WO2004106519A2

WO2004106519A2 - Mrp8/mrp14 inhibitors and the use thereof for preventing and/or treating hypertrophic scars and keloids

Info

Publication number: WO2004106519A2
Application number: PCT/EP2004/006012
Authority: WO
Inventors: Andreas Goppelt; Stephanie Fritz; Michaela Bittner
Original assignee: Switch Biotech Ag
Priority date: 2003-06-03
Filing date: 2004-06-03
Publication date: 2004-12-09
Also published as: WO2004106519A3; DE10324997A1

Abstract

The invention relates to the use of Mrp8/Mrp14 inhibitors for producing a medicament for preventing and/or treating hypertrophic scars and keloids. The invention also relates to novel Mrp8 or Mrp14 inhibitors, particularly siRNA's.

Description

Mrp8 / Mrpl4 inhibitors and their use for the prevention and / or treatment of hypertrophic scars and keloids

The invention relates to the use of Mrp8 / Mrpl4 inhibitors for the manufacture of a medicament for the prevention and / or treatment of hypertrophic scars and keloids. The invention further relates to novel Mrp8 or Mrpl4 inhibitors.

Scars always form after skin injuries after healing is complete. After the re-epithelization of injured skin is complete, the extracellular matrix, in particular collagens, is reorganized. Ideally, a flat scar is created that cannot be recognized macroscopically as such. In some cases, however, there is an excessive formation of the extracellular matrix in the Dennis, so that the excessive scar formation creates a visually unattractive, raised and irregularly shaped hypertrophic scar. These scars are not only a cosmetic problem but are also characterized by the lack of skin attachments, such as hair follicles, sebaceous glands, and poor mechanical properties, so that great problems for the patient arise when subjected to thermal or mechanical stress. Furthermore, keloids can arise; i.e. Scar growths that even grow into the healthy skin tissue, which creates a constantly growing scar.

Hypertrophic scars and keloids are characterized by an aberrant production of extracellular matrix components in the Dennis, which leads to a thickened Dennis. The fibroblasts that lie in the epidermis play a crucial role in this. However, it is also known that the keratinocytes of the overlying epidermis have a significant influence on the fibroblasts during the formation of scars. For example, it has been shown that keratinocytes isolated from keloids, when cocultivated with fibroblasts, stimulate them to produce more liferate and secrete collagen, similar to the known behavior of fibroblasts from keloids. Incorrectly regulated keratinocytes in fresh scar tissue are therefore responsible for the excessive production of collagens and glycoproteins in the underlying dermal layer.

The molecular biological factors on which the scarring is based are essentially unclear. For this reason, no methods of treatment of hypertrophic scars and / or keloids are known in the prior art, which are directed to the molecular mechanisms themselves. The treatment methods of keloids known in the prior art are very often limited to simple surgical removal of the keloids; however, up to 90% of the cases there is a recurrence of the keloids. In general, there are no treatment options for keloids with an acceptable success rate. In the case of hypertrophic scars, existing treatment techniques also usually do not lead to satisfactory results. Classical methods include the surgical removal of scars, whereby a new formation of the hypertrophic scar is frequently observed, as well as treatment with silicone gel bandages, treatment with pressure bandages, treatment with corticosteroids (e.g. triamcinolone acetonide), radiation with lasers or CO and tissue cryotherapy. When using silicone gel bandages, the effect is probably less based on the silicone itself, but on the hydrating and final effect of the bandage. The intralesional lesion of corticosteroids leads to a reduction in collagen synthesis, but severe side effects such as skin atrophy, hypopigmentation or ulcers are observed with long-term treatment. Furthermore, attempts are also made to inject collagen or hyaluronic acid into the scar tissue in order to optically achieve a flatter skin surface. However, these substances are reabsorbed within a few months and the treatment must be repeated every 6-12 months. More recent treatment approaches include the administration of interferon-alpha, interferon-beta or interferon-gamma or the administration of imiquimod, which induces the expression of interferons. The administration of TGF-beta is also discussed for the prevention of the formation of hypertrophic scars. The object of the present invention is therefore to provide improved agents for the prevention and / or treatment of hypertrophic scars and / or keloids.

According to the invention, the object is achieved by using at least one Mrp8 and / or Mrpl4 inhibitor for the manufacture of a medicament for the prevention and / or treatment of hypertrophic scars and / or keloids.

Within the scope of the invention it has surprisingly been found that Mrp8 and / or Mrpl4 inhibitors, in particular siRNA molecules directed against Mrp8 and / or Mrpl4, are suitable for the prevention and / or treatment of hypertrophic scars and keloids. Surprisingly, it has been found that Mrp8 / Mrpl4 are expressed specifically in aberrant hypertrophic scars and keloids, but not in normal scars, the overexpression being found specifically in the suprabasal keratinocytes of the diseased tissue. Furthermore, it was surprisingly found that by adding siRNA molecules which are directed against Mrp8 and Mr7 or Mrpl4, a significant inhibition of the proliferation of keratinocytes can be achieved in vitro. Since, as stated above, these keratinocytes play a crucial role in the formation of hypertrophic scars and keloids, the present invention thus provides effective means for the prevention and / or treatment of hypertrophic scars and kelodids.

Mrp8 and Mrpl4 are proteins of the SlOO family of proteins which have been known for a long time and which together can form a non-covalent heterodimer Mrp8 / 14. The expression of the proteins is greatly increased in a number of diseases, but decreased in others. The biological function of the proteins is completely unclear. Examples of such diseases in which an increased amount of Mrp8 and / or Mrpl4 have been detected are rheumatoid arthritis and other arthritis diseases, inflammatory bowel disease and other inflammatory bowel diseases, cystic fibrosis, periodontosis, and autoimmune diseases. like Kawasaki syndrome. Depending on the different type of wound, the expression in wounds is either increased or decreased (WO 92/088181, EP 1114862).

An enzymatic function of the proteins is unknown. At the same time, it is known that the proteins can bind a large number of substances, such as calcium, zinc, fatty acids, in particular arachidonic acid, heparin, heparan sulfate, glycosaminoglycans and tubulin filaments. It is unclear which of these extra- and intracellular binding partners play a role in vivo. Mrp8 and Mrpl4 are secreted, but it is unclear whether the intracellular and / or the extracellular occurrence is decisive for the pathogenesis of a disease.

Due to the unclear biological function of the proteins or the heterodimer, only the diagnostic use of the proteins is generally proposed in the prior art, i.e. an altered expression of the proteins in a disease is ascertained without a therapeutic concept being derived therefrom.

In the context of the present invention, an inhibitor is defined in that it is able to inhibit the function of MRP8 and / or MRP14 in the organism and can therefore be used therapeutically. This can be done by the inhibitor inhibiting the function of the molecule, for example by attachment to the protein, or by the expression of the protein being inhibited.

In the context of the invention, assays are preferably used to determine whether a substance is an inhibitor in the sense of the present invention, in which the inhibition of Mrp8 and / or Mrp 14 expression or Mrp8 and / or Mrpl4 activity is measured. The inhibition of expression can be investigated, for example, in vitro (example 3), in vivo or in cell lysates. The differences in expression are detected at the level of the mRNA or proteins, in particular at the level of the proteins. For example, how shown in Example 3, cell lines, in particular keratinocyte cell lines, which are transiently or stably overexpressing Mrp8 and Mrpl4 in order to be able to quantitatively determine the inhibition of expression after administration of an inhibitor. Mrp8 or Mrp 14 can be detected using suitable antibodies, each of which specifically recognizes Mrp8 or Mrpl4. Suitable detection methods are, for example, Western blot analysis or immunolocalization. Such an assay for determining the effect of an inhibitor on protein expression can consist, for example, of the following steps:

(1) Culturing cells containing detectable levels of Mrp8 and / or

Produce Mrp 14 protein,

(2) adding an inhibitor to the cells,

(3) detection of the amount of Mrp8 and / or Mrpl4 protein in the cells,

(4) Comparison to the amount of Mrp8 and / or Mrp 14 protein in untreated control cells.

A reduced amount of Mrp8 and / or Mrp 14 protein compared to control cells demonstrates the effect as an inhibitor.

Analogously, the amount of a Mrp8 and / or Mrp 14 mRNA can also be determined in order to determine the inhibitory effect:

(1) cultivation of cells that produce detectable amounts of Mrp8 and / or Mrp 14 mRNA, (2) administration of an inhibitor to the cells,

(3) detection of the amount of Mrp8 and / or Mrpl4 mRNA in the cells,

(4) Comparison to the amount of Mrp8 and or Mrp 14 mRNA in untreated control cells.

A reduced amount of Mrp8 and / or Mrpl4 mRNA compared to control cells demonstrates the effect as an inhibitor. Suitable detection methods are for example PCR-based methods such as RTPCR or in situ hybridization (Current Protocols, John Wiley & Son, Inc., New York (2003)).

The inhibitory effect of an inhibitor to be tested can also be demonstrated in vivo. For example, the influence of an inhibitor to be tested on Mrp8 and / or Mrp 14 expression in a specific tissue can be tested in the animal model. Analogous to the in vitro experiments described above for determining Mrp8 and / or Mrp 14 expression, a substance to be tested can be applied to a tissue, in particular the skin of an animal; the treated sample is then removed, the amount of Mrp8 and / or Mrp 14 protein or mRNA determined as described above and compared with the amount of Mrp8 and / or Mrp 14 protein or mRNA in untreated tissue. The untreated tissue can come from the same animal or from another animal. A reduced amount of Mrp8 and / or Mrp 14 protein or mRNA compared to control cells demonstrates the effect as an inhibitor.

The samples can be taken, for example, by taking biopsies, in particular the skin, or by taking body fluids, for example blood.

In the context of the present invention, “hypertrophic scars” denotes a clinical picture in which, after wound healing has ended, there is an increased production of extracellular matrix components in the Dennis, as a result of which the Dennis is thickened.

In the context of the present invention, “keloid” denotes a clinical picture in which scar growths proliferate in the healthy skin tissue and thus form a scar that proliferates beyond the limits of the location of the original dream or the wound. According to a preferred embodiment, the inhibitor is an inhibitor of human Mrp8 and / or human Mrp 14. However, the invention also includes that it is an inhibitor against Mrp8 and / or Mrp 14 from other species, for example monkey, Pig, beef, horse, rat or mouse.

According to a particularly preferred embodiment, only one inhibitor is used. Within the scope of the invention it has surprisingly been found that an inhibitor which is directed either against Mrp8 or Mrp 14 already has the same effect as a combination of two inhibitors which are directed against Mrp8 and Mrp 14. Thus, full therapeutic success can be achieved simply by administering an inhibitor.

According to a further preferred embodiment, the inhibitor is selected from the group consisting of nucleic acids, antibodies, other natural or synthetic proteins and peptides which, for example, bring about increased degradation or sequestration of Mrp8 and / or Mrp 14, molecules with low molecular weight (LMWs) and Mrp8 / Mrpl4 receptor antagonists.

Low molecular weight molecules are molecules which are not proteins, peptides, antibodies or nucleic acids and which have a molecular weight of less than about 5000 Da, preferably less than 2000 Da, in particular less than 1000 Da, most preferably less than 500 Da. Such inhibitors can be identified, in particular, in the context of high-through put methods based on molecular banks. Such methods are known to the person skilled in the art.

According to a preferred embodiment, the inhibitor is an antibody. This antibody is either polyclonal or monoclonal, the antibody is preferably a monoclonal antibody. According to the present invention, the term “antibody” also means genetically engineered and possibly modified antibodies or antigen-binding parts thereof, such as, for example, chimeric antibodies, humanized antibodies, multifunctional antibodies, bi- or oligo-specific antibodies, single-stranded antibodies, F (ab) - or F (ab) 2-fragments (see, for example, EP- Bl-368684, US 4,816,567, US 4,816,397, WO 88/01649, WO 93/06213, WO 98/24884).

According to a particularly preferred embodiment, the inhibitor is a nucleic acid, preferably with a maximum length of approximately 200 nucleotides.

According to a further preferred embodiment, these nucleic acids bind to Mrp8 and / or Mrp 14 mRNA or DNA, in particular genomic DNA, particularly preferably to mRNA.

Preferred are nucleic acids with a length of a single strand of at most 100 nucleic acids, preferably at most 50 nucleic acids, particularly preferably at most 30 nucleic acids.

According to a particularly preferred embodiment, the nucleic acids inhibit the expression and / or activity of Mrp8 and / or Mrpl4. They particularly preferably inhibit the expression of Mrp8 and / or Mrp 14 polypeptides.

According to a further preferred embodiment, the nucleic acids used in the context of the use according to the invention can be modified.

According to a particularly preferred embodiment, the nuclear acid binds to a human Mrp8 or Mrpl4 mRNA according to SEQ ID NO: 1 or SEQ ID NO: 2 or variants thereof, e.g. allelic variants, sequences with polymorphisms to the sequences SEQ ID No. 1 and 2 or splice variants.

According to a particularly preferred embodiment, the nucleic acid is an antisense molecule or an siRNA, preferably an siRNA. siRNAs (small interfering RNAs) work via the mechanism of dsRNA mediated RNA interference. Small dsRNA molecules cause a sequence-specific, so-called knock-down of gene expression, in contrast to long dsRNA molecules, which cause non-specific inhibition of translation in mammalian cells (Elbashir et al., 2001, Genes Dev, 15: 188-200 ; Vattem et al., 2001; Eur. J. Biochem., 268: 3674-84). A length of approximately <30 nucleotides per single strand is necessary in order to achieve sequence-specific RNA interference (RNAi) in mammalian cells (Xia et al., 2002, Nature Biotech., 20: 1006-1010). dsRNAs with 2-3 nucleotides 3 'overhangs have been described as efficient siRNAs, but there are indications that dsRNAs without an overhang (blunt end) also work in vivo.

siRNAs are double-stranded or partially double-stranded RNAs that are capable of target-specific interference. An siRNA molecule usually consists of two RNA single strands, but it is also possible to use siRNAs which consist of an RNA strand and are designed in such a way that they form a double strand with a hairpin structure.

The “sense strand” of the siRNA is to be understood as the RNA strand of an siRNA that is identical or over a range of at least approximately 16, in particular at least approximately 17, preferably at least approximately 18, most preferably at least approximately 19 nucleotides is at least about 90% identical to the target sequence, preferably it is identical.

The "antisense strand" of the siRNA is then the complementary strand.

According to the invention, a target is understood to mean a nucleic acid whose expression is to be modulated at the protein and / or mRNA level, preferably at the protein level. A target sequence in the sense of the present invention is the sequence of that strand of a target which is complementary to the strand which is used as a template in the transcription; ie the target sequence is the sense strand of the target. Targets of the lying invention are nucleic acids coding for Mrp8 and Mrpl4 proteins.

The “basic sequence of the siRNA molecules” is understood to mean that part of the sense strand of an siRNA which is double-stranded.

“Base target sequence” is to be understood as a part of a target sequence with a length X which is identical to the base sequence of the siRNA molecules in the region of the nucleotides 3-X or is at least 90% identical, preferably identical.

"Before" in connection with the relative position of nucleic acids within oligo- or polynucleic acids is to be understood as in the direction of the 5 'end of the molecule.

"Behind" in connection with the position of nucleic acids and oligo- or polynucleic acids is to be understood as in the direction of the 3 'end of the molecule.

siRNA interference is achieved in that the antisense strand of the siRNA is complementary to part of the target sequence or at least approximately 90% complementary, with complementarity being preferred. In a preferred embodiment, the antisense strand of the siRNA is in a range of at least 16 to 23 amino acids, preferably 17 to 22, in particular 18 to 21, particularly preferably 19 to 20, most preferably 19 nucleic acids complementary to at least one target sequence according to the invention 90% complementary, preferably complementary. In a further preferred embodiment, the siRNA is double-stranded in a range from approximately 16 to 23 amino acids, preferably 17 to 22, in particular 18 to 21, particularly preferably 19 to 20, most preferably 19. The double-stranded part is preferably that part of the siRNA which, as defined above, is complementary to the target sequence. In a preferred embodiment, the siRNA forms a double strand without a single strand overhang (“blunt end”). In a further preferred embodiment, the siRNA at the 3 ′ end of the sense or antisense strand has, independently of one another, single strand overhangs of at least 1, 2, 3, 4, 5 or 6 nucleic acids in length. The number of overhanging nucleic acids at the sense and antisense 3 'end is preferably identical. In a particularly preferred embodiment, the length of the single strand overhangs at the 3' end of the sense or antisense is -Strands 0 to 5. In a particularly preferred embodiment, the length of the single strand overhangs at the 3 'end of the sense or antisense strand is 0 or 2, in particular equal to 2. Frequently, dTdT are used as overhanging nucleic acids, but this is for the function The siRNA is not crucial, and siRNA molecules with a GC content of about 20-80%, especially about 30-70%, especially of about 50% is preferred, and the selection of those siRNAs is preferred in which the target sequence in front of the region (ie 5 'thereof) is at least approximately 90% identical, preferably identical, to the sense strand of the siRNA, 1, in particular 2 Adenosine carries.

The most effective have proven to be siRNAs which are composed of 21 nucleotide long RNA strands which are paired such that 1-3 nucleotide long overhangs, in particular 2 nucleotide long 3 'overhangs, are present at both ends of the dsRNA. siRNAs, which are each composed of 21 nucleotide long RNAs and are paired such that 2 nucleotide long 3 'overhangs, namely dTdT overhangs, are present at both ends of the dsRNA were successfully used in Examples 1 and 2.

According to a particularly preferred embodiment, only one siRNA is used in the context of the use according to the invention which is directed either against Mrp8 or Mrρl4. Surprisingly, the administration of an siRNA is sufficient to modulate both the expression of Mrp8 and that of Mrp 14. A complete therapeutic success can thus be achieved by an siRNA. This solves the problem of the unknown role of Mrp8 and Mrp 14, bypassed the heterogeneous binding partner and the unclear intra- or extracellular importance of the two proteins.

SiRNAs used according to the invention can be derived from any region of a Mrp8 or Mrp 14 mRNA sequence, in particular from human Mrp8 and Mrpl4 mRNA sequences, most preferably from sequences according to SEQ ID No. 1 or SEQ ID No: 2. In a particularly preferred embodiment, siRNAs used according to the invention are characterized in that the sense strand comprises the sequence of one of the sequences shown in SEQ ID No: 3 to 946. In a particularly preferred embodiment, siRNAs used according to the invention are characterized in that the double-stranded portion of the sense strand has the sequence of one of the sequences shown in SEQ ID No: 3 to 946. In particular, those siRNAs are preferred in which both strands of the siRNAs contain Watson-Crick base pairings over a range of 19 nucleotides and the antisense strand is 100% complementary to a target sequence and both strands at the 3 ′ end have overhangs of length 0 -5 nucleotides, preferably 1-3 nucleotides, most preferably 2 nucleotides.

In a preferred embodiment, an siRNA used according to the invention is characterized in that the section of the Mrp8 or Mrp 14 target sequence which is identical or approximately 90% identical to the sense strand of the siRNA is on the first nucleic acid before the first nucleic acid of the sense Strands of siRNA (corresponds to position -1) has an adenosine; particularly preferably has two adenosines on the first two nucleic acids before the first nucleic acid of the sense strand of the siRNA (corresponds to positions -2 and -1). Further preferred siRNAs (or their base sequence), which are characterized in that the section of the Mrp8 or Mrp 14 target sequence which is identical to the sense strand of the siRNA, on the first two nucleic acids before the first nucleic acid of the sense strand of the siRNA has two adenosines (corresponds to positions -2 and -1), are listed in Tables 5 and 6, or it is in Tables 5 and 6 that the SEQ ID NOs of the sequences containing such may contain preferred siRNA (= one of the possible base sequences).

siRNAs in the sense strand that are listed in SEQ ID No. Contained 164, 202 and 238 sequences were successfully used to inhibit Mrp8 expression and / or to inhibit keratinocytes (Examples 1, 2). In a particularly preferred embodiment, the siRNA is therefore characterized in that the sense strand contains the sequence of one of SEQ ID No: 164, 202, 238.

siRNAs which contain one of the sequences shown in SEQ ID No: 548, 649, 712 in the sense strand have been successfully used to inhibit Mrpl4 expression and / or to inhibit keratinocytes (Examples 1, 2). In a particularly preferred embodiment, the siRNA is therefore characterized in that the sense strand contains the sequence of one of SEQ ID No: 548, 649, 712.

The siRNAs that were used in Examples 1 and 2 are characterized in that the length of the single strand is 21 nucleotides, the RNA single strands at the 3 ′ end have 2-nucleotide overhangs, namely dTdT overhangs, and in the region of the double strand Watson-Crick bonds are only 19 nucleotides in length.

In a particularly preferred embodiment, an siRNA used according to the invention is therefore characterized in that the sense and antisense strands are complementary over a range of 19 nucleotides and thus form a double strand of 19 nucleotides in length. In a further preferred embodiment, the siRNA is characterized in that the siRNA at the 3 'end has single-strand overhangs of 2 nucleotides in length, for example with the sequence dTdT. In a further preferred embodiment, the nucleic acid used according to the invention is an antisense molecule.

Antisense molecules are usually single-stranded DNA molecules which are complementary to the sense strand of a gene and cause a "knock-down" in the expression of the desired gene. The mechanisms which play a role here include the inhibition of translation, but mainly that Deactivation of the mRNA by causing the endonuclease RNAse H to degrade the mRNA after binding of the antisense molecule to the target mRNA. Effective antisense molecules can be directed against any part of a target sequence.

An antisense molecule preferably has a maximum length of approximately 30 nucleotides, preferably approximately 18 and 26 nucleotides.

In a preferred embodiment, an antisense molecule used according to the invention is characterized in that the nucleic acid has the complementary sequence of one of the sequences shown in SEQ ID No. SEQ ID No: 3 to 946 shown sequences or parts thereof or is a DNA or DNA / RNA hybrid analogue thereof.

siRNA or antisense molecules can be produced by methods known to the person skilled in the art.

Suitable expression systems to obtain stable RNA interference in mammalian cells are described, for example, in McManus and Sharp (Nature Genetics, 3: 737-747): For example, the siRNAs can be controlled by the expression of Pol II and Pol III promoters, such as CMV, HI and U6, stand. The Pol III transcription ends with a series of thymidine residues, and the transcribed RNA therefore contains several uridines at the end. The expression cassettes can be constructed in such a way that a single siRNA molecule with an inverted hairpin structure is formed, or the two strands of the siRNA can be expressed separately. are expressed, followed by annealing the two strands. The siRNAs can be used directly as a therapeutic agent or used in gene therapy-acceptable carrier systems. Examples of gene therapy-acceptable carrier systems which allow stable expression of the siRNAs in cells are, for example, plasmids and viral expression systems, for example adenoviruses and lentiviruses.

The application of the siRNAs either directly or as an expression system expressing an siRNA according to the invention can be carried out by formulation, for example, together with suitable cationic lipids, such as, for example, Cytofectin ™, AdVectin ™ or Oligofectamine ™. The substances can also be injected, for example intravenously or infradermally. Intravenous application of siRNA expression systems have already been successfully tested in animal models (Xia et al., 2002, Nature Biotech., 20: 1006-10010). There is also the possibility of applying the nucleic acids by lonophoresis or electroporation. Local administration of the agent according to the invention is preferred in order to avoid side effects. Topical or intradermal application is therefore preferred.

According to the invention, the inhibitors can be administered as such, or preferably in combination with at least one suitable auxiliary or additive, e.g. with one or more suitable adjuvants and / or one or more pharmaceutically active and / or compatible carriers, diluents, fillers, binders, etc.

If the administration is topical, the auxiliary or additive is preferably hydrophobic and is preferably selected from the group comprising wax, oleyl alcohol, propylene glycol monostearate, propylene glycol monopalmitostearate, isopropyl laurate, isopropyl myristate, isopropyl palmitate, isopropyl stearate, ethyl myristate, ethyl, propyl myristate, propyl myristate Vaseline, lanolin alcohol and paraffin oil. The antisense molecules according to the invention can be applied using the same methods as for siRNA molecules. The methods for the topical application of antisense molecules, such as lonophoresis, electroporation, intradermal application and direct topical application are summarized in Wraight and White (Pharmacology & Therapeutics, 2001, 89-104).

In a preferred embodiment, the siRNA is produced recombinantly by expression of a single nucleic acid molecule, a double-stranded RNA molecule with stem loop initially being produced. The molecule can be used directly as a siRNA molecule.

In a further preferred embodiment, the siRNA is produced by chemical synthesis, for example using protected ribonucleoside phosphoramidites.

Furthermore, the siRNA molecules can be produced recombinantly by simultaneous expression of both strands in a cell, for example by expression under the control of a Pol III promoter. Examples are the U6 and the Hl promoter.

According to a particularly preferred embodiment, the antisense molecules and siRNAs have modified nucleic acids, preferably nucleic acids modified with phosphothioate, methylphosphonate or peptide bonds.

Suitable modified nucleic acids are summarized in Uhlmann & Peimann (1990; Chem. Ref. 90, 544) (see also Beigelman et al., 1995; Nucleic Acid Research 23: 3989-94; Dudycz 1995, WO 95/11910; Macadam et al , 1998; WO 98/37240; Reese et al. 1997; WO 97/29116).

Modified intemucleotide phosphate bridges in a nucleic acid that can be used in one of the uses according to the invention contain, for example, methylphosphonate, phosphophorothioate, phosphoramidate, phosphorodithioate, phosphorus phate ester, while non-phosphate internucleotide analogs contain, for example, siloxane bridges, carbonate bridges, carboxymethyl esters, acetamidate bridges and / or thioether bridges.

The inhibitors according to the invention are preferably used in the context of a topical treatment. It is preferred that the inhibitors, preferably the nucleic acids, can penetrate the epidermis.

The invention further relates to inhibitors of Mrp8 and / or Mrp 14, which are nucleic acids. The embodiments defined above also apply to this aspect of the invention.

Furthermore, the invention also relates to a pharmaceutical composition which contains the nucleic acids according to the invention, preferably in combination with suitable auxiliaries or additives. The suitable auxiliaries or additives are defined as above.

The invention also relates to a method for the prevention and / or treatment of hypertrophic scars and / or keloids in patients, in which an effective amount of at least one Mrp8 and or Mrpl4 inhibitor is administered. The embodiments disclosed above in the context of the use according to the invention also apply to the method according to the invention.

As used herein, the term "effective amount" means an amount sufficient to achieve a desired physiological result, either in cells treated in vitro or in a subject treated in vivo. More specifically, an effective amount is a pharmaceutically effective amount sufficient to treat hypertrophic scars and / or keloids The effective amount may depend on the particular inhibitor selected, and also depends on a variety of factors and conditions that affect the subject to be treated and the severity of the disease For example, if the inhibitor is administered in vivo, factors such as Age, weight, gender, and general health of the patient, as well as dose response curves and toxicity data obtained in preclinical animal studies are important. The determination of an effective amount for a particular inhibitor is known to the person skilled in the art. The inhibitor is preferably present in a construction of 0.1-50% by weight of the pharmaceutical composition, particularly preferably 1-30%.

The inhibitor can be administered once or in repeated doses. Repeated doses are preferred until the hypertrophic scars and / or keloids have disappeared.

The present invention thus provides for the first time means with which hypertrophic scars and or keloids can be treated or by means of which these diseases can be prevented. In the context of the present invention it was surprisingly possible to show that Mrp8 and Mrpl4 are specifically upregulated in hypertrophic scars and keloids, the increased expression in the proliferating, suprabasal keratinocytes being observed. In contrast, no expression is observed in intact skin and in normal healthy scars, which always occur after a wound. Thus, in particular through the use of siRNAs which are directed against Mrp8 and / or Mrp 14, a locally specific therapy or prevention approach is provided which is limited to proliferating keratinocytes and thus to pathological scarring processes, while the normal scar formation required for the Completion of the normal healing process is necessary, is not affected.

Brief description of the pictures

Figure 1: Sequence of a human Mrp8 mRNA target sequence according to SEQ ID NO: 1 Figure 2: Sequence of a human Mrp 14 mRNA target sequence according to SEQ ID NO: 2.

Figure 3: Localization of Mrp8 and Mrp 14 mRNA in scar tissue. A: Expression of Mrp 14 (left pictures) and Mrp8 (right pictures) in keloids (upper pictures) compared to intact skin (lower pictures) of the same person. While no staining is visible in intact skin, a strong staining is observed in both Mrp8 and Mrp 14 only in suprabasal keratinocytes of the keloid. Examples of stained supra-basal layers are marked with an arrow. B: Localization in normal scars of a healthy subject. No staining was observed.

Figure 4: Detection of Mrp8 and Mrpl4 mRNA expression in scar and keloid biopsies using TaqMan analysis compared to intact skin of healthy volunteers. It has been observed that, particularly in hypertrophic scars and keloids, but not in normal scars of healthy volunteers, a strong upregulation of the expression of both Mrp8 and Mrp 14 takes place. Furthermore, an increased amount of Mrp8 and Mrp 14 can be observed in keloid patients even in intact skin, which shows that the expression of Mrp8 and Mrp 14 mRNA in the skin is a suitable marker for detecting a keloid predisposition.

Figure 5: Influence of siRNAs directed against Mrp8 and / or Mrp 14 on the proliferation of HaCaT keratinocytes. 2 typical test results are shown. A higher luminescence indicates an increased proliferation. An siRNA directed against EGFP was used as negative control (GFP-d3; Table 7). The effect of various siRNAs directed against Mrp8 (1333-dl, 1333-d3; Tab. 3) and Mrpl4 (1759-d2, 1759-d3; Tab. 4) as well as mixtures thereof (1333-dl / 1759-d3) were examined. It was observed that a full therapeutic or preventive effect can be achieved with a single siRNA. Figure 6: Influence of siRNAs directed against Mrp8 and Mrp 14 on the expression of Mrp8 and Mrp 14 protein in keratinocytes. A: Influence of siRNAs directed against Mrp 8 on the expression of Mrp8 protein detected by Western blot. The effect of various siRNAs directed against Mrp8 (1333-dl, 1333-d2, 1333-d3; Tab. 3) and mixtures with siRNAs directed against Mrpl4 (1333-dl / 1759-d3; 1333-dl / 1759-d2 ; Tab. 3, 4) was examined. All siRNAs and siRNA mixtures showed a clear inhibitory effect on Mrp8 expression. Recombinantly produced Mrp8 / 14 was detected as a positive control. The influence of siRNA GFP-d3 was examined as a negative control. B: Influence of siRNAs directed against Mrp 14 on the expression of Mrp 14 protein detected by means of Western blot. The effect of different siRNAs against Mrp 14 (1759-dl, 1759-d2, 1759-d3; Table 3) and mixtures with siRNAs directed against Mrp8 (1333-dl / 1759-d3; 1333-dl / 1759- d2; 1333dl-1759-dl; Tab. 3, 4) was examined. All siRNAs or siRNA mixtures showed a clear inliibitior effect on Mrp 14 expression. Recombinantly produced Mrp8 / 14 was detected as a positive control. The influence of the siRNAs GFP-d3 and IGdl was examined as a negative control (Table 7). C: Effect of siRNAs directed against Mrp8 and / or Mrpl4 on the expression of Mrp8 and Mrpl4 by Western blot. The top blot shows a Mrp 14 Western blot; the bottom blot shows a Mrp8 Western blot. Samples from the same test batch for the detection of both proteins were applied. Track allocation: 1: marker; 2: marker, 3: negative control, cells treated with GFP-d3 siRNA, 4: negative control, cells treated with IGD-dl siRNA (Tab. 7), 5: cells treated with siRNA 1333-dl (Tab. 3), 6: cells treated with siRNA 1759-d3 (Tab. 4), 7: cells treated with siRNA mixture 1333-dl / 1759-d3 (Tab. 3, 4), 8: cells treated with siRNA 1333-d3 (Tab. 3) 9 : cells treated with siRNA 1759-d2 (Tab. 4), 10: control, untreated control cells.

Examples Example 1: Specific upregulation of Mrp8 and Mrpl4 in hypertrophic scars and the like keloids

First, the expression of Mrp8 and Mrp 14 mRNA in different scar tissue sections was examined. The in situ hybridization (non-radioactive) enables the detection of mRNA on the tissue section. The advantage of this method over PCR is that ^'a reference can be made to the morphology. Initially, amplifiers were generated using PCR for the production of probes using the following primers:

1333-T3 -aat taa ccc tca cta aag gg gggaatttccatgccgtctacaag

1333-SP6- att tag gtg aca cta tag aat ac ccacgcccatctttatcaccag

- Mrp8 probe with 171 bp length

1759-T3- aat taa ccc tca cta aag gg gtg tgg ctc ctc ggc ttt ga

1759-SP6- att tag gtg aca cta tag aat ac cat tct tat tct cct tct tga

- Mrp 14 probe with a length of 200 bp

The amplicons were separated by gel electrophoresis, documented and the specific band cut out with a scalpel, in order to then elute the PCR product with the QIAquick Extraction Kit (Qiagen, Hilden). According to the manufacturer, the purified amplicons were cloned into the plasmid TOPO 2.1 (Invitrogen, Karlsruhe) and transformed into competent cells (TOP 10). Bacterial growth (transformants) and plasmid isolation were carried out according to standard techniques (Sambrook et al., 1989). Clones with recombinant plasmid (= white) were picked and grown again in liquid LB medium. After the plasmids had been purified on a silica column (QIAprep Spin Miniprep Kit, Qiagen, Hilden), the recombinant plasmids were Checking the insert sequenced. The DIG RNA Labeling Kit (Röche, Mannheim) was used to label the probes with digoxigenin-11-DUTP ("random primed" DNA labeling) by means of in vitro transcription, and the transcripts were then precipitated and checked by gel electrophoresis. Antisense probes were generated via SP6 RNA polymerases, while the sense probe (negative control) was transcribed with T3 RNA polymerase.

In situ hybridization:

In situ hybridization staining was carried out on cryofixed (PFA) sections (8 μm) using the probes described above for rnrp8 and mrp 14. The following biopsies were used: keloid scar and healthy area of the same patient as well as intact skin of a healthy patient and normal, "healthy" scar of a healthy patient. The sections were prepared after appropriate preparation (drying, proteinase K digestion, fix, acetylation ) was first mixed with hybridization solution (without probe) and incubated at 55 ° C. (1 h), after which the solution was replaced by a hybridization solution (containing antisense or sense probe, 80 ng / 20 μl). The sections were incubated overnight at 55 ° C. Subsequently, several washing steps (SSC (2x) ± 50% formamide buffer) were carried out in order to remove unbound probes, after RNAse digestion (20 μg / ml NTE buffer) and several washing steps (SSC (0, lx) or PBT (lx) as well as washing buffer (Röche, Mannheim)) the sections were incubated in blocking buffer (Röche, Mannheim) for 30 min. After removing the buffer, an anti-DIG analyte conjugated with alkaline phosphatase was incubated. tik body (dilution: 1: 100) of added blocking buffer was added and the sections were incubated for 2 hours. After washing several times (wash buffer, Röche), the sections were equilibrated in detection buffer (Röche, Mannheim) and then transferred to staining solution (NBT / BCIP, 200 μl / 10 ml detection buffer) and the sections were incubated for 2 to 24 h. After stopping the reaction, the sections were washed with ddH ₂ O, viewed microscopically and evaluated. All hybridization steps were carried out under RNAse-free conditions leads. All buffers and solutions were mixed with DEPC (diethyl pyrocarbonate). Glassware was heat treated before use.

The results of the experiment are summarized in Figure 3. Both Mrp8 and Mrp 14 mRNA were specifically detected in the lower suprabasal, proliferating cell layers of the keloid scar by means of in situ hybridization, while no expression was found in intact skin of both the keloid patient and the healthy subject as well as in the normal scar of the healthy subject was detected. Mrp8 and Mrp 14 showed a comparable expression profile. The negative control (sense probe) showed no staining of the sections.

In order to quantify the differences in expression in scar tissue or intact skin, the expression of Mrp8 and Mrp 14 mRNA was detected by means of TaqMan analysis in biopsies.

For this purpose, stamped biopsies were taken from healthy subjects and from normal scars. Biopsies of scar tissue and intact skin were also taken from patients with hypertrophic scars. In addition, biopsies of keloid and intact skin were taken from patients with keloids. RNA was isolated from all biopsies. For this purpose, the biopsies were homogenized in RNAclean buffer (AGS, Heidelberg), to which 1/100 part by volume of 2-mercaptoethanol had been added, using a disperser. The RNA was then extracted by phenolizing twice using acidic phenol saturated with water and in the presence of l-bromo-3-chloropropane. An isopropanol and an ethanol precipitation were then carried out and the RNA was washed with 75% ethanol. A DNAse I digestion of the RNA was then carried out. For this purpose, 20 μg RNA (ad 50 μl with DEPC-treated water) with 5.7 μl transcription buffer (Röche), 1 μl RNAse inhibitor (Röche; 40 U / μl) and 1 μl DNAse I (Röche; 10 U / μl) Incubated for 20 min at 37 ° C. Then 1 μl of DNAse I was again added and incubated at 37 ° C. for a further 20 min. The RNA was then phenolized, ethanol precipitated and washed. All of the steps listed above were carried out with DEPC (diethyl pyrocarbonate) -treated solutions or liquids, provided that these did not contain any reactive amino groups.

The cDNA was then produced from the extracted RNA. This was done in the presence of 1 x TaqMan RT buffer (Perkin Elmer), 5.5 mM MgCl ₂ (Perkin Elmer), each 500 μM dNTPs (Perkin Elmer), 2.5 μM random hexamers (Perkin Elmer), 1.25 U / μl MultiScribe Reverse Transcriptase (50 U / μl Perkin Elmer), 0.4 U / μl RNase Inhibitor (20 U / μl, Perkin Elmer), 20 μl RNA (50 ng / μl) and DEPC-treated water (ad 100 μl volume). After addition of the RNA and thorough mixing, the solution was distributed into two 0.2 ml tubes (50 μl each) and the reverse transcription was carried out in a temperature cycler (10 min at 25 ° C; 30 min at 48 ° C and 5 min at 95 ° C). The subsequent quantification of the cDNA was carried out by means of quantitative PCR using the SYBR Green PCR Master Mix (Perkin Elmer), a triple determination being carried out for the determination of the Mrp8 or Mrp 14 cDNA amount. Cyclophilin A (Gen Bank: XM039526) was used as reference. The stock solution for each triplet contained 37.5 μl 2 x SYBR Master Mix, 0.75 μl AmpErase UNG (1 U / μl) and 18.75 μl DEPC-treated water for a total volume of 57 μl. For each triple determination, 1.5 μl of forward and reverse primers were added to 57 μl stock solution in a previously optimized concentration ratio. 60 μl each of the stock solution / primer mixture was mixed with 15 μl cDNA solution (2 ng / μl) and distributed over three wells. In parallel, a stock solution with primers for the determination of cyclophilin A was prepared, mixed with another 15 μl of the same cDNA solution and distributed over three wells. In addition, in order to create a standard curve for cyclophilin PCR, various cDNA solutions were prepared as a dilution series (4 ng / μl; 2 ng / μl; 1 ng / μl; 0.5 ng / μl and 0.25 ng / μl ). 15 μl of these cDNA solutions were mixed with 60 μl stock solution / primer mixture for the determination of cyclophiline and distributed over three wells. A standard curve was also created for Mrp8 and Mrp 14; the same dilutions used for the standard cyclophilin curve were used. As a control served a PCR approach without cDNA. 15 μl of DEPC water were added to each 60 μl stock solution / primer mixture of human Mrp8 or Mrp 14 and cyclophilin, and the mixture was mixed and divided into three wells. The amplification of the batches was carried out in the GeneAmp 5700 (2 min at 50 ° C; 10 min at 95 ° C, followed by 3 cycles with 15 sec at 96 ° C and 2 min at 60 ° C; then 37 cycles with 15 sec 95 ° C and 1 min at 60 ° C). The evaluation was carried out by determining the relative abundance of Mrp8 and Mrp 14 in relation to the cyclophilin reference. For this purpose, a standard curve was first created by plotting the Cr values of the dilution series against the logarithm of the amount of cDNA in the PCR approach (in ng rewritten RNA) and determining the slope (s) of the straight line. The efficiency (E) of the PCR then results as follows: E = 10 ^{"1 / s} - 1. The relative abundance (X) of the examined cDNA species (Y) with respect to cyclophilin is then: X = (l + E _Cy ciophiiin) ^C τ ^{(cyclophilin)} / (l + Eγ) ^c _τ ^(Y. Then the numerical values were normalized by setting the amount of cDNA from intact skin of healthy volunteers 1. The results are shown in Figure 4.

It was shown that, as already shown above, a specific malregulation of Mrp8 and Mrp 14 mRNA occurs in pathological scar tissue, but not in healthy scar tissue: expression of both mRNAs is greatly increased in hypertrophic scars as well as in keloids, while in normal ones No increase in expression compared to intact skin was found in wounds. This shows that the nucleic acids according to the invention can be used for the therapy and / or prevention of hypertrophic scars and keloids, since there is a specific malregulation in diseased tissue. In addition, it has been shown that Mrp8 and Mrp 14 are suitable for diagnosing a predisposition to keloids, since increased amounts of mRNA were found in intact skin of keloid patients compared to intact skin of healthy subjects for both Mrp8 and Mrp 14.

Example 2: Influence of siRNAs which bind to Mrp8 or Mrpl4 on the proliferation of keratinocytes In order to investigate the influence of Mrp8 and Mrp 14 on the proliferation of keratinocytes, the expression of the two genes was inhibited by the transfection of gene-specific siRNAs and the influence on cell proliferation was analyzed using a vitality assay. For this purpose, siRNAs which are directed against Mrp8 or Mrp 14 and mixtures of siRNAs which are directed against Mrp8 and Mrp 14 were used. The basic sequence and structure of siRNAs used are listed in Tables 3 and 4: 1333-dl, 1333-d3, 1759-d2, 1759-d3. The base sequences given in the tables represent the first 19 nucleic acids of the sense strand of the siRNA molecule. All siRNAs were each composed of two RNA strands which were complementary in the region of the 19 nucleotide sequence given (ie Watson-Crick base pairing) and on the 3rd 'End had 2-nucleotide dTdT overhangs each. An EGFP-specific siRNA (GFP-d3, Tab. 7) was fransfected as a negative control. To carry out this assay, HaCaT cells were used, which are cultivated in DMEM (GIBCO ™) with 10% FCS (PAN ™). The entire assay was run for 5 days. The cells were seeded into a 24-well plate (BD Falcon) with a cell count of 150,000 cells per well 24 hours before the first transfection. The lyophilized siRNAs were adjusted to a concentration of 20 μM. The first part of the transfection batch was prepared by carefully mixing 9μl Optimem I (GIBCO ™) with 6μl Oligofectamin ™ (Invitrogen). The mixture was incubated for 10 minutes at room temperature. During this incubation period, the second part, consisting of 47 μl Optimem I and 6 μl siRNA (in the case of a combination of two siRNAs, 3 μl each), was placed in a new Eppendorf vessel. After the incubation period, the first part was pipetted into the second part, mixed carefully and incubated for a further 22 min at room temperature. This was followed by the addition of 182 μl Optimem I. The culture medium was aspirated from the cells and the cells were washed once with Optimem I. Then 250 μl of transfection batch / well were added to the cells and these were incubated for 4 h in the incubator (37 ° C./10% CO ₂ /95% rH). After the incubation period, 150μl DMEM / 30% FCS was added to regenerate the cells overnight. The following day the transfection was carried out repeated as described above with the only difference that the cells were not washed with Optimem I before the addition of the transfection batch, since this would dry them out. To prevent this, add DPBS (PAN ™ Biotech GmbH) to the wells before aspirating the medium. On day 5, 48 hours after the second transfection, cell vitality was analyzed using the Promega CellTiter-Glo ™ luminescence cell vitality assay. For this purpose, the supernatant was aspirated, the cells were washed with PBS and then 200 μl of CellTiter-Glo / Well were added to the cells. The plate was incubated for 10 min at RT on a rotary shaker, then 100 μl was transferred to a 96-well plate (BD Falcon) and the luminescence was measured in the Fusion ™ α (Packard BioScience).

The experiments were carried out several times; 2 representative results are shown in Figure 5. Surprisingly, it was found for the first time that siRNAs directed against Mrp8 and / or Mrp 14 inhibit the proliferation of keratinocytes and thus these siRNAs for the prevention and / or therapy of hypertrophic scars and keloids. can be used. In addition, it was surprisingly found that the administration of an siRNA directed against Mrp8 or Mrp 14 is sufficient to achieve the effect which a mixture of siRNAs directed against Mrp8 and Mrp 14 has (see Figure 5). Thus, the new nucleic acids surprisingly have the advantage that the administration of a single nucleic acid, a dsRNA, is sufficient to achieve the full therapeutic effect.

Example 3: Influence of siRNAs which bind to Mrp8 or Mrpl4 on expression of Mrp8 and Mrpl4

It was examined whether the siRNAs used, which are directed against Mrp8 or Mrp 14, actually influence the expression of Mrp8 or Mrp 14. SiRNAs used are listed in Tables 4 and 3 (see also Example 1): 1333-dl, 1333-d2, 1333-d3, 1759-dl, 1759-d2, 1759-d3. An IGF-RI-specific siRNA (IGd-1; Table 7) was transfected as a positive control and an EGFP-specific siRNA (GFP-d3, Table 7) as a negative control. To carry out In this assay, HaCaT cells were used which, after stable transfection with Mrp8 and Mrpl4 expression plasmids, overexpress both proteins (HaCaT mrp8pl4n; S. Werner, ETH Zurich). These cells were cultured in DMEM (GIBCO ™) with 10% FCS (PAN ™), 0.1 mg / ml puromycin (SIGMA ™) and 0.4 mg / ml geneticin (GIBCO ™). The entire assay was run over a period of 4 days. The cells were seeded with a cell count of 100,000 cells per well 24 hours before the first transfection in a 24-well plate (BD Falcon) in DMEM (GIBCO ™) with 10% FCS (PAN ™) without antibiotics. The lyophilized siRNAs were adjusted to a concentration of 20 μM. The first part of the transfection batch was prepared by carefully mixing 9μl Optimem I (GIBCO ™) with 6μl Oligofectamin ™ (Invitrogen). The mixture was incubated for 10 minutes at room temperature. During this incubation period, the second part, consisting of 47 μl Optimem I and 6 μl siRNA (in the case of a combination of two siRNAs, 3 μl each), was placed in a new Eppendorf tube. After the incubation period, the first part was pipetted into the second part, mixed carefully and incubated for a further 22 min at room temperature. This was followed by the addition of 182 μl Optimem I. The culture medium was aspirated from the cells and the cells were washed once with Optimem I. Then 250 μl of transfection batch / well were added to the cells and these were incubated for 4 h in the incubator (37 ° C./10% CO2 / 95% rH). After the incubation period, 150μl DMEM / 30% FCS was added to regenerate the cells overnight. The following day, the transfection was repeated as described above with the only difference that the cells were not washed with Optimem I before the addition of the transfection batch, since this would dry them out. To prevent this, add DPBS (PAN ™ Biotech GmbH) to the wells before aspirating the medium. On the 4th day, 24 hours after the 2nd transfection, the cells were harvested for the subsequent Western blot analysis. For this purpose, the medium was suctioned off and the cells were washed once with DPBS. The cells were lysed by adding 50 μl / Well Roti®-Loadl protein application buffer (ROTH). The cell lysate was heated to 95 ° C. for 5 min and homogenized by centrifugation with QIAshredder (QIAGEN) Siert. Western blot analysis was performed using the XCell SureLock ™ Mini-Cell and XCell II ™ Blot Module System and 18% Novex® Tris-Glycine Gels with 10 wells (INVITROGEN). 25 μl of each sample were applied to two gels. The runtime of the SDS-PAGE was 2.5h at 130V and the transfer time to the nitrocellulose membrane (AMERSHAM Biosciences) was at 25V. Mrp8 was detected using a mouse anti-Mrp8 biotin antibody (Dianova) and steptavidin-HRP (R&D Systems) each in a 1: 200 dilution. Mrp 14 was detected with a rabbit anti-Mrpl4 antibody (J. Roth, University Hospital Münster) in a 1: 500 dilution and a mouse anti-rabbit Ig-HRP antibody (Promega) in a 1: 5000 dilution. To check the total amount of protein in each lane, the membrane was divided after the transfer at a running height of 36 kDa and the upper part of the membrane with a mouse anti-actin antibody (Chemicon) and an anti-mouse Ig-HRP antibody each in a 1 : 5000 dilution stained. The ECL ™ Western Blotting Detection Reagent and ECL ™ Hyperfilm (AMERSHAM Biosciences) were used for the chemiluminescence reaction and its detection.

In a first approach, the influence of siRNAs 1333-dl, 1333-d2 and 1333-d3 and mixtures of 1333-dl with 1759-d2 and 1759-d3 on the expression of Mrp8 protein was examined. The result is shown in Fig. 6 A: As expected, all siRNAs and siRNA mixtures result in a reduced amount of Mrp8 protein, since one siRNA directed against Mrp8 was transfected (albeit partly in a mixture with another siRNA which towards Mrp 14). In contrast, no reduced expression was observed when using the GFP-d3 control siRNA. In a further approach, the influence of siRNAs 1759-dl, 1759-d2 and 1759-d3 and mixtures of 1759-dl, 1759-d2 and 1759-d3 with 1333-dl on the expression of Mrpl4 protein was examined. The result is shown in Fig. 6B: As expected, all of these siRNAs and siRNA mixtures produce a reduced amount of Mrp 14 protein, since one siRNA directed against Mrp 14 was transfected (albeit partly in a mixture with another siRNA, which is directed against Mrp8 is). In contrast, no reduced expression was observed when using the IG-dl and GFP-d3 control siR As. In a further test it was tested whether siRNAs directed against Mrp8 have an influence on the amount of M l4 protein and vice versa. For this purpose, the HaCaT cells overexpressing Mφ8 and Mφl4 were again transfected with siRNAs directed against Mrp8 (1333-dl, 1333-d3), as well as siRNAs directed against Mφl4 (1759-d2, 1759-d3) and mixtures thereof, and then the Samples analyzed in parallel for Mφ8 and M l4 using Western blot. SiRNAs IgD-dl and GFP-d3 were used as controls. Recombinant Mφ8 / Mrpl4 was also queried as a positive control for the Western blot. The results are summarized in Fig. 6 C. Surprisingly, it was found that siRNAs, which are directed against Mφl4, decrease the Mφ8 and Mφl4 amounts equally (see e.g. lane 6 Mφ8 and Mφl4 blots vs. lane 3 (control)) and that siRNAs, which are directed against Mφ8 , reduce the amount of Mφ8 and Mφl4 to the same extent (see, for example, lanes 5, 8 Mφ8 and Mφl4 blots vs. lane 3 (control)). In addition, it has been surprisingly found that the use of mixtures of siRNAs which are directed against Mφ8 and Mφl4 have no additional effect on the expression. It was thus possible to confirm that the nucleic acids according to the invention are suitable for reducing both Mφ8 and Mφl4 protein amounts in HaCaT cells and thus bring about a reduction in cell proliferation, as shown in Example 2.

Claims

claims

1. Use of at least one Mφ8 and / or one Mφl4 inhibitor for the manufacture of a medicament for the prevention and / or treatment of hypertrophic scars and / or keloids.

2. Use according to claim 1, characterized in that it is an inhibitor of human Mφ8 and / or human Mφl4.

3. Use according to any one of claims 1-2, characterized in that an inhibitor is used.

4. Use according to any one of claims 1-3, characterized in that the inhibitor is selected from the group consisting of nucleic acids, antibodies, other natural or synthetic proteins and peptides which, for example, cause an increased degradation of Mxp8 and / or Mφl4, molecules with low molecular weight (LMWs) and Mφ8 / Mφl4 receptor antagonists.

5. Use according to claim 4, characterized in that the inhibitor is a nucleic acid.

6. Use according to claim 5, characterized in that the nucleic acid is an antisense molecule or an siRNA, preferably an siRNA.

7. Use according to claim 6, characterized in that the sense strand of the siRNA or the double-stranded portion of the sense strand of the siRNA has or comprises a sequence as shown in SEQ ID NO: 3-946.

8. Use according to claim 6, characterized in that the SEQ ID NO is selected from the numbers 164, 202, 230, 548, 649, 712.

9. Use according to claim 6, characterized in that the anti-sense molecule is a complementary sequence to one of the SEQ ID

NO: 3-946 sequences shown or parts thereof.

10. Use according to one of claims 5 or 9, characterized in that the antisense molecule has modified nucleic acids, preferably phosphothioate, methylphosphonate or peptide bonds.

11. Mφ8 or M l4 inhibitor, characterized in that it is a nucleic acid as defined in claims 6-10.

12. Pharmaceutical composition containing an inhibitor according to claim 11.