface Antigens für Subtyp ayw2 des Genotyps D von HBV im Vergleich zur Nukleotid-Sequenz von HDB 11.
Abb. 4 fasst die Translations-relevanten Abweichungen der Nukleotid-Sequenz von HDB 11 zusammen.
In Abb. 5 wird die Nukleotid-Sequenz von HDB 11 in der Region der a-Determinante sowie die entsprechende Aminosäure-Sequenz dargestellt. Die a-Determinante befindet sich zwischen Aminosäure No. 101 und 180 des kleinen HBsAg (Small, S).
Abb. 6 zeigt die entsprechende Polypeptid-Sequenz der a-Determinante von HDB 11 , die von der in Abb. 5 beschriebenen Nukleotid-Sequenz kodiert wird.
Die nachfolgenden Beispiele erläutern die vorliegende Erfindung näher, ohne dass die Erfindung auf die beschriebenen Beispiele beschränkt ist. Beispiel 1 : HBsAg-Bestimmung mittels Enzymimmunoassay, EIA
Zur Bestimmung des surface Antigens von HBV, HBsAg im Blut des ägyptischen Patienten wurde der Enzymimmunoassay Enzygnost ® HBsAg 5.0 der Fa. Dade Behring GmbH, Marburg Deutschland angewendet.
Es handelt sich um einen in Europa zugelassenen und leistungsfähigen Test, der den Angaben der Packungsbeilage gemäß abgearbeitet wurde.
Das zu Grunde liegende Testprinzip ist ein sogenannter Sandwich Test im Mikrotiterplatten- Format:
100 μl der zu untersuchenden Probe werden in einem Einschritt-Verfahren mit 25 μl Konjugat 1 (monoklonale HBsAg spezifische Antikörper von der Maus, die kovalent mit Biotin markiert sind) und immobilisierten HBsAg-spezifischen polyklonalen Antikörpern vom Schaf in Kontakt gebracht. Nach 60-minütiger Inkubation bei 37°C und Entfernen überschüssiger Komponenten durch 4-maliges Waschen der Platten-Kavitäten werden 100 μl Konjugat 2 zugegeben, das aus Streptavidin besteht, an das das Sonden-Enzym Peroxidase kovalent gebunden ist.
Nach 30-minütiger Inkubation bei 37°C und Entfernen überschüssiger Komponenten durch 4-maliges Waschen der Platten-Kavitäten werden 75 μl Chromogen-Puffer/Substrat-Lösung zugegeben, gefolgt von einer 30-minütigen Inkubation bei Raumtemperatur. Die Entwicklung des blau gefärbten Tetramethylbenzidin-Farbstoffes wird durch Zugabe von 75 μl Stoplösung (Schwefelsäure) unterbrochen und der Farbstoff bei 450 nm photometrisch gemessen.
Die Intensität der Farbentwicklung, gemessen an der optischen Dichte (O.D.) ist dem Gehalt der Untersuchungsprobe an HBsAg direkt proportional, wobei ein O.D. Wert von kleiner als dem Grenzwert als HBsAg-negativ bewertet wird. Der Grenzwert ist definiert als der O.D.Mittelwert der parallel getesteten Kontrolle, negativ (im Testkit enthalten), zu dem ein konstanter Betrag von 0,05 O.D. addiert wird.
Die Nachweisgrenzen des zur Untersuchung herangezogenen Lots (# 32874) wurden mit den international akzeptierten Standardpräparationen des Paul-Ehrlich-Institutes, Langen Deutschland zu 0,012 ng ad-Subtyp/ ml bzw. 0,015 ng ay-Subtyp / ml in parallelen Versuchsansätzen aus Testungen von Verdünnungen der Standardpräparationen in HBsAg- negativem Serum durch graphische Interpolation ermittelt.
Die Untersuchung der Probe # 118234 (Entnahme vom 02. Okt. 2002, aus der auch die DNA-Isolierung vorgenommen wurde) brachte in 2 unabhängigen Versuchen an zwei verschiedenen Tagen Ergebnisse von 0,04 und 0,05 O.D., die den Kriterien des Testes entsprechend als HBsAg-negativ zu interpretieren sind. Die mitgeführte Kontrolle, positiv (im Testkit enthalten) war dagegen ebenso positiv (Validierungskriterien erfüllt) wie die erwähnten ad- und ay-Standardpräparationen.
Beispiel 2: Isolierung der HDB 11 - DNA aus Probe # 118234
Aus einem 200 μl-Aliquot der ägyptischen Probe wurde die DNA isoliert, indem der QIA amp® DNA Blood Mini Kit der Fa. Qiagen, Hilden Deutschland) angewendet wurde. Dabei wurden alle Verfahrensschritte wie in der Packungsbeilage beschrieben befolgt und die Elution in einem Volumen von 50 μl vorgenommen.
Beispiel 3: Polymerase Ketten Reaktion, PCR
3.1 HBV Primer
Die vier nachstehenden HBV Primer wurden verwendet:
Primer 1 mit der 5'> 3'- Sequenz: GGGTCACCATATTCTTGGGAAC (SEQ ID NO:31)
Primer 2 mit der 5'> 3'- Sequenz: TATACCCAAAGACAAAAGAAAATTGG
(SEQ ID NO:32)
Primer 3 mit der 5'> 3'- Sequenz: GACTCGTGGTGGACTTCTCTC (SEQ ID NO:33)
Primer 4 mit der 5'> 3'- Sequenz: TACAGACTTGGCCCCCAATACC (SEQ ID NO:34)
3.2 PCR-Amplifikation
Es wurde eine sogenannte nested PCR amplification des surface Antigens durchgeführt, . wobei der Perkin Eimer Ampli Taq ® DNA Polymerase Kit sowie der Thermocycler Gene Amp ® PCR system 9700 der Fa. Perkin Eimer Applied Biosystems, USA verwendet wurde. Die Nukleotide wurden von der Fa. Amersham Biosciences, UK bezogen.
Für den ersten Amplifikations-Zyklus wurden 5 μl der isolierten DNA unter Verwendung der oben genannten Primer 1 und 2 sowie folgenden Bedingungen amplifiziert:
PCR 1 rxn
Primer 1 (10 μM) 1 μl
Primer 2 (10 μM) 1 μl
10fach konz. Puffer (incl. 15 μM Mg2CI) 5 μl dNTP Mischung (10 μM) 1 μl dest. Wasser 36,75 μl
Ampli Taq (5 U/ μl) 0,25 ul
Pro Röhrchen 45 μl Gesamtvolumen plus 5 ul isolierte DNA 50 μl Reaktionsvolumen
Der 50 μl-Ansatz wurde unter Verwendung des beschriebenen Thermocyclers unter folgenden Bedingungen amplifiziert:
94° C, 1 min. / 94°C, 28 sek. - 50° C, 28 sek. - 72 ° C, 38 sek. (35 cycles) / 72 ° C, 5 min. / 8 °C soak.
In der zweiten Amplifizierungsrunde wurde 5 μl des ersten PCR . Produktes weiter amplifiziert unter Verwendung der HBV Primer 3 und 4 und folgenden Bedingungen: PCR 2 rxn
Primer 3 (10 μM) 1 μl
Primer 4 (10 μM) 1 μl
10 -fach konz. Puffer 5 μl dNTP Mischung (10 μM) 1 μl dest. Wasser 36,75 μl
Ampli Taq (5 U/ μl) 0,25 ul
Pro Röhrchen 45 μl Gesamtvolumen plus 5 ul PCR Produkt v.rxn
50 μl Reaktionsvolumen
Dieser PCR 2 -Ansatz wurde unter Verwendung des oben beschriebenen Thermocyclers amplifiziert. , wobei folgende Bedingungen angewendet wurden:
94° C, 1 min. / 94°C, 28 sek. - 55° C, 28 sek. - 72 ° C, 38 sek. (35 cycles) / 72 ° C, 5 min. / 8 °C soak.
Abschließend wurde das PCR 2 Produkt elektrophoretisch aufgetrennt (1 ,5 % Agarose) unter Mitführen geeigneter Molekulargewichtsmarker. Die Bande mit ca. 520 Basenpaaren wurde ausgeschnitten und mit Hilfe des QIA quick Gel Extraction Kit der Fa. Qiagen, Hilden Deutschland isoliert .
Beispiel 4: Sequenzierung von HDB 11
Das gereinigte PCR Produkt wurde von der Fa. Medigenomix, Martinsried, Deutschland mit Hilfe des ABI 3700 Kapillar Systems sequenziert in Verbindung mit der ABI BigDye Terminator Chemistry Version 1.1. und der ABI Sequencing Analysis Software Version 3.6. unter Verwendung der in Beispiel 3 beschriebenen Primer 3 und 4.
Sequenzierungs-Ergebnis
Es konnte gezeigt werden, dass das HBsAg der Probe innerhalb des sequenzierten Bereiches die beste Übereinstimmung der Nukleotid- und Aminosäure-Sequenz mit dem Genotyp D, Subtyp ayw2 zeigt, aber in der Region der a-Determinante insgesamt 10 Aminosäure-Substitutionen aufweist (siehe auch Abb. 2 und 5):
HDB 11: D, ayw2:
1.) Ile (l) gegen 103 Met (M)
2.) Ala (A) gegen 114 Ser (S)
3.) Ile (l) gegen 115 Thr (T)
4.) Asn (N) gegen 116 Thr (T)
5.) Asn (N) gegen 117 Ser (S)
6.) Arg (R ) gegen 118 Thr (T)
7.) Gln (Q) gegen 120 Pro (P)
8.) Thr (T) gegen 127 Pro (P)
9.) His (H) gegen 129 Gin (Q)
10.) Tyr (Y) gegen 136 Ser (S)
Zusätzlich liegt eine Aminosäure-Substitution in der Position # 96 vor: 11.) Ala (A) gegen 96Val (V)
Diese Ergebnisse wurden in mehreren unabhängigen Versuchen aus verschiedenen Primär- Röhrchen der Blutentnahme vom 02. Okt. 2002 mit den gleichen Sequenzierungs- Ergebnissen reproduziert.
Als einzige Ausnahme wurde in der ersten Analyse die Position aa# 122 als Arg R gelesen, während die zweite Analyse eher für Lys (K) sprach.
Das Nukleotid-Profil läßt beide Interpretationen zu, was allerdings auch Hinweis für das
Vorliegen der Koexistenz zweier Hepatitis B Viren mit unterschiedlicher Subtypisierung (ad bzw. ay) sprechen könnte, aber an der Aminosäure-Sequenz bzw. dem Rückschluß auf das
Vorhandensein einer neuen Variante mit oben genannten Aminosäure-Substitutionen nichts ändert.
Dies wird unter anderem aus dem negativen EIA Ergebnis geschlossen, da nennens-werte
Mengen zirkulierenden HBsAg bekannter Struktur im Hinblick auf die sehr guten
Nachweisgrenzen der angewendeten EIA Bestimmungsmethode in jedem Fall Anlaß zu einem positiven EIA-Ergebnis hätte geben müssen. Die Aminosäure, die Position 122 entspricht, kann daher in den Sequenzen SEQ ID NO:12, SEQIDNO:14, SEQIDNO:15, SEQIDNO:16, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 und SEQ ID NO:30 entweder K oder R sein.

Claims

Patentansprüche:
1. Oligo- oder Polypeptid umfassend
(a) eine Aminosäuresequenz, die wenigstens 78 % Identität zu SEQJD NO:14 hat;
(b) eine Aminosäuresequenz, in der gegenüber SEQ ID NO:14 null bis 10 Aminosäuren substituiert, deletiert oder inseriert sind;
(c) eine Aminosäuresequenz, die eine Teilsequenz von SEQ ID NO: 12 mit wenigstens 5 aufeinanderfolgenden Aminosäuren von SEQ ID NO:12 ist, wobei die Teilsequenz wenigstens eine der Positionen 54, 61 , 72, 73, 74, 75, 76, 78, 85, 87 und 94 von SEQ ID NO: 12 einschließt; oder
(d) ein Fragment eines HBs-Antigens eines Hepatitis B-Virus, wobei das Fragment eine Länge von wenigstens 5 Aminosäuren hat, das HBs-Antigen an Position 96 Alanin, an Position 103 Isoleucin, an Position 114 Alanin, an Position 115 Isoleucin, an Position 116 Asparagin, an Position 117 Asparagin, an Position 118 Arginin, an Position 120 Glutamin, an Position 127 Threonin, an Position 129 Histidin und/oder an Position 136 Tyrosin aufweist, und das Fragment Alanin 96, Isoleucin 103, Alanin 114, Isoleucin 115, Asparagin 116, Asparagin 117, Arginin 118, Glutamin 120, Threonin 127, Histidin 129 und/oder Tyrosin 136 umfasst.
2. Oligo- oder Polypeptid nach Anspruch 1 , dadurch gekennzeichnet, dass es mit Seren aus Individuen reagiert, die mit der Hepatitis B-Variante HDB 11 infiziert sind.
3. Oligo- oder Polypeptid nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass es eine Aminosäuresequenz umfasst, die ausgewählt ist aus der Gruppe bestehend aus SEQ ID NQ:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 und SEQ ID NO:30.
4. Oligo- oder Polynukleotid umfassend
(a) eine Nukleotidsequenz, die wenigstens 91% Identität zu SEQ ID NO:3 hat, (b) eine Nukleotidsequenz, in der im Vergleich zu SEQ ID NO:3 null bis 13 Nukleotide substituiert, deletiert oder hinzugefügt sind,
(c) eine Nukleotidsequenz, die eine Teilsequenz von SEQ ID NO:1 mit wenigstens 8 aufeinanderfolgenden Nukleotiden von SEQ ID NO:1 ist, wobei die Teilsequenz wenigstens eine der Positionen 161, 183, 213, 214, 218, 221 , 224, 227, 233, 234, 239, 253, 261, 281, 294, 306, 312, 387, 405 und 408 von SEQ ID NO:1 einschließt;
(d) eine Nukleotidsequenz, die unter stringenten Bedingungen spezifisch mit einem zu der Sequenz SEQ ID NO:1 komplementären Polynukleotid hybridisiert, oder
(e) eine Nukleotidsequenz, die für ein Oligo- oder Polypeptid nach einem der Ansprüche 1 bis 3 kodiert; oder ein dazu komplementäres Oligo- oder Polynukleotid.
5. Oligo- oder Polynukleotid nach Anspruch 4, dadurch gekennzeichnet, dass es eine Nukleotidsequenz umfasst, die ausgewählt ist aus der Gruppe bestehend aus SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 und SEQ ID NO:11.
6. Oligo- oder Polynukleotid nach Anspruch 4, dadurch gekennzeichnet, dass es eine Länge von 10 bis 30 Nukleotiden hat.
7. Vektor oder Plasmid enthaltend ein Oligo- oder Polynukleotid nach einem der Ansprüche 4 bis 6.
8. Zelle, die mit einem Vektor oder Plasmid nach Anspruch 7 transformiert oder transfiziert wurde.
9. Zelle, die ein Oligo- oder Polynukleotid nach einem der Ansprüche 4 bis 6 oder einen Vektor oder ein Plasmid nach Anspruch 7 enthält.
10. Verfahren zur Herstellung eines Oligo- oder Polypeptids nach einem der Ansprüche 1 bis 3, das umfasst, dass man eine Zelle nach Anspruch 8 oder 9 unter geeigneten Bedingungen kultiviert, so dass das Oligo- oder Polypeptid exprimiert wird.
11. Verfahren nach Anspruch 10, dadurch gekennzeichnet, dass das Oligo- oder Polypeptid aus den Zellen gewonnen wird und von anderen Oligo- oder Polypeptiden abgetrennt wird.
12. Antikörper, der an ein Oligo- oder Polypeptid nach einem der Ansprüche 1 bis 3 bindet.
13. Antikörper nach Anspruch 12, dadurch gekennzeichnet, dass er an HBs-Antigen enthaltend ein Oligo- oder Polypeptid nach einem der Ansprüche 1 bis 3 bindet, aber nicht oder signifikant schwächer an HBs-Antigen eines Hepatitis B-Virus Genotyp D, Subtyp ayw2.
14. Anti-idiotypischer Antikörper, der eine Aminosäuresequenz repräsentiert, wie sie in einem der Ansprüche 1 bis 3 definiert ist.
15. Testkit zum Nachweis von Hepatitis B-Viren, enthaltend
(i) ein Oligo- oder Polypeptid nach einem der Ansprüche 1 bis 3;
(ii) ein Oligo- oder Polynukleotid nach einem der Ansprüche 4 bis 6; und/oder
(iii) einen Antikörper nach einem der Ansprüche 12 bis 14.
16. Immunogenes Peptid oder Mischung immunogener Peptide, enthaltend ein oder mehrere Oligo- oder Polypeptide nach einem der Ansprüche 1 bis 3 alleine oder in Verbindung mit bekannten HBV-Immunogenen.
17. Verfahren zum Nachweis eines Hepatitis B-Antigens, dadurch gekennzeichnet, dass
(a) eine Probe mit einem Antikörper nach Anspruch 12 oder 13 unter Bedingungen inkubiert wird, die die Bildung eines Antigen-Antikörper-Komplexes gestatten; und
(b) ein Antigen-Antikörper-Komplex, der den Antikörper enthält, nachgewiesen wird.
18. Verfahren zum Nachweis von Antikörpern, die gegen ein Hepatitis B-Antigen gerichtet sind, dadurch gekennzeichnet, dass
(a) eine Probe mit einem Oligo- oder Polypeptid nach einem der Ansprüche 1 bis 3 unter Bedingungen inkubiert wird, die die Bildung eines Antigen-Antikörper-Komplexes gestatten; und
(b) der Antikörper-Antigen-Komplex, der das Oligo- oder Polypeptid enthält, nachgewiesen wird.
19. Verfahren zum Nachweis einer Hepatitis B-Nukleinsäure, dadurch gekennzeichnet, dass (a) eine Probe mit einem Oligo- oder Polynukleotid nach einem der Ansprüche 4 bis 6 unter Bedingungen inkubiert wird, die die selektive Hybridisierung des Oligo- oder Polynukleotids mit einer Hepatitis B-Nukleinsäure in der Probe gestatten; und
(b) bestimmt wird, ob Polynukleotidduplexe gebildet wurden, die das Oligo- oder Polynukleotid umfassen.
20. Verfahren zum Nachweis einer Hepatitis B-Nukleinsäure, dadurch gekennzeichnet, dass
(a) eine Probe mit wenigstens einem Oligo- oder Polynukleotid nach einem der Ansprüche 4 bis 6 unter Bedingungen inkubiert wird, die die selektive Hybridisierung des Oligo- oder Polynukleotids mit einer Hepatitis B-Nukleinsäure in der Probe gestatten;
(b) eine Polymerasekettenreaktion durchgeführt wird; und
(c) bestimmt wird, ob eine Nukleinsäure amplifiziert wurde.
21. Verwendung eines Oligo- oder Polynukleotids nach einem der Ansprüche 4 bis 6 als Primer.
22. Verwendung eines Oligo- oder Polynukleotids nach einem der Ansprüche 4 bis 6 als Sonde.
23. Isoliertes Hepatitis B-Virus, das ein HBs-Antigen aufweist, das eine Aminosäuresequenz mit wenigstens 93 % Identität zu SEQ ID NO:12 umfasst.
PCT/EP2004/006516 2003-06-20 2004-06-17 NEUE OBERFLÄCHENPROTEIN-(HBsAG-) VARIANTE DES HEPATITIS B VIRUS Ceased WO2004113370A1 (de)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP04739976.1A EP1638995B1 (de) 2003-06-20 2004-06-17 Neue oberflächenprotein-(hbsag-) variante des hepatitis b virus
CA002529997A CA2529997A1 (en) 2003-06-20 2004-06-17 Novel surface protein (hbsag) variant of hepatitis b virus
JP2006515968A JP4866238B2 (ja) 2003-06-20 2004-06-17 Ｂ型肝炎ウィルスの新規の表面タンパク質（ＨＢｓＡｇ）変異体
US10/561,343 US7485312B2 (en) 2003-06-20 2004-06-17 Surface protein (HBsAg) variant of the hepatitis B virus
US12/292,747 US8628772B2 (en) 2003-06-20 2008-11-25 Surface protein (HBsAg) variant of the hepatitis B virus

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10328139 2003-06-20
DE10328139.8 2003-06-20

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US10561343 A-371-Of-International 2004-06-17
US12/292,747 Division US8628772B2 (en) 2003-06-20 2008-11-25 Surface protein (HBsAg) variant of the hepatitis B virus

Publications (1)

Publication Number Publication Date
WO2004113370A1 true WO2004113370A1 (de) 2004-12-29

Family

ID=33520814

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2004/006516 Ceased WO2004113370A1 (de) 2003-06-20 2004-06-17 NEUE OBERFLÄCHENPROTEIN-(HBsAG-) VARIANTE DES HEPATITIS B VIRUS

Country Status (5)

Country Link
US (2) US7485312B2 (de)
EP (1) EP1638995B1 (de)
JP (1) JP4866238B2 (de)
CA (1) CA2529997A1 (de)
WO (1) WO2004113370A1 (de)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008532534A (ja) * 2005-03-16 2008-08-21 ケーラー トーマス 標的核酸を検出するための方法および試験キット
WO2009083136A1 (de) * 2007-12-21 2009-07-09 Siemens Healthcare Diagnostics Products Gmbh Neue oberflächen-protein-mutante des hepatitis b virus hbv surface antigen (hbsag)
US8242238B2 (en) 2003-06-20 2012-08-14 Dade Behring Marburg Gmbh Surface protein (HBsAg) variant of the hepatitis B virus
EP2726499A4 (de) * 2011-06-30 2015-03-04 Green Cross Corp Epitope und ihr verwendung für ein hepatitis-b-virus-oberflächenantigen

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112012002628B1 (pt) 2009-08-07 2021-09-08 Transgene Sa Composição imunogênica, molécula de ácido nucleico, vetor, partícula viral infecciosa, micro-organismo transgênico, composição, usos da composição imunogênica e kit de partes
CN103163294B (zh) * 2013-03-21 2015-06-10 厦门市波生生物技术有限公司 乙肝5项化学发光检测试剂盒的制备方法
US9714284B2 (en) 2013-07-16 2017-07-25 National Health Research Institutes Antibodies and method for determining deletions in HBV pre-S2 region
CN108271358A (zh) * 2014-12-10 2018-07-10 财团法人卫生研究院 判定HBV病毒pre-S2区域内缺失的抗体与其方法
WO2016164619A2 (en) * 2015-04-07 2016-10-13 Spring Bank Pharmaceuticals, Inc. Compositions and methods for the treatment of hbv infection

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5158769A (en) * 1984-03-07 1992-10-27 New York Blood Center, Inc. Pre-S gene coded peptide hepatitis B immunogens, vaccines, diagnostics, and synthetic lipid vesicle carriers
JPH06503231A (ja) 1991-09-18 1994-04-14 アムジエン・インコーポレーテツド 胆汁酸塩を含有するｂ型肝炎ワクチン製剤
US5531990A (en) * 1993-12-15 1996-07-02 Health Research, Inc. Method of raising an immune response with an anti-idiotypic antibody having correspondence with human hepatitis B surface antigen
EP1068339B1 (de) * 1998-04-01 2008-07-23 The Governors of the University of Alberta Zusammensetzungen und verfahren zur protein-sekretion
DE69941051D1 (de) 1998-08-04 2009-08-13 Jackson H M Found Military Med Expression und charakterisierung eines hiv-1 hüllproteins, das mit einer breitreaktiven neutralisier
US6660843B1 (en) * 1998-10-23 2003-12-09 Amgen Inc. Modified peptides as therapeutic agents
JP2003515327A (ja) * 1999-12-03 2003-05-07 イノジェネティックス・ナムローゼ・フェンノートシャップ Ｈｂｖ配列
JP2003521249A (ja) 2000-02-03 2003-07-15 メルボルン ヘルス 薬剤に対して改変された感受性を示す変異型ｂ型肝炎ウイルス（ｈｂｖ）を検出する検定法
EP1142906A1 (de) 2000-03-31 2001-10-10 Ortho-Clinical Diagnostics, Inc. Eine Variante des Hepatitis B Virus (ayw Subtyp) Oberflächenantigenes
AU2001255575B2 (en) * 2000-04-28 2006-08-31 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
SG90149A1 (en) 2000-07-18 2002-07-23 Government Of The Republic Of Diagnostic assay
WO2002055741A2 (en) * 2001-01-11 2002-07-18 Innogenetics Nv Method for detection of drug-induced mutations in the hiv reverse transcriptase gene
US7452963B2 (en) * 2001-03-27 2008-11-18 Samuel Bogoch Replikin peptides and antibodies therefore
US7202354B2 (en) 2001-03-30 2007-04-10 Abbott Laboratories Hepatitis B virus surface antigen mutant and methods of detection thereof
US7420037B2 (en) * 2003-02-13 2008-09-02 Antigenics Inc. Heat shock protein-based vaccines and immunotherapies
WO2004113369A1 (de) 2003-06-20 2004-12-29 Dade Behring Marburg Gmbh NEUE OBERFLÄCHENPROTEIN- (HbsAg-) VARIANTE DES HEPATITIS B VIRUS

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BORCHANI-CHABCHOUB I ET AL: "Genotyping of Tunisian hepatitis B virus isolates based on the sequencing of preS2 and S regions", MICROBES AND INFECTION, ELSEVIER, PARIS, FR, vol. 2, no. 6, May 2000 (2000-05-01), pages 607 - 612, XP002229227, ISSN: 1286-4579 *
CARMAN W F ET AL: "FULMINANT REACTIVATION OF HEPATITIS B DUE TO ENVELOPE PROTEIN MUTANT THAT ESCAPED DETECTION BY MONOCLONAL HBSAG ELISA", LANCET THE, LANCET LIMITED. LONDON, GB, vol. 345, no. 8962, 3 June 1995 (1995-06-03), pages 1406 - 1407, XP002041203, ISSN: 0140-6736 *
CHIOU H-L ET AL: "Altered antigenicity of 'a' determinant variants of hepatitis B virus", JOURNAL OF GENERAL VIROLOGY, SOCIETY FOR GENERAL MICROBIOLOGY, READING, GB, vol. 78, 1997, pages 2639 - 2645, XP002174817, ISSN: 0022-1317 *
DATABASE EMBL 1 February 1997 (1997-02-01), XP002297050, retrieved from EBI Database accession no. Q96841 *
DATABASE EMBL 10 July 2000 (2000-07-10), XP002297066, retrieved from EBI Database accession no. AF280817 *
DATABASE EMBL 27 June 2003 (2003-06-27), XP002297051, retrieved from EBI Database accession no. AB104715 *
DATABASE EMBL 6 February 2000 (2000-02-06), XP002297053, retrieved from EBI Database accession no. AF214660 *
DATABASE EMBL 6 January 2001 (2001-01-06), TIGEN, XP002297056, retrieved from EBI Database accession no. AJ297881 *
WEINBERGER KLAUS M ET AL: "High genetic variability of the group-specific a-determinant of hepatitis B virus surface antigen (HBsAg) and the corresponding fragment of the viral polymerase in chronic virus carriers lacking detectable HBsAg in serum", JOURNAL OF GENERAL VIROLOGY, vol. 81, no. 5, May 2000 (2000-05-01), pages 1165 - 1174, XP002297178, ISSN: 0022-1317 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8242238B2 (en) 2003-06-20 2012-08-14 Dade Behring Marburg Gmbh Surface protein (HBsAg) variant of the hepatitis B virus
JP2008532534A (ja) * 2005-03-16 2008-08-21 ケーラー トーマス 標的核酸を検出するための方法および試験キット
WO2009083136A1 (de) * 2007-12-21 2009-07-09 Siemens Healthcare Diagnostics Products Gmbh Neue oberflächen-protein-mutante des hepatitis b virus hbv surface antigen (hbsag)
US8729231B2 (en) 2007-12-21 2014-05-20 Siemens Healthcare Diagnostics Products Gmbh Surface antigen protein mutant of hepatitis B virus surface antigen
EP2726499A4 (de) * 2011-06-30 2015-03-04 Green Cross Corp Epitope und ihr verwendung für ein hepatitis-b-virus-oberflächenantigen
US9415100B2 (en) 2011-06-30 2016-08-16 Green Cross Corporation Epitope and its use of hepatitis B virus surface antigen

Also Published As

Publication number Publication date
US8628772B2 (en) 2014-01-14
JP4866238B2 (ja) 2012-02-01
US7485312B2 (en) 2009-02-03
EP1638995A1 (de) 2006-03-29
CA2529997A1 (en) 2004-12-29
US20060204513A1 (en) 2006-09-14
EP1638995B1 (de) 2015-08-26
US20100047764A1 (en) 2010-02-25
JP2007534296A (ja) 2007-11-29

Similar Documents

Publication Publication Date Title
DE69111801T2 (de) Vakzin gegen hepatitis b.
DE3788902T3 (de) Hepatitis-Delta-Diagnostika und Impfstoffe, ihre Herstellung und Verwendung.
DE3886363T2 (de) NANBV-Diagnostika und Vakzine.
DE69433285T2 (de) Hepatitis-b-virusmutanten, und verbindungen und verfahren für ihre bestimmung
DE68929478T2 (de) Rekombinante CMV-Neutralisierungsproteine
DE69637264T2 (de) Virales Material und Multiple-Sklerose assoziierte Nukleotidfragmente mit diagnostischen, prophylaktischen und therapeutischen Verwendungen
DE68929467T2 (de) HIV-2 Varianten
Theilmann et al. Detection of pre‐S1 proteins in serum and liver of HBsAg‐positive patients: A new marker for hepatitis B virus infection
US8628772B2 (en) Surface protein (HBsAg) variant of the hepatitis B virus
DE69534617T2 (de) Hepatitis b-impfstoff
EP0279460A1 (de) Virusantigen, Verfahren zu seiner Gewinnung und Anwendung in Diagnose und Therapie (Impfstoff)
EP1638994B1 (de) NEUE OBERFLÄCHENPROTEIN- (HbsAg-) VARIANTE DES HEPATITIS B VIRUS
EP2726499A1 (de) Epitope und ihr verwendung für ein hepatitis-b-virus-oberflächenantigen
DE60115938T2 (de) Monoklonale antikörper gegen hepatitis b virus
DE69130562T2 (de) Verbesserung in zusammenhang mit dem nachweis von viren
EP2220493B1 (de) Neue oberflächen-protein-mutante des hepatitis b virus hbv surface antigen (hbsag)
KR20010106128A (ko) 백신-유도 ｂ형 간염 바이러스 균주 및 그 용도
Fields et al. Biochemical and biophysical properties of hepatitis B core particles derived from Dane particles and infected hepatocytes
Nalpas et al. Secondary immune response to hepatitis B virus vaccine in alcoholics
DE69726602T2 (de) Hepatitis b inhibitoren
KR100498118B1 (ko) 하나의 돌연변이 인체 ｂ형 간염 바이러스 균주 및 그용도
Coursaget et al. Hepatitis B surface antigen reactivity in man due to a new variant of hepatitis B virus
US20040209292A1 (en) Mutant human hepatitis B viral strain and uses thereof
DE60030443T2 (de) Synthetische peptide die immunoreaktivität gegen den virus von hepatitis a zeigen
Neurath et al. Design of Hepatitis B Vaccines

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2004739976

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2529997

Country of ref document: CA

Ref document number: 2006515968

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 10561343

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 2004739976

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 10561343

Country of ref document: US