JP2007082402A - Composition and method for immobilizing inheritable substance on supporting body and introducing the same into cell - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for immobilizing an inheritable substance on a supporting body simply on an optional timing by an optional combination. <P>SOLUTION: This kit for immobilizing the inheritable substance on a supporting body and then introducing the same into cells is provided by containing (a) the inheritable substance, (b) a charged substance having an opposite electric charge to the inheritable substance and (c) a salt, and being equipped with a direction document for directing to mix the inheritable substance with the charged substance and the salt on the solid phase supporting body. Also the method for immobilizing the inheritable substance on the supporting body and then introducing the same into the cells is provided by comprising (I) a process of providing the supporting body, (II) a process of providing (a) the inheritable substance, (b) the charged substance having an opposite electric charge to the inheritable substance and (c) the salt separately or together to the supporting body and (III) a process of mixing the inheritable substance with the charged substance and the salt on the solid phase supporting body. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a genetic material immobilization technique. More specifically, the present invention relates to a method for immobilizing a substance such as a biomolecule on a solid support and kits, compositions, etc. related thereto.

  Attempts to perform various analyzes by immobilizing genetic material such as DNA on a support such as a microtiter plate are widely performed.

  Conventional methods for immobilizing biomolecules on a support include, for example, a method via a covalent bond, a surface treatment of a solid phase such as hydrophobic interaction, adsorption and silanization.

  For example, Nikiforov et al. Disclosed a method utilizing the binding of an oligomer to a polystyrene well using a cationic surfactant as a medium (Non-patent Document 1).

Nagata et al. Disclosed a technique for binding an unknown amount of cloning DNA to a microtiter well in the presence of 0.1 M MgCl ₂ (Non-patent Document 2). Dahlen, P.M. et al. Describes adsorbing a cloning capture DNA to a well in sandwich hybridization in a microtiter well (Non-patent Document 3). Binding of oligomers in NaCl media to polystyrene wells is described in Nikiforov Nikiforov et al. (Non-Patent Document 4).

  However, since these methods require a certain number of man-hours or special treatments in the fixing step, there is a great demand for more simple methods for fixing substances such as biomolecules.

  In addition, it is often desirable to release slowly after fixation. In such a case, for example, after immobilizing a biomolecule once on a plate such as a microtiter plate, it is necessary to gradually release the immobilized biomolecule after the plate is immersed in an assay solution in an assay. Cases. Alternatively, in some cases, it is required to maintain affinity for a living body such as a cell after fixation, but this is not achieved by conventional methods, or the affinity for a living body after fixation may be greatly reduced. At present, a satisfactory fixing method has not been developed.

In addition, the present inventors have found a method of interposing a salt in order to immobilize a biological material on a support, but in this field, genetic material is simply immobilized on a support on the support. There is a need to enable introduction into cells. In particular, if an array of various patterns can be created by arbitrarily mixing a plurality of genetic materials on a support (for example, an array, etc.), it is expected that the development speed for cells will be dramatically increased. Therefore, the advent of such a technology is awaited.
Nikiforov et al. Nucleic Acids Res. 22: 4167-4175, 1994 Nagata et al. , FEBS Letters 183: 379-382 (1985). Dahlen et al. Mol. Cell. Probes 1: 159-168 (1987) PCR Methods Applic. 3: 285-291, 1994

  In view of the above situation, an object of the present invention is to develop a method for fixing genetic material to a support and introducing it into cells. In the present invention, after fixation to a support, a substance such as a biomolecule fixed when dissolved in a specific solution is gradually released, or affinity for a living body such as a cell is substantially maintained or improved. One of the issues was to develop a fixing method that achieves this effect. In particular, it was aimed to develop a technique that allows a plurality of genetic materials to be arranged in an arbitrary pattern on a support and then introduced into cells.

  The above-mentioned problems include genetic substances such as DNA, RNA, and polypeptides, substances having opposite charges, and salts (organic salts, inorganic salts (for example, inorganic salts such as calcium phosphate contained in a medium)), It was solved by the present inventors that, by mixing on the support, it was unexpectedly fixed on the support, and then taken into the cell and expressed in the cell. The inventors have also unexpectedly found that with the above configuration, the immobilized genetic material is sustained and then released slowly when the support (eg, plate) is immersed in a solution such as an assay solution. . The present inventors have also found that the affinity for a living body (eg, tissue, cell) is maintained or improved by using the above configuration.

Thus, the present invention provides the following.
1. A kit for fixing genetic material to a support and introducing it into cells,
a) genetic material;
b) a charged substance having a charge opposite to that of the genetic material;
c) salt,
Including
A kit comprising instructions for instructing mixing of said genetic material, said charged material and salt on a solid support.
2. Item 2. The kit according to Item 1, wherein at least two substances selected from the group consisting of the genetic material, the charged material, and the salt are provided in a mixed state.
3. Item 2. The kit according to Item 1, wherein there are at least two kinds of the genetic material.
4). Item 2. The kit according to Item 1, wherein the genetic material is selected from the group consisting of DNA, RNA, PNA, and combinations thereof.
5. Item 2. The kit according to Item 1, wherein the charged substance has cell affinity.
6). The kit according to item 1, wherein the charged substance includes a biomolecule.
7). Item 7. The kit according to Item 6, wherein the biomolecule is selected from the group consisting of DNA, RNA, polypeptide, lipid, sugar, small organic molecule, and a complex thereof.
8). The kit according to item 1, wherein the charged substance is selected from the group consisting of a cationic polymer, a cationic lipid, a cationic polyamino acid and a complex thereof.
9. Item 2. The kit according to Item 1, wherein the charged substance is selected from the group consisting of a polyamine reagent, a polyimine reagent, a liposome reagent, and a charged colloid.
10. Item 2. The kit according to Item 1, wherein the salt is obtained by replacing hydrogen of an organic acid or inorganic acid with a metal, or by replacing a hydroxyl group of a base with an organic acid group or an inorganic acid group.

11. Item 1 is selected from the group consisting of calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids and vitamins. The kit according to 1.
12 Item 2. The kit according to Item 1, wherein the salt is provided in the form of a buffer solution, a culture solution, and serum.
13. Item 2. The kit according to Item 1, wherein the genetic material encodes a material having biological activity after being introduced into a cell.
14 Item 2. The kit according to Item 1, wherein the genetic material, the charged material, and the salt are pharmaceutically acceptable.
15. Item 2. The kit according to Item 1, wherein the genetic material, the charged material, and the salt are contained in a microcapsule.
16. A method for fixing genetic material to a support and introducing it into a cell,
I) providing a support;
II) providing the support separately or together with a) genetic material, b) a charged material having a charge opposite to that of the genetic material, and c) a salt;
III) mixing the genetic material, the charged material and the salt on a solid support;
Including the method.
17. Item 17. The method according to Item 16, wherein at least two substances selected from the group consisting of the genetic material, the charged material, and the salt are provided in a mixed state.
18. Item 17. The method according to Item 16, wherein there are at least two types of the genetic material.
19. Item 17. The method according to Item 16, wherein the genetic material is selected from the group consisting of DNA, RNA, PNA, and combinations thereof.
20. Item 17. The method according to Item 16, wherein the charged substance has cell affinity.
21. Item 17. The method according to Item 16, wherein the charged substance includes a biomolecule.
22. Item 22. The method according to Item 21, wherein the biomolecule is selected from the group consisting of DNA, RNA, polypeptide, lipid, sugar, small organic molecule, and complex thereof.
23. Item 17. The method according to Item 16, wherein the charged substance is selected from the group consisting of a cationic polymer, a cationic lipid, a cationic polyamino acid and a complex thereof.
24. Item 17. The method according to Item 16, wherein the charged substance is selected from the group consisting of a polyamine reagent, a polyimine reagent, a liposome reagent, and a charged colloid.
25. Item 17. The method according to Item 16, wherein the salt is one obtained by substituting hydrogen of an organic acid or inorganic acid with a metal, or by substituting a hydroxyl group of a base with an organic acid group or inorganic acid group.
26. Item 16 wherein the salt is selected from the group consisting of calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids and vitamins. The method described in 1.
27. Item 18. The method according to Item 16, wherein the salt is provided in the form of a buffer, a culture solution and serum.
28. The method according to item 16, wherein the genetic material encodes a material having biological activity after being introduced into a cell.
29. The method according to item 16, wherein the genetic material, the charged substance and the salt are pharmaceutically acceptable.
30. Item 17. The method according to Item 16, wherein the genetic material, the charged material, and the salt are contained in a microcapsule.
31. Item 17. The method according to Item 16, wherein the support is a solid phase support.
32. The method according to item 16, wherein the support comprises a material selected from the group consisting of glass, silica, silicon, ceramic, silicon dioxide, plastic, metal, natural polymer and synthetic polymer.
33. The method according to item 16, wherein the support is coated.
34. 34. The method according to item 33, wherein the coating is performed by a coating agent containing a substance selected from the group consisting of poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin, and metal.
35. Item 17. The method according to Item 16, wherein the support is a chip.
36. Item 17. The method according to Item 16, wherein the support is a chip, and the complex is arranged in an array on the chip.
37. Item 17. The method according to Item 16, wherein the biomolecule is introduced into a cell and has biological activity.
38. Item 17. The method according to Item 16, wherein Step II) is performed under conditions that do not destroy the biomolecule.
39. The method according to item 16, wherein the step III) is performed under conditions that do not destroy the biomolecule.
40. The method according to item 16, further comprising the step of reducing or removing the solvent in the mixture after attaching the mixture to the solid support.
41. A support in which genetic material, a charged material having a charge opposite to that of the genetic material, and a salt are fixed to the surface.
42. 42. A support according to item 41, wherein the genetic material can be introduced into cells.
43. Item 42. The support according to Item 41, wherein the genetic material is contained in two or more types.
44. 42. The support according to item 41, wherein the genetic material is selected from the group consisting of DNA, RNA, PNA and combinations thereof.
45. Item 42. The support according to Item 41, wherein the charged substance has cell affinity.
46. Item 42. The support according to Item 41, wherein the charged substance includes a biomolecule.
47. 42. The support according to item 41, wherein the biomolecule is selected from the group consisting of DNA, RNA, polypeptide, lipid, sugar, small organic molecule, and a complex thereof.
48. 42. The support according to item 41, wherein the charged substance is selected from the group consisting of a cationic polymer, a cationic lipid, a cationic polyamino acid and a complex thereof.
49. Item 42. The support according to Item 41, wherein the charged substance is selected from the group consisting of a polyamine reagent, a polyimine reagent, a liposome reagent, and a charged colloid.
50. Item 42. The support according to Item 41, wherein the salt is obtained by substituting hydrogen of an organic acid or inorganic acid with a metal, or by substituting a hydroxyl group of a base with an organic acid group or an inorganic acid group.
51. Item 41, wherein the salt is selected from the group consisting of calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids and vitamins. The support according to 1.
52. 42. The support according to item 41, wherein the salt is provided in the form of a buffer solution, a culture solution and serum.
53. 42. The support according to item 41, wherein the genetic material encodes a material having biological activity after being introduced into a cell.
54. 42. A support according to item 41, wherein the genetic material, the charged substance and the salt are pharmaceutically acceptable.
55. 42. The support according to item 41, wherein the genetic material, the charged substance and the salt are contained in a microcapsule.
56. 42. The support according to item 41, wherein the support is a solid support.
57. 42. A support according to item 41, wherein the support includes a material selected from the group consisting of glass, silica, silicon, ceramic, silicon dioxide, plastic, metal, natural polymer, and synthetic polymer.
58. 42. A support according to item 41, wherein the support is coated.
59. 59. The support according to item 58, wherein the coating is performed by a coating agent comprising a material selected from the group consisting of poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin, and metal.
60. 42. A support according to item 41, wherein the support is a chip.
61. 42. The support according to item 41, wherein the support is a chip, and the composite is arranged in an array on the chip.
62. 42. The support according to item 41, wherein the biomolecule is introduced into a cell and has biological activity.

  These and other advantages of the present invention will be apparent to those of ordinary skill in the art upon reading and understanding the following detailed description with reference to the accompanying drawings.

  Genetic material can be mixed in an arbitrary pattern on a support (eg, array, plate, etc.), introduced into a cell, and gene expression can be performed. Therefore, it has become possible to examine the effects on cells such as when a plurality of genes are simultaneously introduced into cells. Cells are an important tool in medical technology, drug development, and the like, and since various tools can be developed, their industrial utility should be evaluated.

  The present invention will be described below. Throughout this specification, it should be understood that the singular forms also include the plural concept unless specifically stated otherwise. In addition, it is to be understood that the terms used in the present specification are used in the meaning normally used in the art unless otherwise specified.

(the term)
Listed below are definitions of terms particularly used in the present specification.

  The term “substance” as used herein is included in the same meaning as the broadest meaning used in the art, and includes those that can be positively or negatively charged.

  As used herein, “genetic material” refers to any material that carries genetic information. Examples of such substances include, but are not limited to, DNA, RNA, PNA, protein, and the like. The DNA can be in any form such as cDNA, genomic DNA, artificial DNA, RNAi. The RNA may be mRNA, tRNA, rRNA, RNAi and the like.

  As used herein, “charged substance” refers to a substance that may or may have a charge. Such materials include, but are not limited to, positively charged materials and negatively charged materials.

  As used herein, “positively charged substance” includes all substances having a positive charge. Examples of such substances include, but are not limited to, cationic substances such as cationic polymers and cationic lipids. Preferably, such a positively charged substance is advantageously a substance capable of forming a complex. The positively charged substance that can form such a complex includes, for example, a substance having a certain molecular weight such as a cationic polymer, or a specific solvent such as water (e.g., water, Examples include, but are not limited to, substances that can remain in the aqueous solution without being dissolved to some extent. Examples of such preferable positively charged substance include, but are not limited to, polyethyleneimine, poly L-lysine, synthetic polypeptide, or derivatives thereof. Alternatively, positively charged substances include, but are not limited to, biomolecules such as histones, synthetic polypeptides, and the like. The type of such preferred positively charged material will vary depending on the type of negatively charged material that is the partner forming the complex. Selecting a preferred complexing partner is easy for those skilled in the art, and such selection can be made using techniques well known in the art. Various parameters can be taken into account in selecting such a preferred complexing partner. Examples of such parameters include various physical parameters such as charge, molecular weight, hydrophobicity, hydrophilicity, substituent properties, pH, temperature, salt concentration, pressure, and chemical parameters. It is not limited.

  As used herein, “cationic polymer” refers to a polymer having a cationic functional group, and examples thereof include, but are not limited to, polyethyleneimine, poly-L-lysine, synthetic polypeptide, or derivatives thereof.

  As used herein, “cationic lipid” refers to a lipid having a cationic functional group, and examples thereof include, but are not limited to, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, and derivatives thereof.

  Here, examples of the cationic functional group include, but are not limited to, primary amines, secondary amines, and tertiary amines.

  As used herein, “negatively charged material” includes all materials having negative charge. Examples of such substances include, but are not limited to, biomolecular polymers such as DNA and anionic substances such as anionic lipids. Preferably, such negatively charged substances are advantageously substances capable of forming a complex. Examples of the negatively charged substance capable of forming such a complex include a substance having a certain molecular weight such as an anionic polymer such as DNA, or a specific solvent such as an anionic lipid ( Examples thereof include, but are not limited to, substances that can remain in the aqueous solution without being dissolved to some extent. Examples of such preferable negatively charged substance include, but are not limited to, DNA, RNA, PNA, polypeptide, chemical compound, and complex thereof. Alternatively, negatively charged substances include, but are not limited to, biomolecules such as DNA, RNA, PNA, polypeptides, chemical compounds, and complexes thereof. The type of such preferred negatively charged material will vary depending on the type of positively charged material that is the partner forming the complex. Selecting a preferred complexing partner is easy for those skilled in the art, and such selection can be made using techniques well known in the art. Various parameters can be taken into account in selecting such a preferred complexing partner. Such parameters also include various as well as the parameters to be considered in the positively charged materials described above.

  As used herein, “anionic polymer” refers to a polymer having an anionic functional group, and examples thereof include, but are not limited to, DNA, RNA, PNA, polypeptide, chemical compound, and complex thereof.

  In the present specification, “anionic lipid” refers to a lipid having an anionic functional group, and examples thereof include, but are not limited to, phosphatidic acid and phosphatidylserine.

  Here, examples of the anionic functional group include, but are not limited to, a carboxyl group and a phosphate group.

  Therefore, the genetic material of the present invention means a “charged material having an opposite charge” when the genetic material is a positively charged material as described above. In the case of a negatively charged substance as described above, it means a positively charged substance.

  In addition, the charge of the target substance can be converted by adding a portion such as a substituent having a positive charge or a negative charge to the target substance. When preferred complex partners have the same charge as the substance intended for immobilization, complex formation can be facilitated by converting either charge.

  In this specification, “interaction” means that when two objects are referred to, the two objects exert a force on each other. Examples of such interactions include, but are not limited to, covalent bonds, hydrogen bonds, van der Waals forces, ionic interactions, nonionic interactions, hydrophobic interactions, electrostatic interactions, etc. Not. Preferably, the interaction is a hydrogen bond, a hydrophobic interaction or the like. In this specification, the term “covalent bond” is used in a normal sense in the art, and refers to a chemical bond formed by sharing an electron pair with two atoms. In the present specification, the term “hydrogen bond” is used in a normal sense in the field, and the hydrogen nucleus is exposed by attracting an extra-nuclear electron of a hydrogen atom that is only one of the highly electronegative atoms. A bond formed by attracting another highly electronegative atom, for example, formed between a hydrogen atom and an atom (fluorine, oxygen, nitrogen, etc.) having a high electronegativity.

  As used herein, the term “biological substance” or “biomolecule” is used interchangeably herein and refers to a substance or molecule associated with a living body. A biomolecule includes, but is not limited to, a molecule extracted from a living body. Any molecule that can affect a living body falls within the definition of a biomolecule. Therefore, as long as a molecule synthesized by combinatorial chemistry is also intended to have an effect on a living body, it falls within the definition of a biological substance. Biological materials include proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (eg, DNA such as cDNA, genomic DNA, RNA such as mRNA), polysaccharides, oligosaccharides , Lipids, small molecules (for example, small organic molecules), complex molecules thereof, and the like, but are not limited thereto. Thus, biological materials can include cells themselves, parts of tissues, and other materials as long as they can form complexes with polymer molecules.

  As used herein, “polymer molecule” refers to a high molecular weight substance formed by polymerization of a monomer, and generally refers to a substance having a molecular weight of about 5000 or more.

  As used herein, the terms “protein”, “polypeptide”, “oligopeptide” and “peptide” are used interchangeably herein to refer to polymers of amino acids of any length or variants thereof. Say. This polymer may be linear, branched, or cyclic. The amino acid may be natural or non-natural and may be a modified amino acid. The term can also encompass those assembled into a complex of multiple polypeptide chains. The term also encompasses natural or artificially modified amino acid polymers. Such modifications include, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other manipulation or modification (eg, conjugation with a labeling component). This definition also includes, for example, polypeptides (eg, including unnatural amino acids, etc.), peptide-like compounds (eg, peptoids), and other known in the art, including one or more analogs of amino acids. Modifications are included.

  As used herein, the terms “polynucleotide”, “oligonucleotide”, “nucleic acid” and “nucleic acid molecule” are used interchangeably herein and are polymers of nucleotides of any length or variants thereof. Say. The term also includes “derivative oligonucleotide” or “derivative polynucleotide”. As used herein, the term “gene” may be used interchangeably with “polynucleotide”, “oligonucleotide”, “nucleic acid” and “nucleic acid molecule”. As used herein, the term “derivative oligonucleotide” or “derivative polynucleotide” refers to an oligonucleotide or polynucleotide that includes a derivative of a nucleotide or that has an unusual linkage between nucleotides, and is used interchangeably. . Specific examples of such oligonucleotides include, for example, 2′-O-methyl-ribonucleotides, derivative oligonucleotides in which phosphodiester bonds in oligonucleotides are converted to phosphorothioate bonds, and phosphodiester bonds in oligonucleotides. Is an N3′-P5 ′ phosphoramidate bond derivative oligonucleotide, a ribose and phosphodiester bond in the oligonucleotide converted to a peptide nucleic acid bond, and uracil in the oligonucleotide is C− A derivative oligonucleotide substituted with 5-propynyluracil, a derivative oligonucleotide wherein uracil in the oligonucleotide is substituted with C-5 thiazole uracil, and cytosine in the oligonucleotide is C-5 propynylcytosine Substituted derivative oligonucleotides, derivative oligonucleotides in which the cytosine in the oligonucleotide is replaced with phenoxazine-modified cytosine, derivative oligonucleotides in which the ribose in the DNA is replaced with 2'-O-propylribose Examples thereof include derivative oligonucleotides in which ribose in the oligonucleotide is substituted with 2′-methoxyethoxyribose. Unless otherwise indicated, a particular nucleic acid sequence may also be conservatively modified (eg, degenerate codon substitutes) and complementary sequences, as well as explicitly indicated sequences. Is contemplated. Specifically, a degenerate codon substitute creates a sequence in which the third position of one or more selected (or all) codons is replaced with a mixed base and / or deoxyinosine residue. (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91-98). 1994)).

  In the present specification, “RNAi” is an abbreviation for RNA interference, and by introducing a factor that causes RNAi such as double-stranded RNA (also referred to as dsRNA) into cells, homologous mRNA is specifically degraded, It refers to a phenomenon in which the synthesis of a gene product is suppressed and the technology used for it. As used herein, RNAi can also be used interchangeably with an agent that causes RNAi in some cases.

  As used herein, “factor that causes RNAi” refers to any factor that can cause RNAi. In the present specification, the “factor causing RNAi” with respect to “gene” means that RNAi related to the gene is caused and an effect brought about by RNAi (for example, suppression of expression of the gene) is achieved. Factors that cause such RNAi include, for example, at least 10 nucleotides, including sequences having at least about 70% homology to a portion of the nucleic acid sequence of the target gene or sequences that hybridize under stringent conditions Examples include, but are not limited to, RNAs containing long double-stranded portions or variants thereof. Here, the factor preferably comprises a 3 'overhang, more preferably the 3' overhang can be 2 or more nucleotides long DNA (eg 2 to 4 nucleotides long DNA).

  Without being bound by theory, one of the possible mechanisms for RNAi to work is that when a molecule that causes RNAi, such as dsRNA, is introduced into a cell, a relatively long (eg, 40 base pairs or more) RNA, helicase In the presence of ATP, an RNaseIII-like nuclease called Dicer having a domain excises the molecule from the 3 ′ end by about 20 base pairs to produce a short dsRNA (also called siRNA). As used herein, “siRNA” is an abbreviation for short interfering RNA, which is artificially chemically synthesized, biochemically synthesized, synthesized in an organism, or about 40 This refers to short double-stranded RNA of 10 base pairs or more formed by decomposing double-stranded RNA of bases or more in the body, and usually has a 5′-phosphate, 3′-OH structure. 'The end protrudes about 2 bases. A protein specific to the siRNA binds to form RISC (RNA-induced-silencing-complex). This complex recognizes and binds to mRNA having the same sequence as siRNA, and cleaves mRNA at the center of siRNA by RNaseIII-like enzyme activity. The relationship between the siRNA sequence and the mRNA sequence cleaved as a target is preferably 100% identical. However, with respect to the base mutation at a position off the center of siRNA, the cleavage activity by RNAi is not completely lost, but a partial activity remains. On the other hand, the mutation of the base at the center of siRNA has a large effect, and the cleavage activity of mRNA by RNAi is extremely reduced. Utilizing such properties, for mRNA having a mutation, only siRNA having the mutation can be specifically decomposed by synthesizing siRNA having the mutation in the center and introducing it into the cell. Therefore, in the present invention, siRNA itself can be used as a factor that causes RNAi, and a factor that generates siRNA (for example, a dsRNA typically having about 40 bases or more) can be used as such a factor. .

  Moreover, although not wishing to be bound by theory, siRNA is synthesized separately from the above pathway, and the antisense strand of siRNA binds to mRNA and acts as a primer for RNA-dependent RNA polymerase (RdRP). It is also contemplated that this dsRNA becomes Dicer's substrate again, generating new siRNA and amplifying the action. Thus, in the present invention, siRNA itself and factors that produce siRNA are also useful. In fact, in insects and the like, for example, 35 dsRNA molecules almost completely degrade the mRNA in a cell having 1,000 copies or more, so it is understood that siRNA itself and factors that generate siRNA are useful. Is done.

  In the present invention, double-stranded RNA having a length of about 20 bases (for example, typically about 21 to 23 bases in length) or less than that called siRNA can be used. Such siRNA can be used for treatment, prevention, prognosis, etc. of a disease because it suppresses gene expression by expressing in a cell and suppresses expression of a pathogenic gene targeted by the siRNA.

  The siRNA used in the present invention may take any form as long as it can cause RNAi.

  In another embodiment, the factor causing RNAi of the present invention may be a short hairpin structure (shRNA; short hairpin RNA) having an overhang at the 3 'end. As used herein, “shRNA” is a single-stranded RNA that includes a partially palindromic base sequence, and thus has a double-stranded structure within the molecule, resulting in a hairpin-like structure. The above molecules. Such shRNA is artificially chemically synthesized. Alternatively, such shRNA can be generated by synthesizing RNA in vitro using T7 RNA polymerase with hairpin structure DNA in which the DNA sequences of the sense strand and antisense strand are ligated in the opposite direction. Although not wishing to be bound by theory, such shRNAs are approximately 20 bases in length (typically 21 bases, 22 bases, 23 bases, etc.) in length after being introduced into the cell. It should be understood that it is degraded to cause RNAi as well as siRNA and has the therapeutic effect of the present invention. It should be understood that such effects are exerted in a wide range of organisms such as insects, plants, animals (including mammals). Thus, since shRNA causes RNAi similarly to siRNA, it can be used as an active ingredient of the present invention. The shRNA can also preferably have a 3 'overhang. The length of the double-stranded part is not particularly limited, but may preferably be about 10 nucleotides or more, more preferably about 20 nucleotides or more. Here, the 3 'protruding end may be preferably DNA, more preferably DNA having a length of at least 2 nucleotides, and further preferably DNA having a length of 2 to 4 nucleotides.

  The factor causing RNAi used in the present invention can be either artificially synthesized (for example, chemical or biochemical) or naturally occurring, and the effect of the present invention can be achieved between the two. There is no essential difference. Those chemically synthesized are preferably purified by liquid chromatography or the like.

  The factor that causes RNAi used in the present invention can also be synthesized in vitro. In this synthesis system, antisense and sense RNAs are synthesized from template DNA using T7 RNA polymerase and T7 promoter. When these are annealed in vitro and then introduced into cells, RNAi is caused through the mechanism described above, and the effects of the present invention are achieved. Here, for example, such RNA can be introduced into cells by the calcium phosphate method.

  Factors causing RNAi of the present invention also include factors such as single strands that can hybridize to mRNA, or all similar nucleic acid analogs thereof. Such factors are also useful in the treatment methods and compositions of the invention.

In this specification, "salt" is used by the same meaning as is normally used in the said field | area, and includes both inorganic salt and organic salt. The salt is usually produced by a neutralization reaction between an acid and a base. Accordingly, the salt may be one in which hydrogen of an organic acid or inorganic acid is substituted with a metal, or one in which a hydroxyl group of a base is substituted with an organic acid group or an inorganic acid group. In addition to NaCl, K ₂ SO ₄ and the like produced by the neutralization reaction, there are various types of salts such as PbSO ₄ and ZnCl ₂ produced by the reaction between the metal and the acid. Even if it is not produced, it can be regarded as produced from a neutralization reaction between an acid and a base. Examples of the salt include a normal salt (having no acid H or base OH, for example, NaCl, NH ₄ Cl, CH ₃ COONa, Na ₂ CO ₃ ), an acid salt (acid H is converted into a salt). Classification is made into those remaining, for example, NaHCO ₃ , KHSO ₄ , CaHPO ₄ ), basic salts (those in which the base OH remains in the salt, for example, MgCl (OH), CuCl (OH)), etc. Although possible, their classification is not very important in the present invention. Preferred salts include salts that constitute the medium (for example, calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids, vitamins, Salts constituting the buffer solution (for example, carium chloride, magnesium chloride, sodium hydrogen phosphate, sodium chloride) are preferable because they have a higher effect of maintaining or improving the affinity for cells. It is preferable to use a plurality of salts because they tend to have a higher affinity for cells, so that the salts contained in the medium than to use NaCl alone. (For example, calcium chloride, magnesium chloride, sodium hydrogen phosphate, chloride It is preferable to use a plurality of thorium), more preferably, in. In another preferred embodiment it may be advantageous to keep the whole salt contained in the medium, it may be added glucose.

  As used herein, “support” is used in the same meaning as “substrate” and refers to a material capable of immobilizing a substance such as a biomolecule. Support materials can be either covalently bonded or non-covalently bonded to a substance such as a biomolecule used in the present invention or derivatized to have such characteristics. Any solid material to be obtained is mentioned.

  As such a material for use as a support, any material capable of forming a solid surface can be used, for example, glass, silica, silicon, ceramic, silicon dioxide, plastic, metal (including alloys) ), Natural and synthetic polymers such as, but not limited to, polystyrene, cellulose, chitosan, dextran, and nylon. The support may be formed from a plurality of layers of different materials. For example, an inorganic insulating material such as glass, quartz glass, alumina, sapphire, forsterite, silicon oxide, silicon carbide, or silicon nitride can be used. Polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resin, polyacrylonitrile, polystyrene, acetal resin, polycarbonate Organic materials such as polyamide, phenol resin, urea resin, epoxy resin, melamine resin, styrene / acrylonitrile copolymer, acrylonitrile butadiene styrene copolymer, silicone resin, polyphenylene oxide, and polysulfone can be used. In the present invention, a membrane used for blotting, such as a nitrocellulose membrane, a nylon membrane, or a PVDF membrane, can also be used. When the material constituting the support is a solid phase, it is particularly referred to herein as “solid support”. In the present specification, it may take the form of a plate, microwell plate, chip, slide glass, film, bead, metal (surface) and the like.

  In one embodiment, in the present invention, an electrode material may be used to form a substrate electrode that serves as both a substrate and an electrode. In the case of such a substrate electrode, it is preferable that the surface of the substrate electrode is separated by an insulating layer region, and different biomolecules are fixed to the separated electrode regions. The electrode material is not particularly limited. Examples of such electrode materials include gold, gold alloy, silver, platinum, mercury, nickel, palladium, silicon, germanium, gallium, tungsten, and the like, and alloys thereof, or graphite, glassy carbon, and the like. Carbon or the like, or an oxide or a compound thereof can be used. Furthermore, it is also possible to use semiconductor compounds such as silicon oxide and various semiconductor devices such as CCD, FET, and CMOS. When an electrode film is formed on an insulating substrate and a substrate electrode in which the substrate and the electrode are integrated is used, this electrode film can be produced by plating, printing, sputtering, vapor deposition, or the like. When vapor deposition is performed, the electrode film can be formed by a resistance heating method, a high frequency heating method, or an electron beam heating method. When sputtering is performed, the electrode film can be formed by direct current bipolar sputtering, bias sputtering, asymmetrical alternating current sputtering, getter sputtering, high frequency sputtering, or the like. Furthermore, electrolytic polymer films such as polypyrrole and polyaniline and conductive polymers can also be used. In the present invention, the insulating material used for separating the electrode surfaces is not particularly limited, but is preferably a photopolymer or a photoresist material. As the resist material, a light exposure photoresist, a far ultraviolet photoresist, an X-ray photoresist, and an electron beam photoresist are used. Examples of the photoresist for light exposure include those whose main raw materials are cyclized rubber, polycinnamic acid, and novolac resin. For the deep ultraviolet photoresist, cyclized rubber, phenol resin, polymethyl isopropenyl ketone (PMIPK), polymethyl methacrylate (PMMA), or the like is used. Moreover, COP, metal acrylate, etc. can be used for the X-ray resist. Furthermore, a known substance such as PMMA can be used for the electron beam resist.

  In this specification, a “chip” refers to a micro integrated circuit that has various functions and is a part of a system. In this specification, the “biomolecule chip” includes a substrate and a biomolecule, and at least one biomolecule defined in this specification is arranged on the substrate. If the biomolecule is a cell, the chip is called a cell chip or cell array.

  The term “coating” as used herein refers to the formation of a film of a substance on the surface of a solid support and such a film. The coating is performed for various purposes, for example, improving the quality of the solid support (for example, improving the lifetime, improving the environmental resistance such as acid resistance), the affinity of the substance to be bound to the solid support. It is often aimed at improvement. Various materials can be used as the material for such coating. In addition to the materials used for the solid support described above, biological materials such as DNA, RNA, protein, and lipid, polymers (for example, poly -L-lysine, APS (eg, γ-aminopropylsilane), MAS, hydrophobic fluororesin), silane, metal (eg, gold, etc.) can be used, but are not limited thereto. The selection of such materials is within the skill of the artisan and can be selected on a case-by-case basis using techniques well known in the art. In one preferred embodiment, such coatings advantageously use poly-L-lysine, silane, APS, MAS, hydrophobic fluororesins, silanes such as epoxy silane or mercapto silane, metals such as gold. It can be. As such a substance, it may be preferable to use a substance that is compatible with a cell or an object including the cell (for example, a living body, an organ, etc.).

  As used herein, the term “fixed” refers to a state in which a target substance (for example, a biomolecule) is held on the support for at least a certain period of time, or the like. It means to make a state. Therefore, after the substance is fixed on the solid support, the fixed state may be released when the conditions change (for example, immersed in another solvent).

  As used herein, “cytophilic” refers to a substance that interacts with a cell (eg, bacterial cell, animal cell, yeast, plant cell, etc.) or an object (eg, tissue, organ, organism, etc.) containing the cell. When placed in a state where action is possible, it means a property that does not have a detrimental effect on the cell or the object containing the cell. Preferably, the substance having cell affinity may be a substance with which cells interact preferentially, but is not limited thereto. In the present invention, the substance to be immobilized (for example, a positively charged substance and / or a negatively charged substance) preferably has cell affinity, but is not limited thereto. It has been unexpectedly found that if the substance to be immobilized has cytophilicity, cell affinity is retained or improved when the substance is immobilized according to the present invention. In general, when a substance having cell affinity is immobilized on a solid support, the effect of the present invention is immeasurable in view of the fact that cell affinity is not always maintained.

  As used herein, a “cell” is defined in the same way as the broadest meaning used in the art, and is a structural unit of a tissue of a multicellular organism that is enclosed in a membrane structure that isolates the outside world, Refers to a living organism having self-regenerative ability and having genetic information and its expression mechanism. The cells used herein may be naturally occurring cells or artificially modified cells (eg, fusion cells, genetically modified cells). The source of cells can be, for example, a single cell culture, or such as cells from a normally grown transgenic animal embryo, blood, or body tissue, or a normally grown cell line Examples include but are not limited to cell mixtures.

  As used herein, “tissue” refers to a population of cells having substantially the same function and / or morphology in a multicellular organism. A “tissue” usually has the same origin, but even cell populations with different origins can be referred to as a tissue if they have the same function and / or morphology.

  In the present specification, the term “organ” or “organ” is used interchangeably, and a function of an organism individual is localized and operated in a specific part of the individual, and that part has morphological independence. Is a structure. In general, in a multicellular organism (eg, animal, plant), an organ is composed of several tissues having a specific spatial arrangement, and the tissue is composed of many cells. Such organs or organs include organs or organs associated with the vascular system. In one embodiment, organs targeted by the present invention include skin, blood vessels, cornea, kidney, heart, liver, umbilical cord, intestine, nerve, lung, placenta, pancreas, brain, peripheral limbs, retina and the like. It is not limited to them.

  As used herein, “isolated” means that the substances naturally associated with it in a normal environment are at least reduced, preferably substantially free. Thus, an isolated cell refers to a cell that is substantially free of other substances (eg, other cells, proteins, nucleic acids, etc.) that accompany it in its natural environment. When referring to a nucleic acid or polypeptide, “isolated” means, for example, substantially free of cellular material or culture medium when made by recombinant DNA technology, and precursor when chemically synthesized. Refers to a nucleic acid or polypeptide that is substantially free of somatic or other chemicals.

  The cells or objects (eg, organs, tissues, etc.) used in the present invention may be cells derived from any organism (eg, prokaryotic organisms (eg, E. coli), eukaryotic unicellular organisms (eg, yeast), any Types of multicellular organisms (eg, animals (eg, vertebrates, invertebrates), plants (eg, monocotyledons, dicotyledons, etc.)). Preferably, cells derived from vertebrates (eg, eel eels, lampreys, cartilaginous fish, teleosts, amphibians, reptiles, birds, mammals, etc.) are used, more preferably mammals (eg, single pores, Marsupial, rodent, winged, winged, carnivorous, carnivorous, long-nosed, odd-hoofed, cloven-hoofed, rodent, scale, sea cattle, cetacean, primate , Rodents, rabbit eyes, etc.). More preferably, cells derived from primates (eg, cynomolgus monkeys, chimpanzees, Japanese monkeys, humans) are used. Human-derived cells may be used.

  In this specification, “sustained release” means that when a substance is immersed in a solvent that dissolves the substance, the substance gradually dissolves while maintaining a solid phase for a certain period of time. Thus, if a substance has sustained release properties, it usually remains fixed for about 5 minutes after being immersed in a solvent, preferably at least about 10 minutes, more preferably at least about 15 minutes. More preferably, it remains fixed for at least about 30 minutes. When used as a medicament, the sustained release should remain fixed for at least about 30 minutes, preferably at least about 1 hour, more preferably at least about 3 hours, more preferably at least about 6-12 hours. Is advantageous. When used for the purpose of introducing a substance directly fixed to a cell, such as DNA transfection, it is usually kept fixed for at least about 15 minutes.

  As used herein, “biological activity” refers to an activity that a certain factor (eg, polypeptide or protein) may have in vivo, and includes an activity that exhibits various functions. For example, when a factor is an enzyme, the biological activity includes the enzyme activity. In another example, when an agent is a ligand, the ligand includes binding to the corresponding receptor. Such biological activity can be measured by techniques well known in the art depending on the activity to be measured.

  As used herein, “conditions that do not destroy biomolecules” refer to conditions that do not impair at least one biological activity (eg, gene expression activity, enzyme activity, etc.) exhibited by the biomolecule. Such conditions can be appropriately set by those skilled in the art by considering various considerations (eg, temperature, pH, pressure, chemical conditions, etc.) according to the biomolecule. Even if the conditions for not destroying the biomolecule are unknown, the conditions can be determined in advance by exposing the biological material to the conditions to be tested and then examining whether the target biological activity is retained. Accordingly, when practicing the present invention, those skilled in the art will understand that such conditions may be any conditions as long as the desired biological activity is maintained.

  As used herein, “reducing” or “removing” a solvent (eg, water, organic solvent (eg, hexane, etc.)) is performed by placing the mixture or composition containing the solvent under certain conditions. This is achieved by reducing or eliminating the solvent ratio in the product.

  As used herein, “pharmaceutically acceptable” refers to the property of a substance that can be administered as a medicament when referring to the substance.

  “Pharmaceutically acceptable substances” that can be used herein include antioxidants, preservatives, colorants, flavors, and diluents, emulsifiers, suspending agents, solvents, fillers, bulking agents, These include, but are not limited to, buffers, delivery vehicles, diluents, excipients and / or pharmaceutical adjuvants. Typically, the compound of interest (a compound having biological activity or activity as an active ingredient of a pharmaceutical), or a variant or derivative thereof, is one or more physiologically acceptable carriers, excipients Or provided in the form of a composition comprising a diluent.

  The pharmaceutically acceptable substances used herein are non-toxic to the recipient and are preferably inert at the dosages and concentrations used, eg, acid salts, citric acid Salts, or other organic acids; ascorbic acid, α-tocopherol; low molecular weight polypeptides; proteins (eg, serum albumin, gelatin or immunoglobulin); hydrophilic polymers (eg, polyvinylpyrrolidone); amino acids (eg, glycine, glutamine) , Asparagine, arginine or lysine); monosaccharides, disaccharides and other carbohydrates (including glucose, mannose, or dextrin); chelating agents (eg, EDTA); sugar alcohols (eg, mannitol or sorbitol); For example, sodium ; And / or non-ionic surface-active agents (e.g., Tween, Pluronic (pluronic) or polyethylene glycol (PEG)) but the like are not limited thereto.

(Biomolecular chip array)
In this specification, a “chip” refers to a micro integrated circuit that has various functions and is a part of a system. In this specification, it may be referred to as “DNA chip”, “protein chip”, “cell chip” or the like depending on the substance to be loaded.

The term “array” as used herein refers to a fixed pattern of a fixed object on a substrate or film or the patterned substrate itself. Among the arrays, those patterned on a small substrate (eg, 10 × 10 mm) are referred to as microarrays. In this specification, microarrays and arrays are used interchangeably. Accordingly, even a pattern that is larger than the above-described substrate may be called a microarray. For example, an array is composed of a set of desired polynucleotides that are themselves immobilized on a solid surface or membrane. The array preferably comprises different at least 10 ^two polynucleotides at least 10 ³ and more preferably, and more preferably at least 10 ^4, even more preferably at least 10 ⁵ a. These polynucleotides are arranged on a standardized format such as, for example, 125 × 80 mm, 10 × 10 mm.

  As used herein, the term “address” refers to a unique location on a substrate and may be distinguishable from other unique locations. The address is suitable for associating with the microparticle with that address, and can take any shape, with the presence at every address being distinguishable from the presence at the other address (eg, optical). The address shape can be, for example, circular, elliptical, square, rectangular, or irregular.

  The size of each address is, among other things, the size of the substrate, the number of addresses on a particular substrate, the amount of analyte and / or available reagents, the size of the microparticles and any method in which the array is used. Depends on the degree of resolution required. The size can range, for example, from 1-2 nm to several centimeters, but can be any size consistent with the application of the array.

  The spatial arrangement and shape of the address is designed to suit the specific application for which the microarray is used. Addresses can be tightly packed, widely dispersed, or subgrouped into a desired pattern appropriate for a particular type of analyte.

  Microarrays (also referred to as DNA microarrays when DNA is arranged) are broadly outlined in (edited by Shujunsha, Cell Engineering separate volume "DNA microarrays and the latest PCR method").

  Examples of the labeling method in the synthetic DNA microarray include a two-fluorescence labeling method. In this method, two different mRNA samples are labeled with different fluorescence, competitive hybridization is performed on the same microarray, both fluorescences are measured and compared to detect differences in gene expression. For example, Cy5 and Cy3 are most used as fluorescent dyes, but are not limited thereto. The advantage of Cy3 and Cy5 is that there is almost no overlap in fluorescence wavelength. Two fluorescent labeling methods can be used not only to detect differences in gene expression, but also to detect mutations or polymorphisms.

  In an assay using a DNA microarray, a fluorescence signal hybridized on the DNA microarray is detected by a fluorescence detector or the like. As such a detector, various detectors can be used up to now. For example, the Stanford University group has developed an original scanner that combines a fluorescence microscope and a working stage (see http://cmgm.stanford.edu/pbrown). Even with conventional fluorescent image analyzers for gels such as FMBIO (Hitachi Software Engineering) and Storm (Molecular Dynamics), DNA microarrays can be read if the spots are not so dense. Other usable detectors include ScanArray 4000, 5000 (General Scanning; confocal type), GMS418 Array Scanner (Takara Shuzo; scan type (confocal)), Gene Tip Scanner (Japan Laser Electronics; Scanning type (non-confocal type)), Gene Tac 2000 (Genomic Solutions; CCD camera type)) and the like.

  Since the data obtained from the microarray is enormous, data analysis software for managing the correspondence between clones and spots, data analysis, etc. is important. As such software, software attached to various detection systems can be used (Ermolaeva O et al. (1998) Nat. Genet. 20: 19-23). The database format includes, for example, a format called GATC (Genetic Analysis Technology Consortium) proposed by Affymetrix.

  In the present invention, a biomolecule (for example, DNA, RNA, polypeptide, etc.) disposed on a solid support can be prepared by a molecular biological technique using a biological material (for example, mRNA), or It can be chemically synthesized by methods known to those skilled in the art. For example, a synthesis method using an automated solid phase peptide synthesizer is described by: Stewart, JM et al. (1984). Solid Phase Peptide Synthesis, Pierce Chemical Co .; Grant, GA (1992). Synthetic Peptides: A User's Guide, WHFreeman; Bodanszky, M. (1993). Principles of Peptide Synthesis, Springer-Verlag; Bodanszky, M. et al. (1994) .The Practice of Peptide Synthesis, Springer-Verlag; Fields, GB (1997) Phase Peptide Synthesis, Academic Press; Pennington, MW et al. (1994). Peptide Synthesis Protocols, HumanaPress; Fields, GB (1997). Solid-Phase Peptide Synthesis, Academic Press. Oligonucleotides can be prepared by automated chemical synthesis using any of the DNA synthesizers commercially available, such as from Applied Biosystems. Compositions and methods for the synthesis of automated oligonucleotides are described, for example, in US Pat. No. 4,415,732, Caruthers et al. (1983); US Pat. No. 4,500,707 and Caruthers (1985); US Pat. No. 4,668,777, Caruthers et al. (1987) and those skilled in the art can utilize these methods to prepare biomolecules for use in the present invention.

  The present invention can also be used for detection of genes amplified by PCR, SDA, NASBA method, etc., in addition to samples collected directly from living bodies. The present invention further provides that the target gene is a previously electrochemically active substance, a fluorescent substance such as FITC, rhodamine, acridine, Texas Red, fluorescein, an enzyme such as alkaline phosphatase, peroxidase, glucose oxidase, hapten, luminescent substance, antibody It is also possible to label them with colloidal particles such as antigens, colloidal gold, metals, metal ions, and metal chelates with trisbipyridine, trisphenanthroline, hexaamine and the like.

  As used herein, the term “microcapsule” refers to a minute particle encapsulating a substance with a thin film such as a molecule or a container-like substance thereof. It is usually spherical and has a size of several to hundreds of μm. In general, a water-in-oil emulsion is prepared, and a polymer thin film is formed by interfacial polycondensation at the interface between the fine emulsion particles and the medium liquid to cover the particles. The capsule can then be separated from the oil by centrifugation and purified by dialysis. When an emulsion is formed, a target biomolecule can be dissolved and dispersed in an aqueous phase and encapsulated in a capsule. The thickness of the thin film is 10 to 20 μm, and it can give semi-permeability or give a surface charge. In the present invention, the microcapsule can protect and isolate inclusions such as biomolecules, and can be eluted, mixed or reacted as necessary. In the method for producing the biomolecular substrate of the present invention, the microcapsules are sprayed on the substrate by a spraying process such as an inkjet method (such as a bubble jet (registered trademark) method) or a PIN method. By raising the temperature above the melting point of the shell, contents such as biomolecules can be fixed to the substrate. In this case, the substrate is preferably coated with a substance having an affinity for the biomolecule.

  For microfabrication technology, see, for example, Campbell, SA (1996) .The Science and Engineering of Microelectronic Fabrication, Oxford University Press; Zaut, PV (1996) .Micromicroarray Fabrication: a Practical Guide to Semiconductor Processing, Semiconductor Services; Madou, MJ (1997) Fundamentals of Microfabrication, CRC1 5 Press; Rai-Choudhury, P. (1997). Handbook of Microlithography, Micromachining, & Microfabrication: Microlithography can be referred to, and the relevant parts in this specification are for reference. Incorporated.

  The ink jet method (technology) is a technology for ejecting very small droplets to a predetermined position on a two-dimensional plane using heat and piezoelectric effects, and is widely used mainly in printer apparatuses. In manufacturing the DNA array, an ink jet apparatus having a structure in which a piezoelectric element is combined with a glass capillary is used. By applying a voltage to the piezoelectric element connected to the liquid chamber, the liquid in the chamber is ejected as droplets from the capillary connected to the chamber by the change in volume of the piezoelectric element. The size of the ejected droplet is determined by the diameter of the capillary, the volume change of the piezoelectric element, and the physical properties of the liquid, but generally the diameter is about 30 μm. An ink jet apparatus using a piezoelectric element can eject such droplets at a cycle of about 10 KHz. A DNA array manufacturing apparatus using such an ink jet apparatus can drop a desired droplet at a desired spot on the DNA array by relatively moving the ink jet apparatus and the DNA array substrate. There are roughly two types of DNA array manufacturing equipment using inkjet devices. One is a DNA array manufacturing device using only one inkjet device, and the other is a device using a multi-head inkjet device. A DNA array manufacturing apparatus using only one inkjet apparatus is configured to drop a reagent for removing the protecting group at the end of the oligomer onto a desired spot. After removing the protecting group of the spot into which the desired base is to be introduced using this ink jet apparatus to make it active, a desired base binding reaction operation is performed on the entire DNA array. At this time, the desired base binds only to the spot having the oligomer whose terminal is activated by dropping the reagent from the ink jet apparatus. Thereafter, an operation of protecting the terminal of the newly added base is performed. The procedure is then repeated until the desired nucleotide sequence is obtained, changing the spot from which the protecting group is removed. On the other hand, a DNA array manufacturing apparatus using a multi-head ink jet apparatus has a configuration in which a desired base can be directly bonded to each spot by preparing an ink jet apparatus for each reagent containing each base. A higher throughput than that of the DNA array manufacturing apparatus using the single inkjet apparatus described above can be obtained. Among the methods for immobilizing oligonucleotides synthesized in advance on a substrate, mechanical microspotting technology is a technology that mechanically presses and immobilizes a liquid containing oligonucleotides attached to the tips of stainless steel pins onto the substrate. . The spot obtained by this method is about 50 to 300 μm. After micro spotting, post-processing such as immobilization with UV light is performed.

  Examples of the spraying step used in the method of the present invention include an ink jet method (including a bubble jet (registered trademark) method), a PIN method, and the like. Preferably, a bubble jet (registered trademark) system may be used. This is because the microcapsules can be immobilized efficiently.

  In a preferred embodiment of the method for examining biological information of the present invention, the labeling molecule includes a fluorescent molecule, a phosphorescent molecule, a chemiluminescent molecule, or a radioisotope. In this case, detection means corresponding to the type of the labeled molecule can be used.

(Description of a preferred embodiment of the present invention)
While preferred embodiments of the invention are described below, it is to be understood that the description of these preferred embodiments is provided for purposes of illustration and should not limit the scope of the invention.

(Kit for fixing genetic material to a support and introducing it into cells)
In one aspect, the present invention provides a kit for immobilizing genetic material to a support and introducing it into cells. The kit includes a) genetic material, b) a charged material having a charge opposite to the genetic material, and c) a salt, wherein the kit comprises the genetic material and the charged material. Instructions are provided to instruct the salt to be mixed on the solid support. This technique is unexpectedly fixed by mixing genetic material, a material having the opposite charge to that material, and a salt (eg, salts contained in the medium) on a support, and then This was achieved by unexpectedly finding that the introduction into the cell was smooth. Examples of the effect of such immobilization include that the diffusion of the substance after immobilization is sustained release, and that the substance after immobilization maintains or improves cell affinity. Furthermore, any genetic material can be easily fixed in a mixed form on a support in an arbitrary mixed pattern, which is very useful in array production that requires such a technique. .

  In a preferred embodiment, at least two substances selected from the group consisting of genetic material, charged material, and salt contained in the kit of the present invention are provided in a mixed manner. It is because the compartment in a kit can be reduced. When considering the mixing of two or more genetic materials on a support, all three materials can be provided in a mixed form.

  In a preferred embodiment, there are at least two types of genetic material included in the present invention, more preferably three or more, and in another preferred embodiment, four or more, five or more, six or more, seven. As described above, it may be 8 or more, 9 or more, 10 or more, or 20 or more. Alternatively, thousands to tens of thousands of genetic material such as a genome set may be included in the kit of the present invention.

  The genetic material contained in the kit of the present invention can be selected from the group consisting of DNA, RNA, PNA and combinations thereof.

  In one preferred embodiment, the substance to be included in the present invention has cytophilicity. The cell affinity of a substance can be determined by assessing whether the cell remains viable when the substance is mixed with cells compared to when the substance is not present. . The maintenance of the survival of such cells can be specifically determined by measuring various parameters of the cells. Preferably, a substance having cytophilicity may be advantageous to improve the survival of the cell.

  In a preferred embodiment, the substance (eg, charged substance) to be included in the present invention may be a biomolecule. Here, this biomolecule may or may not be the target for fixation.

  Such biomolecules that can be used in preferred embodiments of the present invention include DNA (eg, genomic DNA, cDNA, etc.), RNA (eg, mRNA, etc.), polypeptides, lipids, sugars, small organic molecules (eg, Library members of combinatorial chemistry), and complexes thereof (including but not limited to glycoproteins, glycolipids, nucleic acid peptides, lipoproteins, etc.).

  In one particular embodiment, the biomolecule to be immobilized in the present invention can be a gene encoding molecule such as DNA. By using the fixing method achieved in the present invention, when DNA is treated for gene transfer such as transfection, the time required to complete the treatment (for example, about 15 to about 30 minutes) As a result of continuous sustained release, the effect of efficiently introducing such molecules was achieved. Since such a sustained release effect has not been achieved or is not sufficient by the conventional fixing method, such an effect can be mentioned as a remarkable effect of the present invention. In addition, the composition of the present invention retains or improves the affinity for cells after being fixed, and in particular, it is more efficient than conventional fixing methods in introducing genes such as transfection, and damages to cells. It was found that such an introduction could be made without.

  In a preferred embodiment of the present invention, the charged substance to be immobilized may or may not be a biomolecule. For example, a synthetic polypeptide such as a cationic polymer or a cationic lipid poly-L-lysine or a derivative thereof. And so on. In a preferred embodiment, examples of the chargeable substance include polyamine reagents (SuperFect, PolyFect), polyimine reagents (JetPEI, PEI, Fugene6), liposome reagents (LipofectAMINE, LipofectAMINE2000, OligofectAMINE, Effecten), charged colloids (gold) Examples include, but are not limited to, transfection reagents such as (colloid) polyimine polymers, poly L-lysine, synthetic polypeptides or derivatives thereof.

  In another preferred embodiment, the charged substance used in the present invention is a polyamine reagent (SuperFect, PolyFect), a polyimine reagent (JetPEI, PEI, Fugene6), a liposome reagent (LipofectAMINE, LipofectAMINE2000, OligofectAMINE, Effecten) It is preferable to use a charged colloid (gold colloid). This is because it has a preferable shape, strength, and ease of handling for printing.

  In the present specification, the “polyamine-based reagent” refers to a reagent having a polyamine (amino group —NH_ or an imino group = an aliphatic compound having two or more NHs) in its structure, for example, SuperFect, PolyFect Etc. are exemplified.

  In the present specification, “polyimine-based reagent” refers to a reagent having polyimine in its structure, and examples thereof include JetPEI, PEI, Fugene6 and the like.

  In the present specification, the “liposome reagent” refers to a gene introduction reagent having a liposome structure, and examples thereof include LipofectAMINE2000, OligofectAMINE, Effecten and the like.

  In the present specification, the “charged colloid” refers to a charged colloid, for example, a metal colloid (for example, a gold colloid).

  In one embodiment, the salt used in the present invention is a salt in which hydrogen of an organic acid or an inorganic acid is substituted with a metal, or a hydroxyl group of a base is substituted with an organic acid group or an inorganic acid group. Can be. More preferable examples include, but are not limited to, salts having affinity for cells (for example, salts used in a culture medium, salts used in a buffer solution, and the like). Preferably, for transfection purposes, it may be advantageous to use a combination of all the salts contained in the medium or buffer. This is because such a combination of salts is usually a preferable combination for cells. Examples of such a medium include, but are not limited to, Dulbecco MEM, HAM12 medium, αMEM medium, and RPM1640 (for example, commercially available from Nichirei). Examples of salts contained in such a medium include calcium chloride, potassium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate, sodium pyruvate, HEPES, monopotassium phosphate, dipotassium phosphate, magnesium chloride, sodium chloride, Examples include, but are not limited to, monosodium phosphate, disodium phosphate, magnesium sulfide, iron nitrate, amino acids and vitamins. The concentration of such a salt can be appropriately selected and adjusted by those skilled in the art, but it may be advantageous that it is preferably approximately equal to the osmotic pressure of the cell.

  In a preferred embodiment, examples of the salt used in the present invention include a buffer solution, a culture solution, and serum.

  In a preferred embodiment, it may be advantageous that the immobilized biomolecule is introduced into a cell and exerts biological activity (eg, medicinal effects, enzymes, signal transduction, gene expression, etc.) within the cell. When gene expression is intended, the biomolecule can be DNA containing the sequence encoding the gene. When signal transduction is intended, the biomolecule can be a signal transduction stimulator (eg, cytokine, specific ligand, etc.) and the like. When a medicinal effect is intended, the biomolecule can be a chemical substance having a medicinal effect. Examples of such chemical substances having a medicinal effect include drugs for central nervous system; drugs for peripheral nerves; drugs for sensory organs; drugs for cardiovascular organs; drugs for respiratory organs; drugs for digestive organs; And anal drugs; skin drugs; dental and oral drugs; other individual organ system drugs; vitamins; nourishing tonics; drugs for blood and body fluids; drugs for artificial dialysis; other metabolic drugs (eg viscera) Disease agents, antidote agents, addictive addiction agents, gout treatment agents, enzyme preparations, antidiabetic agents, metabolic drugs not classified elsewhere); cell activating agents; tumor drugs; radiopharmaceuticals; allergy drugs; Antibiotics; chemotherapeutics; biologicals; pharmaceuticals; diagnostics; in vitro diagnostics; drugs that are not primarily targeted for unclassified treatments; and narcotics, but are not limited to these.

  When intended for use as a medicine, the substances (genetic substances, charged substances, etc.) and salts contained in the composition of the present invention are preferably pharmaceutically acceptable.

  In a preferred embodiment, the genetic material used in the present invention encodes a material that has biological activity after being introduced into a cell.

  In another embodiment, the genetic material, charged material and salt to be included in the present invention may be included in a microcapsule. By being contained in the microcapsule, it is convenient to carry and easy to handle, and contamination by other substances can be reduced.

(Method for fixing genetic material to a support and introducing it into cells)
In another aspect, the present invention provides a method for fixing genetic material to a support and introducing it into a cell. The method comprises the steps of I) providing a support, II) providing the support with a) genetic material, b) a charged material having a charge opposite to the genetic material, and c) a salt. Providing separately or together, and III) mixing the genetic material, the charged material, and the salt on a solid support.

  Here, the genetic material, charged material, and salt to be used in the method of the present invention can take any form described in a kit for immobilizing the genetic material to a support and introducing it into a cell.

  In a preferred embodiment, the support used in the present invention is a solid support. Examples of the material for the support include, but are not limited to, glass, silica, silicon, ceramic, silicon dioxide, plastic, metal, natural polymer, and synthetic polymer.

  In another embodiment, the support used in the present invention is preferably coated. In the method of the present invention, the support to be used may be coated, or may include a step of coating the support in carrying out the method. As a material used for such a coating, poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin, metal and the like, or a mixture thereof can be used, but is not limited thereto and is usually supported. This can be done using substances that are intended for use in the body. The support can be prepared fresh or recycled in the method of the present invention. Preferably, it may be advantageous to coat. The coating can be particularly advantageous when intended for recycling.

  In a preferred embodiment of the method of the present invention, the support can be a chip. The method of the present invention can also be applied in the production of small and integrated devices such as chips, and its usefulness extends over a wide range. In this case, the substances fixed on the chip are preferably arranged in an array. When arranged in this manner, the device is also called an array. Therefore, the method of the present invention can be applied when manufacturing a biomolecule array or a biomolecule chip. Chips or arrays produced by such methods are particularly useful when used in chip or array applications where sustained release and / or cell affinity is required. The method of the present invention is also particularly useful in arrays where a high degree of integration is required, where simple fixation and thus simple and fine spotting is required.

  In a preferred embodiment of the method of the present invention, it may be desirable that the genetic material has biological activity after being introduced into the cell. In such a case, examples of the biological activity include, but are not limited to, drug efficacy, gene expression, enzyme activity, signal transduction activity, and the like. When gene expression is intended, the biomolecule can be DNA containing the sequence encoding the gene. Where signal transduction is intended, the genetic material can be a signal transduction stimulator (eg, cytokines, specific ligands, etc.) and the like. When a medicinal effect is intended, the biomolecule can be a chemical substance having a medicinal effect. The medicinal compound can be selected from a variety of compounds as described elsewhere herein.

  In the method of the present invention, the fixing step may be any step and may be manual (pipetting or the like) or automatic (for example, a printer technology such as an ink jet printer). Preferably, it can adhere using the printing pin of an inkjet printer.

  When the method of the present invention is used for such various purposes, the above-described steps (for example, gene introduction such as transfection, signal transduction measurement, drug delivery, etc.) are performed after the fixation of the present invention is achieved. Alternatively, the above-described steps may be performed after being fixed and stored for a certain period of time. When preserved, perform a treatment (such as immersing in a preservation solvent different from the solvent used for sustained release or drying) after the fixation by the method of the present invention does not start. Is preferred.

  In a specific embodiment intended for transfection on a support, DNA is selected as the genetic material, and a positively charged material such as a polyimine polymer as the charged material having the opposite charge to the genetic material. It is preferred that the substance is selected. This is because DNA is negatively charged. In this case, examples of the salt include, but are not limited to, salts having affinity for cells (for example, salts used in a culture medium, salts used in a buffer solution, and the like). Examples of the support material used in the preferred embodiment include glass slides (preferably coated with poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin, etc.), polystyrene resins, and the like. Is not limited to them. A solid support coated with poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin or the like is preferred. This is because it is known to have favorable effects on affinity with cells and efficiency of transfection. In such cases, the method of the present invention may preferably include a coating step.

  In a preferred embodiment of the method of the present invention, the step of providing the material provided on the support of the present invention is performed under conditions that do not destroy the biomolecule. The conditions that do not destroy such biomolecules are appropriate for those skilled in the art by considering the type of each complex partner provided and other conditions for complex formation (eg, pH, temperature, etc.). It can be selected, or it can be easily selected by preliminarily testing appropriate conditions. The selection or testing of such appropriate conditions is within the common general knowledge of those skilled in the art and can be determined by one skilled in the art without undue experimentation. For the first time according to the present invention, the object of the present invention (for example, fixation, intracellular transfer, gene expression, etc.) can be achieved by either the above-described manual (pipetting, etc.) or automatically (for example, printer technology such as an ink jet printer). found. In the present invention, genetic material can be simply fixed on a support using a print pin of an ink jet printer, and then introduced into a cell, so that expression analysis of the genetic material in the cell can be performed. Became.

  In a preferred embodiment of the present invention, the provision of the mixture of salt, genetic material and charged material can be performed under conditions that do not destroy the biomolecule. Conditions for not destroying such biomolecules are appropriately selected by those skilled in the art by considering the types of complexes and salts provided and other conditions for complex formation (eg, pH, temperature, etc.). Or can be easily selected by preliminarily testing appropriate conditions. The selection or testing of such appropriate conditions is within the common general knowledge of those skilled in the art and can be determined by one skilled in the art without undue experimentation.

  In a preferred embodiment of the present invention, it may be advantageous to further comprise the step of reducing or removing the solvent in the mixture after the mixture has been attached to the solid support. Such solvent reduction or removal includes, but is not limited to, natural drying, freeze drying, impression using a desiccant and the like.

(Support for genetic material)
In another aspect, the present invention provides a support in which genetic material, a charged material having a charge opposite to that of the genetic material, and a salt are immobilized on a surface.

  Here, the genetic material, charged material, salt, support may take any form described in the section of the kit or method for fixing the genetic material to the support and introducing it into the cells. Any genetic material (eg, DNA, RNA, PNA and combinations thereof, preferably encoding a substance having biological activity after being introduced into a cell) is in any form that can be introduced into the cell. It may be provided in such a form. Examples of such forms include, but are not limited to, the state of Naked DNA, the use of plasmids, and viral vectors. On the support of the present invention, genetic material may be included in two or more, or three or more. Such multiple types may include DNA encoding a gene and RNAi for it. The charged substance (for example, a cationic polymer, a cationic lipid, a cationic polyamino acid or a complex thereof) is preferably biocompatible, and a reagent known as a gene introduction reagent can be exemplified. Salts (for example, those obtained by substituting hydrogen of an organic acid or inorganic acid with a metal, or those obtained by substituting the base hydroxyl group with an organic acid group or inorganic acid group) include, for example, calcium chloride, sodium hydrogen phosphate , Sodium bicarbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids, vitamins, and a mixture thereof. In one embodiment, the support of the present invention and the substance immobilized thereon are preferably pharmaceutically acceptable. Alternatively, the substance to be fixed on the support may be contained in microcapsules.

  In one embodiment, the support of the present invention is preferably a solid support. This is because a solid phase is easy to handle. Accordingly, examples of the material for the support of the present invention include, but are not limited to, glass, silica, silicon, ceramic, silicon dioxide, plastic, metal, natural polymer, synthetic polymer, and mixtures thereof.

  In one preferred embodiment of the device of the present invention, the support may be coated. The coating can be performed using a substance that is usually intended for use in a solid support, such as poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin, metal, and the like. In a preferred embodiment, a coating agent (for example, poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin, metal) used in cell culture can be used.

  In a preferred embodiment of the device of the present invention, the solid support may be a chip. When the support of the present invention is a chip, the mixture containing genetic material, charged material and salt is preferably arranged in an array on the chip. In such cases, the support of the present invention may also be referred to as an array.

  In a preferred embodiment of the present invention, it may be desired that the genetic material has biological activity after being introduced into the cell. In such a case, examples of the biological activity include, but are not limited to, drug efficacy, gene expression, enzyme activity, signal transduction activity, and the like. When gene expression is intended, the biomolecule can be DNA containing the sequence encoding the gene. When signal transduction is intended, the biomolecule can be a signal transduction stimulator (eg, cytokine, specific ligand, etc.) and the like. When a medicinal effect is intended, the biomolecule can be a chemical substance having a medicinal effect. The medicinal compound can be selected from a variety of compounds as described elsewhere herein.

  In certain embodiments intended for transfection on a support (eg, a solid support), the genetic material to be immobilized is selected as DNA and charged with the opposite charge to that genetic material. The substance is preferably selected from positively charged substances such as polyimine polymers. This is because DNA is generally negatively charged. In this case, examples of the salt include, but are not limited to, salts having affinity for cells (for example, salts used in a culture medium, salts used in a buffer solution, and the like). As a material of the solid support used in the preferred embodiment, for example, a glass slide (poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin, preferably poly-L-lysine is coated). ), Polystyrene resin and the like, but are not limited thereto. A solid support coated with poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin or the like is preferred. This is because it is known to have favorable effects on affinity with cells and efficiency of transfection.

(Composition)
In one aspect, the present invention provides a composition for immobilizing genetic material to a support and introducing it into a cell. The composition of the present invention comprises a) genetic material, b) a charged material having a charge opposite to that of the genetic material, and c) a salt. The composition may contain a mixture of individual components or may contain them separately.

  In one preferred embodiment, the components of the composition of the present invention have cytophilic properties. The cell affinity of a substance can be determined by assessing whether the cell remains viable when the substance is mixed with cells compared to when the substance is not present. . The maintenance of the survival of such cells can be specifically determined by measuring various parameters of the cells. Preferably, a substance having cytophilicity may be advantageous to improve the survival of the cell.

  In a preferred embodiment, the component of the composition of the present invention may be a biomolecule. Here, the biomolecule may or may not be a target for fixation.

  Such biomolecules that can be used in preferred embodiments of the present invention include DNA (eg, genomic DNA, cDNA, etc.), RNA (eg, mRNA, etc.), polypeptides, lipids, sugars, small organic molecules (eg, Library members of combinatorial chemistry), and complexes thereof (including but not limited to glycoproteins, glycolipids, nucleic acid peptides, lipoproteins, etc.).

  In one particular embodiment, a component of the composition of the invention can be a gene encoding molecule such as DNA. By using the fixing method achieved in the present invention, when DNA is treated for gene transfer such as transfection, the time required to complete the treatment (for example, about 15 to about 30 minutes) As a result of continuous sustained release, the effect of efficiently introducing such molecules was achieved. Since such a sustained release effect has not been achieved or is not sufficient by the conventional fixing method, such an effect can be mentioned as a remarkable effect of the present invention. It should be noted that such an effect was retained even when mixing directly on the support. In addition, the composition of the present invention retains or improves the affinity for cells after being fixed, and in particular, it is more efficient than conventional fixing methods in introducing genes such as transfection, and damages to cells. It was found that such an introduction could be made without.

  In a preferred embodiment of the present invention, the components of the composition of the present invention may be biomolecules such as DNA, RNA, PNA, polypeptides and complexes thereof, or biomolecules such as anionic polymers and anionic lipids. It does not have to be.

  In a preferred embodiment of the present invention, the component of the composition of the present invention may or may not be a biomolecule, such as a synthetic polypeptide such as a cationic polymer, a cationic lipid poly-L-lysine, or a derivative thereof. And so on. In a preferred embodiment, positively charged substances include, but are not limited to, for example, transfection reagents such as polyimine polymers, poly L-lysine, synthetic polypeptides or derivatives thereof.

  In certain embodiments intended for transfection on a support, the compositions of the present invention may include positively charged materials such as DNA and polyimine polymers.

  In preferred embodiments, the components of the composition of the invention may be advantageously introduced into a cell and exert biological activity (eg, medicinal properties, enzymes, signal transduction, gene expression, etc.) within the cell. . When gene expression is intended, the genetic material included in the present invention can be DNA containing a sequence encoding the gene. Where signal transduction is intended, the genetic material can be one that encodes a signal transduction stimulator (eg, cytokines, specific ligands, etc.). If a medicinal effect is intended, the genetic material may encode a protein having a medicinal effect. Examples of substances having such medicinal effects include drugs for central nervous system; drugs for peripheral nerves; drugs for sensory organs; drugs for cardiovascular organs; drugs for respiratory organs; drugs for digestive organs; hormone drugs; Anal drugs; skin drugs; dental and oral drugs; other individual organ system drugs; vitamin drugs; nourishing tonics; blood and body fluid drugs; artificial dialysis drugs; other metabolic drugs (eg, visceral diseases) Agent, antidote, habitual addiction agent, gout treatment agent, enzyme preparation, antidiabetic agent, metabolic drug not classified elsewhere); cell activating agent; tumor drug; radiopharmaceutical drug; allergy drug; antibiotic Substance preparations; chemotherapeutic agents; biological preparations; pharmaceuticals; diagnostics; in vitro diagnostics; drugs not intended for unclassified treatment; as well as narcotics, but are not limited to these.

  When intended for use as a medicament, the components of the composition of the present invention are preferably pharmaceutically acceptable.

(device)
In another aspect, the present invention also provides a device having genetic material of interest immobilized thereon. In this device, a target genetic material (for example, DNA), a material having a charge opposite to that of the material, and a salt (for example, a salt contained in a medium) are mixed and fixed to the support. . These mixings are performed on a support. By mixing on the support, when not mixing, the stability of the genetic material is good, multiple genetic materials can be easily mixed, the concentration ratio of genetic material can be easily created, and the genetic material to be arrayed There are differences in terms of easy adjustment and improved chip productivity, and such effects are unexpected. Due to the effect of such immobilization, the device of the present invention has a sustained release property of the substance immobilized on the solid support, and / or the immobilized substance retains or improves the cell affinity. Is achieved. Therefore, the device of the present invention is provided in the form of a microtiter plate, an array (chip), a well or the like used for an assay using a living body such as a cell or a part thereof, and a substance to be immobilized (active ingredient, This is useful in assays where it is desired that the DNA encoding the expressed gene, etc.) be sustained-released and / or cell affinity retained. Alternatively, it can be used as a pharmaceutical delivery vehicle in cases where it is preferred that an active ingredient be released slowly. In such cases, it is desirable that the genetic material, charged material having a charge opposite to that genetic material, salt and support is biocompatible and preferably pharmaceutically acceptable. Accordingly, the device of the present invention comprises a) genetic material, b) a charged material having a charge opposite to that of the genetic material; c) a salt; and d) the complex and its salt are mixed on a support. A fixed solid support is included. Supports, genetic material, charged materials, salts, etc., used individually may take any form described in the section (Genetic material carrying support). Such a device may be, for example, a commercially available device (for example, a slide glass, a microtiter plate, etc.) or a self-made device. The present invention can be used in making an assay device or pharmaceutical delivery device, and its usefulness is broad.

  When the substances fixed on the chip are arranged in an array, the device of the present invention is also called an array. Therefore, the method of the present invention can be applied when manufacturing a biomolecule array or a biomolecule chip. Chips or arrays produced by such methods are particularly useful when used in chip or array applications where sustained release and / or cell affinity is required. The method of the present invention is also particularly useful in arrays where a high degree of integration is required, where simple fixation and thus simple and fine spotting is required.

  The present invention, when used in connection with an organism, may be used in human applications, but may be used with other hosts (eg, mammals, etc.). Thus, the present invention may be used as an agrochemical.

  Molecular biological techniques, biochemical techniques, and microbiological techniques used in the present specification are well known and commonly used in the art. For example, Ausubel FA et al. (1988), Current Protocols in Molecular Biology, Wiley, New York, NY; Sambrook J et al. (1987) Molecular Cloning: A Laboratory Manual, 2nd Ed. And its 3rd Edition (2001), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY & Expression Analysis Experiment Method ”, Yodosha, 1997, etc., and those skilled in the art can implement the present invention by appropriately hitting such well-known literature.

  The present invention will be described below based on examples, but the following examples are provided for illustrative purposes only. Accordingly, the scope of the present invention is not limited to the detailed description of the invention nor the following examples, but is limited only by the scope of the claims.

  Examples of the present invention are shown below by showing specific examples. With the exception of exceptions, reagents and supports used in the following examples were those commercially available from Sigma, Wako Pure Chemicals, etc.

(Example 1: Preparation of fixing composition)
In this example, DNA was selected as genetic material, and a composition for immobilizing DNA on a solid support was prepared.

  Plasmid for transfection was prepared as DNA. As plasmids, pEGFP-N1 and pDsRed2-N1 (both BD Biosciences, Clontech, CA, USA) were used. In these plasmids, gene expression is under the control of cytomegalovirus (CMV). Plasmid DNA was obtained from E. coli. Plasmid DNA amplified and amplified in E. coli (XL1 blue, Stratgene, TX, USA) was used as one of the complex partners. DNA was dissolved in distilled water containing neither DNase nor RNase.

A transfection reagent was used as a charged substance having a charge opposite to that of the genetic material. The transfection reagents used are as follows: Effectene Transfection Reagent (cat. No. 301425, Qiagen, CA), TransFast ^TM Transfection Reagent (E2431, Promega, WI), Tfx ^TM- 20 Reagent (E239, E239 ), SuperFect Transfection Reagent (301305, Qiagen, CA), PolyFect Transfection Reagent (301105, Qiagen, CA), LipofectAMINE 2000 Reagent (11668-019, Invitrogen corporation, CA4) c. (101-30, Polyplus-translation, France) and ExGen 500 (R0511, Fermentas Inc., MD).

  These DNA plasmids and transfection reagents are separately or together, distilled water (control) without DNase or RNase, NaCl solution (0.9%) as a salt, PBS buffer (Sigma), and Dulbecco MEM. Select a medium (glucose (4.5 g / L), L-glutamine and sodium pyruvate (Nacalai Tesque, Kyoto, Japan) added, supplemented with 10% calf serum albumin (Dainippon Pharmaceutical, Osaka, Japan)), Dissolved in this medium.

  As the support, in the present invention, a slide glass, a slide glass coated with poly-L-lysine, silane, APS, PLL, or MAS, and a polystyrene microtiter plate were used.

  The target genetic material was fixed by spotting the dissolved DNA, charged substance and salt solution or a mixed solution thereof on each support and allowing the spots to dry naturally.

  Next, the state of fixation was confirmed by immersing the fixed genetic material in PBS. Confirmation immediately after infiltration with PBS (0 minutes), 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 40 minutes, 50 minutes, and 60 minutes And by DNA quantification.

(result)
In the example using the mixture of the present invention (NaCl solution, PBS buffer solution, Dulbecco medium), it was confirmed that the fixation was not broken even after 15 minutes, whereas in the example prepared with distilled water, PBS was used. Immediately after the immersion, the fixation was broken, and it was revealed that DNA had flowed out. Therefore, it became clear that the substance fixing effect of the method of the present invention is remarkable. Among the examples using salt, the simple salt (NaCl) broke down relatively quickly, but the example using the composite salt (PBS and Dulbecco's MEM medium) lasted longer than the simple salt. did. In particular, in the example using Dulbecco MEM, the effect was remarkable, and the fixing effect was maintained even after 30 minutes. This effect was almost the same whether used separately or mixed together.

(Example 2: Fixed verification using print technology-"overlap")
The DNA solution (salt solution or distilled aqueous solution) used in Example 1, the transfection reagent solution (salt solution or distilled aqueous solution), and optionally the salt solution, were supported using the printing technique in Example 1. Fixed on the body. The procedure is shown below.

  1) First, a DNA plasmid solution was printed on a support. The DNA plasmid solution was employed at a concentration of 10 to 3000 μg / ml, and printing was performed using a device called Cartesian Technologies MicroSys 4000 (Genomic Solution) at room temperature (25 ° C.) and humidity of 65%.

  2) Next, the transfection reagent solution is used at a concentration of 0.5 μl / μl to 3.0 μl / μl, and a device called Cartesian Technologies MicroSys 4000 (Genomic Solution) is set at room temperature (25 ° C.) and humidity is 65%. Was used to print on the support. The printing was performed so as to overprint the portion where the DNA plasmid solution was printed.

  3) When the DNA plasmid solution and the transfection reagent solution do not contain salt, the salt solution shown in Example 1 was printed after this, and the print was made by using a device called Cartesian Technologies MicroSys 4000 (Genomic Solution) at room temperature (25 ° C) and humidity of 65%.

4) If necessary, a fibronectin solution (tell me 0.5 to 5 mg / ml concentration) was printed. Printing was performed using a Cartesian Technologies MicroSys 4000 (GenomicSolution) instrument under conditions of room temperature (25 ° C.) and humidity 65%.
In all the steps, after each solution was dried, the next reagent was overprinted.

(result)
After these printings, it was verified whether or not they were fixed in the same manner as in Example 1. As in Example 1, when a salt solution other than distilled water was used, and when the salt solution was printed later, the fixing effect was confirmed as in Example 1. In addition, even when the order of 1) to 4) was exchanged, since the same fixing effect was seen, it became clear that the order of overstrike has no influence on the fixing effect.

(Example 3: Fixation verification when multiple genetic materials are used)
Next, it was verified whether or not the same printing was possible when a plurality of genetic materials were used.

  According to the procedure of Example 2, except that in the printing of the genetic material solution of 1), in addition to the printing of the plasmid DNA solution, shRNA (pUR6iGFP272 (the sequence of the insert is GFP272 caccGGCTAtGTCtAGGAGtGtACC TAGAATTACATCAAGGGAGATGGTGCGCTCCTGGACGTAGCCTTTTT (SEQ ID NO: 1))-1 pDsRed2 Biosciences Clontech, CA PT3602-5), BD Biosciences Clontech, CA) solutions were printed. Printing was performed using a Cartesian Technologies MicroSys 4000 (Genomic Solution) instrument at room temperature (25 ° C.) and humidity of 65%.

  As an example, this shRNA was printed between 1) and 2) of Example 3.

(result)
After these printings, it was verified whether or not they were fixed in the same manner as in Examples 1 and 2. As in Examples 1 and 2, when a salt solution other than distilled water was used, and when the salt solution was printed later, the fixing effect was confirmed as in Example 1. In addition, even when the order of 1) to 4) and the shRNA solution printing was exchanged, the same fixing effect was seen, and thus it became clear that the overprinting order in particular did not affect the fixing effect.

(Example 4: Confirmation of cell affinity)
Next, in order to confirm the cell affinity of the present invention and the effect of cell introduction of genetic material, a cell transfection experiment was performed using the DNA-immobilized solid phase support prepared in Examples 1 and 2 above. .

  In this example, the following five types of cells were used to confirm the effects: human mesenchymal stem cells (hMSCs, PT-2501, Cambrex BioScience Walkersville, Inc., MD), human embryonic kidney cells (HEK293) , RCB1637, RIKEN Cell Bank, Japan), NIH3T3-3 cells (RCB0150, RIKEN Cell Bank, Japan), HeLa cells (RCB0007, RIKEN Cell Bank, Japan) and HepG2 (RCB1648, RIKEN Cell Bank, Japan).

In Examples 1 to 3, the support on which the DNA was immobilized was placed in a dish, and the medium containing the cells was dropped onto the support. The dish containing the plate was then transferred to an incubator and transfected by incubating the plate for 2 or 3 days at 37 ° C. in an atmosphere of 5% CO ₂ .

(Observation of gene expression)
The gene expression was observed by observing the fluorescence emitted from the expression products (EFP, EGFP and DsRed2) of each gene expression. For observation of fluorescence, a fluorescence microscope (IX-71, Olympus PROMARKETING Inc., Japan) was used. The cells were observed by performing paraformaldehyde (PFA) fixation after the reaction (4% PFA, treated at room temperature for 10 minutes).

(result)
Figures 1-2 show some of the transfection results. FIG. 1 shows the case of mixing from the beginning (control on top, mixture on bottom). The state of elution of the complex immediately after adding the complex to the solid phase (0 minute) and after adding the cell-containing solution 1 minute, 5 minutes and 10 minutes after the addition is shown. FIG. 2 shows the transfection effect in human mesenchymal stem cells on a support printed according to the procedure of Example 2. As shown, even when printing was performed continuously (overlapping), the same cell introduction effect of genetic material as that of the mixture was shown.

  As is clear from this result, it was also found that, in addition to the system which was mixed and added with salt and then fixed to the support, even when printed separately, the fixation was made and the DNA was released slowly. . Such an effect was not apparent in the prior art, and this enabled the first establishment of a technique that allows any gene to be introduced into a cell and observed in any combination using a plate, chip, or the like. It will be done. It was also revealed that the effect of cell introduction is not related to the order of overstrike.

  It was also found that transfection occurred even when other salts of the present invention were used for fixation. This indicates that the transfer of DNA required for transfection to occur in the cells occurred in all cases. Therefore, the support of the present invention maintained or improved the cell affinity and the cell introduction effect. In addition to the release data in Examples 1-2, the fact that transfection had occurred indicates that the immobilized genetic material retained activity.

  Such an effect was not observed in a solution without using salt. In addition, when salt was used, the effect was maintained even when printing (overstrike) was performed. Thus, this result shows that the present invention can be implemented in various forms. In particular, the system using a medium as a salt during fixation had higher transfection efficiency than the system using a single salt, so it was recommended to use a combination of salts suitable for cells during fixation. It turns out that it is also suitable for maintaining or improving the cell transfer effect of sex and genetic material.

(Example 5: Effect of overstrike using multiple genetic materials)
In Example 3, when a plurality of genetic materials were overlaid, it was verified whether or not the activity of any genetic material was introduced into the cells. The verification procedure was as described in Example 4.

  As a combination of a plurality of genetic materials, combinations of composition ratios as shown in the following table were used. In addition, pDNA shows plasmid DNA.

The results are shown in FIG. 3 and FIG.

  FIG. 3 shows gene expression on the third day after transfection into HeLa-K cells. FIG. 4 shows gene expression on the 6th day after transfection into HeLa-K cells. + ShGFP indicates that there is an RNAi molecule, and Pro less indicates that there is no RNAi molecule. Pro less is the result of using pDsRed2-1 as a negative control instead of shGFP because the vector pDsRed2-1 does not have a CMV promoter and does not perform gene expression.

  As is clear from the results, the fluorescence of GFP contained in the plasmid DNA was confirmed, and when the RNAi molecule against it was overlaid, the RNAi effect was confirmed, and the fluorescence disappeared. Therefore, even when there are a plurality of genetic materials, the cell introduction effect of the present invention is shown.

(Example 6: When using an array)
Next, in order to confirm whether or not the above-described effect was demonstrated even when the array was used, an experiment was performed with the scale expanded.

(Experiment protocol)
(Cell source, culture medium, and culture conditions)
In this example, five different cell lines were used: human mesenchymal stem cells (hMSC, PT-2501, Cambrex BioScience Walkersville, Inc., MD), human embryonic kidney cells HEK293 (RCB1637, RIKEN Cell Bank, Japan), NIH3T3-3 (RCB0150, RIKEN Cell Bank, Japan), HeLa (RCB0007, RIKEN Cell Bank, Japan), and HepG2 (RCB1648, RIKEN Cell Bank, Japan). In the case of human MSC cells, the cells were maintained in commercial human mesenchymal cell basal medium (MSCGM BulletKit PT-3001, Cambrex BioScience Walkersville, Inc., MD). In the case of HEK293 cells, NIH3T3-3 cells, HeLa cells and HepG2 cells, these cells were treated with 10% fetal calf serum (FBS, 29-167-54, Lot No. 2025F, Dainippon Pharmaceutical CO., LTD., Japan). Maintained in Dulbecco's modified Eagle's medium (DMEM, high glucose with L-glutamine and sodium pyruvate (4.5 g / L); 14246-25, Nakarai Tesque, Japan). All cell lines were cultured in an incubator controlled at 37 ° C. and 5% CO ₂ . In experiments involving hMSCs, we used hMSCs below passage 5 to avoid phenotypic changes.

(Plasmid and transfection reagent)
To evaluate the efficiency of transfection, pEGFP-N1 and pDsRed2-N1 vectors (Catalog Nos. 6085-1, 6973-1, BD Biosciences Clontech, CA) were used. Both gene expression was under the control of the cytomegalovirus (CMV) promoter. Transfected cells continuously expressed EGFP or DsRed2, respectively. Plasmid DNA was amplified using Escherichia coli, XL1-blue strain (200409, Stratagene, TX) and purified by EndoFree Plasmid Kit (EndoFree Plasmid Max Kit 12362, QIAGEN, CA). In all cases, plasmid DNA was dissolved in water without DNase and RNase. Transfection reagents were obtained as follows: Effectene Transfection Reagent (Cat. No. 301425, Qiagen, CA), TransFast ^TM Transfection Reagent (E2431, Promega, WI), Tfx ^TM- 20 Reagent (E2391, W, Promega). SuperFect Transfection Reagent (301305, Qiagen, CA), PolyFect Transfection Reagent (301105, Qiagen, CA), LipofectAMINE 2000 Reagent (11668-019, Invitrogen corporation PE, CA) (101-30, Polyplus-translation, France), and ExGen 500 (R0511, Fermentas Inc., MD).

(Solid-phase transfection array (SPTA) generation)
Details of the protocol for “reverse transfection” can be found at the website http: // stuffa. wi. mit. edu / sabatini_public / reverse_transfect. It is described in “Reverse Transfection Homepage” of htm. In our solid-phase transfection (SPTA method), three types of glass slides (Silane-treated glass slides; APS slides) with 48 square patterns (3 mm x 3 mm) separated by a hydrophobic fluororesin coating; And slides coated with poly-L-lysine; PLL slides and slides coated with MAS (Matsunami Glass Ind., LTD., Japan).

(Preparation of plasmid DNA printing solution)
Two different methods have been developed for generating SPTA. The main difference is in the preparation of plasmid DNA printing solution.

(Method A)
When using the Effectene Transfection Reagent, the printing solution contained plasmid DNA and cell adhesion molecules (bovine plasma fibronectin (catalog number 16042-41, Nakarai Tesque, Japan) dissolved in ultrapure water at a concentration of 4 mg / mL). . The above solution was applied to the surface of the slide using an ink jet printer (synQUAD ™, Cartian Technologies, Inc., CA) or manually using a 0.5-10 μL tip. The printed slide glass was dried inside the safety cabinet for 15 minutes at room temperature. Prior to transfection, total Effectene reagent was gently poured onto a DNA printed glass slide and incubated for 15 minutes at room temperature. Excess Effectene solution was removed from the glass slide using a suction aspirator and allowed to dry at room temperature for 15 minutes inside the safety cabinet. The resulting DNA printed glass slide was placed on the bottom of a 100 mm culture dish and approximately 25 mL of cell suspension (2-4 × 10 ⁴ cells / mL) was gently poured onto the dish. The dish was then transferred to an incubator at 37 ° C., 5% CO ₂ and incubated for 2-3 days.

(Method B)
For other transfection reagents (TransFast ^™ , Tfx ^™ -20, SuperFect, PolyFect, LipofectAMINE 2000, JetPEI (x4) conc. Or ExGen), plasmid DNA, fibronectin, and transfection reagents are distributed by the manufacturer Were mixed evenly in 1.5 mL microtubes according to the ratios indicated in the instructions and incubated for 15 minutes at room temperature before printing on the chip. The printing solution was applied on the surface of the glass slide using an inkjet printer or a 0.5-10 μL chip. The printed glass slide was completely dried for 10 minutes at room temperature inside the safety cabinet. The printed glass slide was placed on the bottom of a 100 mm culture dish and approximately 3 mL of cell suspension (2-4 × 10 ⁴ cells / mL) was added and incubated for 15 minutes at room temperature inside the safety cabinet. After incubation, fresh medium was gently poured into the dish. The dish was then transferred to an incubator at 37 ° C., 5% CO ₂ and incubated for 2-3 days. After incubation, we used the fluorescence microscope (IX-71, Olympus PROMARKETING, INC., Japan) to transfect the transfectants based on the expression of enhanced fluorescent proteins (EFP, EGFP, and DsRed2). Observed. Phase contrast images were taken using the same microscope. In both protocols, cells were fixed by using the paraformaldehyde (PFA) fixation method (4% PFA in PBS, treatment time 10 minutes at room temperature).

(Laser scanning and fluorescence intensity determination)
To quantify transfection efficiency, we used a DNA microarray scanner (GeneTAC UC4x4, Genomic Solutions Inc., MI). After measuring the total fluorescence intensity (arbitrary units), the fluorescence intensity per surface area was calculated.

(result)
(Solid phase transfection array of human mesenchymal stem cells)
The ability of human mesenchymal stem cells (hMSC) to differentiate into a wide variety of cells has become particularly interesting for studies targeting tissue regeneration and tissue revival. In particular, analysis of transformants of these cells has been of increasing interest in elucidating factors that control pluripotency of hMSC. A significant obstacle in hMSC research is that transfection with the desired genetic material is impossible (or very difficult).

  Conventional methods for accomplishing this include either viral vector or electroporation techniques. By using the complex-salt system developed by the present inventors, it is possible to obtain high transfection efficiency for various cell lines (including hMSC) and spatial localization in a dense array. Solid phase transfection was achieved. An outline of solid phase transfection is shown in FIG.

  Solid phase transfection enables the technical achievement of “transfection patches” that can be used for in vivo gene delivery as well as solid phase transfection arrays (SPTA) for high-throughput gene function studies in hMSCs Turned out to be.

  There are a number of standard methods for transfecting mammalian cells, but the introduction of genetic material into hMSCs can be inconvenient and very difficult compared to cell lines such as HEK293 and HeLa. Are known. Either previously used viral vector delivery or electroporation is important, but the potential toxicity (viral method), insensitivity to high-throughput analysis at the genomic scale, and limited applications for in vivo studies There are inconveniences like sex (with respect to electroporation).

  The development of a solid phase support immobilization system that can be easily immobilized on a solid phase support and that retains sustained release and cell affinity has overcome most of these drawbacks.

  An example of the results of the above experiment is shown in FIG. Using our technique using microprinting techniques, a mixture containing selected genetic material, transfection reagents and appropriate cell adhesion molecules, and salts could be immobilized on a solid support. Cell culture on the support on which the mixture was immobilized allowed the uptake of genes in the mixture for the cultured cells. As a result, it was possible to incorporate spatially separated DNA in the support-adherent cells (FIG. 6).

  As a result of this example, several important effects were achieved: high transfection efficiency (so that statistically significant cell populations can be studied), low reciprocity between regions supporting different DNA molecules Contamination (so that the effects of individual genes can be studied separately), long-term survival of transfected cells, high-throughput compatible formats and convenient detection methods. The development of an SPTA that meets all of these criteria provides an appropriate basis for further research.

In order to clearly establish the achievement of these objectives, as described above, we have developed five different cell lines (HEK293, HeLa, NIH3T3, HepG2 and hMSC) from our methodology (fixed). Phase system transfection) and conventional liquid phase transfection were studied under a range of transfection conditions. In the case of SPTA, in order to assess mutual contamination, we used red fluorescent protein (RFP) and green fluorescent protein (GFP) printed on a glass support in a checkered pattern, whereas traditionally In the case of experiments involving the following liquid phase transfections (where essentially no spontaneous spatial separation of the transfected cells could be achieved) we used GFP. Several transfection reagents were evaluated: four liquid transfection reagents (Effectene, TransFast ^™ , Tfx ^™ -20, LopfectAMINE 2000), two polyamines (SuperFect, PolyFect), and two types of polyimines (JetPEI (× 4) and ExGen 500).

  Transfection efficiency: Transfection efficiency was determined as total fluorescence intensity per unit area (FIG. 7A). Depending on the cell line used, optimal liquid phase results were obtained with different transfection reagents. These efficient transfection reagents were then used to optimize the solid phase system protocol (see FIGS. 7C-D). Several trends were observed: For easily transfectable cell lines (eg, HEK293, HeLa, NIH3T3), the transfection efficiency observed with the solid phase protocol was comparable to that of the standard liquid phase protocol. Although slightly better compared, it has been achieved at an essentially similar level (FIG. 7B).

  However, by using conditions optimized for SPTA methodology in cases where it is difficult to transfect cells (eg, hMSC and HepG2), we have achieved transfection efficiency while maintaining cell characteristics. An increase of 40-fold was observed (see protocol above and FIGS. 4C-D). The results are shown in FIG. 7B.

  In the specific case of hMSC (FIG. 8), the best conditions included the use of polyethyleneimine (PEI) transfection reagent. As expected, an important factor for achieving high transfection efficiency is the charge balance between the number of nitrogen atoms (N) in the polymer and the number of phosphate residues (P) in the plasmid DNA ( N / P ratio), as well as DNA concentration. In general, an increase in N / P ratio and concentration results in an increase in transfection efficiency. In parallel, we observed a significant reduction in cell viability for high DNA and high N / P ratio in hMSC solution transfection experiments. Due to these two antagonists, the efficiency of liquid phase transfection of hMSC was very poor and very low cell viability (observed with N / P ratio> 10). However, the SPTA protocol tolerates very high (fixed to a solid support) N / P ratio and DNA concentration (possibly relative to the cell membrane) without significantly affecting cell viability or cell morphology. This is probably responsible for a dramatic improvement in transfection efficiency) (due to the stabilizing effect of the solid support). In the case of SPTA, an N / P ratio of 10 has been found to be optimal and provides sufficient transfection levels while minimizing cytotoxicity. An additional reason for the increase in transfection efficiency observed in the SPTA protocol is the high local DNA concentration / transfection reagent concentration (which produces cell death when used in liquid phase transfection experiments). Achievement.

  The key to achieving high transfection efficiency on the chip is the type of material used for the coating used. As a coating agent when using glass chips, it has been found that PLL provides the best results in terms of both transfection efficiency and mutual contamination. In the absence of fibronectin coating, a few transfectants were observed (all other experimental conditions were kept constant). Although not fully established, the role of fibronectin is probably to accelerate the cell adhesion process (data not shown) and thus limit the time that allows DNA diffusion off the surface.

  Low reciprocal contamination: Apart from the higher transfection efficiencies observed with the SPTA protocol, an important advantage of this technology is the realization of a separately isolated cell array, in which each selected gene is expressed. We printed JetPEI (see “Experimental Protocol”) and two different reporter genes (RFP and GFP) mixed with fibronectin on a glass surface coated with fibronectin. The resulting transfection chip was provided for appropriate cell culture. Under the experimental conditions found to be best, the expressed GFP and RFP were localized in the region where the respective cDNA was spotted. Almost no mutual contamination was observed (FIG. 6). However, in the absence of fibronectin or PLL, reciprocal contamination was a significant obstacle and transfection efficiency was significantly lower (FIG. 7). This demonstrates the hypothesis that cell adhesion and the relative percentage of plasmid DNA that diffuses away from the support surface are important factors for both high transfection efficiency and high reciprocal contamination.

  A further cause of mutual contamination may be the mobility of the transfected cells on the solid support. We measured both the cell adhesion rate (FIG. 6C) and the diffusion rate of plasmid DNA on several supports. The result showed that almost no DNA diffusion occurred under optimal conditions. However, under high reciprocal conditions, a considerable amount of plasmid DNA diffused from the surface of the solid phase and was depleted during the time until cell adhesion was completed.

  This established technique is particularly important in the context of economical high-throughput gene function screening. Indeed, the small amount of transfection reagent and DNA required and the possibility of automating the entire process (from plasmid isolation to detection) increases the usefulness of the above method.

  In conclusion, we have successfully realized an hMSC transfection array in a complex-salt system. This will enable high-throughput studies in various studies using solid-phase transfection, such as elucidating the genetic mechanisms that control the differentiation of pluripotent stem cells. The detailed mechanism of solid-phase transfection as well as the methodology relating to the use of this technique for high-throughput real-time gene expression monitoring has been found to be applicable for various purposes.

(Example 7: RNAi transfection microarray)
Arrays were made as described in Example 6. As genetic material, plasmid DNA and shRNA were mixed and used. The composition is shown in Table 2 below.

The results are shown in FIG. Data obtained by quantifying the results of this figure are summarized in FIG. 10 for five types of cells.

  Thus, it has been found that the technique of the present invention can be applied regardless of the type of cells used.

(Example 7: When using RNAi microarray = siRNA)
Using the same protocol as in Example 6, an RNAi transfection microarray was constructed this time using siRNA instead of shRNA.

  28 types of siRNA for each transcription factor synthesized using 18 types of transcription factor reporters and Actin promoter vectors in the table below. As a control, siRNA against EGFP was used to evaluate whether siRNA knocks down the target transcription factor. As a negative control, scrambleRNA was used to evaluate these ratios.

After solid phase transfection into each cell, the cells were cultured for 2 days, and after acquiring images with a fluorescence image scanner, the amount of fluorescence was quantified.

(result)
The results are shown in FIG. A summary of the results for each gene is shown in FIG.

  As is apparent from FIGS. 11 to 12, when RNAi was used, it was shown that the expression of each gene was specifically suppressed. An array of multiple genetic materials using RNAi could be realized.

(Example 8: Transfection array using PCR fragments)
Next, it was demonstrated that the present invention can be realized even when PCR fragments are used as genetic material. The procedure is shown below.

  A nucleic acid fragment as shown in FIG. 13 was obtained by PCR, and used as genetic material used for the transfection microarray. The procedure is shown below.

As PCR primers,
GG ATAACCGTATTACCGCCATG CAT (SEQ ID NO: 2) and
Using ccctatctcggtctattcttttg CAAAAGAATAGACCGAGATA GGG (SEQ ID NO: 3), pEGFP-N1 was used as a template (see FIG. 14). The conditions for PCR are as follows.

Cycle conditions: 94 ° C for 2 min → (94 ° C for 15 sec → 60 ° C for 30 sec → 68 ° C for 3 min) → 4 ° C (30 cycles in parentheses).
The obtained PCR fragment was subjected to phenol / chloroform extraction and purified by ethanol precipitation. The sequence of the PCR fragment is
GG ATAACCGTATTACCGCCATG CAT TAGTTATTAA TAGTAATCAA TTACGGGGTC ATTAGTTCAT AGCCCATATATGGAGTTCCG
CGTTACATAACTTACGGTAA ATGGCCCGCC TGGCTGACCG CCCAACGACC CCCGCCCATT
GACGTCAATAATGACGTATG TTCCCATAGT AACGCCAATA GGGACTTTCC ATTGACGTCA
ATGGGTGGAGTATTTACGGT AAACTGCCCA CTTGGCAGTA CATCAAGTGT ATCATATGCC
AAGTACGCCCCCTATTGACG TCAATGACGG TAAATGGCCC GCCTGGCATT ATGCCCAGTA
CATGACCTTATGGGACTTTC CTACTTGGCA GTACATCTAC GTATTAGTCA TCGCTATTAC
CATGGTGATGCGGTTTTGGC AGTACATCAA TGGGCGTGGA TAGCGGTTTG ACTCACGGGG
ATTTCCAAGTCTCCACCCCA TTGACGTCAA TGGGAGTTTG TTTTGGCACC AAAATCAACG
GGACTTTCCAAAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGCG GTAGGCGTGT
ACGGTGGGAGGTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCGCTA
CCGGACTCAGATCTCGAGCT CAAGCTTCGA ATTCTGCAGT CGACGGTACC GCGGGCCCGG
GATCCACCGGTCGCCACCAT GGTGAGCAAG GGCGAGGAGC TGTTCACCGG GGTGGTGCCC
ATCCTGGTCGAGCTGGACGG CGACGTAAAC GGCCACAAGT TCAGCGTGTC CGGCGAGGGC
GAGGGCGATGCCACCTACGG CAAGCTGACC CTGAAGTTCA TCTGCACCAC CGGCAAGCTG
CCCGTGCCCT GGCCCACCCTCGTGACCACC CTGACCTACG GCGTGCAGTG CTTCAGCCGC
TACCCCGACCACATGAAGCA GCACGACTTC TTCAAGTCCG CCATGCCCGA AGGCTACGTC
CAGGAGCGCACCATCTTCTT CAAGGACGAC GGCAACTACA AGACCCGCGC CGAGGTGAAG
TTCGAGGGCGACACCCTGGT GAACCGCATC GAGCTGAAGG GCATCGACTT CAAGGAGGAC
GGCAACATCCTGGGGCACAA GCTGGAGTAC AACTACAACA GCCACAACGT CTATATCATG
GCCGACAAGCAGAAGAACGG CATCAAGGTG AACTTCAAGA TCCGCCACAA CATCGAGGAC
GGCAGCGTGCAGCTCGCCGA CCACTACCAG CAGAACACCC CCATCGGCGA CGGCCCCGTG
CTGCTGCCCGACAACCACTA CCTGAGCACC CAGTCCGCCC TGAGCAAAGA CCCCAACGAG
AAGCGCGATCACATGGTCCT GCTGGAGTTC GTGACCGCCG CCGGGATCAC TCTCGGCATG
GACGAGCTGTACAAGTAAAG CGGCCGCGAC TCTAGATCAT AATCAGCCAT ACCACATTTG
TAGAGGTTTTACTTGCTTTA AAAAACCTCC CACACCTCCC CCTGAACCTG AAACATAAAA
TGAATGCAATTGTTGTTGTT AACTTGTTTA TTGCAGCTTA TAATGGTTAC AAATAAAGCA
ATAGCATCACAAATTTCACA AATAAAGCAT TTTTTTCACT GCATTCTAGT TGTGGTTTGT
CCAAACTCATCAATGTATCT TAAGGCGTAA ATTGTAAGCG TTAATATTTT GTTAAAATTC
GCGTTAAATTTTTGTTAAAT CAGCTCATTT TTTAACCAAT AGGCCGAAAT CGGCAAAATC
It is as described in CCTTATAAATCAAAAGAATA GACCGAGATA GGG (SEQ ID NO: 4).

  MCF7 was seeded on a chip produced using this, and images were acquired with a fluorescence image scanner two days later. The result is shown in FIG. In FIG. 15, the circular DNA and the PCR fragment are compared. In both cases, transfection was successful and it was found that even when PCR fragments were used as genetic material, they were transfected in the same way as full-length plasmids.

  As mentioned above, although this invention has been illustrated using preferable embodiment of this invention, it is understood that the scope of this invention should be construed only by the claims. Patents, patent applications, and documents cited herein should be incorporated by reference in their entirety, as if the contents themselves were specifically described herein. Understood.

  The present invention provides a method for immobilizing a substance on a solid support that is unexpectedly simple and provides biocompatibility (eg, cell affinity) and / or sustained release. By utilizing such effects, various biological phenomena such as gene transfer, signal transduction, and drug efficacy can be exhibited using the solid support. Cells are an important tool in medical technology, drug development, and the like, and since various tools can be developed, their industrial utility should be evaluated.

FIG. 1 is a typical result example in the fourth embodiment. FIG. 1 shows the result of comparing uncomplexed DNA (top) with DNA complexed with a positively charged substance (bottom, NP10 treatment). The state of transfection is shown immediately after adding the complex to the solid phase (0 minute) and after adding the cell-containing solution 1 minute, 5 minutes and 10 minutes after the addition. FIG. 2 shows an example of results in the case of printing (overprinting) with human mesenchymal stem cells of Example 4. The pEGFP-N1 vector was printed on a solid phase substrate, dried, and then LipofectAMINE2000 was printed at the same coordinates and dried. Thereafter, the fibronectin solution was printed on the same coordinates and dried. This was seeded with mesenchymal stem cells and cultured for 2 days, and then an image was obtained with a fluorescence image scanner. FIG. 3 shows gene expression on the third day after transfection into HeLa-K cells in Example 5. PEGFP-N1, pDsRed2-1, pEGFP-N1 and pPUR6iGFP272 vectors were printed on a solid phase substrate, dried, and then LipofectAMINE2000 was printed at the same coordinates and dried. Thereafter, the fibronectin solution was printed on the same coordinates and dried. HeLa-K cells were seeded thereon and cultured for 3 days, and then images were acquired with a fluorescence image scanner. FIG. 4 shows gene expression on the 6th day after transfection into HeLa-K cells in Example 5. PEGFP-N1, pDsRed2-1, pEGFP-N1 and pPUR6iGFP272 vectors were printed on a solid phase substrate, dried, and then LipofectAMINE2000 was printed at the same coordinates and dried. Thereafter, the fibronectin solution was printed on the same coordinates and dried. HeLa-K cells were seeded thereon and cultured for 6 days, and then images were acquired with a fluorescence image scanner. FIG. 5 is a diagram schematically showing a method for preparing a solid phase transfection array (SPTA). This figure shows the solid phase transfection methodology. FIG. 6 shows the results of solid phase transfection. The result of producing SPTA using HEK293 cell line is shown. The green part shows transfected adherent cells. FIG. 7A and FIG. 7B are results showing a comparison between solution phase transfection and SPTA. FIG. 7A shows the results of measuring GFP intensity / mm ² for the five cell lines used in the experiment. FIG. 7A shows a method for determining transfection efficiency as total fluorescence intensity per unit area. FIG. 7A and FIG. 7B are results showing a comparison between solution phase transfection and SPTA. FIG. 7B is a fluorescence image of cells expressing EGFP corresponding to the data shown in FIG. 7A. In FIG. 7B, a region indicated by a white circle indicates a region where plasmid DNA is immobilized. In the region other than the region where the plasmid DNA was immobilized, cells expressing EGFP were not observed even though the cells were immobilized on the solid phase. The white bar indicates 500 μm. Figures 7C and 7D show representative protocol examples of the solid phase transfection method. Figures 7C and D show representative protocol examples of solid phase transfection methods. FIG. 8 shows the result of reducing the mutual contamination by the coating of the chip. FIG. 8 shows the results of solution phase transfection and SPTA using HEK293 cells, HeLa cells, NIT3T3 cells (shown as “3T3”), HepG2 cells, and hMSCs. Transfection efficiency is expressed as GFP intensity. FIG. 9 shows the transfection results of the RNAi transfection array in Example 7. Coordinates where each reporter gene shown in Table 3 is printed on a solid-phase substrate at 4 spots per gene, and after drying, reporter genes corresponding to siRNA (28 types) for each transcription factor are printed Printed on top and dried. Moreover, siRNA for EGFP was used as a control, and scrambleRNA was used as a negative control. Thereafter, LipofectAMINE2000 was printed on the same coordinates of each gene print and dried. Thereafter, the fibronectin solution was printed on the same coordinates and dried. HeLa-K cells were seeded on this and cultured for 2 days, and then images were acquired with a fluorescence image scanner. FIG. 10 shows the transfection results of the RNAi transfection array in Example 7 for each cell. After quantifying the fluorescence brightness of each reporter by image analysis, the ratio to the brightness of each reporter printed with scrambled RNA as a negative control was calculated. The results are shown for all reporters and cells. FIG. 11 shows the transfection results of the RNAi transfection array in Example 8. Each reporter gene expression unit PCR fragment shown in Table 3 is printed on a solid-phase substrate so that there are 4 spots per gene. After drying, reporter genes corresponding to siRNA (28 types) for each transcription factor are printed. Printed on the printed coordinates and dried. Moreover, siRNA for EGFP was used as a control, and scrambled RNA was used as a negative control. Thereafter, LipofectAMINE2000 was printed on the same coordinates of each gene print and dried. Thereafter, the fibronectin solution was printed on the same coordinates and dried. Each cell was seed | inoculated to this, and after culturing for 2 days, the image was acquired with the fluorescence image scanner. FIG. 12 shows the transfection results of the RNAi transfection array in Example 8 for each cell. After quantifying the fluorescence brightness of each reporter by image analysis, the ratio to the brightness of each reporter printed with scrambled RNA as a negative control was calculated. The results are shown for all reporters and cells. FIG. 13 shows the structure of the PCR fragment obtained in Example 8. FIG. 14 shows the structure of pEGFP-N1. FIG. 15 shows a comparison of the transfection efficiency of transfection microarrays using circular DNA and PCR fragments.

(Explanation of sequence listing)
SEQ ID NO: 1: Sequence of pUR6iGFP272 insert SEQ ID NO: 2: Primer 1 used in Example 8
SEQ ID NO: 3: Primer 2 used in Example 8
SEQ ID NO: 4: PCR fragment obtained by PCR in Example 8

Claims (62)

A kit for fixing genetic material to a support and introducing it into cells,
a) genetic material;
b) a charged substance having a charge opposite to that of the genetic material;
c) salt,
Including
A kit comprising instructions for instructing the genetic material, the charged material, and the salt to be mixed on a solid support. The kit according to claim 1, wherein at least two substances selected from the group consisting of the genetic material, the charged substance, and the salt are provided as a mixture. The kit according to claim 1, wherein there are at least two kinds of the genetic material. The kit of claim 1, wherein the genetic material is selected from the group consisting of DNA, RNA, PNA and combinations thereof. The kit according to claim 1, wherein the charged substance has cell affinity. The kit according to claim 1, wherein the charged substance includes a biomolecule. The kit according to claim 6, wherein the biomolecule is selected from the group consisting of DNA, RNA, polypeptide, lipid, sugar, small organic molecule, and a complex thereof. The kit according to claim 1, wherein the charged substance is selected from the group consisting of a cationic polymer, a cationic lipid, a cationic polyamino acid, and a complex thereof. The kit according to claim 1, wherein the charged substance is selected from the group consisting of a polyamine reagent, a polyimine reagent, a liposome reagent, and a charged colloid. The kit according to claim 1, wherein the salt is one obtained by substituting hydrogen of an organic acid or inorganic acid with a metal, or one obtained by substituting a hydroxyl group of a base with an organic acid group or an inorganic acid group. The salt is selected from the group consisting of calcium chloride, sodium hydrogen phosphate, sodium bicarbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids and vitamins. The kit according to 1. The kit according to claim 1, wherein the salt is provided in the form of a buffer, a culture solution and serum. The kit of claim 1, wherein the genetic material encodes a material having biological activity after being introduced into a cell. The kit of claim 1, wherein the genetic material, the charged material, and the salt are pharmaceutically acceptable. The kit according to claim 1, wherein the genetic material, the charged substance, and the salt are contained in a microcapsule. A method for fixing genetic material to a support and introducing it into a cell,
I) providing a support;
II) providing the support separately or together with a) genetic material, b) a charged material having a charge opposite to that of the genetic material, and c) a salt;
III) mixing the genetic material, the charged material and the salt on a solid support;
Including the method. The method according to claim 16, wherein at least two substances selected from the group consisting of the genetic material, the charged material, and the salt are provided as a mixture. The method according to claim 16, wherein there are at least two kinds of the genetic material. 17. The method of claim 16, wherein the genetic material is selected from the group consisting of DNA, RNA, PNA, and combinations thereof. The method according to claim 16, wherein the charged substance has cell affinity. The method of claim 16, wherein the charged substance comprises a biomolecule. The method of claim 21, wherein the biomolecule is selected from the group consisting of DNA, RNA, polypeptide, lipid, sugar, small organic molecule, and complexes thereof. The method according to claim 16, wherein the charged substance is selected from the group consisting of a cationic polymer, a cationic lipid, a cationic polyamino acid, and a complex thereof. The method according to claim 16, wherein the charged substance is selected from the group consisting of a polyamine reagent, a polyimine reagent, a liposome reagent, and a charged colloid. The method according to claim 16, wherein the salt is one obtained by substituting hydrogen of an organic acid or inorganic acid with a metal, or one obtained by substituting a hydroxyl group of a base with an organic acid group or an inorganic acid group. The salt is selected from the group consisting of calcium chloride, sodium hydrogen phosphate, sodium bicarbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids and vitamins. 16. The method according to 16. 17. The method of claim 16, wherein the salt is provided in the form of a buffer, a culture medium and serum. 17. The method of claim 16, wherein the genetic material encodes a material that has biological activity after being introduced into a cell. The method of claim 16, wherein the genetic material, the charged material, and the salt are pharmaceutically acceptable. The method of claim 16, wherein the genetic material, the charged material, and the salt are contained in a microcapsule. The method of claim 16, wherein the support is a solid support. 17. The method of claim 16, wherein the support comprises a material selected from the group consisting of glass, silica, silicon, ceramic, silicon dioxide, plastic, metal, natural polymer, and synthetic polymer. The method of claim 16, wherein the support is coated. 34. The method of claim 33, wherein the coating is performed by a coating agent comprising a material selected from the group consisting of poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin and metal. The method of claim 16, wherein the support is a chip. The method according to claim 16, wherein the support is a chip, and the composite is arranged in an array on the chip. 17. The method of claim 16, wherein the biomolecule is introduced into a cell and has biological activity. The method of claim 16, wherein step II) is performed under conditions that do not destroy the biomolecule. The method of claim 16, wherein step III) is performed under conditions that do not destroy the biomolecule. 17. The method of claim 16, further comprising the step of reducing or removing the solvent in the mixture after attaching the mixture to a solid support. A support in which genetic material, a charged material having a charge opposite to that of the genetic material, and a salt are fixed to the surface. 42. The support of claim 41, wherein the genetic material can be introduced into a cell. The support according to claim 41, wherein the genetic material is contained in two or more types. 42. The support of claim 41, wherein the genetic material is selected from the group consisting of DNA, RNA, PNA and combinations thereof. 42. The support according to claim 41, wherein the charged substance has cell affinity. The support according to claim 41, wherein the charged substance includes a biomolecule. 42. The support of claim 41, wherein the biomolecule is selected from the group consisting of DNA, RNA, polypeptides, lipids, sugars, small organic molecules, and complexes thereof. 42. The support according to claim 41, wherein the charged substance is selected from the group consisting of a cationic polymer, a cationic lipid, a cationic polyamino acid and a complex thereof. 42. The support according to claim 41, wherein the charged substance is selected from the group consisting of a polyamine reagent, a polyimine reagent, a liposome reagent, and a charged colloid. 42. The support according to claim 41, wherein the salt is obtained by substituting a metal for hydrogen of an organic acid or an inorganic acid, or by replacing a hydroxyl group of a base with an organic acid group or an inorganic acid group. The salt is selected from the group consisting of calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids and vitamins. 42. The support according to 41. 42. The support of claim 41, wherein the salt is provided in the form of a buffer, a culture solution and serum. 42. The support of claim 41, wherein the genetic material encodes a material having biological activity after being introduced into a cell. 42. The support of claim 41, wherein the support, the genetic material, the charged material, and the salt are pharmaceutically acceptable. 42. The support of claim 41, wherein the genetic material, the charged material and the salt are contained in a microcapsule. 42. The support of claim 41, wherein the support is a solid support. 42. The support of claim 41, wherein the support comprises a material selected from the group consisting of glass, silica, silicon, ceramic, silicon dioxide, plastic, metal, natural polymer, and synthetic polymer. 42. The support of claim 41, wherein the support is coated. 59. The support according to claim 58, wherein the coating is performed by a coating agent comprising a material selected from the group consisting of poly-L-lysine, silane, APS, MAS, hydrophobic fluororesin and metal. 42. A support according to claim 41, wherein the support is a chip. 42. The support according to claim 41, wherein the support is a chip, and the mixture including the genetic material, the charged material, and the salt is arranged in an array on the chip. 42. The support of claim 41, wherein the biomolecule is introduced into a cell and has biological activity.