WO2004079331A2 - Composition and method for immobilizing a substance on a solid-phase support - Google Patents

Composition and method for immobilizing a substance on a solid-phase support Download PDF

Info

Publication number
WO2004079331A2
WO2004079331A2 PCT/JP2004/002692 JP2004002692W WO2004079331A2 WO 2004079331 A2 WO2004079331 A2 WO 2004079331A2 JP 2004002692 W JP2004002692 W JP 2004002692W WO 2004079331 A2 WO2004079331 A2 WO 2004079331A2
Authority
WO
WIPO (PCT)
Prior art keywords
substance
solid
charged substance
phase support
complex
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2004/002692
Other languages
French (fr)
Other versions
WO2004079331A3 (en
Inventor
Masato Miyake
Tomohiro Yoshikawa
Eiichiro Uchimura
Jun Miyake
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Institute of Advanced Industrial Science and Technology AIST
Original Assignee
National Institute of Advanced Industrial Science and Technology AIST
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Institute of Advanced Industrial Science and Technology AIST filed Critical National Institute of Advanced Industrial Science and Technology AIST
Priority to JP2006507659A priority Critical patent/JP2006519025A/en
Publication of WO2004079331A2 publication Critical patent/WO2004079331A2/en
Publication of WO2004079331A3 publication Critical patent/WO2004079331A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54393Improving reaction conditions or stability, e.g. by coating or irradiation of surface, by reduction of non-specific binding, by promotion of specific binding
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J19/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J19/0046Sequential or parallel reactions, e.g. for the synthesis of polypeptides or polynucleotides; Apparatus and devices for combinatorial chemistry or for making molecular arrays
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y30/00Nanotechnology for materials or surface science, e.g. nanocomposites
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00277Apparatus
    • B01J2219/00497Features relating to the solid phase supports
    • B01J2219/00527Sheets
    • B01J2219/00533Sheets essentially rectangular
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/0061The surface being organic
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00612Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports the surface being inorganic
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00614Delimitation of the attachment areas
    • B01J2219/00617Delimitation of the attachment areas by chemical means
    • B01J2219/00619Delimitation of the attachment areas by chemical means using hydrophilic or hydrophobic regions
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00632Introduction of reactive groups to the surface
    • B01J2219/00637Introduction of reactive groups to the surface by coating it with another layer
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00659Two-dimensional arrays
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00677Ex-situ synthesis followed by deposition on the substrate
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00718Type of compounds synthesised
    • B01J2219/0072Organic compounds
    • B01J2219/00722Nucleotides
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00718Type of compounds synthesised
    • B01J2219/0072Organic compounds
    • B01J2219/00725Peptides
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00718Type of compounds synthesised
    • B01J2219/0072Organic compounds
    • B01J2219/0074Biological products
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/10Libraries containing peptides or polypeptides, or derivatives thereof

Definitions

  • the present invention relates to immobilization technology for a substance such as , for example, a biological molecule. More specifically, the present invention relates to anovel composition andmethodfor immobilizing a substance such as, for example, a biological molecule on a solid-phase support .
  • Conventional methods for immobilizing a biological molecule on a solid-phase support include, for example, use covalent bonds, hydrophobic interaction, adsorption, or solid-phase surface treatment such as silanization or the like.
  • Ni iforo etal. discloses amethodusing an anionic surfactant to bond an oligomer to a polystyrene well via (Nikiforo etal., Nucleic Acids Res .22: 4167-4175, 1994) .
  • Nagata el al. discloses technology for bonding an unknown amount of cloned DNA to a microtiter well in the presence of 0.1 M MgCl 2 (Nagata et al., FEBS Letters 183:379-382 (1985)).
  • Dahlen, P. et al . describes sandwich hybridization in a microtiter well to which cloned, captured DNA to adsorb to the microtiter well (Dahlen et al., Mol. Cell. Probes 1:159-168(1987)).
  • Nikiforov et al. have studied bonding oligomers to a polystyrene well via NaCl (PCR Methods Applic. 3:285-291, 1994).
  • a biological molecule which is immobilized to a plate such as a microtiter plate, is required to be sustain-released after the plate is immersed in an assay solution in an assay process.
  • the biological molecule is required to maintain affinity to a biological organism, such as a cell, after being immobilised.
  • Currently available methods cannot maintain such affinity, or significantly reduce the affinity after immobilization. No satisfactory immobilization method has been developed.
  • One objective of the present invention is to provide a method for simply immobilizing a substance such as a biological molecule or the like to a solid-phase support.
  • Another objective of the present invention is to provide an immobilization method bywhich (i) a biological molecule, once immobilized to a solid-phase support, is sustain-released when dissolved in a specific solution, or (ii) a biological molecule, immobilized to a solid-phase support, substantially maintains or improves its affinity to a biological organism.
  • compositions obtained by forming a complex of a substance such as a biological molecule or the like, for example, DNA, RNA or polypeptide, and an oppositely charged substance; andthen combiningthe complexwithasalt (organic salt, inorganic salt (e.g., calcium phosphate contained in a medium) ) .
  • a composition obtained by forming a complex of a substance such as a biological molecule or the like, for example, DNA, RNA or polypeptide, and an oppositely charged substance
  • complexwithasalt organic salt, inorganic salt (e.g., calcium phosphate contained in a medium)
  • the present inventors also found that a substance such as a biological molecule or the like having the above-describedstructure, once immobilizedto a solid-phase support (e.g., a plate), is unexpectedly sustain-released when the solid-phase support is immersed in a solution such as an assay solution.
  • a substance having the above-describedstructure maintains or improves its affinity to a biological organism (e.g., tissue or cell).
  • the present invention provides the following.
  • a composition for immobilizing a substance on a solid-state support comprising:
  • composition according to item 1 wherein at least one of the positively charged substance and the negatively charged substance has cell affinity.
  • composition according to item 1 wherein both the positively charged substance and the negatively charged substance have cell affinity.
  • composition according to item 1 wherein at least one of the positively charged substance and the negatively charged substance contains a biological molecule.
  • composition according to item 4 wherein the biological molecule is selected from the group consisting of DNA, RNA, polypeptides , lipids , sugars , low molecular weight organic molecules, and complexes thereof.
  • composition according to item 1 wherein the negatively charged substance is selected from the group consisting of
  • DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof are examples of DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof .
  • composition according to item 1 wherein the positively charged substance is selected from the group consisting of cationic polymers , cationic lipids , cationic polyaminoacids , and complexes thereof.
  • composition according to item 1 wherein the salt is selected from the group consisting of calcium chloride,, sodiumhydrogenphosphate, sodiumhydrogencarbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids , and vitamins .
  • composition according to item 4 wherein the biological , molecule has biological activitywhen introduced into a cell
  • composition according to item 1 wherein the complex and the salt are pharmaceutically acceptable.
  • a device having a target substance immobilized therein comprising:
  • a device according to item 11 wherein at least one of the positively charged substance and the negatively charged substance has cell affinity.
  • Adevice according to item 11 wherein both the positively charged substance and the negatively charged substance have cell affinity.
  • a device wherein at least one of the positively charged substance and the negatively charged substance contains a biological molecule.
  • a device wherein the biological molecule is selected from the group consisting of DNA, RNA, polypeptides , lipids , sugars , low molecular weight organic molecules, and complexes thereof.
  • a device according to item 11, wherein the negatively charged substance is selected from the group consisting of DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof .
  • a device according to item 11 wherein the positively charged substance is selected from the group consisting of cationic polymers , cationic lipids , cationic polyaminoacids , and complexes thereof.
  • the solid-phase support contains a material selected from the group consisting of glass, silica, silicon, ceramics, silicon dioxide, plastics, metals, naturally-occurring polymers, and synthetic polymers .
  • a device according to item 20 wherein the coating is performed with a coating material containing a substance selected from the group consisting of poly-L-lysine, silane, APS, MAS, hydrophobic fluoroplastics, and metals. 22. A device according to item 11, wherein the solid-phase support is a chip.
  • a device according to item 11, wherein the solid-phase support is a chip, and the complex is arranged in an array on the chip.
  • a method for immobilizing a substance on a solid-phase support comprising the steps of:
  • DNA DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof.
  • a method according to item 26, wherein the positively i5 charged substance is selected from the group consisting of cationic polymers , cationic lipids , cationic polyaminoacids , and complexes thereof .
  • the salt is selected 20 from the group consisting of calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate; sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids , and vitamins . 25
  • solid-phase support contains a material selected from the group consisting of glass, silica, silicon, ceramics, silicon dioxide, plastics, metals, naturally-occurring polymers,
  • a method according to item 26 wherein the solid-phase support is treated by coating.
  • 36 A method according to item 35, wherein the coating is performed with a coating material containing a substance selected from the group consisting of poly-L-lysine, silane,
  • step (b) is performed under a condition in which the biological molecule is not destroyed.
  • step ( ⁇ ) is 25 performed under a condition in which the biological molecule is not destroyed.
  • Figure 1 shows representative results of the experiments performed in Example 2.
  • Figure 1 compares the results obtained with non-combined DNA (upper photos) and the results obtained with DNA combined with a positively charged substance (lower photos; treated with NP10) . These photos show the state of transfection, immediately after the complex was placed on the solid-phase support (in 0 minutes), and in 1 minute, 5 minutes and 10 minutes after the complex was placed on the solid-phase support.
  • Figure 2 shows representative results of the experiments performed in Example 3 (various systems).
  • Figure 2 is a graph illustrating the progress of sustain-release obtained with" N 3, NP5 and NP10.
  • Figures 3A shows an experiment in which spatially-spaced DNA was caused to be taken into cells by the solid-phase transfection of the present invention in Example 4.
  • Figure 3A schematically shows a method for producing a solid-phase transfection array (SPTA).
  • SPTA solid-phase transfection array
  • Figures 3B also shows the experiment in which spatially-spaced DNA was caused to be taken into cells by the solid-phase transfection of the present invention in Example 4.
  • Figure 3B shows the results of solid-phase transfection.
  • a HEK2 3 cell line was used to produce a SPTA. Green colored portions indicate transfected adherent cells . According to this result , the method of the present invention can be used to produce a group of cells separated spatially and transfected with different genes.
  • Figure 3C shows a difference between conventional liquid phase transfection and SPTA.
  • Figure 4A shows a difference between conventional liquid phase transfection and SPTA.
  • Figure 4A shows the results of experiments where 5 cell lines were measured with respect to GFP intensity/mm 2 . Transfection efficiency was determined as fluorescence intensity per unit area.
  • Figure 4B shows a difference between conventional liquid phase transfection and SPTA.
  • Figure 4B shows fluorescence images of cells expressing EGFP corresponding to the data presented in Figure A.
  • White circular regions were regions in which plasmid DNA was immobilized. In other regions , cells were also immobilized in solidphase, however, cells expressing EGFP were not observed.
  • the white bar indicates 500 ⁇ .
  • Figure 4C shows an exemplary transfection method of the present invention.
  • Figure 4D shows an exemplary transfection method of the present invention.
  • Figures 5A and 5B show the results of coating a chip, where by cross contamination was reduced.
  • Figures 5A and 5B show the results of liquid phase transfection and SPTA using HEK293 cells, HeLa cells, NIT3T3 cells (also referred to as "3T3"), HepG2 cells, and hMSCs . Transfection efficiency was represented by GFP intensity.
  • Figures 6A and 6B show cross contamination between each spot .
  • a nucleic acid mixture containing fibronectin having a predetermined concentration was immobilized to a chip coated with APS or PLL (poly-L-lysine) . Cell transfection was performed on the chip. Substantially no cross contamination was observed (upper and middle rows). In contrast, significant chip cross contamination of immobilized nucleic acids was observed on a uncoated chip (lower row) .
  • Figures 6C and 6D show a correlation relationship between the types of substances contained in a mixture used for immobilization of nucleic acid and the cell adhesion rate .
  • the graph of Figure 6D shows an increase in the proportion of adherent cells over time. A longer time is required for cell adhesion when the slope of the graph is mild than when the slope of the graph is steep.
  • Figure 6E shows the results of experiments in which various actin acting substances and HEK293 cells were used, where gelatinwas usedas acontrol.
  • Figure 6E shows an effect of each adhered substance (HEK cell) with respect to transfection efficiency.
  • the HEK cells were transfected with pEGFP-Nl using an Effectene reagent.
  • Figure 7 shows that under the conditions which generate low cross contamination with no APS coating or PLL coating, thetransfectionefficiencywas significantlylower than that in the case where APS coating or PLL coating -was performed.
  • Figure 8 shows the results of transfection using an RNAi transfection array of Example 5.
  • Each reporter gene was printed on a solid-phase substrate at a rate of 4 points per gene. The substrate was dried.
  • siRNA 28 types
  • siRNA for EGFP was used.
  • scramble RNA was used.
  • LipofectAMINE2000 was printed onto the same coordinates of each gene, followed by drying.
  • fibronectin solution was printed onto the same coordinates of each gene.
  • HeLa-K cells were plated on the substrate, followed by culture for 2 days. Thereafter, images were taken using a fluorescence image scanner.
  • Figures 9A through and 9E show the results of transfection using the RNAi transfection array of Example 5 for each cell.
  • the fluorescence intensity of each reporter was quantified by image analysis, and thereafter, compared with the intensity of each reporter gene to which scramble RNA (negative control) was printed, thereby calculating the ratio .
  • the results are shown for all reporters and all cells .
  • FIG 10 shows the results of transfection using an RNAi transfection array of Example 6.
  • Each reporter gene expression unit PCR fragment was printed on a solid-phase substrate at a rate of 4 points per gene. The substrate was dried.
  • siRNA . 28 types
  • siRNA for EGFP was used.
  • scramble RNA was used.
  • LipofectAMINE2000 was printed onto the same coordinates of each gene, followed by drying.
  • fibronectin solution was printed onto the same coordinates of each gene.
  • HeLa-K cells were plated oil the substrate, followedbyculture for 2 days. Thereafter, images were taken using a fluorescence image scanner.
  • Figures 11A through 11D show the results of transfection using the RNAi transfection array of Example 6 for each cell.
  • the fluorescence intensity of each reporter was quantified by image analysis, and thereafter, compared with the intensity of each reporter gene to which scramble RNA (negative control) was printed, thereby calculating the ratio .
  • the results are shown for all reporters and all cells .
  • Figure 12 shows a structure of a PCR fragment obtained in Example 7.
  • Figure 13 shows a structure of pEGFP-Nl.
  • Figure 14 shows the result of comparison of transfection efficiency of transfection microarrays using cyclic DNA and PCR fragments. DESCRIPTION OF SEQUENCE LISTING
  • SEQ ID NO. 1 primer 1 used in Example 7
  • SEQ ID NO. 2 primer 2 used in Example 7
  • SEQ IDNO. 3 aPCRfragment obtainedin aPCRreaction in Example 7
  • the term "positively charged substance” encompasses all substances having positive charges .
  • Such substances include cationic substances such as cationic polymers, cationic lipids and the like, but are not limited to these.
  • Such positively charged substances can form a complex.
  • Such positively charged substances which can form a complex include, for example, substances having a certain molecular weight (for example, cationic polymers) and substances which can remain insoluble, that is, without being dissolved to a certain extent in aspecific solvent suchaswater, anaqueous solution orthe like (forexample, cationic lipids ) , but arenot limited to these .
  • Preferable positively charged substances include, for example, polyethylene imine, poly-L-lysine, synthetic polypeptides, or derivatives thereof, but are not limited to these.
  • Positively charged substances include, for example, biological molecules such as histone and synthetic polypeptides ,. but are not limited to these.
  • the type of preferable positively charged substances changes in accordance with the type of negatively charged substances, which act as a complex partner to form complexes with the positively charged substances. It requires no specific creativity for those skilled in the art to select a preferable complex partner using technology well known in the art. For selecting a preferable complex partner, various parameters are considered including, but not limited to, charge, molecular weight, hydrophobicity, hydrophilicity, properties of substituents, pH, temperature, salt concentration, pressure, and other physical and chemical parameters .
  • cationic polymer refers to a polymer having a cationic functional group, and encompasses, for example, polyethylene imine, poly-L-lysine, synthetic polypeptides, and derivatives thereof, but is not limited to these.
  • cationic lipid refers to a lipid having a cationic functional group, and encompasses , for example, phosphatidyl choline, phosphatidyl ethanol amine, phosphatidyl serine, and derivatives thereof, but is not limited to these.
  • Cationic functional groups include, for example, primary amine, secondary amine, and tertiary amine, but are not limited to these.
  • negatively charged substance encompasses all substances having negative charges .
  • substances include biological molecular polymers, anionic substances such as anionic lipids, and the like, but are not limited to these.
  • negatively charged substances can form a complex.
  • Such negatively charged substances which can form a complex include, for example, substances having a certain molecular weight (for example, anionic polymers such as DNA) and substances which can remain insoluble, that is , without being dissolved to a certain extent in a specific solvent such aswater, anaqueous solutionor the like (forexample, anionic lipids) , but are not limitedto these.
  • Preferablenegatively charged substances include, for example, DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof. but are not limited to these.
  • Negatively charged substances include, for example, DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof, but, are not limited to these.
  • the type of preferable negatively charged substances changes in accordance with the type of positively charged substances , which act as a complex partner to form complexes with the negatively charged substances. It requires no specific creativity for those skilled in the art to select a preferable complex partner using technology well known in the art. For selecting a preferable complex partner, various parameters are considered as described above regarding the negatively charged substances .
  • anionic polymer encompasses polymers having an anionic functional group, and include, for example, DNA, RNA, PNA, polypeptides, chemical compounds , andcomplexes thereof, but is not limited to these.
  • anionic lipid encompasses lipids having an anionic functional group, and include, for example, phosphatidic acid, phosphatidyl serine, but is not limited to these.
  • Anionic functional groups include, for example, carboxylic groups and phosphoric acid groups , but are not limited to these.
  • the type of charge of a target substance can be converted by adding a part of a substituent or the like having apositive chargeoranegative charge to the target substance.
  • a preferable complex partner has the same type of charge as that of the target substance
  • formation of a complex can be promoted by converting the type of charge of either i:he complex partner or the target substance.
  • complex refers to two or more substances which directly or indirectly interact with each other and as a result , act as if they were one substance as a whole.
  • interaction used for two objects refers to that the two objects exert a force on each other.
  • Such interactions include, for example, covalent bond, hydrogen bond, van der Waals forces, ionic interaction, nonionic interaction, hydrophobic interaction, -and electrostatic interaction, but are not limited to these.
  • Preferable interactions include hydrogen bond : and hydrophobic interaction.
  • covalent bond is used as having the normal sense in the art, and refers to a chemical bond formed by an electron pair being sharedby'two atoms .
  • hydrogen bond is used as having the normal sense in the art , and is generated as follows : a single extranucleic electron of a hydrogen atom is attracted to an atom having high electric negativity to expose the hydrogen atomic nucleus , and the exposed hydrogen atomic nucleus attracts another atom having high electric negativity.
  • a covalent bond is generated between, for example, a hydrogen atom and an atom having high electric negativity (e.g., fluorine, oxygen, nitrogen).
  • complex partner used for a certain member forming a complex refers to anothermember interacting with the certain member directly or indirectly.
  • condition for forming a complexchanges in accordancewith the type of complexpartner can be easily understood by those skilled in the art .
  • Those skilled in the art can easily form a complex from any complex partners (for example, a positively charged substance and a negatively charged substance) using a technique well known in the art .
  • biological substance and “biological molecule” are interchangeably used, and refer to a substance or a molecule relating to an organism.
  • a biological molecule encompasses a molecule extracted from an organism, but not limited to this. Any molecule capable of affecting an organism falls within the definition of biological molecule. Therefore, a molecule synthesized by combinatorial chemistry is encompassed in the biological substance as long as an effect on an organism is intended.
  • the biological substance encompasses proteins , polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (e.g.
  • DNA such as cDNA and genomic DNA
  • RNA such as mRNA
  • polysaccharides oligosaccharides
  • lipids low molecular weight molecules (e.g. , lowmolecularweight organicmolecules)
  • complexes molecules thereof but is not limited to these.
  • a biological molecule may encompass a cell itself, a portion of tissue and other substances as long as the biological molecule is capable of forming a complex with a polymer molecule.
  • polymer molecule refers to a substance having a high molecular weight obtained by polymerizing polymers , and is usually a polymer having a molecular weight of 5,000 or. greater.
  • polypeptide refers to an amino acid or a polymer modified therefrom having any length.
  • the polymer may have a straight, branched or cyclic chain.
  • the amino acid may be naturally occurring, non-naturally occurring, or may be a variant. These terms may encompass assembled complexes of a plurality of polypeptide chains . These terms may also encompass naturally-occurring or artificially modified amino acid polymers . , Such modification includes , for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, and any other manipulation or modification (e.g., conjugation with a labeling moiety).
  • polypeptides containing one or two or more amino acid analogs e.g., non-naturally-occurring amino acids
  • peptide-like compounds e.g. , peptoids
  • polyn ⁇ cleotide As used herein, the terms “polyn ⁇ cleotide” , “oligonucleotide”, “nucleic acid” and “nucleic acid molecule” are used interchangeably, and refer to anucleotide or a polymer modified therefrom having any length. These terms also encompass “oligonucleotide derivatives” and
  • polynucleotide derivatives An "oligonucleotide derivative” or a “polynucleotide derivative” refer to an oligonucleotide or a polynucleotide having different linkages between nucleotides from typical linkages .
  • the terms “oligonucleotide derivative” and “polynucleotide derivative” are interchangeably used.
  • an oligonucleotide examples include 2 ' -O-methyl-ribonucleotide, an oligonucleotide derivative in which a phosphodiester bond in an oligonucleotide is converted to a phosphorothioate bond, anoligonucleotide derivative inwhichaphosphodiester bond in an oligonucleotide is converted to a N3'-P5' phosphoroamidate bond, an oligonucleotide derivative in which aribose andaphosphodiesterbond in an oligonucleotide are converted to a peptide-nucleic acid bond, an oligonucleotide derivative in which uracil .
  • an oligonucleotide derivative in which uracil in an oligonucleotide is substituted with C-5 thiazole uracil an oligonucleotide derivative in which cytosine in an oligonucleotide is substituted with C-5 propynyl cytosine
  • an oligonucleotide derivative in which cytosine in an oligonucleotide is substituted with phenoxazine-modified cytosine an oligonucleotide derivative in which ribose in DNA is substituted with 2 ' -O-propyl ribose
  • nucleic acid sequence also implicitly encompasses conservatively-modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequences explicitly indicated.
  • degenerate codon substitutions may be produced by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al.. Nucleic Acid Res. 19:5081 (1991) ; Ohtsuka et al. , J. Biol. Chem.260:2605-2608 (1985) ; Rossolini et al. , Mol. Cell. Probes 8:91-98(1994) ) .
  • salt is used in the normal sense in the art, and encompasses both inorganic salts and organic salts .
  • Salts are typically generated by neutralizing reactions between acids and bases.
  • Salts include NaCl, K 2 S0 4 , and the like, which are generated by neutralization, as well as PbS0 , ZnCl 2 , and the like, which are generated by reactions between metals and acids.
  • the latter salts may not be generated directly by neutralizing reactions, but can be regarded as a product of neutralizing reactions between acids and bases .
  • Salts may be classified, for example, into the following categories: normal salts ( saltswithout anyprotons orwithout anyOH groups; including, for example, NaCl, NH 4 C1, CH 3 COONa, and Na 2 C0 3 ) , acid salts (salts with remaining H of acids; including, for example, NaHC0 3 , KHS0 4 , and CaHP0 4 ) , and basic salts (salts with OH groups that do not dissociate in solution; including, for example, MgCl(OH) andCuCl(OH) ) .
  • This classification is not very important in the present invention.
  • salts constituting media e.g., calciumchloride , sodiumhydrogenphosphate, sodiumhydrogen carbonate, sodium pyruvate, HEPES, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids, vitamins
  • salts constituting buffers e.g., potassium chloride, magnesium chloride, sodium hydrogen phosphate, sodium chloride
  • These salts are preferable as they provide a higher effect of maintaining or improving the affinity for cells .
  • These salts may be used singlyorapluralityof these saltsmaybeusedin combination.
  • apluralityof these salts are used in combination, since in this way, the affinity for cells tends to be improved.
  • salts e.g. , calcium chloride, magnesium chloride, sodium hydrogen phosphate, and sodium chloride
  • glucose may be added to the medium.
  • support and “substrate” are used interchangeably and refer to an element formed of a material which can immobilize a substance such as a biological molecule or the like.
  • Material usable for a support include any solid material which has a capability of binding to a biological molecule as used in the present invention via covalent or noncovalent, bond, or which may be induced to have such a capability.
  • Suchmaterials used for a support include anymaterial capable of forming a solid surface; for example, glass, silica, silicon, ceramics, silicon dioxide, plastics, metals (including alloys), naturally-occurring and synthetic polymers (e.g. , polystyrene, cellulose, chitosan, dextran, and nylon) , but are not limited to these.
  • a support may be formed of layers made of a plurality of materials.
  • a support may be made of an inorganic insulating material, such as glass, quartz glass, alumina, sapphire, forsterite, siliconoxide, silicon carbide, siliconnitride, or the like.
  • a support may be made of an organic material, such as polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resin, polyacrylonitrile, polystyrene, acetal resins, polycarbonate, polyamide, phenol resin, urea resins, epoxy resin, melamine resin, styrene-acrylonitrile copolymer, acrylonitrile-butadiene-styrene copolymer, silicone resin, polyphenylene oxide, polysulfone, and the like.
  • organic material such as polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyviny
  • nitrocellulose film, nylon film, PVDF film, or the like which are used in blotting, may be used as amaterial for a support .
  • amaterial forming a support is in the solid-phase, such a support is herein particularly referred to as a "solid-phase support".
  • a solid-phase support may be herein in the form of a plate, a microwell plate, achip, aglass slide, afilm, beads, ametals (surface) , or the like.
  • the term "coating" used regarding a solid-phase support refers to an act of forming a film of a substance on a surface of the solid-phase support , and also refers to a film itself. Coating is performed for various purposes, such as, for example, improvement in the quality of a solid-phase support (e.g. , elongation of life, improvement in environmental resistance to hostile environment, such as resistance to acids, etc.), and improvement in affinity to a substance to be bound to the solid-phase support .
  • Various materials may be used for such coating, including, butnot limitedto, biological substances (e.g., DNA, RNA, proteins, lipids), polymers (e.g., poly-L-lysine, APS (e.g., ⁇ -aminopropyl silane) , MAS, hydrophobic fluorineresin) , silane, andmetals (e.g. , gold) , in addition to the above-described materials used for a solid-phase support .
  • biological substances e.g., DNA, RNA, proteins, lipids
  • polymers e.g., poly-L-lysine, APS (e.g., ⁇ -aminopropyl silane) , MAS, hydrophobic fluorineresin
  • silane e.g., gold
  • metals e.g., gold
  • such a coating may be advantageously made of poly-L-lysine, APS, MAS, hydrophobic fluorine resin, silane such as epoxy silane or mercaptosilane, or metal such as gold.
  • Such materials may be preferably substances suitable for cells or objects containing cells (e.g., organisms, and organs).
  • immobilization used for a solid-phase support refers to a state in which a substance as a subject of immobilization (e.g. , abiological molecule) is held on the support or at least a certain time period, or an act of placing the substance into such a state.
  • a substance as a subject of immobilization e.g. , abiological molecule
  • the substance may be released from the immobilization state.
  • cell affinity refers to a property of a substance that when the substance is placed in an interactable state with a cell (e.g. , germ cell, animal cell, yeast, plant cell) or an object containing a cell (e.g. , tissue, organs, biological organisms), the substance does not have any adverse influence on the cell or the object containing the cell.
  • substances having cell affinity may be substances to which a cell interacts with priority, but are not limited to these.
  • the substance to be immobilized e.g., positively charged substances and/or negatively charged substances
  • cell affinity is not absolutely necessary.
  • cell is used in the broadest sense as used in the art .
  • the term “cell” refers to any biogenic matter which is a structural unit of tissue of amulticellular organism, which is surroundedbyamembrane structure which isolates itself from the outside, has a self- replicating capability therein, and has genetic information and a mechanism for expressing the genetic information.
  • Cells used herein may be either naturally-occurring cells or artificially modified cells (e.g., fusion cells, genetically modified cells). Examples of cell sources include, but are not limited to, a single-cell culture; the embryo, blood, or body tissue of normally-grown transgenic animals; and a mixture of cells derived from normally-grown cell lines.
  • tissue refers to an aggregate of cells having substantially the same function and/or form in a multicellular organism.
  • tissue is typically an aggregate of cells of the same origin, but may be an aggregate of cells of different origins as long as the cells have the same function and/or form.
  • organ refers to a morphologically independent structure localized at a particular portion of an individual organism in which a certain function is performed.
  • an organ includes several tissues spatially, arranged in a particular manner, and each tissue includes a number of cells .
  • Examples of such an organ include organs relating to the vascular system.
  • organs targeted by the present invention include, but are not limitedto, skin, bloodvessel, cornea, kidney, heart, liver, umbilical cord, intestine, nerve, lung, placenta, pancreas, brain, peripheral limbs, and retina.
  • isolated means that substances which are naturally accompanying in normal circumstances are at least reduced, or preferably substantially completely eliminated. Therefore, the term “isolated cell” refers to a cell substantially free from other accompanying substances (e.g., other cells, proteins, nucleic acids) in natural circumstances. ⁇ When used for nucleic acids or polypeptides produced by recombinant DNA techniques, the term “isolated” means that the nucleic acids or the polypeptides are substantially free from cellular substances or culture media. When used for nucleic acids or chemically synthesized polypeptides, the term “isolated” means when the nucleic acids or the polypeptides are substantially free from precursory chemical substances or other chemical substances .
  • Cells or objects containing cells (e.g., organs, tissue) used in the present invention may be derived from any organism; for example, any unicellular organism such as prokaryote (e.g., E. coli) or eukaryote (e.g., yeast), or any multicellular organism (e.g., animals (e.g., vertebrates, invertebrates) , plants (e.g. , monocotyledons, dicotyledons) ) .
  • prokaryote e.g., E. coli
  • eukaryote e.g., yeast
  • multicellular organism e.g., animals (e.g., vertebrates, invertebrates) , plants (e.g. , monocotyledons, dicotyledons) ) .
  • Usable cells are preferably derived from, for example, vertebrates (e.g., Myxiniformes , Petronyzoniformes , Chondrichthyes , Osteichthyes, amphibian, reptilian, avian, mammalian), and more preferably from mammalian (e.g., monotremata, marsupialia, edentate, dermoptera, chiroptera, carnivore, insectivore, proboscidea, perissodactyla, artiodactyla, tubulidentata, pholidota, sirenia, cetacean, primates, rodentia, lagomorpha) .
  • vertebrates e.g., Myxiniformes , Petronyzoniformes , Chondrichthyes , Osteichthyes, amphibian, reptilian, avian, mammalian
  • mammalian e.g.
  • usable cells are derived from primates (e.g., cynomolgus, chimpanzee, Japanese monkey, human) . Cells derived from a human may be used.
  • stain-release means that when a substance is immersed in a solvent for" dissolving the substance, the substance is gradually dissolved while maintaining the solid-phase or a certain time period.
  • the substance is usually kept immobilized after being immersed in a solvent for about 5 minutes , preferably for at least about 10 minutes , more preferably for at least about 15 minutes, arid still more -preferably for at least about 30 minutes .
  • the substance When a substance is used as a pharmaceutical agent, it is advantageous that the substance kept immobilized for at least about 30 minutes, preferably for at least about 1 hour, more preferably for at least about 3 hours , and still more preferably for at least about 6 to 12 hours .
  • the substance is usually kept immobilized for about 15 minutes.
  • biological activity refers to activity possessed by an agent (e.g., polypeptide or protein) within an organism, and encompass activities exhibiting various functions.
  • agent e.g., polypeptide or protein
  • the biological activity thereof includes enzyme activity.
  • agent e.g., a ligand
  • the biological activity thereof includes the binding of the ligandto areceptor corresponding thereto.
  • Suchbiological activities can be measured by techniques well-known in the art in accordance with the activity which is a subject of measurement .
  • condition which does not destroy a biological molecule refers to a condition under which at least one biological activity exhibited by biological molecule (e.g. , gene expression activity, yeast activity) is not destroyed.
  • biological molecule e.g. , gene expression activity, yeast activity
  • Those srkilled in the art can appropriately set such a condition in accordance with the biologicalmoleculeinconsideration ofvarious factors (e.g. , temperature, pH, pressure, chemical conditions) .
  • the condition which does not destroy a biological molecule is not known, the condition can be pre-determined by exposing the biological molecule to necessary test conditions then and checking if the intended biological activity is maintained or not. Accordingly, those skilled in the art appreciate that the condition which does not destroy a biological molecule may be any condition as long as the intended biological activity is maintained for carrying out the present invention.
  • reaction or “removal” of a solvent (e.g., water, an organic solvent such as hexane or the like) is achieved by placing a mixture or a composition containing the solvent under a certain condition, so that the ratio of the solvent in the mixture or the composition is reduced or eliminated.
  • a solvent e.g., water, an organic solvent such as hexane or the like
  • the term "pharmaceutically acceptable” used for a substance refers to a property of the substance by which the substance can be administered as a pharmaceutical agent .
  • the term "pharmaceutically acceptable substance” encompasses, but is not limited to, antioxidants , preservatives, colorants, flavoring agents , diluents, emulsifiers, suspending agents , solvents, fillers, bulking agents, buffers, delivery vehicles, excipients, and/or pharmaceutical adjuvants.
  • a target compound compound having biological activity or activity as an effective ingredient of a pharmaceutical agent
  • a variant or a derivative thereof is provided in the form of a composition containing the compound, the variant or the derivative together with one or more physiologically acceptable carrier, excipient, or diluent.
  • the pharmaceutically acceptable substances used in the present invention are non-toxic to a recipient thereof and preferably are inactive in the dose and concentration used.
  • the pharmaceutically acceptable substances used in the present invention include, but are not limited to, organic acid salts such as acetate, citrate, and the like; ascorbic acid; ⁇ -tocopherol; low molecular weight polypeptides; proteins (e.g., serum albumin, gelatin or immunoglobulin); hydrophilic polymers (e.g., polyvinyl pyrrolidone) ; amino acids (e.g., glycin, glutamine, asparagine, arginine, lysin) ; monosaccharide, disaccharide and other carbohydrates (including glucose, mannose, dextrin); chelating materials (e.g., EDTA); sugar alcohols (e.g., mannitol, sorbitol); salt forming counterions (e.g., sodium) ; and/ornonionic surfactants
  • the term "chip” refers to a super-compact integrated circuit having various functions and acting as a part of the system.
  • the chip may be referred to as a "DNA chip” or “protein chip” in accordance with the substance which is to be mounted on the chip.
  • the term "array” refers to a pattern of the substance immobilized on a substrate or a film or a patterned substrate itself.
  • An array which is patterned on a small substrate e.g., 10 x 10 mm
  • a microarray e.g., the term “array” and “microarray” are used interchangeably. Accordingly, an array patterned on a larger substrate may be referred to as a “microarray” .
  • An array is formed of a set of desired polynucleotides immobilizedon asolid-phase surfaceorfilm.
  • Anarray has preferablyat least 10 2 different polynucleotides, more preferablyat least 10 3 different polynucleotides , still more preferably at least 10 4 different polynucleotides, and stillmore preferably at least 10 5 different polynucleotides .
  • These polynucleotides are arranged on a regulated format to have a size of, for example, 125 x 80 mm or 10 x 10 mm.
  • address refers to a unique position on a substrate, which can be distinguished from other unique positions.
  • An address is appropriately associated with a microparticle bearing the address. Addresses can have any distinguishable shape such that substances at each address can be distinguished from substances at other addresses (e.g., optically).
  • a shape defining an address maybe, for example, without limitation, a circle, an ellipse, a square, a rectangle, or an irregular shape.
  • each address particularly depends on the size of the substrate, the numberof addresses on the substrate, the amount of the analytes and/or available reagents, the size of microparticles , and the level of resolution required for an arbitrary method used for the array.
  • the size of each address may be, for example, in the range of from 1 to 2 nm to several centimeters, although the address may have any size, suited to an array.
  • the spatial arrangement and shape which define an address are designed so that the microarray is suited to aparticular application. Addresses maybe densely arranged or sparselydistributed, or subgrouped into a desiredpattern appropriate for a particular type of material to be analyzed.
  • Microarrays also referred to as "DNA arrays” when DNA is placed on the substrate
  • DNA arrays are widely reviewed in, for example, in Saibo-Kogaku [ “Cell Engineering” ] , special issue, “DNA Microarray and Up-to-date PCR Method” , edited by Shujun-sha.
  • One exemplary labeling method for synthetic DNA microarrays is a two-fluorescence method. This method is performed as follows . Two different mRNA samples are tagged with different fluorescence-emitting labels, and competitivehybridizationis performedonthe samemicroarray to measure the fluorescence signals of the mRNA samples. By comparing the measured fluorescence signals , difference in gene expression is detected.
  • a fluorescent label for example, Cy5 and Cy3 are most often used, but the usable fluorescent labels are not limited to these.
  • An advantage of Cy5 and Cy3 is that the fluorescence wavelengths do not substantially overlap.
  • the two-fluorescence method is usable to detect mutation or polymorphism as well as difference in gene expression.
  • a fluorescence signal resulting from hybridization performed on the DNA microarray is detected by a fluorescence detector or the like .
  • fluorescence detectors are available currently.
  • the group of Stanford University developed their original scanner, which is a combination of a fluorescence microscope and a movable stage (see, http://cmgm.stanford.edu/pbrown).
  • FMBI0 Hitachi Software Engineering, Co. , Ltd.
  • Storm MolecularDynamics
  • the like which is a fluorescent image analyzer for gel, can read the DNA microarray unless the spot of DNA samples does not have a very high density.
  • Scanarray 4000 and Scanarray 5000 GeneralScanning; confocal type
  • GMS418 Array Scanner Tekara Bio Inc.; confocal type
  • Gene Tip Scanner Neippon Laser & Electronics Lab. ; non-confocal type
  • Gene Tac 2000 Gene Tac 2000 (Genomic Solutions; CCD camera type).
  • a biological molecule which is to be placed on a solid-phase support may be prepared by a molecular biological technique using an organism derived substance (e.g., mRNA) or chemically synthesized by a method known in the art.
  • synthes s methods usinganautomatic solid-phase peptide synthesizer are described in the following: Stewart, J. M. etal. (1984) Solid Phase Peptide Synthesis, Pierce Chemical Co . ; Grant, G. A. (1992) Synthetic Peptides: AUser's Guide, W. H. Freeman; Bodanszky, M.
  • Oligonucleotides can be prepared by automatic chemical synthesis using any of the DNA synthesizers commercially available fromApplied Biosystems or the like.
  • compositions and methods for automatic oligonucleotide synthesis are disclosed by, for example, USP 4 , 415 , 732 issued to Caruthers et al. (1983); USP 4,500,707 issued to Caruthers (1985); USP 4,668,777 issued to Caruthers et al. (1987). Those skilled in the art can use these methods to prepare the biological molecules used in the present invention.
  • a composition for immobilizing a substance such as a biological molecule on a solid-state support includes a complex of a substance to be immobilized and a substance having an opposite charge to the substance to be immobilized, and a salt (e.g., salts contained in the medium). It was found that by an unexpected effect provided by mixing the complex and the salt, the substance to be immobilized can be simply immobilized on the solid-phase support. Such immobilization provides the effect of, for example, (i) the substance, after immobilized, is sustain-released, and (ii) the substance, after immobilized, maintains or improves its cell affinity.
  • the composition according to the present invention contains (a) a complex of a positively charged substance and anegatively charged substance; and (b) asalt.
  • the substance to be immobilized may be either the positively charged substance or the negatively charged substance, or both of the substances .
  • At least one of the positively charged substance or the negatively charged substance has cell affinity. Whether a substance has cell affinity or not can be determined by evaluating whether or not a cell which is combined with the substance survives longer than when the substance is absent. Such survival of the cell can be specifically determined by measuring various parameters of cells.
  • a substance having cell affinity allows the cell to survive longer.
  • both the positively charged substance and the negatively charged substance have cell affinity. In such a case, it is preferable that the cell affinity is not lost even when both the substances form a complex, but the present invention is not limited to this .
  • At least one of the positively charged substance and the negatively charged substance may be a biological molecule.
  • the biological molecule may or may not be a subject of immobilization.
  • Examples of the biological molecule usable in one preferred embodiment of the present invention include, but are not limited to, DNA (e.g. , genomic DNA, cDNA) , RNA (e.g. , mRNA) , peptides, lipids, sugars, lowmolecularweight organic molecules (e.g., members of combinatorial chemistry libraries), and complexes thereof (e.g., glycoproteins , glycolipids, nucleic acid peptides , lipoproteins) .
  • the biological molecule to be immobilized may be a gene encoding molecule such as DNA.
  • DNA is treated for gene introduction such as transfection
  • use of the immobilization method provided by the present invention allows the DNA to be sustain-released continuously for a time period required for completion of the treatment (for about 15 minutes to about 30 minutes) .
  • the present invention provides the effect of improving the efficiency of molecule introduction.
  • Such an e fect of sustain-release was not previously achieved by any conventional method or was not sufficient . This is one significant effect provided by the present invention.
  • the composition of the present invention maintains or improves its cell affinity after being immobilized. It was found that especially gene introduction such as transfection can be performed more efficiently and without damaging cells as compared to the conventional immobilization methods.
  • the negatively charged substance to be immobilized may be a 'biological molecule such as DNA, RNA, PNA, a peptide, or a complex thereof, or may be an anionic polymer or an anionic lipid, which is not a biological molecule.
  • the positively charged substance to be immobilized may be or may not be a biological molecule.
  • the positively charged substance to be immobilized may be, for example, a cationic polymer, a synthetic peptide such as a cationic lipid poly-L-lysine, or a derivative thereof.
  • the positively charged substance may be, for example, a transfection reagent , such as polyimine polymer, poly-L-lysine, synthetic polypeptide, or a derivative thereof, but is not limited to these.
  • usable salts include salts having cell affinity (e.g. , salts used in media, salts used in the buffer solutions) , but are not limited to these.
  • cell affinity e.g. , salts used in media, salts used in the buffer solutions
  • transfection it is advantageous to combine all the salts contained in the media or the buffer solutions. Such a combination is usually preferable to cells .
  • Examples of the media include, but are not limited to, Dulbecco's MEM, HAM 12 medium, cc MEM medium, and RPM1640 (e.g., commercially available from Nichirei Corporation) .
  • Salts contained in such media include, but are not limited to, calcium chloride, potassium chloride, potassium phosphate, dipotassiumphosphate, magnesium chloride, sodium chloride, sodium phosphate, and disodium phosphate.
  • the concentration of such salts may be appropriately adjusted by those skilled in the art, and is preferably substantially equal to the osmotic pressure of the cell.
  • the biological molecule to be immobilized is advantageously introduced to a cell and exhibits biological activity (e.g. , efficacy, enzyme activity, signal transmission, gene expression) .
  • biological activity e.g. , efficacy, enzyme activity, signal transmission, gene expression
  • the biological molecule maybe DNA containing a sequence encoding the gene.
  • signal transmission the biological molecule maybe a signal transmission stimulation agent (e.g., cytokine, specific ligand).
  • the biological molecule maybe a chemical substance having efficacy. Examples of the chemical substance having efficacyinclude, but arenot limitedto, drugs forthe central
  • •nervous system drugs for the peripheral nervous system, drugs for the sense organs , drugs for the circulatory system, drugs for the respiratory system, drugs for the digestive system, hormone drugs , drugs for the urinary system and drugs for the anus, drugs for the perithelium, drugs for the oral cavity, drugs for other individual organs, vitamin agents, nourishing agents, drugs for the blood and bodily fluids, drugs for dialysis, other metabolic pharmaceutical drugs (e.g.,- drugs for diseases of organs, detoxicating drugs, drugs for habitual addiction, antarthritics, enzymatic formulations , drugs for diabetes , metabolic drugs which cannotbeotherwise classified) , cellenergizingdrugs, drugs for tumors, radioactive pharmaceutical drugs, drugs for allergies, antibiotics, chemotherapeutic drugs, biological drugs , pharmaceutics , diagnostic drugs , extracorporeal diagnostic drugs, drugs which are not otherwise classified and are not mainly intended for treatment , and narcotics .
  • metabolic pharmaceutical drugs e.g.,- drugs for diseases of organs
  • a device having a target substance immobilized therein is provided.
  • a complex of a target substance e.g. , a biological molecule such as DNA
  • a substance having an opposite charge to the target substance e.g., DNA
  • a salt e.g., salts contained in a medium
  • the device according to the present invention provides the effect of, for example, (i) the substance, after immobilization, is sustain-released, and/or (ii) the substance, after immobilization, maintains or improves its cell affinity.
  • the device of the present invention is provided in the form of a microtiter plate or an array (or a chip) used for an assay using an organism such as a cell or a part thereof, and is useful for an assay in which it is desired to sustain-release the substance to be immobilized (e.g., active component, DNA encoding gene expression) and/or to maintain cell affinity.
  • the device according to the present invention may be used as a pharmaceutical drug delivery medium.
  • the substances forming the complex, the salt , and the solid-phase support are desired to be biologically compatible and pre erablyto bepharmaceuticallyacceptable .
  • the device according to the present invention includes (a) a complex of a positively charged substance and a negatively charged substance; (b) a salt; and (c) a solid-phase support having the complex and the salt immobilized thereon.
  • the target substance may be a positively charged substance or a negatively charged substance.
  • the complex formed may itself be the target substance.
  • At least one of the positively charged substance and the negatively charged.substance has cell affinity.
  • the substance having cell affinity can improve the life of the cell, but the present invention is not limited to this.
  • both the positively charged substance and the negatively charged substance have cell affinity. In such a case, it is preferable that the cell affinity is not lost even when both the substances form a complex, but the present invention is not limited to this.
  • biological molecules usable in one preferred embodiment of the device according to the present invention include, but are not limited to, DNA (e.g. , genomic DNA, cDNA, members of genomic DNA/cDNA libraries ) , RNA (e.g. , mRNA or RNAi), peptides (e.g., members of proteomics libraries), lipids, sugars, low molecular weight organic molecules (e.g., members of combinatorial chemistry libraries) , complexes thereof (e.g. , glycoproteins , glycolipids , nucleic acid peptide composites , lipoproteins ) , and drugs.
  • DNA e.g. , genomic DNA, cDNA, members of genomic DNA/cDNA libraries
  • RNA e.g. , mRNA or RNAi
  • peptides e.g., members of proteomics libraries
  • lipids lipids
  • sugars e.g., low molecular weight organic molecules (e.g., members of combinatorial
  • the positively charged substance and/or negatively charged substance and/or salt may be substances listed in the preferable examples of the composition of the present invention, but are not limited to these .
  • Such substances and/or salts may be appropriately changed in accordance with the type or the properties of the target substance.
  • such substances and/or salts can be appropriately selected by those skilled in the art in accordance with the type or the solid-phase support.
  • those which are known as having an suitable property (e.g. , cell affinity) to the already selected type of solid-phase support may be selected, or the suitability may be confirmed before the preparation of the device by a preparatory test.
  • the solid-phase support used in the device of the present invention contains amaterial selected from the group consisting of glass, silica, silicon, ceramics, silicon dioxide, plastics, metals, naturally-occurring polymers, and synthetic polymers, but the material is not limited to these.
  • the solid-phase support may be treated by coating.
  • the coating can be performed with a coating material which is typically intended to be used for
  • a solid-phase support such as poly-L-lysine, silane, APS,
  • coating materials used in cell culture e.g., poly-L-lysine, silane, APS, MAS, hydrophobic fluoroplastics, metals
  • coating materials used in cell culture e.g., poly-L-lysine, silane, APS, MAS, hydrophobic fluoroplastics, metals
  • the solid-phase support may be a chip.
  • the complex is preferably arrangedin an array.
  • the device of thepresent invention is also referred to as an "array".
  • the biological molecule has biological activity after being introduced into a cell.
  • the biological activities include, but are not limited to, efficacy, gene expression, enzyme activity, and signal transmission.
  • the biological molecule may be DNA containing a sequence encoding the gene.
  • the biological molecule may be a signal transmission stimulation agent (e.g., cytokines, specific ligands).
  • cytokines cytokines
  • specific ligands e.g., IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, anti-like agents, anti-like agents, anti-like agents, anti-like agents, anti-like agents.
  • efficacy the biological molecule may be a chemical substance having efficacy. Compounds having efficacy can be selected from various compounds as described in other sections of this specification.
  • a solid-phase support it is preferable to select negatively charged DNA as the substance to be. immobilized and select positively charged DNA, such as a polyimine polymer or the like as the complex partner.
  • usable salts include salts having cell affinity (e.g., salts used in the medium, salts used in the buffer solution), but are not limited to these.
  • Materials of the solid-phase support used in one preferred embodiment of the invention include, but are not limited to, glass slides (poly-L-lysine, silane, APS, MAS, hydrophobic fluorine resin, preferably coated with poly-L-lysine or the like) and polystyrene resin.
  • the biological molecule to be immobilized may be a gene encoding molecule such as DNA.
  • the immobilization method provided by the present invention has achieved the effect of allowing the DNA to be continuously sustain-released for a time period required for completion of the treatment (for about 15 minutes to about 30 minutes) .
  • the present invention provides the effect of improving the efficiency of molecule introduction .
  • Such an effect of sustain-release was not previously achieved by any conventional method or was not sufficient . This is one significant effect provided by the present invention. It was found that especially gene introduction such as transfection can be performed more efficiently and without damaging cells as compared to by the conventional immobilization methods .
  • the complex, the solid-phase support and the salt are preferably pharmaceutically acceptable.
  • a method for immobilizing a substance on a solid-phase support is provided.
  • a complex of a substance to be immobilized and a substance having an opposite charge to the substance to be immobilized, and a salt are provided. It was found that owing to the unexpected effect provided by mixing the complex and the salt, the substance to be immobilized can be immobilized to a solid-phase support simply and without any need to select any special immobilization condition.
  • the immobilization method of the present invention provides the effects that (i) the substance immobilized on a solid-phase support is sustain-released and/or (ii) the immobilized substance maintains or improves its cell affinity.
  • the immobilization method according to the present invention includes the steps of (a) providing the solid-phase support; (b) providing a complex of a positively charged substance and a negatively charged substance; (c) providing a mixture of a salt and the complex; and (d) causing the mixture of the salt and the complex to adhere to the solid-phase support .
  • the target substance may be a positively charged substance or a negatively charged substance, or both of the substances .
  • the complex formed may itself be the target substance.
  • Theprovisionof the solid-phase support , the complex or the salt is within the scope of the technological common knowledge of those skilled in the art, and can be performed by those skilled in the art using techniques well known in the art without any undue experimentation.
  • commercially available solid-phase supports e.g., glass slides, microtiter plates
  • the salts and complex partners for the target substance commercially available substances may be used.
  • such a solid-phase support, salt or complex partner for the target substance may be chemically or biochemically synthesized or processed.
  • the salt and the complex may be mixed in any method by which the interaction of the salt and the complex can be exhibited.
  • the immobilization method according to the present invention is usable for preparing an assay device or a pharmaceutical drug delivery device. The usefulness of the immobilization method according to the present invention is broad.
  • the step of causing the mixture of the salt and the complex to adhere to the solid-phase support may be performed using any technique.
  • This step may be performed manually (e.g. , pipetting) orautomatically (e. g. , usingaprintingtechnique of an ink jet printer or the like) .
  • the mixture can be caused to adhere using a print pin of an ink jet printer.
  • At least one of the positively charged substance and the negatively charged substance has cell affinity.
  • the substance having cell affinity can improve the life of the cell, but the present invention is not limited to this. More preferably, both the positively charged substance and the negatively charged substance have cell affinity. In such a case, it is preferable that the cell affinity is not lost even when both the substances form a complex, but the present invention is not limited to this .
  • Examples of thebiologicalmoleculewhichis intended to be immobilized by one preferred embodiment of the method according to the present invention include, but are not limited to, DNA (e.g. , genomic DNA, cDNA, members of genomic DNA/cDNA libraries ) , RNA (e.g. , mRNA or RNAi) , peptides (e.g. , members of proteomics libraries) , lipids , sugars , low molecular weight organic molecules (e.g., members of combinatorial chemistry libraries ) , complexes thereof (e.g. , glycoproteins , glycolipids, nucleic acid peptides, lipoproteins ) , and drugs .
  • DNA e.g. , genomic DNA, cDNA, members of genomic DNA/cDNA libraries
  • RNA e.g. , mRNA or RNAi
  • peptides e.g. , members of proteomics libraries
  • lipids e.g., sugars
  • sugars e
  • the positively charged substance and/or negatively charged substance and/or salt may be substances listed in the preferable examples of the composition of the present invention, but are not limited to these.
  • Such substances and/or salts may be appropriately changed in accordance with the type or the properties of the target substance.
  • such substances and/or salts can be appropriately selected by those skilled in the art in accordance with the type or the solid-phase support.
  • those which are known as having a suitable property (e.g., cell affinity) to the already selected type of solid-phase support may be selected, or the suitability may be confirmed before the preparation of the device by a preparatory test .
  • the solid-phase support used in the method of the present invention contains amaterial selected from the group consisting of glass, silica, silicon, ceramics, silicon dioxide, plastics, metals, naturally-occurring polymers, and synthetic polymers , but the material is not limited to these .
  • a solid-phase support may be newly prepared or recycled for the method of the present invention.
  • the solid-phase support is coated. Coating is especially advantageous for recycling.
  • the solid-phase support may be treated by coating.
  • the method may include the step of coating the solid-phase support.
  • Materials used for coating include, but are not limited to, poly-L-lysine, silane, APS, MAS, ' hydrophobic fluoroplastics, metals or mixtures thereof. Any material which is usually intended to be used for a solid-phase support is usable.
  • the solid-phase support may be a chip.
  • the method of the present invention is applicable to producing a compact and integrated device such as a chip.
  • the usefulness of the method of the present invention is broad.
  • the substance to be immobilized on the chip is preferably arranged in an array.
  • the device of- the present invention is also referred tp as an "array".
  • the method of the present invention is applicable to producing a biological molecule array or a biological molecule chip .
  • the chip or array produced by such a method is especially advantageous when used for a chip or array which requires sustain-releasability and/or cell affinity.
  • the method of the present invention is especially useful for an array requiring a high integration degree and requiring simple immobilization and fine spotting.
  • the biological molecule has biological activity after introduction into a cell.
  • the biological activities include, but are not limited to, efficacy, gene expression, enzyme activity, and signal transmission.
  • the biological molecule may be DNA containing a sequence encoding the gene.
  • the biological molecule may be a signal transmission stimulation agent (e.g., cytokines, specific ligands).
  • the biologipal molecule may be a chemical substance having efficacy. Compounds having efficacy can be selected from various compounds as described in other sections of this specification.
  • the above-described steps may be performed after the immobilization of the present invention is achieved.
  • the above-described steps may be performed in a certain period after the immobilization.
  • it is preferable to perform a treatment such that sustain-releasing is not started e.g. , to immerse the substance in a conservation solution which is different from the solution used for sustain-releasing; or to dry the substance) after the substance is immobilized by the method of the present invention.
  • a solid-phase support it is preferable to select negatively charged DNA as the substance to be immobilized and select positively charged DNA, such as polyimine polymer or the like as the complex partner.
  • usable salts include salts having cell affinity (e.g., salts used in the medium, salts used in the buffer solution), but are not limited to these.
  • Materials of the solid-phase support used in one preferred embodiment of the invention include, but are not limited to, glass slides (poly-L-lysine, silane, APS, MAS, hydrophobic fluorine resin, preferably coated with poly-L-lysine or the like) and polystyrene resin.
  • Solid-phase supports coated with poly-L-lysine, silane, APS, MAS, hydrophobic fluorine resin or the like are preferable, since such supports are known as providing a preferable effect on cell affinity and transfection efficiency.
  • the method of the present invention preferably includes the step of coating.
  • the biological molecule to be immobilized may be a gene encoding molecule such as DNA.
  • DNA is treatedfor gene introduction such as transfection
  • use of the immobilization method provided by the present invention allows the DNA to be sustain-released continuously for a time period required for completion of the treatment (for about 15 minutes to about 30 minutes) .
  • the present invention provides the effect of improving the efficiency of molecule introduction .
  • Such an effect of sustain-release was not previously achieved by any conventional method or was not sufficient.
  • Themethodof thepresent invention allows the substance tomaintain or improve its ceil affinity. Therefore, the method of the present invention provides an advantageous effect as compared to by the conventionalmethod in a state in which such an effect is expected (e.g., gene introduction such as transfection) .
  • the method of the present invention is used for preparing a pharmaceutical drug, at least one of , preferably all of, the substance, salt and solid-phase support used are pharmaceutically acceptable.
  • the step of providing the complex is performed under a condition in which the biological molecule is not destroyed.
  • a condition in which the biological molecule is not destroyed can be appropriately and easily selected by those skilled in the art, in consideration of type of the complex partner and other conditions (e.g., pH, temperature) for complex formation, or by performing appropriate preliminary tests.
  • selection of condition or performance of tests is within the scope of the technological common knowledge of those skilled in the art, and those skilled in the art can perform selection or tests without undue experimentation.
  • the step of providing a mixture of the salt and the complex is performed under a condition in which the biological molecule is not destroyed.
  • a condition in which the biological molecule is not destroyed can be appropriately and easily selected by those skilled in the art, in consideration of type of the complex partner and other conditions (e.g. , pH, temperature) for complex formation, or by performing appropriate preliminary tests .
  • selection of condition or performance of tests is within the scope of the technological common knowledge of those skilled in the art, and those skilled in the art can perform selection or tests "without undue experimentation.
  • the method advantageously further includes the step of reducing an amount of, or removing, a solvent in the mixture after the mixture is caused to adhere to the solid-phase support.
  • reduction the amount of, or removal of, the solvent may be performed by natural drying, liophylization, or drying using a drying agent, but the present invention is not limited to these.
  • compositions , devices and methods of the present invention are usable for humans, but may be used for other hosts (e.g. , mammals) . Accordingly, the composition of the present invention may be usable as an agricultural chemical.
  • Example 1 Preparation of compositions to be immobilized
  • DNA was selected as a target substance, and compositions for immobilizing the DNA to a solid-phase support was prepared.
  • Plasmid DNAs were amplified using E. coli (XLl-blue, Stratgene, TX, USA), and the amplified plasmid DNAs were used as one complex partner. DNA was dissolved in DNase and RNase free distilled water.
  • transfection reagents were used as the other complex partner.
  • the transfection reagents used were as follows: Effectene Transfection Reagent (cat. no. 301425, Qiagen, CA, USA), TransFastTM Transfection Reagent (E2431, Promega, WI, USA), TfxTM-20 Reagent (E2391, Promega, WI , USA), SuperFect Transfection Reagent (301305, Qiagen,CA, USA), PolyFect Transfection Reagent (301105, Qiagen, CA, USA), LipofectAMINE 2000 Reagent (11668-019, Invitrogen Corporation, CA, USA), JetPEI (x4 )conc . (101-30, Polyplus-transfection, France), and ExGen 500 (R0511, Fermentas Inc., MD, USA).
  • DNA plasmids and transfection reagents were dissolved in DNase and RNAse free distilled water, NaCl solution (0.9%), PBS buffer solution (Sigma), and Dulbecco ' s MEM Medium (supplied with glucose (4.5 g/L), L-glutamine and sodium pyruvate (Nacalai Tesque Inc. , Kyoto, Japan) and supplemented with 10% calf serum albumin (Dainippon Pharmaceutical Co., Ltd., Osaka, Japan)).
  • the immobilized biological molecules were immersed in PBS, and the states of immobilization were confirmed.
  • the confirmation was performed immediately after the immersion in PBS (0 minute later), in 5 minutes, in 10 minutes, in 15 minutes, in 20 minutes, in 25 minutes, in 30 minutes, in 40 minutes, in 50 minutes and in 60 minutes after the immersion, by visual observation and DNA, quantification.
  • compositions prepared using the mixtures of the complexes and the salts according to the present invention NaCl solution, PBS buffer solution, Dulbecco ' s MEMMedium
  • the immobilization was not destroyed even 15 minutes later.
  • the compositions prepared using distilled water the immobilizationwas destroyed immediatelyafter the immersion in PBS and DNA flowed out .
  • the present invention provides a remarkable effect of immobilizing a substance.
  • the immobilization was destroyed in a relatively short time period when a single salt (NaCl) was used.
  • human mesenchyme-system stem cells hMSCs, PT-2, Cambrex BioScience Walkersville, Inc., MD, USA
  • human embryonal renal cells HEK293, RCB1637, RIKEN Cell Bank, Japan
  • NIH3T3-3 cells RCB0150, RIKEN Cell Bank, Japan
  • HeLa cells RCB0007, RIKEN Cell Bank, Japan
  • HepG2 RIKEN Cell Bank, Japan
  • Example 1 The plates having DNA immobilized thereon obtained in Example 1 were placed on dishes , and mediums containing the above-mentioned cells were each dropped thereupon. Then, the dishes accommodating the plates were transferred into an incubator, and the plates were incubated at 37°C for 2 or 3 days in a 5% C0 2 atmosphere to cause transfection.
  • the state of gene expression was determined by observing fluorescence signals emitted by each of expression products (EEP, EGEP and DsRed2). For observing the fluorescence signals, a fluorescence microscope (IX-71, Olympus Promarketing Inc. , Japan) was used. The cells were immobilized with paraformaldehyde (PFA) (treated with 4% PFA at room temperature for 10 minutes) after reaction and observed in this state. (Results )
  • Figure 1 shows a part of the results of transfection.
  • the upper photos show the results of transfection obtained with non-complexed DNA (upper photos)
  • the lower photos show the results of transfection obtained with DNA complexed with a positively charged substance (treated with NP10).
  • These photos show the state of transfection, immediately after the complex was placed on the solid-phase support (in 0 minutes) , and in 1 minute, in 5 minutes and in 10 minutes after the complex was placed on the solid-phase support.
  • Jet-PEI polyethylene imine
  • DMEM Dulbecco
  • the ratio of DNA, Jet-PEI, and the medium was as follows.
  • DNA amount (1 ⁇ g/ ⁇ l) 1.0 ⁇ l 1.5 ⁇ l 2.0 ⁇ l
  • Figure 2 shows the results of immobilization. More specifically.
  • Figure 2 is a graph illustrating the progress of sustain-release obtained with NP3, NP5 and NP10.
  • humanmesenchymal stem cells hMSCs, PT-2501, Cambrex BioScience Walkersville, Inc. , MD
  • human embryonic kidney cell HEK293 RB1637, RIKEN Cell Bank, JPN
  • NIH3T3-3 RB0150, RIKEN Cell Bank, JPN
  • HeLa RB0007, RIKEN Cell Bank, JPN
  • HepG2 RB1648, RIKEN Cell Bank, JPN.
  • human MSCs cells were maintained in commercially available Human Mesenchymal Cell Basal Medium (MSCGM BulletKit PT-3001, Cambrex BioScience Walkersville, Inc., MD) .
  • HEK293, NIH3T3-3, HeLa and HepG2 cells were maintained in Dulbecco ' s Modified Eagle ' s Medium (DMEM, high glucose (4.5 g/L) with L-Glutamine and sodium pyruvate; 14246-25, Nakalai Tesque, JPN) with 10% fetal bovine serum (FBS, 29-167-54, Lot No. 2025F, Dainippon Pharmaceutical CO., LTD., JPN). All the cells were cultivated in an incubator controlled to be at 37°C in a 5% C0 2 atmosphere. In experiments involving hMSCs, the present inventors used hMSCs of that had been passaged less than five times, in order to avoid phenotypic changes .
  • DMEM Dulbecco ' s Modified Eagle ' s Medium
  • FBS fetal bovine serum
  • pEGFP-Nl and pDsRed2-Nl vectors were used. The expression of both genes was under the control of cytomegalovirus (CMV) promoter. Transfected cells continuously expressed EGFP or DsRed2, respectively. Plasmid DNAs were amplified using Escherichia coli, XLl-blue strain (200249, Stratagene, TX) , and purified by EndoFree Plasmid Kit (EndoFree Plasmid Maxi Kit 12362, QIAGEN, CA) . In all the cases, plasmid DNA was dissolved in DNase and RNase free water.
  • the following transfection reagents were used: Effectene Transfection Reagent (cat. no.301425, Qiagen, CA) , TransFastTM Transfection Reagent (E2431, Promega, WI), TfxTM-20 Reagent (E2391, Promega, WI) , SuperFe ⁇ t Transfection Reagent (301305, Qiagen, CA) , PolyFect Transfection Reagent (301105, Qiagen, CA) , LipofectAMINE 2000 Reagent (11668-019, Invitrogen corporation, CA) , JetPEI (x4) cone. (101-30, Polyplus-transfection, France), and ExGen 500 (R0511, Ferment as Inc . , MD ) .
  • SPTA Solid-phase transfection array
  • the printing solution containedplasmid DNA and cell adhesion molecules (bovine plasma fibronectin (cat. no. 16042-41, Nakalai Tesque, JPN), dissolved in ultra-pure water at a concentration of 4 mg/mL) .
  • Plavine plasma fibronectin catalog. no. 16042-41, Nakalai Tesque, JPN
  • the above solution was applied on the surface of the slideusing an Inkjet printer (synQUADTM, Cartesian Technologies, Inc., CA) or manually, using a 0.5 to 10 ⁇ L tip.
  • This printed slide was dried over 15 minutes at roomtemperature inasafetycabinet .
  • total Effectene reagent was gently poured on the DNA-printed glass slide and incubated for 15 minutes at room temperature .
  • the excess Effectene solution was removed from the glass slide using a vacuum aspirator and dried at room temperature for 15 minutes in a safety cabinet.
  • the DNA-printed glass slide obtained was set in the bottom of a 100-mm culture dish, and approximately 25 mL of cell suspension (2 to 4xl0 4 cells/mL) was gently poured into the dish. Then, the dish was transferred to the incubator and incubated at 37°C in a 5% C0 2 atmosphere for 2 or 3 days.
  • transfection reagents TransFastTM, TfxTM-20, SuperFect, PolyFect , LipbfectAMINE 2000, JetPEI (x4) cone. , or ExGen
  • plasmidDNA, fibronectin, and the transfection reagent were mixed homogeneously in a 1.5-mL microtube according to the ratios indicated in the manu acturer's instructions, and incubated at room temperature for 15 minutes before printed on a chip.
  • the printing solution was applied onto the surface of the glass slide using an Inkjet printer or a 0.5- to 10- ⁇ L tip. The printed glass slide was dried completely at room temperature over 10 minutes in a safety cabinet .
  • the printed glass slide was placed in the bottom of a 100-mm culture dish, and approximately 3 mL of cell suspension ( 2 to 4xl0 4 ⁇ ells/mL) was added and incubated at room temperature over 15 minutes in a safety cabinet. After incubation, fresh medium was poured gently into the dish. Then, the dish was transferred to an incubator and incubated at 37°C in a 5% C0 2 atmosphere for 2 to 3 days. After incubation, the present inventors observed the transfectants , using fluorescence microscopy (IX-71, Olympus PROMARKETING, INC., JPN), based on their expression of fluorescence-enhanced proteins (EFP, EGFP and DsRed2). Phase contrast images were taken with the same microscope.
  • fluorescence microscopy IX-71, Olympus PROMARKETING, INC., JPN
  • hMSC human Mesenchymal Stem Cells
  • solid-phase transfection can be used to achieve a "transfection patch" capable of being used for in vivo gene delivery and a solid-phase transfection array (SPTA) for high-throughput genetic function research on hMSC.
  • SPTA solid-phase transfection array
  • the present inventors developed a solid-phase support immobilized system which can be easily immobilized to a solid-phase support andhas sustained-releasecapability and cell affinity, whereby most of the above-described drawbacks could be overcome .
  • FIG. 3B An example of the results of the above-described experiment is shown in Figure 3B.
  • Thepresent inventors used this microprinting technique to immobilize a mixture of a selected genetic material, a transfection reagent, an appropriate cell adhesion molecule, and a salt onto a solid support.
  • a mixture of a selected genetic material, a transfection reagent, an appropriate cell adhesion molecule, and a salt onto a solid support.
  • the gene contained in the mixture was allowed to be taken in by the cultured cells.
  • Figure 3B it became possible to allow support-adherent cells to take in DNA spatially separated therefrom.
  • the present inventors studied five different cell lines (HEK293, HeLa, NIH3T3, HepG2 and hMSC) as described above with both this methodology (transfection in a solid-phase system) (see Figures 3A) and conventional liquid-phase transfection under, a series of transfection conditions.
  • Cross contamination was evaluated for both systems as follows .
  • SPTA weprintedDNA' s encodingaredfluorescent protein (RFP) and a green fluorescent protein (GFP) on glass supports in a checked pattern.
  • RFP redfluorescent protein
  • GFP green fluorescent protein
  • transfection reagents were evaluated: four liquid transfection reagents (Effectene, TransFastM, TfxTM-20, LopofectAMINE 2000), two polyamine (SuperFect, PolyFect), and two polyimine (JetPEI (x4) and ExGen 500).
  • Transfection efficiency was determined as total fluorescence intensity per unit area ( Figure 4A) .
  • the results of liquid phase optimal to cell . lines used were obtained using different transfection reagents (see Figures 4C and 4D) .
  • these efficient transfection reagents were used to optimize a solid-phase protocol. Several tendencies were observed. For cell lines which are readily transfectable (e.g. , HEK293, HeLa, NIH3T3, etc.), the transfection efficiency observed in the solid-phase protocol was slightly superior to, but essentially similar to, that of the standard liquid phase protocol ( Figure 4B) .
  • the coating material used is crucial for the achievement of high transfection efficiency on chips. It was found that when a glass chip is used, PLL provided best
  • an important advantage of the technique of the present invention is to achieve an array of separated cells , in which selected genes are expressed in the separate positions.
  • the present inventors printed JetPEI (see the "Experimental protocols” section) and two different reporter genes (RFP and GFP) mixed with fibronectin on glass surface coate with fibronectin.
  • the resultant transfection chip was sub ected to appropriate cell culture . Under experimental conditions which had been found to be best, expressed GFP and RFP were localized in regions, in which corresponding cDNA had been spotted. Substantially no cross contamination was observed ( Figures 6Athrough6D) .
  • Another cause of cross contamination may be the mobilityof transfectedcells on a solid support .
  • Thepresent inventors measured both the rate of cell adhesion (Figure 6C) and the diffusion rate of plasmidDNA on several supports . As a result, substantially no DNA diffusion occurred under optimum conditions. However, a significant amount of plasmid DNA was diffused under high cross contamination conditions until cell adhesion was completed, so that plasmid DNA was diffused and depleted from the solid-phase surface.
  • the present invention successfully realized a hMSC transfection array in a system using complex-salt.
  • this technique it Will be possible to achieve high-throughput studies using the solid-phase transfection, such as the elucidation of the genetic mechanism for differentiation of pluripotent stem cells .
  • the detailed mechanism of the solid-phase transfection as well as methodologies for the use of this technology for high throughput, real time gene expression monitoring can be applied for various purposes .
  • Arrays wereproducedas describedinthe above example .
  • genetic material mixtures of plasmid DNA (pDNA) and shRNA were used.
  • the compositions of the mixtures are shown in Table 1.
  • RNAi microarray siRNA
  • siRNA was used instead of shRNA to construct RNAi transfection microarrays in accordance with a protocol as described in Example 5.
  • siRNAs for the transcription factors 18 transcription factor reporters and actin promoter vectors described in Table 2 were used to synthesize 28 siRNAs for the transcription factors.
  • siRNA for EGFP was used as a control. Each siRNA was evaluated as to whether or not it knocks out a target transcription factor. Scrambled RNAs were used as negative controls , and their ratios were evaluated.
  • Each cell was subjected to solid-phase transfection, followed by culture for two days . Images were taken using a fluorescence image scanner, and the fluorescent level was quantified.
  • PCR primers were:
  • pEGFP-Nl (see Figure 13) was used as a template.
  • Cycle conditions 94°C, 2 min ⁇ ( 94°C , 15 sec ⁇ 60°C, 30 ,sec ⁇ 68°C, 3 min) ⁇ 4°C (the process in parenthesis was performed 30 times)
  • the resultant PCR fragment was purified with henol/chloroform extraction and ethanol precipitation.
  • the PCR fragment has the following sequence:
  • GGACTTTCCA AAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCGCTA CCGGACTCAG ATCTCGAGCT CAAGCTTCGA ATTCTGCAGT CGACGGTACC GCGGGCCCGG GATCCACCGG TCGCCACCAT GGTGAGCAAG GG ' CGAGGAGC TGTTCACCGG GGTGGTGCCC ATCCTGGTCG AGCTGGACGG CGACGTAAAC GGCCACAAGT TCAGCGTGTC.
  • TAGAGGTTTT ACTTGCTTTA AAAAACCTCC CACACCTCCC CCTGAACCTG AAACATAAAA TGAATGCAAT TGTTGTTGTT AACTTGTTTA TTGCAGCTTA TAATGGTTAC AAATAAAGCA ATAGCATCAC AAATTTCACA AATAAAGCAT TTTTTTCACT GCATTCTAGT TGTGGTTTGT CCAAACTCAT CAATGTATCT TAAGGCGTAA ATTGTAAGCG TTAATATTTT GTTAAAATTC GCGTTAAATT TTTGTTAAAT CAGCTCATTT TTTAACCAAT AGGCCGAAAT CGGCAAAATC
  • Chips were produced using the PCR fragment .
  • MCF7 was disseminated on the chips .
  • images were obtained using a fluorescence image scanner .
  • the results are shown in Figure 14 .
  • the PCR fragment is compared with circular DNA . In either case , transfection was successful . It was revealed that the PCR fragment , which was used as a genetic material , could be transf ected into cells , as with full-length plasmids . It was confirmed that, with the PCR fragment also , the effect of immobilizing the salt and the resulting effect of enhancing gene introduction are provided .
  • Example 9 Types of materials for coating the supports. It is confirmed that the same effect of the salt is provided in the case where glass supports coated with poly-L-lysine, silane, APS, MAS, hydrophobic fluoroplastics are used.
  • Matsunami Glass Ind. Ltd. and arrays are produced as described in the above examples .
  • Example 11 Types of negatively charged substances
  • the immobilization effect can be confirmed by visual observation and in accordance with whether or not a specific antibody adheres to the supports .
  • the present invention provides a method for immobilizing a substance to a solid-phase support.
  • the method is unexpectedly simple and provides biocompatibility (e.g., cell affinity) and/or sustain-releasability of the substance. Such effects are usable to realize various b iological phenomena, including gene introduction, signal transmission and efficacy, using a solid-phase support.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Nanotechnology (AREA)
  • Condensed Matter Physics & Semiconductors (AREA)
  • Materials Engineering (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Composite Materials (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Immobilizing And Processing Of Enzymes And Microorganisms (AREA)

Abstract

The present invention has an objective of providing a method for simply immobilizing a substance such as a biological molecule to a solid-phase support. The method allows the substance such as the biological molecule, once immobilized to a solid-phase support, to be substain-released when dissolved in a specific solution, or allows the biological molecule, immobilized to a solid-phase support, to substantially maintain or improve its affinty to a biological organism. The present invention achieves the above objective by providing a composition for immobilizing a substance on a solid -state support including (a) a complex of a positively charged substance and a negatively charged substance; and (b) a salt. The present invention also provides a solid-phase support (device) having such a composition immobilized thereon and a method for immobilizing the substance to the solid-phase support.

Description

DESCRIPTION
COMPOSITION AND METHOD FOR IMMOBILIZING A SUBSTANCE ON A
SOLID-PHASE SUPPORT
TECHNICAL FIELD
The present invention relates to immobilization technology for a substance such as , for example, a biological molecule. More specifically, the present invention relates to anovel composition andmethodfor immobilizing a substance such as, for example, a biological molecule on a solid-phase support .
BACKGROUND ART
It has been widely attempted to perform various analyses with a substance such as, for example, a biological molecule being immobilized on a solid-phase support such as, for example, a microtiter plate.
Conventional methods for immobilizing a biological molecule on a solid-phase support include, for example, use covalent bonds, hydrophobic interaction, adsorption, or solid-phase surface treatment such as silanization or the like.
Forexample, Ni iforo etal. discloses amethodusing an anionic surfactant to bond an oligomer to a polystyrene well via (Nikiforo etal., Nucleic Acids Res .22: 4167-4175, 1994) .
Nagata el al. discloses technology for bonding an unknown amount of cloned DNA to a microtiter well in the presence of 0.1 M MgCl2 (Nagata et al., FEBS Letters 183:379-382 (1985)). Dahlen, P. et al . describes sandwich hybridization in a microtiter well to which cloned, captured DNA to adsorb to the microtiter well (Dahlen et al., Mol. Cell. Probes 1:159-168(1987)). Nikiforov et al. have studied bonding oligomers to a polystyrene well via NaCl (PCR Methods Applic. 3:285-291, 1994).
Since these methods require a certain number of steps or special treatment in an immobilization.process, a simpler immobilization method of a substance such as a biological molecule or the like is strongly desired.
In many cases, it is preferable to sustain-release the substance once immobilized. In some cases, for example, a biological molecule, which is immobilized to a plate such as a microtiter plate, is required to be sustain-released after the plate is immersed in an assay solution in an assay process. In some other cases, the biological molecule is required to maintain affinity to a biological organism, such as a cell, after being immobilised. Currently available methods cannot maintain such affinity, or significantly reduce the affinity after immobilization. No satisfactory immobilization method has been developed.
DISCLOSURE OF THE INVENTION
One objective of the present invention is to provide a method for simply immobilizing a substance such as a biological molecule or the like to a solid-phase support.
Another objective of the present invention is to provide an immobilization method bywhich (i) a biological molecule, once immobilized to a solid-phase support, is sustain-released when dissolved in a specific solution, or (ii) a biological molecule, immobilized to a solid-phase support, substantially maintains or improves its affinity to a biological organism.
The present inventors found that the following composition is immobilized to a solid-phase support unexpectedly easily and thus achieved the above-described objectives: a composition obtained by forming a complex of a substance such as a biological molecule or the like, for example, DNA, RNA or polypeptide, and an oppositely charged substance; andthen combiningthe complexwithasalt (organic salt, inorganic salt (e.g., calcium phosphate contained in a medium) ) .
The present inventors also found that a substance such as a biological molecule or the like having the above-describedstructure, once immobilizedto a solid-phase support (e.g., a plate), is unexpectedly sustain-released when the solid-phase support is immersed in a solution such as an assay solution. The present inventors also found that the substancehaving the above-describedstructuremaintains or improves its affinity to a biological organism (e.g., tissue or cell).
Thus, the present invention provides the following.
1. A composition for immobilizing a substance on a solid-state support, comprising:
(a) a complex of a positively charged substance and a negatively charged substance; and
(b) a salt. 2. A composition according to item 1, wherein at least one of the positively charged substance and the negatively charged substance has cell affinity.
3. A composition according to item 1, wherein both the positively charged substance and the negatively charged substance have cell affinity.
4. A composition according to item 1, wherein at least one of the positively charged substance and the negatively charged substance contains a biological molecule.
5. A composition according to item 4 , wherein the biological molecule is selected from the group consisting of DNA, RNA, polypeptides , lipids , sugars , low molecular weight organic molecules, and complexes thereof.
6. A composition according to item 1 , wherein the negatively charged substance is selected from the group consisting of
DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof .
7. A composition according to item 1 , wherein the positively charged substance is selected from the group consisting of cationic polymers , cationic lipids , cationic polyaminoacids , and complexes thereof.
8. A composition according to item 1 , wherein the salt is selected from the group consisting of calcium chloride,, sodiumhydrogenphosphate, sodiumhydrogencarbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids , and vitamins .
9. A composition according to item 4 , wherein the biological , molecule has biological activitywhen introduced into a cell,
10. A composition according to item 1 , wherein the complex and the salt are pharmaceutically acceptable.
11. A device having a target substance immobilized therein, comprising:
(a) a complex of a positively charged substance and a negatively charged substance;
(b) a salt; and
(c) a solid-phase support having the complex and the salt immobilized thereon, wherein the target substance is the positively charged substance and/or the negatively charged substance.
12. A device according to item 11, wherein at least one of the positively charged substance and the negatively charged substance has cell affinity.
13. Adevice according to item 11 , whereinboth the positively charged substance and the negatively charged substance have cell affinity.
14. A device according to item 11, wherein at least one of the positively charged substance and the negatively charged substance contains a biological molecule.
15. A device according to item 14, wherein the biological molecule is selected from the group consisting of DNA, RNA, polypeptides , lipids , sugars , low molecular weight organic molecules, and complexes thereof.
16. A device according to item 11, wherein the negatively charged substance is selected from the group consisting of DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof .
17. A device according to item 11, wherein the positively charged substance is selected from the group consisting of cationic polymers , cationic lipids , cationic polyaminoacids , and complexes thereof.
18. Adeviceaccording to item 11, wherein the salt is selected from the group consisting of calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids , and vitamins .
19. A device according to item 11, wherein the solid-phase support contains a material selected from the group consisting of glass, silica, silicon, ceramics, silicon dioxide, plastics, metals, naturally-occurring polymers, and synthetic polymers .
20. A device according to item 11, wherein the solid-phase support is treated by coating.
21. A device according to item 20, wherein the coating is performed with a coating material containing a substance selected from the group consisting of poly-L-lysine, silane, APS, MAS, hydrophobic fluoroplastics, and metals. 22. A device according to item 11, wherein the solid-phase support is a chip.
23. A device according to item 11, wherein the solid-phase support is a chip, and the complex is arranged in an array on the chip.
24. A device according to item 14, wherein the biological molecule has biological activitywhen introduced into a cell .
25. A device according to item 11, wherein the complex, the salt and the material contained in the solid-phase support are , pharmaceutically acceptable.
26. A method for immobilizing a substance on a solid-phase support, comprising the steps of:
(a) providing the solid-phase support;
(b) providing a complex of a positively charged substance and a negatively charged substance; (c) providing a mixture of a salt and the complex; and
(d) causing the mixture of the salt and the complex to adhere to the solid-phase support.
27. A method according to item 26, wherein at least one of the positively charged substance and the negatively charged substance has cell affinity.
28. Amethodaccording to item 26, whereinboth thepositively charged substance and the negatively charged substance have cell affinity.
29. A method according to item 26, wherein at least one of the positively charged substance and the negatively charged substance contains a biological molecule.
30. A method according to item 29, wherein the biological 5 molecule is selected from the group consisting of DNA, RNA, polypeptides , lipids , sugars , low molecular weight organic molecules , and complexes thereof .
31. A method according to item 26, wherein the negatively 10 charged substance is selected- from the group consisting of
DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof.
32. A method according to item 26, wherein the positively i5 charged substance is selected from the group consisting of cationic polymers , cationic lipids , cationic polyaminoacids , and complexes thereof .
33. Amethodaccording to item26 , wherein the salt is selected 20 from the group consisting of calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate; sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids , and vitamins . 25
34. A method according to item 26, wherein the solid-phase support contains a material selected from the group consisting of glass, silica, silicon, ceramics, silicon dioxide, plastics, metals, naturally-occurring polymers,
30 and synthetic polymers.
35. A method according to item 26, wherein the solid-phase support is treated by coating. 36. A method according to item 35, wherein the coating is performed with a coating material containing a substance selected from the group consisting of poly-L-lysine, silane,
5 APS, MAS, hydrophobia fluoroplastics , and metals.
37. A method according to item 26, wherein the solid-phase support is a chip.
10. 38. A method according to item 26, wherein the solid-phase support is a chip, and the complex is arranged in an array on the chip.
39. A method according to item 29, wherein the biological 15 molecule has biological activitywhen introduced into a cell.
40. A method according to item 26, wherein the complex and the salt are pharmaceutically acceptable.
20 41. A method according to item 29, wherein the step (b) is performed under a condition in which the biological molecule is not destroyed.
42. A method according to item 29, wherein the step (σ) is 25 performed under a condition in which the biological molecule is not destroyed.
43. A method according to item 26, further comprising the step of reducing an amount of, or removing, a solvent in
30 the mixture after the mixture is caused to adhere to the solid-phase support.
Hereinafter, the present inventionwill be described by way of preferred embodiments. It will be understood by those skilled in the art that the embodiments of the present invention can be appropriately made or carried out based on the description of the present specification and the accompanying drawings, and commonly used techniques well known in the art. The function and effect of the present invention can be easily recognized by those skilled in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows representative results of the experiments performed in Example 2. Figure 1 compares the results obtained with non-combined DNA (upper photos) and the results obtained with DNA combined with a positively charged substance (lower photos; treated with NP10) . These photos show the state of transfection, immediately after the complex was placed on the solid-phase support (in 0 minutes), and in 1 minute, 5 minutes and 10 minutes after the complex was placed on the solid-phase support.
Figure 2 shows representative results of the experiments performed in Example 3 (various systems). Figure 2 is a graph illustrating the progress of sustain-release obtained with" N 3, NP5 and NP10.
Figures 3A shows an experiment in which spatially-spaced DNA was caused to be taken into cells by the solid-phase transfection of the present invention in Example 4. Figure 3A schematically shows a method for producing a solid-phase transfection array (SPTA).
Figures 3B also shows the experiment in which spatially-spaced DNA was caused to be taken into cells by the solid-phase transfection of the present invention in Example 4. Figure 3B shows the results of solid-phase transfection. A HEK2 3 cell line was used to produce a SPTA. Green colored portions indicate transfected adherent cells . According to this result , the method of the present invention can be used to produce a group of cells separated spatially and transfected with different genes.
Figure 3C shows a difference between conventional liquid phase transfection and SPTA.
Figure 4A shows a difference between conventional liquid phase transfection and SPTA. Figure 4A shows the results of experiments where 5 cell lines were measured with respect to GFP intensity/mm2. Transfection efficiency was determined as fluorescence intensity per unit area.
Figure 4B shows a difference between conventional liquid phase transfection and SPTA. Figure 4B shows fluorescence images of cells expressing EGFP corresponding to the data presented in Figure A. White circular regions were regions in which plasmid DNA was immobilized. In other regions , cells were also immobilized in solidphase, however, cells expressing EGFP were not observed. The white bar indicates 500 μ .
Figure 4C shows an exemplary transfection method of the present invention.
Figure 4D shows an exemplary transfection method of the present invention. Figures 5A and 5B show the results of coating a chip, where by cross contamination was reduced. Figures 5A and 5B show the results of liquid phase transfection and SPTA using HEK293 cells, HeLa cells, NIT3T3 cells (also referred to as "3T3"), HepG2 cells, and hMSCs . Transfection efficiency was represented by GFP intensity.
Figures 6A and 6B show cross contamination between each spot . A nucleic acid mixture containing fibronectin having a predetermined concentration was immobilized to a chip coated with APS or PLL (poly-L-lysine) . Cell transfection was performed on the chip. Substantially no cross contamination was observed (upper and middle rows). In contrast, significant chip cross contamination of immobilized nucleic acids was observed on a uncoated chip (lower row) .
Figures 6C and 6D show a correlation relationship between the types of substances contained in a mixture used for immobilization of nucleic acid and the cell adhesion rate . The graph of Figure 6D shows an increase in the proportion of adherent cells over time. A longer time is required for cell adhesion when the slope of the graph is mild than when the slope of the graph is steep.
Figure 6E shows the results of experiments in which various actin acting substances and HEK293 cells were used, where gelatinwas usedas acontrol. Figure 6E shows an effect of each adhered substance (HEK cell) with respect to transfection efficiency. The HEK cells were transfected with pEGFP-Nl using an Effectene reagent.
The results shown in Figures 6C, 6D and 6E indicate that substantially no DNA diffusion occurred under optimum conditions. However, a considerable amount of plasmid DNA was diffused under high cross contamination conditions until cell adhesion was completed, so that plasmid DNAwas depleted from the solid phase surface.
Figure 7 shows that under the conditions which generate low cross contamination with no APS coating or PLL coating, thetransfectionefficiencywas significantlylower than that in the case where APS coating or PLL coating -was performed.
Figure 8 shows the results of transfection using an RNAi transfection array of Example 5. Each reporter gene was printed on a solid-phase substrate at a rate of 4 points per gene. The substrate was dried. For each transcription factor, siRNA (28 types) were printed onto coordinates at which reporter genes were printed, followed by drying. As a control, siRNA for EGFP was used. As a negative control, scramble RNA was used. Thereafter, LipofectAMINE2000 was printed onto the same coordinates of each gene, followed by drying. Thereafter, fibronectin solution was printed onto the same coordinates of each gene. HeLa-K cells were plated on the substrate, followed by culture for 2 days. Thereafter, images were taken using a fluorescence image scanner.
Figures 9A through and 9E show the results of transfection using the RNAi transfection array of Example 5 for each cell. The fluorescence intensity of each reporter was quantified by image analysis, and thereafter, compared with the intensity of each reporter gene to which scramble RNA (negative control) was printed, thereby calculating the ratio . The results are shown for all reporters and all cells .
Figure 10 shows the results of transfection using an RNAi transfection array of Example 6. Each reporter gene expression unit PCR fragment was printed on a solid-phase substrate at a rate of 4 points per gene. The substrate was dried. For each transcription factor, siRNA (.28 types) were printed onto coordinates at whichreporter genes wereprinted, followed by drying. As a control, siRNA for EGFP was used. As a negative control, scramble RNA was used. Thereafter, LipofectAMINE2000 was printed onto the same coordinates of each gene, followed by drying. Thereafter, fibronectin solution was printed onto the same coordinates of each gene. HeLa-K cells were plated oil the substrate, followedbyculture for 2 days. Thereafter, images were taken using a fluorescence image scanner.
Figures 11A through 11D show the results of transfection using the RNAi transfection array of Example 6 for each cell. The fluorescence intensity of each reporter was quantified by image analysis, and thereafter, compared with the intensity of each reporter gene to which scramble RNA (negative control) was printed, thereby calculating the ratio . The results are shown for all reporters and all cells .
Figure 12 shows a structure of a PCR fragment obtained in Example 7.
Figure 13 shows a structure of pEGFP-Nl.
Figure 14 shows the result of comparison of transfection efficiency of transfection microarrays using cyclic DNA and PCR fragments. DESCRIPTION OF SEQUENCE LISTING
SEQ ID NO. 1: primer 1 used in Example 7 SEQ ID NO. 2 : primer 2 used in Example 7 SEQ IDNO. 3 : aPCRfragment obtainedin aPCRreaction in Example 7
BEST MODE FOR CARRYING OUT THE INVENTION
Hereinafter, preferable embodiments of the present invention will be described.
It should be understood throughout the present specification that articles for singular forms include the concept of their plurality unless otherwise mentioned.
Therefore, articles or adjectives for singular forms (e.g. ,
"a", "an", "the", etc. in English; "ein", "der", "das", "die", etc. and their inflections in German; "un", "une", "le", "la", etc. inFrench; "un"., "una", "el", "la", etc. in Spanish, and articles, adjectives, etc. in other languages) include the concept of their plurality unless otherwise specified.
It should be also understood that terms as used herein have definitions ordinarily used in the art unless otherwise mentioned. Therefore, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art. Otherwise, the present application (including definitions) takes precedence.
(Definition of terms)
Hereinafter, terms specifically used herein will be defined. The term "substance" is used in the broadest sense as used in the art, and encompasses substances which can be positively or negatively charged.
As used herein, the term "positively charged substance" encompasses all substances having positive charges . Such substances include cationic substances such as cationic polymers, cationic lipids and the like, but are not limited to these. Advantageously, such positively charged substances can form a complex. Such positively charged substances which can form a complex include, for example, substances having a certain molecular weight (for example, cationic polymers) and substances which can remain insoluble, that is, without being dissolved to a certain extent in aspecific solvent suchaswater, anaqueous solution orthe like (forexample, cationic lipids ) , but arenot limited to these . Preferable positively charged substances include, for example, polyethylene imine, poly-L-lysine, synthetic polypeptides, or derivatives thereof, but are not limited to these. Positively charged substances include, for example, biological molecules such as histone and synthetic polypeptides ,. but are not limited to these. The type of preferable positively charged substances changes in accordance with the type of negatively charged substances, which act as a complex partner to form complexes with the positively charged substances. It requires no specific creativity for those skilled in the art to select a preferable complex partner using technology well known in the art. For selecting a preferable complex partner, various parameters are considered including, but not limited to, charge, molecular weight, hydrophobicity, hydrophilicity, properties of substituents, pH, temperature, salt concentration, pressure, and other physical and chemical parameters .
As used herein, the term, "cationic polymer" refers to a polymer having a cationic functional group, and encompasses, for example, polyethylene imine, poly-L-lysine, synthetic polypeptides, and derivatives thereof, but is not limited to these.
As used herein, the term "cationic lipid" refers to a lipid having a cationic functional group, and encompasses , for example, phosphatidyl choline, phosphatidyl ethanol amine, phosphatidyl serine, and derivatives thereof, but is not limited to these.
Cationic functional groups include, for example, primary amine, secondary amine, and tertiary amine, but are not limited to these.
As used herein, the term "negatively charged substance" encompasses all substances having negative charges . Such substances include biological molecular polymers, anionic substances such as anionic lipids, and the like, but are not limited to these. Advantageously, such negatively charged substances can form a complex. Such negatively charged substances which can form a complex include, for example, substances having a certain molecular weight (for example, anionic polymers such as DNA) and substances which can remain insoluble, that is , without being dissolved to a certain extent in a specific solvent such aswater, anaqueous solutionor the like (forexample, anionic lipids) , but are not limitedto these. Preferablenegatively charged substances include, for example, DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof. but are not limited to these. Negatively charged substances include, for example, DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof, but, are not limited to these. The type of preferable negatively charged substances changes in accordance with the type of positively charged substances , which act as a complex partner to form complexes with the negatively charged substances. It requires no specific creativity for those skilled in the art to select a preferable complex partner using technology well known in the art. For selecting a preferable complex partner, various parameters are considered as described above regarding the negatively charged substances .
As used herein, the term "anionic polymer" encompasses polymers having an anionic functional group, and include, for example, DNA, RNA, PNA, polypeptides, chemical compounds , andcomplexes thereof, but is not limited to these.
As used herein, the term "anionic lipid" encompasses lipids having an anionic functional group, and include, for example, phosphatidic acid, phosphatidyl serine, but is not limited to these.
Anionic functional groups include, for example, carboxylic groups and phosphoric acid groups , but are not limited to these.
The type of charge of a target substance can be converted by adding a part of a substituent or the like having apositive chargeoranegative charge to the target substance.
In the case where a preferable complex partner has the same type of charge as that of the target substance, formation of a complex can be promoted by converting the type of charge of either i:he complex partner or the target substance.
As used herein, the term "complex" refers to two or more substances which directly or indirectly interact with each other and as a result , act as if they were one substance as a whole.
Herein, the term "interaction" used for two objects refers to that the two objects exert a force on each other. Such interactions include, for example, covalent bond, hydrogen bond, van der Waals forces, ionic interaction, nonionic interaction, hydrophobic interaction, -and electrostatic interaction, but are not limited to these. Preferable interactions include hydrogen bond : and hydrophobic interaction. As usedherein, the term "covalent bond" is used as having the normal sense in the art, and refers to a chemical bond formed by an electron pair being sharedby'two atoms . As usedherein, the term "hydrogen bond" is used as having the normal sense in the art , and is generated as follows : a single extranucleic electron of a hydrogen atom is attracted to an atom having high electric negativity to expose the hydrogen atomic nucleus , and the exposed hydrogen atomic nucleus attracts another atom having high electric negativity. A covalent bond is generated between, for example, a hydrogen atom and an atom having high electric negativity (e.g., fluorine, oxygen, nitrogen).
Herein, the term "complex partner" used for a certain member forming a complexrefers to anothermember interacting with the certain member directly or indirectly.
In this specification, the condition for forming a complexchanges in accordancewith the type of complexpartner. Such a condition can be easily understood by those skilled in the art . Those skilled in the art can easily form a complex from any complex partners (for example, a positively charged substance and a negatively charged substance) using a technique well known in the art .
In this specification, the terms "biological substance" and "biological molecule" are interchangeably used, and refer to a substance or a molecule relating to an organism. A biological molecule encompasses a molecule extracted from an organism, but not limited to this. Any molecule capable of affecting an organism falls within the definition of biological molecule. Therefore, a molecule synthesized by combinatorial chemistry is encompassed in the biological substance as long as an effect on an organism is intended. The biological substance encompasses proteins , polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (e.g. , DNA such as cDNA and genomic DNA; RNA such as mRNA) , polysaccharides , oligosaccharides , lipids, low molecular weight molecules (e.g. , lowmolecularweight organicmolecules) , andcomplexes molecules thereof, but is not limited to these. A biological molecule may encompass a cell itself, a portion of tissue and other substances as long as the biological molecule is capable of forming a complex with a polymer molecule.
As used herein, the term "polymer molecule" refers to a substance having a high molecular weight obtained by polymerizing polymers , and is usually a polymer having a molecular weight of 5,000 or. greater.
In this specification, the terms "protein". "polypeptide", "oligopeptide" and "peptide" are used interchangeably, and refer to an amino acid or a polymer modified therefrom having any length. The polymer may have a straight, branched or cyclic chain. The amino acid may be naturally occurring, non-naturally occurring, or may be a variant. These terms may encompass assembled complexes of a plurality of polypeptide chains . These terms may also encompass naturally-occurring or artificially modified amino acid polymers . , Such modification includes , for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, and any other manipulation or modification (e.g., conjugation with a labeling moiety). These terms encompass, for example, polypeptides containing one or two or more amino acid analogs (e.g., non-naturally-occurring amino acids), peptide-like compounds (e.g. , peptoids) , and other variants known in the art .
As used herein, the terms "polynμcleotide" , "oligonucleotide", "nucleic acid" and "nucleic acid molecule" are used interchangeably, and refer to anucleotide or a polymer modified therefrom having any length. These terms also encompass "oligonucleotide derivatives" and
"polynucleotide derivatives". An "oligonucleotide derivative" or a "polynucleotide derivative" refer to an oligonucleotide or a polynucleotide having different linkages between nucleotides from typical linkages . The terms "oligonucleotide derivative" and "polynucleotide derivative" are interchangeably used. Specific examples of such an oligonucleotide include 2 ' -O-methyl-ribonucleotide, an oligonucleotide derivative in which a phosphodiester bond in an oligonucleotide is converted to a phosphorothioate bond, anoligonucleotide derivative inwhichaphosphodiester bond in an oligonucleotide is converted to a N3'-P5' phosphoroamidate bond, an oligonucleotide derivative in which aribose andaphosphodiesterbond in an oligonucleotide are converted to a peptide-nucleic acid bond, an oligonucleotide derivative in which uracil . in an oligonucleotide is substituted with C-5 propynyl uracil, an oligonucleotide derivative in which uracil in an oligonucleotide is substituted with C-5 thiazole uracil, an oligonucleotide derivative in which cytosine in an oligonucleotide is substituted with C-5 propynyl cytosine, an oligonucleotide derivative in which cytosine in an oligonucleotide is substituted with phenoxazine-modified cytosine, an oligonucleotide derivative in which ribose in DNA is substituted with 2 ' -O-propyl ribose, and an oligonucleotide derivative in which ribose in an oligonucleotide is substitutedwith 2 ' -methoxyethoxy ribose. Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively-modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequences explicitly indicated. Specifically, degenerate codon substitutions may be produced by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al.. Nucleic Acid Res. 19:5081 (1991) ; Ohtsuka et al. , J. Biol. Chem.260:2605-2608 (1985) ; Rossolini et al. , Mol. Cell. Probes 8:91-98(1994) ) .
As used herein, the term "salt" is used in the normal sense in the art, and encompasses both inorganic salts and organic salts . Salts are typically generated by neutralizing reactions between acids and bases. Salts include NaCl, K2S04, and the like, which are generated by neutralization, as well as PbS0 , ZnCl2, and the like, which are generated by reactions between metals and acids. The latter salts may not be generated directly by neutralizing reactions, but can be regarded as a product of neutralizing reactions between acids and bases . Salts may be classified, for example, into the following categories: normal salts ( saltswithout anyprotons orwithout anyOH groups; including, for example, NaCl, NH4C1, CH3COONa, and Na2C03) , acid salts (salts with remaining H of acids; including, for example, NaHC03, KHS04, and CaHP04) , and basic salts (salts with OH groups that do not dissociate in solution; including, for example, MgCl(OH) andCuCl(OH) ) . This classification is not very important in the present invention. Examples of preferable salts include salts constituting media (e.g., calciumchloride , sodiumhydrogenphosphate, sodiumhydrogen carbonate, sodium pyruvate, HEPES, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids, vitamins), salts constituting buffers (e.g., potassium chloride, magnesium chloride, sodium hydrogen phosphate, sodium chloride) , and the like. These salts are preferable as they provide a higher effect of maintaining or improving the affinity for cells . These salts may be used singlyorapluralityof these saltsmaybeusedin combination. Preferably, apluralityof these salts are used in combination, since in this way, the affinity for cells tends to be improved. Therefore, it is preferable to use a plurality of salts (e.g. , calcium chloride, magnesium chloride, sodium hydrogen phosphate, and sodium chloride) contained in amedium, rather than to use NaCl or the like singly. More preferably, all salts contained in the medium are used. In another preferred embodiment, glucose may be added to the medium.
In this specification, the term "support" and "substrate" are used interchangeably and refer to an element formed of a material which can immobilize a substance such as a biological molecule or the like. Material usable for a support include any solid material which has a capability of binding to a biological molecule as used in the present invention via covalent or noncovalent, bond, or which may be induced to have such a capability.
Examples of suchmaterials used for a support include anymaterial capable of forming a solid surface; for example, glass, silica, silicon, ceramics, silicon dioxide, plastics, metals (including alloys), naturally-occurring and synthetic polymers (e.g. , polystyrene, cellulose, chitosan, dextran, and nylon) , but are not limited to these. A support may be formed of layers made of a plurality of materials. For example, a support may be made of an inorganic insulating material, such as glass, quartz glass, alumina, sapphire, forsterite, siliconoxide, silicon carbide, siliconnitride, or the like. A support may be made of an organic material, such as polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resin, polyacrylonitrile, polystyrene, acetal resins, polycarbonate, polyamide, phenol resin, urea resins, epoxy resin, melamine resin, styrene-acrylonitrile copolymer, acrylonitrile-butadiene-styrene copolymer, silicone resin, polyphenylene oxide, polysulfone, and the like. Also in the present invention, nitrocellulose film, nylon film, PVDF film, or the like, which are used in blotting, may be used as amaterial for a support . When amaterial forming a support is in the solid-phase, such a support is herein particularly referred to as a "solid-phase support". A solid-phase support may be herein in the form of a plate, a microwell plate, achip, aglass slide, afilm, beads, ametals (surface) , or the like.
In this specification, the term "coating" used regarding a solid-phase support refers to an act of forming a film of a substance on a surface of the solid-phase support , and also refers to a film itself. Coating is performed for various purposes, such as, for example, improvement in the quality of a solid-phase support (e.g. , elongation of life, improvement in environmental resistance to hostile environment, such as resistance to acids, etc.), and improvement in affinity to a substance to be bound to the solid-phase support . Various materials may be used for such coating, including, butnot limitedto, biological substances (e.g., DNA, RNA, proteins, lipids), polymers (e.g., poly-L-lysine, APS (e.g., γ-aminopropyl silane) , MAS, hydrophobic fluorineresin) , silane, andmetals (e.g. , gold) , in addition to the above-described materials used for a solid-phase support . The selection of such materials is within the technical scope of those skilled in the art and thus can be performed using techniques well known in the art. In one preferred embodiment of the invention, such a coating may be advantageously made of poly-L-lysine, APS, MAS, hydrophobic fluorine resin, silane such as epoxy silane or mercaptosilane, or metal such as gold. Such materials may be preferably substances suitable for cells or objects containing cells (e.g., organisms, and organs).
In this specification, the term "immobilization" used for a solid-phase support refers to a state in which a substance as a subject of immobilization (e.g. , abiological molecule) is held on the support or at least a certain time period, or an act of placing the substance into such a state. As such, in the case where the condition is changed after the substance is immobilized on the solid-phase support (for example, the substance is immersed in another solvent) , the substance may be released from the immobilization state.
As used herein, the term "cell affinity" refers to a property of a substance that when the substance is placed in an interactable state with a cell (e.g. , germ cell, animal cell, yeast, plant cell) or an object containing a cell (e.g. , tissue, organs, biological organisms), the substance does not have any adverse influence on the cell or the object containing the cell.. Preferably, substances having cell affinity may be substances to which a cell interacts with priority, but are not limited to these. According to the present invention, the substance to be immobilized (e.g., positively charged substances and/or negatively charged substances) preferably have cell affinity, but cell affinity is not absolutely necessary. It was unexpectedly found that when the substance to be immobilized has cell affinity, the cell affinity of the substance is maintained or improved when the substance is immobilized according to the present invention. In light of the past situation where a substance having cell affinity does not necessarily maintain its cell affinity when immobilized on a solid-phase support, the effect of the present invention is enormous .
In this specification, the term "cell" is used in the broadest sense as used in the art .- The term "cell" refers to any biogenic matter which is a structural unit of tissue of amulticellular organism, which is surroundedbyamembrane structure which isolates itself from the outside, has a self- replicating capability therein, and has genetic information and a mechanism for expressing the genetic information. Cells used herein may be either naturally-occurring cells or artificially modified cells (e.g., fusion cells, genetically modified cells). Examples of cell sources include, but are not limited to, a single-cell culture; the embryo, blood, or body tissue of normally-grown transgenic animals; and a mixture of cells derived from normally-grown cell lines.
As used herein, the term "tissue" refers to an aggregate of cells having substantially the same function and/or form in a multicellular organism. "Tissue" is typically an aggregate of cells of the same origin, but may be an aggregate of cells of different origins as long as the cells have the same function and/or form.
As used herein, the term "organ" refers to a morphologically independent structure localized at a particular portion of an individual organism in which a certain function is performed. Generally in multicellular organisms (e.g. , animals, plants) , an organ includes several tissues spatially, arranged in a particular manner, and each tissue includes a number of cells . Examples of such an organ include organs relating to the vascular system. In one embodiment of the invention, organs targeted by the present inventioninclude, but are not limitedto, skin, bloodvessel, cornea, kidney, heart, liver, umbilical cord, intestine, nerve, lung, placenta, pancreas, brain, peripheral limbs, and retina.
As used herein, the term "isolated" means that substances which are naturally accompanying in normal circumstances are at least reduced, or preferably substantially completely eliminated. Therefore, the term "isolated cell" refers to a cell substantially free from other accompanying substances (e.g., other cells, proteins, nucleic acids) in natural circumstances. ^When used for nucleic acids or polypeptides produced by recombinant DNA techniques, the term "isolated" means that the nucleic acids or the polypeptides are substantially free from cellular substances or culture media. When used for nucleic acids or chemically synthesized polypeptides, the term "isolated" means when the nucleic acids or the polypeptides are substantially free from precursory chemical substances or other chemical substances .
Cells or objects containing cells (e.g., organs, tissue) used in the present invention may be derived from any organism; for example, any unicellular organism such as prokaryote (e.g., E. coli) or eukaryote (e.g., yeast), or any multicellular organism (e.g., animals (e.g., vertebrates, invertebrates) , plants (e.g. , monocotyledons, dicotyledons) ) . , Usable cells are preferably derived from, for example, vertebrates (e.g., Myxiniformes , Petronyzoniformes , Chondrichthyes , Osteichthyes, amphibian, reptilian, avian, mammalian), and more preferably from mammalian (e.g., monotremata, marsupialia, edentate, dermoptera, chiroptera, carnivore, insectivore, proboscidea, perissodactyla, artiodactyla, tubulidentata, pholidota, sirenia, cetacean, primates, rodentia, lagomorpha) . Still more preferably, usable cells are derived from primates (e.g., cynomolgus, chimpanzee, Japanese monkey, human) . Cells derived from a human may be used. As used herein the term "sustain-release" means that when a substance is immersed in a solvent for" dissolving the substance, the substance is gradually dissolved while maintaining the solid-phase or a certain time period. When a substance has sustain-releasability, the substance is usually kept immobilized after being immersed in a solvent for about 5 minutes , preferably for at least about 10 minutes , more preferably for at least about 15 minutes, arid still more -preferably for at least about 30 minutes . When a substance is used as a pharmaceutical agent, it is advantageous that the substance kept immobilized for at least about 30 minutes, preferably for at least about 1 hour, more preferably for at least about 3 hours , and still more preferably for at least about 6 to 12 hours . When a substance is used for the purpose of introducing a substance directly immobilized to a cell such as DNA transfection, the substance is usually kept immobilized for about 15 minutes.
As usedherein, the term "biological activity" refers to activity possessed by an agent (e.g., polypeptide or protein) within an organism, and encompass activities exhibiting various functions. For example, when the agent is an enzyme, the biological activity thereof includes enzyme activity. In another example, when the agent is a ligand, the biological activity thereof includes the binding of the ligandto areceptor corresponding thereto. Suchbiological activities can be measured by techniques well-known in the art in accordance with the activity which is a subject of measurement .
As used herein, the term "condition which does not destroy a biological molecule" refers to a condition under which at least one biological activity exhibited by biological molecule (e.g. , gene expression activity, yeast activity) is not destroyed. Those srkilled in the art can appropriately set such a condition in accordance with the biologicalmoleculeinconsideration ofvarious factors (e.g. , temperature, pH, pressure, chemical conditions) . Even when the condition which does not destroy a biological molecule is not known, the condition can be pre-determined by exposing the biological molecule to necessary test conditions then and checking if the intended biological activity is maintained or not. Accordingly, those skilled in the art appreciate that the condition which does not destroy a biological molecule may be any condition as long as the intended biological activity is maintained for carrying out the present invention.
In this specification, "reduction" or "removal" of a solvent (e.g., water, an organic solvent such as hexane or the like) is achieved by placing a mixture or a composition containing the solvent under a certain condition, so that the ratio of the solvent in the mixture or the composition is reduced or eliminated.
In this specification, the term "pharmaceutically acceptable" used for a substance refers to a property of the substance by which the substance can be administered as a pharmaceutical agent .
As used herein, the term "pharmaceutically acceptable substance" encompasses, but is not limited to, antioxidants , preservatives, colorants, flavoring agents , diluents, emulsifiers, suspending agents , solvents, fillers, bulking agents, buffers, delivery vehicles, excipients, and/or pharmaceutical adjuvants. Representatively, a target compound (compound having biological activity or activity as an effective ingredient of a pharmaceutical agent), or a variant or a derivative thereof is provided in the form of a composition containing the compound, the variant or the derivative together with one or more physiologically acceptable carrier, excipient, or diluent.
The pharmaceutically acceptable substances used in the present invention are non-toxic to a recipient thereof and preferably are inactive in the dose and concentration used. For example, the pharmaceutically acceptable substances used in the present invention include, but are not limited to, organic acid salts such as acetate, citrate, and the like; ascorbic acid; α-tocopherol; low molecular weight polypeptides; proteins (e.g., serum albumin, gelatin or immunoglobulin); hydrophilic polymers (e.g., polyvinyl pyrrolidone) ; amino acids (e.g., glycin, glutamine, asparagine, arginine, lysin) ; monosaccharide, disaccharide and other carbohydrates (including glucose, mannose, dextrin); chelating materials (e.g., EDTA); sugar alcohols (e.g., mannitol, sorbitol); salt forming counterions (e.g., sodium) ; and/ornonionic surfactants (e.g. , Tween, pluronic, polyethylene glycol (PEG)).
(Biological chip/array)
As used herein, the term "chip" refers to a super-compact integrated circuit having various functions and acting as a part of the system. In this specification, the chip may be referred to as a "DNA chip" or "protein chip" in accordance with the substance which is to be mounted on the chip.
As used herein, the term "array" refers to a pattern of the substance immobilized on a substrate or a film or a patterned substrate itself. An array which is patterned on a small substrate (e.g., 10 x 10 mm) is referred to as . a "microarray" . In this specification, the term "array" and "microarray" are used interchangeably. Accordingly, an array patterned on a larger substrate may be referred to as a "microarray" . An array is formed of a set of desired polynucleotides immobilizedon asolid-phase surfaceorfilm. Anarrayhas preferablyat least 102 different polynucleotides, more preferablyat least 103 different polynucleotides , still more preferably at least 104 different polynucleotides, and stillmore preferably at least 105different polynucleotides . These polynucleotides are arranged on a regulated format to have a size of, for example, 125 x 80 mm or 10 x 10 mm.
As used herein, the term "address" refers to a unique position on a substrate, which can be distinguished from other unique positions. An address is appropriately associated with a microparticle bearing the address. Addresses can have any distinguishable shape such that substances at each address can be distinguished from substances at other addresses (e.g., optically). A shape defining an address maybe, for example, without limitation, a circle, an ellipse, a square, a rectangle, or an irregular shape.
The size of each address particularly depends on the size of the substrate, the numberof addresses on the substrate, the amount of the analytes and/or available reagents, the size of microparticles , and the level of resolution required for an arbitrary method used for the array. The size of each address may be, for example, in the range of from 1 to 2 nm to several centimeters, although the address may have any size, suited to an array.
The spatial arrangement and shape which define an address are designed so that the microarray is suited to aparticular application. Addresses maybe densely arranged or sparselydistributed, or subgrouped into a desiredpattern appropriate for a particular type of material to be analyzed.
Microarrays (also referred to as "DNA arrays" when DNA is placed on the substrate) are widely reviewed in, for example, in Saibo-Kogaku [ "Cell Engineering" ] , special issue, "DNA Microarray and Up-to-date PCR Method" , edited by Shujun-sha.
One exemplary labeling method for synthetic DNA microarrays is a two-fluorescence method. This method is performed as follows . Two different mRNA samples are tagged with different fluorescence-emitting labels, and competitivehybridizationis performedonthe samemicroarray to measure the fluorescence signals of the mRNA samples. By comparing the measured fluorescence signals , difference in gene expression is detected. As a fluorescent label, for example, Cy5 and Cy3 are most often used, but the usable fluorescent labels are not limited to these. An advantage of Cy5 and Cy3 is that the fluorescence wavelengths do not substantially overlap. The two-fluorescence method is usable to detect mutation or polymorphism as well as difference in gene expression.
In an assay using a DNA microarray, a fluorescence signal resulting from hybridization performed on the DNA microarray is detected by a fluorescence detector or the like . Various fluorescence detectors are available currently. For example, the group of Stanford University developed their original scanner, which is a combination of a fluorescence microscope and a movable stage (see, http://cmgm.stanford.edu/pbrown). Even FMBI0 (Hitachi Software Engineering, Co. , Ltd. ) , Storm (MolecularDynamics) or the like, which is a fluorescent image analyzer for gel, can read the DNA microarray unless the spot of DNA samples does not have a very high density. Other usable detectors include, for example, Scanarray 4000 and Scanarray 5000 (GeneralScanning; confocal type); GMS418 Array Scanner (Takara Bio Inc.; confocal type); Gene Tip Scanner (Nippon Laser & Electronics Lab. ; non-confocal type) ; and Gene Tac 2000 (Genomic Solutions; CCD camera type).
Since the amount of data obtained from the microarray is enormous , it is important to use appropriate data analysis software formanagingcorrespondencebetween clones and spots , and performing data analysis. As such software, software accompanying various types of software is usable (Ermolaeva Oetal. (1998) Nat . Genet .20:19-23) . As a database format , for example, GATC (genetic analysis technology consortium) proposed by Affymetrix is usable.
According to the present invention, a biological moleculewhich is to be placed on a solid-phase support (e.g. , DNA, RNA, polypeptides) may be prepared by a molecular biological technique using an organism derived substance (e.g., mRNA) or chemically synthesized by a method known in the art. Forexample, synthes s methods usinganautomatic solid-phase peptide synthesizer are described in the following: Stewart, J. M. etal. (1984) Solid Phase Peptide Synthesis, Pierce Chemical Co . ; Grant, G. A. (1992) Synthetic Peptides: AUser's Guide, W. H. Freeman; Bodanszky, M. (1993) Principles of Peptide Synthesis , Springer-Verlag; Bodanszky, M. et al. (1.994). The Practice of Peptide Synthesis, Springer-Verlag; Fields, G. B. (1997) PhasePeptide Synthesis , Academic Press; Pennington, M. W. et al. (1994) Peptide Synthesis Protocols, Humana Press; and Fields, G. B. (1997) Solid-Phase Peptide Synthesis, Academic Press. Oligonucleotides can be prepared by automatic chemical synthesis using any of the DNA synthesizers commercially available fromApplied Biosystems or the like. Compositions and methods for automatic oligonucleotide synthesis are disclosed by, for example, USP 4 , 415 , 732 issued to Caruthers et al. (1983); USP 4,500,707 issued to Caruthers (1985); USP 4,668,777 issued to Caruthers et al. (1987). Those skilled in the art can use these methods to prepare the biological molecules used in the present invention.
(Description of preferred embodiments of the present invention)
Hereinafter, the present inventionwill be described by way of preferred examples, which are provided for the purpose of illustration and are not intended to limit the scope of the present invention.
In one aspect of the invention, a composition for immobilizing a substance such as a biological molecule on a solid-state support is provided. The composition includes a complex of a substance to be immobilized and a substance having an opposite charge to the substance to be immobilized, and a salt (e.g., salts contained in the medium). It was found that by an unexpected effect provided by mixing the complex and the salt, the substance to be immobilized can be simply immobilized on the solid-phase support. Such immobilization provides the effect of, for example, (i) the substance, after immobilized, is sustain-released, and (ii) the substance, after immobilized, maintains or improves its cell affinity. The composition according to the present invention contains (a) a complex of a positively charged substance and anegatively charged substance; and (b) asalt. The substance to be immobilized may be either the positively charged substance or the negatively charged substance, or both of the substances .
Inonepreferredembodiment of the invention, at least one of the positively charged substance or the negatively charged substance has cell affinity. Whether a substance has cell affinity or not can be determined by evaluating whether or not a cell which is combined with the substance survives longer than when the substance is absent. Such survival of the cell can be specifically determined by measuring various parameters of cells. Advantageously, a substance having cell affinity allows the cell to survive longer.
In one preferred embodiment of the invention, both the positively charged substance and the negatively charged substance, have cell affinity. In such a case, it is preferable that the cell affinity is not lost even when both the substances form a complex, but the present invention is not limited to this .
Inonepreferredembodiment of theinvention, at least one of the positively charged substance and the negatively charged substance may be a biological molecule. The biological molecule may or may not be a subject of immobilization. Examples of the biological molecule usable in one preferred embodiment of the present invention include, but are not limited to, DNA (e.g. , genomic DNA, cDNA) , RNA (e.g. , mRNA) , peptides, lipids, sugars, lowmolecularweight organic molecules (e.g., members of combinatorial chemistry libraries), and complexes thereof (e.g., glycoproteins , glycolipids, nucleic acid peptides , lipoproteins) .
In one specific embodiment of the invention, the biological molecule to be immobilized may be a gene encoding molecule such as DNA. When DNA is treated for gene introduction such as transfection, use of the immobilization method provided by the present invention allows the DNA to be sustain-released continuously for a time period required for completion of the treatment (for about 15 minutes to about 30 minutes) . Thus, the present invention provides the effect of improving the efficiency of molecule introduction. Such an e fect of sustain-release was not previously achieved by any conventional method or was not sufficient . This is one significant effect provided by the present invention. The composition of the present invention maintains or improves its cell affinity after being immobilized. It was found that especially gene introduction such as transfection can be performed more efficiently and without damaging cells as compared to the conventional immobilization methods.
Inonepreferredembodiment of thepresent invention,, the negatively charged substance to be immobilized may be a 'biological molecule such as DNA, RNA, PNA, a peptide, or a complex thereof, or may be an anionic polymer or an anionic lipid, which is not a biological molecule.
Inonepreferredembodiment of thepresent invention, the positively charged substance to be immobilized may be or may not be a biological molecule. The positively charged substance to be immobilized may be, for example, a cationic polymer, a synthetic peptide such as a cationic lipid poly-L-lysine, or a derivative thereof. In a preferred embodiment of the present invention, the positively charged substance may be, for example, a transfection reagent , such as polyimine polymer, poly-L-lysine, synthetic polypeptide, or a derivative thereof, but is not limited to these.
In one specific embodiment of the present invention provided for the purpose of transfection on a solid-phase support, it is preferable to select negatively charged DNA as the substance to be immobilized and select positively charged DNA, such as polyimine polymer or the like as the complex partner. In this case, usable salts include salts having cell affinity (e.g. , salts used in media, salts used in the buffer solutions) , but are not limited to these. When transfection is intended, it is advantageous to combine all the salts contained in the media or the buffer solutions. Such a combination is usually preferable to cells . Examples of the media include, but are not limited to, Dulbecco's MEM, HAM 12 medium, cc MEM medium, and RPM1640 (e.g., commercially available from Nichirei Corporation) . Salts contained in such media include, but are not limited to, calcium chloride, potassium chloride, potassium phosphate, dipotassiumphosphate, magnesium chloride, sodium chloride, sodium phosphate, and disodium phosphate. The concentration of such salts may be appropriately adjusted by those skilled in the art, and is preferably substantially equal to the osmotic pressure of the cell.
In one preferred embodiment of the invention, the biological molecule to be immobilized is advantageously introduced to a cell and exhibits biological activity (e.g. , efficacy, enzyme activity, signal transmission, gene expression) . When gene expression is intended, the biological molecule maybe DNA containing a sequence encoding the gene. When signal transmission is intended, the biological molecule maybe a signal transmission stimulation agent (e.g., cytokine, specific ligand). When efficacy is intended, the biological moleculemaybe a chemical substance having efficacy. Examples of the chemical substance having efficacyinclude, but arenot limitedto, drugs forthe central
•nervous system, drugs for the peripheral nervous system, drugs for the sense organs , drugs for the circulatory system, drugs for the respiratory system, drugs for the digestive system, hormone drugs , drugs for the urinary system and drugs for the anus, drugs for the perithelium, drugs for the oral cavity, drugs for other individual organs, vitamin agents, nourishing agents, drugs for the blood and bodily fluids, drugs for dialysis, other metabolic pharmaceutical drugs (e.g.,- drugs for diseases of organs, detoxicating drugs, drugs for habitual addiction, antarthritics, enzymatic formulations , drugs for diabetes , metabolic drugs which cannotbeotherwise classified) , cellenergizingdrugs, drugs for tumors, radioactive pharmaceutical drugs, drugs for allergies, antibiotics, chemotherapeutic drugs, biological drugs , pharmaceutics , diagnostic drugs , extracorporeal diagnostic drugs, drugs which are not otherwise classified and are not mainly intended for treatment , and narcotics .
When use as a pharmaceutical agent is intended, it is preferable that the complex and the salt contained in the compositionof thepresent inventionarepharmaceutically acceptable . In another aspect of the invention, a device having a target substance immobilized therein is provided. In the device, a complex of a target substance (e.g. , a biological molecule such as DNA) and a substance having an opposite charge to the target substance, and a salt (e.g., salts contained in a medium) , are mixed and immobilized on a solid-phase support. It was found that by an unexpected effect provided by mixing the complex and the salt, the substance to be immobilized can be simply immobilized on the solid-phase support. Owing to such immobilization, the device according to the present invention provides the effect of, for example, (i) the substance, after immobilization, is sustain-released, and/or (ii) the substance, after immobilization, maintains or improves its cell affinity. Accordingly, the device of the present invention is provided in the form of a microtiter plate or an array (or a chip) used for an assay using an organism such as a cell or a part thereof, and is useful for an assay in which it is desired to sustain-release the substance to be immobilized (e.g., active component, DNA encoding gene expression) and/or to maintain cell affinity. In the case where it is preferable to sustain-release an effective ingredient, the device according to the present invention may be used as a pharmaceutical drug delivery medium. In such a case, the substances forming the complex, the salt , and the solid-phase support are desired to be biologically compatible and pre erablyto bepharmaceuticallyacceptable . Accordingly, the device according to the present invention includes (a) a complex of a positively charged substance and a negatively charged substance; (b) a salt; and (c) a solid-phase support having the complex and the salt immobilized thereon. The target substance may be a positively charged substance or a negatively charged substance. Alternatively, the complex formed may itself be the target substance.
In one preferred embodiment of the device according to the present invention, at least one of the positively charged substance and the negatively charged.substance has cell affinity. Preferably, the substance having cell affinity can improve the life of the cell, but the present invention is not limited to this. More preferably, both the positively charged substance and the negatively charged substance have cell affinity. In such a case, it is preferable that the cell affinity is not lost even when both the substances form a complex, but the present invention is not limited to this.
Examples of biological molecules usable in one preferred embodiment of the device according to the present invention include, but are not limited to, DNA (e.g. , genomic DNA, cDNA, members of genomic DNA/cDNA libraries ) , RNA (e.g. , mRNA or RNAi), peptides (e.g., members of proteomics libraries), lipids, sugars, low molecular weight organic molecules (e.g., members of combinatorial chemistry libraries) , complexes thereof (e.g. , glycoproteins , glycolipids , nucleic acid peptide composites , lipoproteins ) , and drugs.
In one preferred embodiment of the device according to the present invention, the positively charged substance and/or negatively charged substance and/or salt may be substances listed in the preferable examples of the composition of the present invention, but are not limited to these . Such substances and/or salts may be appropriately changed in accordance with the type or the properties of the target substance. Alternatively, such substances and/or salts can be appropriately selected by those skilled in the art in accordance with the type or the solid-phase support. As such substances and/or salts, those which are known as having an suitable property (e.g. , cell affinity) to the already selected type of solid-phase support may be selected, or the suitability may be confirmed before the preparation of the device by a preparatory test.
The solid-phase support used in the device of the present invention contains amaterial selected from the group consisting of glass, silica, silicon, ceramics, silicon dioxide, plastics, metals, naturally-occurring polymers, and synthetic polymers, but the material is not limited to these.
In one preferred embodiment of the device according to the present invention, the solid-phase support may be treated by coating. The coating can be performed with a coating material which is typically intended to be used for
~a solid-phase support, such as poly-L-lysine, silane, APS,
MAS, hydrophobic fluoroplastics, metals or the like. In one preferred embodiment of the invention, coating materials used in cell culture (e.g., poly-L-lysine, silane, APS, MAS, hydrophobic fluoroplastics, metals) may be used.
In one preferred embodiment of the device according to the present invention, the solid-phase support may be a chip. When the solid-phase support of the device of the present invention is a chip, the complex is preferably arrangedin an array. In suchacase , the device of thepresent invention is also referred to as an "array". In one preferred embodiment of the device according to the present invention, it is desired that the biological molecule has biological activity after being introduced into a cell. In such a case, the biological activities include, but are not limited to, efficacy, gene expression, enzyme activity, and signal transmission. When gene expression is intended, the biological molecule may be DNA containing a sequence encoding the gene. When signal transmission is intended,, the biological molecule may be a signal transmission stimulation agent (e.g., cytokines, specific ligands). When efficacy is intended, the biological molecule may be a chemical substance having efficacy. Compounds having efficacy can be selected from various compounds as described in other sections of this specification.
In one specific embodiment provided for the purpose of transfection on a solid-phase support, it is preferable to select negatively charged DNA as the substance to be. immobilized and select positively charged DNA, such as a polyimine polymer or the like as the complex partner. In this case, usable salts include salts having cell affinity (e.g., salts used in the medium, salts used in the buffer solution), but are not limited to these. Materials of the solid-phase support used in one preferred embodiment of the invention include, but are not limited to, glass slides (poly-L-lysine, silane, APS, MAS, hydrophobic fluorine resin, preferably coated with poly-L-lysine or the like) and polystyrene resin. Solid-phase supports coated with poly-L-lysine, silane, APS, MAS, hydrophobic fluorine resin or the like are preferable, since such supports are known as providing a preferable effect on cell affinity and transfection efficiency. In one specific embodiment of the present invention, the biological molecule to be immobilized may be a gene encoding molecule such as DNA. When DNA is treated for gene introduction such as transfection, use of the immobilization method provided by the present invention has achieved the effect of allowing the DNA to be continuously sustain-released for a time period required for completion of the treatment (for about 15 minutes to about 30 minutes) . Thus, the present invention provides the effect of improving the efficiency of molecule introduction . Such an effect of sustain-release was not previously achieved by any conventional method or was not sufficient . This is one significant effect provided by the present invention. It was found that especially gene introduction such as transfection can be performed more efficiently and without damaging cells as compared to by the conventional immobilization methods .
When the device of the present invention is used as apharmaceuticaldevice, the complex, the solid-phase support and the salt are preferably pharmaceutically acceptable.
In still another aspect of the invention, a method for immobilizing a substance on a solid-phase support is provided. According to such a substance immobilization method, a complex of a substance to be immobilized and a substance having an opposite charge to the substance to be immobilized, and a salt (e.g. , a salt contained in the media) are provided. It was found that owing to the unexpected effect provided by mixing the complex and the salt, the substance to be immobilized can be immobilized to a solid-phase support simply and without any need to select any special immobilization condition. The immobilization method of the present invention provides the effects that (i) the substance immobilized on a solid-phase support is sustain-released and/or (ii) the immobilized substance maintains or improves its cell affinity. Thus, the immobilization method according to the present invention includes the steps of (a) providing the solid-phase support; (b) providing a complex of a positively charged substance and a negatively charged substance; (c) providing a mixture of a salt and the complex; and (d) causing the mixture of the salt and the complex to adhere to the solid-phase support . The target substance may be a positively charged substance or a negatively charged substance, or both of the substances . Alternatively, the complex formed may itself be the target substance.
Theprovisionof the solid-phase support , the complex or the salt is within the scope of the technological common knowledge of those skilled in the art, and can be performed by those skilled in the art using techniques well known in the art without any undue experimentation. For example, commercially available solid-phase supports (e.g., glass slides, microtiter plates) may be used. For the salts and complex partners for the target substance, commercially available substances may be used. Alternatively, such a solid-phase support, salt or complex partner for the target substance may be chemically or biochemically synthesized or processed. The salt and the complex may be mixed in any method by which the interaction of the salt and the complex can be exhibited. The immobilization method according to the present invention is usable for preparing an assay device or a pharmaceutical drug delivery device. The usefulness of the immobilization method according to the present invention is broad.
In the immobilizationmethodof thepresent invention, the step of causing the mixture of the salt and the complex to adhere to the solid-phase support may be performed using any technique. This step may be performed manually (e.g. , pipetting) orautomatically (e. g. , usingaprintingtechnique of an ink jet printer or the like) . Preferably, the mixture can be caused to adhere using a print pin of an ink jet printer.
In one preferred embodiment of the method according to the present invention, at least one of the positively charged substance and the negatively charged substance has cell affinity. Preferably, .the substance having cell affinity can improve the life of the cell, but the present invention is not limited to this. More preferably, both the positively charged substance and the negatively charged substance have cell affinity. In such a case, it is preferable that the cell affinity is not lost even when both the substances form a complex, but the present invention is not limited to this .
Examples of thebiologicalmoleculewhichis intended to be immobilized by one preferred embodiment of the method according to the present invention include, but are not limited to, DNA (e.g. , genomic DNA, cDNA, members of genomic DNA/cDNA libraries ) , RNA (e.g. , mRNA or RNAi) , peptides (e.g. , members of proteomics libraries) , lipids , sugars , low molecular weight organic molecules (e.g., members of combinatorial chemistry libraries ) , complexes thereof (e.g. , glycoproteins , glycolipids, nucleic acid peptides, lipoproteins ) , and drugs . In one preferred embodiment of the method according to the present invention, the positively charged substance and/or negatively charged substance and/or salt may be substances listed in the preferable examples of the composition of the present invention, but are not limited to these. Such substances and/or salts may be appropriately changed in accordance with the type or the properties of the target substance. Alternatively, such substances and/or salts can be appropriately selected by those skilled in the art in accordance with the type or the solid-phase support. As such substances and/or salts, those which are known as having a suitable property (e.g., cell affinity) to the already selected type of solid-phase support may be selected, or the suitability may be confirmed before the preparation of the device by a preparatory test .
The solid-phase support used in the method of the present invention contains amaterial selected from the group consisting of glass, silica, silicon, ceramics, silicon dioxide, plastics, metals, naturally-occurring polymers, and synthetic polymers , but the material is not limited to these . Such a solid-phase support may be newly prepared or recycled for the method of the present invention. Advantageously, the solid-phase support is coated. Coating is especially advantageous for recycling.
In one embodiment of the method according to the present invention, the solid-phase support may be treated by coating. The method may include the step of coating the solid-phase support. Materials used for coating include, but are not limited to, poly-L-lysine, silane, APS, MAS,' hydrophobic fluoroplastics, metals or mixtures thereof. Any material which is usually intended to be used for a solid-phase support is usable.
In one preferred, embodiment of the method according to the present invention, the solid-phase support may be a chip. The method of the present invention is applicable to producing a compact and integrated device such as a chip. The usefulness of the method of the present invention is broad. In this case, the substance to be immobilized on the chip is preferably arranged in an array. In the case where the substance is in an array, the device of- the present invention is also referred tp as an "array". As such, the method of the present invention is applicable to producing a biological molecule array or a biological molecule chip . The chip or array produced by such a method is especially advantageous when used for a chip or array which requires sustain-releasability and/or cell affinity. The method of the present invention is especially useful for an array requiring a high integration degree and requiring simple immobilization and fine spotting.
In one preferred embodiment of the method according to the present invention, it is desired that the biological molecule has biological activity after introduction into a cell. In such a case, the biological activities include, but are not limited to, efficacy, gene expression, enzyme activity, and signal transmission. When gene expression is intended, the biological molecule may be DNA containing a sequence encoding the gene. When signal transmission is intended, the biological molecule may be a signal transmission stimulation agent (e.g., cytokines, specific ligands). When efficacy is intended, the biologipal molecule may be a chemical substance having efficacy. Compounds having efficacy can be selected from various compounds as described in other sections of this specification.
When the method of the present invention is used for such various purposes , the above-described steps (e.g., gene introduction such as transfection or the like, signal transmission measurement, drug delivery) may be performed after the immobilization of the present invention is achieved. Alternatively, the above-described steps may be performed in a certain period after the immobilization. For conserving the substance, it is preferable to perform a treatment such that sustain-releasing is not started (e.g. , to immerse the substance in a conservation solution which is different from the solution used for sustain-releasing; or to dry the substance) after the substance is immobilized by the method of the present invention.
In one specific embodiment provided for the purpose of transfection on a solid-phase support, it is preferable to select negatively charged DNA as the substance to be immobilized and select positively charged DNA, such as polyimine polymer or the like as the complex partner. In this case, usable salts include salts having cell affinity (e.g., salts used in the medium, salts used in the buffer solution), but are not limited to these. Materials of the solid-phase support used in one preferred embodiment of the invention include, but are not limited to, glass slides (poly-L-lysine, silane, APS, MAS, hydrophobic fluorine resin, preferably coated with poly-L-lysine or the like) and polystyrene resin. Solid-phase supports coated with poly-L-lysine, silane, APS, MAS, hydrophobic fluorine resin or the like are preferable, since such supports are known as providing a preferable effect on cell affinity and transfection efficiency. In this case, the method of the present invention preferably includes the step of coating.
In one specific embodiment of the method according to the present invention, the biological molecule to be immobilized may be a gene encoding molecule such as DNA. When DNA is treatedfor gene introduction such as transfection, use of the immobilization method provided by the present invention allows the DNA to be sustain-released continuously for a time period required for completion of the treatment (for about 15 minutes to about 30 minutes) . Thus, the present invention provides the effect of improving the efficiency of molecule introduction . Such an effect of sustain-release was not previously achieved by any conventional method or was not sufficient. This is one significant effect provided bythe present invention. Themethodof thepresent invention allows the substance tomaintain or improve its ceil affinity. Therefore, the method of the present invention provides an advantageous effect as compared to by the conventionalmethod in a state in which such an effect is expected (e.g., gene introduction such as transfection) .
When the method of the present invention is used for preparing a pharmaceutical drug, at least one of , preferably all of, the substance, salt and solid-phase support used are pharmaceutically acceptable.
In one preferred embodiment of the method according to the present invention, the step of providing the complex is performed under a condition in which the biological molecule is not destroyed. Such a condition in which the biological molecule is not destroyed can be appropriately and easily selected by those skilled in the art, in consideration of type of the complex partner and other conditions (e.g., pH, temperature) for complex formation, or by performing appropriate preliminary tests. Such selection of condition or performance of tests is within the scope of the technological common knowledge of those skilled in the art, and those skilled in the art can perform selection or tests without undue experimentation.
In onepreferredembodiment of the present invention, the step of providing a mixture of the salt and the complex is performed under a condition in which the biological molecule is not destroyed. Such a condition in which the biological molecule is not destroyed can be appropriately and easily selected by those skilled in the art, in consideration of type of the complex partner and other conditions (e.g. , pH, temperature) for complex formation, or by performing appropriate preliminary tests . Such selection of condition or performance of tests is within the scope of the technological common knowledge of those skilled in the art, and those skilled in the art can perform selection or tests "without undue experimentation.
In onepreferredembodiment of thepresent invention, the method advantageously further includes the step of reducing an amount of, or removing, a solvent in the mixture after the mixture is caused to adhere to the solid-phase support. Such reduction the amount of, or removal of, the solvent may be performed by natural drying, liophylization, or drying using a drying agent, but the present invention is not limited to these.
The compositions , devices and methods of the present invention are usable for humans, but may be used for other hosts (e.g. , mammals) . Accordingly, the composition of the present invention may be usable as an agricultural chemical.
The molecular biological techniques, biochemical techniques, andmicrobiological techniques described in this specification are well known in the art and commonly used. These techniques are described in, for example, Ausubel F. A. et al. Ed. (1988), Current Protocols in Molecular Biology, Wiley, New York, NY; Sambrook J et al. (1987), Molecular Cloning:1A Laboratory Manual, 2nd Edition, and 3rd Edition (2001), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and Jikken Kagaku [Experimental Chemistry] , special issue, "Gene introduction and expression analysis experimentalmethods" , Yodosha (1997) . Those skilled in the art can carry out the present invention referring to this well known literature when necessary.
Hereinafter, the present invention will be described by way of examples . The following examples are provided for the purpose of illustration, and the present invention is not limited to the following example but is limited only by the claims .
EXAMPLES
Hereinafter, the present inventionwill be described by way of specific examples. The reagents, supports and the like used in the following examples were commercially available from Sigma, Wako Pure Chemical Industries, Ltd. or the like, with some exceptions.
(Example 1: Preparation of compositions to be immobilized) In this example, DNA was selected as a target substance, and compositions for immobilizing the DNA to a solid-phase support was prepared.
As DNA, plasmids were prepared for transfectio . As plasmids, pEGFP-Nl and pDsRed2-Nl (both BD Bioscienσes, Clontech, CA, USA) were used. In these plasmids, gene expression is under the control of cytomegalovirus (CMV) . Plasmid DNAs were amplified using E. coli (XLl-blue, Stratgene, TX, USA), and the amplified plasmid DNAs were used as one complex partner. DNA was dissolved in DNase and RNase free distilled water.
As the other complex partner, transfection reagents were used. The transfection reagents used were as follows: Effectene Transfection Reagent (cat. no. 301425, Qiagen, CA, USA), TransFastTM Transfection Reagent (E2431, Promega, WI, USA), TfxTM-20 Reagent (E2391, Promega, WI , USA), SuperFect Transfection Reagent (301305, Qiagen,CA, USA), PolyFect Transfection Reagent (301105, Qiagen, CA, USA), LipofectAMINE 2000 Reagent (11668-019, Invitrogen Corporation, CA, USA), JetPEI (x4 )conc . (101-30, Polyplus-transfection, France), and ExGen 500 (R0511, Fermentas Inc., MD, USA).
These DNA plasmids and transfection reagents were dissolved in DNase and RNAse free distilled water, NaCl solution (0.9%), PBS buffer solution (Sigma), and Dulbecco ' s MEM Medium (supplied with glucose (4.5 g/L), L-glutamine and sodium pyruvate (Nacalai Tesque Inc. , Kyoto, Japan) and supplemented with 10% calf serum albumin (Dainippon Pharmaceutical Co., Ltd., Osaka, Japan)).
Glass slides, glass slides coatedwithpoly-L-lysine, silane, APS, PLL or MAS, and polystyrene microtiter plates were used as the solid-phase supports.
Mixed solutions of the dissolved complexes and salts were spotted on the respective solid-phase supports, and the resultant spots were air-dried. Thus, the target biological molecules were immobilized.
Next, the immobilized biological molecules were immersed in PBS, and the states of immobilization were confirmed. The confirmation was performed immediately after the immersion in PBS (0 minute later), in 5 minutes, in 10 minutes, in 15 minutes, in 20 minutes, in 25 minutes, in 30 minutes, in 40 minutes, in 50 minutes and in 60 minutes after the immersion, by visual observation and DNA, quantification.
(Results)
It was confirmed that with the compositions prepared using the mixtures of the complexes and the salts according to the present invention (NaCl solution, PBS buffer solution, Dulbecco ' s MEMMedium) , the immobilization was not destroyed even 15 minutes later. By contrast, it was confirmed that with the compositions prepared using distilled water, the immobilizationwas destroyed immediatelyafter the immersion in PBS and DNA flowed out . It was clearly demonstrated that the present invention provides a remarkable effect of immobilizing a substance. Regarding the compositions prepared using the salts, the immobilization was destroyed in a relatively short time period when a single salt (NaCl) was used. When a complex salt (PBS andDulbecco ' s MEMMedium) was used, the effect of immobilization was maintained for a longer time period than when the single salt was used. Especially when Dulbecco 's MEM Medium was used, the state of immobilization was remarkably kept even 30 minutes later.
(Example 2: Confirmation of cell affinity) Next, in order to confirm the effect of the present invention of providing cell affinity, cell transfection experiments were performed using the solid-phase supports having DNA immobilized thereon.
In this example, the effect was confirmed using the following five types of cells: human mesenchyme-system stem cells (hMSCs, PT-2, Cambrex BioScience Walkersville, Inc., MD, USA) , human embryonal renal cells (HEK293, RCB1637, RIKEN Cell Bank, Japan), NIH3T3-3 cells (RCB0150, RIKEN Cell Bank, Japan), HeLa cells (RCB0007, RIKEN Cell Bank, Japan), and HepG2 (RCB1648, RIKEN Cell Bank, Japan).
The plates having DNA immobilized thereon obtained in Example 1 were placed on dishes , and mediums containing the above-mentioned cells were each dropped thereupon. Then, the dishes accommodating the plates were transferred into an incubator, and the plates were incubated at 37°C for 2 or 3 days in a 5% C02 atmosphere to cause transfection.
(Observation of gene expression)
The state of gene expression was determined by observing fluorescence signals emitted by each of expression products (EEP, EGEP and DsRed2). For observing the fluorescence signals, a fluorescence microscope (IX-71, Olympus Promarketing Inc. , Japan) was used. The cells were immobilized with paraformaldehyde (PFA) (treated with 4% PFA at room temperature for 10 minutes) after reaction and observed in this state. (Results )
Figure 1 shows a part of the results of transfection. The upper photos show the results of transfection obtained with non-complexed DNA (upper photos) , and the lower photos show the results of transfection obtained with DNA complexed with a positively charged substance (treated with NP10). These photos show the state of transfection, immediately after the complex was placed on the solid-phase support (in 0 minutes) , and in 1 minute, in 5 minutes and in 10 minutes after the complex was placed on the solid-phase support.
As is clear from these results , in a system in which a composition of a complex and a salt was placed on a solid-phase support, the composition was immobilized on the solid-phase support and DNA was sustain-released.
It was also found that with the solid-phase supports having mixtures containing salts immobilized thereon according to the present invention, transfection occurred. This demonstrates that introduction of DNA into the cells , which was necessary to cause transfection, occurred in all of these cases. This means that the composition according to the present invention maintained or improved the cell affinity. The data regarding the release which was referred to in Example 1, and the fact that the transfection occurred, indirectly indicate that the immobilized substance was sustain-released.
Such an effect was not observed in a solution containingno salt . The results demonstrate that the present invention provides a remarkable effect . In a system using salts in a medium for immobilization, the transfection efficiency was higher than in a system using a single salt. From this, it is appreciated that use of a combination of salts suitable to the cell at the time of immobilization is appropriate to maintain or to improve the cell affinity.
(Example 3: Influence of the ratio of the complex partner and the salt)
Next, it was evaluated whether or not the ratio of a transfection reagent as a complex partner and a salt influences the efficiency of transfection, which is an index of immobilization and cell affinity.
As the transfection reagent, Jet-PEI (polyethylene imine) was used. As the salt, Dulbecco" s modified MEM (DMEM; salt amounts: CaCL (200 mg/L) , Fe(N03)3-9H20 (0.1 mg/L) , KCL
(400 mg/L), MgS04 (97.67 mg/L), NaCl (6400 mg/ml), NaHC03
(3700 mg/L), NaH2P04'H20 (125 mg/L)) was used.
The ratio of DNA, Jet-PEI, and the medium was as follows.
DNA amount (1 μg/μl) 1.0 μl 1.5 μl 2.0 μl
(1) NP3
Jet-PEI (7.5 mM) 1.2 μl 1.8 μl 2.4 μl DMEM 12.8 μl 11.7 μl 10.6μl
(2) NP5
Jet-PEI (7.5 mM) 2 μl 3 μl 4 μl
DMEM 12 μl 10.5 μl 9 μl
(3) NP10
Jet-PEI (7.5 mM) 4 μl 6 μl 8 μl
DMEM 10 μl 7.5 μl 5 μl (4) NP15
Jet-PEI (7.5mM) 6 μl 9 μl 12 μl
DMEM 8 μl 4.5 μl 1 μl
(Results)
Figure 2 shows the results of immobilization. More specifically. Figure 2 is a graph illustrating the progress of sustain-release obtained with NP3, NP5 and NP10.
As is clear from Figure 2, DNA was sustain-released in all of the systems .
A comparison of the results with NP3, NP5 and NP10 clearly shows that the progress of sustain-release and the transfection activity were substantially the same with all of the systems . This means the quantitative ratio of the salt and the transfection reagent (i.e., the complex) does not influence the effect of the present invention.
(Example 4: Application using arrays)
Next, larger-scale experiments were conducted to determine whether or not the above-described effect is demonstrated when arrays are used.
(Experimental protocols)
(Cell sources, culture media, . and culture conditions)
In this example, the following five different cell lines were used: humanmesenchymal stem cells (hMSCs, PT-2501, Cambrex BioScience Walkersville, Inc. , MD) , human embryonic kidney cell HEK293 (RCB1637, RIKEN Cell Bank, JPN) , NIH3T3-3 (RCB0150, RIKEN Cell Bank, JPN), HeLa (RCB0007, RIKEN Cell Bank, JPN), and HepG2 (RCB1648, RIKEN Cell Bank, JPN). In the case of human MSCs , cells were maintained in commercially available Human Mesenchymal Cell Basal Medium (MSCGM BulletKit PT-3001, Cambrex BioScience Walkersville, Inc., MD) . In the case of HEK293, NIH3T3-3, HeLa and HepG2 , cells were maintained in Dulbecco ' s Modified Eagle ' s Medium (DMEM, high glucose (4.5 g/L) with L-Glutamine and sodium pyruvate; 14246-25, Nakalai Tesque, JPN) with 10% fetal bovine serum (FBS, 29-167-54, Lot No. 2025F, Dainippon Pharmaceutical CO., LTD., JPN). All the cells were cultivated in an incubator controlled to be at 37°C in a 5% C02 atmosphere. In experiments involving hMSCs, the present inventors used hMSCs of that had been passaged less than five times, in order to avoid phenotypic changes .
(Plasmids and transfection reagents)
To evaluate the efficiency of transfection, the pEGFP-Nl and pDsRed2-Nl vectors (cat. no. 6085-1, 6973-1, BD Biosciences Clontech, CA) were used. The expression of both genes was under the control of cytomegalovirus (CMV) promoter. Transfected cells continuously expressed EGFP or DsRed2, respectively. Plasmid DNAs were amplified using Escherichia coli, XLl-blue strain (200249, Stratagene, TX) , and purified by EndoFree Plasmid Kit (EndoFree Plasmid Maxi Kit 12362, QIAGEN, CA) . In all the cases, plasmid DNA was dissolved in DNase and RNase free water. The following transfection reagents were used: Effectene Transfection Reagent (cat. no.301425, Qiagen, CA) , TransFast™ Transfection Reagent (E2431, Promega, WI), Tfx™-20 Reagent (E2391, Promega, WI) , SuperFeσt Transfection Reagent (301305, Qiagen, CA) , PolyFect Transfection Reagent (301105, Qiagen, CA) , LipofectAMINE 2000 Reagent (11668-019, Invitrogen corporation, CA) , JetPEI (x4) cone. (101-30, Polyplus-transfection, France), and ExGen 500 (R0511, Ferment as Inc . , MD ) .
(Production of solid-phase transfection array (SPTA))
The details of protocols for "reverse transfection" are described in the web site, "Reverse Transfection Homepage" (http://staffa.wi.mit.edu/sabatini_public/ reverse_transfection.htm). In the solid-phase transfection (SPTA method) of the present inventors, three types of glass slides were studied (silanized glass slides; APS slides , andpoly-L-lysine coated glass slides ; PLL slides , and MAS coated slides; Matsunami Glass, JPN) with a 48 square pattern (3 mm x 3 mm) separated by a hydrophobic fluoride resin coating.
(Preparation of plasmid DNA printing solution)
Two different ways to produce an SPTAwere developed. The main differences reside in the preparation of the plasmid DNA printing solution.
(Method A)
In the case of using Effectene Transfection Reagent , the printing solution containedplasmid DNA and cell adhesion molecules (bovine plasma fibronectin (cat. no. 16042-41, Nakalai Tesque, JPN), dissolved in ultra-pure water at a concentration of 4 mg/mL) . The above solution was applied on the surface of the slideusing an Inkjet printer (synQUAD™, Cartesian Technologies, Inc., CA) or manually, using a 0.5 to 10 μL tip. This printed slide was dried over 15 minutes at roomtemperature inasafetycabinet . Before transfection, total Effectene reagent was gently poured on the DNA-printed glass slide and incubated for 15 minutes at room temperature . The excess Effectene solution was removed from the glass slide using a vacuum aspirator and dried at room temperature for 15 minutes in a safety cabinet. The DNA-printed glass slide obtained was set in the bottom of a 100-mm culture dish, and approximately 25 mL of cell suspension (2 to 4xl04 cells/mL) was gently poured into the dish. Then, the dish was transferred to the incubator and incubated at 37°C in a 5% C02 atmosphere for 2 or 3 days.
(Method B)
In the case of other transfection reagents (TransFast™, Tfx™-20, SuperFect, PolyFect , LipbfectAMINE 2000, JetPEI (x4) cone. , or ExGen) , plasmidDNA, fibronectin, and the transfection reagent were mixed homogeneously in a 1.5-mL microtube according to the ratios indicated in the manu acturer's instructions, and incubated at room temperature for 15 minutes before printed on a chip. The printing solution was applied onto the surface of the glass slide using an Inkjet printer or a 0.5- to 10-μL tip. The printed glass slide was dried completely at room temperature over 10 minutes in a safety cabinet . The printed glass slide was placed in the bottom of a 100-mm culture dish, and approximately 3 mL of cell suspension ( 2 to 4xl04 σells/mL) was added and incubated at room temperature over 15 minutes in a safety cabinet. After incubation, fresh medium was poured gently into the dish. Then, the dish was transferred to an incubator and incubated at 37°C in a 5% C02 atmosphere for 2 to 3 days. After incubation, the present inventors observed the transfectants , using fluorescence microscopy (IX-71, Olympus PROMARKETING, INC., JPN), based on their expression of fluorescence-enhanced proteins (EFP, EGFP and DsRed2). Phase contrast images were taken with the same microscope. In both protocols, cells were immobilized by using a paraformaldehyde (PFA) immobilization method (4% PFA in PBS, treated for 10 minutes at room temperature). (Laser scanning and fluorescence intensity quantification) In order to quantify the transfection efficiency, the present inventors used a DNAmicro-array scanner (GeneTAC UC4x4, Genomic Solutions Inc. , MI) . The total fluorescence intensity (arbitrary units) was measured, and thereafter, the fluorescence intensity per surface area was calculated.
(Results) (Solid-phase transfection array of human mesenchymal stem cells)
The capacity of human Mesenchymal Stem Cells (hMSC) to differentiate into various kinds of cells is particularly intriguing in studies which target tissue regeneration and renewal. In particular, the analysis of transformation of these cells has attracted attention with the expectation of understanding the factors that control the pluripotency of hMSC. In conventional hMSC studies, it is not possible to perform transfection with desired genetic materials .
To achieve this , conventionalmethods include either a viral vector technique or electroporation. The present inventors developed a complex-salt system, which could be used to achieve solid-phase transfection which makes it possible to obtain high transfection efficiency to various cell lines (including hMSC) and special localization in high-density arrays. An outline of solid-phase transfection is shown in Figure 3A.
It was demonstrated that solid-phase transfection can be used to achieve a "transfection patch" capable of being used for in vivo gene delivery and a solid-phase transfection array (SPTA) for high-throughput genetic function research on hMSC.
Although a number of standard techniques are available for transfecting mammalian cells , it is known that it is inconvenient and very difficult to introduce genetic materialintohMSC as comparedwithcell lines , suchas HEK293 , HeLa, and the like. Conventional viral vector delivery and electroporation techniques are each important. However, these techniques have the following inconveniences : potential toxicity (for the viral technique); difficulty in high-throughput analysis at the genomic scale; and limited applications in in vivo studies (for electroporation) .
The present inventors developed a solid-phase support immobilized system which can be easily immobilized to a solid-phase support andhas sustained-releasecapability and cell affinity, whereby most of the above-described drawbacks could be overcome .
An example of the results of the above-described experiment is shown in Figure 3B. Thepresent inventors used this microprinting technique to immobilize a mixture of a selected genetic material, a transfection reagent, an appropriate cell adhesion molecule, and a salt onto a solid support. By culturing cells on a support having such a mixture immobilized thereon, the gene contained in the mixture was allowed to be taken in by the cultured cells. As a result, it became possible to allow support-adherent cells to take in DNA spatially separated therefrom (Figure 3B) .
As aresultofthis example, severalimportant effects were obtained: high transfection efficienc (thereby making it possible to study a group of cells having a statistically significant scale) ; low cross contamination between regions having different DNA molecules (thereby making it possible to study the effects of different genes separately) ; the extended survival of transfected cells; high-throughpu , highly compatible and simple detecting procedure. SPTA having these features serves as an appropriate basis for f rther studies .
To achieve the above-described objects, the present inventors studied five different cell lines (HEK293, HeLa, NIH3T3, HepG2 and hMSC) as described above with both this methodology (transfection in a solid-phase system) (see Figures 3A) and conventional liquid-phase transfection under, a series of transfection conditions. Cross contamination was evaluated for both systems as follows . Inthe caseof SPTA, weprintedDNA' s encodingaredfluorescent protein (RFP) and a green fluorescent protein (GFP) on glass supports in a checked pattern. In the case of experiments including conventional liquid phase transfection (where cells to be transfected cannot be spatially separated from one another spontaneously), GFP was used. Several transfection reagents were evaluated: four liquid transfection reagents (Effectene, TransFastM, TfxTM-20, LopofectAMINE 2000), two polyamine (SuperFect, PolyFect), and two polyimine (JetPEI (x4) and ExGen 500).
Transfection efficiency: transfection efficiency was determined as total fluorescence intensity per unit area (Figure 4A) . The results of liquid phase optimal to cell . lines used were obtained using different transfection reagents (see Figures 4C and 4D) . Next, these efficient transfection reagents were used to optimize a solid-phase protocol. Several tendencies were observed. For cell lines which are readily transfectable (e.g. , HEK293, HeLa, NIH3T3, etc.), the transfection efficiency observed in the solid-phase protocol was slightly superior to, but essentially similar to, that of the standard liquid phase protocol (Figure 4B) .
However, for cells which are difficult to transfect (e.g., hMSC, HepG2, etc.), the present inventors observed that transfection efficiency was increased up to 40 fold while the features of the cells were retainedunder conditions optimized to the SPTA methodology (see the above-described protocol and Figures 4C and 4D) . The results are shown in Figure 4B .
In the case of hMSC (Figures 5A and 5B) , the best conditions included use of a polyethylene imine (PEI) transfection reagent. As expected, important factors for achievinghightransfection efficiencyare the chargebalance (N/P ratio) between the number of nitrogen atoms (N) in the polymer and the number of phosphate residues (P) in plasmid DNA and DNA concentration. Generally, increases in the N/P ratio and the concentration lead to an increase in transfection efficiency. The present inventors also observed a significant reduction in the survival rate of hMSC cells in liquid phase transfection experiments where the DNA concentration was high and the N/P ratio was high. Because of these two opposing factors, the liquid phase transfection of hMSC had a relatively low cell survival rate (N/P ratio >10) . In the case of the SPTA protocol, however, a considerably high N/P ratio (fixed to the solid support) and DNA concentration were tolerable (probably attributed to the effect of the solid support stabilizing cell membrane) while the cell survival rate and the cellular state were not significantly affected. Therefore, this is probably responsible for the dramatic improvement in transfection efficienc . It was found that the N/P ratio of 10 was optimal for SPTA, and a sufficient transfection level was provided while minimizing cytotoxcity. Another reason for the increase in transfection efficiency observed in the case of the SPTA protocol is that a high, local ratio of the DNA concentration to the transfection reagent concentration was achieved (this leads to cell death in liquid phase transfection experiments).
The coating material used is crucial for the achievement of high transfection efficiency on chips. It was found that when a glass chip is used, PLL provided best
, results both for transfection efficiency and cross contamination (described below) . When fibronectin coating was not used, few transfectants were observed (all the other experimental conditions were retainedunchanged) . Although not completely established, fibronectin probably plays a role in accelerating cell adhesion processes (data not shown) , and thus , limiting the time which permits the diffusion of DNA released from the surface.
Low cross contamination: apart from the higher transfection efficiency observed in the SPTA protocol, an important advantage of the technique of the present invention is to achieve an array of separated cells , in which selected genes are expressed in the separate positions. The present inventors printed JetPEI (see the "Experimental protocols" section) and two different reporter genes (RFP and GFP) mixed with fibronectin on glass surface coate with fibronectin. The resultant transfection chip was sub ected to appropriate cell culture . Under experimental conditions which had been found to be best, expressed GFP and RFP were localized in regions, in which corresponding cDNA had been spotted. Substantially no cross contamination was observed (Figures 6Athrough6D) . In the absence of fibronectin or PLL, however, cross contamination significantly hindered solid-phase transfection was observed, and the transfection efficiency was significantly lower (see Figure 7). This result demonstrated the hypothesis that the relative proportion of plasmid DNA, which was released from the cell adhesion and the support surface, is a factor important for high transfection efficiency and high cross contamination.
Another cause of cross contamination may be the mobilityof transfectedcells on a solid support . Thepresent inventors measured both the rate of cell adhesion (Figure 6C) and the diffusion rate of plasmidDNA on several supports . As a result, substantially no DNA diffusion occurred under optimum conditions. However, a significant amount of plasmid DNA was diffused under high cross contamination conditions until cell adhesion was completed, so that plasmid DNA was diffused and depleted from the solid-phase surface.
This established technique is of particular importance in the context of cost-effective high-throughput gene function screening. Indeed, the small amounts of transfection reagent and DNArequired, as well as the possible automatization of the entire process (from plasmid isolation to detection) increase the utility of the above presented method.
In conclusion, the present invention successfully realized a hMSC transfection array in a system using complex-salt. With this technique, it Will be possible to achieve high-throughput studies using the solid-phase transfection, such as the elucidation of the genetic mechanism for differentiation of pluripotent stem cells . The detailed mechanism of the solid-phase transfection as well as methodologies for the use of this technology for high throughput, real time gene expression monitoring can be applied for various purposes .
(Example 5: RNAi transfection microarray)
Arrays wereproducedas describedinthe above example . As genetic material, mixtures of plasmid DNA (pDNA) and shRNA were used. The compositions of the mixtures are shown in Table 1.
Table 1
Figure imgf000069_0001
The results are shown in Figure 8. For each of the 5 cells , .the results of Figure 8 are converted,into numerical data in Figures 9A through 9E.
Thus , it was revealed that the method of the present invention is applicable to all cells . (Example 6: Use of RNAi microarray=siRNA)
Next , siRNA was used instead of shRNA to construct RNAi transfection microarrays in accordance with a protocol as described in Example 5.
18 transcription factor reporters and actin promoter vectors described in Table 2 were used to synthesize 28 siRNAs for the transcription factors. siRNA for EGFP was used as a control. Each siRNA was evaluated as to whether or not it knocks out a target transcription factor. Scrambled RNAs were used as negative controls , and their ratios were evaluated.
Table 2
Figure imgf000070_0001
Each cell was subjected to solid-phase transfection, followed by culture for two days . Images were taken using a fluorescence image scanner, and the fluorescent level was quantified.
(Results) The results are shown in Figure 10. The results were summarized for each gene in Figure 11A through 11D.
As shown in Figures 10 and 11A through 11D, when RNAi was used, the expression of each gene was specifically suppressed. Thus, it was demonstrated that an array having a plurality of genetic materials can be realized, and that with RNAi also, the effect of immobilizing the salt and the resulting effect of enhancing gene introduction are provided.
(Example 7: Transfection array using PCR fragments)
Next , it was demonstrated that the present invention could be implemented when PCR fragments were used as genetic materials. The procedure will be described below.
PCR was performed to obtain nucleic acid fragments as shown iii Figure 12. These fragments were used as genetic materials which were applied to transfection microarrays . The procedure will be described below.
PCR primers were:
GG ATAACCGTAT TACCGCCATG CAT ( SEQ ID NO . 1 ) ; and ccctatctcggtctattcttttg CAAAAGAATA GACCGAGATA GGG (SEQ ID NO. 2) .
pEGFP-Nl (see Figure 13) was used as a template.
PCR conditions were described in Table 3 below. Table 3
Figure imgf000072_0001
Cycle conditions : 94°C, 2 min → ( 94°C , 15 sec→60°C, 30 ,sec → 68°C, 3 min) → 4°C (the process in parenthesis was performed 30 times)
The resultant PCR fragment was purified with henol/chloroform extraction and ethanol precipitation.
10 The PCR fragment has the following sequence:
GG ATAACCGTAT TACCGCCATG CAT TAGTTATTAA TAGTAATCAA TTACGGGGTC ATTAGTTCAT AGCCCATATA TGGAGTTCCG
CGTTACATAA CTTACGGTAA ATGGCCCGCC TGGCTGACCG CCCAACGACC CCCGCCCATT GACGTCAATA ATGACGTATG TTCCCATAGT AACGCCAATA GGGACTTTCC ATTGACGTCA
15 ATGGGTGGAG TATTTACGGT AAACTGCCCA CTTGGCAGTA CATCAAGTGT ATCATATGCC AAGTACGCCC CCTATTGACG TCAATGACGG TAAATGGCCC GCCTGGCATT ATGCCCAGTA CATGACCTTA TGGGACTTTC CTACTTGGCA GTACATCTAC GTATTAGTCA TCGCTATTAC CATGGTGATG CGGTTTTGGC AGTACATCAA TGGGCGTGGA TAGCGGTTTG ACTCACGGGG ATTTCCAAGT CTCCACCCCA TTGACGTCAA TGGGAGTTTG TTTTGGCACC AAAATCAACG
20. GGACTTTCCA AAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCGCTA CCGGACTCAG ATCTCGAGCT CAAGCTTCGA ATTCTGCAGT CGACGGTACC GCGGGCCCGG GATCCACCGG TCGCCACCAT GGTGAGCAAG GG'CGAGGAGC TGTTCACCGG GGTGGTGCCC ATCCTGGTCG AGCTGGACGG CGACGTAAAC GGCCACAAGT TCAGCGTGTC. CGGCGAGGGC
25 GAGGGCGATG CCACCTACGG CAAGCTGACC CTGAAGTTCA TCTGCACCAC CGGCAAGCTG CCCGTGCCCT GGCCCACCCT CGTGACCACC CTGACCTACG GCGTGCAGTG CTTCAGCCGC TACCCCGACC ACATGAAGCA GCACGACTTC TTCAAGTCCG CCATGCCCGA AGGCTACGTC CAGGAGCGCA CCATCTTCTT CAAGGACGAC GGCAACTACA' AGACCCGCGC CGAGGTGAAG TTCGAGGGCG ACACCCTGGT GAACCGCATC GAGCTGAAGG GCATCGACTT CAAGGAGGAC GGCAACATCC TGGGGCACAA GCTGGAGTAC AACTACAACA GCCACAACGT CTATATCATG
GCCGACAAGC AGAAGAACGG CATCAAGGTG AACTTCAAGA TCCGCCACAA CATCGAGGAC GGCAGCGTGC AGCTCGCCGA CCACTACCAG CAGAACACCC CCATCGGCGA CGGCCCCGTG CTGCTGCCCG ACAACCACTA CCTGAGCACC CAGTCCGCCC TGAGCAAAGA CCCCAACGAG AAGCGCGATC ACATGGTCCT GCTGGAGTTC GTGACCGCCG CCGGGATCAC TCTCGGCATG GACGAGCTGT ACAAGTAAAG CGGCCGCGAC TCTAGATCAT AATCAGCCAT ACCACATTTG
TAGAGGTTTT ACTTGCTTTA AAAAACCTCC CACACCTCCC CCTGAACCTG AAACATAAAA TGAATGCAAT TGTTGTTGTT AACTTGTTTA TTGCAGCTTA TAATGGTTAC AAATAAAGCA ATAGCATCAC AAATTTCACA AATAAAGCAT TTTTTTCACT GCATTCTAGT TGTGGTTTGT CCAAACTCAT CAATGTATCT TAAGGCGTAA ATTGTAAGCG TTAATATTTT GTTAAAATTC GCGTTAAATT TTTGTTAAAT CAGCTCATTT TTTAACCAAT AGGCCGAAAT CGGCAAAATC
CCTTATAAAT ' CAAAAGAATA GACCGAGATA GGG ( SEQ ID NO . 3 ) .
Chips were produced using the PCR fragment . MCF7 was disseminated on the chips . After two days , images were obtained using a fluorescence image scanner . The results are shown in Figure 14 . In Figure 14 , the PCR fragment is compared with circular DNA . In either case , transfection was successful . It was revealed that the PCR fragment , which was used as a genetic material , could be transf ected into cells , as with full-length plasmids . It was confirmed that, with the PCR fragment also , the effect of immobilizing the salt and the resulting effect of enhancing gene introduction are provided .
(Example 8 : Types of supports )
Next , it is confirmed that the same effect of the salts are provided in the case where silica , silicon , ceramics , silicon dioxide , and plastics are used instead of glass . ■ These materials' are obtained from, for example, Matsunami Glass Ind.- Ltd. , and .arrays, are produced as described in the above examples .
As a result , the same effect of the salt is provided with the materials used.
(Example 9: Types of materials for coating the supports) It is confirmed that the same effect of the salt is provided in the case where glass supports coated with poly-L-lysine, silane, APS, MAS, hydrophobic fluoroplastics are used.
These materials are obtained from, for example,
Matsunami Glass Ind. Ltd. , and arrays are produced as described in the above examples .
As a result, the same effect of the salt is provided with the materials listed in this example used.
(Example 10: Types of salts)
It is confirmed that the same effect of the salt is provided in the case where calcium chloride, sodium hydrogen phosphate, sodiumhydrogen carbonate, sodiumpyruvate, HEPES, Tris, calcium chloride, sodiumchloride, potassiumchloride, magnesium sulfide, iron nitrate, amino acids and vitamins (here, vitamin B and vitamin C) are used.
These materials are obtained from, for example, Wako
Pure Chemical Industries, Ltd. (Osaka, Japan), and arrays are produced as described in the above examples. As a result, the same effect of the salt is provided with the materials listed in this example used.
(Example 11: Types of negatively charged substances) It is confirmed that the same immobilization effect same as above is provided by performing experiments as described above using RNA, PNA, polypeptide, and sugar peptide instead of DNA.
The immobilization effect can be confirmed by visual observation and in accordance with whether or not a specific antibody adheres to the supports .
As a result, the same effect of the salt is provided with the materials listed in this example used.
Although certain preferred embodiments have been described herein, it is not intended that such embodiments be construed as limitations on the scope of the invention except as set forth in the appended claims. Various other modifications and equivalents will be apparent to and can be readily made by those skilled in the art, after reading the description herein, without departing from the scope and spirit of this invention. All patents, published patent applications and publications cited herein are incorporated by reference as if set forth fully herein.
INDUSTRIAL APPLICABILITY
The present invention provides a method for immobilizing a substance to a solid-phase support. The method is unexpectedly simple and provides biocompatibility (e.g., cell affinity) and/or sustain-releasability of the substance. Such effects are usable to realize various biological phenomena, including gene introduction, signal transmission and efficacy, using a solid-phase support.

Claims

1. A composition for immobilizing a substance on a solid-state support, comprising: (a) a complex of a positively charged substance and a negatively charged substance; and (b) a salt.
2. A composition according to claim 1, wherein at least one of the positively charged substance and the negatively charged substance has cell affinity.
3. A composition according to claim 1, wherein both the positively charged substance and the negatively charged substance have cell affinity.
4. A composition according to claim 1 , wherein at least one of the positively charged substance and the negatively charged substance contains a biological molecule .
5. A composition according to claim 4 , wherein the biological molecule is selected from the group consisting of DNA, RNA, polypeptides, lipids, sugars, low molecular weight organic molecules , and complexes thereof .
6. A composition according to claim 1 , wherein the negatively charged substance is selected from the group consisting of DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof .
7. A composition according to claim 1 , wherein the positively charged substance is selected from the group consisting of cationic polymers , cationic lipids , cationic polyaminoacids , and complexes thereof . ,
8. A composition according to claim 1 , wherein the salt is selected from the group consisting of calcium chloride, sodiumhydrogen phosphate, sodiumhydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids , and vitamins .
9. A composition according to claim 4 , wherein the biological molecule has biological activitywhen introduced into a cell .
10. A composition according to claim 1, wherein the complex and the salt are pharmaceutically acceptable.
11. A device having a target substance immobilized therein, comprising:
(a) a complex of a positively charged substance and a negatively charged substance; (b) a salt; and
(c) a solid-phase support having the complex and the salt immobilized thereon, wherein the target substance is the positively charged substance and/or the negatively charged substance.
12. A device according to claim 11, wherein at least one of the positively charged substance and the negatively charged substance has cell affinity.
13. A device according to claim 11, wherein both the positively charged substance, and the negatively charged substance have cell affinity.
14. A. device according to claim 11, wherein at least one of the positively charged substance and the negatively charged substance contains a biological molecule.
15. A device according to claim 14, wherein the biological molecule is selected from the group consisting of. DNA, RNA, polypeptides, lipids, sugars, low molecular weight organic molecules, and complexes thereof.
16. A device according to claim 11, wherein the negatively charged substance is selected from the group consisting of DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof .
17. A device according to claim 11, wherein the positively charged substance is selected from the group consisting of cationic polymers , cationic lipids , cationic polyaminoacids , and complexes thereof.
18. A device according to claim 11, wherein the salt is selected from the group consisting of calcium chloride, sodiumhydrogenphosphate, sodiumhydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids, and vitamins.
19. A device according to claim 11, wherein the solid-phase support contains a material selected from the group consisting of glass, silica, silicon,' ceramics, silicon dioxide, plastics, metals, naturally-occurring polymers, and synthetic polymers.
20. A device according to claim 11, wherein the solid-phase support is treated by coating.
21. A device according to claim 20, wherein the coating is performed with a coating material containing a substance selected from the group consisting of poly-L-lysine, silane, APS, MAS, hydrophobic fluoroplastics , and metals.
22. A device according to claim 11, wherein the solid-phase support is a chip.
23. A device according to claim 11, wherein the solid-phase support is a chip, and the complex is arranged in an array on the chip.
24. A device according to claim 14, wherein the biological molecule has biological activitywhen introduced into a cell .
25. A device according to claim 11, wherein the complex, the salt andthematerial contained in the solid-phase support are pharmaceutically acceptable.
26. A method for immobilizing a substance on a solid-phase support, comprising the steps of:
(a) providing the solid-phase support; (b) providing a complex of a positively charged substance and a negatively charged substance;
(c) providing a mixture of a salt and the complex; and
(d) causing the mixture of the salt and the complex to adhere to the solid-phase support.
27. A method according to claim 26, wherein at least one of the positively charged substance and the negatively charged substance has cell affinity.
28. A method according to claim 26, wherein both the positively charged substance and the negatively charged substance have cell affinity.
29. A method according to claim 26, wherein at least one of the positively charged substance and the negatively charged substance contains a biological molecule.
30. A method according to claim 29, wherein the biological molecule is selected from the group consisting of DNA, RNA, polypeptides , lipids , sugars , low molecular weight organic molecules , and complexes thereof .
31. A method according to claim 26, wherein the negatively charged substance is selected from the group consisting of DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof .
32. A method according to claim 26, wherein the positively charged substance is selected from the group consisting of cationic polymers , cationic lipids , cationic polyaminoacids , and complexes thereof.
33. A method according to claim 26, wherein the salt is selected from the group consisting of calcium chloride, sodiumhydrogenphosphate, sodiumhydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids , and vitamins .
34. A method according to claim 26, wherein the solid-phase support contains a material selected from the group consisting of glass, silica, silicon, ceramics, silicon dioxide, plastics, metals, naturally-occurring polymers, and synthetic polymers.
35. A method according to claim 26, wherein the solid-phase support is treated by coating.
36. A method according to claim 35, wherein the coating is performed with a coating material containing a substance selected from the group consisting of poly-L-lysine, silane, APS, MAS, hydrophobic fluoroplastics έ and metals.
37. A method according to claim 26, wherein the solid-phase support is a chip.
38. A method according to claim 26, wherein the solid-phase support is a chip, and the complex is arranged in an array on the chip .
39. A method according to claim 29, wherein the biological molecule has biological activitywhen introduced into a cell .
40. A method according to claim 26, wherein the complex and the salt are pharmaceutically acceptable.
41. A method according to claim 29, wherein the step (b) is performed under a condition in which the biological molecule is not destroyed.
42. A method according to claim 29, wherein the step (c) is performed under a condition iri which the biological molecule is not destroyed.
43. A method according to claim 26, further comprising the step of reducing an amount of, or removing, a solvent in the mixture after the mixture is caused to adhere to the solid-phase support.
PCT/JP2004/002692 2003-03-04 2004-03-03 Composition and method for immobilizing a substance on a solid-phase support Ceased WO2004079331A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2006507659A JP2006519025A (en) 2003-03-04 2004-03-03 Compositions and methods for immobilizing a substance on a solid support

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2003-057868 2003-03-04
JP2003057868 2003-03-04

Publications (2)

Publication Number Publication Date
WO2004079331A2 true WO2004079331A2 (en) 2004-09-16
WO2004079331A3 WO2004079331A3 (en) 2005-08-25

Family

ID=32958776

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2004/002692 Ceased WO2004079331A2 (en) 2003-03-04 2004-03-03 Composition and method for immobilizing a substance on a solid-phase support

Country Status (2)

Country Link
JP (1) JP2006519025A (en)
WO (1) WO2004079331A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007043523A1 (en) * 2005-10-11 2007-04-19 Cytopathfinder, Inc. Transfection device
WO2007105528A1 (en) * 2006-03-06 2007-09-20 Cytopathfinder Inc. Transfection device
US10274453B2 (en) 2008-09-02 2019-04-30 The Governing Council Of The University Of Toronto Nanostructured microelectrodes and biosensing devices incorporating the same
US11366110B2 (en) 2011-01-11 2022-06-21 The Governing Council Of The University Of Toronto Protein detection method
CN119080402A (en) * 2024-08-27 2024-12-06 成都赋仁生物科技有限公司 Single molecule array chip with composite resin substrate and preparation method thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2136211B1 (en) * 2007-03-12 2013-08-07 The University of Tokushima Determination method for allergic disease
WO2011096408A1 (en) * 2010-02-02 2011-08-11 国立大学法人 東京大学 Fine composite particles and method of producing same, and pharmaceutical composition using fine composite particles
ES2606154T3 (en) * 2011-11-23 2017-03-23 The Governing Council Of The University Of Toronto Versatile and sensitive biosensor

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020006664A1 (en) * 1999-09-17 2002-01-17 Sabatini David M. Arrayed transfection method and uses related thereto
WO2002000870A2 (en) * 2000-06-26 2002-01-03 Christian Plank Method for transfecting cells using a magnetic field
FR2820434A1 (en) * 2001-02-05 2002-08-09 Centre Nat Rech Scient USE OF OLIGONUCLEOTIDES TO IMPROVE THE TRANSFECTION OF PLASMIDS INTO CELLS, TRANSFECTION METHOD AND KIT
US6905878B2 (en) * 2002-12-19 2005-06-14 The Scripps Research Institute DNA array for high throughput solid-phase transfection and method for producing the same

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007043523A1 (en) * 2005-10-11 2007-04-19 Cytopathfinder, Inc. Transfection device
WO2007105528A1 (en) * 2006-03-06 2007-09-20 Cytopathfinder Inc. Transfection device
US10274453B2 (en) 2008-09-02 2019-04-30 The Governing Council Of The University Of Toronto Nanostructured microelectrodes and biosensing devices incorporating the same
US11366110B2 (en) 2011-01-11 2022-06-21 The Governing Council Of The University Of Toronto Protein detection method
CN119080402A (en) * 2024-08-27 2024-12-06 成都赋仁生物科技有限公司 Single molecule array chip with composite resin substrate and preparation method thereof

Also Published As

Publication number Publication date
WO2004079331A3 (en) 2005-08-25
JP2006519025A (en) 2006-08-24

Similar Documents

Publication Publication Date Title
US6951757B2 (en) Transfection method and uses related thereto
KR101547295B1 (en) The Methods for Detecting Molecular Interactions
KR20230045612A (en) KRAB fusion inhibitors and methods and compositions for inhibiting gene expression
Wu et al. Origin-Specific Initiation of Mammalian Nuclear DNA Replication in aXenopusCell-Free System
KR20170131478A (en) System for presenting peptides on cell surface
CN108949794B (en) A kind of TALE expression vector and its rapid construction method and application
KR102067487B1 (en) Novel cell penetrating peptide comprising beta-defensin dimer and uses thereof
US20100144038A1 (en) Composition And Method For Increasing Efficiency Of Introduction Of Target Substance Into Cell
CN113549656A (en) Lentiviral vector expression system for polygene transformation
CN116726197A (en) Polypeptide-liposome nano composite particles, preparation method and application thereof
CN109055375A (en) A kind of CRISPR assists the method and its application of trans- enhancer activated gene expression
JP2006519025A (en) Compositions and methods for immobilizing a substance on a solid support
US20080242557A1 (en) System For Detecting Molecular Interactions
JP2007082402A (en) Compositions and methods for fixing genetic material to a support and introducing it into cells
US8143195B2 (en) Arrays for bringing two or more reagents in contact with one or more biological targets and methods for making and using the arrays
EP1333099A1 (en) Method of searching for gene encoding nuclear transport protein
JP4231920B2 (en) Disc-shaped biochip and reader thereof
US9488645B2 (en) Cell-based microarrays and methods of use
WO2004079007A2 (en) Time-lapse cell analysis method
CN111647629B (en) Method for reducing tandem connection of double-stranded DNA (deoxyribonucleic acid) fragments in CRISPR-Cas9 gene editing and application thereof
US20080038824A1 (en) Composition and Method for Elevating Gene Transfer Efficiency
JP2006006281A (en) Cell immobilization substrate and cell immobilization method
CN111518836A (en) Transfection agent for in vivo gene expression protein system and in vitro transfection method thereof
US20040214181A1 (en) Knockout reagent surrogate screening assay
JP2007259855A (en) Disc-shaped biochip and reader thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2006507659

Country of ref document: JP

122 Ep: pct application non-entry in european phase