WO2004079007A2 - Time-lapse cell analysis method - Google Patents

Time-lapse cell analysis method Download PDF

Info

Publication number
WO2004079007A2
WO2004079007A2 PCT/JP2004/002694 JP2004002694W WO2004079007A2 WO 2004079007 A2 WO2004079007 A2 WO 2004079007A2 JP 2004002694 W JP2004002694 W JP 2004002694W WO 2004079007 A2 WO2004079007 A2 WO 2004079007A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
time
lapse
profile
cells
Prior art date
Application number
PCT/JP2004/002694
Other languages
French (fr)
Other versions
WO2004079007A3 (en
Inventor
Masato Miyake
Tomohiro Yoshikawa
Eiichiro Uchimura
Jun Miyake
Original Assignee
National Institute Of Advanced Industrial Science And Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Institute Of Advanced Industrial Science And Technology filed Critical National Institute Of Advanced Industrial Science And Technology
Priority to JP2006507660A priority Critical patent/JP2006522605A/en
Publication of WO2004079007A2 publication Critical patent/WO2004079007A2/en
Publication of WO2004079007A3 publication Critical patent/WO2004079007A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M41/00—Means for regulation, monitoring, measurement or control, e.g. flow regulation
    • C12M41/46—Means for regulation, monitoring, measurement or control, e.g. flow regulation of cellular or enzymatic activity or functionality, e.g. cell viability
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M41/00—Means for regulation, monitoring, measurement or control, e.g. flow regulation
    • C12M41/48—Automatic or computerized control
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to the field of cell analysis technology. More specifically, the present invention relates to a method and system for observing and analyzing cells sequentially or over time.
  • screens for functional interference can be used to identifypeptides that perturb regulatoryprotein-protein interactions.
  • This strategy often referred to as dominant-interfering or dominant-negative genetics, has been successfully employed in several model organisms where high-throughput screening methods are easily applied and to a lesser extent in mammals, which traditionally have been less amenable to these types of screens.
  • dominant-negative strategies One advantage of dominant-negative strategies is that such strategies can pinpoint the functionally relevant protein-protein interactions "fulcrum points" and thereby expose the small number of nodes within the larger web of a protein network that are susceptible to functional modulation by external agents .
  • Rosetta Inpharmatics has proposed cellular information as a profile in some patent applications (WO01/006013, WO01/005935, WO00/39339, WO00/39338,
  • Biotechnology 14:1649; and WO01/006013 Biotechnology 14:1649; and WO01/006013 ) .
  • a number of genes in a cell can be simultaneously monitored.
  • arrays also have been utilized in the field of drug search (e.g., Marton et al.,
  • An object of the present invention is to provide a method and system for accurately presenting an actual state of a cell.
  • an object of the present invention is to provide a system and method for presenting cellular level information over time and/or in real time without modification or directly where the cell is considered as a complex system.
  • the above-described ob ects of the present invention were achieved by monitoring the transcription level associated with at least one transcription control sequence selected from transcription control sequences derived from a cell over time and presenting a time-lapse profile of the cell (in transcription).
  • the present invention provides the following.
  • a method for presenting a state of a cell comprising the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a gene state associated with at least one gene selected from genes derived from the cell; and b) presenting the time-lapse profile.
  • a method for determining a state of a cell comprising the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a gene state associated with at least one gene selected from genes derived from the cell; and b) determining the state of the cell based on the time-lapse profile of the gene state.
  • a method according to item 5 further comprising correlating the time-lapse profile with the state of the cell before obtaining the time-lapse profile.
  • transcription control sequence is selected from the group consisting of promoters, enhancers, silencers, other flanking sequences of structural genes in genomes, and genomic sequences other than exons .
  • transcription control sequences include at least one promoter selected fromthe group consistingof constitutivepromoters , specific promoters , and inducible promoters .
  • (21) Amethod according to item 20, wherein the transfection is performed in solid phase or in liquid phase.
  • (22) A method according to item 5, wherein the step of b) comprises a mathematical process selected from the group consisting of phase comparison, signal processing, and multivariate analysis, of the time-lapse profile.
  • step of b) comprises calculating a difference between the time-lapse profile of the cell and a control profile.
  • a method for correlating an external factor with a response of a cell to the external factor comprising the steps of: a) exposing the cell to the external factor; b) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; and c) correlating the external factor with the time-lapse profile.
  • a method according to item 26 further comprising dividing the at least two time-lapse profiles into categories and classifying the external factors corresponding to the respective time-lapse profiles into the categories.
  • a method according to item 26, wherein the step of ⁇ ) comprises distinguishing phases of the time-lapse profiles from one another.
  • X-ray a chemical substance, a pressure, a gravity change, a gas partial pressure, and an osmotic pressure.
  • a method for in erring an unidentified external factor given to a cell based on a time-lapse profile comprising the steps of: a) exposing the cell to a plurality of known external factors; b) obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from - li ⁇
  • the cell c) correlating the known external factors with the respective time-lapse profiles; d) exposing the cell to the unidentified external factor; e) obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of the transcription levelof the selectedtranscription control sequence; f) determining a profile corresponding to the time-lapse profile obtained in the step of e) from the time-lapse profiles obtained in the step of b); and g) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the step of f ) .
  • a method for inferring an unidentified external factor given to a cell based on a time-lapse profile comprising the steps of: a) providing data relating to a correlation relationship between known external factors and time-lapse profiles of the cell in response to theknown external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) exposing the cell to the unidentified external factor; c) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected transcription control sequence; d) determining a profile corresponding to the time-lapse profile obtained in the step of c) from the time-lapse profiles obtained in the step of a) ; and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the step of d) .
  • a system for presenting a state of a cell comprising: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b) means for presenting the time-lapse profile.
  • a system for determining a state of a cell comprising: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b) means for determining the state of the cell based on the time-lapse profile.
  • a system for correlating an external factor with a response of a cell to the external factor comprising: a) means forexposingthecell tothe externalfactor; b) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one promoter selected from the group consisting of promoters derived from the cell; and c) means for correlating the external factor with the time-lapse profile.
  • a system for inferring an unidentified external factor given to a cell based on a time-lapse profile comprising: a) means forexposingthe cell to apluralityof known external factors ; b) means for obtaining a time-lapse profile of the cell for each known external f ctor by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; c) means for correlating the known external factors with the respective time-lapse profiles; d) means for exposing the cell to the unidentified external factor; e) means for obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of thetranscriptionlevelof the selectedtranscriptioncontrol sequence; f) means for determining a profile corresponding to the time-lapse profile obtained in the means of e) from the time-lapse profiles obtained in the means of b); and g) means for determining that the unidentified external factor is the known external factor corresponding to the profile determined in the means of
  • a system for inferring an unidentified external factor given to a cell based on a time-lapse profile comprising: a) means forproviding datarelatingto a correlation relationship between known external factors and time-lapse profiles of the cell inresponse to theknown external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) means for exposing the cell to the unidentified external factor; c) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associatedwiththe selectedtranscription control sequenc ; d) means for determining a profile corresponding to the time-lapse profile obtained in the means of c) from the time-lapse profiles obtained in the means of a); and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the means of d) .
  • Figure 1 shows the results of experiments in which various a ⁇ tin acting substances and HEK293 cells were used, where gelatinwas used as a control.
  • Figure 1 shows an effect of each adhered substance (HEK cell) with respect to transfection efficiency.
  • the HEK cells were transfected with pEGFP-Nl using an Effectene reagent.
  • Figure 2 shows exemplary transfection efficiency when fibronectin fragments were used.
  • Figure 3 shows exemplary transfection efficiency when fibronectin fragments were used.
  • Figure 4 shows a summary of the results presented in Figures 2 and 3.
  • Figure 5 shows the results of an example in which trans ection efficiency was studied for various cells .
  • Figure 6 shows the results of transfection when various plates were used.
  • Figure 7 shows the results of transfection when various plates were used at a fibronectin concentration of 0, 0.27, 0.53, 0.8, 1.07, and 1.33 ( ⁇ g/ ⁇ L for each) .
  • Figure 7 shows the influence of fibronectin concentration and the surface modification on the transfection of HEK293 cells.
  • the data shows the average of 4 di ferent squares .
  • Figure 8 shows exemplary photographs showing cell adhesion profiles in the presence or absence of fibronectin.
  • Figure 9 shows exemplary cross-sectional photographs of cell adhesion profiles in the presence or absence of fibronectin.
  • Cross-sections of human mesenchymal stem cells were observed using a confocal laser scanning microscope.
  • hMSC human mesenchymal stem cells
  • hMSC were stained with SYT061 (blue fluorescence) and Texas red - X phalloidin (red luorescence) and fixed with 4% PFA.
  • Figure 10 shows transition of nuclear surface area. Relative nuclear surface area was determined by cross-sections of hMSC observed with cofocal laser scanning microscopy. hMSC was fixed with 4% PFA.
  • Figure 11 shows the results of an exemplary transfection experiment when a transfection array chip was constructed and used.
  • Figure 12 shows exemplary contamination between each spot on an array.
  • Figures 13A and 13B show an experiment in which spatially-spaced DNA was caused to be taken into cells by the solid phase transfection of the present invention in Example 4.
  • Figure 13A schematically shows a method for producing a solid phase transfection array (SPTA).
  • Figure 13B shows the results of solid phase transfection.
  • SPTA solid phase transfection array
  • a HEK293 cell line was used to produce a SPTA. Green colored portions indicate transfected adherent cells. According to this result, the method of the present invention can be used to produce a group of cells separated spatially and transfected with different genes .
  • Figure 13C shows a difference between conventional liquid phase transfection and SPTA.
  • Figures 14A and 14B shows the results of comparison of liquid phase transfection and SPTA.
  • Figure 14A shows the results of experiments where 5 cell lines were measured with respect to GFP intensity/mm 2 . Transfection efficiency was determined as fluorescence intensity per unit area.
  • Figure 14B shows fluorescence images of cells expressing EGFP corresponding to the data presented in Figure 14A.
  • White circular regions were regions in which plasmid DNA was fixed. In other regions, cells were also fixed in solid phase, however, cells expressing EGFP were not observed. The white bar indicates 500 ⁇ m.
  • Figure 1 ⁇ SC shows an exemplary transfection method of the present invention.
  • Figure 14D shows an exemplary transfection method of the present invention.
  • Figures 15A and 15B show the results of coating a chip , where by cross contamination was reduced.
  • Figures 15A and 15B show the results of liquid phase transfection and SPTA using HEK293 cells, HeLa cells, NIT3T3 cells (also referred to as "3T3" ) , HepG2 cells, and hMSCs . Transfection efficiency was represented by GFP intensity.
  • Figures 16A and 16B show cross contamination between each spot .
  • a nucleic acid mixture containing fibronectin having a predetermined concentration was fixed to a chip coated with APS or PLL (poly-L-lysine) . Cell transfection was performed on the chip. Substantially no cross contamination was observed (upper and middle rows). In contrast, significant chip cross contamination of fixed nucleic acids was observed on an uncoated chip (lower row) .
  • Figures 16C and 16D show a correlation relationship between the types of substances contained in a mixture used for fixation of nucleic acid and the cell adhesion rate.
  • the graph of Figure 16D shows an increase in the proportion of adherent cells over time. A longer time is required for cell adhesion when the slope of the graph is mild than when the slope of the graph is steep .
  • Figure 17 shows an exemplary configuration of a computer which was used to perform the method of the present invention.
  • Figures 181k and 1SB show exemplary mathematical analyses according to the present invention.
  • a profile of a promoter was obtained by measuring changes in fluorescence intensity. The profile was normalized using inherent fluorescence of cells or medium. Thereafter, the amplitudes of reporter expression fluctuations were compared where an expression fluctuation having an amplitude width of 5 or more (TH ⁇ 5) was considered to indicate the presence of a change . The measurement was made during the early period (0-17.5 hours) and the later period ( 17.5-31.5 hours) after the differentiation induction initiation andthe totalperiod (0-31.5 hours).
  • Expression fluctuation having an amplitude width of 5 or more (TH ⁇ 5) is represented by ( + ), while expression fluctuation having an amplitude width of less than 5 ( TH ⁇ 5 ) is representedby ( - ) .
  • n waves were integrated and the sum was divided by n to form an average wave.
  • a fluctuation of a threshold ormore was regarded as a change.
  • two reporter profiles were integrated and the average profile was drawn in red.
  • a fluctuation of an average profile of 5 or more was regarded as expression fluctuation. Fluctuation could be detected for the two reporters .
  • Figure 19 shows exemplary plasmids containing promoters used in the present invention and exemplary analyses of the present invention.
  • Figure 20 shows the results of exemplary mathematical analysis in the early period of differentiation induction. The results were obtained while changing combinations of arbitrarily extracted reporters at the early period of differentiation induction. An arbitrary number of reporters were extracted from 17 reporters. The average profile was calculated by the method shown in Figures ISH and 18B. Profiles having a fluctuation width of 5 or more were evaluatedat the intervals of 0-31.5 hours, 0-17.5 hours, and 17.5-31.5 hours . The number of extractions was 17 under each extraction condition (one exemplary combination by the 17 extractions is shown) . Figures 18A and 18B show the proportion of combinations which were considered to produce a fluctuation. According to the analyses, differentiation induction could not be detected at the very early period, however, differentiation induction could be detected after about 15 hours. When the number of extracted reporters was 8, the proportion of combinations, which were confirmed to produce a fluctuation, was 100%.
  • Figure 21 shows the results of exemplary mathematical analysis in the maintenance of undifferentiated states .
  • a combination of arbitrarily extracted reporters was changed under undifferentiated state maintaining conditions. The results were significantly different from when differentiation induction was performed in Figure 20. By comparing with Figure 20, it is considered to be possible to determine whether a cell is induced into differentiation or maintained in an undifferentiated state.
  • Figure 22 schematically shows a cocktail party process .
  • Figure 23 shows an exemplary construct of a gene transcription switch reporter used in a transfection plasmid of the present invention.
  • Figure 24 shows exemplary construction of a set of transcription factor reporters.
  • Figure 25 shows the results of exemplaryassays using transcription factor reporters.
  • Figure 26 shows exemplary time-series measurement of the activity of a transcription factor in the bone differentiation process.
  • Human mesenchymal stem cells available from Osiris
  • hMSC Osteogenic SingleQuots available from Osiris
  • Figure 27 shows exemplary oscillation phenomenon and phase analysis of the activity of transcription factors.
  • Figure 28 shows an exemplary real time measuring device .
  • Figure 29 shows a schematic, enlarged view of the cell measuring device of Figure 28.
  • Figure 30 shows a scheme of cell measurement.
  • Figure 31 shows an exemplary grid array used in the present invention. Names of genes used are shown in the lower left portion of the figure.
  • Figure 32 shows raw data obtained using a grid array in the present invention.
  • Figure 3323 shows a graph of raw data obtained in Example 5.
  • the vertical axis represents fluorescence intensity (Arbitrary Unit), while the horizontal axis represents time (unit: minute (min)).
  • the following genes were used: pEGFP-Nl, pAPl-EGFP, pAPl(PMA) -EGFP, pE2F-EGFP, pGAS-EGFP, pHSE-EGFP, pMyc-EGFP, pNFkB-EGFP, pRb-EGFP, pSRE-EGFP, pp53-EGFP, pCRE-EGFP, pERE-EGFP, pGRE-EGFP, pISRE-EGFP, pNFAT-EGFP, pRARE-EGFP, pSTAT3-EGFP, pTRE-EGFP, pCREB-EGFP, plkB-EGFP, pp53-EGFP (Signaling probe), and pCaspase3-Sen
  • Figures 33B to 33E show raw data obtained in Example 5.
  • Figures 33F to 331 show the results of calculation after polynominal approximation of the data obtained in Example 5.
  • Figures 33J to 33U show the results of first-order differentiation and second-order differentiation of the data obtained in Example 5.
  • Figures 34-1 to 34-55 show raw data obtained in
  • Example 5 for each gene (negative controls are represented by "none” ) .
  • Figure 34-1 shows time-lapse data of EGFP-N1.
  • Figure 34-2 shows time-lapse data of API.
  • Figure 34-3 shows time-lapse data of APl(PMA).
  • Figure 34-4 shows time-lapse data of CRE .
  • Figure 34-5 shows time-lapse data of E2F.
  • Figure 34- ⁇ shows time-lapse data of none.
  • Figure 34-7 shows time-lapse data of EGFP-N1.
  • Figure 34-8 shows further time-lapse data of API.
  • Figure 34-9 shows further time-lapse data of APl(PMA) .
  • Figure 34-10 shows further time-lapse data of CRE.
  • Figure 34-11 shows further time-lapse data of E2F.
  • Figure 34-12 shows time-lapse data of ERE.
  • Figure 34-13 shows time-lapse data of GAS.
  • Figure 34-14 shows time-lapse data of GRE .
  • Figure 34-15 shows time-lapse data of HSE.
  • Figure 34-16 shows time-lapse data of ISRE.
  • Figure 34-17 shows further time-lapse data of none.
  • Figure 34-18 shows further time-lapse data of ERE.
  • Figure 34-19 shows further time-lapse data of GAS.
  • Figure 34-20 shows further time-lapse data of GRE,
  • Figure 34-21 shows time-lapse data of HSE.
  • Figure 34-22 shows time-lapse data of ISRE.
  • Figure 34-23 shows time-lapse data of Myc.
  • Figure 34-24 shows time-lapse data of NFAT.
  • Figure 34-25 shows time-lapse data of NFKB.
  • Figure 34-26 shows time-lapse data of RARE.
  • Figure 34-27 shows time-lapse data of Rb.
  • Figure 34-28 shows further time-lapse data of none.
  • Figure 34-29 shows time-lapse data of Myc.
  • Figure 34-30 shows further time-lapse data of NFAT
  • Figure 34-31 shows further time-lapse data of NFKB
  • Figure 34-32 shows further time-lapse data of RARE.
  • Figure 34-33 shows further time-lapse data of Rb
  • Figure 34-34 shows time-lapse data of STAT3.
  • Figure 34-35 shows time-lapse data of SRE.
  • Figure 34-36 shows time-lapse data of TRE.
  • Figure 34-37 shows time-lapse data of p53.
  • Figure 34-38 shows time-lapse data of Caspase3.
  • Figure 34-39 shows further time-lapse data of none.
  • Figure 34-40 shows time-lapse data of STATS.
  • Figure 34-41 shows further time-lapse data of SRE.
  • Figure 34-42 shows further time-lapse data of TRE.
  • Figure 34-43 shows further time-lapse data of p53.
  • Figure 34-44 shows further time-lapse data of Caspase3.
  • Figure 34-45 shows time-lapse data of CREB-EGFP.
  • Figure 34-46 shows time-lapse data of IKB-EGFP.
  • Figure 34-47 shows time-lapse data of pp53-EGFP.
  • Figure 34-48 shows further time-lapse data of none.
  • Figure 34-49 shows further time-lapse data of none.
  • Figure 34-50 shows further time-lapse data of none.
  • Figure 34-51 shows further time-lapse data of CREB-EGFP.
  • Figure 34-52 shows further time-lapse data of IKB-EGFP.
  • Figure 34-53 shows further time-lapse data of pp53-EGFP.
  • Figure 34-54 shows further time-lapse data of none.
  • Figure 34-55 shows further time-lapse data of none.
  • Figure 35 shows the results of transfection using an RNAi transfection array of Example 7.
  • Each reporter gene was printed on a solid phase substrate at a rate of 4 points per gene. The substrate was dried.
  • siRNA 28 types
  • siRNA for EGFP was used.
  • scramble RNA was used.
  • LipofectAMINE2000 was printed onto the same coordinates of each gene, followed by drying.
  • fibronectin solution was printed onto the same coordinates of each gene.
  • HeLa-K cells were plated on the substrate, followed by culture for 2 days. Thereafter, images were taken using a fluorescence image scanner.
  • Figures 36A to 36E show the results of transfection using the RNAi transfection array of Example 7 or each cell.
  • D+G, etc. D was printed before G was printed (the order of printing is as written).
  • Figure 37 shows the results of transfection using an RNAi transfection array of Example 8.
  • Each reporter gene expression unit PCR fragment was printed on a solid phase substrate at a rate of 4 points per gene. The substrate was dried.
  • siRNA 28 types
  • siRNA for EGFP was used.
  • scramble RNA was used.
  • LipofectAMINE2000 was printed onto the same coordinates of each gene, followed by drying.
  • fibronectin solution was printed onto the same coordinates of each gene.
  • HeLa-K cells were platedon the substrate , followedby culture for 2 days. Thereafter, images were taken using a fluorescence image scanner .
  • Figure 38A to 38D show the results of transfection using the RNAi transfection array of Example 7 for each cell .
  • the fluorescence intensity of each reporter was quantified by image analysis, and thereafter, compared with the intensity of each reporter gene to which scramble RNA (negative control) wasprinted, therebycalculating the ratio. The results are shown for all reporters and all cells.
  • Figure 39 shows a structureof aPCRfragment obtained in Example 9.
  • Figure 40 shows a structure of pEGFP-Nl.
  • Figure 41 shows the result of comparison of transfection efficiency of transfection microarrays using cyclic DNA and PCR fragments.
  • Figure 42 shows changes when a tetracycline dependent promoter was used.
  • Figure 43 shows the results of expression when a tetracycline dependent promoter and a tetracycline independent promoter were used.
  • Figure 44 shows an exemplary configuration of a system of the present invention for producing cellular profile data.
  • SEQ ID NO . : 1 a nucleic acid sequence of fibronectin (human)
  • SEQ ID NO. : 2 an amino acid sequence of fibronectin (human)
  • SEQ ID NO . : 3 a nucleic acid sequence of vitronectin (mouse)
  • SEQ ID NO. : 4 an amino acid sequence of vitronectin (mouse)
  • SEQ ID NO.: 5 a nucleic acid sequence of laminin
  • SEQ ID NO . : 6 an amino acid sequence of laminin (mouse ⁇ -chain) SEQ ID NO. • 7 • a nucleic acid sequence of laminin
  • SEQ ID NO. : 8 an amino acid sequence of laminin
  • SEQ ID NO. : 9 a nucleic acid sequence of laminin
  • SEQ ID NO. : 10 an amino acid sequence of laminin
  • SEQ ID NO.: 15 mouse olfactory receptor 17 (heptanal-sensitive) nucleic acid (Genbank Accession No. AF106007)
  • SEQ ID NO . : 16 a protein encoded by the nucleic acid set forth in SEQ ID NO.: 15
  • SEQ ID NO . : 17 mouse olfactory receptor S46 nucleic acid (Genbank Accession No. AF121979)
  • SEQ ID NO. : 18 a protein encoded by the nucleic acid set forth in SEQ ID NO. : 17
  • SEQ ID NO.: 19 mouse G protein ⁇ -subunit nucleic acid (Genbank Accession No. M36778)
  • SEQ ID NO. : 20 a protein encodedby the nucleic acid set forth in SEQ ID NO. : 19
  • SEQ ID NO.: 21 mouse G protein ⁇ -subunit nucleic acid (Genbank Accession No. M87286)
  • SEQ ID NO . : 22 a protein encoded by the nucleic acid set forth in SEQ ID NO. : 21
  • SEQ ID NO.: 23 mouse G protein ⁇ -subunit nucleic acid (Genbank Accession No. U37527)
  • SEQ ID NO. : 24 a protein encoded by the nucleic acid set forth in SEQ ID : 23
  • cell is herein used in its broadest sense in the art, referring to a structural unit of tissue of a multicellularorganism, whichis capableof selfreplicating, has genetic information and a mechanism for expressing it, and is surrounded by a membrane structure which isolates the cell from the outside.
  • Cells used herein may be either naturally-occurring cells or artificially modified cells (e.g., fusion cells, genetically modified cells, etc.).
  • Examples of cell sources include, but are not limited to, a single-cell culture; the embryo, blood, or body tissue of normally-grown transgenic animal; a mixture of cells derived from normally-grown cell lines; and the like.
  • Cells used herein may be derived from any organism (e.g., any unicellular organisms (e.g., bacteria and yeast ) or any multicellular organisms (e.g., animals (e.g., vertebrates and invertebrates), plants (e.g., monocotyledons and dicotyledons, etc.)).
  • cells used herein are derived from a vertebrate (e.g., Myxiniformes , Petronyzoniformes, Chondrichthyes, Osteichthyes , amphibian, reptilian, avian, mammalian, etc.
  • mammalian e.g., monotremata, marsupialia, edentate, dermoptera, chiroptera, carnivore, insectivore, probos ⁇ idea, perissodactyla, artiodactyla, tubulidentata, pholidota, sirenia, cetacean, primates, rodentia, lagomorpha, etc.
  • cells derived from Primates e.g. , chimpanzee, Japanesemonkey, human
  • cells derived from a human are used.
  • the above-described cells maybe either stem cells or somatic cells.
  • the cells may be adherent cells, suspended cells, tissue forming cells, andmixtures thereof .
  • the cells may be used for transplantation.
  • any organ may be targeted by the present invention.
  • a tissue or cell targeted by the present invention may be derived from any organ.
  • the term "organ” refers to a morphologically independent structure localized at a particular portion of an individual organism in which a certain f nction is performe .
  • Inmulticellular organisms e.g., animals , plants
  • an organ consists of several tissues spatially arranged in a particular manner, each tissue being composed of a number of cells.
  • An example of such an organ includes an organ relating to the vascular system.
  • organs targetedbythepresent invention include, but are not limited to, skin, bloodvessel, cornea, kidney, heart, liver, umbilical cord, intestine, nerve, lung, placenta, pancreas, brain, peripheral limbs, retina, and the like .
  • Examples of cells differentiated frompluripotent cells include epidermic cells , pancreaticparenchymal cells , pancreatic duct cells, hepatic cells, blood cells, cardiac muscle cells, skeletal muscle cells , osteoblasts, skeletal myoblasts, neurons, vascular endothelial cells, pigment cells, smooth muscle cells, fat cells, bone cells, cartilage cells, and the like.
  • tissue refers to an aggregate of cells having substantially the same function and/or form in a multicellular organism.
  • tissue is typically an aggregate of cells of the same origin, but may be an aggregate of cells of different origins as long as the cells have the same function and/or form. Therefore, when stemcells of thepresent invention areusedto regenerate tissue, the tissue may be composed of an aggregate of cells of two or more different origins.
  • a tissue constitutes apart of an organ. Animal tissues are separated into epithelial tissue, connective tissue, muscular tissue, nervous tissue, and the like, on amorphological, functional, or developmentalbasis . Plant tissues are roughly separated into meristematic tissue and permanent tissue according to the developmental stage of the cells constituting the tissue. Alternatively, tissues may be separated into single tissues and composite tissues according to the type of cells constituting the tissue. Thus, tissues are separated into various leg .
  • stem cell 11 refers to a cell capable of self replication and pluripotency. Typically, stem cells can regenerate an in ured tissue.
  • Stem cells used herein may be, but are not limited to, embryonic stem (ES) cells or tissue stem cells (also called tissular stem cell, tissue-specific stem cell, or somatic stem cell) .
  • ES embryonic stem
  • tissue stem cells also called tissular stem cell, tissue-specific stem cell, or somatic stem cell
  • a stem cell maybe an artificiallyproducedcell (e.g. , fusion cells, reprogrammed cells, or the like used herein) as long as it can have the above-described abilities.
  • Embryonic stem cells are pluripotent stem cells derived from early embryos . An embryonic stem cell was first established in 1981, which has been applied to production of knockout mice since 1989.
  • Tissue stem cells have a relatively limited level of differentiation unlike embryonic stem cells.
  • Tissue stem cells are present in tissues and have an undifferentiated intracellular structure.
  • Tissue stem cells have a higher nucleus/cytoplasm ratio and have few intracellular organelles .
  • Most tissue stemcells havepluripotency, a long cell cycle, and proliferative ability beyond the life of the individual.
  • stem cells may be preferably embryonic stem cells, though tissue stem cells may also be employed depending on the circumstance.
  • Tissue stem cells are separated into categories of sites from which the cells are derived, such as the dermal system, the digestive system, the bone marrow system, the nervous system, and the lik .
  • Tissue stem cells in the dermal system include epidermal stem cells , hair follicle stem cells , and the like.
  • Tissue stem cells in the digestive system include pancreatic (common) stem cells, liver stem cells, and the like.
  • Tissue stem cells in the bone marrow system include hematopoietic stem cells, mesenchymal stem cells, and the lik .
  • Tissue stem cells in the nervous system include neural stem cells, retinal stem cells, and the like.
  • somatic cell refers to any cell other than a germ cell, such as an egg, a sperm, or the like, which does not transfer its DNA to the next generation. Typically, somatic cells have limited or no pluripotency. Somatic cells used herein may be naturally-occurring or genetically modified as long as they can achieve the intended treatment .
  • the origin of a stem cell is categorized into the ectoderm, endoderm, or mesoderm.
  • Stem cells of ectodermal origin are mostly present in the brain, including neural stem cells .
  • Stem cells of endodermal origin are mostly present in bone marrow, including blood vessel stem cells, hematopoietic stem cells, mesenchymal stem cells, and the like.
  • Stem cells of mesoderm origin are mostly present in organs, including liver stem cells, pancreas stem cells, and the like.
  • Somatic cells may be herein derived from any germ layer.
  • somatic cells such as lymphocytes , spleen cells or testis-derived cells, may be used.
  • isolated means that naturally accompanying material is at least reduced, or preferably substantially completely eliminated, in normal circumstances. Therefore, the term “isolated cell” refers to a cell substantially free from other accompanying substances (e.g. , othercells, proteins, nucleicacids, etc. ) in natural circumstances.
  • isolated 177 in relation to nucleic acids or polypeptides means that, for example, the nucleic acids or the polypeptides are substantially free from cellular substances or culture media when they are produced by recombinant DNA techniques; or precursory chemical substances or other chemical substances when they are chemically synthesized.
  • Isolated nucleic acids are preferablyfreefromsequences naturallyflankingthenucleic acidwithin an organism fromwhich the nucleic acid is derived (i.e., sequences positioned at the 5' terminus and the 3' terminus of the nucleic acid) .
  • the term "established" in relation to cells refers to a state of a cell in which a particular property (pluripotency) of the cell is maintained and the cellundergoes stable proliferation underculture conditions .
  • differentiatedcell refers to a cell having a specialized function and form (e.g. , muscle cells, neurons, etc.). Unlike stem cells, differentiated cells have no or little pluripotency. Examples of differentiated cells include epidermic cells, pancreatic parenchymal cells, pancreatic duct cells, hepatic cells, blood cells , cardiac muscle cells , skeletal muscle cells , osteoblasts, skeletal myoblasts, neurons, vascular endothelial cells, pigment cells, smooth muscle cells, fat cells, bone cells , cartilage cells , and the like.
  • the term "state” refers to acondition concerning various parameters of a cell (e.g., cell cycle, response to an external factor, signal transduction, gene expression, gene transcription, etc.). Examples of such a state include, but are not limited to, dif erentiated states , undifferentiated states, responses to external factors, cell cycles, growth states, and the like.
  • the term “gene state” refers to any state associated with a gene (e.g., an expression state, a transcription state, etc.).
  • differentiation refers to a phenomenon where two or more types of cells having qualitative differences in form and/or function occur in a daughter cell population derived from the division of a single cell. Therefore, “differentiation” includes a process during which a population (family tree) of cells , which do not originally have a specific detectable feature, acquire a feature, such as production of a specific protein, or the like.
  • cell differentiation is generally considered to be a state of a cell in which a specific group of genes in the genome are expressed. Cell differentiation can be identified by searching for intracellular or extracellular agents or conditions which elicit the above-described state of gene expression. Differentiated cells are stable in principle. Particularly, animal cells which have been once differentiated are rarely differentiated into other types of cells .
  • the term “pluripotency” refers to a nature of a cell, i.e., an ability to differentiate into one or more, preferably two or more, tissues or organs. Therefore, the terms “pluripotent” and “undifferentiated” are herein used interchangeably unless otherwise mentioned.
  • the pluripotency of a cell is limited during development, and in an adult, cells constituting a tissue or organ rarely alter to different cells , that is , the pluripotency is usually lost.
  • epithelial cells resist altering to other types of epithelial cells. Suchalteration typicallyoccurs inpathological conditions , and is called metaplasia.
  • mesenchymal cells tend to easily undergo metaplasia, i.e., alter to other mesenchymal cells, with relatively simple stimuli. Therefore, mesenchymal cells have a high level of pluripotency.
  • Embryonic stem cells have pluripotency.
  • Tissue stem cells have pluripotency.
  • the term "pluripotency" may include the concept of totipotency.
  • An example of an in vi tro assay for determining whether or not a cell has pluripotency includes, but is not limited to, culturing under conditions for inducing the formation and differentiation of embryoid bodies.
  • Examples of an in vivo assayfor determining the presence orabsence of pluripotency include, but are not limited to, implantation of a cell into an immunodeficient mouse so as to form teratoma, injection of a cell into a blastocyst so as to form a chimeric embryo, implantation of a cell into a tissue of an organism (e.g., injection of a cell into ascites) so as to undergo proliferation, and the like.
  • one type of pluripotency is "totipotency”, which refers to an ability to be differentiated into all kinds of cells which constitute an organism.
  • the idea of pluripotency encompasses totipotency.
  • An example of a totipotent cell is a fertilized ovum.
  • An ability to be differentiated into only one type of cell is called “unipotency” .
  • the term "gene” refers to an element defining a genetic trait.
  • a gene is typically arranged in a given sequence on a chromosome.
  • a gene which defines the primary structure of a protein is called a structural gene.
  • a gene which regulates the expression of a structural gene is called a regulatory gene (e.g. , promoter) .
  • Genes herein include structural genes and regulatory genes unless otherwise specified. Therefore, the term “cyclin gene” typically includes the structural gene of cyclin and the promoter of cyclin.
  • gene ® may refer to “polynucleotide”, “oligonucleotide”, “nucleic acid”, and “nucleic acid molecule” and/or “protein”, “polypeptide”, “oligopeptide” and “peptide”.
  • gene product includes “polynucleotide”, “oligonucleotide”, “nucleic acid” and “nucleic acidmolecule” and/or “protein” , “polypeptide”, “oligopeptide” and “peptide”, which are expressed by a gene.
  • Those skilled in the art understand what a gene product is , according to the context .
  • the term "homology" in relation to a sequence refers to the proportion of identity between two or more gene sequences. Therefore, the greater the homology between two given genes , the greater the identity or similarity between their sequences . Whether or not two genes have homology is determined by comparing their sequences directly or by a hybridization method under stringent conditions . When two gene sequences are directly compared with each other, these genes have homology if the
  • DNA sequences of the genes have representatively at least 50% identity, preferably at least 70% identity, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity with each other.
  • identity preferably at least 70% identity, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity with each other.
  • similarity in relation to a sequence (e.g. , a nucleic acid sequence, an amino acid sequence, or the like) refers to the proportion of identity between two or more sequences when conservative substitution is regarded as positive (identical) in the above-described homology. Therefore, homologyand similaritydiffer romeachother in thepresence of conservative substitutions. If no conservative substitutions are present, homology and similarity have the same value.
  • protein protein
  • polypeptide oligopeptide
  • peptide as used herein have the same meaning and refer to an amino acid polymer having any length. This polymer may be a straight, branched or cyclic chain.
  • An amino acid maybe a naturally-occurring ornonnaturally-occurring amino acid, or a variant amino acid.
  • the term may include those assembled into a composite of a plurality of polypeptide chains.
  • the term also includes a naturally-occurring or artificially modified amino acid polymer.
  • Such modification includes, forexample, disulfide bondformation, glycosylation, lipidation, acetylation, phosphorylation, or any othermanipulation ormodification (e.g., conjugation with a labeling moiety) .
  • This definition encompasses a polypeptide containing at least one amino acid analog (e.g. , nonnaturally-occurring amino acid, etc.), a peptide-like compound (e.g., peptoid) , and other variants known in the art, for example.
  • Gene products such as extracellular matrix proteins (e.g., fibronectin, etc.), are usually in the form of polypeptide.
  • polynucleotide oligonucleotide
  • nucleic acid molecule and “nucleic acid” as used herein have the same meaning andref r to a nucleotide polymer having any length.
  • This term also includes an "oligonucleotide derivative” or a “polynucleotide derivative”.
  • An "oligonucleotide derivative” or a “polynucleotide derivative” includes a nucleotide derivative, or refers to an oligonucleotide or a polynucleotide having different linkages between nucleotides from typical linkages, which are interchangeably used. Examples of • such an oligonucleotide specifically include
  • an oligonucleotide derivative in which a phosphodiester bond in an oligonucleotide is converted to a phosphorothioate bond an oligonucleotide derivative in which a phosphodiester bond in an oligonucleotide is converted to a N3 ' -P5 ' phosphoroamidate bond
  • an oligonucleotide derivative in which uracil in an oligonucleotide is substituted with C-5 propynyl uracil an oligonucleotide derivative in which uracil in an oligonucleotide is substitutedwith C-5 thiazole uracil, an oligonucleotide
  • nucleic acid sequence also implicitly encompasses conservatively-modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated.
  • degenerate codon substitutions mayfoe producedby generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Bat er et al.. Nucleic Acid Res. 19:5081(1991); Ohtsuka et al. , J. Biol. Chem.260:2605-2608 (1985) ; Rossolini et al. , Mol. Cell. Probes 8:91-98(1994) ) .
  • a gene encoding an extracellular matrix protein (e.g., fibronectin, etc. ) or the like is usually in the form of polynucleotide.
  • a molecule to be transfected is in the form of polynucleotide.
  • corresponding amino acid or nucleic acid refers to an amino acid or nucleotide in a given polypeptide or polynucleotide molecule, which has, or is anticipated to have, a function similar to that of a predetermined amino acid or nucleotide in a polypeptide or polynucleotide as a reference for comparison.
  • enzymemolecules the term refers to an amino acid which is present at a similar position in an active site and similarly contributes to catalytic activity.
  • antisense molecules for a certain polynucleotide the term refers to a similar portion in an ortholog corresponding to a particular portion of the antisense molecule.
  • corresponding gene refers to a gene in a given species, which has, or is anticipated to have, a function similar to that of apredetermined gene in a species as a reference for comparison.
  • the term refers to a gene having the same evolutionary origin. Therefore, a gene corresponding to a given gene may be an ortholog of the given gene. Therefore, genes corresponding to mouse cyclin genes can be found in other animals . Such a corresponding gene can be identified by techniques well known in the art.
  • acorresponding gene in agiven animal can be found by searching a sequence database of the animal (e.g., human, rat) using the sequence of a reference gene (e.g., mouse cyclin gene, etc.) as a query sequence.
  • a reference gene e.g., mouse cyclin gene, etc.
  • fragment with respect to a polypeptide or polynucleotide refer to a polypeptide or polynucleotide having a sequence length ranging from 1 to n-l with respect to the full length of the reference polypeptide or polynucleotide (of length n) .
  • the length of the fragment can be appropriately changed depending on the purpose.
  • the lower limit of the length of the fragment includes 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50 or more nucleotides. Lengths represented by integers which are not herein specified (e.g., 11 and the like) may be appropriate as a lower limit.
  • the lower limit of the length of the fragment includes 5 , 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100 ormorenucleotides .
  • Lengths represented by integers which are not herein specified may be appropriate as a lower limit.
  • the length of polypeptides or polynucleotides can be represented by the number of amino acids or nucleic acids, respectively.
  • the above-described numbers are not absolute. The above-described numbers as the upper or lower limit are intended to include some greater or smaller numbers (e.g., ⁇ 10%) , as long as the same function is maintained.
  • biological activity refers to activity possessed by an agent (e.g. , a polynucleotide, a protein, etc.) within an organism, including activities exhibitingvarious functions (e.g., transcription promoting activity, etc.).
  • an agent e.g. , a polynucleotide, a protein, etc.
  • the biological activity thereof includes its enzyme activity.
  • the biological activity thereof includes the binding of the ligand to a receptor corresponding thereto.
  • the above-described biological activity can be measured by techniques well-known in the art.
  • polynucleotides hybridizingunder stringent conditions refers to conditions commonly used and well known in the art .
  • a polynucleotide can be obtained by conducting colony hybridization, plaque hybridization. Southern blot hybridization, or the like using a polynucleotide selected from the polynucleotides of the present invention. Specifically, a filter on which DNA derived from a colony or plaque is immobilized is used to conduct hybridization at 65°C in the presence of 0.7 to 1.0 M NaCl.
  • a 0.1 to 2-fold concentration SSC ( saline-sodium citrate) solution (1-fold concentration SSC solution is composed of 150 mM sodium chloride and 15 mM sodium citrate) is used to wash the filter at 65°C.
  • Polynucleotides identified by this method are referred to as "polynucleotides hybridizing under stringent conditions". Hybridization can be conducted in accordance with a method described in, for example. Molecular Cloning 2nd ed., Current Protocols in Molecular Biology, Supplement 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford University Press (1995), and the like.
  • sequences hybridizing under stringent conditions exclude, preferably, sequences containing only A or T.
  • Hybridizable polynucleotide refers to a polynucleotide which can hybridize other polynucleotides under the above-described hybridization conditions.
  • the hybridizable polynucleotide includes at least a polynucleotide having a homology of at least 60% to the base sequence of DNA encoding a polypeptide having an amino acid sequence specifically herein disclosed, preferably a polynucleotide having a homologyof at least 80%, andmorepreferablyapolynucleotide having a homology of at least 95%.
  • salt has the same meaning as that commonly understood by those skilled in the art, including both inorganic and organic salts.
  • Salts are typically generated by neutralizing reactions between acids and bases.
  • Salts include NaCl, K 2 S0 4 , and the like, which are generatedby neutralization, andin addition, PbS0 4 , ZnCl 2 , and the like , which are generated by reactions between metals and acids.
  • the latter salts may not be generated directly by neutralizing reactions, but may be regarded as a product of neutralizing reactions between acids and bases.
  • Salts may be divided into the following categories: normal salts (salts without any H of acids or without any OH of bases, including, for example, NaCl, NH 4 C1, CH 3 C00Na, and Na 2 C0 3 ), acid salts (salts with remaining H of acids, including, for example, NaHC0 3 , KHS0 4 , and CaHP0 4 ), and basic salts (salts with remaining OH of bases, including, for example, MgCl(OH) and CuCl(OH)).
  • This classification is not very important in the present invention.
  • preferable salts include salts constituting medium (e.g.
  • salts constitutingbuffer e.g. , calciumchloride, magnesium chloride, sodiumhydrogenphosphate, sodiumchloride, etc.
  • these salts are preferable as they have a high affinity for cells and thus are better able to maintain cells in cultur .
  • These salts maybe used singlyor in combination.
  • these salts may be used in combination. This is because a combination of salts tends to have a higher affinity for cells .
  • a plurality of salts are preferably contained inmedium, rather than onlyNaCl or the like . More preferably, all salts for cell culture medium may be added to the medium. In another preferred embodiment, glucose may be added to medium.
  • probe refers to a substance foruse in searching, whichis usedinabiological experiment , suchas in vi troand/or in vivoscreening orthe like, including, but not being limited to, for example, a nucleic acidmolecule having a specific base sequence or a peptide containing a specific amino acid sequence.
  • nucleic acid molecule as a common probe include one having a nucleic acid sequence having a length of at least 8 contiguous nucleotides , which is homologous or complementary to the nucleic acid sequence of a gene of interest.
  • Such a nucleic acid sequence may be preferably anucleicacidsequencehavingalengthof at least 9 contiguous nucleotides, more preferably a length of at least 10 contiguous nucleotides, and even more preferably a length of at least 11 contiguous nucleotides, a length of at least 12 contiguous nucleotides, a length of at least 13 contiguous nucleotides, a length of at least 14 contiguous nucleotides, a length of at least 15 contiguous nucleotides, a length of at least 20 contiguous nucleotides, a length of at least 25 contiguous nucleotides, a length of at least 30 contiguous nucleotides, a length of at least 40 contiguous nucleotides, or a length of at least 50 contiguous nucleotides .
  • a nucleic acid sequence used as a probe includes a nucleic acid sequence having at least 70% homology to the above
  • search indicates that a given nucleic acid sequence is utilized to find other nucleic acid base sequences having a specific function and/or property either electronically or biologically, or using other methods.
  • Examples of an electronic search include, but are not limited to, BLAST (Altschul et al. , J. Mol. Biol. 215:403-410 (1990)), FASTA (Pearson & Lipman, Proc. Natl. Acad. Sci., USA 85:2444-2448 (1988)), Smith and Waterman method (Smith andWaterman, J. Mol. Biol.147:195-197 (1981)), and Needleman and Wunsch method (Needleman and Wunsch, J. Mol. Biol.
  • Examples of a biological search include, but are not limited to, a macroarray inwhich genomic DNAis attachedto a nylonmembrane or the like or a microarray (microassay) in which genomic DNAis attachedto a glass plate under stringent hybridization, PCR and in situ hybridization, and the like.
  • the term "primer” refers to a substance required for initiation of a reaction of a macromolecule compound to be synthesized, in a macromolecule synthesis enzymatic reaction.
  • anucleic acidmolecule In a reaction for synthesizing anucleic acidmolecule, anucleic acidmolecule
  • RNA complementary to part of a macromolecule compound to be synthesized
  • a nucleic acid molecule which is ordinarily used as a primer includes one that has a nucleic acid sequence having a length of at least 8 contiguous nucleotides, which is complementary to the nucleic acid sequence of a gene of interest .
  • Such a nucleic acid sequence pref rably has a length of at least 9 contiguous nucleotides, more preferably a length of at least 10 contiguous nucleotides, even more preferably a length of at least 11 contiguous nucleotides, a length of at least 12 contiguous nucleotides, a length of at least 13 contiguous nucleotides, a length of at least 14 contiguous nucleotides, a length of at least 15 contiguous nucleotides, a length of at least 16 contiguous nucleotides, a length of at least 17 contiguous nucleotides, a length of at least 18 contiguous nucleotides, a length of at least 19 con
  • a nucleic acid sequence used as a primer includes a nucleic acid sequence having at least 70% homology to the above-described sequence, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%.
  • An appropriate sequence as a primer may vary depending on the property of the sequence to be synthesized (amplified) . Those skilled in the art can design an appropriate primer depending on the sequence of interest. Such primer design is well known in the art and may be performed manually or using a computer program (e.g. , LASERGENE, Primer Select, DNAStar) . As used herein, the term "epitope" refers to an antigenic determinant.
  • epitope includes a set of amino acid residues which is involved in recognition by a particular immunoglobulin, or in the context of T cells, those residues necessary for recognition by the T cell receptor proteins and/or Major Histocompatibility Complex (MHC) receptors. This term is also used interchangeably with "antigenic determinant” or "antigenic determinant site” .
  • an epitope is the features of a molecule (e.g., primary, secondary and tertiary peptide structure, and charge) that form a site recognized by an immunoglobulin, T cell receptor or HLA molecule.
  • An epitope including a peptide comprises 3 or more amino acids in a spatial conformation which is unique to the epitope.
  • an epitope consists of at least 5 such amino acids, and more ordinarily, consists of at least 6, 7, 8, 9 or 10 such amino acids.
  • the greater the length of an epitope the more the similarity of the epitope to the original peptide, i.e., longer epitopes are generally preferable. This is not necessarily the case when the conformation is taken into account .
  • Methods of determining the spatial conformation of amino acids are known in the art , and include, for example, X-ray crystallography and 2-dimensional nuclear magnetic resonance spectroscopy.
  • epitopes in a given protein is readily accomplished using techniques well known in the art. See, also, Geysen et al., Proc. Natl. Acad. Sci. USA (1984) 81: 3998 (general method of rapidly synthesizing peptides to determine the location of immunogenic epitopes in a given antigen); U. S. Patent No. 4,708,871 (procedures for identifying and chemically synthesizing epitopes of antigens); and Geysen et al.. Molecular immunology (1986) 23: 709 (technique for identifying peptides with high affinity for a given antibody) . Antibodies that recognize the same epitope can be identified in a simple immunoassay.
  • epitopes including a peptide are well known in the art .
  • Such an epitope can be determined using a well-known, common technique by those skilled in the art if the primary nucleic acid or ai ⁇ ino acid sequence of the epitope is provided.
  • an epitope including a peptide requires a sequencehavingalengthof at least 3 amino acids , preferably at least 4 amino acids, more preferably at least 5 amino acids, at least 6 amino acids, at least 7 amino acids, at least 8 amino acids, at least 9 amino acids, at least 10 amino acids, at least 15 amino acids, at least 20 amino acids, and 25 amino acids .
  • Epitopes maybe linear or conformational .
  • the term "agent binding specifically to" a certain nucleic acid molecule or polypeptide refers to an agent which has a level of binding to the nucleic acid molecule or polypeptide equal to or higher than a level of binding to other nucleic acid molecules or polypeptides .
  • an agent include, but are not limited to, when a target is a nucleic acid molecule, a nucleic acid molecule having a complementary sequence of a nucleic acid molecule of interest, a polypeptide capable of binding to a nucleic acid sequence of interest (e.g., a transcription agent , etc . ) , and the like, andwhen a target is a polypeptide, an antibody, a single chain antibody, either of a pair of a receptor and a ligand, either of a pair of an enzyme and a substrate, and the like.
  • antibody encompasses polyclonal antibodies, monoclonal antibodies, human antibodies , humanized antibodies , polyf nctional antibodies, chimeric antibodies, and anti-idiotype antibodies, and fragments thereof (e.g., F(ab r )2 and Fab fragments), and other recombinant conjugates. These antibodies may be fused with an enzyme (e.g., alkaline phosphatase, horseradish peroxidase, ⁇ -galactosidase, and the like) via a covalent bond or by recombination.
  • an enzyme e.g., alkaline phosphatase, horseradish peroxidase, ⁇ -galactosidase, and the like
  • the term "monoclonal antibody” refers to an antibody composition having a group of homologous antibodies . Thistermisnot limitedbytheproductionmanner thereof. This term encompasses all immunoglobulin molecules andFabmolecules , F(ab ' ) 2 fragments , Fv ragments , and other molecules having an immunological binding property of the original monoclonal antibody molecule. Methods for producing polyclonal antibodies and monoclonal antibodies are well known in the art, and will be more sufficiently described below.
  • Monoclonal antibodies are prepared by using the standard technique well known in the art (e.g. , Kohler and Milstein, Nature (1975) 256:495) or a modification thereof (e.g. , Bucket al. (1982) InVitro 18:377) .
  • a mouse or rat is immunized with a protein bound to a protein carrier, and boosted.
  • the spleen (and optionally several large lymph nodes) is removed and dissociated into a single cell suspension.
  • the spleen cells may be screened (after removal of nonspecifically adherent cells) by applying the cell suspension to a plate or well coated with a protein antigen.
  • B-cells that express membrane-bound immunoglobulin speci ic for the antigen bind to the plate, and are not rinsed away with the rest of the suspension. Resulting B-cells, or all dissociated spleen cells, are then induced to fuse with myeloma cells to form hybridomas . The hybridomas are used to produce monoclonal antibodies .
  • the term "antigen” refers to any substrate to which an antibody molecule may specifically bind.
  • the term “immunogen” refers to an antigen capable of initiating activation of the antigen-specific immune response of a lymphocyte.
  • a given amino acid may be substituted with another amino acid in a structurally important region, such as a cationic region or a substrate molecule binding site, without a clear reduction or loss of interactive binding ability.
  • a given biological function of a protein is defined by the interactive ability or other property of the protein . Therefore, a particular amino acid substitution may be performed in an amino acid sequence, or at the DNA sequence level, to produce a protein which maintains the original property after the substitution. Therefore, various modifications of peptides as disclosed herein and DNA encoding such peptides maybe performedwithout clear losses of biological activity.
  • hydrophobicity indices of amino acids may be taken into consideration.
  • the hydrophobic amino acid indices play an important role in providing a protein with an interactive biological function, which is generally recognized in the art (Kyte, J. and Doolittle, R.F., J. Mol. Biol. 157( 1 ): 105-132, 1982).
  • the hydrophobic property of an amino acid contributes to the secondary structure of a protein and then regulates interactions between the protein and other molecules (e.g., enzymes, substrates, receptors, DNA, antibodies, antigens, etc.).
  • Each amino acid is given a hydrophobicity index based on the hydrophobicity and charge properties thereof as follows: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine ( +1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamic acid (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
  • the resultant protein may still have a biological function similar to that of the original protein (e.g. , a protein having an equivalent enzymatic activity) .
  • the hydrophobicity index is pre erably within ⁇ 2 , more preferably within ⁇ 1 , and even more preferably within ⁇ 0.5. It is understood in the art that such an amino acid substitution based on hydrophobicity is e ficient . As described in US Patent No.
  • amino acidresidues are given the followinghydrophilicityindices arginine (+3.0); lysine (+3.0); aspartic acid (+3.0 ⁇ 1) glutamic acid (+3.0 ⁇ 1); serine (+0.3); asparagine (+0.2) glutamine (+0.2); glycine (0); threonine (-0.4); proline ( -0.5 ⁇ 1) ; alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4) .
  • an amino acid may be substituted with another amino acid which has a similar hydrophilicity index and can still provide a biological equivalent.
  • the hydrophilicityindex is preferablywithin ⁇ 2 , more preferably ⁇ 1 , and even more preferably ⁇ 0.5.
  • the term “profile” in relation to a cell refers to a set of measurements of the biological state of the cell.
  • the term “profile of a cell” refers to a set of discrete or continuous values obtained by quantitativelymeasuring a level of a "cellular component” .
  • a level of a cellular component includes the expression level of a gene, the transcription level of a gene (the activity level of a transcription control sequence), the amount of mRNA encoding a specific gene, and the expression level of a protein in biological systems.
  • the level of each cellular component such as the expression level of mRNA and/orprotein, is known to be altered in response to treatment with drugs or cellular biological perturbation or vibration.
  • the measurement of a plurality of "cellular components" generates a large amount of information about the effects of stimuli on the biological states of cells. Therefore, the profile is more and more important in analysis of cells. Mammalian cells contain about 30,000 or more cellular components. Therefore, the profile of an individual cell is usually complicated. A profile in a predetermined state of a biological system may often be measured after stimulating the biological system. Such stimulation is performedunder experimental orenvironmental conditions associated with the biological system. Examples of a stimulus include exposure of a biological system to a drug candidate, introduction of an exogenous gene, passage of time, deletion of a gene from the system, alteration of culture conditions, and the like.
  • the wide rangemeasurement of cellular components i.e., profiles of gene replication or transcription, protein expression, and response to stimuli
  • has a high level of utility including comparison and investigation of the effects of drugs, diagnosis of diseases , andoptimization of drugadministration topatients as well as investigation of cells. Further, profiles are useful for basic life science research.
  • time-lapse profile in relation to a certain cell refers to a profile which indicates time-lapse changes in a parameter relating to the cell.
  • a time-lapse profile include, but are not limited to, a time-lapse profile of transcription level, a time-lapse profileof expression level (translation level) , atime-lapse profile of signal transduction, a time-lapse profile of neural potential, and the like.
  • a time-lapse profile may be produced by continuously recording a certain parameter (e.g., a signal caused by a label associated with a transcription level). Time-lapse measurement may mean continuous measurement. Therefore, the term "time-lapse profile" as used herein may also be referred to as “continuous profile” .
  • transcription control sequence refers to a sequence which can regulate the transcription level of a gene. Such a sequence has at least two nucleotides in length. Examples of such a sequence include, but are not limited to, promoters, enhancers, silencers, terminators, sequences flanking other genome structural genes , genomic sequences other than exons , sequences within exons, and the like.
  • a transcription control sequence used herein is not related to particular types . Rather, important information about a transcription control sequence is time-lapse fluctuation. Such fluctuation is referred to as a process (changes in a state of a cell ) . Therefore , such atranscription control sequence may be herein arbitrarily selected. Such a transcription control sequence may include those which are not conventionally used as markers. Preferably, a transcription control sequence has an ability to bind to a transcription factor.
  • transcription factor refers to a factor which regulates the process of transcription of a gene.
  • transcription factor mainly indicates a factor which regulates a transcription initiating reaction. Transcription factors are roughly divided into the following groups: basic transcription factors required forplacing an RNA polymerase into a promoter region on DNA; and transcription regulatory factors which bind to cis-acting elements present upstream or downstream of a transcription region to regulate the synthesis initiation frequency of RNA.
  • RNA polymerase RNA polymerase
  • a TATA-binding protein is believed to be common to all transcription systems .
  • a typical transcription factor consists of a portion structurally required for binding to DNA and a portion required for activating or suppressing transcription.
  • Factors which have a DNA-binding portion and can bind to ⁇ is-acting elements are collectively referred to as trans-acting factors.
  • a portion required for activating or suppressing transcription is involved in interaction with other transcription ctors or basic transcription factors . Such a portion is believed to play a role in regulating transcription via a structural change in DNA or a transcription initiating complex. Transcription regulatory factors are divided into several groups or families accordingto structuralproperties of theseportions, including factors which play an important role in the development or differentiation of a cell.
  • transcription factor examples include, but are not limited to, STAT1, STAT2, STAT3, GAS, NFAT, Myc,
  • API API, CREB, NFKB, E2F, Rb, p53, RUNX1 , RUNX2 , RUNX3 , Nkx-2,
  • terminatator refers to a sequence which is located downstream of a protein-encoding region of a gene and which is involved in the termination of transcription when DNA is transcribed into mRNA, and the addition of a poly-A sequence . It is known that a terminator contributes to the stability of mRNA, and has an influence on the amount of gene expression.
  • promoter refers to a base sequence which determines the initiation site of transcription of a gene and is a DNA region which directly regulates the frequency of transcription. Transcription is started by RNA polymerase binding to a promoter.
  • a promoter region is usually located within about 2 kbp upstream of the first exon of aputativeprotein codingregion . Therefore, it is possible to estimate a promoter region by predicting a protein coding region in a genomic base sequence using DNA analysis software .
  • Aputative promoter region is usually located upstream of a structural gene, but depending on the structural gene, i.e., a putative promoter region may be located downstream of a structural gene. Preferably, a putative promoter region is located within about 2 kbp upstream of the translation initiation site of the first
  • enhancer refers to a sequence which is used so as to enhance the expression efficiency of a gene of interest.
  • One or more enhancers may be used, or no enhancer may be used.
  • silencer refers to a sequence which has a function of suppressing and arresting the expression of a gene. Any silencer which has such a function may be herein used. No silencer may be used.
  • operably linked indicates that a desired sequence is located such that expression (operation) thereof is under control of a transcription and translation regulatory sequence (e.g., a promoter, an enhancer, and the like) or a translation regulatory sequence.
  • a transcription and translation regulatory sequence e.g., a promoter, an enhancer, and the like
  • a promoter In order for a promoter to be operably linked to a gene, typically, the promoter is located immediately upstream of the gene. A promoter is not necessarily adjacent to a structural gene.
  • Sequences flanking other genome structural genes, genomic sequences other than exons, and sequences within exons may also be herein used.
  • structural gene-flanking sequences are well expected to be involved in the control of transcription in terms of "processes” . Therefore, such flanking sequences are also included in transcription control sequences .
  • Genomic sequences other than exons and sequences within exons are also expected to be involved in the control of transcription in terms of "processes” . Therefore, genomic sequences other than exons and sequences within exons are also included in transcription control sequences .
  • RNAi is an abbreviation of RNA interference and refers to a phenomenon where an agent for causing RNAi, such as double-stranded RNA (also called dsRNA) , is introduced into cells and mRNA homologous thereto is specifically degraded, so that synthesis of gene products is suppressed, and a technique using the phenomenon .
  • RNAi may have the same meaning as that of an agent which causes RNAi.
  • an agent causing RNAi refers to any agent capable of causing RNAi.
  • an agent causing RNAi of a gene indicates that the agent causes RNAi relating to the gene and the effect of RNAi is achieved (e.g., suppression of expression of the gene, and the like) .
  • examples of such an agent causing RNAi include, but are not limited to, a sequence having at least about 70% homology to the nucleic acid sequence of a target gene or a sequence hybridizable under stringent conditions, RNA containing a double-stranded portion having a length of at least 10 nucleotides or variants thereof.
  • this agent may be preferably DNA containing a 3' protruding end, and more preferably the 3 ' protruding end has a length of 2 or more nucleotides (e.g., 2-4 nucleotides in length).
  • RNAi RNAi clease having a helicase domain
  • dicer cleaves the molecule on about a 20 base pair basis from the 3 ' terminus in the presence of ATP in the case where the RNA is relatively long (e.g., 40 or more base pairs).
  • siRNA is an abbreviation of short interfering RNA and refers to short double-stranded RNA of 10 or more base pairs which are artificially chemically synthesized or biochemically synthesized, synthesized in the organism body, or produced by double-stranded RNA of about 40 or more base pairs being degraded within the organism.
  • siRNA typically has a structure having 5 ' -phosphate and 3' -OH, where the 3' terminus projects by about 2 bases.
  • a specific protein is boundto siRNAto formRISC (RNA-induced-silencing- ⁇ omplex) .
  • This complex recognizes and binds to mRNA having the same sequence as that of siRNA and cleaves mRNA at the middle of siRNA due to RNaselll-like enzymatic activity. It is preferable that the relationship between the sequence of siRNA and the sequence of mRNA to be cleaved as a target is a 100% match.
  • base mutations at a site away from the middle of siRNA do not completely remove the cleavage activity by RNAi, leaving partial activity, while base mutations in the middle of siRNA have a large influence and the mRNA cleavage activity by RNAi is considerably lowered. By utilizing such a nature, only mRNA having a mutation can be specifically degraded.
  • siRNA in which the mutation is provided in the middle thereof is synthesized and is introduced into a cell. Therefore, in the present invention, siRNAper seaswell as an agent capable ofproducing siRNA (e.g. , representatively dsRNA of about 40 or more base pairs) can be used as an agent capable of eliciting RNAi. Also, though not wishing to be bound by any theory, apart from the above-described pathway, the antisense strand of siRNA binds to mRNA and siRNA functions as a primer for RNA-dependent RNA polymerase (RdRP), so that dsRNA is synthesized. This dsRNA is a substrate for a dicer again, leading to production of new siRNA.
  • RdRP RNA-dependent RNA polymerase
  • siRNA per se as well as an agent capable of producing siRNA are useful.
  • 35 dsRNAmolecules can substantiallycompletelydegrade 1 , 000 or more copies of intracellular mRNA, and there ore, it will be understood that siRNA per se as well as an agent capable of producing siRNA are useful .
  • double-strandedRNAhaving a length of about 20 bases (e.g., representatively about 21 to 23 bases) or less than about 20 bases, which is called siRNA, can be used.
  • siRNA double-strandedRNAhaving a length of about 20 bases (e.g., representatively about 21 to 23 bases) or less than about 20 bases, which is called siRNA.
  • Expression of siRNA in cells can suppress expression of a pathogenic gene targeted by the siRNA. Therefore, siRNA can be used for treatment, prophylaxis, prognosis, and the like of diseases.
  • the siRNA of the present invention may be in any orm as long as it can elicit RNAi.
  • an agent capable of causing RNAi mayhave a short hairpin structurehaving a stickyportion at the 3 ' terminus (shRNA; short hairpin RNA) .
  • shRNA refers to a molecule of about 20 or more base pairs in which a single- tranded RNA partially contains a palindromic base sequence and forms a double-strand structure therein (i.e., a hairpin structure).
  • shRNA can be artificially chemically synthesized.
  • shRNA can be produced by linking sense and antisense strands of a DNA sequence in reverse directions and synthesizing RNA in vi tro ith in RNApolymerase using the DNA as a template.
  • shRNA after shRNA is introduced into a cell, the shRNA is degraded in the cell into a length of about 20 bases (e.g., representatively 21, 22, 23 bases), and causes RNAi as with siRNA, leading to the treatment eff ct of the present invention. It should be understood that such an effect is exhibited in a wide range of organisms, such as insects, plants, animals (including mammals), and the like. Thus, shRNA elicits RNAi as with siRNA and therefore can be used as an effective component of the present invention .
  • shRNA may preferably have a 3' protruding end.
  • the length of the double-stranded portion is not particularly limited, but is preferably about 10 or more nucleotides, and more preferably about 20 or more nucleotides.
  • the 3' protruding end may be preferably DNA, more preferably DNA of at least 2 nucleotides in length, and even more preferably DNA of 2-4 nucleotides in length.
  • An agent capable of causing RNAi used in the present invention may be artificially synthesized (chemically or biochemically) or naturally occurring. There is substantially no difference therebetween in terms of the effect of the present invention.
  • a chemically synthesized agent is preferably purified by liquid chromatography or the like .
  • RNAi an agent capable of causing RNAi used in the present invention canbeproduced in vi tro .
  • T7 RNA polymerase and T7 promoter are used to synthesize antisense and sense RNAs from template DNA. These RNAs are annealed and thereafter are introduced into a cell.
  • RNAi is caused via the above- escribed mechanism, thereby achieving the effect of the present inventio .
  • the introduction of RNA into cell can be carried out by a calcium phosphate method.
  • RNAi Another example of an agent capable of causing RNAi according to the present invention is a single-stranded nucleic acid hybridizable to mRNA or all nucleic acid analogs thereof. Such agents are useful for the method and composition of the present invention.
  • time-lapse means anyaction or phenomenon that is related to the passage of time.
  • monitoring refers to measurement of a state of a cell using at least one parameter as measure (e.g., a label signal attributed to transcription, etc. ) .
  • a device such as a detector, a measuring instrument, or the like. More preferably, such a device is connected to a computer for recording and/or processing data.
  • Monitoring may comprise the step of obtaining the image data of a solid phase support (e.g., an array, a plate, etc.).
  • the term "real time” means that a certain state is substantially simultaneously displayed in another form (e.g. , as an image on a display or a graph with processed data) .
  • the "real time” lags behind an actual event by the time required for data processing.
  • Such a time lag is included in the the scope of "real time” if it is substantially negligible.
  • Such a time lag may be typicallywithin 10 seconds, andpreferablywithin 1 second. without limitation.
  • a time lag exceeding 10 seconds may be included in the scope of "real time” .
  • the determination of a state of a cell can be performed using various method .
  • methods include, but are not limited to, mathematical processing (e.g. , signal processing, multivariate analysis, etc.), empirical processing, phase changes, and the like.
  • the term "difference” refers to a result of mathematical processing inwhich avalue of acontrol profile (e.g., without a stimulus) is subtracted from a certain profile.
  • phase in relation to a time-lapse profile refers to a result of determination of whether the profile is positive or negative with respect to a reference point (typically 0) , which is expressed with + or - , and also refers to analysis based on such a result .
  • the term "correlate” in relation to a profile (e.g., a time-lapse profile, etc.) and a state of a cell refers to an act of associating the profile or particular information about changes with the state of the cell. A relationship between them is referred to as “correlation” or “correlation relationship” .
  • correlation or “correlation relationship” .
  • the present invention has an advantageous effect of performing such a correlation.
  • correlation can be performed by associating at least one profile (e.g., a time-lapse profile, etc.) or changes therein with a state of a cell, a tissue, an organ or an organism (e.g. , drug resistance, etc. ) .
  • a profile e.g., a time-lapse profile, etc.
  • changes therein is quantitatively or qualitatively associated with at least one parameter indicating a state of a cell.
  • a small number of profiles may be used for correlation as long as correlation can be performed, typically including, without limitation, 1, preferably 2, and more preferably 3.
  • At least 2 preferably at least 3, profiles (e.g., a time-lapse profile, etc.) are sufficient for specifying substantially all cells.
  • At least oneprofile e.g. , a time-lapse profile, etc.
  • at least 8 profiles e.g., a time-lapse profile, etc. may be advantageously used.
  • Examples of a specificmethodfor correlation include, but are not limited to, signal processing (e.g., wavelet analysis, etc.), multivariate analysis (e.g., cluster analysis, etc.), and the like.
  • Correlation may be performed in advance or may be performed at the time of determination of cells using a control.
  • the term “externalfactor” inrelation to a cell refers to a factor which is not usually present in the cell (e. g. , a substance, energy, etc. ) .
  • factor may refer to any substance or element as long as an intended object can be achieved (e.g., energy, such as ionizingradiation, radiation, light, acousticwaves, and the like).
  • Such a substance examples include, but are not limited to, proteins, polypeptides, oligopeptides , peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (e.g., DNA such as cDNA, genomic DNA and the like, orRNA such as mRNA, RNAi andthe like) , polysaccharides, oligosaccharides, lipids, low molecular weight organic molecules (e.g., hormones, ligands, information transduction substances , low molecular weight organic molecules, molecules synthesized by combinatorial chemistry, low molecular weight molecules usable as medicaments (e.g.
  • an external factor as used herein include, but are not limited to, temperature changes, humidity changes, electromagnetic wave, potential difference, visible light , infrared light , ultraviolet light , X-rays, chemical substances , pressure, gravity changes , gas partial pressure, osmotic pressure, and the like.
  • an external factor may be a biological molecule or a chemically synthesized substance.
  • biologicalmolecule refers to molecules relating to an organismand aggregations thereof .
  • biological or “organism” refers to a biological organism, including, but being not limited to, an animal, a plant, a fungus, a virus, and the like.
  • Biological molecules include molecules extracted from an organism and aggregations thereof, though the present invention is not limited to this . Any molecule capable of affecting an organism and aggregations thereof fall within the definition of a biological molecule. Therefore, low molecular weight molecules (e.g., low molecular weight molecule ligands, etc. ) capable of being used as medicaments fall within the definition of a biological molecule as long as an effect on an organism is intended.
  • Such a biological molecule include, but are not limited to, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (e.g., DNA such as cDNA and genomic DNA; RNA such as mRNA), polysaccharides, oligosaccharides, lipids, low molecular weight molecules (e.g., hormones, ligands, information transmitting substances, low molecular weight organic molecules, etc.), and composite molecules thereof and aggregations thereof (e.g. , glycolipids, glycoproteins, lipoproteins, etc.), and the like.
  • proteins es, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (e.g., DNA such as cDNA and genomic DNA; RNA such as mRNA), polysaccharides, oligos
  • a biological molecule may include a cell itself or a portion of tissue as long as it is intended to be introduced into a cell.
  • a biological molecule may be a nucleic acid, a protein, a lipid, a sugar, aproteolipid, a lipoprotein, a glycoprotein , a proteoglycan, or the like.
  • a biological molecule may include a nucleic acid ( DNA or RNA) or a protein.
  • a biological molecule is a nucleic acid (e.g. , genomic DNA or cDNA, or DNA synthesized by PCR or the like).
  • a biological molecule may be a protein.
  • such a biological molecule may be a hormone or a cytokine.
  • the term "chemically synthesized substance” refers to any substance which may be synthesized by using typical chemical techniques . Such synthesizing techniques are well known in the art . Those skilled in the art can produce chemically synthesized substances by combining such techniques as appropriate.
  • cytokine is used herein in the broadest sense in the art and refers to a physiologically active substance which is produced by a cell and acts on the same or different cell.
  • Cytokines are generally proteins or polypeptides having a function of controlling an immune response, regulating the endocrine system, regulating the nervous system, acting against a tumor, acting against a virus, regulating cell growth, regulating cell differentiation, or the like. Cytokines are used herein in the form of a protein or a nucleic acid or in other forms . In actual practice, cytokines are typically proteins.
  • growth factor refers to a substance which promotes or controls cell growth. Growth factors are also called “proliferation factors” or “development factors”.
  • Growth factors may be added to cell or tissue culture medium, substituting for serummacromolecules . It has been revealed that a number of growth f ctors have a function of controlling differentiation in addition to a function of promoting cell growth.
  • cytokines representatively include, but are not limited to, interleukins, chemokines, hematopoietic factors (e.g., colony stimulating factors), tumor necrosis factor, and interferons.
  • growth factors include, but are not limited to, platelet-derived growth factor (PDGF) , epidermal growth factor (EGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF) , endothelial cell growth factor (VEGF) , cardiotrophin, and the like, which have proliferative activity.
  • PDGF platelet-derived growth factor
  • EGF epidermal growth factor
  • FGF fibroblast growth factor
  • HGF hepatocyte growth factor
  • VEGF endothelial cell growth factor
  • cardiotrophin cardiotrophin
  • hormone is herein used in its broadest sense in the art, referring to a physiological organic compound which is produced in a particular organ or cell of an animal or plant, and has a physiological effect on an organ apart fromthe siteproducing the compoun .
  • examples of such a hormone include, but are not limited to, growth hormones, sex hormones, thyroid hormones, and the like.
  • the scope of hormones may overlap partially with that of cytokines .
  • actin acting substance refers to a substance which interacts directly or indirectly with actin within cells to alter the form or state of actin.
  • examples of such a substance include, but are not limited to, extracellular matrix proteins (e.g., fibronectin, vitronectin, laminin, etc. ) , and the like .
  • actin acting substances include substances identified by the following assays .
  • interaction with actin is evaluated by visualizing actin with an actin staining reagent (Molecular Probes, Texas Red-X phalloidin) or the like, followed by microscopic inspection to observe and determine actin aggregation, actin reconstruction or an improvement in cellular outgrowthrate . Such evaluationmaybe performed quantitatively or qualitatively.
  • Actin acting substances are herein utilized so as to increase transfection efficiency.
  • An actin acting substance used herein is derived from any organism, including, for example, mammals, such as human, mouse, bovine, and the like.
  • cell adhesion agent Asusedherein, theterms "cell adhesion agent” , “cell adhesionmolecule” , “adhesion agent” and “adhesionmolecule” are used interchangeably to refer to a molecule capable of mediating the joining of two or more cells (cell adhesion) or adhesion between a substrate and a cell.
  • cell adhesion molecules are divided into two groups : molecules involved in cell-cell adhesion (intercellular adhesion) (cell-cell adhesion molecules) and molecules involved in cell-extracellular matrix adhesion (cell-substrate adhesion) (cell-substrate adhesion molecules).
  • intercellular adhesion intercellular adhesion
  • cell-substrate adhesion cell-substrate adhesion molecules
  • cell adhesion molecules herein include a substrate protein and a cellular protein (e.g., integrin, etc.) involved in cell-substrate adhesion.
  • a molecule other than a protein can fall within the concept of cell adhesion molecule as long as it can mediate cell adhesion.
  • cadherin For cell-cell adhesion, cadherin, a number of molecules belonging in an immunoglobulin superfamily (NCAM, LI, ICAM, fasciclin II, III, etc.), selectin, and the like are known, each of which is known to connect cell membranes via a specific molecular reaction.
  • integrin a major cell adhesion molecule functioning for cell-substrate adhesion
  • integrin a major cell adhesion molecule functioning for cell-substrate adhesion
  • These cell adhesion molecules are all located on cell membranes and can be regarded as a type of receptor (cell adhesion receptor) . Therefore, receptors present on cell membranes can also be used in a method of the present invention. Examples of such a receptor include, but are not limited to, ⁇ -integrin, ⁇ -integrin, CD44, syndecan, aggrecan, and the like.
  • Techniques for cell adhesion are well known as described above and as described in, for example, "Saibogaimatorikkusu -Rinsho heno Oyo- [Extracellular matrix -Clinical Applications-], Medical Revie .
  • a certainmolecule is a cell adhesion molecule, by an assay, such as biochemical quantification (an SDS-PAGE method, a labeled-collagen method, etc.), immunological quantification (an enzyme antibody method, a fluorescent antibody method, an immunohistological study, etc.), a PDR method, a hybridization method, or the like, in which a positive reaction is detected.
  • biochemical quantification an SDS-PAGE method, a labeled-collagen method, etc.
  • immunological quantification an enzyme antibody method, a fluorescent antibody method, an immunohistological study, etc.
  • PDR method a hybridization method, or the like
  • a positive reaction is detected.
  • cell adhesion molecule include, but are not limited to, collagen, integrin, fibronectin, laminin, vitronectin, fibrinogen, immunoglobulin superfamily members (e.g., CD2, CD4, CD8, ICM1, ICAM2, VCAMl), selectin, cadherin, and the like.
  • auxiliary signal for cell activation into a cell due to intercellular interaction as well as cell adhesion. It can be determined whether or not such an auxiliary signal can be transmitted into a cell, by an assay, such as biochemical quantification (an SDS-PAGE method, a labeled-collagen method, etc.), immunological quantification (an enzyme antibody method, a fluorescent antibody method, an immunohistological study, etc.), a PDR method, a hybridization method, or the like, in which a positive reaction is detected.
  • biochemical quantification an SDS-PAGE method, a labeled-collagen method, etc.
  • immunological quantification an enzyme antibody method, a fluorescent antibody method, an immunohistological study, etc.
  • PDR method a hybridization method, or the like, in which a positive reaction is detected.
  • cell adhesion molecules include, but are not limitedto, immunoglobulin superfamilymolecules (LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3, LFA-3,
  • ICAM-1 ICAM-1, CD2, CD4, CDS, ICM1, ICAM2, VCAMl, etc.
  • integrin family molecules LFA-1, Mac-1, gpllbllla, pl50, p95, VLA1 ,
  • VLA2, VLA3, VLA , VLA5 , VLA6 , etc. selectin family molecules (L-selectin, E-selectin, P-selectin, etc.), and the like .
  • extracellular matrix protein refers to a protein constituting an "extracellular matrix” .
  • extracellular matrix (ECM) is also called “extracellular substrate” and has the same meaning as commonly used in the art, and refers to a substance existing between somatic cells no matter whether the cells are epithelial cells or non-epithelial cells.
  • Extracellular matrices are involved in supporting tissue as well as in internal environmental structures essential for survival of all somatic cells .
  • Extracellular matrices are generally produced from connective tissue cells. Some extracellular matrices are secreted from cells possessing basal membrane, such as epithelial cells or endothelial cells .
  • Extracellular matrices are roughly divided into fibrous components and matrices filling there between.
  • Fibrous components include collagen fibers and elastic fibers.
  • a basic component of matrices is glycosaminoglycan (acidic ucopolysaccharide) , most of which is bound to non-collagenous protein to form a polymer of a proteoglycan (acidic mucopolysaccharide-protein comple ) .
  • matrices include glycoproteins , such as laminin of basal membrane, microfibrils around elastic fibers, fibers, fibronectins on cell surfaces, and the like. Particularly di ferentiated tissue has the same basic structure.
  • cartilage matrices including proteogly ⁇ ans .
  • osteoblasts produce bone matrices which cause calcification.
  • extracellular matrices for use in the present invention include, but are not limited to, collagen, elastin, proteoglycan, glycosaminoglycan, fibronectin, laminin, elastic fiber, collagen fiber, and the like.
  • receptor refers to a molecule which is present on cells, within nuclei, or the like, and is capable of binding to an extracellular or intracellular agent where the binding mediates signal transduction. Receptors are typically in the form of proteins .
  • the binding partner of a receptor is usually referred to as a ligand.
  • agonist refers to an agent which binds to the receptor of a certain biologically acting substance (e.g., ligand, etc.), and has the same or similar function as the function of the substance.
  • a certain biologically acting substance e.g., ligand, etc.
  • Antagonist refers to a factor which competitively binds to the receptor of a certain biologically acting substance (ligand) , and does not produce a physiological action via the receptor. Antagonists include antagonist drugs, blockers, inhibitors, andthe like.
  • the term "device” refers to a part which can constitute the whole or a portion of an apparatus, and comprises a support (preferably, a solid phase support) and a target substance carried thereon.
  • a support preferably, a solid phase support
  • a target substance carried thereon examples include, but are not limited to, chips, arrays, microtiter plates, cell culture plates, Petri dishes, films, beads, and the like.
  • support refers to a material which can fix a substance, such as a biological molecule .
  • a support maybe made from any fixingmaterial which has a capability of binding to a biological molecule as used herein via covalent or noncovalent bond, or which may be induced to have such a capability.
  • Examples of materials used for supports include any material capable of forming a solid surface, such as, without limitation, glass, silica, silicon, ceramics, silicon dioxide, plastics, metals (including alloys), naturally-occurring and synthetic polymers (e.g., polystyrene, cellulose, chitosan, dextran, and nylon) , and the like .
  • a support maybe formedof layers made of aplurality of materials.
  • a support may be made of an inorganic insulating material, such as glass, quartz glass, alumina, sapphire, forsterite, silicon oxide, silicon carbide, silicon nitride, or the like.
  • a support may be made of an organic material, such as polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resin, polyacrylonitrile, polystyrene, acetal resin, polycarbonate, polyamide, phenol resin, urea resin, epoxy resin, mela ine resin, styrene-acrylonitrile copolymer, acrylonitrile-butadiene-styrene copolymer, silicone resin, polyphenylene oxide, polysulfone, and the like.
  • organic material such as polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyviny
  • nitrocellulose film, nylon film, PVDF film, or the like which are used in blotting, may be used as a material for a support .
  • a material constituting a support is in the solid phase, such as a support is herein particularly referred to as a " solid phase support " .
  • a solid phase support may be herein in the form of a plate , a microwell plate, a chip, a glass slide, a film, beads, a metal (surface). or the like.
  • a support may not be coated or may be coated.
  • liquid phase has the same meanings as commonly understood by those skilled in the art , typically referring a state in solution.
  • solid phase has the same meanings as commonly understood by those skilled in the art, typically referring to a solid state .
  • liquid and solid may be collectively referred to as a "fluid”.
  • substrate refers to a material (preferably, solid) which is used to construct a chip or arrayaccording to the present inventio . Therefore, substrates are included in the concept of plates. Such a substrate may be made from any solid material which has a capability of binding to a biological molecule as used herein via covalent or noncovalent bonds , or which may be induced to have such a capability.
  • Examples of materials used for plates and substrates include any material capable of forming a solid surface, suchas, without limitation, glass, silica, silicon, ceramics, silicon dioxide, plastics, metals (including alloys), naturally-occurring and synthetic polymers (e.g., polystyrene, cellulose, chitosan, dextran, and nylon) , and the like .
  • a support maybe formedof layers made of aplurality of materials.
  • a support may be made of an inorganic insulating material, such as glass, quartz glass, alumina, sapphire, forsterite, silicon oxide, silicon carbide, silicon nitride, or the like.
  • a support may be made of an organic material, such as polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate. unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol , polyvinyl acetal, acrylic resin, polyacrylonitrile, polystyrene, acetal resin, polycarbonate, polyamide, phenol resin, urea resin, epoxy resin, melamine resin, styrene-acrylonitrile copolymer, acrylonitrile-butadiene-styrene copolymer, silicone resin, polyphenylene oxide, polysulfone, and the like.
  • organic material such as polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate. unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl
  • a material preferable as a substrate varies depending on various parameters such as a measuring device, and can be selected from the above-described various materials as appropriate by those skilled in the art.
  • glass slides are pre erable.
  • such a substrate mayhave a coating.
  • the term "coating" in relation to a solid phase support or substrate refers to an act of forming a film of a material on a surface of the solid phase support or substrate, and also refers to a film itself. Coating is performed for various purposes, such as, for example, improvement in the quality of a solid phase support and substrate (e.g., elongation of life span, improvement in resistance to hostile environment, such as resistance to acids, etc.), an improvement in affinity to a substance integrated with a solid phase support or substrate, and the like.
  • Various materials may be used for such coating, including, without limitation, biological substances (e.g.
  • such a coating may be advantageously made of poly-L-lysine, silane (e.g., epoxy silane ormercaptosilane, APS ( ⁇ -aminopropyl silane) , etc. ) , MAS, hydrophobic fluorine resin, a metal (e.g. , gold, etc. ) .
  • silane e.g., epoxy silane ormercaptosilane, APS ( ⁇ -aminopropyl silane) , etc.
  • MAS ⁇ -aminopropyl silane
  • hydrophobic fluorine resin e.g. , gold, etc.
  • a metal e.g. , gold, etc.
  • Such a material may be preferably a substance suitable for cells or objects containing cells (e.g. , organisms, organs, etc. ) .
  • chip or “microchip” are used interchangeably to refer to a micro integrated circuit which has versatile functions and constitutes a portion of a system.
  • Examples of a chip include, but are not limited to, DNA chips, protein chips, and the like.
  • the term "array” refers to a substrate (e.g., a chip, etc.) which has a pattern of a composition containing at least one (e.g., 1000 or more, etc.) target substances (e.g., DNA, proteins, transfection mixtures, etc.), which are arrayed.
  • patterned substrates having a small size e.g., 10x10 mm, etc.
  • microarrays e.g., 10x10 mm, etc.
  • the terms "microarray” and “array” are used interchangeably. Therefore, a patterned substrate having a larger size than thatwhich is describedabovemaybe referredto as amicroarra .
  • an array comprises a set of desired transfection mixtures fixed to a solid phase surface or a film thereof.
  • An array preferably comprises at least 10 2 antibodies of the same or different types, more preferably at least 10 3 , even more preferablyat least 10 4 , and still even more preferably at least 10 5 . These antibodies are placed on a surface of up to 125x80 mm, more preferably 10x10 mm.
  • An array includes , but is not limited to, a 96-well microtiter plate, a 384-well microtiter plate, a microtiter plate the size of a glass slide, and the like.
  • a composition to be fixed may contain one or a plurality of types of target substances . Such a number of target substance types may be in the range of from one to the number of spots, including, without limitation, about 10, about 100, about 500, and about 1,000.
  • any number of target substances may be provided on a solid phase surface or film, typically including no more than 10 8 biological molecules per substrate, in another embodiment no more than 10 7 biological molecules, no more than 10 6 biological molecules, no more than 10 5 biological molecules, no more than 10 4 biological molecules, no more than 10 3 biological molecules, or no more than 10 2 biological molecules .
  • Acomposition containingmore than 10 8 biological molecule target substances may be provided on a substrate.
  • the size of a substrate is preferably small.
  • the size of a spot of a composition containing target substances e.g., proteins such as antibodies
  • a single biological molecule e.g. , 1 to 2 nm order
  • the minimum area of a substrate may be determined based on the number of biological molecules on a substrate.
  • a composition containing target substances, which are intended to be introduced into cells, are herein typically arrayed on and fixed via covalent bonds or physical interaction to a substrate in the form of spots having a size of 0.01 mm to 10 mm.
  • spots of biological molecules may be provided on an array.
  • spot refers to a certain set of compositions containing target substances.
  • spotting refers to an act of preparing a spot of a composition containing a certain target substance on a substrate or plate. Spotting may be performed by any method, for example, pipetting or the like, or alternatively, using an automatic device. These methods are well known in the art .
  • the term "address” refers to a unique position on a substrate, which may be distinguished from other unique positions. Addresses are appropriately associated with spots. Addresses can have any distinguishable shape such that substances at each address may be distinguished from substances at other addresses (e.g. , optically) .
  • a shape defining an address maybe, for example, without limitation, a circle, an ellipse, a square, a rectangle, or an irregular shape. Therefore, the term “address” is used to indicate an abstract concept, while the term “spot” is used to indicate a specific concept. Unless it is necessary to distinguish them from each other, the terms “address” and “spot” may be herein used interchangeably.
  • each address particularly depends on the size of the substrate, thenumber of addresses on the substrate, the amount of a composition containing target substances and/or available reagents, the size of microparticles, and the level of resolution required for any method used for the array.
  • the size of each address may be, for example, in the range of from 1-2 nm to several centimeters, though the address may have any size suited to an array.
  • the spatial arrangement and shape which define an address are designed so that the microarray is suited to a particular applicatio . Addresses maybe densely arranged or sparsely distributed, or subgrouped into a desired pattern appropriate for a particular type of material to be analyzed.
  • Microarrays are widely reviewed in, for example,
  • Such software may be attached to various detection systems (e.g., Ermolaeva O. et al. , (1998) Nat. Genet., 20: 19-23).
  • the format of database includes, for example, GATC (genetic analysis technology consortium) proposed by Affymetrix.
  • Micromachining for arrays is described in, for example, Campbell, S.A. (1996), “The Science and Engineering of Microelectronic Fabrication”, Oxford University Press; Zaut, P.V. (1996) , “Micromi ⁇ roarray Fabrication: aPractical Guide to Semiconductor Processing” , Semiconductor Services ; Madou,M.J. (1997), “Fundamentals of Microfabri ⁇ ation” , CRC1 5 Press; Rai-Choudhury, P. (1997), “Handbook of Microlithography, Micromachining, & Microfabrication: Microlithography” ; and the like, portions related thereto of which are herein incorporated by reference. (Detection)
  • various detection methods and means can be used as long as they can be used to detect information attributed to a cell or a substance interacting therewith.
  • detection methods and means include, but are not limitedto, visual inspection, opticalmicroscopes , confocal microscopes, reading devices using a laser light source, surface plas on resonance (SPR) imaging, electric signals, chemical or biochemical markers, which may be used singly or in combination.
  • SPR surface plas on resonance
  • Examples of such a detecting device include, but are not limited to, fluorescence analyzing devices, spectrophotometers, scintillation counters, CCD, luminometers, and the like. Any means capable of detecting a biological molecule may be used.
  • the term "marker” refers to a biological agent for indicating a level or frequency of a substance or state of interest .
  • examples of such a marker include, but are not limited to, nucleic acids encoding a gene, gene products, metabolic products, receptors, ligands, antibodies, and the like.
  • the term "marker" in relation to a state of a cell refers to an agent (e.g. , ligands, antibodies, complementary nucleic acids , etc.) interacting with intracellular factors indicating the state of the cell (e.g., nucleic acids encoding a gene, gene products (e.g., mRNA, proteins, posttrans ⁇ riptionally modified proteins, etc.), metabolic products, receptors, etc.) in addition to transcription control factors.
  • a marker may be used to produce a time-lapse profile which is in turn analyzed.
  • Such a marker may preferably interact with a factor of interest .
  • the term "specificity" in relation to a marker refers to a property of the marker which interacts with a molecule of interest to a significantlyhigher extent than with similarmolecules .
  • a marker is herein preferably present within cells or may be present outside cells .
  • label refers to a factor which distinguishes a molecule or substance of interest from others (e.g., substances, energy, electromagnetic waves, etc.).
  • labeling methods include, but are not limitedto, RI (radioisotope) methods, fluorescencemethods, biotinylationmethods , chemoluminancemethods , andthe like .
  • Any fluorescent substance which can bind to a base portion of a nucleic acid may be used, preferably including a cyanine dye (e.g. , Cy3 andCy5 in the CyDyeTMseries , etc . ) , arhodamine 6G reagent, N-acetoxy-N2-acetyl amino fluorene (AAF), AAIF (iodine derivative of AAF), and the like.
  • a cyanine dye e.g. , Cy3 andCy5 in the CyDyeTMseries , etc .
  • arhodamine 6G reagent e.g. , N-acetoxy-N2-acetyl amino fluorene (AAF), AAIF (iodine derivative of AAF), and the like.
  • Examples of fluorescent substances having a difference in fluorescence emission maximum wavelength of 10 nm or more include a combination of Cy5 and a rhodamine 6G reagent, a combination of Cy3 and fluorescein , a combination of a rhodamine 6G reagent and fluorescein, and the like.
  • a label can be used to alter a sample of interest so that the sample can be detected by detecting means .
  • Such alteration is known in the art.
  • Those skilled in the art can perform such alteration using a method appropriate for a label and a sample of interest .
  • reaction refers to, without limitation, hydrophobic interactions, hydrophilic interactions, hydrogen bonds. Van der Waals forces, ionic interactions, nonionic interactions, electrostatic interactions, and the like.
  • interaction level in relation to interaction between two substances (e.g., cells, etc . ) refers to the extent or frequencyof interaction between the two substances .
  • Such an interaction level canbemeasured by methods well known in the art .
  • the number of cells which are fixed and actually perform interaction is counted directly or indirectly (e.g., the intensity of reflected light) , for example, without limitation, by using an optical microscope, a fluorescence microscope, a phase-contrast microscope, or the like, or alternatively by staining cells with a marker, an antibody, a fluorescent label or the like specific thereto andmeasuring the intensity thereof .
  • Such a level can be displayed directly from a marker or indirectly via a label. Based on the measured value of such a level, the number or frequency of genes, which are actually transcribed or expressed in a certain spot, can be calculated.
  • display and “presentation” are used interchangeably to refer to an act of providing a profile obtained by a method of the present invention or information derived therefrom directly or indirectly, or in an information-processed form.
  • displayed forms include, but are not limited to. various methods, such as graphs, photographs, tables, animations, and the like. Such techniques are described in, for example, METHODS IN CELL BIOLOGY, VOL. 56, ed.
  • a High-Resolution Multimode Digital Microscope System (Sluder & Wolf, Salmon) , which discusses application software for automating a microscope and controlling a camera and the design of a hardware device comprising an automated optical microscope, a camera, and a Z-axis focusing device, which can be used herein.
  • Image acquisition by a camera is described in detail in, for example, Inoue and Spring, Video Miroscopy, 2d. Edition, 1997, which is herein incorporated by reference.
  • Real time display can also be performed using techniques well known in the art. For example, after all images are obtained and stored in a semi-permanent memory, or substantially at the same time as when an image is obtained, the image can be processed with appropriate application software to obtain processed data.
  • data may be processed by a method for playing back a sequence of images without interruption, a method for displaying images in real time, or a method for displaying images as a "movie" showing irradiating light as changes or continuation on a focal plane .
  • application software for measurement and presentation typically includes software for setting conditions for applying stimuli or conditions for recording detected signals .
  • a computer can have a means for applying a stimulus to cells and ameans forprocessing signals detected from cells, andin addition, can control an optically observing means (a SIT camera and an image filing device) and/or a cell culturing means.
  • a display screen displays a time-lapse profile detected from a cell or information derived therefrom in real time or after recording.
  • another recorded profile or information derived therefrom of a cell can be displayed while being superimposed with a microscopic image of the cell.
  • measurement parameters in recording stimulation conditions, recording conditions, display conditions, process conditions, various conditions for cells, temperature, pH, etc.
  • the present invention may be equipped with a function of issuing an alarmwhen a temperature or pH departs from the tolerable range.
  • the present invention may be equipped with a function of temporarily displaying a profile, a function of displaying topography, or the like.
  • the results of these analyses can be displayed while being superimposed with microscopic images stored in a recording medium.
  • Gene introduction Any technique may be used herein for introduction of a nucleic acidmolecule into cells , including, for example, transformation, transduction, transfection, and the like.
  • transfection refers to an act of performing gene introduction or transfection by culturing cells with gene DMA, plasmid DNA, viral DNA, viral RNA or the like in a substantially naked form (excluding viral particles), or adding such a genetic material into cell suspension to allow the cells to take in the genetic material.
  • a gene introduced by transfection is typically expressed within cells in a temporary manner or may be incorporated into cells in a permanent manner.
  • nucleic acid molecule introduction technique is well known in the art and commonly used, and is described in, for example, AusubelF .A. et al. , editors, (1988) , Current Protocols in Molecular Biology, Wiley, New York, NY; Sambrook J. et al. (1987) Molecular Cloning: A Laboratory Manual, 2nd Ed. and its 3rd Ed. , Cold Spring Harbor Laboratory Press , Cold Spring Harbor, NY; Special issue, Jikken Igaku [Experimental Medicine] "Experimental Methods for Gene introduction & Expression Analysis", Yodo-sha, 1997; and the like. Gene introduction can be confirmed by method as described herein, such as Northern blotting analysis and Western blotting analysis, or other well-known, common techniques .
  • vector refers to a vector transferring a polynucleotide sequence of interest to a target cell.
  • a vector is capable of self-replication or incorporation into a chromosome in a host cell (e.g. , a prokaryotic cell, yeast, an animal cell, a plant cell, an insect cell, an individual animal, and an individual plant, etc.), and contains a promoter at a site suitable for transcription of a polynucleotide of the present invention.
  • a vector suitable for performing cloning is referred to as a "cloning vector" .
  • Such a cloning vector ordinarily contains a multiple cloning site containing a plurality of restriction sites .
  • Restriction enzyme sites and multiple cloning sites as described above are well known in the art and can be used as appropriate by those skilled in the art depending on the purpose in accordance with publications described herein (e.g., Sambrook et al., supra) .
  • expression vector refers to a nucleic acid sequence comprising a structural gene and apromoter for regulating expression thereof , and in addition , various regulatory elements in a state that allows them to operate within host cells.
  • the regulatory element may include, preferably, terminators, selectable markers such as drug-resistance genes, and enhancers.
  • prokaryotic cells examples include, but are not limited to, pcDNA3(+), pBluescript-SK(+/-) , pGEM-T, pEF-BOS, pEGFP , pHAT, pUC18, pFT-DESTTM42GATEWAY (Invitrogen), and the like.
  • recombinant vectors for animal cells include, but are not limited to, pcDNAI/Amp, pcDNAI , pCDM ⁇ (all commercially available from Funakoshi) , pAGE107 [Japanese Laid-Open Publication No. 3-229 (Invitrogen), pAGE103 [ J. Biochem. , 101, 1307(1987) ] , pAMo, pAMoA [ J. Biol. Chem., 268, 22782-22787(1993)], a retrovirus expression vector based on a murine stem cell virus (MSCV) , pEF-BOS, pEGFP, and the like.
  • MSCV murine stem cell virus
  • recombinant vectors for plant cells include, but are not limited to, pPCVICEn4HPT, pCGN1548, pCGN1549, pBI221, pBI121, and the like.
  • any of the above-described methods for introducing DNA into cells can be used as a vector introduction method, including, for example, transfection, transduction, transformation, and the like (e.g., a calcium phosphate method, a liposome method, a DEAE dextran method, an electroporation method, a particle gun (gene gun) method, and the like), a lipo ection method, a spheroplast method (Proc. Natl. Acad. Sci. USA, 84, 1929(1978)), a lithium acetate method (J. Bacteriol. , 153, 163(1983); and Proc. Natl. Acad. Sci. USA, 75, 1929(1978)), and the like.
  • transfection e.g., a calcium phosphate method, a liposome method, a DEAE dextran method, an electroporation method, a particle gun (gene gun) method, and the like
  • a lipo ection method e. Natl
  • gene introduction reagent refers to a reagent which is used in a gene introduction method so as to enhance introduction efficiency.
  • examples of such a gene introduction reagent include, but are not limited to, cationic polymers, cationic lipids, polyamine-based reagents, polyimine-based reagents, calcium phosphate, and the like.
  • Specific examples of a reagent used in transfection include reagents available from various sources, such as, without limitation, Ef ectene Transfection Reagent (cat. no.
  • Gene expression may be "detected” or "quantified” by an appropriate method, including mRNA measurement and immunological measurement method.
  • molecular biological measurement methods include Northern blotting methods, dot blotting methods, PCR methods, and the like.
  • immunological measurement method include ELISA methods, RIA methods, fluorescent antibody methods.
  • Western blotting methods immunohistological staining methods , and the like, where a microtiter plate may be used.
  • quantificationmethods includeELISAmethods, RIAmethods, and the like.
  • a gene analysis method using an array e.g. , a DNA array, a protein array, etc.
  • an array e.g. , a DNA array, a protein array, etc.
  • the DNA array is widely reviewed in Saibo-Kogaku [Cell Engineering] , special issue, "DNA Microarray and Up-to-date PCR Method", edited by Shujun-sha.
  • the protein array is described in detail in Nat Genet. 2002 Dec; 32 Suppl: 526-32.
  • methods for analyzing gene expression include, but are not limited to, RT-PCR methods, RACE methods, SSCP methods, immunoprecipitation methods, two-hybrid systems, in vitro translation methods, and the like in addition to the above-described techniques.
  • the term “expression level” refers to the amount of a polypeptide or mRNA expressed in a subject cell.
  • the term “expression level” includes the level of protein expression of a polypeptide evaluated by any appropriate method using an antibody, including immunological measurement methods (e.g., an ELISA method. an RIA method, a fluorescent antibody method, a Western blotting method, an immunohistological staining method, and the like, or the mRNA level of expression of a polypeptide evaluated by any appropriate method, including molecular biological measurement methods (e.g., a Northern blotting method, a dot blotting method, a PCR method, and the like) .
  • the term “change in expression level” indicates that an increase or decrease in theprotein ormRNA level of expression of a polypeptide evaluatedby an appropriate method including the above-described immunological measurement method or molecular biological measurement method.
  • screening refers to selection of a target, such as an organism, a substance, or the like, a given specific property of interest from a population containing a number of elements using a specific operation/evaluation method.
  • an agent e.g., an antibody
  • a polypeptide or a nucleic acid molecule of the present invention can be used.
  • an antibody or a single chain antibody may be used for immunophenotyping a cell line and a biological sample.
  • a transcription or translation product of a gene may be useful as a cell specific marker, or more particularly, a cell marker which is distinctively expressed in various stages in differentiation and/or maturation of a specific cell type.
  • a monoclonal antibody directed to a specific epitope, or a combination of epitopes allows for screening of a cell population expressing amarker .
  • Various techniques employ monoclonal antibodies to screen for a cell population expressing a marker.
  • Examples of such techniques include, but are not limited to, magnetic separation using magnetic beads coated with antibodies, "panning” using antibodies attached to a solid matrix (i.e. , a plate), flow cytometry, and the like (e.g., US Patent No. 5,985,660; and Morrison et al. , Cell, 96:737-49(1999) ) .
  • These techniques may be used to screen cell populations containing undifferentiated cells, which can grow and/or differentiate as seen in human umbilical cord blood or which are treated and modified into an undifferentiated state (e.g. , embryonic stem cells, tissue stem cells, etc.).
  • undifferentiated cells e.g., embryonic stem cells, tissue stem cells, etc.
  • diagnosis refers to an act of identifying various parameters associated with a disease, a disorder, a condition, or the like of a subject and determining a current state of the disease, the disorder, the condition, or the like.
  • a method, device, or system of the present invention can be used to analyze a sugar chain structure, a drug resistance level, or the like. Such information can be usedto select parameters , such as a disease, a disorder, a condition, and a prescription or method for treatment or prevention of a subject.
  • a diagnosis method of the present invention can use, in principle, a sample which is derived from the body of a subject. Therefore, it is possible for some one which is not a medical practitioner, such as a medical doctor, to deal with such a sample.
  • the present invention is industrially useful. ( Therapy)
  • the term "therapy” refers to an act of preventing progression of a disease or a disorder, preferably maintaining the current state of a disease or a disorder, more preferably alleviating a disease or a disorder, and more preferably extinguishing a disease or a disorder .
  • the term "subject” refers to an organism which is sub ected to the treatment of the present invention.
  • a subject is also referred to as a "patient”.
  • a patient or subject may preferably be a human.
  • the term "cause” or "pathogen” in relation to a disease, a disorder or a condition of a subject refers to an agent associated with the disease, the disorder or the condition (also collectivelyreferred to as a “lesion” , or “disease damage” inplants) , including, without limitation, a causative or pathogenic substance (pathogenic agent), a disease agent, a disease cell, a pathogenic virus, and the like.
  • a disease targeted by the present invention may be any disease associated with a pathogenic gene.
  • diseases include, but are not limited to, cancer, infectious diseases due to viruses or bacteria, allergy, hypertension, hyperlipemia, diabetes, cardiac diseases, cerebral infarction, dementia, obesity, arteriosclerosis, infertility, mental andnervous diseases, cataract, progeria, hypersensitivity to ultraviolet radiation, and the like.
  • a disorder targeted by the present invention may be any disorder associated with a pathogenic gene.
  • a disease, disorder or condition include, but are not limited to, circulatory diseases (anemia (e.g., aplastic anemia (particularly, severe aplastic anemia), renal anemia, cancerous anemia, secondary anemia, refractory anemia, etc.), cancer or tumors (e.g., leukemia, multiple myeloma) , etc.); neurological diseases (dementia, cerebral stroke and sequela thereof, cerebral tumor, spinal injury, etc.); immunological diseases (T-cell deficiency syndrome, leukemia, etc.); motor organ and the skeletal systemdiseases (fracture, osteoporosis, luxation of joints , subluxation, sprain, ligament injury, osteoarthritis, osteosarcoma, Ewing's sarcoma, osteogenesis imperfe ⁇ ta, osteochondrodysplasia, etc.); dermatologic diseases (atrichia, melanom
  • respiratory diseases pulmonary diseases (e.g., pneumonia, lung cancer, etc.), bronchial diseases, lung cancer, bronchial cancer, etc.); alimentary diseases (esophagial diseases (e.g., esophagial cancer, etc.), stomach/duodenum diseases (e.g.. stomach cancer, duodenum cancer, etc.), small intestine diseases/large intestine diseases (e.g. , polyps of the colon, colon cancer, rectal cancer, etc. ) , bile duct diseases, liver diseases (e.g., liver cirrhosis, hepatitis (A, B, C, D, E, etc .
  • pancreatic diseases acute pancreatitis, chronic pancreatitis, pancreas cancer, cystic pancreas diseases, etc.
  • peritoneum/abdominal wall/diaphragm diseases hereinia, etc.
  • Hirschsprung' s disease etc.
  • urinary diseases kidney diseases (e.g., renal failure, primary glomerulus diseases, renovascular disorders, tubular function abnormality, interstitial kidney diseases , kidney disorders due to systemic diseases, kidney cancer, etc.), bladder diseases (e.g., cystitis, bladder cancer, etc.
  • genital diseases male genital organ diseases (e.g. , male sterility, prostatomegaly, prostate cancer, testicular cancer, etc.), female genital organ diseases (e.g., female sterility, ovary function disorders, hysteromyoma, adenomyosis uteri, uterine cancer, endometriosis, ovarian cancer, villosity diseases, etc.), etc); circulatory diseases (heart failure, anginapectoris , myocardial infarct , arrhythmia, valvulitis, cardiac muscle/pericardium diseases, congenital heart diseases (e.g., atrial septal defect, arterial canal patency, tetralogy of Fallot, etc.
  • genital organ diseases e.g. , male sterility, prostatomegaly, prostate cancer, testicular cancer, etc.
  • female genital organ diseases e.g., female sterility, ovary function disorders, hysteromy
  • artery diseases e.g., arteriosclerosis, aneurysm
  • vein diseases e.g., phlebeurysm, etc.
  • lymphoduct diseases e.g., lymphedema, etc.
  • cancer refers to a malignant tumor which has a high level of atypism, grows faster than normal cells, tends to disruptively invade surrounding tissue or metastasize to new body sites or a condition characterized by the presence of such a malignant tumor.
  • cancer includes, without limitation, solid cancer and hematological cancer.
  • solid cancer refers to a cancer having a solid shape in contrast to hematological cancer, such as leukemia and the like.
  • examples of such a solid cancer include, but are not limited to, breast cancer, liver cancer, stomach cancer, lung cancer, head and neck cancer, uterocervical cancer, prostate cancer, retinoblastoma, malignant lymphoma, esophagus cancer, brain tumor, osteon ⁇ us, and the like.
  • cancer therapy encompasses administration of an anticancer agent (e.g., a chemotherapeutic agent , radiation therapy, etc. ) or surgical therapy, such as surgical excision and the like.
  • an anticancer agent e.g., a chemotherapeutic agent , radiation therapy, etc.
  • surgical therapy such as surgical excision and the like.
  • Chemotherapeutic agents used herein are well known in the art and are described in, for example, Shigeru
  • Anticancer agents " , 2nded. , Chugailgaku sha; Pharmacology; and Lippincott Williams & Wilkins, Inc.
  • alkylating agents which alkylate cell components, such as DNA, protein, andthe like, toproduce cytotoxicity (e.g. , cyclophosphamide, busulfan, thiotepa, dacarbazine, etc.); 2) antimetabolites which mainly inhibit synthesis of nucleic acids (e.g., antifolics (methotrexate, etc.), antipurines ( 6-mercaptopurine, etc.), antipyrimidines (fluorourasil
  • DNA topoisomerase inhibitors e.g., camptothecin and etoposide, each of which inhibits topoisomerases I and II
  • tubulin agents which inhibit formation of microtubules and suppress cell division (vinblastine, vincristine, etc.); 5) platinum compounds which bind to DNA and proteins to exhibit cytotoxicity (cisplatin, carboplatin, etc.); 6) anticancer antibiotics which bind to DNA to inhibit synthesis of DNA and RNA (adriamycin, dactinomycin, mitomycin C, bleomycin, etc.); 7) hormone agents which are applicable to hormone-dependent cancer, such as breast cancer, uterus cancer, prostate cancer, and the like (e.g., tamoxifen, leuprorelin (LH-RH), etc.); 8) biological formulations (asparaginase effective for asparagine requiring blood malignant tumor, interferon exhibiting direct antitumor action
  • an “anticancer agent” used herein selectively suppresses the growth of cancerous (tumor) cells, and includes both pharmaceutical agents and radiation therapy.
  • an anticancer agent is well known in the art and described in, for example, Shigeru Tsukagoshi et al. editors, "Kogan zai Manuaru [Manual of Anticancer agents]", 2nd ed. , Chugailgaku sha; Pharmacology; and Lippincott Williams & Wilkins, Inc.
  • radiation therapy refers to a therapy for diseases using ionizing radiation or radioactive substances.
  • Representative examples of radiation therapy include, but are not limited to. X-ray therapy, ⁇ -ray therapy, electron beam therapy, proton beam therapy, heavyparticlebeamtherapy, neutron capture therapy. and the like.
  • heavy particle beam therapy is preferable.
  • heavy particle beam therapy requires a large-size device and is not generally used.
  • the term "pharmaceutically acceptable carrier” refers to amaterial for use in production of a medicament, an animal drug or an agricultural chemical, which does not have an adverse effect on an effective component .
  • a pharmaceutically acceptable carrier include, but are not limitedto, antioxidants, preservatives, colorants, flavoring agents, diluents, emulsifiers, suspending agents, solvents, fillers, bulking agents, buffers, delivery vehicles, excipients, agricultural or pharmaceutical adjuvants, and the like.
  • the type and amount of a pharmaceutical agent used in a treatment method of the present invention can be easily determined by those skilled in the art based on information obtained by a method of the present invention (e.g., information about the level of drug resistance, etc. ) and with reference to the purpose of use, a target disease (type. severity, and the like), the patient's age, weight, sex, and case history, the form or type of the cell, and the like.
  • the frequency of the treatment methodof thepresent invention applied to a subject (or patient) is also determined by those skilled in the art with respect to t e purpose of use, target disease (type, severity, and the like), the patient's age, weight, sex, andcasehistory, theprogression of the therapy, and the like . Examples o£ he frequency include once per day to several months (e.g., once per week to once per month) . Preferably, administration is performed once per week to month with reference to the progression.
  • the term "instructions" refers to a descriptionof atailormade therapyof thepresent invention for a person who performs administration, such as a medical doctor, a patient, or the like. Instructions state when to administer a medicament of the present invention, such as immediately after or before radiation therapy (e.g. , within 24 hours , etc. ) .
  • the instructions are prepared in accordance with a format defined by an authority of a country in which the present invention is practiced (e.g. , Health, Labor and Welfare Ministryin Japan, Food and DrugAdministration (FDA) in the U.S. , and the like), explicitly describing that the instructions are approved by the authority.
  • the instructions are so-called package insert and are typically provided in papermedia.
  • the instructions are not so limited and may be provided in the form of electronic media (e.g., web sites, electronic mails, and the like provided on the internet ) .
  • two or more pharmaceutical agents may be used as required.
  • these agents may have similar properties or may be derived from similar origins, or alternatively, may have different properties or may be derived from diff rent origins .
  • a method of the present invention can be used to obtain information about the drug resistance level of a method of administering two or more pharmaceutical agents.
  • a gene therapy can be performed based on the resultant information about drug resistance.
  • the term "gene therapy” refers to a therapy in which a nucleic acid, which has been expressed or can be expressed, is administered into a subject.
  • a protein encoded by a nucleic acid is produced to mediate a therapeutic effect .
  • Thepresent invention maybe appliedto gene therapies based on such a certain specific time-lapse profile.
  • Micromachining is described in, for example, Campbell, S.A. (1996), “The Science and Engineering of Microelectronic Fabrication” , Oxford University Press; Zaut, P.V. (1996), “MicromicroarrayFabrication: a Practical Guide to Semiconductor Processing” , Semiconductor Services; Madou, M.J. (1997), “Fundamentals of Microfabrication” , CRC1 5 Press; Rai-Choudhury, P. (1997), “Handbook of Microlithography, Micromachining, & Microfabrication: Microlithography”. Relevant portions (or possibly the entirety) of each of these publications are herein incorporated by reference.
  • DNA synthesis techniques and nucleic acid chemistry for producing artificially synthesized genes are described in, for example. Gait, M.J. (1985), “Oligonucleotide Synthesis: A Practical Approach”, IRL Press; Gait, M.J. (1990), “Oligonucleotide Synthesis : A Practical Approach” , IRL Press; Eckstein, F. (1991), “Oligonucleotides and Analogues: A Practical Approach", IRL Press; Adams, R.L. et al. (1992), “The Biochemistry of the Nucleic Acids", Chapman & Hall; Shabarova, Z. etal. (1994), “Advanced Organic Chemistry of Nucleic Acids", Weinheim; Blackburn, G.M.
  • Mathematical processes used herein can be performed by using well-known techniques described in, for example, Kazuyuki Shimizu, "Seimei Sisutemu Kaiseki notameno Sugaku [Mathematics forAnalyzing Biological Systems] " , Corona sha, 1999; and the like . Among these techniques, representative analyzing techniques will be described below.
  • such a mathematical process may be regression analysis.
  • regression analysis include, but are not limited to, linear regression (e.g., simple regression analysis, multiple regression analysis, robust estimation, etc. ) , nonlinear estimation, andthe like.
  • the parameters a and b are typically determined so that the mean of sum of squares of the distance between a data point and the straight line is minimum. In this case, the rms of the distance is partially differentiated to produce simultaneous linear equations . These equations are solved for a and b which minimize the square errors. Such values are called least square estimates .
  • a regression line is calculated based on the value obtained by subtracting the mean of all data values from each data value.
  • a regression line represented by:
  • the correlation coefficient r xy is represented by:
  • r x S ⁇ y/V SxySyy .
  • This equation is called a multiple regression equation.
  • a Q and the like are called (partial) regression coefficients.
  • a least square method is used and normal equations are solved to obtain least square estimates . Evaluation can be performed as with single regression analysis.
  • robust estimation is used.
  • the least square method is based on the premise that measurement values are not biased and measurement errors have a normal distribution, and models have no approximation error. In actual situations, however, there may be errors in measurement.
  • robust estimation unreliable data is detected and separated as outliers from the great majority of data which are reliable, or is subjected to a statistical process. Such a robust estimation may be utilized herein.
  • Nonlinear estimation may also be used herein. With nonlinear estimation, it is possible to represent a nonlinear model as vector equations which are in turn solved.
  • Principal component analysis which utilizes two-dimensional data principal component analysis, multi-dimensional data principal component analysis, singularvalue decomposition, and generalized inversematrix.
  • canonical correlation analysis factor analysis, discrimination analysis, cluster analysis, and the like may be used herein. (Gene set classification by cluster analysis)
  • a set of reference transcription control sequences which are cooperatively controlled under a wide range of condition .
  • An embodiment of identifying such a set of reference transcription control sequences is, for example, a clustering algorithm, which is reviewed in, for example,
  • a set of transcription control sequences can also be defined based on a transcription control mechanism. Transcription control sequences having a transcription factor binding site for the same or similar sequence in a regulatory region are likely to be cooperatively regulated. In a certain embodiment, the regulatory regions of transcr.iption control sequences of interest are compared with one another using multiple alignment analysis, so that a possible common transcription factor binding site can be determined (Stormo and Hartzell, 1989, "Identifying protein binding sites from unaligned DNA fragments", Proc. Natl. Acad. Sci., 86: 1183-1187; Hertz and Stormo, 1995, "Identification of consensus patterns in unaligned DNA and protein sequences : a large-deviation statistical basis for penalizing gaps", Proc. of 3rd Intl. Conf . on Bioinformatics and Genome Research, Lim and Cantor, ed. , World Scientific Publishing Co., Ltd. Singapore, pp.201-216).
  • a preferable embodiment for identif ing such a set of basic transcription control sequences includes a clustering algorithm.
  • the transcription levels of a number of transcription control sequences can be monitored while applying various stimuli to biological samples .
  • a table of data containing measurements of the transcription levels of transcription control sequences is used in cluster analysis .
  • cluster analysis is performed for a table of datahavingmxk dimensions where m is the total number of conditions or stimuli and k is the number of transcription control sequences to be measured.
  • clustering algorithms are useful for clustering analysis .
  • differences or distances between samples are used to form clusters .
  • a distance used is a Euclidean distance in multi-dimensional space:
  • (x, y) represents a distance between gene X and gene Y (or any other cellular components X and Y (e.g., transcription control sequences)); i and i represent gene expression in response to i stimuli. Euclidean distances may be squared and then multiplied with weights which are increased with an increase in the distance. Alternatively, a distance reference may be, for example, a distance between transcription control sequences X and Y, or a Manhattan distance represented by:
  • X and Y represent responses of transcription control sequences or gene expression when i stimuli are applied.
  • distance Several other definitions of distance include Chebyshev distance, power distance, and mismatch rate.
  • I(x, y) (the number of Xi ⁇ Yi)/i may be used in a method of the present invention. Such a method is particularly useful in terms of cellular responses .
  • an inner product X-Y is defined by:
  • a distance reference is suited to a biological problem in order to identify cellular components (e.g., transcription control sequences, etc.) which are simultaneously changed and/or simultaneously regulated.
  • r ⁇ is defined by:
  • Oi (x) and Oi (Y) represent standard errors in measurement of genes X and Y in experiment i.
  • correlation coefficients are constrained between values +1 (two response vectors are completely correlated, i.e. , the two vectors are essentially the same) and -1 (two response vectors are not correlated or do not have the same orientation (i.e., opposing orientations)).
  • correlation coefficients are particularly preferable in an embodiment of the present invention which tries to detect a set or cluster of cellular components (e.g. , transcription control sequences, etc.) having the same sign or response.
  • a set or cluster of cellular components e.g. , transcription control sequences, etc.
  • the relationship between cellular components are more complicated, e.g. , a number of biological pathways (e.g. , signal transduction pathways , etc.) are involved with the same cellular component (e.g., a transcription control sequence, etc.) so that different results may be obtained.
  • a correlation coefficient represented by expression (5) is particularly useful for the above-described embodiment:
  • Examples of such a technique include a simple linkage method, a nearest neighbor method, and the like. In these techniques, a distance between the two closest samples is measured. Alternatively, in a complete linkage method, which may be herein used, a maximum distance between two samples in different clusters is measured. This technique is particularly useful when genes or other cellular components naturally form separate "clumps".
  • themean of non-weightedpairs is used to define themean distance of all samplepairs in two different clusters .
  • This technique is also useful in clustering genes or other cellular components which naturally form separate "clumps".
  • a weighted pair mean technique is also available .
  • This technique is the same as a non-weighted pair mean technique, except that in the former, the size of each cluster is used as a weight .
  • This technique is particularly useful in an embodiment in which it is suspected that the size of a cluster of transcription control sequences or the like varies considerably (Sneath and Sokal, 1973, "Numerical taxonomy” , San Francisco : .H. Freeman & Co . ) .
  • cluster linkage methods such as, for example, non-weighted and weighted pair group centroid and Ward's method, are also useful in several embodiments of the present invention. See, for example. Ward, 1963, J. Am. Stat . Assn., 58: 236; and Hartigan, 1975, "Clustering algorithms”. New York: Wiley.
  • cluster analysis can be performed using a well-known hclust technique (e.g. , see awell-known procedure in "hclust” available from Program S-Plus, MathSoft, Inc., Cambridge, MA).
  • Stimulation conditions include treatment with a pharmaceutical agent in different concentrations, different measurement times after treatment , response to genetic mutations in various genes, a combination of treatment of a pharmaceutical agent and mutation, and changes in growth conditions (temperature, density, calcium concentration, etc. ) .
  • the term "significantly different" in relation to two statistics means that the two statistics are different from each otherwith a statistical significance .
  • data of a set of experiments concerning the responses of cellular components can be randomized by a Monte Carlo method to define an objective test.
  • an objective test can be definedbythe following technique .
  • Pki represents aresponse of a component k in experiment i.
  • ⁇ (i) represents a random permutation of the indices of experiments.
  • Pk ⁇ is calculated for a number of different random permutations (about 100 to 1,000) . For each branch of the original tree and each permutation:
  • D k is the square of the distance reference (mean) of component k with respect to the center of a cluster to which component k belongs .
  • Superscript 1 or 2 indicates the center of all branches or the center of the more preferable cluster of the two subclusters .
  • an objective statistical test can be preferably used to determine the statistical reliability of grouping any clustering methods or algorithms .
  • similar tests can be applied to both hierarchical and nonhierar ⁇ hical clustering methods .
  • the compactness of a cluster is quantitatively defined as, for example, the mean of squares of the distances of elements in the cluster from the "mean of the cluster” , ormorepreferably, the inverse of the mean of squares of the distances of elements from the mean of the cluster.
  • the mean of a specific cluster is generally defined as the mean of response vectors of all elements in the cluster. However, in a specific embodiment (e.g.
  • the above-described definition of the mean may raise a problem in an embodiment in which response vectors have opposing directions so that the mean of the cluster as defined above is zero. Therefore, in such an embodiment, a different definition is preferably selected for the compactness of a cluster, for example, without limitation, the mean of squares of the distances of all pairs of elements in a cluster.
  • the compactness of a cluster may be defined as the mean of distances between each element (e.g. , a cellular component) of a cluster and another element of the cluster (or more preferably the inverse of the mean distance) .
  • a profile of the present invention canbe analyzed using signalprocessing techniques .
  • signalprocessing techniques acorrelation function is defined, a correlation coefficient is calculated, an autocorrelation function and a cross-correlation function are defined, and these functions are weighted where the sum of the weights is equal to 1. Thereby, moving averages can be obtained.
  • Rhythm In signal processing, it is important to consider a time domain and a frequency domain. Rhythm often plays an important role in dynamic characteristic analysis for natural phenomena, particularly life and organisms. If a certain time function f (t ) satisfies the followingconditio , the function is called a periodic function:
  • the function takes a value of f ( 0 ) .
  • the function takes a value of f (0) at time T again after taking various values after time 0.
  • Such a function is called a periodic function.
  • Such a function includes a sine wave. T is called a period.
  • the function has one cycle per time T. Alternatively, this feature may be represented by 1/T which means the number of cycles per unit time (cycles/time) without loss of the information.
  • the concept represented by the number of cycles per unit time is called frequency. If the frequency is represented by f, f is represented by:
  • the frequency is an inverse of the time.
  • the time is dealt in a time domain, while the frequency is dealt in a frequency domain.
  • the frequency may be represented in an electrical engineering manner.
  • the frequency is represented by angular measure where one period corresponds to 360° or 2 ⁇ radians.
  • f cycles/ sec
  • 2 ⁇ f radians/sec
  • a sine wave is compared with a cosine wave.
  • the cosine wave is obtained by translating the sine wave by 90° or ⁇ /2 radians.
  • the sine wave may be represented by the delayed cosine wave. This time delay is called phase.
  • a sine wave has a phase of 90°.
  • the amplitude of the resultant wave is increased by a factor of 42 and the phase is ⁇ /4.
  • thepresent invention provides amethod for presenting a state of a cell.
  • the method comprises the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a gene state (e.g. , the expression of a gene (transcription, translation, etc.), etc.) associated with at least one gene (including a transcription control sequence, etc.) selected from genes (including a transcription control sequence , etc . ) derived rom the cell ; an b) presenting the time-lapse profile.
  • a gene state e.g. , the expression of a gene (transcription, translation, etc.), etc.
  • a transcription control sequence e.g., the expression of a gene (transcription, translation, etc.), etc.
  • a transcription control sequence e.g., the expression of a gene (transcription, translation, etc.), etc.
  • a transcription control sequence e.g., the expression of a gene (transcription, translation, etc.), etc.
  • a transcription control sequence such as a constitutive promoter or the like, which is assumed to be changed, can be used as a reference to obtain a difference, thereby obtaining a time-lapse profile.
  • the present invention is not limited to this .
  • the above-described genes preferably include different transcription control sequences .
  • the present invention is not limited to this .
  • Time-lapse profiles maybe displayedusinganymethod, for example, maybevisually displayedusing a displaydevices (e.g., the x axis shows time while the y axis shows signal intensity) , or alternatively, may be displayed as a table of numerical values. Alternatively, signal intensity may be displayed as optical intensity.
  • a displaydevices e.g., the x axis shows time while the y axis shows signal intensity
  • signal intensity may be displayed as optical intensity.
  • cells are fixed to a solid phase support (e.g., an array, a plate, a microtiter plate, etc.) when they are monitored.
  • a solid phase support e.g., an array, a plate, a microtiter plate, etc.
  • fixation can be carried out using techniques known in the art or techniques as describedherein .
  • such a time-lapse profile may be presented in real time.
  • the real time presentation may contain a time lag to some extent if it is performed substantially in real time.
  • a tolerable time lag is, for example, 10 seconds at maximum, andmore preferably 1 second at maximum, though the tolerable time lag depends on the required level of real time (simultaneity).
  • the present invention provides a method for determining a state of a cell.
  • Such determination of the cellular state is achievedbymonitoring changes in a state (e.g., the expression of a gene (transcription, translation, etc.), etc.) of a gene (e.g., a transcription control factor, etc.), which are not conventionally observed. Therefore, the method of the present invention or determining the cellular state makes it possible to determine various states which cannot be conventionally observed.
  • Such a method comprises the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a gene state (e.g.
  • the expression of a gene (transcription, translation, etc.), etc.) associated with at least one gene (including a transcription control sequence, etc.) selected from genes (including a transcription control sequence, etc. ) derived from the cell; and b) determining the state of the cell based on the time-lapse profile of the transcription level.
  • the above-described genes preferably include different transcription control sequences . The present invention is not limited to this.
  • the cellular state determination method of the present invention may further comprise correlating the time-lapse profile with the state of the cellbefore obtaining the time-lapse profile .
  • correlation information may be provided from known information.
  • Such a correlating step may be performed every determining step or correlation information may be stored in a database and may be used as required.
  • the transcription control sequence may be, without limitation, a promoter, an enhancers, a silencer, another flanking sequence of a structural gene in a genome, and a genomic sequence other than exons.
  • a promoter is preferable. This is because a transcription level can be directly measured.
  • the transcription control sequences may include constitutive promoters, specific promoters , inducible promoters , and the like . Any promotermaybe used.
  • the present invention is characterized in that any type of promoter can be used. According to the method of the present invention, profiles can be analyzed from a viewpoint of "procession" . Therefore, it is possible to determine a state of a cell using any promoter or any set of promoters. Such determination cannot be achieved by conventional techniques.
  • the present invention is highly useful since the present invention achieves what cannot be achieved by conventional techniques .
  • At least two transcription control sequences are monitored. By observing at least two transcription control sequences, 80% of the states of a cell can be typically identified. More preferably, at least 3 transcription control sequences are monitored. By observing at least three transcription control sequences, at least 90% of the states of a cell canbe typicallyidentified. In a most preferred embodiment, at least 8 transcription control sequences are monitored. By observing at least 8 transcription control sequences, substantially all of the states of a cell can be typically identified. Thus , although any transcription control sequences are selected, substantially all of the states of a cell can be determined by selecting and monitoring a small number of transcription control sequences as described above. This feature has not been conventionally expected. The method of the present invention is simpler, more precise and more accurate than conventional determination methods in which observation is made at time points and resultant data is statistically processed as heterologous groups .
  • the determination method of the present invention preferably further comprises arbitrarily selecting at least one gene (including transcription control sequence, etc.) from genes (including transcription control sequences, etc.) before monitoring.
  • agene e.g. , aparticular transcription control sequence , etc .
  • agene which does not exhibit specificity when investigated from point to point, can be used.
  • such a time-lapse profile may be presented in real time.
  • the real time presentation may contain a time lag to some extent if it is .performed substantially in real time.
  • a tolerable time lag is, for example, 10 seconds at maximum, and more preferably 1 second at maximum, though the tolerable time lag depends on the required level of real time (simultaneity). For example, in a therapy requiring real time diagnosis , the time lag may be, for example, 30 seconds at maximum.
  • states determined by the cellular state determination method of the present invention includes, for example, differentiated states, undifferentiated states, cellular responses to external factors , cell cycles , growth states , and the like . More specifically, such a state includes, for example, without limitation, a response of a cancer cell to an anticancer agent , drug resistance, a response to abiological clock, a differentiated state of a stem cell (e.g., a mesenchymal stem cell, a neural stem cell, etc.), an undifferentiated state of a purified stem cell (e.g., an embryonic stem cell, etc.), and the like.
  • differentiated states e.g., a mesenchymal stem cell, a neural stem cell, etc.
  • a purified stem cell e.g., an embryonic stem cell, etc.
  • a cell determined by the cellular state determination method of the present invention includes, for example, without limitation, a stemcell or a somatic cell, or amixture thereof .
  • suchacell includes anadherent cell, a suspendedcell, a tissue forming cell, andamixture thereof .
  • the cellular state determination method of the present invention may be performed for a cell fixed on a substrate which is a solid phase support.
  • the solid phase support is called a chip.
  • the substrate is also called an array.
  • a transcription control sequence used for determination may be operably linked to a reporter gene sequence and may be transfected into a cell.
  • the transcription levelof the transcriptioncontrol sequence can be measured as a signal from the reporter gene.
  • transfection a technique for increasing the efficiency of introduction of a target substance into a cell may be used.
  • a target substance e.g., DNA, RNA, a polypeptide, a sugar chain, or a composite substance thereof, etc.
  • an actin acting substance such as fibronectin
  • the order of steps of A) and B) is not particularly limited, and C) contacting the target substance and the actin acting substance with the cell.
  • the target substance and the actin acting substance may be provided together or separately.
  • the actin acting substance may be used as described in detail above for the composition of the present invention for increasing the efficiency of introduction of a target substance into a cell. Such a technique can be carried out as appropriate based on the present speci ication by those skilled in the art. Therefore, the actin acting substance may be used in a manner which is described in detail above for the composition of the present invention for increasing the efficiency of introduction of a target substance into a cell.
  • the actin acting substance may be an extracellular matrix protein (e.g., fibronectin, vitronectin, laminin, etc. ) oravariant thereof . More preferably, fibronectin or a variant or fragment thereof may be used.
  • extracellular matrix protein e.g., fibronectin, vitronectin, laminin, etc.
  • fibronectin or a variant or fragment thereof may be used.
  • transcription control sequence used in the present invention may be capable of binding to a transcription factor.
  • a transcription factor include, but are not limited to, ISRE, RARE, STAT3, GAS, NFAT, MIC, API, SRE, GRE, CRE, NFKB, ERE, TRE, E2F, Rb, p53, and the like.
  • ISRE is related to STAT1/2.
  • RARE is related to retinoic acid.
  • STAT3 is related to the control of differentiation.
  • GRE is related to the metabolism of sugar.
  • CRE is related to cAMP.
  • TRE is related to thyroid hormone.
  • E2F is related to cell cycle.
  • p53 is related to Gl check point . Therefore, such information can be used to determine a state of a cell.
  • the determination step of b) of the present invention comprises comparing the phases of the time-lapseproflies .
  • Phases canbe calculatedbythose skilled in the art using general techniques as described herein above and techniques described in the examples below.
  • the determination step of b) of the present invention comprises calculating a difference between the time-lapse profile of the cell and a control profile .
  • the difference can be calculated by those skilled in the art using general techniques as described herein above and techniques described in Examples below.
  • the determination step of b) of the present invention comprises a mathematical process selected from the group consisting of signal processing and multivariate analysis. Such a mathematical process can be easily carried out by those skilled in the art based on the description of the present specification.
  • thepresent invention provides amethod for generating profile data of information of a cell.
  • the method comprises the steps of: a) providing and fixing the cell to a support; and b) monitoring a biological factor or an aggregation of biological factors on or within the cell over time to generate data of the profile of the cell.
  • the present invention is characterized in that the cell is fixed to substantially the same site of the support so that information can be continuously (e.g., in a time-lapse manner, etc.) obtained from the same cell. Thereby, it is possible to monitor a biological factor and an aggregation of biological factors over time.
  • the time-lapse monitoring makes it possible to obtain a profile of a cell and construct a digital cell.
  • a fixing agent such as a salt or the like, may be used for the support in the present invention.
  • a combination of a salt, a complex of a positively charged substance and a negatively charged substance, and a cell may fix the cell to the support .
  • Any salt may be used in the present invention. Examples of such a salt include, but are not limited to, calcium chloride, sodium hydrogen phosphate, sodiumhydrogen carbonate, sodiumpyruvate, HEPES, sodium chloride, potassiumchloride, magnesium sulfide, iron nitrate, amino acids, vitamins, and the like.
  • a biological factor of interest may be a nucleic acid molecule or a molecule derived from the nucleic acid molecule . This is because most nucleic acid molecules carry genetic information, from which cellular information can be obtained.
  • the present invention relates to data obtained by a method comprising the steps of: a) providing and fixing the cell to a support; and b) monitoring a biological factor or an aggregation of biological factors on or within the cell over time to generate data of the profile of the cell.
  • data is obtained by the method which is not conventionally available, and is thus novel. Therefore, the present invention provides a recording medium storing such data.
  • the present invention relates to a method for generating profile data of information of a plurality of cells in the same environment .
  • the method comprises the steps of: a) providing a plurality of cells on a support which can maintain the same environment ; and b) monitoring a biological factor or an aggregation of biological factors on orwithin the cells over time to generate profile data of the cells.
  • the present invention is characterized in that profile data of information of a plurality of cells in the same environment can be obtained. Techniques for providing such an environment is also within the scope of the present inventio .
  • a fixing agent such as a salt or the like, may be used for the support in the present invention.
  • a combination of a salt, a complex of a positively charged substance and a negatively charged substance, and cells may fix the cells to the support .
  • Any salt maybe used in the present invention .
  • examples of such a salt include, but are not limited to, calciumchloride, sodiumhydrogen phosphate, sodiumhydrogen carbonate, sodium pyruvate, HEPES, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids , vitamins , and the like .
  • a biological factor of interest may be a nucleic acid molecule or a molecule derived from the nucleic acid molecule . This is because most nucleic acidmolecules carry genetic information, from which cellular information can be obtained.
  • an actin acting substance is preferably provided to the cells in the method of the present invention.
  • the actin acting substance acts on actin within the cells to deform the internal cytoskeleton to acilitate introduction of an external f ctor into the cells .
  • the presence of such an actin acting substance makes it possible to investigate an influence of an external factor of interest on the cells .
  • a biological factor targeted by the present invention is at least one factor selected from the group consisting of nucleic acids , proteins , sugar chains , lipids, low molecular weight molecules, and composite molecules thereof .
  • cells targeted by the present invention are preferably cultured for a certain period of time without stimulation before monitoring. This procedure is performed for the purpose of synchronization of the target cells.
  • the period of time required for synchronization is, for example, advantageously at least one day, more preferably at least two days, even more preferably at least 3 days, and still even more preferably at least 5 days. It should be noted that as the period of time for culture is increased, the necessity of maintenance of culture conditions is increased.
  • the same medium is preferably supplied to cells. Therefore, culture medium is preferably consistent or at least changed in the consistent manner. To achieve this, a means for causing convection in the medium may be preferably provided and used.
  • a biological factor provided to a cell in the present invention may comprise a nucleic acid molecule encoding a gene.
  • the nucleic acid molecule encoding a gene is preferably transfected into a cell.
  • such a biological factor may be provided alongwithatransfectionreagent (gene introduction reagent ) .
  • the nucleic acid molecule encoding a gene may be provided to a cell along with a gene introduction reagent and an actin acting substance.
  • the cell is preferably provided with a complex of a salt , a positively charged substance, and a negatively charged substance (in this case, a nucleic acid molecule and a gene introduction reagent).
  • the cell and the target molecule are fixed on a support.
  • this technique makes it possible to allow separate biological factors (e.g. , nucleic acid molecules) to be separately introduced into cells without a partition. As substantially no partition is used, aplurality of cells canbemonitored in substantially the same environment. Further, different biological factors can be introduced into a cell, thereby making it possible to obtain a profile of a state of the cell affected by the biological factors . Such a profile can be stored as data. Such data may be stored in a certain standard format, and therefore, can be reproduced and compared. Thus, the present invention has an effect which is not achieved by conventional biological assays.
  • Such data which is once obtained and stored in such a starndard format, can be extracted and used for various purposes and a number of times .
  • researchers can perform "virtual experiments" to conduct various analyses under the same conditions while taking into consideration differences in a substantially infinite number of parameters.
  • virtual experiments and the results thereof are stored in a raw data format, undergraduate and graduate students, who otherwise spend most of their school life doing labor work, can have data analysis education in the true sense.
  • the above-described cellular profile data can be easily standardized, therebymaking it possible to do research based on data which can be considered to be obtained by experiments under the same conditions over the world.
  • Such data may be distributed in a standardizedform.
  • Such a standardizedform may be readable to typical computers (e.g.
  • Data produced in the present invention may include generated cellular pro ile data, information about experimental conditions used in data generation, information about cells, information about environments, and the like.
  • a profile targeted by the present invention may include a profile of gene expression, aprofile of an apoptotic signal, aprofile of a stress signal, a profile of localization of a molecule (preferably, the molecule is labeled with a fluorescent, phosphorescent, or radioactive substances or a combination thereof) , a profile of changes in cellular morphology, a profile of a promoter, aprofile of a promoter dependent on a specific pharmaceutical agent (e.g., antibiotics, ligands, toxins, nutrients, vitamins, hormones, cytokines, etc.), a profile of intermolecular interaction, and the like.
  • the present invention may further comprise administering the specific pharmaceutical agent .
  • the present invention may further comprise providing an external stimulus to the cell.
  • an external stimulus may or may not be a biological actor.
  • the external factor may be any f ctor and includes , without limitation, substances or other elements (e.g., energy, such as ionizing radiation, radiation, light, acoustic waves, and the like).
  • an external factor used in the present invention may be RNAi.
  • RNAi can be used to substantially suppress an arbitrary gene. It is possible to produce RNAi for all existing genes and investigate the effect of RNAi on the genes . RNAi canbe createdby techniques well known in the art .
  • an external factor of the present invention may comprise a chemical substance which does not exist in organisms.
  • a chemical substance which does not exist in organisms By providing such chemical substance which does not exist in organisms, it is possible to collect a variety of information. Data which is once collected can be reused. Therefore, assuming that a chemical substance which does not exist in organisms is not substantially available, if data can be once obtained for such a chemical substance in accordance with the present invention, research can be continued without worrying bout the availability of such a chemical substance.
  • an external factor targeted by the present invention may comprise a ligand to a cellular receptor.
  • a profile obtained according to the present invention may be a profile of re ⁇ eptor-ligand interactions.
  • a profile of cellular morphology may be obtained.
  • a method of the present invention may further comprise applying to a cell a stimulus which may be selected from the group consisting of overexpression of a gene, underexpression of a gene, knock down of a gene, addition of an external factor, and a change in an environment.
  • a profile obtained according to the present invention may be a profile of interactions between molecules present within a cell. Such an intermolecular interaction includes, but is not limited to, interaction between molecules present in a signal transduction pathway, interaction between a receptor and a ligand, interaction between a transcription factor and a transcription factor sequence, and the like.
  • a profile obtained according to the present invention may be a profile of interaction between molecules present in a cell.
  • a method of the present invention may further comprise observing a cell using a technique selected from the group consisting of a two-hybrid method, FRET, and BRET.
  • the two-hybridmethod detects intermolecular interactionwithin a cell.
  • this technique is described in, for example, Protein-Protein Interactions, A MOLECULAR CLONING MANUAL, Edited by Erica Golemis , Cold Spring Habor Laboratory Press, Cold Spring Harbor, New York (this document also describes FRET) .
  • FRET is a technique for detecting inter- or intra-molecular resonance energy shift as a fluorescent wavelength, andis describedin, forexample, Protein-Protein Interactions (supra) ; and Miyawaki A. , Visualization of the spatial and temporal dynamics of intracellular signaling,
  • BRET is an intermolecular interaction assay system and is described, for example, Boute N. , The use of resonance energy transfer in high-throughput screening: BRET versus FRET, Trends Pharmacol Sci., 2002 Aug; 23(8):351-4.
  • cells targeted by the present invention are preferably arranged on a support in a pattern of an array.
  • a plurality of cells targeted by the present invention may be spaced at intervals of 10 cm at maximum, more preferably 1 cm at maximum, even more preferably 1 mm at maximum, and most preferably 0.1 mm at maximum.
  • the cells need to be spaced at minimum intervals . Such intervals may be preferably set so that substantially no interaction occurs.
  • a profile obtained according to the present invention may or may not be obtained in real time.
  • a real time profile may be advantageous. When simultaneity is important , it is important to obtain aprofile in real time. Alternatively, when a profile is intended to be stored, the profile is not necessarily obtained in real time.
  • the present invention further comprises fixing a cell to a solid phase support .
  • the cell is fixed to the solid phase support along with a salt, a complex, an actin acting substance, or the like .
  • data generated according to the present invention may contain information about a profile.
  • data generated according to the present invention may contain information about conditions for monitoring, information about a cellular state, information about an external factor, information about environment, and the like.
  • At least two biological factors may be preferablymonitored in the present invention, more preferably at least 3 biological factors, and even more preferably at least 8 biological factors.
  • all biological factors in a certain specific category e.g. , all olfactory receptors, all gustatory receptors, etc. ) may be preferably monitored.
  • the present invention mayfurther comprise arbitrarily selecting the above-described biological factors.
  • a cell targeted by the present invention may be selected from the group consisting of stem cells and somatic cells.
  • a support used in the present invention is preferably a solid phase support . This is because cells are easily fixed to such a support .
  • a solid phase support may be made of any material known in the art.
  • the support may be in the form of a substrate.
  • the above-described biological factor may be a nucleic acid and the above-described cell may be transfected with the nucleic acid.
  • transfection may be performedin solidphase or in liquidphase . Morepreferably, transf ction may be advantageously performed in solid phase . This is because data collection and standardization can be more easily carried out .
  • a profile may be subjected to a process selected from the group consisting of phase comparison, calculation of a difference from a control profile, signal processing, and multivariate analysis. Data processed in such a manner may fall within the scope of the present invention.
  • the present invention provides a method for presenting profile data of information of a plurality of cells in the same environment.
  • the method comprises the steps of: a) providing a plurality of cells on a support capable of retaining the cells in the same environment; b) monitoring a biological factor or an aggregation of biological factors on or within the cells over time to generate profile data of the cells; and c) presenting the data.
  • the above-described support capable of retaining a plurality of cells in the same environment can be achieved as described elsewhere herein.
  • the step of generating data can be performed as described elsewhere herein.
  • the step of presenting data can be performed as described elsewhere herein .
  • Examples of amethod of performing such presentation include, but are not limited to, techniques of using various sensory means, such as visual means, auditory means, olfactory means, tactile means, gustatory means, and the like.
  • a visually presenting means may be used.
  • Such visual means includes, without limitation, a computer display and the like.
  • presentation may be performed in real time.
  • stored data may be called and presentation may be delayed.
  • data signals may be transferred directly to, for example, a display.
  • the present invention provides a method for determining states of cells in the same environment.
  • the method comprises the steps of: a) providing a plurality of cells on a support capable of retaining the cells in the same environment; b) monitoring a biological factor or an aggregation of biological factors on or within the cells over time to generate profile data of the cells; and c) determining the states of the cells based on the data.
  • the above-described support capable of retaining a plurality of cells in the same environment can be achieved as described elsewhere herein.
  • the step of generating data can be performed as described elsewhere herein.
  • the step of determining the states of the cells may be performed by correlating the generated data with information about the cells, or comparing the generated data with standard data. In this case, the data may be statistically processed.
  • the present invention mayfurthercomprise correlatingaprofile obtained according to the present invention with a state of a cell before obtaining the time-lapse profile.
  • the cells targeted by the present invention may advantageously include cells whose states are known. It is possible to hold data of cells whose states are known, determination can be quickly performed by comparing data between the known cell and unknown cells .
  • at least two biological factors are preferably present.
  • the plurality of biological factors may belong to heterologous categories (e.g., proteins and nucleic acids, etc.) or homologous categories .
  • the present invention may further comprise arbitrarily selecting a biological factor. Any biological factor can be selected and used to characterize a state of a cell to some extent, and in some cases, identification is possible. Thus, the present invention has an effect which cannot be expected from conventional techniques .
  • data may be preferably generated in real time.
  • an unknown substance or state of an unknown cell may be determined in real time.
  • examples of a state of a target cell include, but are not limited to, differentiated states, undifferentiated states, cellular responses to external factors, cell cycles, growth states, and the like.
  • a cell targeted by the present invention maybe either a stem cell or a somatic cell. Any somatic cell may be used.
  • a cell may be selected by those skilled in the art, depending on the purpose of use of the cell.
  • a solidphase support usedin the determinationmethod of the present invention may comprise a substrate.
  • a substrate can be used as a part of a computer system, so that determination can be automated.
  • An exemplary configuration of such a system is shown in
  • the biological factor may be a nucleic acid molecule, and the cell is transfected with the nucleic acid molecule.
  • Transfection may be performed- on a solid phase support using any material, but preferably a gene introduction agent, more preferably a salt, an actin acting substance, or the like. Transfection maybe performed in solid phase or in liquid phase, and preferably in solid phase.
  • a target biological factor maybe capable of binding to another biological factor.
  • a network mechanism in a cell may be elucidated.
  • the determination step may comprise a mathematical process selected from the group consisting of comparison of phases of profiles , collection of differences from a control profile , signal processing, and multivariate analysis.
  • Such processing techniques are well known in the art and described in detail herein.
  • the present invention provides a method for correlating an external factor with a cellular response to the external factor.
  • the method comprises the steps of: a) exposing a plurality of cells to an external factor on a support capable of retaining the cells in the same environment; b) monitoring a biological factor or an aggregation of biological factors on or within the cells over time to generate profile data of the cells; and c) correlating the external factor with the profile.
  • Exposure of the cells to the external factor may be achieved by placing the cells and the external factor into an environment in which the cells are contactedwith the external ctor . For example, when the cells are fixed on the support , the external factor is added to the support to achieve exposure .
  • Techniques for generating and correlating data are also well known in the art, and may be used singly or in combination. Preferably, statistical processes are performed to generate statistically significant data and information.
  • the cells maybe fixedon the support . Since the cells are fixed, data can be easily standardized, so that data can be significantly efficiently processed.
  • a correlation method of the present invention may further comprise using at least two external factors to obtain a profile for each external factor. Techniques for obtaining such a profile are well described herein.
  • the correlation step may further comprise dividing at least two profiles into categories and classifying the external factors corresponding to the respective profiles into the categories .
  • categorization data can be processed in a more standardized manner.
  • a profile obtained by the present invention may be presented in real time.
  • data When data is intended to be stored, data may not be particularly presented in real time.
  • a cell used in the present invention may be cultured on an array.
  • the cell is preferably covered with medium. Any medium which is commonly used for cells may be used.
  • the step of monitoring a profile may comprise obtaining image data from the array.
  • a pro ile contains visual information (e.g., emission of fluorescence due to gene expression)
  • the profile can be obtained by capturing image data.
  • the step of correlating an external factor with a profile may comprise distinguishing phases of the profile. Distinguishing phases of the profile can be achieved only after the present invention provides time-lapse profiles obtained in the same environment .
  • An external factor targeted by the present invention may be selected from the group consisting of a temperature change, a humidity change, an electromagnetic wave, a potential difference, visible light, infrared light, ultraviolet light. X-ray, a chemical substance, a pressure, a gravity change, a gas partial pressure, and an osmotic pressure.
  • the chemical substance may be a biological molecule, a chemical compound, or a medium. Examples of such a biological molecule include, but are not limitedto, nucleic acidmolecules , proteins, lipids, sugars, proteolipids , lipoproteins, glycoproteins, proteoglycans, and the like. Such a biological molecule may also be, for example, a hormone, a cytokine, a cell adhesion factor, an extracellular matrix, or the like. Alternatively, the chemical substance may be either a receptor agonist or antagonist .
  • the present invention relates to a method for identifying an unidentified external factor given to a cell from a profile of the cell.
  • the method comprises the steps of: a) exposing a cell to a plurality of known external factors on a support capable of retaining the cell in the same environment; b) monitoring a biological factor or an aggregation of biological factors on or within the cell over time to generate a profile of the cell to each of the known external factor and generate profile data of the cell; c) correlating each of the known external factors with each of the profiles; d) exposing the cell to an unidentified external factor; e) monitoring a biological factor or an aggregation of biological factors on or within the cell exposed to the external factors over time to obtain aprofile of the cellwith respect to the unidentified external factor; f) determining, from the profiles obtained in the step of b) , a profile corresponding to the profile obtained the step of e); and g) determining that theunidentifled external factor is the known external factor corresponding
  • the present invention provides a method for identifying an unidentified external factor given to a cell from a profile of the cell.
  • the method comprises the steps of: a) providing data relating to a correlation relationship between known external factors and profiles of the cell in response to theknown external ctors , in relation to a biological factor or an aggregation of biological factors on or within the cell; b) exposing the cell to the unidentified external factor; c) monitoring the biological factor or the aggregation of the biological factors on or within the cell to obtain a profile of the cell; d) determining, from the profiles provided in the step of a) , a profile corresponding to the profile obtained in the step of c); and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the step of d) .
  • Techniques for exposure to external factors, data generation, correlation, exposure to unidentified external factors, and the like are described elsewhere herein and can be selected as appropriate depending on the purpose by those skilled in the art taking
  • the present invention provides a method for obtaining a profile relating to information of a plurality of cells in the same environment .
  • the method comprises the steps of: a) providing a plurality of cells on a support capable of retaining the cells in the same environment; and b) monitoring a biological factor or an aggregation of biological factors on or within the cell over time to generate a profile of the cells .
  • Techniques for exposure to external factors , data generation, correlation, exposure to unidentified external factors, and the like are described elsewhere herein and can be selected as appropriate depending on the purpose by those skilled in the art taking such descriptions into consideration.
  • the present invention relates to a recording medium in which data generated by a method for generating cellular profile data of the present invention is stored.
  • Data may be stored in any format. Any recording medium may be used. Examples of such a recording medium include, but are not limited to, CD-ROMs, flexible disks, CD-Rs, CD-RWs, MOs, mini disks, DVD-ROMs, DVD-Rs, memory sticks , hard disks , and the like .
  • the present invention also relates to a transmission medium in which data generated by amethod for generatingcellularprofile dataof the present invention is stored. Examples of such a transmission medium include, but are not limited to, networks, such as intranets, the Internet, and the like.
  • a recording medium or transmission medium of the present invention may further contain data relating to at least one piece of information selected from the group consistingof information about conditions for themonitoring step, information about the profile, information about the cellular state, and information about the biological factor. Data relating to such information may be stored while being linked to one another. Preferably, the data may be advantageously standardized. Standardized data can be distributed on general distribution pathways. The above-described linkage may be constructed for each cell or for each biological factor, or for both.
  • the present invention relates to data generated by a method for generating cellular profile data of the present invention .
  • Such data cannot be generated by conventional techniques and is thus novel.
  • the present invention provides a system for generating profile data of information of a plurality of cells in the same environment .
  • the system comprises: a) a support capable of retaining a plurality of cells in the same environment; b) means for monitoring a biological factor or an aggregation of biological factors on or within the cells over time; and c) means for generating profile data of the cells from a signal obtained from the monitoring means.
  • the support capable of retaining cells in the same environment can be made by those skilled in the art using a technique first providedby the present invention .
  • Such a technique is attributed to the finding that cells are fixed and arrayed without a partition.
  • the monitoring means include, but are not limited to , microscopes (e.g., optical microscopes, fluorescence microscopes, phase-contrast microscopes, etc.), electron microscopes, scanners, naked eyes, infrared cameras, confo ⁇ al/nonconfo ⁇ almicroscopes, CCD cameras , and the like.
  • microscopes e.g., optical microscopes, fluorescence microscopes, phase-contrast microscopes, etc.
  • electron microscopes e.g., scanners, naked eyes, infrared cameras, confo ⁇ al/nonconfo ⁇ almicroscopes, CCD cameras , and the like.
  • An exemplary configuration of such a system is shown in Figure 44.
  • the system may not necessarily contain cells from the start, but preferably may contain cells which are advantageously fixed on a support .
  • fixation is preferably standardized.
  • the cells are fixed and spaced, for example, without limitation, at intervals of 1 mm or the like.
  • At least one substance selected from the group consisting of salts and actin acting substances may be preferably adhered to the support .
  • a salt or an actin acting substance or preferably with both, fixation of the cells and/or introduction of a substance into the cells can be enhanced.
  • Examples of the monitoring means used in the system of the present invention include, but are not limited to, optical microscopes, fluorescence microscopes, phase-contrast microscopes, reading devices using a laser source, means using surface plasmon resonance (SPR) imaging, electric signals, chemical or biochemical markers singly or in combination, radiation, confocal microscopes, nonconfocal microscopes, differential interference microscopes, stereoscopic microscopes, video monitors, infrared cameras , andthe like .
  • a scanner e.g. , a scanner for scanning a surface of a substrate using a white light source or laser
  • the reason a scanner is preferable is that fluorescence can efficiently transmit excited energy and microscopic technology can be easily applied. Further, measurement can be advantageously performedwithout significant damage to cells .
  • An exemplary configuration of such a system is shown in Figure 44.
  • the present invention provides a systemforpresenting aprofile of information of aplurality of cells in the same environment .
  • the system comprises : a) a support capable of retaining a plurality of cells in the same environment ; b) means formonitoring abiologicalfactor or an aggregation of biological factors on or within the cells over time; ⁇ ) means for generating profile data of the cells from a signal obtained from the monitoring means; and d) means for presenting the data.
  • the support, the monitoring means , and the data generating means can be made as described elsewhere herein .
  • the means forpresenting data can be achieved by techniques well known in the art . Examples of such a data presenting means include, but are not limited to, computer displays, loudspeakers, and the like. An exemplary configuration of such a system is shown in Figure ⁇ i ⁇ .
  • a presentation system of the present invention may further comprise a plurality of cells , in which the cells are preferably fixed to the support .
  • the cells are preferably fixed to the support .
  • at least one substance selected from the group consisting of salts and actin acting substances may be preferably adhered to the support .
  • monitoring means include, but are not limited to, optical microscopes; fluorescence microscopes; phase microscopes; reading devices using a laser source; means using surface plasmon resonance (SPR)imaging, electric signals, chemical or biochemical markers singly or in combination; and the like.
  • SPR surface plasmon resonance
  • Any data presenting means may be used, including, without limitation, displays, loudspeakers, and the like.
  • the present invention provides a system for determining a state of a cell.
  • the system comprises: a) a support capable of retaining a plurality of cells in the same environment; b) means for monitoring a biological factor or an aggregation of biological f ctors on or within the cells over time; c) means for generating data from a signal obtained by the monitoring means; and d) means for extrapolating the state of the cell from the data.
  • the support, the monitoring means, and the data generating means can be made by those skilled in the art as described elsewhere herein.
  • the means for extrapolating a state of a cell from data may be produced and used by techniques well known in the art . For example, measured data can be compared with standard data for known cells to achieve extrapolation.
  • a device storing a program for such extrapolation or a computer capable of executing such a program may be used as the extrapolation means .
  • An exemplary configuration of such a system is shown in Figure 44.
  • the present invention provides a system for correlating an external factor with responses of cells to the external factor.
  • the system comprises: a) a support capable of retaining a plurality of cells in the same environment; b) means for exposing the cell to the external factor; c) means for monitoring a biological factor or an aggregation of biological factors on or within the cells over time; d) generating profile data of the cells from a signal from the monitoring means; and e) means for correlating the external factor with the profile.
  • the support, the monitoring means, and the data generating means can be made by those skilled in the art as described elsewhere herein.
  • the means for exposing the cells to the external factor can be designed and carried out as appropriate by those skilled in the art depending on the properties of the external factor.
  • the correlation means can employ a recording medium storing a program for correlation or a computer capable of executing such a program.
  • a system of the present invention comprises a plurality of cells . An exemplary configuration of such a system is shown in Figure 44 .
  • the present invention provides a system for identifying an unidentified external factor given to a cell based on a profile of the cell.
  • the system comprises: a) a support capable of retaining a plurality of cells in the same environment; b) means for exposing the cell to known external factor; ⁇ ) means for monitoring a biological factor or an aggregation of biological factors on or within the cells over time; d) means for obtaining a profile of the cell withrespect to each of the known external factors to generate profile data of the cell; e) means for correlating each of the known external factors with each profile; f ) means for exposing the cell to the unidentified external factor; g) means for comparing the profiles of the known external factors obtained by the means of d) with the profile of the unidentified external factor to determine a profile of the unidentified external factor from the profiles of the known external factors , wherein the determinedunidentifledexternal factoris theknown external factor corresponding to the determined profile .
  • the support , the exposure means, the monitoringmeans, the data generating means , and the correlation means , and the other exposure means can be made and carried out as appropriate by those skilled in the art as described elsewhere herein.
  • the means for determining a corresponding profile can also be made and carried out by utilizing a recording medium storing a program capable of executing such a determination process and a computer capable of executing such a program.
  • a system of the present invention comprises a plurality of cells. An exemplary configuration of such a system is shown in Figure 44.
  • the present invention provides a system for identifying an unidentified external factor given to a cell based on a profile of the cell.
  • the system comprises: a) a recording medium storing providing data relating to a correlationrelationship betweenknown external factors and profiles of the cell in response to the known external factors, in relation to a biological factor or an aggregation of biological factors on or within the cell; b) means for exposing the cell to the unidentified external factor; c ) a support capable of retaining a plurality of cells in the same environment ; d)means for monitoring a biological factor or an aggregation of biological factors on or within the cells over time; e) means for obtaining a profile of the cell from a signal obtained by the monitoring means ; ) means for determining, from the profiles stored in the recordingmedium of a) , a profile corresponding to the profile obtained with respect to the unidentified external factor, wherein the determined unidentified external factor is the known external factor corresponding to the determinedprofile .
  • the support, the exposure means, the monitoring means, the data generating means, and the correlation means, and the other exposure means canbemade and carriedout as appropriate by those skilled in the art as described elsewhere herein.
  • the means for determining a corresponding profile can also be made and carriedout byutilizing arecordingmedium storing a program capable of executing such a determination process and a computer capable of executing such a program.
  • a system of the present invention comprises a plurality of cells . An exemplary configuration of such a system is shown in Figure 44.
  • the present invention relates to a support capable of maintaining the same environment for a plurality of cells .
  • a support was first provided by the present invention.
  • a plurality of cells can be analyzed in the same environment .
  • the support may preferably comprise a salt or an actin acting substance .
  • the support may advantageously comprise a complex of a positively charged substance and a negatively charged substance. This is because cells can be easily fixed to the support .
  • Actin acting substances are preferable when the inside of cells is analyzed, since the actin acting substances increase the efficiency of introduction of external factors into cells. Therefore, in a preferred embodiment of the present invention, the support may comprise a salt and an actin acting substance, and more preferably may comprise a complex of a positively charged substance and a negatively charged substance.
  • a support of the present invention is characterized in that cells may be provided and spaced at intervals of 1 mm. In the case of such intervals , it is not conventionally possible to provide an environment without a partition. Therefore, the present invention has a remarkable effect and practicability.
  • a support of the present invention may comprise a cell fixed thereto .
  • a support of the present invention may comprise a biological factor fixed thereto .
  • At least two biological factors may be fixed to the support .
  • Such biological factors may be factors selected from the group consisting of nucleic acid molecules , proteins, sugars, lipids, metabolites, low molecular weight molecules , and complexes thereo , and factors containing physical elements and/or temporal elements .
  • a cell and a biological factor may be fixed to a support of the present invention in a mixed manner.
  • the biological factor and the cell may be provided so that they can interact with each other. Such interactionmayvary depending on the biological factor . According to the properties of the biological factor, those skilled in the art can understand how the biological actor interacts with the cell andwhere the biological factor is positioned so as to interact with the cell.
  • a salt, a complex of a positively charged substance and a negatively charged substance, and an actin acting substance are fixed along with a cell and a biological factor to a support of the present invention.
  • a salt, a complex of a positively charged substance and a negatively charged substance, and an actin acting substance are fixed along with a cell and a biological factor to a support of the present invention in the form of an array.
  • a cell chip capable of generating the profile data of a cell can be provide .
  • the support has a structure in which a salt , a complex of a positively charged substance and a negatively charged substance, and an actin acting substance are fixed along with a cell and a biological factor in the form of an array.
  • Such a support is also called a "transfection array" .
  • Examples of a salt used in the support of the present invention include, but are not limited to, calcium chloride, sodiumhydrogenphosphate, sodiumhydrogencarbonate, sodium pyruvate, HEPES, sodium chloride, potassium chloride, magnesium sulfide , iron nitrate, amino acids, vitamins, and the like.
  • a preferable salt is, for example, without limitation, sodium chloride or the like.
  • Examples of a gene introduction agent used in the support of the present invention include, but are not limited to, cationic polymers, cationic lipids, polyamine-based reagents, polyimine-based reagents, calcium phosphate, oligofectamin, SureFECTOR EM-101-001 (B-Bridge), UniFECTOR EM- 101-002 (B-Bridge), siFECTORl EM- 101-004 (B-Bridge), and the like.
  • Preferable gene introduction agents include, but are not limited to, lipofectamin, oligofectamin, SureFECTOR EM-101-001 (B-Bridge), UniFECTOR EM-101-002 (B-Bridge), siFECTORl EM-101-004 (B-Bridge), and the like.
  • an actin acting substance used in the support of the present invention examples include, but are not limited to, fibronectin, laminin, vitronectin, and the like.
  • a preferable actin acting substance is, for example, without limitation, fibronectin.
  • nucleic acid molecules used in the support of the present invention include, but are not limited to, nucleic acid molecules comprising transcription control sequences (e.g., promoters, enhancers, etc.), gene coding sequences, genomic sequences containing nontranslation regions, nucleic acid sequences encoded by the genome of a host (a fluorescent protein gene, E. coli/yeast self-replication origins, a GAL4 domain, etc.), and the like.
  • transcription control sequences e.g., promoters, enhancers, etc.
  • Examples of a cell used in the support of the present invention include, but are not limited to, stem cells, established cell lines , primary culture cells , insect cells , bacterial cells, and the like.
  • Preferable cells include, but are not limited to, stem cells, established cell lines, primary culture cells , and the like .
  • Examples of a material for a support of the present invention include, but are not limited to, glass, silica, plastics, and the like.
  • Preferable materials include, but are not limited to, the above-described materials with coating.
  • the present invention provides a method for producing a support comprising a plurality of cells fixed thereto and capable of maintaining the same environment for the cells.
  • the method comprises the steps of: A) providing the support; and B) fixing the cells via a salt and a complex of a positively charged substance and a negatively charged substance onto the support .
  • the step of providing a support may be achieved by obtaining a commerciallyavailable support ormoldinga support material .
  • a support material may be prepared by mixing starting materials or the material as required.
  • the fixing step can be carried out by using techniques known in the art . Examples of such fixing techniques include, but are not limited to, an ink jet printing technique, a pin array technique, a stamping technique, and the like . These techniques are well known and can be performed as appropriate by those skilled in the art .
  • the fixing step in the present invention may comprise fixing a mixture of the salt , the complex of a gene introduction agent and an actin acting substance (positively charged substances) and a nucleic acid molecule (a negatively charged substance), and the cell in the form of an array.
  • a fixing step may be achieved by printing techniques .
  • the present invention provides a device for producing a support comprising a plurality of cells fixed thereto and capable of maintaining the same environment for the cells.
  • the device comprises: A) means for providing the support; and B) means for fixing the cells via a salt and a complex of a positively charged substance and a negatively charged substance onto the support .
  • the support may be obtained using means which can perform the above-described methods. Examples of such means include, but are not limited to, a support molding means, a material formulating means (e.g., a mixing means ) , and the like.
  • the molding means can employ techniques well known in the art .
  • the fixing means may comprise a printing means. As such a printing means, commercially available ink jet printers can be used.
  • the present invention provides a method for correlating an external factor with a response of a cell to the external factor.
  • the method comprises the steps of: a) exposing the cell to the external factor; b) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; and c) correlating the external factor with the time-lapse profile.
  • An external factor used in the present invention is not particularly limited. Such an external factor may be preferablyapplicable either directlyor indirectlyto cells . Techniques for exposing a cell to an external factor are well known in the art and vary depending on the type of the external factor. If an external factor is a substance, the substance is dissolved in a solvent and the resultant solution is dropped into a medium containing a cell, whereby the cell can be exposed to the external factor.
  • a time-lapse profile can be produced as described above .
  • an external factor can be correlatedwith a time-lapse profile with various techniques. Briefly, a time-lapse profile which is previously obtained by dropping a certain external factor is used as a template. If a profile is not substantially different from the template , it can be inferred that the external factor is identified.
  • the cell is monitored while being fixed on a solidphase support (e.g. , an array, a plate, amicrotiter plate, etc.). Fixation can be performed with techniques known in the art or techniques described herein.
  • a solidphase support e.g. , an array, a plate, amicrotiter plate, etc.
  • the correlation method of the present invention may further comprise using at least two external f ctors to obtain a time-lapse profile for each external factor.
  • at least 3 external factors may be preferably used, more preferably at least 4 external factors, and even more preferably at least 10 external factors.
  • the correlation method of the present invention may further comprise dividing at least two time-lapseprofiles into categories andclassifying the external factors corresponding to the respective time-lapse profiles into the categories.
  • Such division and classification can be easily carried out by those skilled in the art in accordance with the present specification.
  • the method of the present invention can be used to achieve correlation and identification of unknown external factors.
  • a transcription control sequence used in the present invention may be, without limitation, a promoter, an enhancer, a silencer, other flanking sequences of structural genes in genomes , and genomic sequences other than exons .
  • Apromoter is preferable, since the transcription level can be directly measured.
  • transcription control sequences used in the present invention may be constitutive promoters, specific promoters , inducible promoters , and the like.
  • the present invention is characterized in that any type of promoter can be used. According to the method of the present invention, profiles can be analyzed from a viewpoint of "procession". Therefore, it is possible to determine a state of a cell using any promoter or any set of promoters . Such determination cannot be achieved by conventional techniques.
  • the present invention is highly useful since the present invention achieves what cannot be achieved by conventional techniques .
  • At least two transcription control sequences are monitored. By observing at least two transcription control sequences, at least 80% of the states of a cell can be typically identified. More preferably, at least 3 transcription control sequences are monitored. By observing at least three transcription control sequences, at least 90% of the states of a cell can be typically identified. In a most preferred embodiment , at least 8 transcription control sequences are monitored. By observing at least 8 transcription control sequences, substantially all of the states of a cell can be typically identified. Thus , although any transcription control sequences are selected, substantially all of the states of a cell can be determined by selecting and monitoring a small number of transcription control sequences as described above. This feature has not been conventionally expected. The method of the present invention is simpler, more precise and more accurate than conventional determination methods in which observation is made at time points and resultant data is statistically processed as heterologous groups.
  • the determination method of the present invention preferably further comprises arbitrarily selecting at least one transcription control sequence from transcription control sequences before monitoring.
  • An important feature of the present invention is such that a transcription control sequence, which does not exhibit specificity when investigated from point to point, can be used.
  • such a time-lapse profile may be presented in real time.
  • the real time presentation may contain a time lag to some extent if it is performed substantially in real time.
  • a tolerable time lag is, for example, 10 seconds at maximum, and more preferably 1 second at maximum, though the tolerable time lag depends on the required level of real time (simultaneity).
  • the tolerable time lag may be, for example, 1 sec at maximum, 0.1 sec at maximum, or the like .
  • the phase of the time-lapse profile may be used as information about the time-lapse profile in order to correlate the external factor with the time-lapseprofile.
  • Thephase is representedbyplus orminus depending on the signal intensity at a certain time .
  • cells are advantageously cultured on an array. This is because a number of cells can be simultaneously observed.
  • the step of monitoring the transcription level over time may comprise obtaining image data from the array. This is because image data can be subjected to visual inspection and a human (particularly, a person skilled in the art, such as a medical practitioner or the like) can easily examine image data with his/her eyes .
  • the step of correlating the external factor with the time-lapse profile may comprise distinguishing the phases of the time-lapse profiles.
  • phase is a simple parameter, and its information processing is simple.
  • cells can be well identified by such simple information processing.
  • examples of an external factor to be identified by the method of the present invention include, but are not limited to, a temperature change, a humidity change, an electromagnetic wave, a potential difference, visible light , infrared light , ultraviolet light , X-ray, a chemical substance, a pressure, a gravity change, a gas partial pressure, an osmotic pressure, and the like. These factors cannot be satisfactorily identified by conventional methods . By using the cell determination method of the present invention which places an importance on "procession", an influence of a factor on a cell can be well examined.
  • an external factor to be identified by the method of the present invention may be a chemical substance.
  • a chemical substance include, but are not limited to, biological molecules, chemical compound, media, and the like.
  • biological molecules include, but are not limited to, nucleic acids, proteins, lipids, sugars, proteolipids, lipoproteins, glycoproteins, proteogly ⁇ ans, and the like. These biological molecules are known to have an influence on organisms . Unknown biological molecules are also highly likely to have an influence on organisms and are considered to be important targets to be studied.
  • hormones cytokine, cell adhesion factors, extracellular matrices, receptor agonists, receptor antagonists, and the like, which are expected to have an influence on cells , are used as biological molecules to be investigated.
  • the present invention provides a method for inferring an unidentified external factor given to a cell based on a time-lapse profile of the cell.
  • the method comprises the steps of: a) exposing the cell to a plurality of known external factors; b) obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; c) correlating the known external factors with the respective time-lapse profiles; d) exposing the cell to the unidentified external factor; e) obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of the transcription level of the selected transcription control sequence; f ) determining a profile corresponding to the time-lapse profile obtained in the step of e) from the time-lapse profiles obtained in the step of b); and g) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the step of f).
  • the step of exposing a cell to external factors can be performed as described above herein or as illustrated in examples described below.
  • the step of obtaining a time-lapse pro ile can be performed as described above herein or as illustrated in examples described below.
  • the correlation step can be performed as described above herein or as illustrated in examples described below.
  • the present invention provides a method for inferring an unidentified external factor given to a cell based on a time-lapse profile of the cell.
  • the method comprises : a) providingdatarelating to acorrelation relationship between known external factors and time-lapse profiles of the cell inresponse to the known external factors , in relation to at least one transcription control sequence selected from promoters present in the cell; b) exposing the cell to the unidentified external factor; c) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected promoter; d) determining a profile corresponding to the time-lapse profile obtained in the step of c) from the time-lapse pro iles obtained in the step of a) ; and e) determining that the unidentified external factor is the known external factorcorresponding to theprofile determined in the step of d) .
  • Exposure to external factors, profile generation, correlation, and the like can be carried out using techniques as described herein above or as illustrated in the examples below.
  • the present invention provides a system for presenting a state of a cell.
  • the system comprises: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; andb) means for presenting the time-lapse profile.
  • Figure 17 shows an exemplary configuration of a computer 500 for executing the cellular state presenting method of the present invention.
  • the computer 500 comprises an input section 501, a CPU 502, an output section 503, a memory 504, and a bus 505.
  • the input section 501, the CPU 502, the output section 503, and the memory 504 are connected via a bus 505.
  • the input section 501 and the output section 503 are connected to an I/O device 506.
  • a cellular state presenting program for executing the cellular state presenting method (hereinafter referred to as a "cellular state presenting program") is stored in, for example, the memory 502.
  • each component of the cellular state presentingprogrammaybe stored in any type of recording medium such as a floppy disk, MO, CD-ROM, CD-R, DVD-ROM, or the like separately or together.
  • the program may be stored in an application server.
  • the cellular state presenting program stored in such a recording medium is loadedvia the I/O device 506 (e.g. , a disk drive, a network (e.g. , the Internet) ) to the memory 504 of the computer 500.
  • the CPU 502 executes the cellular state presenting program, so that the computer 500 functions as a device for performing the cellular state presenting method of the present invention.
  • Information about a cell or the like is input via the input section 501 aswell as profile data obtained. Known information may be input as appropriate.
  • the CPU 502 generates display data based on the information about profile data and cells through the input section 501, and stored the display data into the memory 504. Thereafter, the CPU 502 may store the information in the memory 504. Thereafter, the output section 503 outputs a cellular state selected by the CPU 502 as display data. The output data is output through the I/O device SOS.
  • the present invention provides a system for determining a state of a cell.
  • the system comprises: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; andb) means for determining the state of the cell based on the time-lapse profile.
  • Figure 17 shows an exemplary configuration of a computer 500 for executing the cellular state determining method of the present invention.
  • the computer 500 comprises an input section 501, a CPU 502, an output section 503, a memory 504, and a bus 505.
  • the input section 501, the CPU 502, the output section 503, and the memory 504 are connected via a bus 505.
  • the input section 501 and the output section 503 are connected to an I/O device 506.
  • a program for executing the cellular state determining method (hereinafter referred to as a "cellular state determining program") is stored in, for example, the memory 502.
  • each component of the cellular state determining program may be stored in any type of recording medium, such as a floppy disk, MO, CD-ROM, CD-R, DVD-ROM, or the likeseparately or together.
  • the program may be stored in an application server.
  • the cellular state determining program stored in such a recording medium is loaded via the I/O device 506 (e.g.
  • the CPU 502 executes the cellular state presenting program, so that the computer 500 functions as a device for performing the cellular state determining method of the present invention.
  • Information about a cell or the like is input via the input section 501 as well as profile data obtained. Known information may be input as appropriate.
  • the CPU 502 determines a state of a cell based on the information about profile data and cells input through theinput section 501, generates the results as determination result data, and stores the determination result data into the memory 504. Thereafter, the CPU 502 may store the information in the memory 504. Thereafter, the output section 503 outputs a cellular state selected by the CPU 502 as determination result data. The output data is output through the I/O device 506.
  • the present invention provides a system for correlating an external factor with a response of a cell to the external factor.
  • the system comprises: a) means for exposing the cell to the external factor; b) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one promoter selected from the group consisting of promoters derived from the cell; and c) means for correlating the external factor with the time-lapse profile .
  • a system can be implemented using a computer as with the above-described systems .
  • the present invention provides a system for inferring an unidentified external factor given to a cell based on a time-lapse profile.
  • the system comprising: a) means for exposing the cell to a plurality of known external factors; b) means for obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least one transcription control f ctor selected from the group consisting of transcription control factors derived from the cell; c) means for correlating the known external factors with the respective time-lapse profiles; d) means for exposing the cell to the unidentified external factor; e) means for obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of the transcription level of the selectedtranscription control sequence; f ) means for determining a profile corresponding to the time-lapse profile obtained in the means of e) from the time-lapse profiles obtained in the means of b); and g) means for determining that the unidentified
  • the present invention provides A system for inferring an unidentified external factor given to a cell based on a time-lapse profile, comprising: a) means for providing data relating to a correlation relationship between known external factors and time-lapse profiles of the cell in response totheknown external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) means for exposing the cell to the unidentified external factor; c) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected transcription control sequence; d) means for determining a profile corresponding to the time-lapse profile obtained in the means of c) from the time-lapse profiles obtained in the means of a); and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the means of d) .
  • Such a system can be implemented using a computer as with the above-described systems.
  • the present invention provides a computer recordable recording medium recording a program for executing a process for presenting a state of a cell to a computer.
  • the recording medium records at least a program for executing the procedures of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b) presenting the time-lapse profile.
  • the present invention provides a computer recordable recording medium recording a program for executing a process for determining a state of a cell to a computer.
  • the recording medium records at least a program for executing the procedures of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b) determining the state of the cell based on the time-lapse profile of the transcription level.
  • the present invention provides a computer recordable recording medium recording a program for executing a process for correlating an external factor with a response of a cell to the external factor.
  • the recording medium records at least a program for executing the procedures of: a) exposing the cell to the external factor; b) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control f ctor selected from the group consisting of transcription control factors derived from the cell; and c) correlating the external factor with the time-lapse profile.
  • the present invention provides a computer recordable recording medium recording a program for executing a process for inferring an unidentified external factor given to a cell based on a time-lapse pro ile .
  • the recording medium records at least a program for executing the procedures of: a) exposing the cell to a plurality of known external factors; b) obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; c) correlating the known external factors with the respective time-lapse profiles; d) exposing the cell to the unidentified external factor; e) obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of the transcription level of the selected transcription control sequence; f ) determining a profile corresponding to the time-lapse profile obtained in the procedure of e) from the time-lapse profiles obtained in the procedure of b); and g) determining that the unidentified
  • the present invention provides a computer recordable recording medium recording a program for executing a process for inferring an unidentified external factor given to a cell based on a time-lapse profile .
  • the recording medium records at least a program or executing the procedures of: a) providing data relating to a correlation relationship between known external factors and time-lapse profiles of the cell in response to the known external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) exposing the cell to the unidentified external factor; c) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected transcription control sequence; d) determining a profile corresponding to the time-lapse profile obtained in the procedure of c) from the time-lapse profiles obtained in the procedure of a) ; and e ) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the procedure of d) .
  • each constituent element thereof can be implemented as with the detailed or pre erred embodiments of the method of the present invention .
  • Preferredembodiments of such a recordingmedium can be easily selected by those skilled in the art and can be made or carried out by those skilled in the art based on the present specification.
  • the present invention provides a program for executing a process for presenting a state of a cell to a computer .
  • the program executes the procedures of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected rom the group consisting of transcription control sequences derived from the cell; and b) presenting the time-lapse profile.
  • the present invention provides a program for executing a process for determining a state of a cell to a computer.
  • the program executes the procedures of: a) obtaining a time-lapse profile of the cell hy time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected rom the group consisting of transcription control sequences derived from the cell; and b) determining the state of the cell based on the time-lapse profile of the transcription level.
  • the present invention provides a program for executing a process for correlating an external factor with a response of a cell to the external factor.
  • the program executes the procedures of: a) exposing the cell to the external factor; b) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; and c) correlating the external factor with the time-lapse profile.
  • the present invention provides a program for executing a process for inferring an unidentified external factor given to a cell based on a time-lapse pro ile.
  • the program executes the procedures of : a) exposing the cell to apluralityof known external ctors ; b) obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least on® transcription control factor selected from the group consisting of transcription control factors derived from the cell; ⁇ ) correlating the known external factors with the respective time-lapse profiles; d) exposing the cell to the unidentified external factor; e) obtainingatime-lapseprofile of theunidentified external factorbytime-lapsemonitoringof the transcription level of the selected transcription control sequence; f) determining a profile corresponding to the time-lapse profile obtained in the procedure of e) from the time-lapse profiles obtained in the procedure of b) ; and g) determining that the unidentified external factor is the known external factor corresponding
  • the present invention provides a program for executing a process for inferring an unidentified external factor given to a cell based on a time-lapse profile .
  • the program executes the procedures of : a) providing data relating to a correlation relationship between known external factors and time-lapse profiles of the cell in response to theknown external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) exposing the cell to the unidentified external factor; c) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected transcription control sequence; d) determining a profile corresponding to the time-lapse profile obtained in the procedure of c) from the time-lapse profiles obtained in the procedure of a); and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the procedure of d) .
  • the present invention provides a method and system for diagnosing a subject .
  • the diagnosis method comprises the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; b) determining the state of the cell based on the time-lapse profile of the transcription level; and c) determining a condition, disorder or disease of a subject based on the state of the cell.
  • the diagnosis method is provided in the form of a system, the system of the present invention comprises: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; b) means for determining the state of the cell based on the time-lapse profile of the transcription level; and c) means for determining a conditio , disorder or disease of a subject based on the state of the cell.
  • the present invention is applicable to tailor-made diagnoses and therapies , such as drug resistance, selection of appropriate anticanceragents , selection of appropriate transplant cells , andthe like.
  • the diagnosismethodof thepresent invention may be provided as a therapeutic or prevention method comprising the step of treating a subject with a therapy or prevention selected based on the result of diagnosis.
  • the diagnosis system of the present invention may be provided as a therapeutic or prevention system comprising means fortreating a subject with a therapy or prevention selected based on the result of diagnosis.
  • Figure 17 shows an exemplary configuration of a computer 500 for executing the cellular state determining method of the present invention.
  • the computer 500 comprises an input section 501, a
  • the input section 501, the CPU 502, the output section 503, and the memory 504 are connected via a bus 505.
  • the input section 501 and the output section 503 are connected to an I/O device 506.
  • Aprogram for executing the correlation methodand/or selection of treatment or prevention (hereinafter referred to as a "correlation program” and a “selection program”, respectively) is stored in, for example, the memory 502.
  • the correlation program and the selection program may be stored in any type of recording medium, such as a floppy disk, MO, CD-ROM, CD-R, DVD-ROM, or the like, separately or together.
  • the programs may be stored in an application server.
  • the correlation program and the selection program stored in such a recording medium are loaded via the I/O device 506 (e.g., a disk drive, a network (e.g., the Internet)) to the memory 504 of the computer 500.
  • the CPU 502 executes the correlation program and the selection program, so that the computer 500 functions as a device for performing the correlation method and the selection method of the present invention.
  • the result of analysis of a time-lapse profile (e.g. , phase, etc.) and information about a cell or the like are input via the input section 501.
  • Secondary information about a condition, disorder or diseases to be correlated with a time-lapse profile and information about treatment and/or prevention may be input as required.
  • the CPU 502 correlates information about a time-lapse profile with a state of a cell or a condition, disorder or disease of a subject and a prevention or therapeutic method as required, based on the information input through the input section 501, and stores correlation data into the memory 504. Thereafter, the CPU 502 may store the information in the memory 504. Thereafter, the output section 503 outputs information about a state of a cell or a condition , disorder or disease of a subject and a prevention or therapeutic method as required, which has been selected by the CPU 502 as diagnostic information.
  • the output data is output through the I/O device 506.
  • Example 1 As candidates for an actin acting substance, various extracellular matrix proteins and variants or fragments thereof were prepared in Example 1 as listed below. Fibronectin and the like were commercially available. Fragments and variants were obtained by genetic engineering techniques :
  • fibronectin SEQ ID NO. : 11
  • fibronectin variant (SEQ ID NO. : 11, alanine at 152 was substituted with leucine);
  • Plasmids were prepared as DNA for transfection.
  • Plasmids, pEGFP-Nl andpDsRed2-Nl were used. In these plasmids, gene expression was under the control of cytomegalovirus (CMV) .
  • CMV cytomegalovirus
  • the plasmid DNA was amplified in E . coli (XLlblue, Stratgene, TX, USA) and the ampli ied plasmid DNA was used as a complex partner. The DNA was dissolved in distilled water free from DNase and RNase.
  • TfxTM-20 Reagent E2391, Promega, WI ) , SuperFect Transfection Reagent (301305, Qiagen, CA) , PolyFect Transfection Reagent (301105, Qiagen, CA) , LipofectAMINE 2000 Reagent (11668-019, Invitrogen corporation, CA) , JetPEI (x4) cone. (101-30, Polyplus-transfection, France), and ExGen 500 (R0511, Fermentas Inc . , MD) . These transfection reagents were added to the above-described DNA and actin acting substance in advance or complexes thereof with the DNA were produced in advance .
  • the thus-obtained solution was used in assays using transfection arrays described below.
  • Example 2 an improvement in the transfection efficiency of solid phase was observed.
  • the protocol used in Example 2 will be described below.
  • the final concentration of DNA was adjustedto 1 ⁇ g/ ⁇ L .
  • An actin acting substance was preserved as a stock having a concentration of 10 ⁇ g/ ⁇ L in ddH 2 0. All dilutions were made using PBS, ddH 2 0, or Dulbecco ' s MEM. A series of dilutions, for example, 0.2 ⁇ g/ ⁇ L, 0.27 ⁇ g/ ⁇ L, 0.4 ⁇ g/ ⁇ L,
  • Transfection reagents were used in accordance with instructions provided by each manufacturer.
  • Plasmid DNA was removed from a glycerol stock and amplified in 100 mL L-amp overnight.
  • Qiaprep Miniprep or Qiagen Plasmid Purification Maxi was used to purify DNA in accordance with a standard protocol provided by the manufacturer.
  • Example 2 the following 5 cells were used to confirm an effect: human mesenchymal stem cell (hMSCs, PT-2501, Cambrex BioScien ⁇ e Walkersville, Inc., MD); human embryonic renal cell (HEK293, RCB1637, RIKEN Cell Bank, JPN) ; NIH3T3-3 cell (RCB0150, RIKEN Cell Bank, JPN); HeLa cell (RCB0007, RIKEN Cell Bank, JPN); and HepG2(RCB1648, RIKEN Cell Bank, JPN). These cells were cultured in DMEM/10% IFS containing L-glut and pen/strep.
  • hMSCs human mesenchymal stem cell
  • PT-2501 Cambrex BioScien ⁇ e Walkersville, Inc., MD
  • human embryonic renal cell HEK293, RCB1637, RIKEN Cell Bank, JPN
  • NIH3T3-3 cell RB0150, RIKEN Cell Bank, J
  • Transfection reagents and DNA were mixed to form a DNA-transfection reagent complex.
  • the complex formation requires a certain period of time. Therefore, the mixture was spotted onto a solid phase support (e.g., a poly-L-lysine slide) using an arrayer.
  • a solid phase support e.g., a poly-L-lysine slide
  • an APS slide, a MAS slide, and an uncoated slide were used as well as a poly-L-lysine slide.
  • These slides are available from Matsunami Glass (Kishiwada, Japan) or the like .
  • the slides were dried overnight in a vacuum dryer. Drying was performed in the range of 2 hours to 1 week.
  • a transfection reagent (Eff ctene, etc. ) was added to the mixture, followed by mixing by pipetting.
  • a transfection reagent an annular wax barrier was formed around the spots on the slide. 366 ⁇ L of the mixture was added to the spot region surrounded by the wax, followed by incubation at room temperature for 10 to 20 minutes. Thereby, the fixation to the support was manually achieved.
  • Cells were distributed for transfection. The distribution was typically performed by reduced-pressure suction in a hood. A slide was placed on a dish, and a solution containing cells was added to the dish for transfection. The cells were distributed as follows.
  • the growingcells were distributedto aconcentration of 10 7 cells/25 mL.
  • the cells were plated on the slide in a 100x100x15 mm squared Petri dish or a 100 mm (radius) x 15 mm circular dish. Transfection was conducted for about 40 hours. This period of time corresponded to about 2 cell cycles.
  • the slide was treated for immunofluorescence.
  • Gene introduction was evaluated by detection using, for example, immunofluorescence, fluorescence microscope examination, laser scanning, radioactive labels, and sensitive films, or emulsion.
  • an expressed protein to be visualized is a fluorescent protein
  • a fluorescent protein such a protein can be observed with a fluorescence microscope and a photograph thereof can be taken.
  • slides may be scanned using a laser scanner for storage of data. If an expressed protein can be detected using fluorescence antibodies, an immunofluorescence protocol can be successively performed. If detection is based on radioactivity, the slide may be adhered as described above, and autoradiography using film or emulsion can be performed to detect radioactivity.
  • the present inventors use a DNA microarray scanner (GeneTAC UC4x4, Genomic Solutions Inc., MI). Total fluorescence intensity
  • Cells were seeded on tissue culture dishes at a final concentration of lxlO 5 cells/well andcultured in appropriate medium (Human Mesenchymal Cell Basal Medium (MSCGM BulletKit PT-3001, Cambrex BioScience Walkersville , Inc. , MD) . After fixation of the cell layer with 4% paraformaldehyde solution, SYTO and Texas Red-X phalloidin (Molecular Probes Inc. , OR, USA) was added to the cell layer for observation of nuclei and F-actin .
  • appropriate medium Human Mesenchymal Cell Basal Medium (MSCGM BulletKit PT-3001, Cambrex BioScience Walkersville , Inc. , MD) . After fixation of the cell layer with 4% paraformaldehyde solution, SYTO and Texas Red-X phalloidin (Molecular Probes Inc. , OR, USA) was added to the cell layer for observation of nuclei and F-actin .
  • Figure 1 shows the results of experiments in which various actin acting substances and HEK293 cells were used where gelatin was used as a control.
  • Figures 2 and 3 show transfection efficiency when fibronectin fragments were used.
  • Figure 4 shows the summary of the results. 29 kDa and 72 kDa fragments exhibited a significant level of transfection activity, while a 43 kDa fragment had activity but its level was low. Therefore, it was suggested that an amino acid sequence contained in the 29 kDa fragment played a role in an increase in transfection efficiency. Substantially no contamination was found in the case of the 29 kDa fragment, while contamination was observed in the case of the other two fragments (43 kDa and 72 kDa) . Therefore, only the 29 kDa domain may be preferably used as an actin acting substance.
  • Figure 5 shows the result of studies on transfection efficiency of cells .
  • HEK293 cells, HeLa cells, and 3T3 cells which were conventionally transfectable, and HepG2 cells and mesenchymal stem cells (MSC ) which were conventionally believed to be substantially impossible to transfect, were used to show an effect of the transfection method of the present invention.
  • the vertical axis represents the intensity of GFP.
  • Figure 6 shows theresults of transfectionwhen various plates were used. As can be seen from the results of Figure 6, when coating was provided, contamination was reduced as compared with when coating was not provided and transfection efficiency was increased.
  • Figure 7 shows the results of transfection where the concentration of fibronectin was 0, 0.27, 0.53,
  • transfection efficiency was increased with an increase in fibronectin concentration. Note that in the case of PLL coating and the absence of coating, the transfection efficiency reached a plateau at a fibronectin concentration of more than 0.53 ⁇ g/ ⁇ L. In the case of APS, it was found that the effect was further increased at a fibronectin concentration of more than of 1.07 ⁇ g/ ⁇ L.
  • Figure 8 shows photographs indicating cell adhesion profiles in the presence or absence of fibronectin.
  • Figure 9 shows cross-sectional photographs. It was revealed that the shapes of adherent cells were signi icantly different (Figure 8). The full extension of cells was found for the initial 3 hours of culture in the presence of fibronectin, while extension was limited in the absence of fibronectin ( Figure 9). Considering the behavior of filaments ( Figure 9) and the results of the time-lapse observation , it was considered that an actin acting substance, such as fibronectin, attached to a solid phase support had an influence on the shape and orientation of actin filaments, and the efficiency of introduction of a substance into a cell, such as transfection efficiency or the like, is increased.
  • an actin acting substance such as fibronectin
  • actin filaments quickly change their location in the presence of fibronectin, and disappear from the cytoplasmic space under the nucleus as the cell extends . It is considered that actin depletion in the perinuclear space, which is induced by an actin acting substance, such as fibronectin, allows the transport of a target substance, such as DNA or the like, into cells or nuclei. Though not wishing to be bound by any theory, the reason is considered to be that the viscosity of cytoplasm is reduced andpositively chargedDNAparticles are prevented from being trapped by negatively charged actin filaments. Additionally, it is considered that the surface area of the nucleus is significantly increased in the presence of fibronectin ( Figure 10 ) , possibly facilitating the transfer of a target substance, such as DNA or the like, into nuclei.
  • hMSCs human mesenchymal stem cells
  • PT-2501 human mesenchymal stem cells
  • Cambrex human mesenchymal stem cells
  • HEK293, NIH3T3-3, HeLa and HepG2 cells were maintained in Dulbecco ' s Modified Eagle r s Medium (DMEM, high glucose 4.5 g/L with L-Glutamine and sodium pyruvate; 14246-25, Nakalai Tesque, JPN) with 10% fetal bovine serum (FBS, 29-167-54, Lot No. 2025F, Dainippon Pharmaceutical CO. , LTD. , JPN) . All cells were cultivated in a controlled incubator at 37°C in 5% C0 2 . In experiments involving hMSCs, we used hMSCs of less than five passages, in order to avoid phenotypic changes .
  • DMEM Dulbecco ' s Modified Eagle r s Medium
  • FBS fetal bovine serum
  • pEGFP-Nl and pDsRed2-Nl vectors were used. Both genes' expressions were under the control of cytomegalovirus (CMV) promoter. Transfected cells continuously expressed EGFP or DsRed2, respectively. Plasmid DNAs were amplified using Escherichia coli, XL1-blue strain (200249, Stratagene, TX) , and purified by EndoFree Plasmid Kit (EndoFree Plasmid Maxi Kit 12362, QIAGEN, CA) . In all cases, plasmid DNA was dissolved in DNase and RNase free water.
  • Transfection reagents were obtained as below: Effectene Transfection Reagent (cat. no.301425, Qiagen, CA) , TransFastTM Transfection Reagent (E2431, Promega, WI ) , TfxTM-20 Reagent (E2391, Promega, WI), SuperFect Transfection Reagent (301305, Qiagen, CA) , PolyFect Transfection Reagent (301105, Qiagen, CA) , LipofectAMINE 2000 Reagent (11668-019, Invitrogen corporation, CA) , JetPEI (x4) cone. (101-30, Polyplus-transfection, France), and ExGen 500 (R0511, Fermentas Inc., MD) .
  • the printing solution contained plasmid DNA and cell adhesion molecules (bovine plasma fibronectin (cat. no. 16042-41, Nakalai Tesque, JPN), dissolved in ultra-pure water at a concentration of 4 mg/mL) .
  • the above solution was applied on the surface of the slide using an Inkjet printer ( synQUADTM, Cartesian Technologies, Inc., CA) or manually, using a 0.5 to 10 ⁇ L tip .
  • This printed slide was dried up over 15 minutes at room temperature in a safety-cabinet. Before transfection, total Effectene reagent was gently poured on the DNA-printed glass slide and incubated for 15 minutes at room temperature.
  • the excess Effectene solution was removed from the glass slide using a vacuum aspirator and driedup at roomtemperature for 15 minutes in a safety-cabinet ,
  • the DNA-printed glass slide obtained was set in the bottom of a 100-mm culture dish and approximately 25 mL of cell suspension (2 to 4xl0 4 cells/mL) was gently poured into the dish. Then, the dish was transferred to the incubator at 37°C in 5% C0 2 and incubated for 2 or 3 days.
  • transfection reagents TransFast , TfxTM-20, SuperFect, PolyFect, LipofectAMINE 2000, JetPEI (x4) cone, or ExGen
  • plasmid DNA, fibronectin, and the transfection reagent were mixed homogeneously in a 1.5-mL micro-tube according to the ratios indicated in the manufacturer's instructions and incubated at room temperature for 15 minutes before printing on a chip.
  • the printing solution was applied onto the surface of the glass-slide using an Inkjet printer or a 0.5- to 10- ⁇ L tip.
  • the printed glass-slide was completely dried up at room temperature over 10 minutes in a safety-cabinet .
  • the printed glass-slide was placed in the bottom of a 100-mm culture dish and approximately 3 mL of cell suspension (2 to 4xl0 4 cells/mL) was added and incubated at room temperature over 15 minutes in a safety-cabinet. After incubation, fresh medium was poured gently into the dish. Then, the dish was transferred to an incubator at 37°C in 5% C0 2 and incubated for 2 to 3 days. After incubation, using fluorescence microscopy (IX-71, Olympus PROMARKETING, INC., JPN), we observed the transfe ⁇ tants , based on their expression of enhanced fluorescent proteins (EFP, EGFP and DsRed2) . Phase contrast images were taken with the same microscope . In both protocols, cells were fixedby using a paraformaldehyde (PFA) fixation method (4% PFA in PBS, treatment time was 10 minutes at room temperature) .
  • PFA paraformaldehyde
  • a transfection array chip was constructed as shown in Figure 11.
  • the transfection array chip was constructed by microprinting a cell cultivation medium solution containing fibronectin and DNA/transfection reagent onto a poly L lysine (PLL) coated glass slide.
  • PLL poly L lysine
  • Various cells were used for this example.
  • the cells were cultivated under typical cell cultivation conditions . As they adhered to the glass slide, the cells efficiently incorporated and expressed the genes corresponding to the DNA printed at a given position on the array.
  • conventional transfection methods e.g., cationic lipid or cationic polymer-mediated transfection
  • the efficiency of transfection using the method of the present invention was high in all the cells tested.
  • tissue stem cells such as HepG2 and hMSC, which were conventionally believed to resist transfection, were efficiently transfected.
  • hMSC was transfected at an efficiency 40 or more times higher than that of conventional techniques.
  • hMSC human Mesenchymal Stem Cells
  • solid phase transfection can be used to achieve a "transfection patch" capable of being used for in vivo gene delivery and a solid phase transfection array (SPTA) for high-throughput genetic function research on hMSC.
  • SPTA solid phase transfection array
  • the present inventors developed solid phase support fixed systemwhich can be easily fixed to a solidphase support and has sustained-release capability and cell affinity, whereby most of the above-described drawbacks could be overcome .
  • FIG. 13B An example of the results of the above-described experiment is shown in Figure 13B.
  • the present inventors usedourmicroprinting technique to fix amixture of a selected genetic material, a transfection reagent, an appropriate cell adhesion molecule, and a salt onto a solid support.
  • a transfection reagent an appropriate cell adhesion molecule
  • a salt an appropriate cell adhesion molecule
  • a salt an appropriate cell adhesion molecule
  • the present inventors studied five different cell lines (HEK293, HeLa, NIH3T3, HepG2 and hMSC) as described above with both our methodology (transfection in a solid phase system) (see Figures 13A and 13C) and conventional liquid-phase transfection under a series of transfection conditions.
  • Cross contamination was evaluated for both systems as follows .
  • RFP red fluorescent protein
  • GFP green fluorescent protein
  • transfection reagents were evaluated: four liquid transfection reagents (Effectene, TransFastTM, TfxTM-20, LopofectAMINE 2000), two polyamine (SuperFect, PolyFect), and two polyimine (JetPEI (x4) and ExGen 500).
  • Transfection efficiency was determined as total fluorescence intensity per unit area ( Figure 14A and Figure 14B (images )) .
  • the results of liquid phase optimal to cell lines used were obtained using different transfection reagents (see Figures 14Ctol4D).
  • these efficient transfection reagents were used to optimize a solid phaseprotocol.
  • Several tendencies were observed.
  • the transfection efficiency observed in the solid phase protocol was slightly superior to, but essentially similar to, that of the standard liquid phase protocol ( Figure 14A to 14D) .
  • transfection efficiency was increased up to 40 fold while the features of the cells were retained under conditions optimized to the SPTA methodlology (see the above-described protocol and Figures 14C and 14D) .
  • the best conditions included use of a polyethylene imine (PEI) transfection reagent.
  • PEI polyethylene imine
  • important factors for achieving high transfection efficiency are the charge balance (N/P ratio) between the number of nitrogen atoms (N) in the polymer and the number of phosphate residues (P) in plasmid DNA and DNA concentration.
  • N/P ratio charge balance
  • increases in the N/P ratio and the concentration lead to an increase in transfection efficiency.
  • a coating agent used is crucial for the achievement of high transfection efficiency on chips. It was found that when a glass chip is used, PLL provided best results both for transfection efficiency and cross contamination (described below) . When fibronectin coating was not used, few transfectants were observed (all the other experimental conditions were retained unchanged) . Although not completely established, fibronectin probably plays a role in accelerating cell adhesion process (data not shown) , and thus, limiting the time which permits the diffusion of DNA released from the surface.
  • an important advantage of the technique of the present invention is to achieve an array of separated cells, in which selected genes are expressed in the separate positions.
  • the present inventors printed JetPEI (see the "Experimental protocols” section) and two different reporter genes (RFP and GFP) mixed with fibronectin on glass surface coated with fibronectin.
  • the resultant transfection chip was sub ected to appropriate cell culture .
  • ExpressedGFP andRFP were localizedinregions , in which corresponding cDNA had been spotted, under experimental conditions which had been found to be best . Substantially no cross contamination was observed
  • Another cause of cross contamination may be the mobilityof transfectedcells on a solid support .
  • Thepresent inventors measured both the rate of cell adhesion (Figure 16C) and the diffusion rate of plasmid DNA on several supports. As a result, substantially no DNA diffusion occurred under optimum conditions . However, a considerably amount of plasmid DNA were diffused under high cross contamination conditions until cell adhesion was completed, so that plasmid DNAwas depleted from the solidphase surface.
  • the present invention successfully realized a hMSC transfection array in a system using complex-salt.
  • this technique it will be possible to achieve high-throughput studies using the solid phase trans ection, such as the elucidation of the genetic mechanism for differentiation of pluripotent stem cells .
  • the detailed fflechanism of the solid phase transfection as well as methodologies for & use of this technology for high throughput, real time gene expression monitoring can be applied or various purposes .
  • Each reporter was ixed to a solid phase support and cultured in undifferentiated mesenchymal stem cell maintenance medium (MSCGM, PT-3001, PT-3238. PT-4105, Cambrex, BioWhittaker, USA) for two days. Thereafter, the medium was replaced with differentiation inducing medium (hMSC Differentiation, PT-3002, PT-4120, Cambrex, BioWhittaker, USA) . The response profile of each reporter was measured.
  • MSCGM mesenchymal stem cell maintenance medium
  • PT-4105 Cambrex, BioWhittaker, USA
  • differentiation inducing medium hMSC Differentiation, PT-3002, PT-4120, Cambrex, BioWhittaker, USA
  • ISRE ISRE, RARE, STAT3 , GAS , NFAT, MIC, API, SRE,GRE,CRE, NFKB,
  • ERE, TRE, E2F, Rh , p53 were operably linked to GFP, were used to observe the differentiation of mesenchymal stemcells into osteoblasts.
  • the resultant time-lapse profiles are shown in Figure 19.
  • Reporters for the transcription factors were constructed as shown in Figure 23.
  • time-lapse profiles which were obtained in the induction of differentiation under the above-described conditions, were compared with each other.
  • the time-lapse profiles were obtained as follows .
  • Each reporter gene was introduced into mesenchymal stem cells by a solid phase transfection method.
  • the cells were culturedinundi ferentiated statemaintenance medium for two days. Thereafter, the medium was replaced with osteoblast differentiation medium. This time point was referred to as osteoblast differentiation start time. Supplement factors were added at concentrations recommended for the osteoblast differentiation medium.
  • the other culture conditions were in accordance with Cambre 's instructions.
  • HeLa cells available from RIKEN or the like
  • Nakalai DMEM high Glucose supplemented with serum (10% FBS, Dainippon Pharmaceutical Co . , Ltd. ) were used.
  • Transfection arrays were constructed as described in the above-describedexamples .
  • 24 reporters forgeneexpression and signal transduction were introduced into the HeLa cells .
  • the cells were cultured for 48 hours .
  • a culture unit was installed and time-lapse observation was performed.
  • a measuring device as shown in Figures 28 and 29 was used to detect the expression of the reporters via the intensity of fluorescence. Measurement was conducted in accordance with a procedure as shown in Figure 30.
  • 570-grid arrays having a format as shown in Figure 31 were used. Real time monitoring was performed in serum-free medium two days after transfection for illustrative purposes. Images were taken every 30 minutes. The 24 genes (reporter vectors) were confirmed to have activity under control conditions . An exemplary image acquisition is shown in Figure 32.
  • Figure 33A is a graph showing data from all of the genes.
  • Figures 33B to 33E show raw data.
  • Figures 33F to 331 show the results of calculation after polynominal approximation.
  • Figures 33J to 33U show data after first order differentiation and second order differentiation.
  • Figures 34-1 to 34-55 show the genes separately.
  • Figures 34-1 to 34-55 include data obtained from the same gene but at different points.
  • Figure 34-1 shows time-lapse data of EGFP-N1.
  • Figure 34-2 shows time-lapse data of API.
  • Figure 34-3 shows time-lapse data of APl(PMA).
  • Figure 34-4 shows time-lapse data of CRE.
  • Figure 34-5 shows time-lapse data of E2F.
  • Figure 34-6 shows time-lapse data of none.
  • Figure 34-7 shows time-lapse data of EGFP-N1.
  • Figure 34-8 shows further time-lapse data of API.
  • Figure 34-9 shows further time-lapse data of APl(PMA) .
  • Figure 34-10 shows further time-lapse data of CRE.
  • Figure 34-11 shows further time-lapse data of E2F.
  • Figure 34-12 shows time-lapse data of ERE.
  • Figure 34-13 shows time-lapse data of GAS.
  • Figure 34-14 shows time-lapse data of GRE.
  • Figure 34-15 shows time-lapse data of HSE.
  • Figure 34-16 shows time-lapse data of ISRE.
  • Figure 34-17 shows further time-lapse data of none.
  • Figure 34-18 shows further time-lapse data of ERE.
  • Figure 34-19 shows further time-lapse data of GAS.
  • Figure 34-20 shows further time-lapse data of GRE.
  • Figure 34-21 shows time-lapse data of HSE.
  • Figure 34-22 shows time-lapse data of ISRE.
  • Figure 34-23 shows time-lapse data of Myc.
  • Figure 34-24 shows time-lapse data of NFAT.
  • Figure 34-25 shows time-lapse data of NFKB.
  • Figure 34-26 shows time-lapse data of RARE.
  • Figure 34-27 shows time-lapse data of Rb.
  • Figure 34-28 shows further time-lapse data of none.
  • Figure 34-29 shows time-lapse data of Myc.
  • Figure 34-30 shows further time-lapse data of NFAT.
  • Figure 34-31 shows further time-lapse data of NFKB.
  • Figure 34-32 shows further time-lapse data of RARE.
  • Figure 34-33 shows further time-lapse data of Rb.
  • Figure 34-34 shows time-lapse data of STAT3.
  • Figure 34-35 shows time-lapse data of SRE.
  • Figure 34-36 shows time-lapse data of TRE.
  • Figure 34-37 shows time-lapse data of p53.
  • Figure 34-38 shows time-lapse data of Caspase3.
  • Figure 34-39 shows further time-lapse data of none.
  • Figure 34-40 shows time-lapse data of STAT3.
  • Figure 34-41 shows further time-lapse data of SRE.
  • Figure 34-42 shows further time-lapse data of TRE.
  • Figure 34-43 shows further time-lapse data of p53.
  • Figure 34-44 shows further time-lapse data of
  • Figure 34-45 shows time-lapse data of CREB-EGFP.
  • Figure 34-46 shows time-lapse data of IKB-EGFP.
  • Figure 34-47 shows time-lapse data of pp53-EGFP.
  • Figure 34-48 shows further time-lapse data of none.
  • Figure 34-49 shows further time-lapse data of none.
  • Figure 34-50 shows further time-lapse data of none.
  • Figure 34-51 shows further time-lapse data of CREB-EGFP.
  • Figure 34-52 shows further time-lapse data of
  • Figure 34-53 shows further time-lapse data of pp53-EGFP.
  • Figure 34-54 shows further time-lapse data of none.
  • Figure 34-55 shows further time-lapse data of none.
  • cisplatin was used as an exemplary anticancer agent and mixed into medium exposed cells .
  • concentration of the anticancer agent was selected as appropriate, such as 1 ⁇ M, 5 ⁇ M, 10 ⁇ M, and the like, to observe the reaction of the cells.
  • Cisplatin was applied to cells resistant or sensitive to the anticancer agent. Time-lapse observation was conducted to produce profiles as in the above-described examples. As a result, it was revealed that time-lapse profiles varied depending on the difference in cisplatin concentration and resistance/sensitivity.
  • Example 7 RNAi transfection microarray
  • Arrays were produced as described in Example 3.
  • pDNA plasmid DNA
  • shRNA shRNA
  • the compositions of the mixtures are shown in Table 2.
  • the method of the present invention is applicable to any cells .
  • siRNA was used instead of shRNA to construct RNAi transfection microarrays in accordance with a protocol as described in Example 3.
  • siRNA for EGFP was used as a control. Each siRNA was evaluated as to whether or not it knocks out a target transcription factor. Scramble RNAs were used as negative controls, and their ratios were evaluated. Table 3
  • Each cell was subjected to solid phase transfection, followed by culture for two days . Images were taken using a fluorescence image scanner, and the fluorescent level was quantified.
  • PCR primers were :
  • Cycle conditions 94°C, 2 min ⁇ ( 94°C, 15 sec ⁇ 60°C, 30 sec —> 68°C, 3 min) ⁇ 4°C (the process in parenthesis was performed 30 times)
  • the resultant PCR fragment was purified with phenol/chloroform extraction and ethanol precipitation.
  • the PCR fragment has the following sequence:
  • Chips were produced using the PCR fragment .
  • MCF7 was disseminated on the chips. After two days, images were obtained using a fluorescence image scanner. The results are shown in Figure 41.
  • the PCR fragment is compared with circular DNA. In either case, transfection was successful . It was revealed that the PCR fragment , which was used as a genetic material, could be transfected into cells, as with full-length plasmids, so that time-lapse analysis could be performed for the cells.
  • pTet-Off and pTet-On vectors were used (see http : //www. clontech.com/techinfo/vectors/cattet . shtml) .
  • pTRE-d2EGFP SEQ ID NO.: 29 was used (see http: //www.clontech.com/techinfo/vectors/vectorsT-Z/pTR E-d2EGFP. shtml) .
  • Reverse tetracycline-responsive transcriptional activator (rtTA) 774-1781 • pUC origin of replication: 2604-3247 Ampicillin resistance gene: ⁇ -lactamase coding sequences: 4255-3395 Fragment containing the SV40 poly A signal: 1797-2254 Neomycin/kanamycin resistance gene: 6462-5668 • SV40 promoter (Psvo) controlling expression of neomycin/kanamycin resistance gene: 7125-6782.
  • Tet-responsive promoter Phc ⁇ stv * - ⁇ Tet-responsive promoter: 1-438 Tet-responsive element (TRE): 1-318
  • TATA box 341-348 Destabilized enhanced green fluorescent protein (d2EGFP) gene
  • nucleic acid molecules encoding structural genes were usedtoproduce cellularprofiles .
  • an olfactory receptor 17 (SEQ ID NOS: 15, 16) was used as a structural gene .
  • the protocol used in the above-described examples was used.
  • pCaspase3-Sensor Vector (BD Biosciences Clontech, 1020 East Meadow Circle, Palo Alto, CA94303; cat. No. 8185-1) was used to monitor an apoptotic signal from caspase 3.
  • pAPl-EGFP, pCRE-EGFP, and pSRE-EGFP available from BD Bioscience Clontech were used to monitor stress signals from JNK, ERK, and p38.
  • GFP, RFP, CFP and BFP were used as fluorescent proteins and cloned KIAA cDNA libraries or the like were used as genes of interest to produce gene constructs. These materials are specifically described below:
  • KIAA Kazusa DNAResearch Institute, Kazusa, Chiba, Japan
  • cDNA libraries commercially available from Invitrogen.
  • RNAi for transcription factors CBFA-1, API
  • Mesenchymal stemcells as usedin the above-described examples were used to monitor the morphology of cells which were induced to be differentiated into osteoblasts.
  • Event descriptors can be produced based on the profile data using the process as used in the above-described examples.
  • cellular profiles could be produced by using a technique such as a two-hybrid system, FRET, BRET, or the like.
  • olfactory receptors SEQ ID NOS: 15 to 18
  • G proteins SEQ ID NOS: 19 to 24.
  • the dissociation of the olfactory receptor and the G protein was monitored through induction of a smelling substance, which was captured as changes in fluorescent wavelength. In this manner, cells were monitored.
  • the two-hybrid system, FRET, and BRET were specifically performed as follows .
  • the two-hybrid system was available from Clontech (http://www.clontech.co. jp/product/catalog/007003006. sh tml) .
  • FRET and BRET were performed using devices available from Berthold Japan .
  • miRNA microRNA
  • MicroRNA is a non-coding RNA of 18 to 25 bases (not translated into protein) , which was first found in nematodes and then revealed to bepreservedwidelyin animals andplants . It has been reported that miRNA is involved in the development and differentiation of nematodes and plants. It has been suggested that animals have a similar process. To date 200 or more miRNAs have been reported.
  • RNA-23 is theHesl gene (Hesl is arepressor transcription factor which suppress the differentiation of stem cells into neurons).
  • miRNA-23 is present in the vicinity of the translation terminating codon for this gene, and forms incomplete complementary base pairing (77%). Such incomplete complementary base pairing is important for the function of miRNA. Indeed, it has already been found that synthetic miRNA-23, which is introduced into NT2 human embryonic tumor cells, can suppress the expression of Hesl. This activity can be knocked out by using siRNA or the like.
  • miRNA as set forth in SEQ ID NO.: 25 was actually produced.
  • Example 18 Biological system-ribozyme
  • aribozyme was usedtoproduce cellularprofiles .
  • a protocol as described in Example 1 was used.
  • ribozyme refers to RNAhaving such an enzymatic activit .
  • examples of ribozymes include hammerhead ribozymes, hairpin ribozymes, and the like.
  • the present invention it is possible to determine the state of cells by observing a surprisingly small number of factors. Therefore, the present invention is applicable to diagnosis, prevention, and treatment. The present invention is also applicable to the fields of food, cosmetics, agriculture, environmental engineering, and the like.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Sustainable Development (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Computer Hardware Design (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The present invention provides a method and system for accurately presenting an actual state of a cell. The present invention also provides a system and method for presenting information within a cell over time and/or in real time without modification or directly where the cell is considered as a complex system. A method of the present invention for determining a state of a cell comprises a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription contorl sequence selected from the group consisting of transcription control sequences derived form the cell; and b) presenting the time-lapse profile.

Description

DESCRIPTION
TIME-LAPSE CELL ANALYSIS METHOD
TECHNICAL FIELD
The present invention relates to the field of cell analysis technology. More specifically, the present invention relates to a method and system for observing and analyzing cells sequentially or over time.
BACKGROUND ART
The survival of organisms depends on their ability to perceive and respond to extra-cellular signals. At the molecular level, signals are perceived and transmitted through networks of interacting proteins or the like that act cooperatively to maintain cellular homeostasis and regulate activities like growth, division and differentiation. Information transfer through biological signaling networks is mediated largely by protein-protein interactions that can assemble and disassemble dynamically in response to signals, creating transient circuits that link external events to specific internal outputs, such as changes in gene expression. Numerous strategies have been developed to map the protein-protein interactions that underlie these networks . These studies have collectively provided a wealth of data delineating genome-wide protein-protein interactions for Saccharomyces cervlslae and other organisms . While powerful, these approaches have provided only partial pictures and are likely to overlook many interactions that are context dependent, forming only in the presence of their appropriate signals . The disruption of protein-protein interactions by mutation or small-molecules can create biological fulcrums that enable small perturbations of a signaling network to elicit large changes in cellular phenotype, however not all protein-protein interactions in a given signaling pathway are likely to possess this power. As such, complementary strategies that aim to identify regulatory protein-protein interactions by artificially introducing proteins or peptides into cells whichcompete with and titrate-out the endogenous regulatory interactions , thereby disrupting the normal circuits that connect external signals to cellular responses, are of interest. By combining this strategy with functional assays , suchas theactivation of a gene inresponse to a signal, screens for functional interference can be used to identifypeptides that perturb regulatoryprotein-protein interactions. This strategy, often referred to as dominant-interfering or dominant-negative genetics, has been successfully employed in several model organisms where high-throughput screening methods are easily applied and to a lesser extent in mammals, which traditionally have been less amenable to these types of screens. One advantage of dominant-negative strategies is that such strategies can pinpoint the functionally relevant protein-protein interactions "fulcrum points" and thereby expose the small number of nodes within the larger web of a protein network that are susceptible to functional modulation by external agents . As such, theirresults canprovidevital information about the regulatory components that define a particular pathway and can allow the elucidation of key protein-protein interactions suitable for targeting by drug screening programs . Rosetta Inpharmatics has proposed cellular information as a profile in some patent applications (WO01/006013, WO01/005935, WO00/39339, WO00/39338,
WO00/39337, WO00/24936, WO00/17402, WO99/66067, WO99/66024, WO99/58720, andWO99/59037 ) . In such a profile, information from separate cells is processed as a group of separate pieces of information but not continuous information. Therefore, this technique is limited in that information analysis is not conducted on a single (the same) cell. Particularly, in this technique, analysis is conducted only at one specific time point before and after a certain change, and a series of temporal changes in a point (gene) are not analyzed.
Recent advances in the profiling technique have led to accurate measurement of cellular components, and thus, profiling of cellular information (e.g. , Schenaetal., 1995,
"Quantitative monitoring of gene expression patterns with a complementary DNA microarray". Science 270:467-470;
Lockhart et al., 1996, "Expression monitoring by hybridization to high-density oligonucleotide arrays".
Nature Biotechnology 14:1675-1680; Blanchard et al., 1996,
"Sequence to array: Probing the genome's secrets". Nature
Biotechnology 14:1649; and WO01/006013 ) . For organisms whose genome has been entirelyknown, it is possible to analyze the transcripts of all genes in a cell. In the case of other organisms whose genomic information is increasing, a number of genes in a cell can be simultaneously monitored.
As array technology advances, arrays also have been utilized in the field of drug search (e.g., Marton et al.,
"Drug target validation and identification of secondary drug target effects using Microarrays", Mat. Med., 1998 Nov, 4(11) : 1293-301; and Gray et al . , 1998, "Exploiting chemical libraries, structure, and genomics in the search for kinase inhibitors". Science, 281:533-538) . Analysis usingprofile
(e.g., US Patent No. 5,777,888) and clustering of profiles provides information about conditions of cells, transplantation, target molecules and candidates of drugs, and/or the relevant functions , efficacy and toxicity of drugs . These techniques can be used to induce a common profile which represents ideal drug activity and disease conditions . Comparing profiles assists in detecting diseases in patients at early stages and provides prediction of improved clinical results for patients who have been diagnosed as having a disease.
However, therehas beenno techniquewhichcanprovide information about the same cell in the true sense. In the above-described techniques, data is obtained as average for a group of heterologous cells . Analyses and evaluations based on such data lack accuracy. Therefore, there is an increasing demand for a method for providing information at the cellular level.
DISCLOSURE OF THE INVENTION
An object of the present invention is to provide a method and system for accurately presenting an actual state of a cell. Particularly, an object of the present invention is to provide a system and method for presenting cellular level information over time and/or in real time without modification or directly where the cell is considered as a complex system.
The above-described ob ects of the present invention were achieved by monitoring the transcription level associated with at least one transcription control sequence selected from transcription control sequences derived from a cell over time and presenting a time-lapse profile of the cell (in transcription).
Therefore, the present invention provides the following.
(1) A method for presenting a state of a cell, comprising the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a gene state associated with at least one gene selected from genes derived from the cell; and b) presenting the time-lapse profile.
(2) A method according to item 1, further comprising fixing the cell to a solid phase support .
(3) A method according to item 1, wherein the time-lapse profile is presented in real time.
( 4 ) A method according to item 1 , wherein the gene comprises a transcription control sequence, and the gene state includes expression of the gene.
(5) A method for determining a state of a cell, comprising the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a gene state associated with at least one gene selected from genes derived from the cell; and b) determining the state of the cell based on the time-lapse profile of the gene state.
(6) A method according to item 5, further comprising fining the cell to a solid phase support .
( 7 ) A method according to item 5 , wherein the gene comprises a transcription control sequence, and the gene state includes expression of the gene.
(8) A method according to item 5, further comprising correlating the time-lapse profile with the state of the cell before obtaining the time-lapse profile.
(9) A method according to item 7, wherein the transcription control sequence is selected from the group consisting of promoters, enhancers, silencers, other flanking sequences of structural genes in genomes, and genomic sequences other than exons .
(10) Amethod according to item 7, wherein the transcription control sequences include at least one promoter selected fromthe group consistingof constitutivepromoters , specific promoters , and inducible promoters .
(11) Amethod according to item 7, wherein the transcription control sequences to be monitored include at least two transcription control sequences .
(12) Amethod according to item 7, wherein the transcription control sequences to be monitored include at least three transcription control sequence .
( 13 ) Amethod according to item 7 , wherein the transcription control sequences to be monitored include at least eight transcription control sequences .
(14) A method according to item 7, further comprising arbitrarily selecting at least one transcription control sequence from the transcription control sequences .
(15) A method according to item 5, wherein the time-lapse profile is presented in real time.
(16) A method according to item 5, wherein the state of the cell is selectedfromthe group consisting of a differentiated state, an undifferentiated state, a cellular response to an external agent, a cell cycle, and a growth state.
(17) A method according to item 5, wherein the cell is selected from the group consisting of stem cells and somatic cells .
(18) A method according to item 5, wherein the cell is selected from the group consisting of adherent cells , suspended cells , tissue forming cells , andmixtures thereof .
(19) A method according to item 6, wherein the solid phase support comprises a substrate.
(20) A method according to item 7, wherein the cell is transfected with a nucleic acid molecule comprising the transcription control sequence and a reporter gene sequence operably linked to the transcription control sequence.
(21) Amethod according to item 20, wherein the transfection is performed in solid phase or in liquid phase. (22) A method according to item 5, wherein the step of b) comprises a mathematical process selected from the group consisting of phase comparison, signal processing, and multivariate analysis, of the time-lapse profile.
(23) A method according to item 5, wherein the step of b) comprises calculating a difference between the time-lapse profile of the cell and a control profile.
(24) A method for correlating an external factor with a response of a cell to the external factor, comprising the steps of: a) exposing the cell to the external factor; b) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; and c) correlating the external factor with the time-lapse profile.
( 25 ) Amethod according to item 24 , wherein the cell is fixed to a solid phase support .
(26) A method according to item 24, further comprising exposing the cell to at least two external factors to obtain a time-lapse profile of the cell for each external factor.
(27) A method according to item 26, further comprising dividing the at least two time-lapse profiles into categories and classifying the external factors corresponding to the respective time-lapse profiles into the categories. (28) Amethodaccordingtoitem 24, wherein thetranscription control factor includes a constitutive promoter.
(29) Amethodaccordingto item 24, wherein the transcription control factor includes an inducible promoter.
(30) A method according to item 24, wherein the time-lapse profile is presented in real time.
(31) A method according to item 24, wherein in the step of c), the external factor is correlated with the time-lapse profile based on a phase of the time-lapse profile.
(32) A method according to item 24, wherein the cell is cultured on an array.
(33) A method according to item 32, wherein the step of b) comprises obtaining image data from the array.
(34) A method according to item 26, wherein the step of σ) comprises distinguishing phases of the time-lapse profiles from one another.
(35) A method according to item 24, wherein the external factor is selected from the group consisting of a temperature change, a humidity change, an electromagnetic wave, a potential difference, visible light, infrared light, ultraviolet light. X-ray, a chemical substance, a pressure, a gravity change, a gas partial pressure, and an osmotic pressure.
(36) A method according to item 35, wherein the chemical substance is a biological molecule, a chemical compound, or a medium.
(37) A, method according to item 36, wherein the biological molecule is selected from the group consisting of nucleic acids, proteins, lipids, sugars, proteolipids, lipoproteins, glycoproteins, and proteoglycans .
(38) A method according to item 36, wherein the biological molecule is a hormone.
(39) A method according to item 36, wherein the biological molecule is a cytokine.
(40) A method according to item 36, wherein the biological molecule is a cell adhesion factor.
(41) A method according to item 36, wherein the biological molecule is an extracellular matrices .
(42) A method according to item 35, wherein the chemical substance is a receptor agonist or antagonist.
( 43 ) A method for in erring an unidentified external factor given to a cell based on a time-lapse profile, comprising the steps of: a) exposing the cell to a plurality of known external factors; b) obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from - li ¬
the cell; c) correlating the known external factors with the respective time-lapse profiles; d) exposing the cell to the unidentified external factor; e) obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of the transcription levelof the selectedtranscription control sequence; f) determining a profile corresponding to the time-lapse profile obtained in the step of e) from the time-lapse profiles obtained in the step of b); and g) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the step of f ) .
(44) A method for inferring an unidentified external factor given to a cell based on a time-lapse profile, comprising the steps of: a) providing data relating to a correlation relationship between known external factors and time-lapse profiles of the cell in response to theknown external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) exposing the cell to the unidentified external factor; c) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected transcription control sequence; d) determining a profile corresponding to the time-lapse profile obtained in the step of c) from the time-lapse profiles obtained in the step of a) ; and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the step of d) .
(45) A system for presenting a state of a cell, comprising: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b) means for presenting the time-lapse profile.
(46) A system for determining a state of a cell, comprising: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b) means for determining the state of the cell based on the time-lapse profile.
(47) A system for correlating an external factor with a response of a cell to the external factor, comprising: a) means forexposingthecell tothe externalfactor; b) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one promoter selected from the group consisting of promoters derived from the cell; and c) means for correlating the external factor with the time-lapse profile.
(48) A system for inferring an unidentified external factor given to a cell based on a time-lapse profile, comprising: a) means forexposingthe cell to apluralityof known external factors ; b) means for obtaining a time-lapse profile of the cell for each known external f ctor by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; c) means for correlating the known external factors with the respective time-lapse profiles; d) means for exposing the cell to the unidentified external factor; e) means for obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of thetranscriptionlevelof the selectedtranscriptioncontrol sequence; f) means for determining a profile corresponding to the time-lapse profile obtained in the means of e) from the time-lapse profiles obtained in the means of b); and g) means for determining that the unidentified external factor is the known external factor corresponding to the profile determined in the means of f) .
(49) A system for inferring an unidentified external factor given to a cell based on a time-lapse profile, comprising: a) means forproviding datarelatingto a correlation relationship between known external factors and time-lapse profiles of the cell inresponse to theknown external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) means for exposing the cell to the unidentified external factor; c) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associatedwiththe selectedtranscription control sequenc ; d) means for determining a profile corresponding to the time-lapse profile obtained in the means of c) from the time-lapse profiles obtained in the means of a); and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the means of d) .
Hereinafter, thepresent inventionwillbe described by way of preferred embodiments. It will be understood by those skilled in the art that the embodiments of the present invention can be appropriately made or carried out based on the description of the present specification and the accompanying drawings, and commonly used techniques well known in the art . The function and effect of the present invention can be easily recognized by those skilled in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the results of experiments in which various aσtin acting substances and HEK293 cells were used, where gelatinwas used as a control. Figure 1 shows an effect of each adhered substance (HEK cell) with respect to transfection efficiency. The HEK cells were transfected with pEGFP-Nl using an Effectene reagent.
Figure 2 shows exemplary transfection efficiency when fibronectin fragments were used.
Figure 3 shows exemplary transfection efficiency when fibronectin fragments were used.
Figure 4 shows a summary of the results presented in Figures 2 and 3.
Figure 5 shows the results of an example in which trans ection efficiency was studied for various cells .
Figure 6 shows the results of transfection when various plates were used.
Figure 7 shows the results of transfection when various plates were used at a fibronectin concentration of 0, 0.27, 0.53, 0.8, 1.07, and 1.33 (μg/μL for each) . Figure 7 shows the influence of fibronectin concentration and the surface modification on the transfection of HEK293 cells. The data shows the average of 4 di ferent squares .
Figure 8 shows exemplary photographs showing cell adhesion profiles in the presence or absence of fibronectin.
Figure 9 shows exemplary cross-sectional photographs of cell adhesion profiles in the presence or absence of fibronectin. Cross-sections of human mesenchymal stem cells (hMSC) were observed using a confocal laser scanning microscope. hMSC were stained with SYT061 (blue fluorescence) and Texas red - X phalloidin (red luorescence) and fixed with 4% PFA. Blue fluorescence (nuclei: SYT061) and red fluorescence (nuclei: Texas red - X phalloidin) were obtained using a confocal laser microscope (LSM510, Carl Seiss Co., Ltd., pin hole size=l .0 , image interval=0. ) . Figure 10 shows transition of nuclear surface area. Relative nuclear surface area was determined by cross-sections of hMSC observed with cofocal laser scanning microscopy. hMSC was fixed with 4% PFA.
Figure 11 shows the results of an exemplary transfection experiment when a transfection array chip was constructed and used.
Figure 12 shows exemplary contamination between each spot on an array.
Figures 13A and 13B show an experiment in which spatially-spaced DNA was caused to be taken into cells by the solid phase transfection of the present invention in Example 4. Figure 13A schematically shows a method for producing a solid phase transfection array (SPTA). Figure 13B shows the results of solid phase transfection. A HEK293 cell line was used to produce a SPTA. Green colored portions indicate transfected adherent cells. According to this result, the method of the present invention can be used to produce a group of cells separated spatially and transfected with different genes .
Figure 13C shows a difference between conventional liquid phase transfection and SPTA.
Figures 14A and 14B shows the results of comparison of liquid phase transfection and SPTA. Figure 14A shows the results of experiments where 5 cell lines were measured with respect to GFP intensity/mm2. Transfection efficiency was determined as fluorescence intensity per unit area.
Figure 14B shows fluorescence images of cells expressing EGFP corresponding to the data presented in Figure 14A. White circular regions were regions in which plasmid DNA was fixed. In other regions, cells were also fixed in solid phase, however, cells expressing EGFP were not observed. The white bar indicates 500 μm.
Figure 1<SC shows an exemplary transfection method of the present invention.
Figure 14D shows an exemplary transfection method of the present invention.
Figures 15A and 15B show the results of coating a chip , where by cross contamination was reduced. Figures 15A and 15B show the results of liquid phase transfection and SPTA using HEK293 cells, HeLa cells, NIT3T3 cells (also referred to as "3T3" ) , HepG2 cells, and hMSCs . Transfection efficiency was represented by GFP intensity.
Figures 16A and 16B show cross contamination between each spot . A nucleic acid mixture containing fibronectin having a predetermined concentration was fixed to a chip coated with APS or PLL (poly-L-lysine) . Cell transfection was performed on the chip. Substantially no cross contamination was observed (upper and middle rows). In contrast, significant chip cross contamination of fixed nucleic acids was observed on an uncoated chip (lower row) .
Figures 16C and 16D show a correlation relationship between the types of substances contained in a mixture used for fixation of nucleic acid and the cell adhesion rate.
The graph of Figure 16D shows an increase in the proportion of adherent cells over time. A longer time is required for cell adhesion when the slope of the graph is mild than when the slope of the graph is steep .
Figure 17 shows an exemplary configuration of a computer which was used to perform the method of the present invention.
Figures 181k and 1SB show exemplary mathematical analyses according to the present invention. A profile of a promoter was obtained by measuring changes in fluorescence intensity. The profile was normalized using inherent fluorescence of cells or medium. Thereafter, the amplitudes of reporter expression fluctuations were compared where an expression fluctuation having an amplitude width of 5 or more (TH≥5) was considered to indicate the presence of a change . The measurement was made during the early period (0-17.5 hours) and the later period ( 17.5-31.5 hours) after the differentiation induction initiation andthe totalperiod (0-31.5 hours). Expression fluctuation having an amplitude width of 5 or more (TH≥5) is represented by ( + ), while expression fluctuation having an amplitude width of less than 5 ( TH<5 ) is representedby ( - ) . When arbitraryreporters were extracted (A+B+ ... +n), n waves were integrated and the sum was divided by n to form an average wave. A fluctuation of a threshold ormorewas regarded as a change. In Figure 18B, two reporter profiles were integrated and the average profile was drawn in red. A fluctuation of an average profile of 5 or more was regarded as expression fluctuation. Fluctuation could be detected for the two reporters .
Figure 19 shows exemplary plasmids containing promoters used in the present invention and exemplary analyses of the present invention. Figure 20 shows the results of exemplary mathematical analysis in the early period of differentiation induction. The results were obtained while changing combinations of arbitrarily extracted reporters at the early period of differentiation induction. An arbitrary number of reporters were extracted from 17 reporters. The average profile was calculated by the method shown in Figures ISH and 18B. Profiles having a fluctuation width of 5 or more were evaluatedat the intervals of 0-31.5 hours, 0-17.5 hours, and 17.5-31.5 hours . The number of extractions was 17 under each extraction condition (one exemplary combination by the 17 extractions is shown) . Figures 18A and 18B show the proportion of combinations which were considered to produce a fluctuation. According to the analyses, differentiation induction could not be detected at the very early period, however, differentiation induction could be detected after about 15 hours. When the number of extracted reporters was 8, the proportion of combinations, which were confirmed to produce a fluctuation, was 100%.
Figure 21 shows the results of exemplary mathematical analysis in the maintenance of undifferentiated states . A combination of arbitrarily extracted reporters was changed under undifferentiated state maintaining conditions. The results were significantly different from when differentiation induction was performed in Figure 20. By comparing with Figure 20, it is considered to be possible to determine whether a cell is induced into differentiation or maintained in an undifferentiated state.
Figure 22 schematically shows a cocktail party process . Figure 23 shows an exemplary construct of a gene transcription switch reporter used in a transfection plasmid of the present invention.
Figure 24 shows exemplary construction of a set of transcription factor reporters.
Figure 25 shows the results of exemplaryassays using transcription factor reporters.
Figure 26 shows exemplary time-series measurement of the activity of a transcription factor in the bone differentiation process. Human mesenchymal stem cells (available from Osiris) and hMSC Osteogenic SingleQuots
(available from BioWhittaker) were used in the measurement.
Figure 27 shows exemplary oscillation phenomenon and phase analysis of the activity of transcription factors.
Figure 28 shows an exemplary real time measuring device .
Figure 29 shows a schematic, enlarged view of the cell measuring device of Figure 28.
Figure 30 shows a scheme of cell measurement.
Figure 31 shows an exemplary grid array used in the present invention. Names of genes used are shown in the lower left portion of the figure.
Figure 32 shows raw data obtained using a grid array in the present invention.
Figure 3323. shows a graph of raw data obtained in Example 5. The vertical axis represents fluorescence intensity (Arbitrary Unit), while the horizontal axis represents time (unit: minute (min)). The following genes were used: pEGFP-Nl, pAPl-EGFP, pAPl(PMA) -EGFP, pE2F-EGFP, pGAS-EGFP, pHSE-EGFP, pMyc-EGFP, pNFkB-EGFP, pRb-EGFP, pSRE-EGFP, pp53-EGFP, pCRE-EGFP, pERE-EGFP, pGRE-EGFP, pISRE-EGFP, pNFAT-EGFP, pRARE-EGFP, pSTAT3-EGFP, pTRE-EGFP, pCREB-EGFP, plkB-EGFP, pp53-EGFP (Signaling probe), and pCaspase3-Sensor.
Figures 33B to 33E show raw data obtained in Example 5.
Figures 33F to 331 show the results of calculation after polynominal approximation of the data obtained in Example 5.
Figures 33J to 33U show the results of first-order differentiation and second-order differentiation of the data obtained in Example 5.
Figures 34-1 to 34-55 show raw data obtained in
Example 5 for each gene (negative controls are represented by "none" ) .
Figure 34-1 shows time-lapse data of EGFP-N1.
Figure 34-2 shows time-lapse data of API.
Figure 34-3 shows time-lapse data of APl(PMA). Figure 34-4 shows time-lapse data of CRE .
Figure 34-5 shows time-lapse data of E2F.
Figure 34-δ shows time-lapse data of none.
Figure 34-7 shows time-lapse data of EGFP-N1.
Figure 34-8 shows further time-lapse data of API.
Figure 34-9 shows further time-lapse data of APl(PMA) .
Figure 34-10 shows further time-lapse data of CRE.
Figure 34-11 shows further time-lapse data of E2F.
Figure 34-12 shows time-lapse data of ERE.
Figure 34-13 shows time-lapse data of GAS.
Figure 34-14 shows time-lapse data of GRE .
Figure 34-15 shows time-lapse data of HSE.
Figure 34-16 shows time-lapse data of ISRE.
Figure 34-17 shows further time-lapse data of none.
Figure 34-18 shows further time-lapse data of ERE.
Figure 34-19 shows further time-lapse data of GAS. Figure 34-20 shows further time-lapse data of GRE,
Figure 34-21 shows time-lapse data of HSE.
Figure 34-22 shows time-lapse data of ISRE.
Figure 34-23 shows time-lapse data of Myc.
Figure 34-24 shows time-lapse data of NFAT.
Figure 34-25 shows time-lapse data of NFKB.
Figure 34-26 shows time-lapse data of RARE.
Figure 34-27 shows time-lapse data of Rb.
Figure 34-28 shows further time-lapse data of none.
Figure 34-29 shows time-lapse data of Myc.
Figure 34-30 shows further time-lapse data of NFAT,
Figure 34-31 shows further time-lapse data of NFKB,
Figure 34-32 shows further time-lapse data of RARE.
Figure 34-33 shows further time-lapse data of Rb,
Figure 34-34 shows time-lapse data of STAT3.
Figure 34-35 shows time-lapse data of SRE. Figure 34-36 shows time-lapse data of TRE.
Figure 34-37 shows time-lapse data of p53.
Figure 34-38 shows time-lapse data of Caspase3.
Figure 34-39 shows further time-lapse data of none.
Figure 34-40 shows time-lapse data of STATS.
Figure 34-41 shows further time-lapse data of SRE.
Figure 34-42 shows further time-lapse data of TRE.
Figure 34-43 shows further time-lapse data of p53.
Figure 34-44 shows further time-lapse data of Caspase3.
Figure 34-45 shows time-lapse data of CREB-EGFP.
Figure 34-46 shows time-lapse data of IKB-EGFP.
Figure 34-47 shows time-lapse data of pp53-EGFP.
Figure 34-48 shows further time-lapse data of none.
Figure 34-49 shows further time-lapse data of none.
Figure 34-50 shows further time-lapse data of none.
Figure 34-51 shows further time-lapse data of CREB-EGFP. Figure 34-52 shows further time-lapse data of IKB-EGFP.
Figure 34-53 shows further time-lapse data of pp53-EGFP.
Figure 34-54 shows further time-lapse data of none.
Figure 34-55 shows further time-lapse data of none.
Figure 35 shows the results of transfection using an RNAi transfection array of Example 7. Each reporter gene was printed on a solid phase substrate at a rate of 4 points per gene. The substrate was dried. For each transcription factor, siRNA (28 types) were printed onto coordinates at which reporter genes were printed, followed by drying. As a control, siRNA for EGFP was used. As a negative control, scramble RNA was used. Thereafter, LipofectAMINE2000 was printed onto the same coordinates of each gene, followed by drying. Thereafter, fibronectin solution was printed onto the same coordinates of each gene. HeLa-K cells were plated on the substrate, followed by culture for 2 days. Thereafter, images were taken using a fluorescence image scanner.
Figures 36A to 36E show the results of transfection using the RNAi transfection array of Example 7 or each cell.
The fluorescence intensity of each reporter was quantified by image analysis, and thereafter, compared with the intensity of each reporter gene to which scramble RNA (negativecontrol) was printed, thereby calculating the ratio. The results are shown for all reporters and all cells. D: pDsRed2-l (promoterless vector: negative control to shRNA) . G: pEGEP-Nl (green fluorescent protein expression vector: a target gene for shRNA used herein) . sh: pPUR6iGFP272
(vector type RNAi suppressing the expression of EGFP gene) . D+G, etc.: D was printed before G was printed (the order of printing is as written). D+G(7:3), etc.: the ratio of D to G, where the total amout of D and G genes was 2 μg and the ratio of the D gene to the G gene was 7:3.
Figure 37 shows the results of transfection using an RNAi transfection array of Example 8. Each reporter gene expression unit PCR fragment was printed on a solid phase substrate at a rate of 4 points per gene. The substrate was dried. For each transcription factor, siRNA (28 types) were printed onto coordinates at which reporter genes were printed, followed by drying. As a control, siRNA for EGFP was used. As a negative control, scramble RNA was used. Thereafter, LipofectAMINE2000 was printed onto the same coordinates of each gene, followed by drying. Thereafter, fibronectin solution was printed onto the same coordinates of each gene. HeLa-K cells were platedon the substrate , followedby culture for 2 days. Thereafter, images were taken using a fluorescence image scanner .
Figure 38A to 38D show the results of transfection using the RNAi transfection array of Example 7 for each cell . The fluorescence intensity of each reporter was quantified by image analysis, and thereafter, compared with the intensity of each reporter gene to which scramble RNA (negative control) wasprinted, therebycalculating the ratio. The results are shown for all reporters and all cells.
Figure 39 shows a structureof aPCRfragment obtained in Example 9.
Figure 40 shows a structure of pEGFP-Nl.
Figure 41 shows the result of comparison of transfection efficiency of transfection microarrays using cyclic DNA and PCR fragments.
Figure 42 shows changes when a tetracycline dependent promoter was used.
Figure 43 shows the results of expression when a tetracycline dependent promoter and a tetracycline independent promoter were used.
Figure 44 shows an exemplary configuration of a system of the present invention for producing cellular profile data.
DESCRIPTION OF SEQUENCE LISTING
SEQ ID NO . : 1 : a nucleic acid sequence of fibronectin (human)
SEQ ID NO. : 2 : an amino acid sequence of fibronectin (human)
SEQ ID NO . : 3 : a nucleic acid sequence of vitronectin (mouse)
SEQ ID NO. : 4 : an amino acid sequence of vitronectin (mouse) SEQ ID NO.: 5: a nucleic acid sequence of laminin
(mouse α-chain)
SEQ ID NO . : 6 : an amino acid sequence of laminin (mouse α-chain) SEQ ID NO. • 7 • a nucleic acid sequence of laminin
(mouse β-chain)
SEQ ID NO. : 8: an amino acid sequence of laminin
(mouse β-chain)
SEQ ID NO. : 9: a nucleic acid sequence of laminin
(mouse γ-chain)
SEQ ID NO. : 10 : an amino acid sequence of laminin
(mouse γ-chain)
SEQ ID NO . : 1 111:: an amino acid sequence of fibronectin
(bovine)
SEQ ID NO. : 12 primer 1 used in Example 9
SEQ ID NO. : 13 primer 2 used in Example 9
SEQ ID NO. : 14 a PCR fragment obtained in a PCR reaction in Example 9
SEQ ID NO.: 15: mouse olfactory receptor 17 (heptanal-sensitive) nucleic acid (Genbank Accession No. AF106007)
SEQ ID NO . : 16 : a protein encoded by the nucleic acid set forth in SEQ ID NO.: 15
SEQ ID NO . : 17 : mouse olfactory receptor S46 nucleic acid (Genbank Accession No. AF121979)
SEQ ID NO. : 18 : a protein encoded by the nucleic acid set forth in SEQ ID NO. : 17
SEQ ID NO.: 19: mouse G protein α-subunit nucleic acid (Genbank Accession No. M36778)
SEQ ID NO. : 20 : a protein encodedby the nucleic acid set forth in SEQ ID NO. : 19
SEQ ID NO.: 21: mouse G protein β-subunit nucleic acid (Genbank Accession No. M87286)
SEQ ID NO . : 22 : a protein encoded by the nucleic acid set forth in SEQ ID NO. : 21
SEQ ID NO.: 23: mouse G protein γ-subunit nucleic acid (Genbank Accession No. U37527) SEQ ID NO. : 24 : a protein encoded by the nucleic acid set forth in SEQ ID : 23
SEQ ID NO 25 miRNA indicated in Example 16 SEQ ID NO 26 pTet-Off used in Example 10 SEQ ID NO 27 pTet-On used in Example 10 SEQ ID NO 28 5 amino acids of laminin SEQ ID No 29 pTRE-d2EGFP used in Example 10
BEST MODE FOR CARRYING OUT THE INVENTION
It should be understood throughout the present specification that articles for singular forms include the concept of their plurality unless otherwise mentioned. Therefore, articles or adjectives for singular forms (e.g. , "a", "an", "the" , etc. in English; "ein", "der", "das", "die", etc. and their inflections in German; "un" , "une" , "le", "la", etc. in French; "un", "una", "el", "la", etc. in Spanish, and articles, adjectives, etc. in other languages) include the concept of their plurality unless otherwise specified. It should be also understood that terms as used herein have definitions ordinarily used in the art unless otherwise mentioned. Therefore, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art. Otherwise, the present application (including definitions) takes precedence.
(Definition of terms)
Hereinafter, terms specifiσally used herein will be defined.
(Cellular biology)
The term "cell" is herein used in its broadest sense in the art, referring to a structural unit of tissue of a multicellularorganism, whichis capableof selfreplicating, has genetic information and a mechanism for expressing it, and is surrounded by a membrane structure which isolates the cell from the outside. Cells used herein may be either naturally-occurring cells or artificially modified cells (e.g., fusion cells, genetically modified cells, etc.). Examples of cell sources include, but are not limited to, a single-cell culture; the embryo, blood, or body tissue of normally-grown transgenic animal; a mixture of cells derived from normally-grown cell lines; and the like.
Cells used herein may be derived from any organism (e.g., any unicellular organisms (e.g., bacteria and yeast ) or any multicellular organisms (e.g., animals (e.g., vertebrates and invertebrates), plants (e.g., monocotyledons and dicotyledons, etc.)). For example, cells used herein are derived from a vertebrate (e.g., Myxiniformes , Petronyzoniformes, Chondrichthyes, Osteichthyes , amphibian, reptilian, avian, mammalian, etc. ) , more preferably mammalian (e.g., monotremata, marsupialia, edentate, dermoptera, chiroptera, carnivore, insectivore, probosσidea, perissodactyla, artiodactyla, tubulidentata, pholidota, sirenia, cetacean, primates, rodentia, lagomorpha, etc.). In one embodiment, cells derived from Primates (e.g. , chimpanzee, Japanesemonkey, human) areused. Particularly, without limitation, cells derived from a human are used. The above-described cells maybe either stem cells or somatic cells. Also, the cells may be adherent cells, suspended cells, tissue forming cells, andmixtures thereof . The cells may be used for transplantation.
Any organ may be targeted by the present invention. A tissue or cell targeted by the present invention may be derived from any organ. As used herein, the term "organ" refers to a morphologically independent structure localized at a particular portion of an individual organism in which a certain f nction is performe . Inmulticellular organisms (e.g., animals , plants ) , an organ consists of several tissues spatially arranged in a particular manner, each tissue being composed of a number of cells. An example of such an organ includes an organ relating to the vascular system. In one embodiment, organs targetedbythepresent invention include, but are not limited to, skin, bloodvessel, cornea, kidney, heart, liver, umbilical cord, intestine, nerve, lung, placenta, pancreas, brain, peripheral limbs, retina, and the like . Examples of cells differentiated frompluripotent cells include epidermic cells , pancreaticparenchymal cells , pancreatic duct cells, hepatic cells, blood cells, cardiac muscle cells, skeletal muscle cells , osteoblasts, skeletal myoblasts, neurons, vascular endothelial cells, pigment cells, smooth muscle cells, fat cells, bone cells, cartilage cells, and the like.
As used herein, the term "tissue" refers to an aggregate of cells having substantially the same function and/or form in a multicellular organism. "Tissue" is typically an aggregate of cells of the same origin, but may be an aggregate of cells of different origins as long as the cells have the same function and/or form. Therefore, when stemcells of thepresent invention areusedto regenerate tissue, the tissue may be composed of an aggregate of cells of two or more different origins. Typically, a tissue constitutes apart of an organ. Animal tissues are separated into epithelial tissue, connective tissue, muscular tissue, nervous tissue, and the like, on amorphological, functional, or developmentalbasis . Plant tissues are roughly separated into meristematic tissue and permanent tissue according to the developmental stage of the cells constituting the tissue. Alternatively, tissues may be separated into single tissues and composite tissues according to the type of cells constituting the tissue. Thus, tissues are separated into various categorie .
As used herein, the term "stem cell11 refers to a cell capable of self replication and pluripotency. Typically, stem cells can regenerate an in ured tissue. Stem cells used herein may be, but are not limited to, embryonic stem (ES) cells or tissue stem cells (also called tissular stem cell, tissue-specific stem cell, or somatic stem cell) . A stem cellmaybe an artificiallyproducedcell (e.g. , fusion cells, reprogrammed cells, or the like used herein) as long as it can have the above-described abilities. Embryonic stem cells are pluripotent stem cells derived from early embryos . An embryonic stem cell was first established in 1981, which has been applied to production of knockout mice since 1989. In 1998, a human embryonic stem cell was established, which is currently becoming available for regenerative medicine. Tissue stem cells have a relatively limited level of differentiation unlike embryonic stem cells. Tissue stem cells are present in tissues and have an undifferentiated intracellular structure. Tissue stem cells have a higher nucleus/cytoplasm ratio and have few intracellular organelles . Most tissue stemcells havepluripotency, a long cell cycle, and proliferative ability beyond the life of the individual. As used herein, stem cells may be preferably embryonic stem cells, though tissue stem cells may also be employed depending on the circumstance.
Tissue stem cells are separated into categories of sites from which the cells are derived, such as the dermal system, the digestive system, the bone marrow system, the nervous system, and the lik . Tissue stem cells in the dermal system include epidermal stem cells , hair follicle stem cells , and the like. Tissue stem cells in the digestive system include pancreatic (common) stem cells, liver stem cells, and the like. Tissue stem cells in the bone marrow system include hematopoietic stem cells, mesenchymal stem cells, and the lik . Tissue stem cells in the nervous system include neural stem cells, retinal stem cells, and the like.
As used herein, the term "somatic cell" refers to any cell other than a germ cell, such as an egg, a sperm, or the like, which does not transfer its DNA to the next generation. Typically, somatic cells have limited or no pluripotency. Somatic cells used herein may be naturally-occurring or genetically modified as long as they can achieve the intended treatment .
The origin of a stem cell is categorized into the ectoderm, endoderm, or mesoderm. Stem cells of ectodermal origin are mostly present in the brain, including neural stem cells . Stem cells of endodermal origin are mostly present in bone marrow, including blood vessel stem cells, hematopoietic stem cells, mesenchymal stem cells, and the like. Stem cells of mesoderm origin are mostly present in organs, including liver stem cells, pancreas stem cells, and the like. Somatic cells may be herein derived from any germ layer. Preferably, somatic cells , such as lymphocytes , spleen cells or testis-derived cells, may be used.
As used herein, the term "isolated" means that naturally accompanying material is at least reduced, or preferably substantially completely eliminated, in normal circumstances. Therefore, the term "isolated cell" refers to a cell substantially free from other accompanying substances (e.g. , othercells, proteins, nucleicacids, etc. ) in natural circumstances. The term "isolated177 in relation to nucleic acids or polypeptides means that, for example, the nucleic acids or the polypeptides are substantially free from cellular substances or culture media when they are produced by recombinant DNA techniques; or precursory chemical substances or other chemical substances when they are chemically synthesized. Isolated nucleic acids are preferablyfreefromsequences naturallyflankingthenucleic acidwithin an organism fromwhich the nucleic acid is derived (i.e., sequences positioned at the 5' terminus and the 3' terminus of the nucleic acid) .
As used herein, the term "established" in relation to cells refers to a state of a cell in which a particular property (pluripotency) of the cell is maintained and the cellundergoes stable proliferation underculture conditions .
Therefore, established stem cells maintain pluripotency.
As usedherein, the term "differentiatedcell" refers to a cell having a specialized function and form (e.g. , muscle cells, neurons, etc.). Unlike stem cells, differentiated cells have no or little pluripotency. Examples of differentiated cells include epidermic cells, pancreatic parenchymal cells, pancreatic duct cells, hepatic cells, blood cells , cardiac muscle cells , skeletal muscle cells , osteoblasts, skeletal myoblasts, neurons, vascular endothelial cells, pigment cells, smooth muscle cells, fat cells, bone cells , cartilage cells , and the like. As usedherein, the term "state" refers to acondition concerning various parameters of a cell (e.g., cell cycle, response to an external factor, signal transduction, gene expression, gene transcription, etc.). Examples of such a state include, but are not limited to, dif erentiated states , undifferentiated states, responses to external factors, cell cycles, growth states, and the like. As used herein, the term "gene state" refers to any state associated with a gene (e.g., an expression state, a transcription state, etc.).
As used herein, the terms "differentiation" or "cell differentiation" refers to a phenomenon where two or more types of cells having qualitative differences in form and/or function occur in a daughter cell population derived from the division of a single cell. Therefore, "differentiation" includes a process during which a population (family tree) of cells , which do not originally have a specific detectable feature, acquire a feature, such as production of a specific protein, or the like. At present, cell differentiation is generally considered to be a state of a cell in which a specific group of genes in the genome are expressed. Cell differentiation can be identified by searching for intracellular or extracellular agents or conditions which elicit the above-described state of gene expression. Differentiated cells are stable in principle. Particularly, animal cells which have been once differentiated are rarely differentiated into other types of cells .
As used herein, the term "pluripotency" refers to a nature of a cell, i.e., an ability to differentiate into one or more, preferably two or more, tissues or organs. Therefore, the terms "pluripotent" and "undifferentiated" are herein used interchangeably unless otherwise mentioned. Typically, the pluripotency of a cell is limited during development, and in an adult, cells constituting a tissue or organ rarely alter to different cells , that is , the pluripotency is usually lost. Particularly, epithelial cells resist altering to other types of epithelial cells. Suchalteration typicallyoccurs inpathological conditions , and is called metaplasia. However, mesenchymal cells tend to easily undergo metaplasia, i.e., alter to other mesenchymal cells, with relatively simple stimuli. Therefore, mesenchymal cells have a high level of pluripotency. Embryonic stem cells have pluripotency. Tissue stem cells have pluripotency. Thus, the term "pluripotency" may include the concept of totipotency. An example of an in vi tro assay for determining whether or not a cell has pluripotency, includes, but is not limited to, culturing under conditions for inducing the formation and differentiation of embryoid bodies. Examples of an in vivo assayfor determining the presence orabsence of pluripotency, include, but are not limited to, implantation of a cell into an immunodeficient mouse so as to form teratoma, injection of a cell into a blastocyst so as to form a chimeric embryo, implantation of a cell into a tissue of an organism (e.g., injection of a cell into ascites) so as to undergo proliferation, and the like. As used herein, one type of pluripotency is "totipotency", which refers to an ability to be differentiated into all kinds of cells which constitute an organism. The idea of pluripotency encompasses totipotency. An example of a totipotent cell is a fertilized ovum. An ability to be differentiated into only one type of cell is called "unipotency" .
(Biochemistry and Molecular Biology)
As used herein, the term "gene" refers to an element defining a genetic trait. A gene is typically arranged in a given sequence on a chromosome. A gene which defines the primary structure of a protein is called a structural gene. A gene which regulates the expression of a structural gene is called a regulatory gene (e.g. , promoter) . Genes herein include structural genes and regulatory genes unless otherwise specified. Therefore, the term "cyclin gene" typically includes the structural gene of cyclin and the promoter of cyclin. As used herein, "gene® may refer to "polynucleotide", "oligonucleotide", "nucleic acid", and "nucleic acid molecule" and/or "protein", "polypeptide", "oligopeptide" and "peptide". As used herein, "gene product" includes "polynucleotide", "oligonucleotide", "nucleic acid" and "nucleic acidmolecule" and/or "protein" , "polypeptide", "oligopeptide" and "peptide", which are expressed by a gene. Those skilled in the art understand what a gene product is , according to the context .
As used herein, the term "homology" in relation to a sequence (e.g., a nucleic acid sequence, an amino acid sequence, etc. ) refers to the proportion of identity between two or more gene sequences. Therefore, the greater the homology between two given genes , the greater the identity or similarity between their sequences . Whether or not two genes have homology is determined by comparing their sequences directly or by a hybridization method under stringent conditions . When two gene sequences are directly compared with each other, these genes have homology if the
DNA sequences of the genes have representatively at least 50% identity, preferably at least 70% identity, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity with each other. As used herein, the term
"similarity" in relation to a sequence (e.g. , a nucleic acid sequence, an amino acid sequence, or the like) refers to the proportion of identity between two or more sequences when conservative substitution is regarded as positive (identical) in the above-described homology. Therefore, homologyand similaritydiffer romeachother in thepresence of conservative substitutions. If no conservative substitutions are present, homology and similarity have the same value.
The terms "protein" , "polypeptide", "oligopeptide" and "peptide" as used herein have the same meaning and refer to an amino acid polymer having any length. This polymer may be a straight, branched or cyclic chain. An amino acid maybe a naturally-occurring ornonnaturally-occurring amino acid, or a variant amino acid. The term may include those assembled into a composite of a plurality of polypeptide chains. The term also includes a naturally-occurring or artificially modified amino acid polymer. Such modification includes, forexample, disulfide bondformation, glycosylation, lipidation, acetylation, phosphorylation, or any othermanipulation ormodification (e.g., conjugation with a labeling moiety) . This definition encompasses a polypeptide containing at least one amino acid analog (e.g. , nonnaturally-occurring amino acid, etc.), a peptide-like compound (e.g., peptoid) , and other variants known in the art, for example. Gene products, such as extracellular matrix proteins (e.g., fibronectin, etc.), are usually in the form of polypeptide.
The terms "polynucleotide" , "oligonucleotide",
"nucleic acid molecule" and "nucleic acid" as used herein have the same meaning andref r to a nucleotide polymer having any length. This term also includes an "oligonucleotide derivative" or a "polynucleotide derivative". An "oligonucleotide derivative" or a "polynucleotide derivative" includes a nucleotide derivative, or refers to an oligonucleotide or a polynucleotide having different linkages between nucleotides from typical linkages, which are interchangeably used. Examples of • such an oligonucleotide specifically include
2 ' -O-methyl-ribonucleotide, an oligonucleotide derivative in which a phosphodiester bond in an oligonucleotide is converted to a phosphorothioate bond, an oligonucleotide derivative in which a phosphodiester bond in an oligonucleotide is converted to a N3 ' -P5 ' phosphoroamidate bond, an oligonucleotide derivative in which a ribose and a phosphodiester bond in an oligonucleotide are converted toapeptide-nucleicacidbond, an oligonucleotide derivative in which uracil in an oligonucleotide is substituted with C-5 propynyl uracil, an oligonucleotide derivative in which uracil in an oligonucleotide is substitutedwith C-5 thiazole uracil, an oligonucleotide derivative in which cytosine in an oligonucleotide is substitutedwith C-5 propynylcytosine, an oligonucleotide derivative in which cytosine in an oligonucleotide is substituted with phenoxazine-modified cytosine, an oligonucleotide derivative in which ribose in DNA is substituted with 2 ' -O-propyl ribose, and an oligonucleotide derivative in which ribose in an oligonucleotide is substitutedwith 2 ' -methoxyethoxy ribose. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively-modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions mayfoe producedby generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Bat er et al.. Nucleic Acid Res. 19:5081(1991); Ohtsuka et al. , J. Biol. Chem.260:2605-2608 (1985) ; Rossolini et al. , Mol. Cell. Probes 8:91-98(1994) ) . A gene encoding an extracellular matrix protein (e.g., fibronectin, etc. ) or the like is usually in the form of polynucleotide. A molecule to be transfected is in the form of polynucleotide.
As used herein, the term "corresponding" amino acid or nucleic acid refers to an amino acid or nucleotide in a given polypeptide or polynucleotide molecule, which has, or is anticipated to have, a function similar to that of a predetermined amino acid or nucleotide in a polypeptide or polynucleotide as a reference for comparison. Particularly, in the case of enzymemolecules , the termrefers to an amino acid which is present at a similar position in an active site and similarly contributes to catalytic activity. For example, in the case of antisense molecules for a certain polynucleotide, the term refers to a similar portion in an ortholog corresponding to a particular portion of the antisense molecule.
As used herein, the term "corresponding" gene (e.g. , a polypeptide or polynucleotide molecule) refers to a gene in a given species, which has, or is anticipated to have, a function similar to that of apredetermined gene in a species as a reference for comparison. When there are a plurality of genes having such a function, the term refers to a gene having the same evolutionary origin. Therefore, a gene corresponding to a given gene may be an ortholog of the given gene. Therefore, genes corresponding to mouse cyclin genes can be found in other animals . Such a corresponding gene can be identified by techniques well known in the art. Therefore, for exampl , acorresponding gene in agiven animal can be found by searching a sequence database of the animal (e.g., human, rat) using the sequence of a reference gene (e.g., mouse cyclin gene, etc.) as a query sequence.
As used herein, the term "fragment" with respect to a polypeptide or polynucleotide refer to a polypeptide or polynucleotide having a sequence length ranging from 1 to n-l with respect to the full length of the reference polypeptide or polynucleotide (of length n) . The length of the fragment can be appropriately changed depending on the purpose. For example, in the case of polypeptides, the lower limit of the length of the fragment includes 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50 or more nucleotides. Lengths represented by integers which are not herein specified (e.g., 11 and the like) may be appropriate as a lower limit. For example, in the case of polynucleotides, the lower limit of the length of the fragment includes 5 , 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100 ormorenucleotides . Lengths represented by integers which are not herein specified (e.g., 11 and the like) may be appropriate as a lower limit. As used herein, the length of polypeptides or polynucleotides can be represented by the number of amino acids or nucleic acids, respectively. However, the above-described numbers are not absolute. The above-described numbers as the upper or lower limit are intended to include some greater or smaller numbers (e.g., ±10%) , as long as the same function is maintained. For this purpose, "about" may be herein put ahead of the numbers. However, it should be understood that the interpretation of numbers is not affected by the presence or absence of "about" in the present specification. As usedherein, the term "biological activity" refers to activity possessed by an agent (e.g. , a polynucleotide, a protein, etc.) within an organism, including activities exhibitingvarious functions (e.g., transcription promoting activity, etc.). For example, when a certain factor is an enzyme, the biological activity thereof includes its enzyme activity. In another example, when a certain factor is a ligand, the biological activity thereof includes the binding of the ligand to a receptor corresponding thereto. The above-described biological activity can be measured by techniques well-known in the art.
As used herein, the term "polynucleotides hybridizingunder stringent conditions" refers to conditions commonly used and well known in the art . Such a polynucleotide can be obtained by conducting colony hybridization, plaque hybridization. Southern blot hybridization, or the like using a polynucleotide selected from the polynucleotides of the present invention. Specifically, a filter on which DNA derived from a colony or plaque is immobilized is used to conduct hybridization at 65°C in the presence of 0.7 to 1.0 M NaCl. Thereafter, a 0.1 to 2-fold concentration SSC ( saline-sodium citrate) solution (1-fold concentration SSC solution is composed of 150 mM sodium chloride and 15 mM sodium citrate) is used to wash the filter at 65°C. Polynucleotides identified by this method are referred to as "polynucleotides hybridizing under stringent conditions". Hybridization can be conducted in accordance with a method described in, for example. Molecular Cloning 2nd ed., Current Protocols in Molecular Biology, Supplement 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford University Press (1995), and the like. Here, sequences hybridizing under stringent conditions exclude, preferably, sequences containing only A or T. "Hybridizable polynucleotide" refers to a polynucleotide which can hybridize other polynucleotides under the above-described hybridization conditions. Specifically, the hybridizable polynucleotide includes at least a polynucleotide having a homology of at least 60% to the base sequence of DNA encoding a polypeptide having an amino acid sequence specifically herein disclosed, preferably a polynucleotide having a homologyof at least 80%, andmorepreferablyapolynucleotide having a homology of at least 95%.
As used herein, the term "salt" has the same meaning as that commonly understood by those skilled in the art, including both inorganic and organic salts. Salts are typically generated by neutralizing reactions between acids and bases. Salts include NaCl, K2S04, and the like, which are generatedby neutralization, andin addition, PbS04, ZnCl2, and the like , which are generated by reactions between metals and acids. The latter salts may not be generated directly by neutralizing reactions, but may be regarded as a product of neutralizing reactions between acids and bases. Salts may be divided into the following categories: normal salts (salts without any H of acids or without any OH of bases, including, for example, NaCl, NH4C1, CH3C00Na, and Na2C03), acid salts (salts with remaining H of acids, including, for example, NaHC03, KHS04, and CaHP04), and basic salts (salts with remaining OH of bases, including, for example, MgCl(OH) and CuCl(OH)). This classification is not very important in the present invention. Examples of preferable salts include salts constituting medium (e.g. , calcium chloride, sodiumhydrogenphosphate, sodiumhydrogen carbonate, sodium pyruvate, HEPES, sodium chloride, potassium chloride, magnesiumsulfide, ironnitrate, amino acids, vitamins, etc. ) , salts constitutingbuffer (e.g. , calciumchloride, magnesium chloride, sodiumhydrogenphosphate, sodiumchloride, etc. ) , and the like. These salts are preferable as they have a high affinity for cells and thus are better able to maintain cells in cultur . These salts maybe used singlyor in combination. Preferably, these salts may be used in combination. This is because a combination of salts tends to have a higher affinity for cells . Therefore, a plurality of salts (e.g., calcium chloride, magnesium chloride, sodium hydrogen phosphate, and sodium chloride) are preferably contained inmedium, rather than onlyNaCl or the like . More preferably, all salts for cell culture medium may be added to the medium. In another preferred embodiment, glucose may be added to medium.
As usedherein, the term "probe" refers to a substance foruse in searching, whichis usedinabiological experiment , suchas in vi troand/or in vivoscreening orthe like, including, but not being limited to, for example, a nucleic acidmolecule having a specific base sequence or a peptide containing a specific amino acid sequence.
Examples of a nucleic acid molecule as a common probe include one having a nucleic acid sequence having a length of at least 8 contiguous nucleotides , which is homologous or complementary to the nucleic acid sequence of a gene of interest. Such a nucleic acid sequence may be preferably anucleicacidsequencehavingalengthof at least 9 contiguous nucleotides, more preferably a length of at least 10 contiguous nucleotides, and even more preferably a length of at least 11 contiguous nucleotides, a length of at least 12 contiguous nucleotides, a length of at least 13 contiguous nucleotides, a length of at least 14 contiguous nucleotides, a length of at least 15 contiguous nucleotides, a length of at least 20 contiguous nucleotides, a length of at least 25 contiguous nucleotides, a length of at least 30 contiguous nucleotides, a length of at least 40 contiguous nucleotides, or a length of at least 50 contiguous nucleotides . A nucleic acid sequence used as a probe includes a nucleic acid sequence having at least 70% homology to the above-described sequence, more preferably at least 80%, and even more preferably at least 90% or at least 95%.
As used herein, the term "search" indicates that a given nucleic acid sequence is utilized to find other nucleic acid base sequences having a specific function and/or property either electronically or biologically, or using other methods. Examples of an electronic search include, but are not limited to, BLAST (Altschul et al. , J. Mol. Biol. 215:403-410 (1990)), FASTA (Pearson & Lipman, Proc. Natl. Acad. Sci., USA 85:2444-2448 (1988)), Smith and Waterman method (Smith andWaterman, J. Mol. Biol.147:195-197 (1981)), and Needleman and Wunsch method (Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970)), and the like. Examples of a biological search include, but are not limited to, a macroarray inwhich genomic DNAis attachedto a nylonmembrane or the like or a microarray (microassay) in which genomic DNAis attachedto a glass plate under stringent hybridization, PCR and in situ hybridization, and the like.
As used herein, the term "primer" refers to a substance required for initiation of a reaction of a macromolecule compound to be synthesized, in a macromolecule synthesis enzymatic reaction. In a reaction for synthesizing anucleic acidmolecule, anucleic acidmolecule
(e.g. , DNA, RNA, or the like) which is complementary to part of a macromolecule compound to be synthesized may be used.
A nucleic acid molecule which is ordinarily used as a primer includes one that has a nucleic acid sequence having a length of at least 8 contiguous nucleotides, which is complementary to the nucleic acid sequence of a gene of interest . Such a nucleic acid sequence pref rably has a length of at least 9 contiguous nucleotides, more preferably a length of at least 10 contiguous nucleotides, even more preferably a length of at least 11 contiguous nucleotides, a length of at least 12 contiguous nucleotides, a length of at least 13 contiguous nucleotides, a length of at least 14 contiguous nucleotides, a length of at least 15 contiguous nucleotides, a length of at least 16 contiguous nucleotides, a length of at least 17 contiguous nucleotides, a length of at least 18 contiguous nucleotides, a length of at least 19 contiguous nucleotides, a length of at least 20 contiguous nucleotides, a length of at least 25 contiguous nucleotides, a length of at least 30 contiguous nucleotides, a length of at least 40 contiguous nucleotides, and a length of at least 50 contiguous nucleotides. A nucleic acid sequence used as a primer includes a nucleic acid sequence having at least 70% homology to the above-described sequence, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%. An appropriate sequence as a primer may vary depending on the property of the sequence to be synthesized (amplified) . Those skilled in the art can design an appropriate primer depending on the sequence of interest. Such primer design is well known in the art and may be performed manually or using a computer program (e.g. , LASERGENE, Primer Select, DNAStar) . As used herein, the term "epitope" refers to an antigenic determinant. Therefore, the term "epitope" includes a set of amino acid residues which is involved in recognition by a particular immunoglobulin, or in the context of T cells, those residues necessary for recognition by the T cell receptor proteins and/or Major Histocompatibility Complex (MHC) receptors. This term is also used interchangeably with "antigenic determinant" or "antigenic determinant site" . In the field of immunology, in vivo or in vitro, an epitope is the features of a molecule (e.g., primary, secondary and tertiary peptide structure, and charge) that form a site recognized by an immunoglobulin, T cell receptor or HLA molecule. An epitope including a peptide comprises 3 or more amino acids in a spatial conformation which is unique to the epitope. Generally, an epitope consists of at least 5 such amino acids, and more ordinarily, consists of at least 6, 7, 8, 9 or 10 such amino acids. The greater the length of an epitope, the more the similarity of the epitope to the original peptide, i.e., longer epitopes are generally preferable. This is not necessarily the case when the conformation is taken into account . Methods of determining the spatial conformation of amino acids are known in the art , and include, for example, X-ray crystallography and 2-dimensional nuclear magnetic resonance spectroscopy. Furthermore, the identification of epitopes in a given protein is readily accomplished using techniques well known in the art. See, also, Geysen et al., Proc. Natl. Acad. Sci. USA (1984) 81: 3998 (general method of rapidly synthesizing peptides to determine the location of immunogenic epitopes in a given antigen); U. S. Patent No. 4,708,871 (procedures for identifying and chemically synthesizing epitopes of antigens); and Geysen et al.. Molecular immunology (1986) 23: 709 (technique for identifying peptides with high affinity for a given antibody) . Antibodies that recognize the same epitope can be identified in a simple immunoassay. Thus, methods for determining epitopes including a peptide are well known in the art . Such an epitope can be determined using a well-known, common technique by those skilled in the art if the primary nucleic acid or aiαino acid sequence of the epitope is provided.
Therefore, an epitope including a peptide requires a sequencehavingalengthof at least 3 amino acids , preferably at least 4 amino acids, more preferably at least 5 amino acids, at least 6 amino acids, at least 7 amino acids, at least 8 amino acids, at least 9 amino acids, at least 10 amino acids, at least 15 amino acids, at least 20 amino acids, and 25 amino acids . Epitopes maybe linear or conformational .
As used herein, the term "agent binding specifically to" a certain nucleic acid molecule or polypeptide refers to an agent which has a level of binding to the nucleic acid molecule or polypeptide equal to or higher than a level of binding to other nucleic acid molecules or polypeptides . Examples of such an agent include, but are not limited to, when a target is a nucleic acid molecule, a nucleic acid molecule having a complementary sequence of a nucleic acid molecule of interest, a polypeptide capable of binding to a nucleic acid sequence of interest (e.g., a transcription agent , etc . ) , and the like, andwhen a target is a polypeptide, an antibody, a single chain antibody, either of a pair of a receptor and a ligand, either of a pair of an enzyme and a substrate, and the like.
As used herein, the term "antibody" encompasses polyclonal antibodies, monoclonal antibodies, human antibodies , humanized antibodies , polyf nctional antibodies, chimeric antibodies, and anti-idiotype antibodies, and fragments thereof (e.g., F(abr)2 and Fab fragments), and other recombinant conjugates. These antibodies may be fused with an enzyme (e.g., alkaline phosphatase, horseradish peroxidase, α-galactosidase, and the like) via a covalent bond or by recombination.
Asusedherein, the term "monoclonal antibody" refers to an antibody composition having a group of homologous antibodies . Thistermisnot limitedbytheproductionmanner thereof. This term encompasses all immunoglobulin molecules andFabmolecules , F(ab ' ) 2 fragments , Fv ragments , and other molecules having an immunological binding property of the original monoclonal antibody molecule. Methods for producing polyclonal antibodies and monoclonal antibodies are well known in the art, and will be more sufficiently described below.
Monoclonal antibodies are prepared by using the standard technique well known in the art (e.g. , Kohler and Milstein, Nature (1975) 256:495) or a modification thereof (e.g. , Bucket al. (1982) InVitro 18:377) . Representatively, a mouse or rat is immunized with a protein bound to a protein carrier, and boosted. Subsequently, the spleen (and optionally several large lymph nodes) is removed and dissociated into a single cell suspension. If desired, the spleen cells may be screened (after removal of nonspecifically adherent cells) by applying the cell suspension to a plate or well coated with a protein antigen. B-cells that express membrane-bound immunoglobulin speci ic for the antigen bind to the plate, and are not rinsed away with the rest of the suspension. Resulting B-cells, or all dissociated spleen cells, are then induced to fuse with myeloma cells to form hybridomas . The hybridomas are used to produce monoclonal antibodies .
As used herein, the term "antigen" refers to any substrate to which an antibody molecule may specifically bind. As used herein, the term "immunogen" refers to an antigen capable of initiating activation of the antigen-specific immune response of a lymphocyte.
In a given protein molecule, a given amino acid may be substituted with another amino acid in a structurally important region, such as a cationic region or a substrate molecule binding site, without a clear reduction or loss of interactive binding ability. A given biological function of a protein is defined by the interactive ability or other property of the protein . Therefore, a particular amino acid substitution may be performed in an amino acid sequence, or at the DNA sequence level, to produce a protein which maintains the original property after the substitution. Therefore, various modifications of peptides as disclosed herein and DNA encoding such peptides maybe performedwithout clear losses of biological activity.
When the above-described modifications are designed, the hydrophobicity indices of amino acids may be taken into consideration. The hydrophobic amino acid indices play an important role in providing a protein with an interactive biological function, which is generally recognized in the art (Kyte, J. and Doolittle, R.F., J. Mol. Biol. 157( 1 ): 105-132, 1982). The hydrophobic property of an amino acid contributes to the secondary structure of a protein and then regulates interactions between the protein and other molecules (e.g., enzymes, substrates, receptors, DNA, antibodies, antigens, etc.). Each amino acid is given a hydrophobicity index based on the hydrophobicity and charge properties thereof as follows: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine ( +1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamic acid (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
It is well known that if a given amino acid is substituted with another amino acid having a similar hydrophobicity index, the resultant protein may still have a biological function similar to that of the original protein (e.g. , a protein having an equivalent enzymatic activity) . For such an amino acid substitution, the hydrophobicity index is pre erably within ±2 , more preferably within ±1 , and even more preferably within ±0.5. It is understood in the art that such an amino acid substitution based on hydrophobicity is e ficient . As described in US Patent No. 4, 554, 101, amino acidresidues are given the followinghydrophilicityindices arginine (+3.0); lysine (+3.0); aspartic acid (+3.0±1) glutamic acid (+3.0±1); serine (+0.3); asparagine (+0.2) glutamine (+0.2); glycine (0); threonine (-0.4); proline ( -0.5±1) ; alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4) . It is understood that an amino acid may be substituted with another amino acid which has a similar hydrophilicity index and can still provide a biological equivalent. For such an amino acid substitution, the hydrophilicityindex is preferablywithin ±2 , more preferably ± 1 , and even more preferably ±0.5.
(Profile and its relevant techniques) As used herein, the term "profile" in relation to a cell refers to a set of measurements of the biological state of the cell. Particularly, the term "profile of a cell" refers to a set of discrete or continuous values obtained by quantitativelymeasuring a level of a "cellular component" . A level of a cellular component includes the expression level of a gene, the transcription level of a gene (the activity level of a transcription control sequence), the amount of mRNA encoding a specific gene, and the expression level of a protein in biological systems. The level of each cellular component, such as the expression level of mRNA and/orprotein, is known to be altered in response to treatment with drugs or cellular biological perturbation or vibration. Therefore, the measurement of a plurality of "cellular components" generates a large amount of information about the effects of stimuli on the biological states of cells. Therefore, the profile is more and more important in analysis of cells. Mammalian cells contain about 30,000 or more cellular components. Therefore, the profile of an individual cell is usually complicated. A profile in a predetermined state of a biological system may often be measured after stimulating the biological system. Such stimulation is performedunder experimental orenvironmental conditions associated with the biological system. Examples of a stimulus include exposure of a biological system to a drug candidate, introduction of an exogenous gene, passage of time, deletion of a gene from the system, alteration of culture conditions, and the like. The wide rangemeasurement of cellular components (i.e., profiles of gene replication or transcription, protein expression, and response to stimuli) has a high level of utility including comparison and investigation of the effects of drugs, diagnosis of diseases , andoptimization of drugadministration topatients as well as investigation of cells. Further, profiles are useful for basic life science research.
As used herein, the term "time-lapse profile" in relation to a certain cell refers to a profile which indicates time-lapse changes in a parameter relating to the cell. Examples of a time-lapse profile include, but are not limited to, a time-lapse profile of transcription level, a time-lapse profileof expression level (translation level) , atime-lapse profile of signal transduction, a time-lapse profile of neural potential, and the like. A time-lapse profile may be produced by continuously recording a certain parameter (e.g., a signal caused by a label associated with a transcription level). Time-lapse measurement may mean continuous measurement. Therefore, the term "time-lapse profile" as used herein may also be referred to as "continuous profile" .
As used herein, the term "transcription control sequence" refers to a sequence which can regulate the transcription level of a gene. Such a sequence has at least two nucleotides in length. Examples of such a sequence include, but are not limited to, promoters, enhancers, silencers, terminators, sequences flanking other genome structural genes , genomic sequences other than exons , sequences within exons, and the like. A transcription control sequence used herein is not related to particular types . Rather, important information about a transcription control sequence is time-lapse fluctuation. Such fluctuation is referred to as a process (changes in a state of a cell ) . Therefore , such atranscription control sequence may be herein arbitrarily selected. Such a transcription control sequence may include those which are not conventionally used as markers. Preferably, a transcription control sequence has an ability to bind to a transcription factor.
As used herein, the term "transcription factor" refers to a factor which regulates the process of transcription of a gene. The term "transcription factor" mainly indicates a factor which regulates a transcription initiating reaction. Transcription factors are roughly divided into the following groups: basic transcription factors required forplacing an RNA polymerase into a promoter region on DNA; and transcription regulatory factors which bind to cis-acting elements present upstream or downstream of a transcription region to regulate the synthesis initiation frequency of RNA.
Basic transcription factors are prepared depending on the type of RNA polymerase. A TATA-binding protein is believed to be common to all transcription systems . Although there are a number of types of transcription factors , a typical transcription factor consists of a portion structurally required for binding to DNA and a portion required for activating or suppressing transcription. Factors which have a DNA-binding portion and can bind to σis-acting elements are collectively referred to as trans-acting factors.
A portion required for activating or suppressing transcription is involved in interaction with other transcription ctors or basic transcription factors . Such a portion is believed to play a role in regulating transcription via a structural change in DNA or a transcription initiating complex. Transcription regulatory factors are divided into several groups or families accordingto structuralproperties of theseportions, including factors which play an important role in the development or differentiation of a cell.
Examples of such a transcription factor include, but are not limited to, STAT1, STAT2, STAT3, GAS, NFAT, Myc,
API, CREB, NFKB, E2F, Rb, p53, RUNX1 , RUNX2 , RUNX3 , Nkx-2,
CF2-II, Skn-1, SRY, HFH-2, Oct-1, Oct-3, Sox-5, HNF-3b, PPARγ, and the like .
As used herein, the term "terminator" refers to a sequence which is located downstream of a protein-encoding region of a gene and which is involved in the termination of transcription when DNA is transcribed into mRNA, and the addition of a poly-A sequence . It is known that a terminator contributes to the stability of mRNA, and has an influence on the amount of gene expression.
As used herein, the term "promoter" refers to a base sequence which determines the initiation site of transcription of a gene and is a DNA region which directly regulates the frequency of transcription. Transcription is started by RNA polymerase binding to a promoter. A promoter region is usually located within about 2 kbp upstream of the first exon of aputativeprotein codingregion . Therefore, it is possible to estimate a promoter region by predicting a protein coding region in a genomic base sequence using DNA analysis software . Aputative promoter region is usually located upstream of a structural gene, but depending on the structural gene, i.e., a putative promoter region may be located downstream of a structural gene. Preferably, a putative promoter region is located within about 2 kbp upstream of the translation initiation site of the first
As used herein, the term "enhancer" refers to a sequence which is used so as to enhance the expression efficiency of a gene of interest. One or more enhancers may be used, or no enhancer may be used.
As used herein, the term "silencer" refers to a sequence which has a function of suppressing and arresting the expression of a gene. Any silencer which has such a function may be herein used. No silencer may be used.
As used herein, the term "operably linked" indicates that a desired sequence is located such that expression (operation) thereof is under control of a transcription and translation regulatory sequence (e.g., a promoter, an enhancer, and the like) or a translation regulatory sequence. In order for a promoter to be operably linked to a gene, typically, the promoter is located immediately upstream of the gene. A promoter is not necessarily adjacent to a structural gene.
Sequences flanking other genome structural genes, genomic sequences other than exons, and sequences within exons may also be herein used. For example, in addition to the above-described sequences having specific names, structural gene-flanking sequences are well expected to be involved in the control of transcription in terms of "processes" . Therefore, such flanking sequences are also included in transcription control sequences . Genomic sequences other than exons and sequences within exons are also expected to be involved in the control of transcription in terms of "processes" . Therefore, genomic sequences other than exons and sequences within exons are also included in transcription control sequences .
As used herein, the term "RNAi" is an abbreviation of RNA interference and refers to a phenomenon where an agent for causing RNAi, such as double-stranded RNA (also called dsRNA) , is introduced into cells and mRNA homologous thereto is specifically degraded, so that synthesis of gene products is suppressed, and a technique using the phenomenon . As used herein, RNAi may have the same meaning as that of an agent which causes RNAi.
As used herein, the term "an agent causing RNAi" refers to any agent capable of causing RNAi. As used herein, "an agent causing RNAi of a gene" indicates that the agent causes RNAi relating to the gene and the effect of RNAi is achieved (e.g., suppression of expression of the gene, and the like) . Examples of such an agent causing RNAi include, but are not limited to, a sequence having at least about 70% homology to the nucleic acid sequence of a target gene or a sequence hybridizable under stringent conditions, RNA containing a double-stranded portion having a length of at least 10 nucleotides or variants thereof. Here, this agent may be preferably DNA containing a 3' protruding end, and more preferably the 3 ' protruding end has a length of 2 or more nucleotides (e.g., 2-4 nucleotides in length).
Though not wishing to be bound by any theory, a mechanism which causes RNAi is considered to be as follows . When amoleculewhichcauses RNAi, suchasdsRNA, is introduced into a cell, an RNaselll-like nuclease having a helicase domain (called dicer) cleaves the molecule on about a 20 base pair basis from the 3 ' terminus in the presence of ATP in the case where the RNA is relatively long (e.g., 40 or more base pairs). As used herein, the term "siRNA" is an abbreviation of short interfering RNA and refers to short double-stranded RNA of 10 or more base pairs which are artificially chemically synthesized or biochemically synthesized, synthesized in the organism body, or produced by double-stranded RNA of about 40 or more base pairs being degraded within the organism. siRNA typically has a structure having 5 ' -phosphate and 3' -OH, where the 3' terminus projects by about 2 bases. A specific protein is boundto siRNAto formRISC (RNA-induced-silencing-σomplex) . This complex recognizes and binds to mRNA having the same sequence as that of siRNA and cleaves mRNA at the middle of siRNA due to RNaselll-like enzymatic activity. It is preferable that the relationship between the sequence of siRNA and the sequence of mRNA to be cleaved as a target is a 100% match. However, base mutations at a site away from the middle of siRNA do not completely remove the cleavage activity by RNAi, leaving partial activity, while base mutations in the middle of siRNA have a large influence and the mRNA cleavage activity by RNAi is considerably lowered. By utilizing such a nature, only mRNA having a mutation can be specifically degraded. Specifically, siRNA in which the mutation is provided in the middle thereof is synthesized and is introduced into a cell. Therefore, in the present invention, siRNAper seaswell as an agent capable ofproducing siRNA (e.g. , representatively dsRNA of about 40 or more base pairs) can be used as an agent capable of eliciting RNAi. Also, though not wishing to be bound by any theory, apart from the above-described pathway, the antisense strand of siRNA binds to mRNA and siRNA functions as a primer for RNA-dependent RNA polymerase (RdRP), so that dsRNA is synthesized. This dsRNA is a substrate for a dicer again, leading to production of new siRNA. It is intended that such an action is amplified. Therefore, in thepresent invention, siRNA per se as well as an agent capable of producing siRNA are useful. In fact, in insects and the like, for example, 35 dsRNAmolecules can substantiallycompletelydegrade 1 , 000 or more copies of intracellular mRNA, and there ore, it will be understood that siRNA per se as well as an agent capable of producing siRNA are useful .
In the present invention, double-strandedRNAhaving a length of about 20 bases (e.g., representatively about 21 to 23 bases) or less than about 20 bases, which is called siRNA, can be used. Expression of siRNA in cells can suppress expression of a pathogenic gene targeted by the siRNA. Therefore, siRNA can be used for treatment, prophylaxis, prognosis, and the like of diseases.
The siRNA of the present invention may be in any orm as long as it can elicit RNAi.
In another embodiment, an agent capable of causing RNAimayhave a short hairpin structurehaving a stickyportion at the 3 ' terminus (shRNA; short hairpin RNA) . As used herein, the term "shRNA" refers to a molecule of about 20 or more base pairs in which a single- tranded RNA partially contains a palindromic base sequence and forms a double-strand structure therein (i.e., a hairpin structure). shRNA can be artificially chemically synthesized. Alternatively, shRNA can be produced by linking sense and antisense strands of a DNA sequence in reverse directions and synthesizing RNA in vi tro ith in RNApolymerase using the DNA as a template. Though not wishing to be bound by any theory, it should be understood that after shRNA is introduced into a cell, the shRNA is degraded in the cell into a length of about 20 bases (e.g., representatively 21, 22, 23 bases), and causes RNAi as with siRNA, leading to the treatment eff ct of the present invention. It should be understood that such an effect is exhibited in a wide range of organisms, such as insects, plants, animals (including mammals), and the like. Thus, shRNA elicits RNAi as with siRNA and therefore can be used as an effective component of the present invention . shRNA may preferably have a 3' protruding end. The length of the double-stranded portion is not particularly limited, but is preferably about 10 or more nucleotides, and more preferably about 20 or more nucleotides. Here, the 3' protruding end may be preferably DNA, more preferably DNA of at least 2 nucleotides in length, and even more preferably DNA of 2-4 nucleotides in length.
An agent capable of causing RNAi used in the present invention may be artificially synthesized (chemically or biochemically) or naturally occurring. There is substantially no difference therebetween in terms of the effect of the present invention. A chemically synthesized agent is preferably purified by liquid chromatography or the like .
An agent capable of causing RNAi used in the present invention canbeproduced in vi tro . In this synthesis system, T7 RNA polymerase and T7 promoter are used to synthesize antisense and sense RNAs from template DNA. These RNAs are annealed and thereafter are introduced into a cell. In this case, RNAi is caused via the above- escribed mechanism, thereby achieving the effect of the present inventio . Here , for example, the introduction of RNA into cell can be carried out by a calcium phosphate method.
Another example of an agent capable of causing RNAi according to the present invention is a single-stranded nucleic acid hybridizable to mRNA or all nucleic acid analogs thereof. Such agents are useful for the method and composition of the present invention.
As usedherein, the term "time-lapse" means anyaction or phenomenon that is related to the passage of time.
As used herein, the term "monitor" refers to measurement of a state of a cell using at least one parameter as measure (e.g., a label signal attributed to transcription, etc. ) . Preferably, monitoring is performed using a device, such as a detector, a measuring instrument, or the like. More preferably, such a device is connected to a computer for recording and/or processing data. Monitoring may comprise the step of obtaining the image data of a solid phase support (e.g., an array, a plate, etc.).
As used herein, the term "real time" means that a certain state is substantially simultaneously displayed in another form (e.g. , as an image on a display or a graph with processed data) . In such a case, the "real time" lags behind an actual event by the time required for data processing. Such a time lag is included in the the scope of "real time" if it is substantially negligible. Such a time lag may be typicallywithin 10 seconds, andpreferablywithin 1 second. without limitation. A time lag exceeding 10 seconds may be included in the scope of "real time" .
As used herein, the determination of a state of a cell can be performed using various method . Examples of such methods include, but are not limited to, mathematical processing (e.g. , signal processing, multivariate analysis, etc.), empirical processing, phase changes, and the like.
As used herein, the term "difference" refers to a result of mathematical processing inwhich avalue of acontrol profile (e.g., without a stimulus) is subtracted from a certain profile.
As used herein, the term "phase" in relation to a time-lapse profile refers to a result of determination of whether the profile is positive or negative with respect to a reference point (typically 0) , which is expressed with + or - , and also refers to analysis based on such a result .
As used herein, the term "correlate" in relation to a profile (e.g., a time-lapse profile, etc.) and a state of a cell refers to an act of associating the profile or particular information about changes with the state of the cell. A relationship between them is referred to as "correlation" or "correlation relationship" . Conventionally, it was substantially impossible to associate a profile (e.g., a time-lapse profile, etc.) with a state of a cell. No relationship between them was known. The present invention has an advantageous effect of performing such a correlation.
As used herein, correlation can be performed by associating at least one profile (e.g., a time-lapse profile, etc.) or changes therein with a state of a cell, a tissue, an organ or an organism (e.g. , drug resistance, etc. ) . For example, a profile (e.g., a time-lapse profile, etc.) or changes therein is quantitatively or qualitatively associated with at least one parameter indicating a state of a cell. A small number of profiles (e.g., time-lapse profile, etc.) may be used for correlation as long as correlation can be performed, typically including, without limitation, 1, preferably 2, and more preferably 3. The present invention demonstrated that at least 2 , preferably at least 3, profiles (e.g., a time-lapse profile, etc.) are sufficient for specifying substantially all cells. Such an effect could not be expected by conventional profiling or assay which uses point observation, and can be said to be realizedbythepresent invention. At least oneprofile (e.g. , a time-lapse profile, etc. ) may be subjected to mathematical processing by utilizing a matrix to associate the profile with a state of a cell . In one preferred embodiment , at least 8 profiles (e.g., a time-lapse profile, etc.) may be advantageously used. By observing increases or decreases in 8 profiles, 256 results can be theoretically obtained, based on which about 300 types of cells constituting an organismcanbe substantiallydis inguishedfromone another. In this context, it may be further advantageous to use at least 9 or 10 sugar chain structures as profiles.
Examples of a specificmethodfor correlation include, but are not limited to, signal processing (e.g., wavelet analysis, etc.), multivariate analysis (e.g., cluster analysis, etc.), and the like.
Correlation may be performed in advance or may be performed at the time of determination of cells using a control.
As usedherein, theterm "externalfactor" inrelation to a cell refers to a factor which is not usually present in the cell (e. g. , a substance, energy, etc. ) . As usedherein, the term "factor" may refer to any substance or element as long as an intended object can be achieved (e.g., energy, such as ionizingradiation, radiation, light, acousticwaves, and the like). Examples of such a substance include, but are not limited to, proteins, polypeptides, oligopeptides , peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (e.g., DNA such as cDNA, genomic DNA and the like, orRNA such as mRNA, RNAi andthe like) , polysaccharides, oligosaccharides, lipids, low molecular weight organic molecules (e.g., hormones, ligands, information transduction substances , low molecular weight organic molecules, molecules synthesized by combinatorial chemistry, low molecular weight molecules usable as medicaments (e.g. , low molecular weight molecule ligands, etc.), etc.), and composite molecules thereof . External factors may be used singly or in combination. Examples of an external factor as used herein include, but are not limited to, temperature changes, humidity changes, electromagnetic wave, potential difference, visible light , infrared light , ultraviolet light , X-rays, chemical substances , pressure, gravity changes , gas partial pressure, osmotic pressure, and the like. In one embodiment, an external factor may be a biological molecule or a chemically synthesized substance.
As usedherein, the term "biologicalmolecule" refers to molecules relating to an organismand aggregations thereof . As used herein, the term "biological" or "organism" refers to a biological organism, including, but being not limited to, an animal, a plant, a fungus, a virus, and the like. Biological molecules include molecules extracted from an organism and aggregations thereof, though the present invention is not limited to this . Any molecule capable of affecting an organism and aggregations thereof fall within the definition of a biological molecule. Therefore, low molecular weight molecules (e.g., low molecular weight molecule ligands, etc. ) capable of being used as medicaments fall within the definition of a biological molecule as long as an effect on an organism is intended. Examples of such a biological molecule include, but are not limited to, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (e.g., DNA such as cDNA and genomic DNA; RNA such as mRNA), polysaccharides, oligosaccharides, lipids, low molecular weight molecules (e.g., hormones, ligands, information transmitting substances, low molecular weight organic molecules, etc.), and composite molecules thereof and aggregations thereof (e.g. , glycolipids, glycoproteins, lipoproteins, etc.), and the like. A biological molecule may include a cell itself or a portion of tissue as long as it is intended to be introduced into a cell. Typically, a biological molecule may be a nucleic acid, a protein, a lipid, a sugar, aproteolipid, a lipoprotein, a glycoprotein , a proteoglycan, or the like. Preferably, a biological molecule may include a nucleic acid ( DNA or RNA) or a protein. In another preferred embodiment, a biological molecule is a nucleic acid (e.g. , genomic DNA or cDNA, or DNA synthesized by PCR or the like). In another preferred embodiment, a biological molecule may be a protein. Preferably, such a biological molecule may be a hormone or a cytokine. As used herein, the term "chemically synthesized substance" refers to any substance which may be synthesized by using typical chemical techniques . Such synthesizing techniques are well known in the art . Those skilled in the art can produce chemically synthesized substances by combining such techniques as appropriate.
The term "cytokine" is used herein in the broadest sense in the art and refers to a physiologically active substance which is produced by a cell and acts on the same or different cell. Cytokines are generally proteins or polypeptides having a function of controlling an immune response, regulating the endocrine system, regulating the nervous system, acting against a tumor, acting against a virus, regulating cell growth, regulating cell differentiation, or the like. Cytokines are used herein in the form of a protein or a nucleic acid or in other forms . In actual practice, cytokines are typically proteins. The terms "growth factor" refers to a substance which promotes or controls cell growth. Growth factors are also called "proliferation factors" or "development factors". Growth factors may be added to cell or tissue culture medium, substituting for serummacromolecules . It has been revealed that a number of growth f ctors have a function of controlling differentiation in addition to a function of promoting cell growth. Examples of cytokines representatively include, but are not limited to, interleukins, chemokines, hematopoietic factors (e.g., colony stimulating factors), tumor necrosis factor, and interferons. Representative examples of growth factors include, but are not limited to, platelet-derived growth factor (PDGF) , epidermal growth factor (EGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF) , endothelial cell growth factor (VEGF) , cardiotrophin, and the like, which have proliferative activity.
The term "hormone" is herein used in its broadest sense in the art, referring to a physiological organic compound which is produced in a particular organ or cell of an animal or plant, and has a physiological effect on an organ apart fromthe siteproducing the compoun . Examples of such a hormone include, but are not limited to, growth hormones, sex hormones, thyroid hormones, and the like. The scope of hormones may overlap partially with that of cytokines .
As used herein, the term "actin acting substance" refers to a substance which interacts directly or indirectly with actin within cells to alter the form or state of actin. Examples of such a substance include, but are not limited to, extracellular matrix proteins (e.g., fibronectin, vitronectin, laminin, etc. ) , and the like . Such actin acting substances include substances identified by the following assays . As used herein, interaction with actin is evaluated by visualizing actin with an actin staining reagent (Molecular Probes, Texas Red-X phalloidin) or the like, followed by microscopic inspection to observe and determine actin aggregation, actin reconstruction or an improvement in cellular outgrowthrate . Such evaluationmaybe performed quantitatively or qualitatively. Actin acting substances are herein utilized so as to increase transfection efficiency. An actin acting substance used herein is derived from any organism, including, for example, mammals, such as human, mouse, bovine, and the like.
Asusedherein, theterms "cell adhesion agent" , "cell adhesionmolecule" , "adhesion agent" and "adhesionmolecule" are used interchangeably to refer to a molecule capable of mediating the joining of two or more cells (cell adhesion) or adhesion between a substrate and a cell. In general, cell adhesion molecules are divided into two groups : molecules involved in cell-cell adhesion (intercellular adhesion) (cell-cell adhesion molecules) and molecules involved in cell-extracellular matrix adhesion (cell-substrate adhesion) (cell-substrate adhesion molecules). For a method of the present invention, either type of molecule is useful and can be effectively used. Therefore, cell adhesion molecules herein include a substrate protein and a cellular protein (e.g., integrin, etc.) involved in cell-substrate adhesion. A molecule other than a protein can fall within the concept of cell adhesion molecule as long as it can mediate cell adhesion.
For cell-cell adhesion, cadherin, a number of molecules belonging in an immunoglobulin superfamily (NCAM, LI, ICAM, fasciclin II, III, etc.), selectin, and the like are known, each of which is known to connect cell membranes via a specific molecular reaction.
On the other hand, a major cell adhesion molecule functioning for cell-substrate adhesion is integrin, which recognizes and binds to various proteins contained in extracellular matrices . These cell adhesion molecules are all located on cell membranes and can be regarded as a type of receptor (cell adhesion receptor) . Therefore, receptors present on cell membranes can also be used in a method of the present invention. Examples of such a receptor include, but are not limited to, α-integrin, β-integrin, CD44, syndecan, aggrecan, and the like. Techniques for cell adhesion are well known as described above and as described in, for example, "Saibogaimatorikkusu -Rinsho heno Oyo- [Extracellular matrix -Clinical Applications-], Medical Revie .
It can be determinedwhether ornot a certainmolecule is a cell adhesion molecule, by an assay, such as biochemical quantification (an SDS-PAGE method, a labeled-collagen method, etc.), immunological quantification (an enzyme antibody method, a fluorescent antibody method, an immunohistological study, etc.), a PDR method, a hybridization method, or the like, in which a positive reaction is detected. Examples of such a cell adhesion molecule include, but are not limited to, collagen, integrin, fibronectin, laminin, vitronectin, fibrinogen, immunoglobulin superfamily members (e.g., CD2, CD4, CD8, ICM1, ICAM2, VCAMl), selectin, cadherin, and the like. Most of these cell adhesion molecules transmit an auxiliary signal for cell activation into a cell due to intercellular interaction as well as cell adhesion. It can be determined whether or not such an auxiliary signal can be transmitted into a cell, by an assay, such as biochemical quantification (an SDS-PAGE method, a labeled-collagen method, etc.), immunological quantification (an enzyme antibody method, a fluorescent antibody method, an immunohistological study, etc.), a PDR method, a hybridization method, or the like, in which a positive reaction is detected.
Examples of cell adhesion molecules include, but are not limitedto, immunoglobulin superfamilymolecules (LFA-3,
ICAM-1, CD2, CD4, CDS, ICM1, ICAM2, VCAMl, etc.); integrin family molecules (LFA-1, Mac-1, gpllbllla, pl50, p95, VLA1 ,
VLA2, VLA3, VLA , VLA5 , VLA6 , etc.); selectin family molecules (L-selectin, E-selectin, P-selectin, etc.), and the like .
As used herein, the term "extracellular matrix protein" refers to a protein constituting an "extracellular matrix" . As used herein, the term "extracellular matrix" (ECM) is also called "extracellular substrate" and has the same meaning as commonly used in the art, and refers to a substance existing between somatic cells no matter whether the cells are epithelial cells or non-epithelial cells. Extracellular matrices are involved in supporting tissue as well as in internal environmental structures essential for survival of all somatic cells . Extracellular matrices are generally produced from connective tissue cells. Some extracellular matrices are secreted from cells possessing basal membrane, such as epithelial cells or endothelial cells . Extracellular matrices are roughly divided into fibrous components and matrices filling there between. Fibrous components include collagen fibers and elastic fibers. A basic component of matrices is glycosaminoglycan (acidic ucopolysaccharide) , most of which is bound to non-collagenous protein to form a polymer of a proteoglycan (acidic mucopolysaccharide-protein comple ) . In addition, matrices include glycoproteins , such as laminin of basal membrane, microfibrils around elastic fibers, fibers, fibronectins on cell surfaces, and the like. Particularly di ferentiated tissue has the same basic structure. For example, in hyaline cartilage, chondroblasts characteristically produce a large amount of cartilage matrices including proteoglyσans . In bones, osteoblasts produce bone matrices which cause calcification. Examples of extracellular matrices for use in the present invention include, but are not limited to, collagen, elastin, proteoglycan, glycosaminoglycan, fibronectin, laminin, elastic fiber, collagen fiber, and the like.
As used herein, the term "receptor" refers to a molecule which is present on cells, within nuclei, or the like, and is capable of binding to an extracellular or intracellular agent where the binding mediates signal transduction. Receptors are typically in the form of proteins . The binding partner of a receptor is usually referred to as a ligand.
As usedherein, the term "agonist" refers to an agent which binds to the receptor of a certain biologically acting substance (e.g., ligand, etc.), and has the same or similar function as the function of the substance.
As used herein, the term "antagonist" refers to a factor which competitively binds to the receptor of a certain biologically acting substance (ligand) , and does not produce a physiological action via the receptor. Antagonists include antagonist drugs, blockers, inhibitors, andthe like.
(Devices and solid phase supports)
As used herein, the term "device" refers to a part which can constitute the whole or a portion of an apparatus, and comprises a support (preferably, a solid phase support) and a target substance carried thereon. Examples of such a device include, but are not limited to, chips, arrays, microtiter plates, cell culture plates, Petri dishes, films, beads, and the like.
As used herein, the term "support" refers to a material which can fix a substance, such as a biological molecule . Such a support maybe made from any fixingmaterial which has a capability of binding to a biological molecule as used herein via covalent or noncovalent bond, or which may be induced to have such a capability.
Examples of materials used for supports include any material capable of forming a solid surface, such as, without limitation, glass, silica, silicon, ceramics, silicon dioxide, plastics, metals (including alloys), naturally-occurring and synthetic polymers (e.g., polystyrene, cellulose, chitosan, dextran, and nylon) , and the like . A support maybe formedof layers made of aplurality of materials. For example, a support may be made of an inorganic insulating material, such as glass, quartz glass, alumina, sapphire, forsterite, silicon oxide, silicon carbide, silicon nitride, or the like. A support may be made of an organic material, such as polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resin, polyacrylonitrile, polystyrene, acetal resin, polycarbonate, polyamide, phenol resin, urea resin, epoxy resin, mela ine resin, styrene-acrylonitrile copolymer, acrylonitrile-butadiene-styrene copolymer, silicone resin, polyphenylene oxide, polysulfone, and the like. Also in the present invention, nitrocellulose film, nylon film, PVDF film, or the like, which are used in blotting, may be used as a material for a support . When a material constituting a support is in the solid phase, such as a support is herein particularly referred to as a " solid phase support " . A solid phase support may be herein in the form of a plate , a microwell plate, a chip, a glass slide, a film, beads, a metal (surface). or the like. A support may not be coated or may be coated.
As used herein, the term "liquid phase" has the same meanings as commonly understood by those skilled in the art , typically referring a state in solution.
As used herein, the term "solid phase" has the same meanings as commonly understood by those skilled in the art, typically referring to a solid state . As used herei , liquid and solid may be collectively referred to as a "fluid".
As used herein, the term "substrate" refers to a material (preferably, solid) which is used to construct a chip or arrayaccording to the present inventio . Therefore, substrates are included in the concept of plates. Such a substrate may be made from any solid material which has a capability of binding to a biological molecule as used herein via covalent or noncovalent bonds , or which may be induced to have such a capability.
Examples of materials used for plates and substrates include any material capable of forming a solid surface, suchas, without limitation, glass, silica, silicon, ceramics, silicon dioxide, plastics, metals (including alloys), naturally-occurring and synthetic polymers (e.g., polystyrene, cellulose, chitosan, dextran, and nylon) , and the like . A support maybe formedof layers made of aplurality of materials. For example, a support may be made of an inorganic insulating material, such as glass, quartz glass, alumina, sapphire, forsterite, silicon oxide, silicon carbide, silicon nitride, or the like. A support may be made of an organic material, such as polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate. unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol , polyvinyl acetal, acrylic resin, polyacrylonitrile, polystyrene, acetal resin, polycarbonate, polyamide, phenol resin, urea resin, epoxy resin, melamine resin, styrene-acrylonitrile copolymer, acrylonitrile-butadiene-styrene copolymer, silicone resin, polyphenylene oxide, polysulfone, and the like. A material preferable as a substrate varies depending on various parameters such as a measuring device, and can be selected from the above-described various materials as appropriate by those skilled in the art. For transfection arrays, glass slides are pre erable. Preferably, such a substrate mayhave a coating.
As used herein, the term "coating" in relation to a solid phase support or substrate refers to an act of forming a film of a material on a surface of the solid phase support or substrate, and also refers to a film itself. Coating is performed for various purposes, such as, for example, improvement in the quality of a solid phase support and substrate (e.g., elongation of life span, improvement in resistance to hostile environment, such as resistance to acids, etc.), an improvement in affinity to a substance integrated with a solid phase support or substrate, and the like. Various materials may be used for such coating, including, without limitation, biological substances (e.g. , DNA, RNA, protein, lipid, etc.), polymers (e.g., poly-L-lysine, MAS (available from Matsunami Glass, Kishiwada, Japan), and hydrophobic fluorine resin) , silane (APS (e.g. , γ-aminopropyl silane, etc . ) ) , metals (e.g. , gold, etc . ) , in addition to the above-described solid phase support and substrate. The selection of such materials is within the technical scope of those skilled in the art and thus can be performed using techniques well known in the art .
In one preferred embodiment, such a coating may be advantageously made of poly-L-lysine, silane (e.g., epoxy silane ormercaptosilane, APS (γ-aminopropyl silane) , etc. ) , MAS, hydrophobic fluorine resin, a metal (e.g. , gold, etc. ) . Such a material may be preferably a substance suitable for cells or objects containing cells (e.g. , organisms, organs, etc. ) .
As used herein, the terms "chip" or "microchip" are used interchangeably to refer to a micro integrated circuit which has versatile functions and constitutes a portion of a system. Examples of a chip include, but are not limited to, DNA chips, protein chips, and the like.
As usedherein, the term "array" refers to a substrate (e.g., a chip, etc.) which has a pattern of a composition containing at least one (e.g., 1000 or more, etc.) target substances (e.g., DNA, proteins, transfection mixtures, etc.), which are arrayed. Among arrays, patterned substrates having a small size (e.g., 10x10 mm, etc.) are particularly referred to as microarrays . The terms "microarray" and "array" are used interchangeably. Therefore, a patterned substrate having a larger size than thatwhich is describedabovemaybe referredto as amicroarra . For example, an array comprises a set of desired transfection mixtures fixed to a solid phase surface or a film thereof. An array preferably comprises at least 102 antibodies of the same or different types, more preferably at least 103, even more preferablyat least 104, and still even more preferably at least 105. These antibodies are placed on a surface of up to 125x80 mm, more preferably 10x10 mm. An array includes , but is not limited to, a 96-well microtiter plate, a 384-well microtiter plate, a microtiter plate the size of a glass slide, and the like. A composition to be fixed may contain one or a plurality of types of target substances . Such a number of target substance types may be in the range of from one to the number of spots, including, without limitation, about 10, about 100, about 500, and about 1,000.
As described above, any number of target substances (e.g., proteins, such as antibodies) may be provided on a solid phase surface or film, typically including no more than 108 biological molecules per substrate, in another embodiment no more than 107 biological molecules, no more than 106 biological molecules, no more than 105 biological molecules, no more than 104 biological molecules, no more than 103 biological molecules, or no more than 102 biological molecules . Acomposition containingmore than 108 biological molecule target substances may be provided on a substrate. In these cases, the size of a substrate is preferably small. Particularly, the size of a spot of a composition containing target substances (e.g., proteins such as antibodies) may be as small as the size of a single biological molecule (e.g. , 1 to 2 nm order). In some cases, the minimum area of a substrate may be determined based on the number of biological molecules on a substrate. A composition containing target substances, which are intended to be introduced into cells, are herein typically arrayed on and fixed via covalent bonds or physical interaction to a substrate in the form of spots having a size of 0.01 mm to 10 mm.
"Spots" of biological molecules may be provided on an array. As usedherein, the term "spot" refers to a certain set of compositions containing target substances. As used herein, the term "spotting" refers to an act of preparing a spot of a composition containing a certain target substance on a substrate or plate. Spotting may be performed by any method, for example, pipetting or the like, or alternatively, using an automatic device. These methods are well known in the art .
As usedherein, the term "address" refers to a unique position on a substrate, which may be distinguished from other unique positions. Addresses are appropriately associated with spots. Addresses can have any distinguishable shape such that substances at each address may be distinguished from substances at other addresses (e.g. , optically) . A shape defining an address maybe, for example, without limitation, a circle, an ellipse, a square, a rectangle, or an irregular shape. Therefore, the term "address" is used to indicate an abstract concept, while the term "spot" is used to indicate a specific concept. Unless it is necessary to distinguish them from each other, the terms "address" and "spot" may be herein used interchangeably.
The size of each address particularly depends on the size of the substrate, thenumber of addresses on the substrate, the amount of a composition containing target substances and/or available reagents, the size of microparticles, and the level of resolution required for any method used for the array. The size of each address may be, for example, in the range of from 1-2 nm to several centimeters, though the address may have any size suited to an array.
The spatial arrangement and shape which define an address are designed so that the microarray is suited to a particular applicatio . Addresses maybe densely arranged or sparsely distributed, or subgrouped into a desired pattern appropriate for a particular type of material to be analyzed.
Microarrays are widely reviewed in, for example,
"Genomu Kino Kenkyu Purotokoru [Genomic Function Research Protocol] (Jikken Igaku Bessatsu [Special Issue of Experimental Medicine] , Posuto Genomu Jidai no Jikken Koza 1 [Lecture 1 on Experimentation in Post-genome Era) , "Genomu Ikagaku to korekarano Genomu Iryo [Genome Medical Science and Futuristic Genome Therapy (Jikken Igaku Zokan [Special Issue of Experimental Medicine]), and the like.
Avast amount of datacanbe obtainedfrom amicroarray. Therefore, data analyzsis software is important for administration of correspondence between clones and spots , data analysis, and the like. Such software may be attached to various detection systems (e.g., Ermolaeva O. et al. , (1998) Nat. Genet., 20: 19-23). The format of database includes, for example, GATC (genetic analysis technology consortium) proposed by Affymetrix.
Micromachining for arrays is described in, for example, Campbell, S.A. (1996), "The Science and Engineering of Microelectronic Fabrication", Oxford University Press; Zaut, P.V. (1996) , "Micromiσroarray Fabrication: aPractical Guide to Semiconductor Processing" , Semiconductor Services ; Madou,M.J. (1997), "Fundamentals of Microfabriσation" , CRC1 5 Press; Rai-Choudhury, P. (1997), "Handbook of Microlithography, Micromachining, & Microfabrication: Microlithography" ; and the like, portions related thereto of which are herein incorporated by reference. (Detection)
In cell analysis or determination in the present invention, various detection methods and means can be used as long as they can be used to detect information attributed to a cell or a substance interacting therewith. Examples of such detection methods and means include, but are not limitedto, visual inspection, opticalmicroscopes , confocal microscopes, reading devices using a laser light source, surface plas on resonance (SPR) imaging, electric signals, chemical or biochemical markers, which may be used singly or in combination. Examples of such a detecting device include, but are not limited to, fluorescence analyzing devices, spectrophotometers, scintillation counters, CCD, luminometers, and the like. Any means capable of detecting a biological molecule may be used.
As used herein, the term "marker" refers to a biological agent for indicating a level or frequency of a substance or state of interest . Examples of such a marker include, but are not limited to, nucleic acids encoding a gene, gene products, metabolic products, receptors, ligands, antibodies, and the like.
Therefore, as used herein, the term "marker" in relation to a state of a cell refers to an agent (e.g. , ligands, antibodies, complementary nucleic acids , etc.) interacting with intracellular factors indicating the state of the cell (e.g., nucleic acids encoding a gene, gene products (e.g., mRNA, proteins, posttransσriptionally modified proteins, etc.), metabolic products, receptors, etc.) in addition to transcription control factors. In the present invention, such a marker may be used to produce a time-lapse profile which is in turn analyzed. Such a marker may preferably interact with a factor of interest . As used herein, the term "specificity" in relation to a marker refers to a property of the marker which interacts with a molecule of interest to a significantlyhigher extent than with similarmolecules . Such a marker is herein preferably present within cells or may be present outside cells .
As used herein, the term "label" refers to a factor which distinguishes a molecule or substance of interest from others (e.g., substances, energy, electromagnetic waves, etc.). Examples of labeling methods include, but are not limitedto, RI (radioisotope) methods, fluorescencemethods, biotinylationmethods , chemoluminancemethods , andthe like . When the above-described nucleic acid fragments and complementary oligonucleotides are labeled by fluorescence methods, fluorescent substances having different fluorescence emission maximum wavelengths are used for labeling. The difference between each fluorescence emission maximum wavelength may be preferably 10 n or more . Any fluorescent substance which can bind to a base portion of a nucleic acid may be used, preferably including a cyanine dye (e.g. , Cy3 andCy5 in the CyDye™series , etc . ) , arhodamine 6G reagent, N-acetoxy-N2-acetyl amino fluorene (AAF), AAIF (iodine derivative of AAF), and the like. Examples of fluorescent substances having a difference in fluorescence emission maximum wavelength of 10 nm or more include a combination of Cy5 and a rhodamine 6G reagent, a combination of Cy3 and fluorescein , a combination of a rhodamine 6G reagent and fluorescein, and the like. In the present invention, such a label can be used to alter a sample of interest so that the sample can be detected by detecting means . Such alteration is known in the art. Those skilled in the art can perform such alteration using a method appropriate for a label and a sample of interest .
As used herein, the term "interaction" refers to, without limitation, hydrophobic interactions, hydrophilic interactions, hydrogen bonds. Van der Waals forces, ionic interactions, nonionic interactions, electrostatic interactions, and the like.
As used herein, the term "interaction level" in relation to interaction between two substances (e.g., cells, etc . ) refers to the extent or frequencyof interaction between the two substances . Such an interaction level canbemeasured by methods well known in the art . For example , the number of cells which are fixed and actually perform interaction is counted directly or indirectly (e.g., the intensity of reflected light) , for example, without limitation, by using an optical microscope, a fluorescence microscope, a phase-contrast microscope, or the like, or alternatively by staining cells with a marker, an antibody, a fluorescent label or the like specific thereto andmeasuring the intensity thereof . Such a level can be displayed directly from a marker or indirectly via a label. Based on the measured value of such a level, the number or frequency of genes, which are actually transcribed or expressed in a certain spot, can be calculated.
(Presentation and display)
As used herein, the terms "display" and "presentation" are used interchangeably to refer to an act of providing a profile obtained by a method of the present invention or information derived therefrom directly or indirectly, or in an information-processed form. Examples of such displayed forms include, but are not limited to. various methods, such as graphs, photographs, tables, animations, and the like. Such techniques are described in, for example, METHODS IN CELL BIOLOGY, VOL. 56, ed. 1998, p : 185-215 , A High-Resolution Multimode Digital Microscope System (Sluder & Wolf, Salmon) , which discusses application software for automating a microscope and controlling a camera and the design of a hardware device comprising an automated optical microscope, a camera, and a Z-axis focusing device, which can be used herein. Image acquisition by a camera is described in detail in, for example, Inoue and Spring, Video Miroscopy, 2d. Edition, 1997, which is herein incorporated by reference. Real time display can also be performed using techniques well known in the art. For example, after all images are obtained and stored in a semi-permanent memory, or substantially at the same time as when an image is obtained, the image can be processed with appropriate application software to obtain processed data. For example, data may be processed by a method for playing back a sequence of images without interruption, a method for displaying images in real time, or a method for displaying images as a "movie" showing irradiating light as changes or continuation on a focal plane .
In another embodiment, application software for measurement and presentation typically includes software for setting conditions for applying stimuli or conditions for recording detected signals . With such a measurement and presentation application, a computer can have a means for applying a stimulus to cells and ameans forprocessing signals detected from cells, andin addition, can control an optically observing means (a SIT camera and an image filing device) and/or a cell culturing means.
By inputting conditions for stimulation on a parameter setting screen using a keyboard, a touch panel, a mouse, or the like, it is possible to set desired complicated conditions for stimulation. In addition, various conditions, such as a temperature for cell culture, pH, and the like, can be set using a keyboard, a mouse, or the like. A display screen displays a time-lapse profile detected from a cell or information derived therefrom in real time or after recording. In addition, another recorded profile or information derived therefrom of a cell can be displayed while being superimposed with a microscopic image of the cell. In addition to recorded information, measurement parameters in recording (stimulation conditions, recording conditions, display conditions, process conditions, various conditions for cells, temperature, pH, etc. ) can be displayed in real time. The present invention may be equipped with a function of issuing an alarmwhen a temperature or pH departs from the tolerable range.
On a data analysis screen, it is possible to set conditions forvarious mathematical analyses , suchas Fourier transformation, cluster analysis, FFT analysis, coherence analysis, correlation analysis, and the like. The present invention may be equipped with a function of temporarily displaying a profile, a function of displaying topography, or the like. The results of these analyses can be displayed while being superimposed with microscopic images stored in a recording medium.
(Gene introduction) Any technique may be used herein for introduction of a nucleic acidmolecule into cells , including, for example, transformation, transduction, transfection, and the like.
In the present invention, transfection is preferable. As used herein, the term "transfection" refers to an act of performing gene introduction or transfection by culturing cells with gene DMA, plasmid DNA, viral DNA, viral RNA or the like in a substantially naked form (excluding viral particles), or adding such a genetic material into cell suspension to allow the cells to take in the genetic material. A gene introduced by transfection is typically expressed within cells in a temporary manner or may be incorporated into cells in a permanent manner.
Such a nucleic acid molecule introduction technique is well known in the art and commonly used, and is described in, for example, AusubelF .A. et al. , editors, (1988) , Current Protocols in Molecular Biology, Wiley, New York, NY; Sambrook J. et al. (1987) Molecular Cloning: A Laboratory Manual, 2nd Ed. and its 3rd Ed. , Cold Spring Harbor Laboratory Press , Cold Spring Harbor, NY; Special issue, Jikken Igaku [Experimental Medicine] "Experimental Methods for Gene introduction & Expression Analysis", Yodo-sha, 1997; and the like. Gene introduction can be confirmed by method as described herein, such as Northern blotting analysis and Western blotting analysis, or other well-known, common techniques .
When a gene is mentioned herein, the term "vector" or "recombinant vector" refers to a vector transferring a polynucleotide sequence of interest to a target cell. Such a vector is capable of self-replication or incorporation into a chromosome in a host cell (e.g. , a prokaryotic cell, yeast, an animal cell, a plant cell, an insect cell, an individual animal, and an individual plant, etc.), and contains a promoter at a site suitable for transcription of a polynucleotide of the present invention. A vector suitable for performing cloning is referred to as a "cloning vector" . Such a cloning vector ordinarily contains a multiple cloning site containing a plurality of restriction sites . Restriction enzyme sites and multiple cloning sites as described above are well known in the art and can be used as appropriate by those skilled in the art depending on the purpose in accordance with publications described herein (e.g., Sambrook et al., supra) .
As used herein, the term "expression vector" refers to a nucleic acid sequence comprising a structural gene and apromoter for regulating expression thereof , and in addition , various regulatory elements in a state that allows them to operate within host cells. The regulatory element may include, preferably, terminators, selectable markers such as drug-resistance genes, and enhancers.
Examples of "recombinant vectors" for prokaryotic cells include, but are not limited to, pcDNA3(+), pBluescript-SK(+/-) , pGEM-T, pEF-BOS, pEGFP , pHAT, pUC18, pFT-DEST™42GATEWAY (Invitrogen), and the like.
Examples of "recombinant vectors" for animal cells include, but are not limited to, pcDNAI/Amp, pcDNAI , pCDMδ (all commercially available from Funakoshi) , pAGE107 [Japanese Laid-Open Publication No. 3-229 (Invitrogen), pAGE103 [ J. Biochem. , 101, 1307(1987) ] , pAMo, pAMoA [ J. Biol. Chem., 268, 22782-22787(1993)], a retrovirus expression vector based on a murine stem cell virus (MSCV) , pEF-BOS, pEGFP, and the like.
Examples of recombinant vectors for plant cells include, but are not limited to, pPCVICEn4HPT, pCGN1548, pCGN1549, pBI221, pBI121, and the like.
Any of the above-described methods for introducing DNA into cells can be used as a vector introduction method, including, for example, transfection, transduction, transformation, and the like (e.g., a calcium phosphate method, a liposome method, a DEAE dextran method, an electroporation method, a particle gun (gene gun) method, and the like), a lipo ection method, a spheroplast method (Proc. Natl. Acad. Sci. USA, 84, 1929(1978)), a lithium acetate method (J. Bacteriol. , 153, 163(1983); and Proc. Natl. Acad. Sci. USA, 75, 1929(1978)), and the like.
As usedherein, the term "gene introduction reagent" refers to a reagent which is used in a gene introduction method so as to enhance introduction efficiency. Examples of such a gene introduction reagent include, but are not limited to, cationic polymers, cationic lipids, polyamine-based reagents, polyimine-based reagents, calcium phosphate, and the like. Specific examples of a reagent used in transfection include reagents available from various sources, such as, without limitation, Ef ectene Transfection Reagent (cat. no. 301425, Qiagen, CA) , TransFast™ Transfection Reagent (E2431, Promega, WI ) , Tfx™-20 Reagent (E2391, Promega, WI) , SuperFect Transfection Reagent (301305, Qiagen, CA) , PolyFect Transfection Reagent (301105, Qiagen, CA) , LipofectAMINE 2000Reagent (11668-019, Invitrogen corporation, CA) , JetPEI (x4) cone. (101-30, Polyplus-transfection, France) and ExGen 500 (R0511, Fermentas Inc., MD), and the like.
Gene expression (e.g. , mRNA expression, polypeptide expression) may be "detected" or "quantified" by an appropriate method, including mRNA measurement and immunological measurement method. Examples of molecular biological measurement methods include Northern blotting methods, dot blotting methods, PCR methods, and the like. Examples of immunological measurement method include ELISA methods, RIA methods, fluorescent antibody methods. Western blotting methods , immunohistological staining methods , and the like, where a microtiter plate may be used. Examples of quantificationmethods includeELISAmethods, RIAmethods, and the like. A gene analysis method using an array (e.g. , a DNA array, a protein array, etc.) may be used. The DNA array is widely reviewed in Saibo-Kogaku [Cell Engineering] , special issue, "DNA Microarray and Up-to-date PCR Method", edited by Shujun-sha. The protein array is described in detail in Nat Genet. 2002 Dec; 32 Suppl: 526-32. Examples of methods for analyzing gene expression include, but are not limited to, RT-PCR methods, RACE methods, SSCP methods, immunoprecipitation methods, two-hybrid systems, in vitro translation methods, and the like in addition to the above-described techniques. Other analysis methods are described in, for example, "Genome Analysis Experimental Method, Yusuke Nakamura rs Lab-Manual, edited by Yusuke Nakamura, Yodo-sha (2002), and the like. All of the above-described publications are herein incorporated by reference.
As used herein, the term "expression level" refers to the amount of a polypeptide or mRNA expressed in a subject cell. The term "expression level" includes the level of protein expression of a polypeptide evaluated by any appropriate method using an antibody, including immunological measurement methods (e.g., an ELISA method. an RIA method, a fluorescent antibody method, a Western blotting method, an immunohistological staining method, and the like, or the mRNA level of expression of a polypeptide evaluated by any appropriate method, including molecular biological measurement methods (e.g., a Northern blotting method, a dot blotting method, a PCR method, and the like) . The term "change in expression level" indicates that an increase or decrease in theprotein ormRNA level of expression of a polypeptide evaluatedby an appropriate method including the above-described immunological measurement method or molecular biological measurement method.
(Screening)
As used herein, the term "screening" refers to selection of a target, such as an organism, a substance, or the like, a given specific property of interest from a population containing a number of elements using a specific operation/evaluation method. For screening, an agent (e.g., an antibody) , a polypeptide or a nucleic acid molecule of the present invention can be used.
As used herein, screening by utilizing an immunological reaction is also referred to as "immunophenotyping" . In this case, an antibody or a single chain antibody may be used for immunophenotyping a cell line and a biological sample. A transcription or translation product of a gene may be useful as a cell specific marker, or more particularly, a cell marker which is distinctively expressed in various stages in differentiation and/or maturation of a specific cell type. A monoclonal antibody directed to a specific epitope, or a combination of epitopes allows for screening of a cell population expressing amarker . Various techniques employ monoclonal antibodies to screen for a cell population expressing a marker. Examples of such techniques include, but are not limited to, magnetic separation using magnetic beads coated with antibodies, "panning" using antibodies attached to a solid matrix (i.e. , a plate), flow cytometry, and the like (e.g., US Patent No. 5,985,660; and Morrison et al. , Cell, 96:737-49(1999) ) .
These techniques may be used to screen cell populations containing undifferentiated cells, which can grow and/or differentiate as seen in human umbilical cord blood or which are treated and modified into an undifferentiated state (e.g. , embryonic stem cells, tissue stem cells, etc.).
(Diagnosis)
As used herein, the term "diagnosis" refers to an act of identifying various parameters associated with a disease, a disorder, a condition, or the like of a subject and determining a current state of the disease, the disorder, the condition, or the like. A method, device, or system of the present invention can be used to analyze a sugar chain structure, a drug resistance level, or the like. Such information can be usedto select parameters , such as a disease, a disorder, a condition, and a prescription or method for treatment or prevention of a subject.
A diagnosis method of the present invention can use, in principle, a sample which is derived from the body of a subject. Therefore, it is possible for some one which is not a medical practitioner, such as a medical doctor, to deal with such a sample. The present invention is industrially useful. ( Therapy)
As used herein, the term "therapy" refers to an act of preventing progression of a disease or a disorder, preferably maintaining the current state of a disease or a disorder, more preferably alleviating a disease or a disorder, and more preferably extinguishing a disease or a disorder .
As used herein, the term "subject" refers to an organism which is sub ected to the treatment of the present invention. A subject is also referred to as a "patient". A patient or subject may preferably be a human.
As used herein, the term "cause" or "pathogen" in relation to a disease, a disorder or a condition of a subject refers to an agent associated with the disease, the disorder or the condition (also collectivelyreferred to as a "lesion" , or "disease damage" inplants) , including, without limitation, a causative or pathogenic substance (pathogenic agent), a disease agent, a disease cell, a pathogenic virus, and the like.
A disease targeted by the present invention may be any disease associated with a pathogenic gene. Examples of such a disease include, but are not limited to, cancer, infectious diseases due to viruses or bacteria, allergy, hypertension, hyperlipemia, diabetes, cardiac diseases, cerebral infarction, dementia, obesity, arteriosclerosis, infertility, mental andnervous diseases, cataract, progeria, hypersensitivity to ultraviolet radiation, and the like.
A disorder targeted by the present invention may be any disorder associated with a pathogenic gene. Examples of such a disease, disorder or condition include, but are not limited to, circulatory diseases (anemia (e.g., aplastic anemia (particularly, severe aplastic anemia), renal anemia, cancerous anemia, secondary anemia, refractory anemia, etc.), cancer or tumors (e.g., leukemia, multiple myeloma) , etc.); neurological diseases (dementia, cerebral stroke and sequela thereof, cerebral tumor, spinal injury, etc.); immunological diseases (T-cell deficiency syndrome, leukemia, etc.); motor organ and the skeletal systemdiseases (fracture, osteoporosis, luxation of joints , subluxation, sprain, ligament injury, osteoarthritis, osteosarcoma, Ewing's sarcoma, osteogenesis imperfeσta, osteochondrodysplasia, etc.); dermatologic diseases (atrichia, melanoma, cutis malignant lympoma, hemangiosarcoma, histiocytosis, hydroa, pustulosis, dermatitis, eczema, etc.); endocrinologic diseases (hypothalamus/hypophysis diseases, thyroid gland diseases, accessory thyroid gland (parathyroid) diseases, adrenal cortex/medulla diseases, saccharometabolism abnormality, lipid metabolism abnormality, protein metabolism abnormality, nucleic acid metabolism abnormality, inborn error of metabolism (phenylketonuria, galactosemia, homocystinuria, maple syrup urine disease) , analbuminemia, lack of ascorbic acid synthetic ability, hyperbilirubinemia, hyperbilirubinuria, kallikrein deficiency, mast cell deficiency, diabetes insipidus, vasopressin secretion abnormality, dwarfism, Wolman's disease (acid lipase deficiency) ) , mucopolysacσharidosis VI, etc. ) ; respiratory diseases (pulmonary diseases (e.g., pneumonia, lung cancer, etc.), bronchial diseases, lung cancer, bronchial cancer, etc.); alimentary diseases (esophagial diseases (e.g., esophagial cancer, etc.), stomach/duodenum diseases (e.g.. stomach cancer, duodenum cancer, etc.), small intestine diseases/large intestine diseases (e.g. , polyps of the colon, colon cancer, rectal cancer, etc. ) , bile duct diseases, liver diseases (e.g., liver cirrhosis, hepatitis (A, B, C, D, E, etc . ) , f lminant hepatitis , chronic hepatitis , primary liver cancer, alcoholic liver disorders, drug induced liver disorders, etc.), pancreatic diseases (acute pancreatitis, chronic pancreatitis, pancreas cancer, cystic pancreas diseases, etc.), peritoneum/abdominal wall/diaphragm diseases (hernia, etc.), Hirschsprung' s disease, etc.); urinary diseases (kidney diseases (e.g., renal failure, primary glomerulus diseases, renovascular disorders, tubular function abnormality, interstitial kidney diseases , kidney disorders due to systemic diseases, kidney cancer, etc.), bladder diseases (e.g., cystitis, bladder cancer, etc. ) ; genital diseases (male genital organ diseases (e.g. , male sterility, prostatomegaly, prostate cancer, testicular cancer, etc.), female genital organ diseases (e.g., female sterility, ovary function disorders, hysteromyoma, adenomyosis uteri, uterine cancer, endometriosis, ovarian cancer, villosity diseases, etc.), etc); circulatory diseases (heart failure, anginapectoris , myocardial infarct , arrhythmia, valvulitis, cardiac muscle/pericardium diseases, congenital heart diseases (e.g., atrial septal defect, arterial canal patency, tetralogy of Fallot, etc. ) , artery diseases (e.g., arteriosclerosis, aneurysm) , vein diseases (e.g., phlebeurysm, etc.), lymphoduct diseases (e.g., lymphedema, etc.), etc.); and the like.
As used herein, the term "cancer" refers to a malignant tumor which has a high level of atypism, grows faster than normal cells, tends to disruptively invade surrounding tissue or metastasize to new body sites or a condition characterized by the presence of such a malignant tumor. In the present invention, cancer includes, without limitation, solid cancer and hematological cancer.
As used herein, the term "solid cancer" refers to a cancer having a solid shape in contrast to hematological cancer, such as leukemia and the like. Examples of such a solid cancer include, but are not limited to, breast cancer, liver cancer, stomach cancer, lung cancer, head and neck cancer, uterocervical cancer, prostate cancer, retinoblastoma, malignant lymphoma, esophagus cancer, brain tumor, osteonσus, and the like.
As usedherein, the term "cancer therapy" encompasses administration of an anticancer agent (e.g., a chemotherapeutic agent , radiation therapy, etc. ) or surgical therapy, such as surgical excision and the like.
Chemotherapeutic agents used herein are well known in the art and are described in, for example, Shigeru
Tsukagoshi et al. editors, "Kogan zai Manuaru [Manual of
Anticancer agents] " , 2nded. , Chugailgaku sha; Pharmacology; and Lippincott Williams & Wilkins, Inc. Examples of such chemotherapeutic agents are described below: 1) alkylating agents which alkylate cell components, such as DNA, protein, andthe like, toproduce cytotoxicity (e.g. , cyclophosphamide, busulfan, thiotepa, dacarbazine, etc.); 2) antimetabolites which mainly inhibit synthesis of nucleic acids (e.g., antifolics (methotrexate, etc.), antipurines ( 6-mercaptopurine, etc.), antipyrimidines (fluorourasil
(5-FU), etc.); 3) DNA topoisomerase inhibitors (e.g., camptothecin and etoposide, each of which inhibits topoisomerases I and II)); 4) tubulin agents which inhibit formation of microtubules and suppress cell division (vinblastine, vincristine, etc.); 5) platinum compounds which bind to DNA and proteins to exhibit cytotoxicity (cisplatin, carboplatin, etc.); 6) anticancer antibiotics which bind to DNA to inhibit synthesis of DNA and RNA (adriamycin, dactinomycin, mitomycin C, bleomycin, etc.); 7) hormone agents which are applicable to hormone-dependent cancer, such as breast cancer, uterus cancer, prostate cancer, and the like (e.g., tamoxifen, leuprorelin (LH-RH), etc.); 8) biological formulations (asparaginase effective for asparagine requiring blood malignant tumor, interferon exhibiting direct antitumor action and indirect action by immunopotentiation, etc.); 9) immunostimulants which exhibit capability of immune response, indirectly leading to antitumor activity (e.g., rentinan which is a polysacσharide derived from shiitake mushroom, bestatin which is a peptide derived from a microorganism, etc. ) .
An "anticancer agent" used herein selectively suppresses the growth of cancerous (tumor) cells, and includes both pharmaceutical agents and radiation therapy. Such an anticancer agent is well known in the art and described in, for example, Shigeru Tsukagoshi et al. editors, "Kogan zai Manuaru [Manual of Anticancer agents]", 2nd ed. , Chugailgaku sha; Pharmacology; and Lippincott Williams & Wilkins, Inc.
As used herein, the term "radiation therapy" refers to a therapy for diseases using ionizing radiation or radioactive substances. Representative examples of radiation therapy include, but are not limited to. X-ray therapy, γ-ray therapy, electron beam therapy, proton beam therapy, heavyparticlebeamtherapy, neutron capture therapy. and the like. For example, heavy particle beam therapy is preferable. However, heavy particle beam therapy requires a large-size device and is not generally used. The above-described radiation therapies are well known in the art and are described in, for example, Sho Kei Zen, "Hoshasenkensa to Chiryo no Kiso: Hoshasen Chiryo to Shugakuteki Chiryo [Basics of Radiation Examination and Therapies : Radiation Therapyand Incentive Therapy] " , ( Shiga Medical School, Radiation) : Total digestive system care, Vol. 6, No. 6, Pages 79-89, 6-7 (2002.02). For drug resistance to be identified in the present invention, chemotherapies are typically considered. However, resistance to radiation therapy is also associated with time-lapse profiles. Therefore, radiation therapy is herein encompassed by the concept of pharmaceutical agents.
As used herein, the term "pharmaceutically acceptable carrier" refers to amaterial for use in production of a medicament, an animal drug or an agricultural chemical, which does not have an adverse effect on an effective component , Examples of such a pharmaceutically acceptable carrier include, but are not limitedto, antioxidants, preservatives, colorants, flavoring agents, diluents, emulsifiers, suspending agents, solvents, fillers, bulking agents, buffers, delivery vehicles, excipients, agricultural or pharmaceutical adjuvants, and the like.
The type and amount of a pharmaceutical agent used in a treatment method of the present invention can be easily determined by those skilled in the art based on information obtained by a method of the present invention (e.g., information about the level of drug resistance, etc. ) and with reference to the purpose of use, a target disease (type. severity, and the like), the patient's age, weight, sex, and case history, the form or type of the cell, and the like. The frequency of the treatment methodof thepresent invention applied to a subject (or patient) is also determined by those skilled in the art with respect to t e purpose of use, target disease (type, severity, and the like), the patient's age, weight, sex, andcasehistory, theprogression of the therapy, and the like . Examples o£ he frequency include once per day to several months (e.g., once per week to once per month) . Preferably, administration is performed once per week to month with reference to the progression.
As used herein, the term "instructions" refers to a descriptionof atailormade therapyof thepresent invention for a person who performs administration, such as a medical doctor, a patient, or the like. Instructions state when to administer a medicament of the present invention, such as immediately after or before radiation therapy (e.g. , within 24 hours , etc. ) . The instructions are prepared in accordance with a format defined by an authority of a country in which the present invention is practiced (e.g. , Health, Labor and Welfare Ministryin Japan, Food and DrugAdministration (FDA) in the U.S. , and the like), explicitly describing that the instructions are approved by the authority. The instructions are so-called package insert and are typically provided in papermedia. The instructions are not so limited and may be provided in the form of electronic media (e.g., web sites, electronic mails, and the like provided on the internet ) .
In a therapy of the present invention, two or more pharmaceutical agents may be used as required. When two or more pharmaceutical agents are used, these agents may have similar properties or may be derived from similar origins, or alternatively, may have different properties or may be derived from diff rent origins . A method of the present invention can be used to obtain information about the drug resistance level of a method of administering two or more pharmaceutical agents.
Also, in the present invention, a gene therapy can be performed based on the resultant information about drug resistance. As usedherein, the term "gene therapy" refers to a therapy in which a nucleic acid, which has been expressed or can be expressed, is administered into a subject. In such an embodiment of the present invention, a protein encoded by a nucleic acid is produced to mediate a therapeutic effect .
In the present invention, it will be understood by those skilled in the art that if the result of analysis of a certain specific time-lapse profile is once correlated with a state of a cell in a similar organism (e.g., mouse with respect to human, etc.), the result of analysis of a corresponding time-lapse profile can be correlated with a state of a cell. This feature is supported by, for example, Dobutsu Baiyo Saibo Manuaru [Animal Culture Cell Manual] , Seno, ed. , Kyoritsu Shuppan, 1993, which is herein incorporated by reference.
Thepresent inventionmaybe appliedto gene therapies based on such a certain specific time-lapse profile.
Any methods for gene therapy available in the art may be used in accordance with the present invention. Illustrative methods will be described below. Methods for gene therapy are generally reviewed in, for example, Goldspiel et al., Clinical Pharmacy 12: 488-505(1993); Wu and Wu, Biotherapy 3: 87-95(1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol., 32: 573-596(1993) ; Mulligan, Science 260: 926-932(1993) ; Morgan and Anderson, Ann. Rev. Biochem., 62: 191-217(1993); and May, TIBTECH 11(5): 155-215(1993). Commonly known recombinant DNA techniques used in gene therapy are described in, for example, Ausubel et al. (ed.). Current Protocols in Molecular Biology, John Wiley & Sons, NY(1993); and Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990).
(Basic techniques) Techniques usedherein are within the technical scope of the present invention unless otherwise specified. These techniques are commonly used in the fields of fluidics, micromachining, organic chemistry, biochemistry, genetic engineering, molecular biology, microbiology, genetics, and their relevant fields. The techniques are well described in documents described below and the documents mentioned herein elsewhere.
Micromachining is described in, for example, Campbell, S.A. (1996), "The Science and Engineering of Microelectronic Fabrication" , Oxford University Press; Zaut, P.V. (1996), "MicromicroarrayFabrication: a Practical Guide to Semiconductor Processing" , Semiconductor Services; Madou, M.J. (1997), "Fundamentals of Microfabrication" , CRC1 5 Press; Rai-Choudhury, P. (1997), "Handbook of Microlithography, Micromachining, & Microfabrication: Microlithography". Relevant portions (or possibly the entirety) of each of these publications are herein incorporated by reference.
Molecular biology techniques, biochemistry techniques , andmicrobiology techniques used herein are well known and commonly used in the art, and are described in, for example, Sambrook J. et al. (1989), "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor and its 3rd Ed. ( 2001) ; Ausubel, F.M. (1987), "Current Protocols inMolecular Biology", Greene Pub. Associates and Wiley-Interscience; Ausubel, F.M. (1989), "Short Protocols in Molecular Biolog : A Compendium of Methods from Current Protocols in Molecular Biology", Greene Pub. Associates and Wiley-Interscience; Innis, M.A. (1990), "PCR Protocols: A Guide to Methods and Applications", Academic Press ; Ausubel, F.M. (1992), "Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology", Greene Pub. Associates; Ausubel, F.M. (1995), "Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology", Greene Pub. Associates; Innis, M.A. et al. ( 1995) , "PCR Strategies" , Academic Press ; Ausubel, F.M. (1999), "Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology", Wiley, and annual updates; Sninsky, J.J. et al. (1999), "PCR Applications: Protocols for Functional Genomics", Academic Press; Special issue, Jikken Igaku [Experimental Medicine] "Idenshi Donyu & Hatsugenkaiseki Jikkenho [Experimental Method for Gene introduction & Expression Analysis]", Yodo-sha, 1997; and the like. Relevant portions (or possibly the entirety) of each of these publications are herein incorporated by reference.
DNA synthesis techniques and nucleic acid chemistry for producing artificially synthesized genes are described in, for example. Gait, M.J. (1985), "Oligonucleotide Synthesis: A Practical Approach", IRL Press; Gait, M.J. (1990), "Oligonucleotide Synthesis : A Practical Approach" , IRL Press; Eckstein, F. (1991), "Oligonucleotides and Analogues: A Practical Approach", IRL Press; Adams, R.L. et al. (1992), "The Biochemistry of the Nucleic Acids", Chapman & Hall; Shabarova, Z. etal. (1994), "Advanced Organic Chemistry of Nucleic Acids", Weinheim; Blackburn, G.M. et al. (1996) , "Nucleic Acids in Chemistry and Biology" , Oxford University Press; Hermanson, G.T. (1996), "Bioconjugate Techniques", Academic Press; and the like. Relevant portions (or possibly the entirety) of each of these publications are herein incorporated by reference.
(Analysis of co-regulation of genes)
Mathematical processes used herein can be performed by using well-known techniques described in, for example, Kazuyuki Shimizu, "Seimei Sisutemu Kaiseki notameno Sugaku [Mathematics forAnalyzing Biological Systems] " , Corona sha, 1999; and the like . Among these techniques, representative analyzing techniques will be described below.
In one embodiment, such a mathematical process may be regression analysis. Examples of regression analysis include, but are not limited to, linear regression (e.g., simple regression analysis, multiple regression analysis, robust estimation, etc. ) , nonlinear estimation, andthe like.
In simple regression analysis, n sets of data ( i, ι ) to (xn, yn) are fitted to
Figure imgf000101_0001
(i=l, 2, ..., n) where a and b are model parameters, and e± represents a deviation or an error from the straight line . The parameters a and b are typically determined so that the mean of sum of squares of the distance between a data point and the straight line is minimum. In this case, the rms of the distance is partially differentiated to produce simultaneous linear equations . These equations are solved for a and b which minimize the square errors. Such values are called least square estimates .
Next, a regression line is calculated based on the value obtained by subtracting the mean of all data values from each data value. A regression line represented by:
ASiXi + B = SYi
is assumed. Further, it is assumed that B=0. The mean (xave, yave) of (x±, yi) (i=l, 2, ..., n) is calculated, and the variance of x (Sxx) and the covariance of x and y (sxy) are calculated.
The above-described regression line can be represented by:
y - Yave — ( Sχy/ Sχx / V 5 - Xave / •
The correlation coefficient rxy is represented by:
rx = Sχy/V SxySyy .
In this case, the relationship Seι2/n = Syy(l - rxy 2) is satisfied. Therefore, as |rxy| approaches 1, the error is decreased, which means that data can be satisfactorily represented by the regression line.
In another embodiment , multiple regression analysis is used. In this technique, y is not a single independent variable, and is considered to be a function of two or more variables, e.g., is represented by: y = a0 + aiXi + a2x2 + • • • + anxn.
This equation is called a multiple regression equation. aQ and the like are called (partial) regression coefficients. In multiple regression analysis, a least square method is used and normal equations are solved to obtain least square estimates . Evaluation can be performed as with single regression analysis.
In another embodiment, robust estimation is used. The least square method is based on the premise that measurement values are not biased and measurement errors have a normal distribution, and models have no approximation error. In actual situations, however, there may be errors in measurement. In robust estimation, unreliable data is detected and separated as outliers from the great majority of data which are reliable, or is subjected to a statistical process. Such a robust estimation may be utilized herein.
Nonlinear estimation may also be used herein. With nonlinear estimation, it is possible to represent a nonlinear model as vector equations which are in turn solved.
Other mathematical processes used herein include principal component analysis, which utilizes two-dimensional data principal component analysis, multi-dimensional data principal component analysis, singularvalue decomposition, and generalized inversematrix. Alternatively, canonical correlation analysis, factor analysis, discrimination analysis, cluster analysis, and the like may be used herein. (Gene set classification by cluster analysis)
For a number of applications , it may be desirable to obtain a set of reference transcription control sequences which are cooperatively controlled under a wide range of condition . An embodiment of identifying such a set of reference transcription control sequences is, for example, a clustering algorithm, which is reviewed in, for example,
Fukunaga, 1990, "Statistical Pattern Recognition" , 2nded.,
AcademicPress, SanDiego; Anderberg, 1973, "ClusterAnalysis forApplications" , Academic Press : New York; Everitt, 1974,
"ClusterAnalysis" , London: Heinemann Educ . Books; Hartigan,
1975, "Clustering Algorithms", New York: Wiley; and Sneath and Sokal, 1973, "Numerical Taxonomy", Freeman.
A set of transcription control sequences can also be defined based on a transcription control mechanism. Transcription control sequences having a transcription factor binding site for the same or similar sequence in a regulatory region are likely to be cooperatively regulated. In a certain embodiment, the regulatory regions of transcr.iption control sequences of interest are compared with one another using multiple alignment analysis, so that a possible common transcription factor binding site can be determined (Stormo and Hartzell, 1989, "Identifying protein binding sites from unaligned DNA fragments", Proc. Natl. Acad. Sci., 86: 1183-1187; Hertz and Stormo, 1995, "Identification of consensus patterns in unaligned DNA and protein sequences : a large-deviation statistical basis for penalizing gaps", Proc. of 3rd Intl. Conf . on Bioinformatics and Genome Research, Lim and Cantor, ed. , World Scientific Publishing Co., Ltd. Singapore, pp.201-216).
It may be desirable to obtain a set of basic transcription control sequences which are cooperatively regulatedundervarious conditions . With sucha set , amethod of the present invention can satisfactorily and ef iciently carry out determination based on profiles . A preferable embodiment for identif ing such a set of basic transcription control sequences includes a clustering algorithm.
In an embodiment using cluster analysis, the transcription levels of a number of transcription control sequences can be monitored while applying various stimuli to biological samples . A table of data containing measurements of the transcription levels of transcription control sequences is used in cluster analysis . In order to obtain a set of basic transcription control sequences containing transcription control sequences which simultaneously vary under various conditions , typically at least two, preferably at least 3, more preferably at least 10, even more preferably more than 50, and most preferably more than 100 stimuli or conditions are used. Cluster analysis is performed for a table of datahavingmxk dimensions where m is the total number of conditions or stimuli and k is the number of transcription control sequences to be measured.
A number of clustering algorithms are useful for clustering analysis . In clustering algorithms , differences or distances between samples are used to form clusters . In a certain embodiment , a distance used is a Euclidean distance in multi-dimensional space:
Figure imgf000106_0001
(1)
where (x, y) represents a distance between gene X and gene Y (or any other cellular components X and Y (e.g., transcription control sequences)); i and i represent gene expression in response to i stimuli. Euclidean distances may be squared and then multiplied with weights which are increased with an increase in the distance. Alternatively, a distance reference may be, for example, a distance between transcription control sequences X and Y, or a Manhattan distance represented by:
Figure imgf000106_0002
where X and Y represent responses of transcription control sequences or gene expression when i stimuli are applied. Several other definitions of distance include Chebyshev distance, power distance, and mismatch rate. When dimensional data can be categorized without modification, a mismatch rate defined as I(x, y) = (the number of Xi≠Yi)/i may be used in a method of the present invention. Such a method is particularly useful in terms of cellular responses . Another useful definition of distance is I=l-r where r is a correlation coefficient of response vectors X and Y, e.g. , a normalized inner product X-Y/|x| |Y|. Specifically, an inner product X-Y is defined by:
Figure imgf000107_0001
( 3 ) .
Also , | x | = (X-X) 1/2 and | Y | = ( Y-Y ) 1/ 2
Most preferably, a distance reference is suited to a biological problem in order to identify cellular components (e.g., transcription control sequences, etc.) which are simultaneously changed and/or simultaneously regulated. For example, in a particularly preferred embodiment, a distance reference is 1=1-r having a correlation coefficient containing a weighted inner product of genes X and Y. Specifically, in such a preferred embodiment, rη is defined by:
Figure imgf000107_0002
(4)
where Oi(x) and Oi(Y) represent standard errors in measurement of genes X and Y in experiment i.
The above-described normalized and weighted inner products (correlation coefficients) are constrained between values +1 (two response vectors are completely correlated, i.e. , the two vectors are essentially the same) and -1 (two response vectors are not correlated or do not have the same orientation (i.e., opposing orientations)). These correlation coefficients are particularly preferable in an embodiment of the present invention which tries to detect a set or cluster of cellular components (e.g. , transcription control sequences, etc.) having the same sign or response.
In another embodiment, it is preferable to identify a set or cluster of cellular components (e.g. , transcription control sequences, etc. ) which simultaneously regulate the same biological response or pathway or are involved in such regulation, or have similar or non-correlated responses. In such a embodiment, it is preferable to use the absolute value of either the above-described normalized or weighted inner product, i.e., |r| as a correlation coefficient.
In still another embodiment, the relationship between cellular components (e.g., transcription control sequences, etc. ) , which are simultaneously regulated and/or simultaneously changed, are more complicated, e.g. , a number of biological pathways (e.g. , signal transduction pathways , etc.) are involved with the same cellular component (e.g., a transcription control sequence, etc.) so that different results may be obtained. In such an embodiment, it is preferable to use a correlation coefficient r=r (clιan9e> which can identify cellular components (other transcription control sequences as controls which are not involved in change) which are simultaneously changed and/or simultaneously regulated. A correlation coefficient represented by expression (5) is particularly useful for the above-described embodiment:
Figure imgf000109_0002
Figure imgf000109_0001
(5)
Various clusterlinkagemethods areusefulinamethod of the present invention.
Examples of such a technique include a simple linkage method, a nearest neighbor method, and the like. In these techniques, a distance between the two closest samples is measured. Alternatively, in a complete linkage method, which may be herein used, a maximum distance between two samples in different clusters is measured. This technique is particularly useful when genes or other cellular components naturally form separate "clumps".
Alternatively, themean of non-weightedpairs is used to define themean distance of all samplepairs in two different clusters . This technique is also useful in clustering genes or other cellular components which naturally form separate "clumps". Finally, a weighted pair mean technique is also available . This technique is the same as a non-weighted pair mean technique, except that in the former, the size of each cluster is used as a weight . This technique is particularly useful in an embodiment in which it is suspected that the size of a cluster of transcription control sequences or the like varies considerably (Sneath and Sokal, 1973, "Numerical taxonomy" , San Francisco : .H. Freeman & Co . ) . Other cluster linkage methods, such as, for example, non-weighted and weighted pair group centroid and Ward's method, are also useful in several embodiments of the present invention. See, for example. Ward, 1963, J. Am. Stat . Assn., 58: 236; and Hartigan, 1975, "Clustering algorithms". New York: Wiley.
In a certain preferred embodiment, cluster analysis can be performed using a well-known hclust technique (e.g. , see awell-known procedure in "hclust" available from Program S-Plus, MathSoft, Inc., Cambridge, MA).
According to the present invention, it was found that even if the versatility of stimuli to a clustering set is increased, a state of a cell can be substantially elucidated by analyzing typically at least two, preferably at least 3, profiles using a method of the present invention. Stimulation conditions include treatment with a pharmaceutical agent in different concentrations, different measurement times after treatment , response to genetic mutations in various genes, a combination of treatment of a pharmaceutical agent and mutation, and changes in growth conditions (temperature, density, calcium concentration, etc. ) .
As used herein, the term "significantly different" in relation to two statistics means that the two statistics are different from each otherwith a statistical significance . In an embodiment of the present invention, data of a set of experiments concerning the responses of cellular components can be randomized by a Monte Carlo method to define an objective test.
In a certain embodiment, an objective test can be definedbythe following technique . Pki represents aresponse of a component k in experiment i. π(i) represents a random permutation of the indices of experiments. Next, Pkπ ) is calculated for a number of different random permutations (about 100 to 1,000) . For each branch of the original tree and each permutation:
(1) hierarchical clustering is performed using the same algorithm as that which has been used for the original data which is not permutated (in this case, "hclust"); and
(2) an improvement f in classification in total variance about the center of clusters when transition is made from one cluster to two clusters;
Figure imgf000111_0001
( 6 )
where Dk is the square of the distance reference (mean) of component k with respect to the center of a cluster to which component k belongs . Superscript 1 or 2 indicates the center of all branches or the center of the more preferable cluster of the two subclusters . The distance function D used in this clustering technique has a considerable degree of freedom. In these examples, D=l-r, where r is a correlation coefficient of one responsewith respect to anotherresponse of a component appearing in a set of experiments (or of the mean cluster response) .
Specifically, an objective statistical test can be preferably used to determine the statistical reliability of grouping any clustering methods or algorithms . Preferably, similar tests can be applied to both hierarchical and nonhierarσhical clustering methods . The compactness of a cluster is quantitatively defined as, for example, the mean of squares of the distances of elements in the cluster from the "mean of the cluster" , ormorepreferably, the inverse of the mean of squares of the distances of elements from the mean of the cluster. The mean of a specific cluster is generally defined as the mean of response vectors of all elements in the cluster. However, in a specific embodiment (e.g. , the definition of the mean of the cluster is doubt ul) , for example, the absolute values of normalized or weighted inner products are used to evaluate the distance function of a clustering algorithm (i.e., 1=1- |r|). Typically, the above-described definition of the mean may raise a problem in an embodiment in which response vectors have opposing directions so that the mean of the cluster as defined above is zero. Therefore, in such an embodiment, a different definition is preferably selected for the compactness of a cluster, for example, without limitation, the mean of squares of the distances of all pairs of elements in a cluster. Alternatively, the compactness of a cluster may be defined as the mean of distances between each element (e.g. , a cellular component) of a cluster and another element of the cluster (or more preferably the inverse of the mean distance) .
Other definitions, which may be used in statistical techniques used in the present invention, are obvious to those skilled in the art .
In another embodiment, a profile of the present invention canbe analyzedusing signalprocessing techniques . In these signalprocessing techniques , acorrelation function is defined, a correlation coefficient is calculated, an autocorrelation function and a cross-correlation function are defined, and these functions are weighted where the sum of the weights is equal to 1. Thereby, moving averages can be obtained.
In signal processing, it is important to consider a time domain and a frequency domain. Rhythm often plays an important role in dynamic characteristic analysis for natural phenomena, particularly life and organisms. If a certain time function f (t ) satisfies the followingconditio , the function is called a periodic function:
f(t) = f(t+T)
At time 0 , the function takes a value of f ( 0 ) . The function takes a value of f (0) at time T again after taking various values after time 0. Such a function is called a periodic function. Such a function includes a sine wave. T is called a period. The function has one cycle per time T. Alternatively, this feature may be represented by 1/T which means the number of cycles per unit time (cycles/time) without loss of the information. The concept represented by the number of cycles per unit time is called frequency. If the frequency is represented by f, f is represented by:
f=l/T,
Thus, the frequency is an inverse of the time. The time is dealt in a time domain, while the frequency is dealt in a frequency domain. The frequency may be represented in an electrical engineering manner. For example, the frequency is represented by angular measure where one period corresponds to 360° or 2π radians. In this case, f (cycles/ sec) is converted to 2πf (radians/sec) , which is generally represented by ω (=2πf) and is called angular frequency. Now, a sine wave is compared with a cosine wave. The cosine wave is obtained by translating the sine wave by 90° or π/2 radians. The sine wave may be represented by the delayed cosine wave. This time delay is called phase. For example, when a pure cosine wave has a phase of 0, a sine wave has a phase of 90°. When a sine wave is added to a cosine wave, the amplitude of the resultant wave is increased by a factor of 42 and the phase is π/4.
In such analysis , Fourier series and frequency analysis may be available. In addition, Fourier transformation, discrete Fourier transformation, and power spectrummay be available. In Fourier expansion, techniques, such as wavelet transformation andthe like, maybeavailable. These techniques are well known in the art and are described in, for example, Yukio Shimizu, "Seimei Sisutemu Kaiseki notameno Sugaku [Mathematics for analyzing life systems]". Corona sha, (1999); and Yasuhiro Ishikawa, "Rinsho Igaku notameno Ueburetto Kaiseki [Wavelet analysis for clinical medicine]", Igaku Shuppan.
(Description of preferred embodiments)
Hereinafter, the present inventionwill be described by way of embodiments. Embodiments described below are provided only for illustrative purposes. Accordingly, the scope of the present invention is not limited by the embodiments except as by the appended claims.
(Presentation of cellular state)
In one aspect , thepresent inventionprovides amethod for presenting a state of a cell. The method comprises the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a gene state (e.g. , the expression of a gene (transcription, translation, etc.), etc.) associated with at least one gene (including a transcription control sequence, etc.) selected from genes (including a transcription control sequence , etc . ) derived rom the cell ; an b) presenting the time-lapse profile. For example, the profile of the intensity of a signal obtained by monitoring is subjected to interval di ferentiation, thereby obtaining a function of changes, which can be in turn displayed. In this case, preferably, for example, a transcription control sequence, such as a constitutive promoter or the like, which is assumed to be changed, can be used as a reference to obtain a difference, thereby obtaining a time-lapse profile. The present invention is not limited to this . The above-described genes preferably include different transcription control sequences . The present invention is not limited to this .
Time-lapse profiles maybe displayedusinganymethod, for example, maybevisually displayedusing a displaydevices (e.g., the x axis shows time while the y axis shows signal intensity) , or alternatively, may be displayed as a table of numerical values. Alternatively, signal intensity may be displayed as optical intensity.
Preferably, cells are fixed to a solid phase support (e.g., an array, a plate, a microtiter plate, etc.) when they are monitored. Such fixation can be carried out using techniques known in the art or techniques as describedherein .
In a preferred embodiment , such a time-lapse profile may be presented in real time. The real time presentation may contain a time lag to some extent if it is performed substantially in real time. A tolerable time lag is, for example, 10 seconds at maximum, andmore preferably 1 second at maximum, though the tolerable time lag depends on the required level of real time (simultaneity).
(Determination of cellular state) In another aspect, the present invention provides a method for determining a state of a cell. Such determination of the cellular state is achievedbymonitoring changes in a state (e.g., the expression of a gene (transcription, translation, etc.), etc.) of a gene (e.g., a transcription control factor, etc.), which are not conventionally observed. Therefore, the method of the present invention or determining the cellular state makes it possible to determine various states which cannot be conventionally observed. Such a method comprises the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a gene state (e.g. , the expression of a gene (transcription, translation, etc.), etc.) associated with at least one gene (including a transcription control sequence, etc.) selected from genes (including a transcription control sequence, etc. ) derived from the cell; and b) determining the state of the cell based on the time-lapse profile of the transcription level. The above-described genes preferably include different transcription control sequences . The present invention is not limited to this.
Preferably, cells are fixed to a solid phase support (e.g., an array, a plate, a microtiter plate, etc.) when they are monitored. Such fixation can be carried out using techniques known in the art ortechniques as describedherei . In a preferred embodiment, advantageously, the cellular state determination method of the present invention may further comprise correlating the time-lapse profile with the state of the cellbefore obtaining the time-lapse profile . Alternatively, such correlation information may be provided from known information. Such a correlating step may be performed every determining step or correlation information may be stored in a database and may be used as required.
In apreferred embodiment , the transcription control sequence may be, without limitation, a promoter, an enhancers, a silencer, another flanking sequence of a structural gene in a genome, and a genomic sequence other than exons. A promoter is preferable. This is because a transcription level can be directly measured.
In a particular embodiment, the transcription control sequences may include constitutive promoters, specific promoters , inducible promoters , and the like . Any promotermaybe used. The present invention is characterized in that any type of promoter can be used. According to the method of the present invention, profiles can be analyzed from a viewpoint of "procession" . Therefore, it is possible to determine a state of a cell using any promoter or any set of promoters. Such determination cannot be achieved by conventional techniques. The present invention is highly useful since the present invention achieves what cannot be achieved by conventional techniques .
In apreferredembodiment , at least two transcription control sequences are monitored. By observing at least two transcription control sequences, 80% of the states of a cell can be typically identified. More preferably, at least 3 transcription control sequences are monitored. By observing at least three transcription control sequences, at least 90% of the states of a cell canbe typicallyidentified. In a most preferred embodiment, at least 8 transcription control sequences are monitored. By observing at least 8 transcription control sequences, substantially all of the states of a cell can be typically identified. Thus , although any transcription control sequences are selected, substantially all of the states of a cell can be determined by selecting and monitoring a small number of transcription control sequences as described above. This feature has not been conventionally expected. The method of the present invention is simpler, more precise and more accurate than conventional determination methods in which observation is made at time points and resultant data is statistically processed as heterologous groups .
Therefore, the determination method of the present invention preferably further comprises arbitrarily selecting at least one gene (including transcription control sequence, etc.) from genes (including transcription control sequences, etc.) before monitoring. An important feature of thepresent invention is suchthat agene (e.g. , aparticular transcription control sequence , etc . ) , which does not exhibit specificity when investigated from point to point, can be used.
In a preferred embodiment , such a time-lapse profile may be presented in real time. The real time presentation may contain a time lag to some extent if it is .performed substantially in real time. A tolerable time lag is, for example, 10 seconds at maximum, and more preferably 1 second at maximum, though the tolerable time lag depends on the required level of real time (simultaneity). For example, in a therapy requiring real time diagnosis , the time lag may be, for example, 30 seconds at maximum.
In a particularly preferred embodiment, states determined by the cellular state determination method of the present invention includes, for example, differentiated states, undifferentiated states, cellular responses to external factors , cell cycles , growth states , and the like . More specifically, such a state includes, for example, without limitation, a response of a cancer cell to an anticancer agent , drug resistance, a response to abiological clock, a differentiated state of a stem cell (e.g., a mesenchymal stem cell, a neural stem cell, etc.), an undifferentiated state of a purified stem cell (e.g., an embryonic stem cell, etc.), and the like.
Therefore, in a preferred embodiment, a cell determined by the cellular state determination method of the present invention includes, for example, without limitation, a stemcell or a somatic cell, or amixture thereof .
Alternatively, suchacell includes anadherent cell, a suspendedcell, a tissue forming cell, andamixture thereof .
In a preferred embodiment , the cellular state determination method of the present invention may be performed for a cell fixed on a substrate which is a solid phase support. In such a case, the solid phase support is called a chip. When cells are arrayed on the substrate, the substrate is also called an array.
In a particularly preferred embodiment of the cellular state determinationmethodof thepresent inventio , advantageously, a transcription control sequence used for determination may be operably linked to a reporter gene sequence and may be transfected into a cell. In this case, the transcription levelof the transcriptioncontrol sequence can be measured as a signal from the reporter gene.
Such trans ction maybe performed in the solidphase or in the liquid phase. For transfection, a technique for increasing the efficiency of introduction of a target substance into a cell may be used. In the present invention, a target substance (e.g., DNA, RNA, a polypeptide, a sugar chain, or a composite substance thereof, etc. ) , which cannot be substantially introduced into cells under typical conditions, is presented (preferably, contacted) along with an actin acting substance, such as fibronectin, to a cell, therebymaking it possible to efficiency introduce the target substance into cells. Therefore, the transfection method comprises the steps o : A) providing a target substance (i.e. , DNA comprising a transcription control sequence) and B) providing an actin acting substance (e.g. , fibronectin) , wherein the order of steps of A) and B) is not particularly limited, and C) contacting the target substance and the actin acting substance with the cell. The target substance and the actin acting substance may be provided together or separately. The actin acting substance may be used as described in detail above for the composition of the present invention for increasing the efficiency of introduction of a target substance into a cell. Such a technique can be carried out as appropriate based on the present speci ication by those skilled in the art. Therefore, the actin acting substance may be used in a manner which is described in detail above for the composition of the present invention for increasing the efficiency of introduction of a target substance into a cell. Preferably, the actin acting substance may be an extracellular matrix protein (e.g., fibronectin, vitronectin, laminin, etc. ) oravariant thereof . More preferably, fibronectin or a variant or fragment thereof may be used.
In one embodiment, transcription control sequence used in the present invention may be capable of binding to a transcription factor. Examples of such a transcription factor include, but are not limited to, ISRE, RARE, STAT3, GAS, NFAT, MIC, API, SRE, GRE, CRE, NFKB, ERE, TRE, E2F, Rb, p53, and the like. These transcription factors are commercially available from BD Biosciences Clonetech, CA, USA. ISRE is related to STAT1/2. RARE is related to retinoic acid. STAT3 is related to the control of differentiation. GRE is related to the metabolism of sugar. CRE is related to cAMP. TRE is related to thyroid hormone. E2F is related to cell cycle. p53 is related to Gl check point . Therefore, such information can be used to determine a state of a cell.
In a preferred embodiment, the determination step of b) of the present invention comprises comparing the phases of the time-lapseproflies . Phases canbe calculatedbythose skilled in the art using general techniques as described herein above and techniques described in the examples below.
In another preferred embodiment, the determination step of b) of the present invention comprises calculating a difference between the time-lapse profile of the cell and a control profile . The difference can be calculated by those skilled in the art using general techniques as described herein above and techniques described in Examples below. In another preferred embodiment, the determination step of b) of the present invention comprises a mathematical process selected from the group consisting of signal processing and multivariate analysis. Such a mathematical process can be easily carried out by those skilled in the art based on the description of the present specification.
(Generation of data) In one aspect, thepresent inventionprovides amethod for generating profile data of information of a cell. The method comprises the steps of: a) providing and fixing the cell to a support; and b) monitoring a biological factor or an aggregation of biological factors on or within the cell over time to generate data of the profile of the cell. In this aspect, the present invention is characterized in that the cell is fixed to substantially the same site of the support so that information can be continuously (e.g., in a time-lapse manner, etc.) obtained from the same cell. Thereby, it is possible to monitor a biological factor and an aggregation of biological factors over time. The time-lapse monitoring makes it possible to obtain a profile of a cell and construct a digital cell. To fix a cell to a support, a fixing agent, such as a salt or the like, may be used for the support in the present invention. A combination of a salt, a complex of a positively charged substance and a negatively charged substance, and a cell may fix the cell to the support . Any salt may be used in the present invention. Examples of such a salt include, but are not limited to, calcium chloride, sodium hydrogen phosphate, sodiumhydrogen carbonate, sodiumpyruvate, HEPES, sodium chloride, potassiumchloride, magnesium sulfide, iron nitrate, amino acids, vitamins, and the like. Examples of the above-described combination of a positively charged substance and a negatively charged substance include, but are not limited to, complexes of a negatively charged substance selected from the group consisting of DNA, RNA, PNA, apolypeptide, a chemical compound, and a complex thereof and a positively charged substance selected from the group consisting of a cationicpolymer, a cationic lipid, a cationic polyamino acid and a complex thereof . In a preferred embodiment of the present invention, a biological factor of interest may be a nucleic acid molecule or a molecule derived from the nucleic acid molecule . This is because most nucleic acid molecules carry genetic information, from which cellular information can be obtained.
In another aspect, the present invention relates to data obtained by a method comprising the steps of: a) providing and fixing the cell to a support; and b) monitoring a biological factor or an aggregation of biological factors on or within the cell over time to generate data of the profile of the cell. Such data is obtained by the method which is not conventionally available, and is thus novel. Therefore, the present invention provides a recording medium storing such data.
In another aspect, the present invention relates to a method for generating profile data of information of a plurality of cells in the same environment . The method comprises the steps of: a) providing a plurality of cells on a support which can maintain the same environment ; and b) monitoring a biological factor or an aggregation of biological factors on orwithin the cells over time to generate profile data of the cells. In this aspect, the present invention is characterized in that profile data of information of a plurality of cells in the same environment can be obtained. Techniques for providing such an environment is also within the scope of the present inventio . To provide the same environment to a plurality of cells, a fixing agent, such as a salt or the like, may be used for the support in the present invention. A combination of a salt, a complex of a positively charged substance and a negatively charged substance, and cells may fix the cells to the support . Any salt maybe used in the present invention . Examples of such a salt include, but are not limited to, calciumchloride, sodiumhydrogen phosphate, sodiumhydrogen carbonate, sodium pyruvate, HEPES, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids , vitamins , and the like . Examples of the above-described combination of a positively charged substance and a negatively charged substance include, but are not limited to, complexes of a negatively charged substance selected from the group consisting of DNA, RNA, PNA, apolypeptide, a chemical compound, and a complex thereof and a positively charged substance selected from the group consisting of a cationic polymer, a cationic lipid, a cationic polyamino acid and a complex thereof . In a preferred embodiment of the present invention, a biological factor of interest may be a nucleic acid molecule or a molecule derived from the nucleic acid molecule . This is because most nucleic acidmolecules carry genetic information, from which cellular information can be obtained.
In a preferred embodiment, an actin acting substance is preferably provided to the cells in the method of the present invention. The actin acting substance acts on actin within the cells to deform the internal cytoskeleton to acilitate introduction of an external f ctor into the cells . The presence of such an actin acting substance makes it possible to investigate an influence of an external factor of interest on the cells .
In one embodiment , a biological factor targeted by the present invention is at least one factor selected from the group consisting of nucleic acids , proteins , sugar chains , lipids, low molecular weight molecules, and composite molecules thereof .
In a preferred embodiment, cells targeted by the present invention are preferably cultured for a certain period of time without stimulation before monitoring. This procedure is performed for the purpose of synchronization of the target cells. The period of time required for synchronization is, for example, advantageously at least one day, more preferably at least two days, even more preferably at least 3 days, and still even more preferably at least 5 days. It should be noted that as the period of time for culture is increased, the necessity of maintenance of culture conditions is increased. In the synchronization procedure, the same medium is preferably supplied to cells. Therefore, culture medium is preferably consistent or at least changed in the consistent manner. To achieve this, a means for causing convection in the medium may be preferably provided and used.
In a more preferred embodiment, a biological factor provided to a cell in the present invention may comprise a nucleic acid molecule encoding a gene. The nucleic acid molecule encoding a gene is preferably transfected into a cell. Preferably, such a biological factor may be provided alongwithatransfectionreagent (gene introduction reagent ) . More preferably, the nucleic acid molecule encoding a gene may be provided to a cell along with a gene introduction reagent and an actin acting substance. In this case, the cell is preferably provided with a complex of a salt , a positively charged substance, and a negatively charged substance (in this case, a nucleic acid molecule and a gene introduction reagent). Thus, the cell and the target molecule are fixed on a support. In addition, this technique makes it possible to allow separate biological factors (e.g. , nucleic acid molecules) to be separately introduced into cells without a partition. As substantially no partition is used, aplurality of cells canbemonitored in substantially the same environment. Further, different biological factors can be introduced into a cell, thereby making it possible to obtain a profile of a state of the cell affected by the biological factors . Such a profile can be stored as data. Such data may be stored in a certain standard format, and therefore, can be reproduced and compared. Thus, the present invention has an effect which is not achieved by conventional biological assays. Such data, which is once obtained and stored in such a starndard format, can be extracted and used for various purposes and a number of times . For example, researchers can perform "virtual experiments" to conduct various analyses under the same conditions while taking into consideration differences in a substantially infinite number of parameters. In addition, since virtual experiments and the results thereof are stored in a raw data format, undergraduate and graduate students, who otherwise spend most of their school life doing labor work, can have data analysis education in the true sense. The above-described cellular profile data can be easily standardized, therebymaking it possible to do research based on data which can be considered to be obtained by experiments under the same conditions over the world. Such data may be distributed in a standardizedform. Such a standardizedform may be readable to typical computers (e.g. , computers having a commonly available OS, such as Windows, Mac, UNIX, LINUX, or the like) . Data produced in the present invention may include generated cellular pro ile data, information about experimental conditions used in data generation, information about cells, information about environments, and the like.
In a preferred embodiment, a profile targeted by the present invention may include a profile of gene expression, aprofile of an apoptotic signal, aprofile of a stress signal, a profile of localization of a molecule (preferably, the molecule is labeled with a fluorescent, phosphorescent, or radioactive substances or a combination thereof) , a profile of changes in cellular morphology, a profile of a promoter, aprofile of a promoter dependent on a specific pharmaceutical agent (e.g., antibiotics, ligands, toxins, nutrients, vitamins, hormones, cytokines, etc.), a profile of intermolecular interaction, and the like. In an embodiment in which the present invention targets aprofile of a promoter dependent on a specific pharmaceutical agent, it is preferable that the present invention may further comprise administering the specific pharmaceutical agent .
In a preferred embodiment , the present invention may further comprise providing an external stimulus to the cell. Such an external stimulus may or may not be a biological actor. The external factor may be any f ctor and includes , without limitation, substances or other elements (e.g., energy, such as ionizing radiation, radiation, light, acoustic waves, and the like). In one embodiment, an external factor used in the present invention may be RNAi. RNAi can be used to substantially suppress an arbitrary gene. It is possible to produce RNAi for all existing genes and investigate the effect of RNAi on the genes . RNAi canbe createdby techniques well known in the art .
In another embodiment , an external factor of the present invention may comprise a chemical substance which does not exist in organisms. By providing such chemical substance which does not exist in organisms, it is possible to collect a variety of information. Data which is once collected can be reused. Therefore, assuming that a chemical substance which does not exist in organisms is not substantially available, if data can be once obtained for such a chemical substance in accordance with the present invention, research can be continued without worrying bout the availability of such a chemical substance.
In one embodiment, an external factor targeted by the present invention may comprise a ligand to a cellular receptor. By analyzing a ligand, it is possible to study various signal transduction pathways. Therefore, in such a case, a profile obtained according to the present invention may be a profile of reσeptor-ligand interactions.
In a preferred embodiment of the present invention, a profile of cellular morphology may be obtained. In this case, a method of the present invention may further comprise applying to a cell a stimulus which may be selected from the group consisting of overexpression of a gene, underexpression of a gene, knock down of a gene, addition of an external factor, and a change in an environment. In a preferred embodiment, a profile obtained according to the present invention may be a profile of interactions between molecules present within a cell. Such an intermolecular interaction includes, but is not limited to, interaction between molecules present in a signal transduction pathway, interaction between a receptor and a ligand, interaction between a transcription factor and a transcription factor sequence, and the like.
In another preferred embodiment, a profile obtained according to the present invention may be a profile of interaction between molecules present in a cell. In this case, a method of the present invention may further comprise observing a cell using a technique selected from the group consisting of a two-hybrid method, FRET, and BRET. The two-hybridmethod detects intermolecular interactionwithin a cell. Specifically, this technique is described in, for example, Protein-Protein Interactions, A MOLECULAR CLONING MANUAL, Edited by Erica Golemis , Cold Spring Habor Laboratory Press, Cold Spring Harbor, New York (this document also describes FRET) . FRET is a technique for detecting inter- or intra-molecular resonance energy shift as a fluorescent wavelength, andis describedin, forexample, Protein-Protein Interactions (supra) ; and Miyawaki A. , Visualization of the spatial and temporal dynamics of intracellular signaling,
Dev. Cell, 2003 Mar; 4 (3 ): 295-305. BRET is an intermolecular interaction assay system and is described, for example, Boute N. , The use of resonance energy transfer in high-throughput screening: BRET versus FRET, Trends Pharmacol Sci., 2002 Aug; 23(8):351-4.
In a preferred embodiment, cells targeted by the present invention are preferably arranged on a support in a pattern of an array. In this case, preferably, a plurality of cells targeted by the present invention may be spaced at intervals of 10 cm at maximum, more preferably 1 cm at maximum, even more preferably 1 mm at maximum, and most preferably 0.1 mm at maximum. The cells need to be spaced at minimum intervals . Such intervals may be preferably set so that substantially no interaction occurs.
In one embodiment , a profile obtained according to the present invention may or may not be obtained in real time. A real time profile may be advantageous. When simultaneity is important , it is important to obtain aprofile in real time. Alternatively, when a profile is intended to be stored, the profile is not necessarily obtained in real time.
In an additional embodiment, the present invention further comprises fixing a cell to a solid phase support . In this case, the cell is fixed to the solid phase support along with a salt, a complex, an actin acting substance, or the like .
In one embodiment , data generated according to the present invention may contain information about a profile. In a preferred embodiment, data generated according to the present invention may contain information about conditions for monitoring, information about a cellular state, information about an external factor, information about environment, and the like.
In a preferred embodiment, at least two biological factors may be preferablymonitored in the present invention, more preferably at least 3 biological factors, and even more preferably at least 8 biological factors. Alternatively, all biological factors in a certain specific category (e.g. , all olfactory receptors, all gustatory receptors, etc. ) may be preferably monitored.
Alternatively, in another preferred embodiment , the present inventionmayfurther comprise arbitrarily selecting the above-described biological factors.
In a preferred embodiment , a cell targeted by the present invention may be selected from the group consisting of stem cells and somatic cells.
In one embodiment, a support used in the present invention is preferably a solid phase support . This is because cells are easily fixed to such a support . Such a solid phase support may be made of any material known in the art. The support may be in the form of a substrate.
In one embodiment of the present invention, the above-described biological factor may be a nucleic acid and the above-described cell may be transfected with the nucleic acid. By transfecting the cell with the nucleic acid, an influence of the nucleic acid on the cell can be collected in real time or in a standardized storable format into data or a profile. This cannot be achieved by conventional techniques . In a preferred embodiment, transfection may be performedin solidphase or in liquidphase . Morepreferably, transf ction may be advantageously performed in solid phase . This is because data collection and standardization can be more easily carried out . In a preferred embodiment of the present invention, a profile may be subjected to a process selected from the group consisting of phase comparison, calculation of a difference from a control profile, signal processing, and multivariate analysis. Data processed in such a manner may fall within the scope of the present invention.
In another aspect, the present invention provides a method for presenting profile data of information of a plurality of cells in the same environment. The method comprises the steps of: a) providing a plurality of cells on a support capable of retaining the cells in the same environment; b) monitoring a biological factor or an aggregation of biological factors on or within the cells over time to generate profile data of the cells; and c) presenting the data.
The above-described support capable of retaining a plurality of cells in the same environment can be achieved as described elsewhere herein. The step of generating data can be performed as described elsewhere herein. The step of presenting data can be performed as described elsewhere herein . Examples of amethod of performing such presentation include, but are not limited to, techniques of using various sensory means, such as visual means, auditory means, olfactory means, tactile means, gustatory means, and the like. Preferably, a visually presenting means may be used. Such visual means includes, without limitation, a computer display and the like.
Preferably, in the presentation method of the present invention, presentation may be performed in real time. Alternatively, stored data may be called and presentation may be delayed. When presentation should be performed in real time, data signals may be transferred directly to, for example, a display.
In another aspect, the present invention provides a method for determining states of cells in the same environment. The method comprises the steps of: a) providing a plurality of cells on a support capable of retaining the cells in the same environment; b) monitoring a biological factor or an aggregation of biological factors on or within the cells over time to generate profile data of the cells; and c) determining the states of the cells based on the data.
The above-described support capable of retaining a plurality of cells in the same environment can be achieved as described elsewhere herein. The step of generating data can be performed as described elsewhere herein. The step of determining the states of the cells may be performed by correlating the generated data with information about the cells, or comparing the generated data with standard data. In this case, the data may be statistically processed.
Therefore, in a certain embodiment, the present inventionmayfurthercomprise correlatingaprofile obtained according to the present invention with a state of a cell before obtaining the time-lapse profile. To perform determination smoothly, the cells targeted by the present invention may advantageously include cells whose states are known. It is possible to hold data of cells whose states are known, determination can be quickly performed by comparing data between the known cell and unknown cells . In determination, at least two biological factors are preferably present. In this case, the plurality of biological factors may belong to heterologous categories (e.g., proteins and nucleic acids, etc.) or homologous categories .
Preferably, the present invention may further comprise arbitrarily selecting a biological factor. Any biological factor can be selected and used to characterize a state of a cell to some extent, and in some cases, identification is possible. Thus, the present invention has an effect which cannot be expected from conventional techniques .
In the determinationmethod of the present invention, data may be preferably generated in real time. When data is generated in real time, an unknown substance or state of an unknown cell may be determined in real time.
In the determination methodof the present invention, examples of a state of a target cell include, but are not limited to, differentiated states, undifferentiated states, cellular responses to external factors, cell cycles, growth states, and the like.
A cell targeted by the present invention maybe either a stem cell or a somatic cell. Any somatic cell may be used. A cell may be selected by those skilled in the art, depending on the purpose of use of the cell.
A solidphase support usedin the determinationmethod of the present invention may comprise a substrate. In the present invention, such a substrate can be used as a part of a computer system, so that determination can be automated. An exemplary configuration of such a system is shown in
Figure <^ .
In a preferred embodiment, in the determination method of the present invention, the biological factor may be a nucleic acid molecule, and the cell is transfected with the nucleic acid molecule. Transfection may be performed- on a solid phase support using any material, but preferably a gene introduction agent, more preferably a salt, an actin acting substance, or the like. Transfection maybe performed in solid phase or in liquid phase, and preferably in solid phase.
In a determination method of the present invention, a target biological factormaybe capable of binding to another biological factor. By investigating a biological factor having such a property, a network mechanism in a cell may be elucidated.
In a determination method of the present invention, the determination step may comprise a mathematical process selected from the group consisting of comparison of phases of profiles , collection of differences from a control profile , signal processing, and multivariate analysis. Such processing techniques are well known in the art and described in detail herein.
In another aspect, the present invention provides a method for correlating an external factor with a cellular response to the external factor. The method comprises the steps of: a) exposing a plurality of cells to an external factor on a support capable of retaining the cells in the same environment; b) monitoring a biological factor or an aggregation of biological factors on or within the cells over time to generate profile data of the cells; and c) correlating the external factor with the profile. Exposure of the cells to the external factor may be achieved by placing the cells and the external factor into an environment in which the cells are contactedwith the external ctor . For example, when the cells are fixed on the support , the external factor is added to the support to achieve exposure . Techniques for generating and correlating data are also well known in the art, and may be used singly or in combination. Preferably, statistical processes are performed to generate statistically significant data and information.
In a preferred embodiment , in the correlation method of thepresent invention, the cells maybe fixedon the support . Since the cells are fixed, data can be easily standardized, so that data can be significantly efficiently processed.
In a preferred embodiment, a correlation method of the present invention may further comprise using at least two external factors to obtain a profile for each external factor. Techniques for obtaining such a profile are well described herein.
More preferably, the correlation step may further comprise dividing at least two profiles into categories and classifying the external factors corresponding to the respective profiles into the categories . By categorization , data can be processed in a more standardized manner.
In a preferred embodiment, a profile obtained by the present invention may be presented in real time. When data is intended to be stored, data may not be particularly presented in real time.
In a preferred embodiment , a cell used in the present invention may be cultured on an array. In such a case, therefore, the cell is preferably covered with medium. Any medium which is commonly used for cells may be used.
In a preferred embodiment of the present invention, the step of monitoring a profile may comprise obtaining image data from the array. Particularly, when a pro ile contains visual information (e.g., emission of fluorescence due to gene expression), the profile can be obtained by capturing image data.
In a correlation method of the present invention, the step of correlating an external factor with a profile may comprise distinguishing phases of the profile. Distinguishing phases of the profile can be achieved only after the present invention provides time-lapse profiles obtained in the same environment .
An external factor targeted by the present invention may be selected from the group consisting of a temperature change, a humidity change, an electromagnetic wave, a potential difference, visible light, infrared light, ultraviolet light. X-ray, a chemical substance, a pressure, a gravity change, a gas partial pressure, and an osmotic pressure. Preferably, the chemical substance may be a biological molecule, a chemical compound, or a medium. Examples of such a biological molecule include, but are not limitedto, nucleic acidmolecules , proteins, lipids, sugars, proteolipids , lipoproteins, glycoproteins, proteoglycans, and the like. Such a biological molecule may also be, for example, a hormone, a cytokine, a cell adhesion factor, an extracellular matrix, or the like. Alternatively, the chemical substance may be either a receptor agonist or antagonist .
In another aspect, the present invention relates to a method for identifying an unidentified external factor given to a cell from a profile of the cell. The method comprises the steps of: a) exposing a cell to a plurality of known external factors on a support capable of retaining the cell in the same environment; b) monitoring a biological factor or an aggregation of biological factors on or within the cell over time to generate a profile of the cell to each of the known external factor and generate profile data of the cell; c) correlating each of the known external factors with each of the profiles; d) exposing the cell to an unidentified external factor; e) monitoring a biological factor or an aggregation of biological factors on or within the cell exposed to the external factors over time to obtain aprofile of the cellwith respect to the unidentified external factor; f) determining, from the profiles obtained in the step of b) , a profile corresponding to the profile obtained the step of e); and g) determining that theunidentifled external factor is the known external factor corresponding to the profile determined in the step of f) . Techniques for exposure to external factors, data generation, correlation, exposure to unidentified external factors, and the like are described elsewhere herein and can be selected as appropriate depending on the purpose by those skilled in the art taking such descriptions into consideration.
In another aspect, the present invention provides a method for identifying an unidentified external factor given to a cell from a profile of the cell. The method comprises the steps of: a) providing data relating to a correlation relationship between known external factors and profiles of the cell in response to theknown external ctors , in relation to a biological factor or an aggregation of biological factors on or within the cell; b) exposing the cell to the unidentified external factor; c) monitoring the biological factor or the aggregation of the biological factors on or within the cell to obtain a profile of the cell; d) determining, from the profiles provided in the step of a) , a profile corresponding to the profile obtained in the step of c); and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the step of d) . Techniques for exposure to external factors, data generation, correlation, exposure to unidentified external factors, and the like are described elsewhere herein and can be selected as appropriate depending on the purpose by those skilled in the art taking such descriptions into consideration.
In another aspect, the present invention provides a method for obtaining a profile relating to information of a plurality of cells in the same environment . The method comprises the steps of: a) providing a plurality of cells on a support capable of retaining the cells in the same environment; and b) monitoring a biological factor or an aggregation of biological factors on or within the cell over time to generate a profile of the cells . Techniques for exposure to external factors , data generation, correlation, exposure to unidentified external factors, and the like are described elsewhere herein and can be selected as appropriate depending on the purpose by those skilled in the art taking such descriptions into consideration.
In another aspect, the present invention relates to a recording medium in which data generated by a method for generating cellular profile data of the present invention is stored. Data may be stored in any format. Any recording medium may be used. Examples of such a recording medium include, but are not limited to, CD-ROMs, flexible disks, CD-Rs, CD-RWs, MOs, mini disks, DVD-ROMs, DVD-Rs, memory sticks , hard disks , and the like . The present invention also relates to a transmission medium in which data generated by amethod for generatingcellularprofile dataof the present invention is stored. Examples of such a transmission medium include, but are not limited to, networks, such as intranets, the Internet, and the like.
A recording medium or transmission medium of the present invention may further contain data relating to at least one piece of information selected from the group consistingof information about conditions for themonitoring step, information about the profile, information about the cellular state, and information about the biological factor. Data relating to such information may be stored while being linked to one another. Preferably, the data may be advantageously standardized. Standardized data can be distributed on general distribution pathways. The above-described linkage may be constructed for each cell or for each biological factor, or for both.
In another aspect, the present invention relates to data generated by a method for generating cellular profile data of the present invention . Such data cannot be generated by conventional techniques and is thus novel. In another aspect , the present invention provides a system for generating profile data of information of a plurality of cells in the same environment . The system comprises: a) a support capable of retaining a plurality of cells in the same environment; b) means for monitoring a biological factor or an aggregation of biological factors on or within the cells over time; and c) means for generating profile data of the cells from a signal obtained from the monitoring means. The support capable of retaining cells in the same environment can be made by those skilled in the art using a technique first providedby the present invention . Such a technique is attributed to the finding that cells are fixed and arrayed without a partition. Examples of the monitoring means include, but are not limited to , microscopes (e.g., optical microscopes, fluorescence microscopes, phase-contrast microscopes, etc.), electron microscopes, scanners, naked eyes, infrared cameras, confoσal/nonconfoσalmicroscopes, CCD cameras , and the like. An exemplary configuration of such a system is shown in Figure 44.
In a system of the present invention, the system may not necessarily contain cells from the start, but preferably may contain cells which are advantageously fixed on a support . In such a case, fixation is preferably standardized. In addition, the cells are fixed and spaced, for example, without limitation, at intervals of 1 mm or the like.
In a preferred embodiment, at least one substance selected from the group consisting of salts and actin acting substances may be preferably adhered to the support . By adhering cells to the support with a salt or an actin acting substance, or preferably with both, fixation of the cells and/or introduction of a substance into the cells can be enhanced.
Examples of the monitoring means used in the system of the present invention include, but are not limited to, optical microscopes, fluorescence microscopes, phase-contrast microscopes, reading devices using a laser source, means using surface plasmon resonance (SPR) imaging, electric signals, chemical or biochemical markers singly or in combination, radiation, confocal microscopes, nonconfocal microscopes, differential interference microscopes, stereoscopic microscopes, video monitors, infrared cameras , andthe like . Preferabl , a scanner (e.g. , a scanner for scanning a surface of a substrate using a white light source or laser) may be used. The reason a scanner is preferable is that fluorescence can efficiently transmit excited energy and microscopic technology can be easily applied. Further, measurement can be advantageously performedwithout significant damage to cells . An exemplary configuration of such a system is shown in Figure 44.
In another aspect, the present invention provides a systemforpresenting aprofile of information of aplurality of cells in the same environment . The system comprises : a) a support capable of retaining a plurality of cells in the same environment ; b) means formonitoring abiologicalfactor or an aggregation of biological factors on or within the cells over time; σ) means for generating profile data of the cells from a signal obtained from the monitoring means; and d) means for presenting the data. The support, the monitoring means , and the data generating means can be made as described elsewhere herein . The means forpresenting data can be achieved by techniques well known in the art . Examples of such a data presenting means include, but are not limited to, computer displays, loudspeakers, and the like. An exemplary configuration of such a system is shown in Figure <i^ .
A presentation system of the present invention may further comprise a plurality of cells , in which the cells are preferably fixed to the support . In such a case, at least one substance selected from the group consisting of salts and actin acting substances may be preferably adhered to the support . By adhering cells to the support with a salt or an actin acting substance, or preferably with both, fixation of the cells and/or introduction of a substance into the cells can be enhanced.
Any monitoring means may be used. Examples of the monitoring means include, but are not limited to, optical microscopes; fluorescence microscopes; phase microscopes; reading devices using a laser source; means using surface plasmon resonance (SPR)imaging, electric signals, chemical or biochemical markers singly or in combination; and the like.
Any data presenting means may be used, including, without limitation, displays, loudspeakers, and the like.
In another aspect, the present invention provides a system for determining a state of a cell. The system comprises: a) a support capable of retaining a plurality of cells in the same environment; b) means for monitoring a biological factor or an aggregation of biological f ctors on or within the cells over time; c) means for generating data from a signal obtained by the monitoring means; and d) means for extrapolating the state of the cell from the data. The support, the monitoring means, and the data generating means can be made by those skilled in the art as described elsewhere herein. The means for extrapolating a state of a cell from data may be produced and used by techniques well known in the art . For example, measured data can be compared with standard data for known cells to achieve extrapolation. A device storing a program for such extrapolation or a computer capable of executing such a programmay be used as the extrapolation means . An exemplary configuration of such a system is shown in Figure 44.
In another aspect , the present invention provides a system for correlating an external factor with responses of cells to the external factor. The system comprises: a) a support capable of retaining a plurality of cells in the same environment; b) means for exposing the cell to the external factor; c) means for monitoring a biological factor or an aggregation of biological factors on or within the cells over time; d) generating profile data of the cells from a signal from the monitoring means; and e) means for correlating the external factor with the profile. The support, the monitoring means, and the data generating means can be made by those skilled in the art as described elsewhere herein. The means for exposing the cells to the external factor can be designed and carried out as appropriate by those skilled in the art depending on the properties of the external factor. The correlation means can employ a recording medium storing a program for correlation or a computer capable of executing such a program. Preferably, a system of the present invention comprises a plurality of cells . An exemplary configuration of such a system is shown in Figure 44 .
In another aspect, the present invention provides a system for identifying an unidentified external factor given to a cell based on a profile of the cell. The system comprises: a) a support capable of retaining a plurality of cells in the same environment; b) means for exposing the cell to known external factor; σ) means for monitoring a biological factor or an aggregation of biological factors on or within the cells over time; d) means for obtaining a profile of the cell withrespect to each of the known external factors to generate profile data of the cell; e) means for correlating each of the known external factors with each profile; f ) means for exposing the cell to the unidentified external factor; g) means for comparing the profiles of the known external factors obtained by the means of d) with the profile of the unidentified external factor to determine a profile of the unidentified external factor from the profiles of the known external factors , wherein the determinedunidentifledexternal factoris theknown external factor corresponding to the determined profile . The support , the exposure means, the monitoringmeans, the data generating means , and the correlation means , and the other exposure means can be made and carried out as appropriate by those skilled in the art as described elsewhere herein. The means for determining a corresponding profile can also be made and carried out by utilizing a recording medium storing a program capable of executing such a determination process and a computer capable of executing such a program. Preferably, a system of the present invention comprises a plurality of cells. An exemplary configuration of such a system is shown in Figure 44. In another aspect, the present invention provides a system for identifying an unidentified external factor given to a cell based on a profile of the cell. The system comprises: a) a recording medium storing providing data relating to a correlationrelationship betweenknown external factors and profiles of the cell in response to the known external factors, in relation to a biological factor or an aggregation of biological factors on or within the cell; b) means for exposing the cell to the unidentified external factor; c ) a support capable of retaining a plurality of cells in the same environment ; d)means for monitoring a biological factor or an aggregation of biological factors on or within the cells over time; e) means for obtaining a profile of the cell from a signal obtained by the monitoring means ; ) means for determining, from the profiles stored in the recordingmedium of a) , a profile corresponding to the profile obtained with respect to the unidentified external factor, wherein the determined unidentified external factor is the known external factor corresponding to the determinedprofile . The support, the exposure means, the monitoring means, the data generating means, and the correlation means, and the other exposure means canbemade and carriedout as appropriate by those skilled in the art as described elsewhere herein. The means for determining a corresponding profile can also be made and carriedout byutilizing arecordingmedium storing a program capable of executing such a determination process and a computer capable of executing such a program. Preferably, a system of the present invention comprises a plurality of cells . An exemplary configuration of such a system is shown in Figure 44.
In another aspect, the present invention relates to a support capable of maintaining the same environment for a plurality of cells . Such a support was first provided by the present invention. By utilizing such a support, a plurality of cells can be analyzed in the same environment .
Preferably, cells are arranged on a support in the form of an array. This is because standardized analysis can be achieved. In this case, the support may preferably comprise a salt or an actin acting substance . Morepreferably, the support may advantageously comprise a complex of a positively charged substance and a negatively charged substance. This is because cells can be easily fixed to the support . Actin acting substances are preferable when the inside of cells is analyzed, since the actin acting substances increase the efficiency of introduction of external factors into cells. Therefore, in a preferred embodiment of the present invention, the support may comprise a salt and an actin acting substance, and more preferably may comprise a complex of a positively charged substance and a negatively charged substance.
A support of the present invention is characterized in that cells may be provided and spaced at intervals of 1 mm. In the case of such intervals , it is not conventionally possible to provide an environment without a partition. Therefore, the present invention has a remarkable effect and practicability.
In a preferred embodiment, a support of the present invention may comprise a cell fixed thereto . In a more preferred embodiment, a support of the present invention may comprise a biological factor fixed thereto .
In a preferred embodiment, at least two biological factors may be fixed to the support . Such biological factors may be factors selected from the group consisting of nucleic acid molecules , proteins, sugars, lipids, metabolites, low molecular weight molecules , and complexes thereo , and factors containing physical elements and/or temporal elements .
In a more preferred embodiment , a cell and a biological factor may be fixed to a support of the present invention in a mixed manner. The biological factor and the cell may be provided so that they can interact with each other. Such interactionmayvary depending on the biological factor . According to the properties of the biological factor, those skilled in the art can understand how the biological actor interacts with the cell andwhere the biological factor is positioned so as to interact with the cell.
In a preferred embodiment, a salt, a complex of a positively charged substance and a negatively charged substance, and an actin acting substance are fixed along with a cell and a biological factor to a support of the present invention.
In a more preferred embodiment , a salt, a complex of a positively charged substance and a negatively charged substance, and an actin acting substance are fixed along with a cell and a biological factor to a support of the present invention in the form of an array. With such a structure, a cell chip capable of generating the profile data of a cell can be provide . The support has a structure in which a salt , a complex of a positively charged substance and a negatively charged substance, and an actin acting substance are fixed along with a cell and a biological factor in the form of an array. Such a support is also called a "transfection array" .
Examples of a salt used in the support of the present invention include, but are not limited to, calcium chloride, sodiumhydrogenphosphate, sodiumhydrogencarbonate, sodium pyruvate, HEPES, sodium chloride, potassium chloride, magnesium sulfide , iron nitrate, amino acids, vitamins, and the like. A preferable salt is, for example, without limitation, sodium chloride or the like.
Examples of a gene introduction agent used in the support of the present invention include, but are not limited to, cationic polymers, cationic lipids, polyamine-based reagents, polyimine-based reagents, calcium phosphate, oligofectamin, SureFECTOR EM-101-001 (B-Bridge), UniFECTOR EM- 101-002 (B-Bridge), siFECTORl EM- 101-004 (B-Bridge), and the like. Preferable gene introduction agents include, but are not limited to, lipofectamin, oligofectamin, SureFECTOR EM-101-001 (B-Bridge), UniFECTOR EM-101-002 (B-Bridge), siFECTORl EM-101-004 (B-Bridge), and the like.
Examples of an actin acting substance used in the support of the present invention include, but are not limited to, fibronectin, laminin, vitronectin, and the like. A preferable actin acting substance is, for example, without limitation, fibronectin.
Examples of a nucleic acid molecule used in the support of the present invention include, but are not limited to, nucleic acid molecules comprising transcription control sequences (e.g., promoters, enhancers, etc.), gene coding sequences, genomic sequences containing nontranslation regions, nucleic acid sequences encoded by the genome of a host (a fluorescent protein gene, E. coli/yeast self-replication origins, a GAL4 domain, etc.), and the like. Preferable nucleic acid molecules include, but are not limited to, transcription control sequences (e.g. , promoters, enhancers, etc.), gene coding sequences, genomic sequences containing nontranslation regions, and the like.
Examples of a cell used in the support of the present invention include, but are not limited to, stem cells, established cell lines , primary culture cells , insect cells , bacterial cells, and the like. Preferable cells include, but are not limited to, stem cells, established cell lines, primary culture cells , and the like .
Examples of a material for a support of the present invention include, but are not limited to, glass, silica, plastics, and the like. Preferable materials include, but are not limited to, the above-described materials with coating.
In another aspect, the present invention provides a method for producing a support comprising a plurality of cells fixed thereto and capable of maintaining the same environment for the cells. The method comprises the steps of: A) providing the support; and B) fixing the cells via a salt and a complex of a positively charged substance and a negatively charged substance onto the support . The step of providing a support may be achieved by obtaining a commerciallyavailable support ormoldinga support material . A support material may be prepared by mixing starting materials or the material as required. The fixing step can be carried out by using techniques known in the art . Examples of such fixing techniques include, but are not limited to, an ink jet printing technique, a pin array technique, a stamping technique, and the like . These techniques are well known and can be performed as appropriate by those skilled in the art .
In a preferred embodiment , the fixing step in the present invention may comprise fixing a mixture of the salt , the complex of a gene introduction agent and an actin acting substance (positively charged substances) and a nucleic acid molecule (a negatively charged substance), and the cell in the form of an array. Such a fixing step may be achieved by printing techniques .
In another aspect, the present invention provides a device for producing a support comprising a plurality of cells fixed thereto and capable of maintaining the same environment for the cells. The device comprises: A) means for providing the support; and B) means for fixing the cells via a salt and a complex of a positively charged substance and a negatively charged substance onto the support . The support may be obtained using means which can perform the above-described methods. Examples of such means include, but are not limited to, a support molding means, a material formulating means (e.g., a mixing means ) , and the like. The molding means can employ techniques well known in the art . The fixing means may comprise a printing means. As such a printing means, commercially available ink jet printers can be used.
(Correlation of external factors)
In another aspect, the present invention provides a method for correlating an external factor with a response of a cell to the external factor. The method comprises the steps of: a) exposing the cell to the external factor; b) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; and c) correlating the external factor with the time-lapse profile.
An external factor used in the present invention is not particularly limited. Such an external factor may be preferablyapplicable either directlyor indirectlyto cells . Techniques for exposing a cell to an external factor are well known in the art and vary depending on the type of the external factor. If an external factor is a substance, the substance is dissolved in a solvent and the resultant solution is dropped into a medium containing a cell, whereby the cell can be exposed to the external factor.
According to the correlation method of the present invention, a time-lapse profile can be produced as described above .
In a correlation method of the present invention, an external factor can be correlatedwith a time-lapse profile with various techniques. Briefly, a time-lapse profile which is previously obtained by dropping a certain external factor is used as a template. If a profile is not substantially different from the template , it can be inferred that the external factor is identified.
Preferably, the cell is monitored while being fixed on a solidphase support (e.g. , an array, a plate, amicrotiter plate, etc.). Fixation can be performed with techniques known in the art or techniques described herein.
In a preferred embodiment, the correlation method of the present invention may further comprise using at least two external f ctors to obtain a time-lapse profile for each external factor. In a certain embodiment, without limitation, at least 3 external factors may be preferably used, more preferably at least 4 external factors, and even more preferably at least 10 external factors.
In a particular embodiment, the correlation method of the present invention may further comprise dividing at least two time-lapseprofiles into categories andclassifying the external factors corresponding to the respective time-lapse profiles into the categories. Such division and classification can be easily carried out by those skilled in the art in accordance with the present specification. By such division andclassification , the method of the present invention can be used to achieve correlation and identification of unknown external factors.
In a preferred embodiment , a transcription control sequence used in the present invention may be, without limitation, a promoter, an enhancer, a silencer, other flanking sequences of structural genes in genomes , and genomic sequences other than exons . Apromoter is preferable, since the transcription level can be directly measured.
In a particular embodiment, transcription control sequences used in the present invention may be constitutive promoters, specific promoters , inducible promoters , and the like. The present invention is characterized in that any type of promoter can be used. According to the method of the present invention, profiles can be analyzed from a viewpoint of "procession". Therefore, it is possible to determine a state of a cell using any promoter or any set of promoters . Such determination cannot be achieved by conventional techniques. The present invention is highly useful since the present invention achieves what cannot be achieved by conventional techniques .
In apreferredembodiment , at least two transcription control sequences are monitored. By observing at least two transcription control sequences, at least 80% of the states of a cell can be typically identified. More preferably, at least 3 transcription control sequences are monitored. By observing at least three transcription control sequences, at least 90% of the states of a cell can be typically identified. In a most preferred embodiment , at least 8 transcription control sequences are monitored. By observing at least 8 transcription control sequences, substantially all of the states of a cell can be typically identified. Thus , although any transcription control sequences are selected, substantially all of the states of a cell can be determined by selecting and monitoring a small number of transcription control sequences as described above. This feature has not been conventionally expected. The method of the present invention is simpler, more precise and more accurate than conventional determination methods in which observation is made at time points and resultant data is statistically processed as heterologous groups.
Therefore, the determination method of the present invention preferably further comprises arbitrarily selecting at least one transcription control sequence from transcription control sequences before monitoring. An important feature of the present invention is such that a transcription control sequence, which does not exhibit specificity when investigated from point to point, can be used.
In a preferred embodiment , such a time-lapse profile may be presented in real time. The real time presentation may contain a time lag to some extent if it is performed substantially in real time. A tolerable time lag is, for example, 10 seconds at maximum, and more preferably 1 second at maximum, though the tolerable time lag depends on the required level of real time (simultaneity). For example, in the case of environment measurement requiring real time identification of external factors, the tolerable time lag may be, for example, 1 sec at maximum, 0.1 sec at maximum, or the like .
In a preferred embodiment, in the correlation step of c) of the present invention, the phase of the time-lapse profile may be used as information about the time-lapse profile in order to correlate the external factor with the time-lapseprofile. Thephaseis representedbyplus orminus depending on the signal intensity at a certain time . By using even such a simplified method, a cell or an external factor can be identified, whereby the precision of the method of the present invention can be demonstrated.
Preferably, in the method of the present invention, cells are advantageously cultured on an array. This is because a number of cells can be simultaneously observed.
In a preferred embodiment, the step of monitoring the transcription level over time may comprise obtaining image data from the array. This is because image data can be subjected to visual inspection and a human (particularly, a person skilled in the art, such as a medical practitioner or the like) can easily examine image data with his/her eyes .
In a preferred embodiment of the present invention, the step of correlating the external factor with the time-lapse profile may comprise distinguishing the phases of the time-lapse profiles. As described above, phase is a simple parameter, and its information processing is simple. Thus , cells can be well identified by such simple information processing.
In a preferred embodiment, examples of an external factor to be identified by the method of the present invention include, but are not limited to, a temperature change, a humidity change, an electromagnetic wave, a potential difference, visible light , infrared light , ultraviolet light , X-ray, a chemical substance, a pressure, a gravity change, a gas partial pressure, an osmotic pressure, and the like. These factors cannot be satisfactorily identified by conventional methods . By using the cell determination method of the present invention which places an importance on "procession", an influence of a factor on a cell can be well examined.
In a particularly preferred embodiment, an external factor to be identified by the method of the present invention may be a chemical substance. Examples of such a chemical substance include, but are not limited to, biological molecules, chemical compound, media, and the like. Examples of biological molecules include, but are not limited to, nucleic acids, proteins, lipids, sugars, proteolipids, lipoproteins, glycoproteins, proteoglyσans, and the like. These biological molecules are known to have an influence on organisms . Unknown biological molecules are also highly likely to have an influence on organisms and are considered to be important targets to be studied.
Particularly preferably, hormones, cytokine, cell adhesion factors, extracellular matrices, receptor agonists, receptor antagonists, and the like, which are expected to have an influence on cells , are used as biological molecules to be investigated.
(Inference of external factors)
In another aspect, the present invention provides a method for inferring an unidentified external factor given to a cell based on a time-lapse profile of the cell. The method comprises the steps of: a) exposing the cell to a plurality of known external factors; b) obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; c) correlating the known external factors with the respective time-lapse profiles; d) exposing the cell to the unidentified external factor; e) obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of the transcription level of the selected transcription control sequence; f ) determining a profile corresponding to the time-lapse profile obtained in the step of e) from the time-lapse profiles obtained in the step of b); and g) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the step of f).
In the method of the present invention, the step of exposing a cell to external factors can be performed as described above herein or as illustrated in examples described below. The step of obtaining a time-lapse pro ile can be performed as described above herein or as illustrated in examples described below. The correlation step can be performed as described above herein or as illustrated in examples described below. After information about all known external factors has been obtained, an unidentified external factor is similarly monitored. These pieces of information are compared to determine whether or not the unidentified external factor is a known one. If the profile of an unidentified factor fully matches the profile of a known factor, these two factors can be determined to be identical. Also, if the profile of an unidentified factor substantially matches the profile of a known factor, these two factors can be determined to be identical. Such determination depends on the information quantity and quality of the known external factor. Such determination can be easily carried out by those skilled in the art considering various elements .
(Inference of unidentified external factor)
In another aspect, the present invention provides a method for inferring an unidentified external factor given to a cell based on a time-lapse profile of the cell. The methodcomprises : a) providingdatarelating to acorrelation relationship between known external factors and time-lapse profiles of the cell inresponse to the known external factors , in relation to at least one transcription control sequence selected from promoters present in the cell; b) exposing the cell to the unidentified external factor; c) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected promoter; d) determining a profile corresponding to the time-lapse profile obtained in the step of c) from the time-lapse pro iles obtained in the step of a) ; and e) determining that the unidentified external factor is the known external factorcorresponding to theprofile determined in the step of d) .
Exposure to external factors, profile generation, correlation, and the like can be carried out using techniques as described herein above or as illustrated in the examples below.
(Presentation system of cellular states) In another aspect, the present invention provides a system for presenting a state of a cell. The system comprises: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; andb) means for presenting the time-lapse profile.
A configuration of a computer or system for implementing the cellular state presenting method of the present invention is shown in Figure 17. Figure 17 shows an exemplary configuration of a computer 500 for executing the cellular state presenting method of the present invention.
The computer 500 comprises an input section 501, a CPU 502, an output section 503, a memory 504, and a bus 505. The input section 501, the CPU 502, the output section 503, and the memory 504 are connected via a bus 505. The input section 501 and the output section 503 are connected to an I/O device 506.
An outline of a process for presenting a state of a cell, which is executed by the computer 500, will be described below.
Aprogram for executing the cellular state presenting method (hereinafter referred to as a "cellular state presenting program") is stored in, for example, the memory 502. Alternatively, each component of the cellular state presentingprogrammaybe stored in any type of recording medium, such as a floppy disk, MO, CD-ROM, CD-R, DVD-ROM, or the like separately or together. Alternatively, the program may be stored in an application server. The cellular state presenting program stored in such a recording medium is loadedvia the I/O device 506 (e.g. , a disk drive, a network (e.g. , the Internet) ) to the memory 504 of the computer 500. The CPU 502 executes the cellular state presenting program, so that the computer 500 functions as a device for performing the cellular state presenting method of the present invention.
Information about a cell or the like is input via the input section 501 aswell as profile data obtained. Known information may be input as appropriate.
The CPU 502 generates display data based on the information about profile data and cells through the input section 501, and stored the display data into the memory 504. Thereafter, the CPU 502 may store the information in the memory 504. Thereafter, the output section 503 outputs a cellular state selected by the CPU 502 as display data. The output data is output through the I/O device SOS.
(Cellular state determining system) In another aspect, the present invention provides a system for determining a state of a cell. The system comprises: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; andb) means for determining the state of the cell based on the time-lapse profile.
A configuration of a computer or system for implementing the cellular state determining method of the present invention is shown in Figure 17. Figure 17 shows an exemplary configuration of a computer 500 for executing the cellular state determining method of the present invention.
The computer 500 comprises an input section 501, a CPU 502, an output section 503, a memory 504, and a bus 505. The input section 501, the CPU 502, the output section 503, and the memory 504 are connected via a bus 505. The input section 501 and the output section 503 are connected to an I/O device 506.
An outline of a process for determining a state of a cell, which is executed by the computer 500, will be described below. A program for executing the cellular state determining method (hereinafter referred to as a "cellular state determining program") is stored in, for example, the memory 502. Alternatively, each component of the cellular state determining program may be stored in any type of recording medium, such as a floppy disk, MO, CD-ROM, CD-R, DVD-ROM, or the likeseparately or together. Alternatively, the program may be stored in an application server. The cellular state determining program stored in such a recording medium is loaded via the I/O device 506 (e.g. , a disk drive, a network (e.g., the Internet)) to the memory 504 of the computer 500. The CPU 502 executes the cellular state presenting program, so that the computer 500 functions as a device for performing the cellular state determining method of the present invention.
Information about a cell or the like is input via the input section 501 as well as profile data obtained. Known information may be input as appropriate.
The CPU 502 determines a state of a cell based on the information about profile data and cells input through theinput section 501, generates the results as determination result data, and stores the determination result data into the memory 504. Thereafter, the CPU 502 may store the information in the memory 504. Thereafter, the output section 503 outputs a cellular state selected by the CPU 502 as determination result data. The output data is output through the I/O device 506.
(External factor correlating system) In another aspect, the present invention provides a system for correlating an external factor with a response of a cell to the external factor. The system comprises: a) means for exposing the cell to the external factor; b) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one promoter selected from the group consisting of promoters derived from the cell; and c) means for correlating the external factor with the time-lapse profile . Such a system can be implemented using a computer as with the above-described systems .
(External factor inferring system) In another aspect, the present invention provides a system for inferring an unidentified external factor given to a cell based on a time-lapse profile. The system comprising: a) means for exposing the cell to a plurality of known external factors; b) means for obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least one transcription control f ctor selected from the group consisting of transcription control factors derived from the cell; c) means for correlating the known external factors with the respective time-lapse profiles; d) means for exposing the cell to the unidentified external factor; e) means for obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of the transcription level of the selectedtranscription control sequence; f ) means for determining a profile corresponding to the time-lapse profile obtained in the means of e) from the time-lapse profiles obtained in the means of b); and g) means for determining that the unidentified external factor is the known external factor corresponding to the profile determined in the means of f). Such a system can be implemented using a computer as with the above-described systems .
(Unidentified external factor inferring system) In another aspect, the present invention provides A system for inferring an unidentified external factor given to a cell based on a time-lapse profile, comprising: a) means for providing data relating to a correlation relationship between known external factors and time-lapse profiles of the cell in response totheknown external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) means for exposing the cell to the unidentified external factor; c) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected transcription control sequence; d) means for determining a profile corresponding to the time-lapse profile obtained in the means of c) from the time-lapse profiles obtained in the means of a); and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the means of d) . Such a system can be implemented using a computer as with the above-described systems.
When the present invention is provided in the form of a system as described above, each constituent element thereof can be implemented as with the detailed or preferred embodiments of the method of the present invention. Preferred embodiments of such a system can be easily selected by those skilled in the art and can be made or carried out by those skilled in the art based on the present specification .
(Program recording medium)
In another aspect, the present invention provides a computer recordable recording medium recording a program for executing a process for presenting a state of a cell to a computer. The recording medium records at least a program for executing the procedures of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b) presenting the time-lapse profile.
In another aspect, the present invention provides a computer recordable recording medium recording a program for executing a process for determining a state of a cell to a computer. The recording medium records at least a program for executing the procedures of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b) determining the state of the cell based on the time-lapse profile of the transcription level.
In another aspect, the present invention provides a computer recordable recording medium recording a program for executing a process for correlating an external factor with a response of a cell to the external factor. The recording medium records at least a program for executing the procedures of: a) exposing the cell to the external factor; b) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control f ctor selected from the group consisting of transcription control factors derived from the cell; and c) correlating the external factor with the time-lapse profile.
In another aspect, the present invention provides a computer recordable recording medium recording a program for executing a process for inferring an unidentified external factor given to a cell based on a time-lapse pro ile . The recording medium records at least a program for executing the procedures of: a) exposing the cell to a plurality of known external factors; b) obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; c) correlating the known external factors with the respective time-lapse profiles; d) exposing the cell to the unidentified external factor; e) obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of the transcription level of the selected transcription control sequence; f ) determining a profile corresponding to the time-lapse profile obtained in the procedure of e) from the time-lapse profiles obtained in the procedure of b); and g) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the procedure of f).
In another aspect, the present invention provides a computer recordable recording medium recording a program for executing a process for inferring an unidentified external factor given to a cell based on a time-lapse profile . The recording medium records at least a program or executing the procedures of: a) providing data relating to a correlation relationship between known external factors and time-lapse profiles of the cell in response to the known external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) exposing the cell to the unidentified external factor; c) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected transcription control sequence; d) determining a profile corresponding to the time-lapse profile obtained in the procedure of c) from the time-lapse profiles obtained in the procedure of a) ; and e ) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the procedure of d) .
When the present invention is provided in the form of a recording medium as described above, each constituent element thereof can be implemented as with the detailed or pre erred embodiments of the method of the present invention . Preferredembodiments of such a recordingmedium can be easily selected by those skilled in the art and can be made or carried out by those skilled in the art based on the present specification.
(Program) In another aspect, the present invention provides a program for executing a process for presenting a state of a cell to a computer . The program executes the procedures of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected rom the group consisting of transcription control sequences derived from the cell; and b) presenting the time-lapse profile. In another aspect, the present invention provides a program for executing a process for determining a state of a cell to a computer. The program executes the procedures of: a) obtaining a time-lapse profile of the cell hy time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected rom the group consisting of transcription control sequences derived from the cell; and b) determining the state of the cell based on the time-lapse profile of the transcription level.
In another aspect, the present invention provides a program for executing a process for correlating an external factor with a response of a cell to the external factor. The program executes the procedures of: a) exposing the cell to the external factor; b) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; and c) correlating the external factor with the time-lapse profile.
In another aspect, the present invention provides a program for executing a process for inferring an unidentified external factor given to a cell based on a time-lapse pro ile. The program executes the procedures of : a) exposing the cell to apluralityof known external ctors ; b) obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least on® transcription control factor selected from the group consisting of transcription control factors derived from the cell; σ) correlating the known external factors with the respective time-lapse profiles; d) exposing the cell to the unidentified external factor; e) obtainingatime-lapseprofile of theunidentified external factorbytime-lapsemonitoringof the transcription level of the selected transcription control sequence; f) determining a profile corresponding to the time-lapse profile obtained in the procedure of e) from the time-lapse profiles obtained in the procedure of b) ; and g) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the procedure of f ) .
In another aspect, the present invention provides a program for executing a process for inferring an unidentified external factor given to a cell based on a time-lapse profile . The program executes the procedures of : a) providing data relating to a correlation relationship between known external factors and time-lapse profiles of the cell in response to theknown external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) exposing the cell to the unidentified external factor; c) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected transcription control sequence; d) determining a profile corresponding to the time-lapse profile obtained in the procedure of c) from the time-lapse profiles obtained in the procedure of a); and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the procedure of d) . When the present invention is provided in the form of a program as described above, each constituent element thereof can be implemented as with the detailed or preferred embodiments of the method of the present invention. Preferred embodiments of such a program can be easily selected by those skilled in the art and can be made or carried out bythose skilled in the art based on thepresent specification . Description formats of such a program are well known to those skilled in the art and include, for example, the C++ language, and the like.
(Diagnosis)
In another aspect, the present invention provides a method and system for diagnosing a subject . The diagnosis method comprises the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; b) determining the state of the cell based on the time-lapse profile of the transcription level; and c) determining a condition, disorder or disease of a subject based on the state of the cell. The diagnosis method is provided in the form of a system, the system of the present invention comprises: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; b) means for determining the state of the cell based on the time-lapse profile of the transcription level; and c) means for determining a conditio , disorder or disease of a subject based on the state of the cell. The present invention is applicable to tailor-made diagnoses and therapies , such as drug resistance, selection of appropriate anticanceragents , selection of appropriate transplant cells , andthe like. Preferably, the diagnosismethodof thepresent invention may be provided as a therapeutic or prevention method comprising the step of treating a subject with a therapy or prevention selected based on the result of diagnosis. In another preferred embodiment, the diagnosis system of the present invention may be provided as a therapeutic or prevention system comprising means fortreating a subject with a therapy or prevention selected based on the result of diagnosis.
A configuration of a computer or system for implementing the diagnosis method and system of the present invention is shown in Figure 17. Figure 17 shows an exemplary configuration of a computer 500 for executing the cellular state determining method of the present invention.
The computer 500 comprises an input section 501, a
CPU 502, an output section 503, a memory 504, and a bus 505. The input section 501, the CPU 502, the output section 503, and the memory 504 are connected via a bus 505. The input section 501 and the output section 503 are connected to an I/O device 506.
An outline of acorrelationprocess , whichis executed by the computer 500, will be described below.
Aprogram for executing the correlation methodand/or selection of treatment or prevention (hereinafter referred to as a "correlation program" and a "selection program", respectively) is stored in, for example, the memory 502. Alternatively, the correlation program and the selection program may be stored in any type of recording medium, such as a floppy disk, MO, CD-ROM, CD-R, DVD-ROM, or the like, separately or together. Alternatively, the programs may be stored in an application server. The correlation program and the selection program stored in such a recording medium are loaded via the I/O device 506 (e.g., a disk drive, a network (e.g., the Internet)) to the memory 504 of the computer 500. The CPU 502 executes the correlation program and the selection program, so that the computer 500 functions as a device for performing the correlation method and the selection method of the present invention.
The result of analysis of a time-lapse profile (e.g. , phase, etc.) and information about a cell or the like are input via the input section 501. Secondary information about a condition, disorder or diseases to be correlated with a time-lapse profile and information about treatment and/or prevention may be input as required.
The CPU 502 correlates information about a time-lapse profile with a state of a cell or a condition, disorder or disease of a subject and a prevention or therapeutic method as required, based on the information input through the input section 501, and stores correlation data into the memory 504. Thereafter, the CPU 502 may store the information in the memory 504. Thereafter, the output section 503 outputs information about a state of a cell or a condition , disorder or disease of a subject and a prevention or therapeutic method as required, which has been selected by the CPU 502 as diagnostic information. The output data is output through the I/O device 506. All patents, published patent applications and publications cited herein are incorporated by reference as if set forth fully herein.
The preferred embodiments of the present invention have been heretofore described for a better understanding of the present invention. Hereinafter, the present invention will be described by way of examples . Examples described below are provided only for illustrative purposes . Accordingly, the scope of the present invention is not limited except as by the appended claims . According to the examples below, it will be understood that those skilled in the art can select cells, supports, biological factors, salts, positively charged substances , negatively charged substances, actin acting substances, and the like, as appropriate, and can make or carry out the present invention.
EXAMPLES
Hereinafter, the present inventionwill be described in greater detail by way of examples , though the present invention is not limited to the examples below. Reagents, supports , and the like were commercially available from Sigma (St. Louis, USA), Wako Pure Chemical Industries (Osaka, Japan), Matsunami Glass (Kishiwada, Japan) unless otherwise specified.
(Example 1: Reagents)
Formulations below were prepared in Example 1.
As candidates for an actin acting substance, various extracellular matrix proteins and variants or fragments thereof were prepared in Example 1 as listed below. Fibronectin and the like were commercially available. Fragments and variants were obtained by genetic engineering techniques :
1) fibronectin (SEQ ID NO. : 11);
2) fibronectin 29 kDa fragment;
3) fibronectin 43 kDa fragment;
4) fibronectin 72 kDa fragment;
5) fibronectin variant (SEQ ID NO. : 11, alanine at 152 was substituted with leucine);
6) ProNectin F (Sanyo Chemical Industries, Kyoto, Japan);
7) ProNectin L (Sanyo Chemical Industries);
8) ProNectin Plus (Sanyo Chemical Industries);
9 ) laminin ( SEQ ID NO . : 6 ) ; 10) RGD peptide ( tripeptide) ;
11) RGD-containing 30kDa peptide;
12) 5 amino acids of laminin (IKVAV, SEQ ID NO.: 28); and
13) gelatin.
Plasmids were prepared as DNA for transfection.
Plasmids, pEGFP-Nl andpDsRed2-Nl (both from BD Biosciences , Clontech, CA, USA) were used. In these plasmids, gene expression was under the control of cytomegalovirus (CMV) . The plasmid DNA was amplified in E . coli (XLlblue, Stratgene, TX, USA) and the ampli ied plasmid DNA was used as a complex partner. The DNA was dissolved in distilled water free from DNase and RNase.
The following transfection reagents were used: Effectene Transfection Reagent (cat. no. 301425, Qiagen,
CA) , TransFast™ Transfection Reagent (E2431, Promega, WI ) ,
Tfx™-20 Reagent (E2391, Promega, WI ) , SuperFect Transfection Reagent (301305, Qiagen, CA) , PolyFect Transfection Reagent (301105, Qiagen, CA) , LipofectAMINE 2000 Reagent (11668-019, Invitrogen corporation, CA) , JetPEI (x4) cone. (101-30, Polyplus-transfection, France), and ExGen 500 (R0511, Fermentas Inc . , MD) . These transfection reagents were added to the above-described DNA and actin acting substance in advance or complexes thereof with the DNA were produced in advance .
The thus-obtained solution was used in assays using transfection arrays described below.
(Example 2: Transfection array - Demonstration using mesenchymal stem cells)
In Example 2, an improvement in the transfection efficiency of solid phase was observed. The protocol used in Example 2 will be described below.
(Protocol)
The final concentration of DNAwas adjustedto 1 μg/μL . An actin acting substance was preserved as a stock having a concentration of 10 μg/μL in ddH20. All dilutions were made using PBS, ddH20, or Dulbecco ' s MEM. A series of dilutions, for example, 0.2 μg/μL, 0.27 μg/μL, 0.4 μg/μL,
0.53 μg/μL, 0.6 μg/μL, 0.8 μg/μL, 1.0 μg/μL, 1.07 μg/μL, 1.33 μg/μL, and the like, were formulated.
Transfection reagents were used in accordance with instructions provided by each manufacturer.
Plasmid DNA was removed from a glycerol stock and amplified in 100 mL L-amp overnight. Qiaprep Miniprep or Qiagen Plasmid Purification Maxi was used to purify DNA in accordance with a standard protocol provided by the manufacturer.
In Example 2 , the following 5 cells were used to confirm an effect: human mesenchymal stem cell (hMSCs, PT-2501, Cambrex BioScienσe Walkersville, Inc., MD); human embryonic renal cell (HEK293, RCB1637, RIKEN Cell Bank, JPN) ; NIH3T3-3 cell (RCB0150, RIKEN Cell Bank, JPN); HeLa cell (RCB0007, RIKEN Cell Bank, JPN); and HepG2(RCB1648, RIKEN Cell Bank, JPN). These cells were cultured in DMEM/10% IFS containing L-glut and pen/strep.
(Dilution and DNA spots)
Transfection reagents and DNA were mixed to form a DNA-transfection reagent complex. The complex formation requires a certain period of time. Therefore, the mixture was spotted onto a solid phase support (e.g., a poly-L-lysine slide) using an arrayer. In Example 2, as a solid phase support, an APS slide, a MAS slide, and an uncoated slide were used as well as a poly-L-lysine slide. These slides are available from Matsunami Glass (Kishiwada, Japan) or the like .
For complex formation and spot fixation, the slides were dried overnight in a vacuum dryer. Drying was performed in the range of 2 hours to 1 week.
Although the actin acting substance might be used during the complex formation, it was also used immediately before spotting in Example 2.
(Formulation of mixed solution and application to solid phase supports)
300 μL of DNA concentratedbuffer (EC buffer) + 16 μL of an enhancer were mixed in an Eppendorf tube . The mixture was mixedwith aVortex, followedbyincubation for 5 minutes.
50 μL of a transfection reagent (Eff ctene, etc. ) was added to the mixture, followed by mixing by pipetting. To apply a transfection reagent, an annular wax barrier was formed around the spots on the slide. 366 μL of the mixture was added to the spot region surrounded by the wax, followed by incubation at room temperature for 10 to 20 minutes. Thereby, the fixation to the support was manually achieved.
(Distribution of cells)
Next , a protocol for adding cells will be described. Cells were distributed for transfection. The distribution was typically performed by reduced-pressure suction in a hood. A slide was placed on a dish, and a solution containing cells was added to the dish for transfection. The cells were distributed as follows.
The growingcells were distributedto aconcentration of 107 cells/25 mL. The cells were plated on the slide in a 100x100x15 mm squared Petri dish or a 100 mm (radius) x 15 mm circular dish. Transfection was conducted for about 40 hours. This period of time corresponded to about 2 cell cycles. The slide was treated for immunofluorescence.
(Evaluation of gene introduction) Gene introduction was evaluated by detection using, for example, immunofluorescence, fluorescence microscope examination, laser scanning, radioactive labels, and sensitive films, or emulsion.
When an expressed protein to be visualized is a fluorescent protein, such a protein can be observed with a fluorescence microscope and a photograph thereof can be taken. For large-sized expression arrays, slides may be scanned using a laser scanner for storage of data. If an expressed protein can be detected using fluorescence antibodies, an immunofluorescence protocol can be successively performed. If detection is based on radioactivity, the slide may be adhered as described above, and autoradiography using film or emulsion can be performed to detect radioactivity.
(Laser scanning and Quantification of fluorescence intensity)
To quantify transfection efficiency, the present inventors use a DNA microarray scanner (GeneTAC UC4x4, Genomic Solutions Inc., MI). Total fluorescence intensity
(arbitrary unit ) was measured, and thereafter, fluorescence intensity per unit surface area was calculated.
(Cross-sectional observation by confocal scanning microscope)
Cells were seeded on tissue culture dishes at a final concentration of lxlO5 cells/well andcultured in appropriate medium (Human Mesenchymal Cell Basal Medium (MSCGM BulletKit PT-3001, Cambrex BioScience Walkersville , Inc. , MD) . After fixation of the cell layer with 4% paraformaldehyde solution, SYTO and Texas Red-X phalloidin (Molecular Probes Inc. , OR, USA) was added to the cell layer for observation of nuclei and F-actin . The samples emitting light due to gene products and the stained samples were observed with a confocal laser microscope (LSM510: Carl Zeiss Co., Ltd., pin hole size=Chl=123 μm, Ch2=108 μm, image interval = 0.4 ) to obtain cross sectional views. (Results )
Figure 1 shows the results of experiments in which various actin acting substances and HEK293 cells were used where gelatin was used as a control.
As can be seen from the results , whereas transfection was not very successful in a system using gelatin, transfection took place to a significant level in systems using fibronectin, ProNectin (ProNectin F, ProNectin L, ProNectin Plus ) which is avariant of fibronectin, and laminin. Therefore, it was demonstrated that these molecules significantly increased transfection efficiency. Use of the RGD peptide alone exhibited substantially no effect .
Figures 2 and 3 show transfection efficiency when fibronectin fragments were used. Figure 4 shows the summary of the results. 29 kDa and 72 kDa fragments exhibited a significant level of transfection activity, while a 43 kDa fragment had activity but its level was low. Therefore, it was suggested that an amino acid sequence contained in the 29 kDa fragment played a role in an increase in transfection efficiency. Substantially no contamination was found in the case of the 29 kDa fragment, while contamination was observed in the case of the other two fragments (43 kDa and 72 kDa) . Therefore, only the 29 kDa domain may be preferably used as an actin acting substance. When only the RGD peptide was used, the activity to increase transfection efficiency was not exhibited. The 29-kDapeptide exhibitedactivity. Such a system with additional 6 amino acids of laminin (higher molecular weight) exhibited transfection activity. Therefore, these peptide sequences may also play an important role in the activity to increase transfection efficiency, without limitation. In such a case, a molecular weight of at least 5 kDa, preferablyat least 10 kDa, andmore preferably at least 15 kDamay be requiredfor an increase in transfection efficiency.
Next, Figure 5 shows the result of studies on transfection efficiency of cells . In Figure 5, HEK293 cells, HeLa cells, and 3T3 cells, which were conventionally transfectable, and HepG2 cells and mesenchymal stem cells (MSC ) which were conventionally believed to be substantially impossible to transfect, were used to show an effect of the transfection method of the present invention. The vertical axis represents the intensity of GFP.
In Figure 5, the transfection method of the present invention using a solid phase support was compared with a conventional liquid phase transfection method. The conventional liquid phase transfection method was conducted in accordance with a protocol recommended by the kit manu acturer.
As can be seen fromFigure 5 , transfection efficiency comparable to HeLa and 3T3 was achieved in HepG2 cells and mesenchymal stem cells (MSC) which were conventionally believed to be substantially impossible to transfect, as well as HEK293 cells, HeLa cells, and 3T3 cells, which were conventionally transfectable. Such an effect was not achieved by conventional transfection systems . The present invention was the first to provide a systemwhich can increase transfection efficiency for substantially all cells and can provide practicable transfection to all cells. By using solid phase conditions, cross contamination was significantly reduced. Therefore, it was demonstrated that the present invention using a solid phase support is appropriate for production of an integrated bioarray.
Next, Figure 6 shows theresults of transfectionwhen various plates were used. As can be seen from the results of Figure 6, when coating was provided, contamination was reduced as compared with when coating was not provided and transfection efficiency was increased.
Next, Figure 7 shows the results of transfection where the concentration of fibronectin was 0, 0.27, 0.53,
0.8, 1.07, and 1.33 (μg/μL for each). In Figure 7, slides coated with PLL (poly-L-lysine) and APS and uncoated slides were shown.
As can be seen from the results of Figure 7, transfection efficiency was increased with an increase in fibronectin concentration. Note that in the case of PLL coating and the absence of coating, the transfection efficiency reached a plateau at a fibronectin concentration of more than 0.53 μg/μL. In the case of APS, it was found that the effect was further increased at a fibronectin concentration of more than of 1.07 μg/μL.
Next, Figure 8 shows photographs indicating cell adhesion profiles in the presence or absence of fibronectin. Figure 9 shows cross-sectional photographs. It was revealed that the shapes of adherent cells were signi icantly different (Figure 8). The full extension of cells was found for the initial 3 hours of culture in the presence of fibronectin, while extension was limited in the absence of fibronectin (Figure 9). Considering the behavior of filaments (Figure 9) and the results of the time-lapse observation , it was considered that an actin acting substance, such as fibronectin, attached to a solid phase support had an influence on the shape and orientation of actin filaments, and the efficiency of introduction of a substance into a cell, such as transfection efficiency or the like, is increased. Specifically, actin filaments quickly change their location in the presence of fibronectin, and disappear from the cytoplasmic space under the nucleus as the cell extends . It is considered that actin depletion in the perinuclear space, which is induced by an actin acting substance, such as fibronectin, allows the transport of a target substance, such as DNA or the like, into cells or nuclei. Though not wishing to be bound by any theory, the reason is considered to be that the viscosity of cytoplasm is reduced andpositively chargedDNAparticles are prevented from being trapped by negatively charged actin filaments. Additionally, it is considered that the surface area of the nucleus is significantly increased in the presence of fibronectin ( Figure 10 ) , possibly facilitating the transfer of a target substance, such as DNA or the like, into nuclei.
(Example 3: Application to bioarrays)
Next, larger-scale experiments were conducted to determine whether or not the above-described effect was demonstrated when arrays were used.
(Experimental protocols)
(Cell sources, culture media, and culture conditions )
In this example, five different cell lines were used: human mesenchymal stem cells (hMSCs, PT-2501, Cambrex
BioScience Walkersville. Inc. , MD) , human embryonic kidney cell HEK293 (RCB1637, RIKEN Cell Bank, JPN), NIH3T3-3
(RCB0150, RIKEN Cell Bank, JPN), HeLa (RCB0007, RIKEN Cell Bank, JPN), and HepG2 (RCB1648, RIKEN Cell Bank, JPN). In the case of human MSCs , cells were maintained in commercialized Human Mesenchymal Cell Basal Medium (MSCGM BulletKit PT-3001, Cambrex BioScience Walkersville, Inc., MD). In case of HEK293, NIH3T3-3, HeLa and HepG2 , cells were maintained in Dulbecco ' s Modified Eagle r s Medium (DMEM, high glucose 4.5 g/L with L-Glutamine and sodium pyruvate; 14246-25, Nakalai Tesque, JPN) with 10% fetal bovine serum (FBS, 29-167-54, Lot No. 2025F, Dainippon Pharmaceutical CO. , LTD. , JPN) . All cells were cultivated in a controlled incubator at 37°C in 5% C02. In experiments involving hMSCs, we used hMSCs of less than five passages, in order to avoid phenotypic changes .
(Plasmids and Transfection reagents)
To evaluate the efficiency of transfection, the pEGFP-Nl and pDsRed2-Nl vectors (cat. no. 6085-1, 6973-1, BD Biosciences Clontech, CA) were used. Both genes' expressions were under the control of cytomegalovirus (CMV) promoter. Transfected cells continuously expressed EGFP or DsRed2, respectively. Plasmid DNAs were amplified using Escherichia coli, XL1-blue strain (200249, Stratagene, TX) , and purified by EndoFree Plasmid Kit (EndoFree Plasmid Maxi Kit 12362, QIAGEN, CA) . In all cases, plasmid DNA was dissolved in DNase and RNase free water. Transfection reagents were obtained as below: Effectene Transfection Reagent (cat. no.301425, Qiagen, CA) , TransFast™ Transfection Reagent (E2431, Promega, WI ) , Tfx™-20 Reagent (E2391, Promega, WI), SuperFect Transfection Reagent (301305, Qiagen, CA) , PolyFect Transfection Reagent (301105, Qiagen, CA) , LipofectAMINE 2000 Reagent (11668-019, Invitrogen corporation, CA) , JetPEI (x4) cone. (101-30, Polyplus-transfection, France), and ExGen 500 (R0511, Fermentas Inc., MD) .
(Solid-Phase Transfection Array (SPTA) production) The detail of protocols for 'reverse transfection' was described in the web site, 'Reverse Transfection Homepage '
(http: //staffa.wi.mit.edu/sabatini_public/reverse_trans fection.htm) or J. Ziauddin, D. M. Sabatini, Nature, 411, 2001, 107; and R.W. Zu, S.N. Bailey, D.M. Sabatini, Trends in Cell Biology, Vol. 12, No. 10, 485. In our solid phase transfection (SPTA method) , three types of glass slides were studied (silanized glass slides; APS slides, and poly-L-lysine coated glass slides ; PLL slides , andMAS coated slides; Matsunami Glass, JPN) with a 48 square pattern (3 mm x 3 mm) separated by a hydrophobic fluoride resin coating.
(Plasmid DNA printing solution preparation) Two different ways to produce a SPTA were developed. The main differences reside in the preparation of the plasmid DNA printing solution.
(Method A)
In the case of using Effectene Transfection Reagent , the printing solution contained plasmid DNA and cell adhesion molecules (bovine plasma fibronectin (cat. no. 16042-41, Nakalai Tesque, JPN), dissolved in ultra-pure water at a concentration of 4 mg/mL) . The above solution was applied on the surface of the slide using an Inkjet printer ( synQUAD™, Cartesian Technologies, Inc., CA) or manually, using a 0.5 to 10 μL tip . This printed slide was dried up over 15 minutes at room temperature in a safety-cabinet. Before transfection, total Effectene reagent was gently poured on the DNA-printed glass slide and incubated for 15 minutes at room temperature. The excess Effectene solution was removed from the glass slide using a vacuum aspirator and driedup at roomtemperature for 15 minutes in a safety-cabinet , The DNA-printed glass slide obtained was set in the bottom of a 100-mm culture dish and approximately 25 mL of cell suspension (2 to 4xl04 cells/mL) was gently poured into the dish. Then, the dish was transferred to the incubator at 37°C in 5% C02 and incubated for 2 or 3 days.
(Method B)
In case of other transfection reagents (TransFast , Tfx™-20, SuperFect, PolyFect, LipofectAMINE 2000, JetPEI (x4) cone, or ExGen), plasmid DNA, fibronectin, and the transfection reagent were mixed homogeneously in a 1.5-mL micro-tube according to the ratios indicated in the manufacturer's instructions and incubated at room temperature for 15 minutes before printing on a chip. The printing solution was applied onto the surface of the glass-slide using an Inkjet printer or a 0.5- to 10-μL tip. The printed glass-slide was completely dried up at room temperature over 10 minutes in a safety-cabinet . The printed glass-slide was placed in the bottom of a 100-mm culture dish and approximately 3 mL of cell suspension (2 to 4xl04 cells/mL) was added and incubated at room temperature over 15 minutes in a safety-cabinet. After incubation, fresh medium was poured gently into the dish. Then, the dish was transferred to an incubator at 37°C in 5% C02 and incubated for 2 to 3 days. After incubation, using fluorescence microscopy (IX-71, Olympus PROMARKETING, INC., JPN), we observed the transfeσtants , based on their expression of enhanced fluorescent proteins (EFP, EGFP and DsRed2) . Phase contrast images were taken with the same microscope . In both protocols, cells were fixedby using a paraformaldehyde (PFA) fixation method (4% PFA in PBS, treatment time was 10 minutes at room temperature) .
(Laser scanning and fluorescence intensity quantification)
In order to quantify the transfection efficiency, we used a DNA micro-array scanner (GeneTAC UC4x4, Genomic
Solutions Inc., MI). The total fluorescence intensity
(arbitrary units) was measured, and thereafter, the fluorescence intensity per surface area was calculated.
(Results)
(Fibronectin-supported localized transfection)
A transfection array chip was constructed as shown in Figure 11. The transfection array chip was constructed by microprinting a cell cultivation medium solution containing fibronectin and DNA/transfection reagent onto a poly L lysine (PLL) coated glass slide.
Various cells were used for this example. The cells were cultivated under typical cell cultivation conditions . As they adhered to the glass slide, the cells efficiently incorporated and expressed the genes corresponding to the DNA printed at a given position on the array. As compared to conventional transfection methods (e.g., cationic lipid or cationic polymer-mediated transfection) , the efficiency of transfection using the method of the present invention was high in all the cells tested. Importantly, it was found that tissue stem cells, such as HepG2 and hMSC, which were conventionally believed to resist transfection, were efficiently transfected. hMSC was transfected at an efficiency 40 or more times higher than that of conventional techniques. In addition, high spatial localization, which is required for high-density arrays, was achieved (low cross contamination between adjacent spots on the array) . This was confirmed by production of a checkered pattern array of EGFP and Ds-Red. hMSC cultivated on this array expressed the corresponding luorescent proteins with virtually total space resolution. The result is shown in Figure 12. As can be seen from Figure 12, it was found that there was little cross contamination. Based on the study of the role of the individual components of the printed mixture, transfection efficiency can be optimized.
(Solid-phase transfection array of human mesenchymal stem cells)
The capacity of human Mesenchymal Stem Cells (hMSC) to differentiate into various kinds of cells is particularly intriguing in studies which target tissue regeneration and renewal. In particular, the genetic analysis of transformation of these cells has attracted attention with expectation of understanding of a factor that controls the pluripotency of hMSC. In conventional hMSC studies, it is not possible to perform transfection with desired genetic materials .
To achieve this , conventional methods include either a viral vector technique or electroporation. The present inventors developed a complex-salt system, which could be used to achieve solid phase transfection which makes it possible to obtain high transfection efficiency to various cell lines (including hMSC) and special localization in high-density arrays . An outline of solid phase transfection is shown in Figure 13A.
It was demonstrated that solid phase transfection can be used to achieve a "transfection patch" capable of being used for in vivo gene delivery and a solid phase transfection array (SPTA) for high-throughput genetic function research on hMSC.
Although a number of standard techniques are available for transfecting mammalian cells , it is known that it is inconvenient and difficult to introduce genetic material into hMSC as comparedwith cell lines , such as HEK293 , HeLa, and the like. Conventional viral vector delivery and electroporation techniques are each important. However, these techniques have the following inconveniences : potential toxicity (for the virus technique); difficulty in high-throughput analysis at the genomic scale ; and limited applications in in vivo studies (for electroporation).
The present inventors developed solid phase support fixed systemwhich can be easily fixed to a solidphase support and has sustained-release capability and cell affinity, whereby most of the above-described drawbacks could be overcome .
An example of the results of the above-described experiment is shown in Figure 13B. The present inventors usedourmicroprinting technique to fix amixture of a selected genetic material, a transfection reagent, an appropriate cell adhesion molecule, and a salt onto a solid support. By culturing cells on a support having such a mixture fixed thereonto, the gene contained in the mixture was allowed to be taken in by the cultured cells. As a result, it became possible to allow support-adherent cells to take in DNA spatially separated therefrom (Figure 13B) . As aresult of this example, several important effects were achieved: high transfection efficiency ( thereby making it possible to study a group of cells having a statistically significant scale) ; low cross contamination between regions having different DNA molecules (thereby making it possible to study the effects of different genes separately) ; the extended survival of transfected cells; high-throughput , compatible and simple detecting procedure. SPTA having these features serves as an appropriate basis for further studies.
To achieve the above-described objects, the present inventors studied five different cell lines (HEK293, HeLa, NIH3T3, HepG2 and hMSC) as described above with both our methodology (transfection in a solid phase system) (see Figures 13A and 13C) and conventional liquid-phase transfection under a series of transfection conditions. Cross contamination was evaluated for both systems as follows . In the case of SPTA, weprintedDNA' s encoding aredfluorescent protein (RFP) and a green fluorescent protein (GFP) on glass supports in a checked pattern. In the case of experiments including conventional liquid phase transfection (where cells to be trans ected cannot be spatially separated from one another spontaneously) , a DNA encoding GFP was used. Several transfection reagents were evaluated: four liquid transfection reagents (Effectene, TransFast™, Tfx™-20, LopofectAMINE 2000), two polyamine (SuperFect, PolyFect), and two polyimine (JetPEI (x4) and ExGen 500).
Transfection efficiency: transfection efficiency was determined as total fluorescence intensity per unit area (Figure 14A and Figure 14B (images )) . The results of liquid phase optimal to cell lines usedwere obtained using different transfection reagents (see Figures 14Ctol4D). Next, these efficient transfection reagents were used to optimize a solid phaseprotocol. Several tendencies were observed. For cell lines which are readily transfectable (e.g. , HEK293, HeLa, NIH3T3, etc.), the transfection efficiency observed in the solid phase protocol was slightly superior to, but essentially similar to, that of the standard liquid phase protocol (Figure 14A to 14D) .
However, for cells which are difficult to transfect
(e.g., hMSC, HepG2, etc.), we observed that transfection efficiency was increased up to 40 fold while the features of the cells were retained under conditions optimized to the SPTA methodlology (see the above-described protocol and Figures 14C and 14D) . In the case of hMSC (Figures 15A and 15B) , the best conditions included use of a polyethylene imine (PEI) transfection reagent. As expected, important factors for achieving high transfection efficiency are the charge balance (N/P ratio) between the number of nitrogen atoms (N) in the polymer and the number of phosphate residues (P) in plasmid DNA and DNA concentration. Generally, increases in the N/P ratio and the concentration lead to an increase in transfection efficiency. We also observed a significant reduction in the survival rate of hMSC cells in liquid phase transfection experiments where the DNA concentration was high and the N/P ratio was high. Because of these two opposing factors, the liquid phase transfection of hMSC had a relatively low cell survival rate (N/P ratio >10). In the case of the SPTA protocol, however, a considerably high N/P ratio (fixed to the solid support) and DNA concentration were tolerable (probably attributed to the effect of the solid support stabilizing cell membrane) while the cell survival rate and the cellular state were not significantly affected. Therefore, this is probably responsible for the dramatic improvement in transfection e iciency. It was ound that the N/P ratio of 10 was optimal for SPTA, and a sufficient transfection level was provided while minimizing σytotoxcity. Another reason for the increase in transfection efficiency observed in the case of the SPTA protocol is that a high local ratio of the DNA concentration to the trans ection reagent concentration was achieved ( this leads to cell death in liquid phase transfection experiments).
A coating agent used is crucial for the achievement of high transfection efficiency on chips. It was found that when a glass chip is used, PLL provided best results both for transfection efficiency and cross contamination (described below) . When fibronectin coating was not used, few transfectants were observed (all the other experimental conditions were retained unchanged) . Although not completely established, fibronectin probably plays a role in accelerating cell adhesion process (data not shown) , and thus, limiting the time which permits the diffusion of DNA released from the surface.
Low cross contamination: apart from the higher transfection efficiency observed in the SPTA protocol, an important advantage of the technique of the present invention is to achieve an array of separated cells, in which selected genes are expressed in the separate positions. The present inventors printed JetPEI (see the "Experimental protocols" section) and two different reporter genes (RFP and GFP) mixed with fibronectin on glass surface coated with fibronectin. The resultant transfection chip was sub ected to appropriate cell culture . ExpressedGFP andRFPwere localizedinregions , in which corresponding cDNA had been spotted, under experimental conditions which had been found to be best . Substantially no cross contamination was observed
(Figures ISA to 16D) . In the absence of fibronectin or PLL, however, cross contamination which hinders solid phase transfection was observed, and the transfection efficiency was significantly lower (see Figure 6). This result demonstrated the hypothesis that the relative proportion of plasmid DNA, which was released from the cell adhesion and the support surface, is a factor important for high transfection efficiency and high cross contamination.
Another cause of cross contamination may be the mobilityof transfectedcells on a solid support . Thepresent inventors measured both the rate of cell adhesion (Figure 16C) and the diffusion rate of plasmid DNA on several supports. As a result, substantially no DNA diffusion occurred under optimum conditions . However, a considerably amount of plasmid DNA were diffused under high cross contamination conditions until cell adhesion was completed, so that plasmid DNAwas depleted from the solidphase surface.
This established technique is of particular importance in the context of cost-effective high-throughput gene function screening. Indeed, the small amounts of transfection reagent andDNArequired, as well as the possible automatization of the entire process ( f om plasmid isolation to detection) increase the utility of the above presented method.
In conclusion, the present invention successfully realized a hMSC transfection array in a system using complex-salt. With this technique, it will be possible to achieve high-throughput studies using the solid phase trans ection, such as the elucidation of the genetic mechanism for differentiation of pluripotent stem cells . The detailed fflechanism of the solid phase transfection as well as methodologies for & use of this technology for high throughput, real time gene expression monitoring can be applied or various purposes .
(Example 4 : Mathematical analysis) Next, time-lapseprofileswereproducedbasedondata obtained using the techniques described in Examples 2 and 3.
(Induction σf differentiation) Each reporter was ixed to a solid phase support and cultured in undifferentiated mesenchymal stem cell maintenance medium (MSCGM, PT-3001, PT-3238. PT-4105, Cambrex, BioWhittaker, USA) for two days. Thereafter, the medium was replaced with differentiation inducing medium (hMSC Differentiation, PT-3002, PT-4120, Cambrex, BioWhittaker, USA) . The response profile of each reporter was measured.
(Mathematical analysis technique) A mathematical analysis technique used herein is shown in Figures 18A a d 18B.
(Transcription factors used herein)
As shown in Figures 19 and24 , plasmids (commercially available from Clontβcft) , in which 17 transcription f ctors
(ISRE, RARE, STAT3 , GAS , NFAT, MIC, API, SRE,GRE,CRE, NFKB,
ERE, TRE, E2F, Rh , p53 ) were operably linked to GFP, were used to observe the differentiation of mesenchymal stemcells into osteoblasts. The resultant time-lapse profiles are shown in Figure 19. Reporters for the transcription factors were constructed as shown in Figure 23.
An assay was conducted using the reporters for the transcription factors under control conditions (cells, supplement factors, culture conditions, etc.) published by Clontech.
The results are shown in Figure 25. It was demonstrated that when compared only to DNA in this manner, most of the transcription factors were induced when inducing agents were added.
Next, the activity of the transcription factors was measured over time in the course of induction of differentiation into bone. In this case, time-lapse profiles , which were obtained in the induction of differentiation under the above-described conditions, were compared with each other. The time-lapse profiles were obtained as follows . Each reporter gene was introduced into mesenchymal stem cells by a solid phase transfection method. The cells were culturedinundi ferentiated statemaintenance medium for two days. Thereafter, the medium was replaced with osteoblast differentiation medium. This time point was referred to as osteoblast differentiation start time. Supplement factors were added at concentrations recommended for the osteoblast differentiation medium. The other culture conditions were in accordance with Cambre 's instructions.
The results are shown in Figure 26. The profile pattern on the left of Figure 26 was obtained 10 hours to 30 hours after replacement of the medium. The profile pattern on the right of Figure 26 was obtained 5 to 6 days after replacement of the medium. Thus, it was demonstrated that the pattern significantly changedover time . Thephases of the profiles were calculated using a formula shown in Figure 27 and the results were summarized in a table to the right of Figure 27. As can be seen, the inversion of the phase of the profile was deeply associated with differentiation for ISRE, RARE, STATS, GRE, CRE, TRE, E2F, and p53. Therefore, it was demonstrated that by examining the phase, changes in process, i.e., the occurrence of transcription control, could be detected.
(Arbitrary combination of reporters) Next, it was demonstrated that differentiation could be identified using an arbitrary combination of promoters for which data was extracted at the initial stage of induction of differentiation. Briefly, the analysis was conducted by changing combinations of arbitrarily extracted reporters at the early period of differentiation induction. An arbitrary number of reporters were extracted from 17 reporters . The average profile was calculated by the method shown in Figures 18Aandl8B. Profiles having a fluctuation width of 5 or more were evaluated at the intervals of 0-31.5 hours, 0-17.5 hours, and 17.5-31.5 hours.
The results are shown in Figure 20. This analysis revealed that although differentiation could not be detected at its very initial stage (potentially due to noise), but could be confirmed about 15 hours after induction of differentiation. In this example, when data was extracted for 8 or more promoters , differentiation could be detected at a detection rate of 100%. When data was extracted for 3 promoters , differentiation could be detected at a detection rate of more than 90%. When data was extracted for two promoters, differentiation could be detected at a detection rate of 88%. When data was extracted for one promoter, differentiation could be detected at a detection rate of 82%. Thus, it was revealed that one, two or at least three promoters are su ficient for determination or identification of the state of cells.
(Maintenance of undifferentiated state)
Next, the maintenance of undifferentiated state was analyzed using an arbitrary combination of transcription control sequences for which data was extracted. Analysis was conducted as described in Figure 20.
The results are shown in Figure 21. As is largely different from the results of induction of differentiation, by comparing the profiles of the transcription control sequences with one another, it could be determined whether or not stem cells were induced toward differentiation or remained undifferentiated. Such a determination could be achieved using at least one transcription control sequence. The determination of the state of cells using such a small number of transcription control sequences cannot be achieved by conventional techniques. It can be said that the present invention achieved an excellent effect .
By analyzing a cellular process in such a fashion, the formation of cellular functions can be described as a cocktail party process as shown in Figure 22. With such a process description, the present invention made it possible to analyze procession of response to drugs and procession of induction of dif erentiation. (Example 5 : Real time measurement of a plurality of genes using cells)
Next , a device for measuring signals from cells in real time was used to obtain time-lapse data and a descriptor was produced from the data.
HeLa cells (available from RIKEN or the like) and Nakalai DMEM high Glucose supplemented with serum (10% FBS, Dainippon Pharmaceutical Co . , Ltd. ) were used. Transfection arrays were constructed as described in the above-describedexamples . 24 reporters forgeneexpression and signal transduction were introduced into the HeLa cells . The cells were cultured for 48 hours . A culture unit was installed and time-lapse observation was performed. A measuring device as shown in Figures 28 and 29 was used to detect the expression of the reporters via the intensity of fluorescence. Measurement was conducted in accordance with a procedure as shown in Figure 30.
In this example, 570-grid arrays having a format as shown in Figure 31 were used. Real time monitoring was performed in serum-free medium two days after transfection for illustrative purposes. Images were taken every 30 minutes. The 24 genes (reporter vectors) were confirmed to have activity under control conditions . An exemplary image acquisition is shown in Figure 32.
Time-lapse data obtained from the acquired image is shown for each gene. Figure 33A is a graph showing data from all of the genes. Figures 33B to 33E show raw data. Figures 33F to 331 show the results of calculation after polynominal approximation. Figures 33J to 33U show data after first order differentiation and second order differentiation. Figures 34-1 to 34-55 show the genes separately. Figures 34-1 to 34-55 include data obtained from the same gene but at different points. The vertical axis represents the intensity of fluorescence (arbitrary unit = unit used in the device used herein), while the horizontal axis represents time (unit: hour (hr) ) .
Figure 34-1 shows time-lapse data of EGFP-N1. Figure 34-2 shows time-lapse data of API.
Figure 34-3 shows time-lapse data of APl(PMA).
Figure 34-4 shows time-lapse data of CRE.
Figure 34-5 shows time-lapse data of E2F.
Figure 34-6 shows time-lapse data of none. Figure 34-7 shows time-lapse data of EGFP-N1.
Figure 34-8 shows further time-lapse data of API.
Figure 34-9 shows further time-lapse data of APl(PMA) .
Figure 34-10 shows further time-lapse data of CRE. Figure 34-11 shows further time-lapse data of E2F.
Figure 34-12 shows time-lapse data of ERE.
Figure 34-13 shows time-lapse data of GAS.
Figure 34-14 shows time-lapse data of GRE.
Figure 34-15 shows time-lapse data of HSE. Figure 34-16 shows time-lapse data of ISRE.
Figure 34-17 shows further time-lapse data of none.
Figure 34-18 shows further time-lapse data of ERE.
Figure 34-19 shows further time-lapse data of GAS.
Figure 34-20 shows further time-lapse data of GRE. Figure 34-21 shows time-lapse data of HSE.
Figure 34-22 shows time-lapse data of ISRE.
Figure 34-23 shows time-lapse data of Myc.
Figure 34-24 shows time-lapse data of NFAT. Figure 34-25 shows time-lapse data of NFKB.
Figure 34-26 shows time-lapse data of RARE.
Figure 34-27 shows time-lapse data of Rb.
Figure 34-28 shows further time-lapse data of none. Figure 34-29 shows time-lapse data of Myc.
Figure 34-30 shows further time-lapse data of NFAT.
Figure 34-31 shows further time-lapse data of NFKB.
Figure 34-32 shows further time-lapse data of RARE.
Figure 34-33 shows further time-lapse data of Rb. Figure 34-34 shows time-lapse data of STAT3.
Figure 34-35 shows time-lapse data of SRE.
Figure 34-36 shows time-lapse data of TRE.
Figure 34-37 shows time-lapse data of p53.
Figure 34-38 shows time-lapse data of Caspase3. Figure 34-39 shows further time-lapse data of none.
Figure 34-40 shows time-lapse data of STAT3.
Figure 34-41 shows further time-lapse data of SRE.
Figure 34-42 shows further time-lapse data of TRE.
Figure 34-43 shows further time-lapse data of p53. Figure 34-44 shows further time-lapse data of
Caspase3.
Figure 34-45 shows time-lapse data of CREB-EGFP.
Figure 34-46 shows time-lapse data of IKB-EGFP.
Figure 34-47 shows time-lapse data of pp53-EGFP. Figure 34-48 shows further time-lapse data of none.
Figure 34-49 shows further time-lapse data of none.
Figure 34-50 shows further time-lapse data of none.
Figure 34-51 shows further time-lapse data of CREB-EGFP. Figure 34-52 shows further time-lapse data of
1KB-EGFP.
Figure 34-53 shows further time-lapse data of pp53-EGFP. Figure 34-54 shows further time-lapse data of none. Figure 34-55 shows further time-lapse data of none.
Note that the above-described "none" represents a negative control.
Thus, time-lapse data was simultaneously obtained for various genes .
(Example 6: Anticancer agent)
In this example, cisplatin was used as an exemplary anticancer agent and mixed into medium exposed cells . The concentration of the anticancer agent was selected as appropriate, such as 1 μM, 5 μM, 10 μM, and the like, to observe the reaction of the cells. Cisplatin was applied to cells resistant or sensitive to the anticancer agent. Time-lapse observation was conducted to produce profiles as in the above-described examples. As a result, it was revealed that time-lapse profiles varied depending on the difference in cisplatin concentration and resistance/sensitivity.
(Example 7: RNAi transfection microarray) Arrays were produced as described in Example 3. As genetic material, mixtures of plasmid DNA (pDNA) and shRNA were used. The compositions of the mixtures are shown in Table 2.
Figure imgf000201_0001
The results are shown in Figure 35. For each of the 5 cells , the results of Figure 35 are converted into numerical data in Figures 36A to 36E.
Thus , it was revealed that the method of the present invention is applicable to any cells .
(Example 8: Use of RNAi miσroarray=siRNA)
Next, siRNA was used instead of shRNA to construct RNAi transfection microarrays in accordance with a protocol as described in Example 3.
18 transcription factor reporters and actin promoter vectors described in Table 3 were used to synthesize 28 siRNAs for the transcription factors . siRNA for EGFP was used as a control. Each siRNA was evaluated as to whether or not it knocks out a target transcription factor. Scramble RNAs were used as negative controls, and their ratios were evaluated. Table 3
Figure imgf000202_0001
Each cell was subjected to solid phase transfection, followed by culture for two days . Images were taken using a fluorescence image scanner, and the fluorescent level was quantified.
The results are shown in Figure 37. The results were summarized for each gene in Figures 38A to 38D.
As shown in Figures 37 and 38A to 38D, when RNAi was used, the expression of each gene was specifically suppressed. Thus , it was demonstrated that an array having a plurality of genetic materials, which is applicable to RNAi, can be realized and time-lapse analysis can be performed for the effect of RNAi on cells .
(Example 9: Transfection array using PCR fragments) Next, it was demonstrated that the present invention could be implemented when PCR fragments were used as genetic materials. The procedure will be described below.
PCR was performed to obtain nucleic acid fragments as shown in Figure 39. These fragments were used as genetic materials which were applied to transfection microarrays .
The procedure will be described below.
PCR primers were :
GG ATAACCGTAT TACCGCCATG CAT (SEQ ID NO.: 12); and ccctatctcggtctattcttttg CAAAAGAATA GACCGAGATA GGG (SEQ ID NO. : 13) .
pEGFP-Nl (see Figure 40) was used as a template,
PCR conditions were described in Table 4 below.
Table 4
Figure imgf000203_0001
Cycle conditions :94°C, 2 min → ( 94°C, 15 sec→60°C, 30 sec —> 68°C, 3 min) → 4°C (the process in parenthesis was performed 30 times)
The resultant PCR fragment was purified with phenol/chloroform extraction and ethanol precipitation. The PCR fragment has the following sequence:
GG ATAACCGTAT TACCGCCATG CAT TAGTTATTAA TAGTAATCAA TTACGGGGTC ATTAGTTCAT AGCCCATATA TGGAGTTCCG CGTTACATAA CTTACGGTAA ATGGCCCGCC TGGCTGACCG CCCAACGACC CCCGCCCATT GACGTCAATA ATGACGTATG TTCCCATAGT AACGCCAATA GGGACTTTCC ATTGACGTCA ATGGGTGGAG TATTTACGGT AAACTGCCCA CTTGGCAGTA CATCAAGTGT ATCATATGCC AAGTACGCCC CCTATTGACG TCAATGACGG TAAATGGCCC GCCTGGCATT ATGCCCAGTA CATGACCTTA TGGGACTTTC CTACTTGGCA GTACATCTAC GTATTAGTCA TCGCTATTAC CATGGTGATG CGGTTTTGGC AGTACATCAA TGGGCGTGGA TAGCGGTTTG ACTCACGGGG ATTTCCAAGT CTCCACCCCA TTGACGTCAA TGGGAGTTTG TTTTGGCACC AAAATCAACG GGACTTTCCA AAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCGCTA CCGGACTCAG ATCTCGAGCT CAAGCTTCGA ATTCTGCAGT CGACGGTACC GCGGGCCCGG GATCCACCGG TCGCCACCAT GGTGAGCAAG GGCGAGGAGC TGTTCACCGG GGTGGTGCCC ATCCTGGTCG AGCTGGACGG CGACGTAAAC GGCCACAAGT TCAGCGTGTC CGGCGAGGGC GAGGGCGATG CCACCTACGG CAAGCTGACC CTGAAGTTCA TCTGCACCAC CGGCAAGCTG CCCGTGCCCT GGCCCACCCT CGTGACCACC CTGACCTACG GCGTGCAGTG CTTCAGCCGC TACCCCGACC ACATGAAGCA GCACGACTTC TTCAAGTCCG CCATGCCCGA AGGCTACGTC CAGGAGCGCA CCATCTTCTT CAAGGACGAC GGCAACTACA AGACCCGCGC CGAGGTGAAG TTCGAGGGCG ACACCCTGGT GAACCGCATC GAGCTGAAGG GCATCGACTT CAAGGAGGAC GGCAACATCC TGGGGCACAA GCTGGAGTAC AACTACAACA GCCACAACGT CTATATCATG GCCGACAAGC AGAAGAACGG CATCAAGGTG AACTTCAAGA TCCGCCACAA CATCGAGGAC GGCAGCGTGC AGCTCGCCGA CCACTACCAG CAGAACACCC CCATCGGCGA CGGCCCCGTG CTGCTGCCCG ACAACCACTA CCTGAGCACC CAGTCCGCCC TGAGCAAAGA CCCCAACGAG AAGCGCGATC ACATGGTCCT GCTGGAGTTC GTGACCGCCG CCGGGATCAC TCTCGGCATG GACGAGCTGT ACAAGTAAAG CGGCCGCGAC TCTAGATCAT AATCAGCCAT ACCACATTTG TAGAGGTTTT ACTTGCTTTA AAAAACCTCC CACACCTCCC CCTGAACCTG AAACATAAAA TGAATGCAAT TGTTGTTGTT AACTTGTTTA TTGCAGCTTA TAATGGTTAC AAATAAAGCA ATAGCATCAC AAATTTCACA AATAAAGCAT TTTTTTCACT GCATTCTAGT TGTGGTTTGT CCAAACTCAT CAATGTATCT TAAGGCGTAA ATTGTAAGCG TTAATATTTT GTTAAAATTC GCGTTAAATT TTTGTTAAAT CAGCTCATTT TTTAACCAAT AGGCCGAAAT CGGCAAAATC CCTTATAAAT CAAAAGAATA GACCGAGATA GGG (SEQ ID NO . : 14). Chips were produced using the PCR fragment . MCF7 was disseminated on the chips. After two days, images were obtained using a fluorescence image scanner. The results are shown in Figure 41. In Figure 41, the PCR fragment is compared with circular DNA. In either case, transfection was successful . It was revealed that the PCR fragment , which was used as a genetic material, could be transfected into cells, as with full-length plasmids, so that time-lapse analysis could be performed for the cells.
(Example 10: Regulation of gene expression using tetracycline-dependent promoter)
As described in the above-described examples , it was demonstrated that a tetracycline-dependent promoter could be used to produce a profile showing how gene expression is regulated. The sequences described below were used.
As the tetracycline-dependent promoter ( and its gene vector construct), pTet-Off and pTet-On vectors (BD Biosciences) were used (see http : //www. clontech.com/techinfo/vectors/cattet . shtml) . As a vector, pTRE-d2EGFP (SEQ ID NO.: 29) was used (see http: //www.clontech.com/techinfo/vectors/vectorsT-Z/pTR E-d2EGFP. shtml) .
pTet-Off (BD Clonetech K1620-A)
Fragment containing PCMV : 86-673
Tetracyσline-responsive transcriptional activator (tTA): 774-1781
Col El origin of replication: 2604-3247 ? Ampicillin resistance gene: β-lactamase coding sequences: 4255-3395 Fragment containing the SV40 poly A signal: 1797-2254 Neomycin/kanamycin resistance gene: 6462-5668 SV40 promoter ( svβo) controlling expression of neomycin/kanamycin resistance gene: 7125-6782.
pTet-ON(BD Clonetech K1621-A)
Fragment containing PC V: 86-673
Reverse tetracycline-responsive transcriptional activator (rtTA) : 774-1781 • pUC origin of replication: 2604-3247 Ampicillin resistance gene: β-lactamase coding sequences: 4255-3395 Fragment containing the SV40 poly A signal: 1797-2254 Neomycin/kanamycin resistance gene: 6462-5668 • SV40 promoter (Psvo) controlling expression of neomycin/kanamycin resistance gene: 7125-6782.
pTRE-d2EGFP(BD Clonetech 6242-1)
Phcιstv*-ι Tet-responsive promoter: 1-438 Tet-responsive element (TRE): 1-318
Location of seven tetOlδ-mers: 15-33; 57-75; 99-117;
141-159; 183-201; 225-243; & 257-275
Fragment containing PmincM : 319-438
TATA box 341-348 • Destabilized enhanced green fluorescent protein (d2EGFP) gene
Start codon: 445-447; stop codon: 1288-1290
Insertion of Val at position #2: 448-450
GFPmutl mutations (Phe-64-Leu, Ser-65-Thr) : 634-639
His-231-Leu: 1137
Mouse ornithine decarboxylase (MODC) PEST sequence: 1167-1290 Fragment containing SV40 poly A signal: 1330-1787
(approximate coordinates of poly A signal: 1448-1453)
Fragment containing Col El origin of replication: 2137-2780
Ampicillin resistance gene β-lactamase coding sequences: 2928-3788 start codon: 3788-3786 stop codon: 2928-2930
(Protocol) pTet-Off and pTet-On (SEQ ID NOS.: 26 and 27, respectively) were printed onto array substrates . Real time measurement was performed on the array substrates to determine whether or not tetracycline regulates gene expression. The results are shown in Figure 42. As shown in Figure 42, a change in gene expression was detected only for the tetracycline-dependent promoter. Figure 43 is a photograph showing the actual states of expression for the tetracycline-dependent promoter and the tetracycline-independent promoter. As can be seen, the difference between them is measurable by the naked eye.
(Measurement of profile data) Images are taken in real time. Changes in intensity per cell or area are plotted on a graph. The resultant data may be subjected to linear transformation, such as noise reduction, and thenmultivariate analysis , signalprocessing, or the like, to obtain profile data. The resultant data is compared between phenomena or cells, thereby making it possible to obtain response or identity specific to cells. (Example 11: Gene expression)
Next, nucleic acid molecules encoding structural geneswereusedtoproduce cellularprofiles . In this example, an olfactory receptor 17 (SEQ ID NOS: 15, 16) was used as a structural gene . The protocol used in the above-described examples was used.
As a result , as with promoters , it was demonstrated that cellular profiles could be produced by measuring the amount of gene products or the like.
(Example 12: Apoptotic signals)
Next, it was investigated that cellular profiles could be produced by monitoring the activation of caspase 3 present within cells. Transfection and array preparation were performed as in the above-described examples.
pCaspase3-Sensor Vector (BD Biosciences Clontech, 1020 East Meadow Circle, Palo Alto, CA94303; cat. No. 8185-1) was used to monitor an apoptotic signal from caspase 3.
As a result, as with promoters, it was demonstrated that cellular profiles could be produced by measuring apoptotic signals or the like.
(Example 13: Stress signal)
Next, it was investigated whether cellular proflies concerning stress signals from JNK, ERK, p38 or the like could be produced using transcription factor reporters . Transfection and array preparation were performed as in the above-described examples.
pAPl-EGFP, pCRE-EGFP, and pSRE-EGFP available from BD Bioscience Clontech were used to monitor stress signals from JNK, ERK, and p38.
As a result, as in the above-described examples, it was demonstrated that cellular profiles could be produced by measuring stress signals.
(Example 14: Localization of molecules) Next, it was demonstrated that a gene of interest could be fused with a fluorescent protein so that the expression profile of the gene and the localization within cells of the gene could be visualized.
GFP, RFP, CFP and BFP, were used as fluorescent proteins and cloned KIAA cDNA libraries or the like were used as genes of interest to produce gene constructs. These materials are specifically described below:
clonedKIAA cDNA (KIAA=Kazusa DNAResearch Institute, Kazusa, Chiba, Japan); and cDNA libraries commercially available from Invitrogen.
Transfection and array preparation were performed as in the above-described examples.
The expression of cloned KIAA, KIAA1474, was monitored to produce a profile of the expression and investigate the localization of the expression.
As a result, as in the above-described examples, it was demonstrated that intentionally constructed gene constructs could be used to produce cellular profiles for target characteristics.
(Example 15: Changes in cellular morphology)
Next, it was demonstrated that cellular profiles concerning cellular morphology could be produced by expressing or knocking out genes or adding substances
(glycerophosphate as a chemical substance and dexamethasone as a cytokine) . Cellular morphology, such as multinucleated cells, cellular outgrowth, outgrowth projections, and the like, was measured and analyzed as three-dimensional data.
The specific sequences of the introduced nucleic acid molecules are described below:
Cloned KIAA ( supra) ; and
RNAi for transcription factors (CBFA-1, API).
Transfection and array preparation were performed as in the above-described examples.
Mesenchymal stemcells as usedin the above-described examples were used to monitor the morphology of cells which were induced to be differentiated into osteoblasts.
As a result, as in the above-described examples, it was demonstrated that intentionally constructed gene constructs could be used to produce cellular profiles for target characteristics . Event descriptors can be produced based on the profile data using the process as used in the above-described examples.
(Example 16: Intermolecular interaction)
Next, it was demonstrated that cellular profiles could be produced by using a technique such as a two-hybrid system, FRET, BRET, or the like.
The specific sequences of the introducednucleic acid molecules are described below:
olfactory receptors (SEQ ID NOS: 15 to 18); and G proteins (SEQ ID NOS: 19 to 24).
Transfection and array preparation were performed as in the above-described examples.
The dissociation of the olfactory receptor and the G protein was monitored through induction of a smelling substance, which was captured as changes in fluorescent wavelength. In this manner, cells were monitored.
The two-hybrid system, FRET, and BRET were specifically performed as follows .
The two-hybrid system was available from Clontech (http://www.clontech.co. jp/product/catalog/007003006. sh tml) . FRET and BRET were performed using devices available from Berthold Japan .
As a result, as in the above-described examples, it was demonstrated that intentionally constructed gene constructs could be used in a two-hybrid system, FRET, BRET, or the like to produce cellular profiles .
(Example 17: MicroRNA)
Next , nucleic acid molecules encoding microRNA (miRNA) were used to produce cellular profiles. As miRNA, miRNA-23 was used. A protocol as used in the above-described examples was used.
MicroRNA is a non-coding RNA of 18 to 25 bases (not translated into protein) , which was first found in nematodes and then revealed to bepreservedwidelyin animals andplants . It has been reported that miRNA is involved in the development and differentiation of nematodes and plants. It has been suggested that animals have a similar process. To date 200 or more miRNAs have been reported.
Nature 423, 838-842(2003) reported that the target ofmiRNA-23 is theHesl gene (Hesl is arepressor transcription factor which suppress the differentiation of stem cells into neurons). miRNA-23 is present in the vicinity of the translation terminating codon for this gene, and forms incomplete complementary base pairing (77%). Such incomplete complementary base pairing is important for the function of miRNA. Indeed, it has already been found that synthetic miRNA-23, which is introduced into NT2 human embryonic tumor cells, can suppress the expression of Hesl. This activity can be knocked out by using siRNA or the like.
According to the above-described principle, miRNA as set forth in SEQ ID NO.: 25 was actually produced.
It can be demonstrated that such a system can be used to produce a profile concerning the behavior of miRNA and measure the amount of relevant genetic material, thereby making it possible to produce cellular profiles.
(Example 18: Biological system-ribozyme) Next, aribozymewas usedtoproduce cellularprofiles . A ribozyme as described in 305 YAKUGAKU ZASSHI [Journal of Phamacology] 123(5) 305-313 (2003) was herein used. A protocol as described in Example 1 was used.
Ribozymes were discoveredbyobserving that the group
I intron of tetrahymena catalyzes site specific cleavage and binding reactions of RNA chains . A ribozyme refers to RNAhaving such an enzymatic activit . Examples of ribozymes include hammerhead ribozymes, hairpin ribozymes, and the like.
It can be demonstrated that such a system can be used to produce a profile concerning the behavior of a ribozyme and measure the transcription level of relevant genes , the amount of relevant genetic materials, or the like, thereby making it possible to produce cellular profiles.
Although certain preferred embodiments have been described herein, it is not intended that such embodiments be construed as limitations on the scope of the invention except as set forth in the appended claims . Various other modifications and equivalents will be apparent to and can be readily made by those skilled in the art, after reading the description herein, without departing from the scope and spirit of this invention. All patents, published patent applications and publications cited herein are incorporated by reference as if set forth fully herein.
INDUSTRIAL APPLICABILITY
According to the present invention, it is possible to determine the state of cells by observing a surprisingly small number of factors. Therefore, the present invention is applicable to diagnosis, prevention, and treatment. The present invention is also applicable to the fields of food, cosmetics, agriculture, environmental engineering, and the like.

Claims

1. A method for presenting a state of a cell, comprising the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a gene state associated with at least one gene selected from genes derived from the cell; and b) presenting the time-lapse profile.
2. A method according to claim 1 , further comprising fixing the cell to a solid phase support .
3. A method according to claim 1, wherein the time-lapse profile is presented in real time.
4. A method according to claim 1 , wherein the gene comprises a transcription control sequence, and the gene state includes expression of the gene.
5. A method for determining a state of a cell, comprising the steps of: a) obtaining a time-lapse profile of the cell by time-lapse monitoring of a gene state associated with at least one gene selected from genes derived from the cell; and b) determining the state of the cell based on the time-lapse profile of the gene state.
6. A method according to claim 5, further comprising fixing the cell to a solid phase support.
7. A method according to claim 5 , wherein the gene comprises a transcription control sequence, and the gene state includes expression of the gene.
8. A method according to claim 5, further comprising correlating the time-lapse profile with the state of the cell before obtaining the time-lapse profile.
9. A method according to claim 7 , wherein the transcription control sequence is selected from the group consisting of promoters, enhancers, silencers, other flanking sequences of structural genes in genomes , and genomic sequences other than exons .
10. Amethod according to claim 7 , wherein the transcription control sequences include at least one promoter selected fromthe group consistingof constitutivepromoters , specific promoters , and inducible promoters .
11. Amethod according to claim 7, wherein the transcription control sequences to be monitored include at least two transcription control sequences .
12. A method according to claim 7 , wherein the transcription control sequences to be monitored include at least three transcription control sequences.
13. Amethod according to claim 7 , wherein the transcription control sequences to be monitored include at least eight transcription control sequences .
14. A method according to claim 7, further comprising arbitrarily selecting at least one transcription control sequence from the transcription control sequences .
15. A method according to claim 5, wherei the time-lapse profile is presented in real time.
16. A method according to claim 5, wherein the state of the cell is selected from the group consisting of a differentiated state, an undifferentiated state, a cellular response to an external agent, a cell cycle, and a growth state.
17. A method according to claim 5, wherein the cell is selected from the group consisting of stem cells and somatic cells.
18. A method according to claim 5, wherein the cell is selected from the group consisting of adherent cells, suspended cells, tissue forming cells , and mixtures thereof .
19. A method according to claim 6, wherein the solid phase support comprises a substrate.
20. A method according to claim 7 , wherein the cell is transfected with a nucleic acid molecule comprising the transcription control sequence and a reporter gene sequence operably linked to the transcription control sequence.
21. A method according to claim 20 , wherein the transfection is performed in solid phase or in liquid phase.
22. A method according to claim 5, wherein the step of b) comprises a mathematical process selected from the group consisting of phase comparison, signal processing, and multivariate analysis, of the time-lapse profile.
23. A method according to claim 5, wherein the step of b) comprises calculating a difference between the time-lapse profile of the cell and a control profile.
24. A method for correlating an external factor with a response of a cell to the external factor, comprising the steps of: a) exposing the cell to the external factor; b) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consistingof transcription controlfactors derived from the cell; and c) correlating the external factor with the time-lapse profile.
25. A method according to claim 24 , wherein the cell is fixed to a solid phase support .
26. A method according to claim 24, further comprising exposing the cell to at least two external factors to obtain a time-lapse profile of the cell for each external factor.
27. A method according to claim 26, further comprising dividing the at least two time-lapse profiles into categories and classifying the external factors corresponding to the respective time-lapse profiles into the categories.
28. Amethodaccordingto claim 24 , wherein the transcription control factor includes a constitutive promoter.
29. Amethodaccording to claim 24 , wherein the transcription control factor includes an inducible promoter.
30. A method according to claim 24, wherein the time-lapse profile is presented in real time.
31. A method according to claim 24, wherein in the step of c) , the external factor is correlated with the time-lapse profile based on a phase of the time-lapse profile.
32. A method according to claim 24, wherein the cell is cultured on an array.
33. A method according to claim 32, wherein the step of b) comprises obtaining image data from the array.
34. A method according to claim 26, wherein the step of c) comprises distinguishing phases of the time-lapse profiles from one another.
35. A method according to claim 24, wherein the external factor is selected from the group consisting of a temperature change, a humidity change, an electromagnetic wave, a potential difference, visible light, infrared light, ultraviolet light. X-ray, a chemical substance, a pressure, a gravity change, a gas partial pressure, and an osmotic pressure.
36. A method according to claim 35, wherein the chemical substance is a biological molecule, a chemical compound, or a medium.
37. A method according to claim 36, wherein the biological molecule is selected from the group consisting of nucleic acids, proteins, lipids, sugars, proteolipids, lipoproteins. glycoproteins, and proteoglycans .
38. A method according to claim 36, wherein the biological molecule is a hormone.
39. A method according to claim 36, wherein the biological molecule is a cytokine .
40. A method according to claim 36, wherein the biological molecule is a cell adhesion factor.
41. A method according to claim 36, wherein the biological molecule is an extracellular matrices .
42. A method according to claim 35, wherein the chemical substance is a receptor agonist or antagonist .
43. A method for inferring an unidentified external factor given to a cell based on a time-lapse profile, comprising the steps of: a) exposing theσell to a plurality ofknown external factors; b) obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; c) correlating the known external factors with the respective time-lapse profiles; d) exposing the cell to the unidentified external factor; e) obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of the transcription level of the selectedtranscription control sequence; f) determining a profile corresponding to the time-lapse profile obtained in the step of e) from the time-lapse profiles obtained in the step of b); and g) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the step of f).
44. A method for inferring an unidentified external factor given to a cell based on a time-lapse profile, comprising the steps of: a) providing data relating to a correlation relationship between known external factors and time-lapse profiles of the cell in response to theknown external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) exposing the cell to the unidentified external factor; c) obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with the selected transcription control sequence; d) determining a profile corresponding to the time-lapse profile obtained in the step of c) from the time-lapse profiles obtained in the step of a) ; and e) determining that the unidentified external factor is the known external factor corresponding to the profile determined in the step of d) .
45. A system for presenting a state of a cell, comprising: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b) means for presenting the time-lapse profile.
46. A system for determining a state of a cell, comprising: a) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b) means for determining the state of the cell based on the time-lapse profile.
47. A system for correlating an external factor with a response of a cell to the external factor, comprising: a) means for exposingthecellto the external factor; b) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associated with at least one promoter selected from the group consisting of promoters derived from the cell; and c) means for correlating the external factor with the time-lapse profile.
48. A system for inferring an unidentified external factor given to a cell based on a time-lapse profile, comprising: a) means for exposing the cell to a plurality of known external factors; b) means for obtaining a time-lapse profile of the cell for each known external factor by time-lapse monitoring of a transcription level associated with at least one transcription control factor selected from the group consisting of transcription control factors derived from the cell; c) means for correlating the known external f ctors with the respective time-lapse profiles; d) means for exposing the cell to the unidentified external factor; e) means for obtaining a time-lapse profile of the unidentified external factor by time-lapse monitoring of the transcription level of the selected transcription control sequence; f) means for determining a profile corresponding to the time-lapse profile obtained in the means of e) from the time-lapse profiles obtained in the means of b); and g) means for determining that the unidentified external factor is the known external factor corresponding to the profile determined in the means of f).
49. A system for inferring an unidentified external factor given to a cell based on a time-lapse profile, comprising: a) means for providing data relatingto a correlation relationship between known external factors and time-lapse profiles of the cell in response to theknown external factors , in relation to at least one transcription control sequence selected from transcription control sequences present in the cell; b) means for exposing the cell to the unidentified external factor; c) means for obtaining a time-lapse profile of the cell by time-lapse monitoring of a transcription level associatedwith the selected transcription control sequence; d) means for determining a profile corresponding to the time-lapse profile obtained in the means of c) from the time-lapse profiles obtained in the means of a); and e) determining that the unidentified external factor is the known external factor corresponding to the pro ile determined in the means of d) .
PCT/JP2004/002694 2003-03-04 2004-03-03 Time-lapse cell analysis method WO2004079007A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2006507660A JP2006522605A (en) 2003-03-04 2004-03-03 Time-lapse cell analysis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2003057870 2003-03-04
JP2003-057870 2003-03-04

Publications (2)

Publication Number Publication Date
WO2004079007A2 true WO2004079007A2 (en) 2004-09-16
WO2004079007A3 WO2004079007A3 (en) 2004-12-02

Family

ID=32958778

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2004/002694 WO2004079007A2 (en) 2003-03-04 2004-03-03 Time-lapse cell analysis method

Country Status (2)

Country Link
JP (1) JP2006522605A (en)
WO (1) WO2004079007A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11869181B2 (en) 2018-09-28 2024-01-09 Fujifilm Corporation Determination method
US12067713B2 (en) 2018-09-28 2024-08-20 Fujifilm Corporation Determination method

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5670020B2 (en) * 2008-10-21 2015-02-18 株式会社ビーエムティーハイブリッド Three-dimensional cell culture chip and method of using the same
WO2019021472A1 (en) * 2017-07-28 2019-01-31 オリンパス株式会社 Cell identification method, method for producing cell population, and cell identification system

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002088165A1 (en) * 2001-04-30 2002-11-07 Doranz Benjamin J Elucidation of gene function

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020006664A1 (en) * 1999-09-17 2002-01-17 Sabatini David M. Arrayed transfection method and uses related thereto

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002088165A1 (en) * 2001-04-30 2002-11-07 Doranz Benjamin J Elucidation of gene function

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BAILEY S N ET AL: "APPLICATIONS OF TRANSFECTED CELL MICROARRAYS IN HIGH-THROUGHPUT DRUG DISCOVERY" DRUG DISCOVERY TODAY, ELSEVIER SCIENCE LTD, GB, vol. 7, no. 18, SUPPL, 2002, pages S113-S118, XP008026706 ISSN: 1359-6446 *
DATABASE BIOSIS [Online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; 2000, WEBB KEN ET AL: "Fibronectin immobilized by a novel surface treatment regulates fibroblast attachment and spreading" XP009034748 Database accession no. PREV200000504258 & CRITICAL REVIEWS IN BIOMEDICAL ENGINEERING, vol. 28, no. 1-2, 2000, pages 203-208, 18TH SOUTHERN BIOMEDICAL ENGINEERING CONFERENCE AND THE 2ND INTERNATIONAL CONFERENCE ON ETHICAL ISSU; CLEMSON, SOUTH CAROLINA, USA; MAY 21-23, 1999 ISSN: 0278-940X *
DATABASE BIOSIS [Online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; 28 April 2004 (2004-04-28), YOSHIKAWA TOMOHIRO ET AL: "Transfection microarray of human mesenchymal stem cells and on-chip siRNA gene knockdown" XP002291278 Database accession no. PREV200400300235 & JOURNAL OF CONTROLLED RELEASE, vol. 96, no. 2, 28 April 2004 (2004-04-28), pages 227-232, ISSN: 0168-3659 *
DATABASE BIOSIS [Online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; 7 March 2001 (2001-03-07), PRECKEL TOBIAS ET AL: "The use of Lab-on-a-Chip technology for monitoring transfection efficiency in cells" XP009034806 Database accession no. PREV200100290293 & FASEB JOURNAL, vol. 15, no. 4, 7 March 2001 (2001-03-07), page A531, ANNUAL MEETING OF THE FEDERATION OF AMERICAN SOCIETIES FOR EXPERIMENTAL BIOLOGY ON EXPERIMENTAL BIOL; ORLANDO, FLORIDA, USA; MARCH 31-APRIL 04, 2001 ISSN: 0892-6638 *
DATABASE MEDLINE [Online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; September 2000 (2000-09), GORE M A ET AL: "Gene expression changes associated with cytotoxicity identified using cDNA arrays." XP002291277 Database accession no. NLM11793227 & FUNCTIONAL & INTEGRATIVE GENOMICS. SEP 2000, vol. 1, no. 2, September 2000 (2000-09), pages 114-126, ISSN: 1438-793X *
WU R Z ET AL: "Cell-biological applications of transfected-cell microarrays" TRENDS IN CELL BIOLOGY 01 OCT 2002 UNITED KINGDOM, vol. 12, no. 10, 1 October 2002 (2002-10-01), pages 485-488, XP002291276 ISSN: 0962-8924 *
ZIAUDDIN JUNAID ET AL: "Microarrays of cells expressing defined cDNAs" NATURE, MACMILLAN JOURNALS LTD. LONDON, GB, vol. 411, no. 6833, 2001, pages 107-110, XP002246363 ISSN: 0028-0836 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11869181B2 (en) 2018-09-28 2024-01-09 Fujifilm Corporation Determination method
US12067713B2 (en) 2018-09-28 2024-08-20 Fujifilm Corporation Determination method

Also Published As

Publication number Publication date
JP2006522605A (en) 2006-10-05
WO2004079007A3 (en) 2004-12-02

Similar Documents

Publication Publication Date Title
EP1727065A1 (en) Event sequencer
Li et al. Regulatory T-cells regulate neonatal heart regeneration by potentiating cardiomyocyte proliferation in a paracrine manner
JP2010207222A (en) Digital cell
JPWO2006001397A1 (en) Cell network analysis system
Hernández-Miranda et al. Robo1 regulates semaphorin signaling to guide the migration of cortical interneurons through the ventral forebrain
Izumi et al. Bone morphogenetic protein-2 inhibits serum deprivation-induced apoptosis of neonatal cardiac myocytes through activation of the Smad1 pathway
Krishn et al. The αvβ6 integrin in cancer cell-derived small extracellular vesicles enhances angiogenesis
Wilson et al. Endogenous retrovirus-derived lncRNA BANCR promotes cardiomyocyte migration in humans and non-human primates
Raju et al. Secretagogin is expressed by developing neocortical GABAergic neurons in humans but not mice and increases neurite arbor size and complexity
De Santis Puzzonia et al. Tetraploid cells produced by absence of substrate adhesion during cytokinesis are limited in their proliferation and enter senescence after DNA replication
Bonnet et al. Quaking RNA-binding proteins control early myofibril formation by modulating tropomyosin
WO2004079007A2 (en) Time-lapse cell analysis method
de Lima et al. BMP signalling directs a fibroblast-to-myoblast conversion at the connective tissue/muscle interface to pattern limb muscles
WO2009033162A1 (en) Gene targets in anti-aging therapy and tissue repair
US20100144038A1 (en) Composition And Method For Increasing Efficiency Of Introduction Of Target Substance Into Cell
Rebustini A functional MicroRNA screening method for organ morphogenesis
WO2004079331A2 (en) Composition and method for immobilizing a substance on a solid-phase support
US20070174009A1 (en) Methods and systems for analyzing a network of biological functions
Cardeira-da-Silva et al. Antigen presentation plays positive roles in the regenerative response to cardiac injury in zebrafish
D’Antonio-Chronowska et al. Human iPSC gene signatures and X chromosome dosage impact response to WNT inhibition and cardiac differentiation fate
CA2554753A1 (en) Composition and method for elevating gene transfer efficiency
Giri et al. Single-cell Senseless protein analysis reveals metastable states during the transition to a sensory organ fate
CN108179181B (en) Application of RDX gene in clinical medication
Cherry et al. Transfer learning identifies in vivo senescence heterogeneity and contributions to vascularization and matrix production across species and diverse pathologies
Bielczyk-Maczynska et al. CROP-Seq: a single-cell CRISPRi platform for characterizing candidate genes relevant to metabolic disorders in human adipocytes

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2006507660

Country of ref document: JP

122 Ep: pct application non-entry in european phase